Note: Descriptions are shown in the official language in which they were submitted.
CA 03188282 2022-12-23
WO 2022/026379 PCT/US2021/043170
EXPEDITED BREEDING OF TRANSGENIC CROP PLANTS BY
GENOME EDITING
Inventors: Michael A. Kock, Michael Nuccio, Frederic Van
Ex,
Alexandra Elata, Daniel Rodriguez Leal, Joshua L. Price
BIOLOGICAL SEQUENCES
100011 The sequence listing contained in the file named "10076W01
ST25.txt", which is
475,315 bytes as measured in the Windows operating system and which was
created on July 26,
2021 and electronically filed on July 26, 2021, is incorporated herein by
reference in its entirety.
BACKGROUND
[0002] Transgenes which are placed into different positions in the plant
genome through
non-site specific integration can exhibit different levels of expression
(Weising et al., 1988, Ann.
Rev. Genet. 22:421-477). Such transgene insertion sites can also contain
various undesirable
rearrangements of the foreign DNA elements that include deletions and/or
duplications.
Furthermore, many transgene insertion sites can also comprise selectable or
scoreable marker
genes which in some instances are no longer required once a transgenic plant
event containing
the linked transgenes which confer desirable traits are selected.
[0003] Commercial transgenic plants typically comprise one or more
independent
insertions of transgenes at specific locations in the host plant genome that
have been selected for
features that include expression of the transgene(s) of interest and the
transgene-conferred
trait(s), absence or minimization of rearrangements, and normal Mendelian
transmission of the
trait(s) to progeny. Examples of selected transgenic maize, soybean, cotton,
and canola plant
events which confer traits such as herbicide tolerance and/or pest tolerance
are disclosed in US
Patent Nos. 7323556; 8575434; 6040497; 10316330; 8618358; 8212113; 9428765;
8455720;
7897748; 8273959; 8093453; 8901378; 8466346; RE44962; 9540655; 9738904;
8680363;
8049071; 9447428; 9944945; 8592650; 10184134; 7179965; 7371940; 9133473;
8735661;
7381861; 8048632; and 9738903.
- 1 -
CA 03188282 2022-12-23
WO 2022/026379 PCT/US2021/043170
[0004] Methods for removing selectable marker genes and/or duplicated
transgenes in
transgene insertion sites in plant genomes involving use of site-specific
recombinase systems
(e.g., cre-lox) as well as for insertion of new genes into transgene insertion
sites have been
disclosed (Srivastava and Ow; Methods Mol Biol, 2015,1287:95-103; Dale and Ow,
1991, Proc.
Natl Acad. Sci. USA 88, 10558-10562; Srivastava and Thomson, Plant Biotechnol
J, 2016;14(2):471-82). Such methods typically require incorporation of the
recombination site
sequences recognized by the recombinase at particular locations within the
transgene.
SUMMARY
[0005] Methods of producing an elite crop plant comprising a targeted
genetic change
and at least one transgenic locus comprising steps of: (i) inducing at least
one targeted genetic
change in the genome of the crop plant with one or more genome editing
molecules in an elite
crop plant comprising a first transgenic loci and a second transgenic loci;
(ii) excising a DNA
segment comprising all or most of the first transgenic locus with genome
editing molecules by
(a) contacting genomic DNA of said plant with: (i) at least a first and at
least a second guide
RNA directed to genomic DNA adjacent to two PAM sites, wherein the PAM sites
are operably
linked to a 5' and a 3' DNA junction polynucleotide of the first transgenic
locus; and (ii) one or
more RNA dependent DNA endonucleases (RdDe) which recognize the PAM sites; and
(iii)
selecting an elite crop plant wherein the first transgenic locus is excised,
the second transgenic
locus is present, and the targeted genetic change is present are provided.
[0006] Elite crop plants or parts thereof comprising at least one first
transgenic locus and
a transgenic locus excision site wherein all of a second transgenic locus and
one or more
nucleotides of endogenous chromosomal DNA of the plant genome in the 5' and a
3' DNA
junction polynucleotide of the second transgenic locus is excised are
provided.
[0007] Methods for obtaining elite crop plants disclosed herein
comprising the steps of:
(a) obtaining a crop plant comprising at least the first transgenic locus and
a second transgenic
locus; (b) introgressing the first transgenic locus and a second transgenic
locus into the
germplasm of the elite crop plant; (c) excising a DNA segment comprising the
second transgenic
locus from the elite crop plant of step (b) with genome editing molecules and
optionally inducing
at least one targeted genetic change in the genome of the crop plant of step
(b) with one or more
genome editing molecules; and (d) selecting an elite crop plant comprising:
(i) the first
- 2 -
CA 03188282 2022-12-23
WO 2022/026379 PCT/US2021/043170
transgenic locus and a transgenic locus excision site wherein all of the
second transgenic locus
and one or more nucleotides of endogenous chromosomal DNA of the plant genome
in the 5' and
a 3' DNA junction polynucleotide of the second transgenic locus is excised;
and optionally (ii)
the targeted genetic change are provided.
[0008] DNA comprising a transgenic locus excision site wherein all of a
transgenic locus
and one or more nucleotides of endogenous chromosomal DNA of the plant genome
in the 5' and
a 3' DNA junction polynucleotide of the transgenic locus is excised.
[0009] Nucleic acid markers adapted for detection of genomic DNA or
fragments thereof
comprising a transgenic locus excision site wherein all of a transgenic locus
and one or more
nucleotides of endogenous chromosomal DNA of the plant genome in the 5' and a
3' DNA
junction polynucleotide of the transgenic locus is excised and wherein the
marker does not
detect a transgenic locus which has not been excised are provided.
[0010] Biological sample comprising plant genomic DNA or fragments
thereof, said
genomic DNA or fragments comprising a transgenic locus excision site wherein
all of a
transgenic locus and one or more nucleotides of endogenous chromosomal DNA of
the plant
genome in the 5' and a 3' DNA junction polynucleotide of the transgenic locus
is excised.
[0011] Methods of identifying any one the aforementioned plants, DNA, or
biological
samples, comprising detecting a polynucleotide comprising a transgenic locus
excision site
wherein all of a transgenic locus and one or more nucleotides of endogenous
chromosomal DNA
of the plant genome in the 5' and a 3' DNA junction polynucleotide of the
transgenic locus is
excised with a nucleic acid detection assay are provided.
[0012] Elite crop plants or parts thereof comprising at least one first
transgenic locus
and a transgenic locus excision site wherein all but at least one to 50
nucleotides of the
heterologous DNA of the 5' and/or 3' DNA junction polynucleotide of a second
transgenic locus
is excised are provided.
[0013] Methods for obtaining the aforementioned elite crop plants
comprising the steps
of: (a) obtaining a crop plant comprising at least the first transgenic locus
and a second
transgenic locus; (b) introgressing the first transgenic locus and a second
transgenic locus into
the germplasm of the elite crop plant; (c) excising a DNA segment comprising
the second
transgenic locus from the elite crop plant of step (b) with genome editing
molecules and
optionally inducing at least one targeted genetic change in the genome of the
crop plant of step
(b) with one or more genome editing molecules; and (d) selecting an elite crop
plant comprising:
- 3 -
CA 03188282 2022-12-23
WO 2022/026379 PCT/US2021/043170
(i) the first transgenic locus and a transgenic locus excision site wherein
all of the second
transgenic locus and one or more nucleotides of endogenous chromosomal DNA of
the plant
genome in the 5' and a 3' DNA junction polynucleotide of the second transgenic
locus is
excised; and optionally (ii) the targeted genetic change are provided.
[0014]
Methods for obtaining a bulked population of inbred seed for commercial seed
production comprising selfing any one of the aforementioned elite crop plants
and harvesting
seed from the selfed elite crop plants are provided.
[0015]
Methods for obtaining hybrid crop seed comprising crossing a first crop plant
comprising any one of the aforementioned elite crop plants to a second crop
plant and harvesting
seed from the cross are provided.
[0016]
DNA comprising a transgenic locus excision site wherein all but at least one
to 50
nucleotides of the heterologous DNA of the 5' and/or 3' DNA junction
polynucleotide of a
transgenic locus is excised is provided.
[0017]
Nucleic acid markers adapted for detection of genomic DNA or fragments
comprising a transgenic locus excision site wherein all but at least one to 50
nucleotides of the
heterologous DNA of the 5' and/or 3' DNA junction polynucleotide of a
transgenic locus is
excised and wherein the marker does not detect a transgenic locus which has
not been excised are
provided.
[0018]
Biological samples comprising the plant genomic DNA or fragments thereof, said
genomic DNA or fragments comprising a transgenic locus excision site wherein
all but at least
one to 50 nucleotides of the heterologous DNA of the 5' and/or 3' DNA junction
polynucleotide
of a transgenic locus is excised are provided.
[0019]
Methods of identifying the any of the aforementioned plants, DNA, or
biological
samples comprising detecting a polynucleotide comprising a transgenic locus
excision site
wherein all but at least one to 50 nucleotides of the heterologous DNA of the
5' and/or 3' DNA
junction polynucleotide of a transgenic locus is excised with a nucleic acid
detection assay.
BRIEF DESCRIPTION OF THE DRAWINGS/FIGURES
[0020]
Figure 1 shows of a diagram of transgene expression cassettes and selectable
markers in the DAS-59122-7 transgenic locus set forth in SEQ ID NO: 1.
[0021]
Figure 2 shows a diagram of transgene expression cassettes and selectable
markers in the DP-4114 transgenic locus set forth in SEQ ID NO: 2.
- 4 -
CA 03188282 2022-12-23
WO 2022/026379 PCT/US2021/043170
[0022] Figure 3 shows a diagram of transgene expression cassettes and
selectable
markers in the M0N87411 transgenic locus set forth in SEQ ID NO: 3.
[0023] Figure 4 shows a diagram of transgene expression cassettes and
selectable
markers in the M0N89034 transgenic locus.
[0024] Figure 5 shows a diagram of transgene expression cassettes and
selectable
markers in the MIR162 transgenic locus.
[0025] Figure 6 shows a diagram of transgene expression cassettes and
selectable
markers in the MIR604 transgenic locus set forth in SEQ ID NO: 6.
[0026] Figure 7 shows a diagram of transgene expression cassettes and
selectable
markers in the NK603 transgenic locus set forth in SEQ ID NO: 7.
[0027] Figure 8 shows a diagram of transgene expression cassettes and
selectable
markers in the SYN-E3272-5 transgenic locus set forth in SEQ ID NO: 8.
[0028] Figure 9 shows a diagram of transgene expression cassettes and
selectable
markers in the transgenic locus set forth in SEQ ID NO: 8.
[0029] Figure 10 shows a diagram of transgene expression cassettes and
selectable
markers in the TC1507 transgenic locus set forth in SEQ ID NO: 10.
[0030] Figure 11 shows a schematic diagram which compares current breeding
strategies
for introgression of transgenic events (i.e., transgenic loci) to alternative
breeding strategies for
introgression of transgenic events where the transgenic events (i.e.,
transgenic loci) can be
removed following introgression to provide different combinations of
transgenic traits.
[0031] Figure 12 shows a diagram of transgene expression cassettes and
selectable
markers in the DA568416-4 transgenic locus set forth in SEQ ID NO: 12.
[0032] Figure 13 shows a diagram of transgene expression cassettes and
selectable
markers in the MON87701transgenic locus set forth in SEQ ID NO: 14.
[0033] Figure 14 shows a diagram of transgene expression cassettes and
selectable
markers in the M0N89788 transgenic locus set forth in SEQ ID NO: 16.
[0034] Figure 15 shows a diagram of transgene expression cassettes and
selectable
markers in the COT102 transgenic locus set forth in SEQ ID NO: 19.
[0035] Figure 16 shows a diagram of transgene expression cassettes and
selectable
markers in the M0N88302 transgenic locus set forth in SEQ ID NO: 21.
- 5 -
CA 03188282 2022-12-23
WO 2022/026379 PCT/US2021/043170
DETAILED DESCRIPTION
[0036] Unless otherwise stated, nucleic acid sequences in the text of
this specification are
given, when read from left to right, in the 5' to 3' direction. Nucleic acid
sequences may be
provided as DNA or as RNA, as specified; disclosure of one necessarily defines
the other, as well
as necessarily defines the exact complements, as is known to one of ordinary
skill in the art.
[0037] Where a term is provided in the singular, the inventors also
contemplate
embodiments described by the plural of that term.
[0038] The phrase "allelic variant" as used herein refers to a
polynucleotide or
polypeptide sequence variant that occurs in a different strain, variety, or
isolate of a given
organism.
[0039] The term "about" as used herein means a value or range of values
which would be
understood as an equivalent of a stated value and can be greater or lesser
than the value or range
of values stated by 10 percent. Each value or range of values preceded by the
term "about" is also
intended to encompass the embodiment of the stated absolute value or range of
values.
[0040] The term "and/or" where used herein is to be taken as specific
disclosure of each
of the two specified features or components with or without the other. Thus,
the term and/or" as
used in a phrase such as "A and/or B" herein is intended to include "A and B,"
"A or B," "A"
(alone), and "B" (alone). Likewise, the term "and/or" as used in a phrase such
as "A, B, and/or
C" is intended to encompass each of the following embodiments: A, B, and C; A,
B, or C; A or
C; A or B; B or C; A and C; A and B; B and C; A (alone); B (alone); and C
(alone).
[0041] As used herein, the phrase "approved transgenic locus" is a
genetically modified
plant event which has been authorized, approved, and/or de-regulated for any
one of field testing,
cultivation, human consumption, animal consumption, and/or import by a
governmental body.
Illustrative and non-limiting examples of governmental bodies which provide
such approvals
include the Ministry of Agriculture of Argentina, Food Standards Australia New
Zealand,
National Biosafety Technical Committee (CTNBio) of Brazil, Canadian Food
Inspection
Agency, China Ministry of Agriculture Biosafety Network, European Food Safety
Authority, US
Department of Agriculture, US Department of Environmental Protection, and US
Food and Drug
Administration.
[0042] The term "backcross", as used herein, refers to crossing an Fl
plant or plants with
one of the original parents. A backcross is used to maintain or establish the
identity of one parent
- 6 -
CA 03188282 2022-12-23
WO 2022/026379 PCT/US2021/043170
(species) and to incorporate a particular trait from a second parent
(species). The term "backcross
generation", as used herein, refers to the offspring of a backcross.
[0043] As used herein, the phrase "biological sample" refers to either
intact or non-intact
(e.g. milled seed or plant tissue, chopped plant tissue, lyophilized tissue)
plant tissue. It may also
be an extract comprising intact or non-intact seed or plant tissue. The
biological sample can
comprise flour, meal, syrup, oil, starch, and cereals manufactured in whole or
in part to contain
crop plant by-products. In certain embodiments, the biological sample is "non-
regenerable" (i.e.,
incapable of being regenerated into a plant or plant part). In certain
embodiments, the biological
sample refers to a homogenate, an extract, or any fraction thereof containing
genomic DNA of
the organism from which the biological sample was obtained, wherein the
biological sample does
not comprising living cells.
[0044] As used herein, the terms "correspond," "corresponding," and the
like, when used
in the context of an nucleotide position, mutation, and/or substitution in any
given polynucleotide
(e.g., an allelic variant of SEQ ID NO: 1-34) with respect to the reference
polynucleotide
sequence (e.g., SEQ ID NO: 1-34) all refer to the position of the
polynucleotide residue in the
given sequence that has identity to the residue in the reference nucleotide
sequence when the
given polynucleotide is aligned to the reference polynucleotide sequence using
a pairwise
alignment algorithm (e.g., CLUSTAL 0 1.2.4 with default parameters).
[0045] As used herein, the terms "Cpfl" and "Cas12a" are used
interchangeably to refer
to the same RNA dependent DNA endonuclease (RdDe). Cas12a proteins include the
protein
provided herein as SEQ ID NO: 85.
[0046] The term "crossing" as used herein refers to the fertilization of
female plants (or
gametes) by male plants (or gametes). The term "gamete" refers to the haploid
reproductive cell
(egg or pollen) produced in plants by meiosis from a gametophyte and involved
in sexual
reproduction, during which two gametes of opposite sex fuse to form a diploid
zygote. The term
generally includes reference to a pollen (including the sperm cell) and an
ovule (including the
ovum). When referring to crossing in the context of achieving the
introgression of a genomic
region or segment, the skilled person will understand that in order to achieve
the introgression of
only a part of a chromosome of one plant into the chromosome of another plant,
random portions
of the genomes of both parental lines recombine during the cross due to the
occurrence of
crossing-over events in the production of the gametes in the parent lines.
Therefore, the genomes
- 7 -
CA 03188282 2022-12-23
WO 2022/026379 PCT/US2021/043170
of both parents must be combined in a single cell by a cross, where after the
production of
gametes from the cell and their fusion in fertilization will result in an
introgression event.
[0047] As used herein, the phrases "DNA junction polynucleotide" and
"junction
polynucleotide" refers to a polynucleotide of about 18 to about 500 base pairs
in length
comprised of both endogenous chromosomal DNA of the plant genome and
heterologous
transgenic DNA which is inserted in the plant genome. A junction
polynucleotide can thus
comprise about 8, 10, 20, 50, 100, 200, or 250 base pairs of endogenous
chromosomal DNA of
the plant genome and about 8, 10, 20, 50, 100, 200, or 250 base pairs of
heterologous transgenic
DNA which span the one end of the transgene insertion site in the plant
chromosomal DNA.
Transgene insertion sites in chromosomes will typically contain both a 5'
junction polynucleotide
and a 3' junction polynucleotide. In embodiments set forth herein in SEQ ID
NO: 1-34, the 5'
junction polynucleotide is located at the 5' end of the sequence and the 3'
junction
polynucleotide is located at the 3' end of the sequence. In a non-limiting and
illustrative example,
a 5' junction polynucleotide of a transgenic locus is telomere proximal in a
chromosome arm and
the 3' junction polynucleotide of the transgenic locus is centromere proximal
in the same
chromosome arm. In another non-limiting and illustrative example, a 5'
junction polynucleotide
of a transgenic locus is centromere proximal in a chromosome arm and the 3'
junction
polynucleotide of the transgenic locus is telomere proximal in the same
chromosome arm.
[0048] The term "donor," as used herein in the context of a plant, refers
to the plant or
plant line from which the trait, transgenic event, or genomic segment
originates, wherein the
donor can have the trait, introgression, or genomic segment in either a
heterozygous or
homozygous state.
[0049] As used herein, the terms "excise" and "delete," when used in the
context of a
DNA molecule, are used interchangeably to refer to the removal of a given DNA
segment or
element (e.g., transgene element or transgenic locus) of the DNA molecule.
[0050] As used herein, the phrase "elite crop plant" refers to a plant
which has undergone
breeding to provide one or more trait improvements. Elite crop plant lines
include plants which
are an essentially homozygous, e.g. inbred or doubled haploid. Elite crop
plants can include
inbred lines used as is or used as pollen donors or pollen recipients in
hybrid seed production
(e.g. used to produce Fl plants). Elite crop plants can include inbred lines
which are selfed to
produce non-hybrid cultivars or varieties or to produce (e.g., bulk up) pollen
donor or recipient
- 8 -
CA 03188282 2022-12-23
WO 2022/026379 PCT/US2021/043170
lines for hybrid seed production. Elite crop plants can include hybrid Fl
progeny of a cross
between two distinct elite inbred or doubled haploid plant lines.
[0051] As used herein, an "event," "a transgenic event," "a transgenic
locus" and related
phrases refer to an insertion of one or more transgenes at a unique site in
the genome of a plant as
well as to DNA fragments, plant cells, plants, and plant parts (e.g., seeds)
comprising genomic
DNA containing the transgene insertion. Such events typically comprise both a
5' and a 3' DNA
junction polynucleotide and confer one or more useful traits including
herbicide tolerance, insect
resistance, male sterility, and the like.
[0052] As used herein, the phrases "endogenous sequence," "endogenous
gene,"
"endogenous DNA" and the like refer to the native form of a polynucleotide,
gene or polypeptide
in its natural location in the organism or in the genome of an organism.
[0053] The term "exogenous DNA sequence" as used herein is any nucleic
acid sequence
that has been removed from its native location and inserted into a new
location altering the
sequences that flank the nucleic acid sequence that has been moved. For
example, an exogenous
DNA sequence may comprise a sequence from another species.
[0054] As used herein, the term "Fl" refers to any offspring of a cross
between two
genetically unlike individuals.
[0055] The term "gene," as used herein, refers to a hereditary unit
consisting of a
sequence of DNA that occupies a specific location on a chromosome and that
contains the
genetic instruction for a particular characteristics or trait in an organism.
The term "gene" thus
includes a nucleic acid (for example, DNA or RNA) sequence that comprises
coding sequences
necessary for the production of an RNA, or a polypeptide or its precursor. A
functional
polypeptide can be encoded by a full length coding sequence or by any portion
of the coding
sequence as long as the desired activity or functional properties (e.g.,
enzymatic activity,
pesticidal activity, ligand binding, and/or signal transduction) of the RNA or
polypeptide are
retained.
[0056] The term "identifying," as used herein with respect to a plant,
refers to a process
of establishing the identity or distinguishing character of a plant, including
exhibiting a certain
trait, containing one or more transgenes, and/or containing one or more
molecular markers.
[0057] The term "isolated" as used herein means having been removed from
its natural
environment.
- 9 -
CA 03188282 2022-12-23
WO 2022/026379 PCT/US2021/043170
[0058] As used herein, the terms "include," "includes," and "including"
are to be
construed as at least having the features to which they refer while not
excluding any additional
unspecified features.
[0059] As used herein, the phrase "introduced transgene" is a transgene
not present in the
original transgenic locus in the genome of an initial transgenic event or in
the genome of a
progeny line obtained from the initial transgenic event. Examples of
introduced transgenes
include exogenous transgenes which are inserted in a resident original
transgenic locus.
[0060] As used herein, the terms "introgression", "introgressed" and
"introgressing" refer
to both a natural and artificial process, and the resulting plants, whereby
traits, genes or DNA
sequences of one species, variety or cultivar are moved into the genome of
another species,
variety or cultivar, by crossing those species. The process may optionally be
completed by
backcrossing to the recurrent parent. Examples of introgression include entry
or introduction of a
gene, a transgene, a regulatory element, a marker, a trait, a trait locus, or
a chromosomal segment
from the genome of one plant into the genome of another plant.
[0061] The phrase "marker-assisted selection", as used herein, refers to
the diagnostic
process of identifying, optionally followed by selecting a plant from a group
of plants using the
presence of a molecular marker as the diagnostic characteristic or selection
criterion. The process
usually involves detecting the presence of a certain nucleic acid sequence or
polymorphism in the
genome of a plant.
[0062] The phrase "molecular marker", as used herein, refers to an
indicator that is used
in methods for visualizing differences in characteristics of nucleic acid
sequences. Examples of
such indicators are restriction fragment length polymorphism (RFLP) markers,
amplified
fragment length polymorphism (AFLP) markers, single nucleotide polymorphisms
(SNPs),
microsatellite markers (e.g. SSRs), sequence-characterized amplified region
(SCAR) markers,
Next Generation Sequencing (NGS) of a molecular marker, cleaved amplified
polymorphic
sequence (CAPS) markers or isozyme markers or combinations of the markers
described herein
which defines a specific genetic and chromosomal location.
[0063] As used herein the terms "native" or "natural" define a condition
found in nature.
A "native DNA sequence" is a DNA sequence present in nature that was produced
by natural
means or traditional breeding techniques but not generated by genetic
engineering (e.g., using
molecular biology/transformation techniques).
- 10 -
CA 03188282 2022-12-23
WO 2022/026379 PCT/US2021/043170
[0064] The term "offspring", as used herein, refers to any progeny
generation resulting
from crossing, selfing, or other propagation technique.
[0065] The phrase "operably linked" refers to a juxtaposition wherein the
components so
described are in a relationship permitting them to function in their intended
manner. For
instance, a promoter is operably linked to a coding sequence if the promoter
affects its
transcription or expression. When the phrase "operably linked" is used in the
context of a PAM
site and a DNA junction polynucleotide, it refers to a PAM site which permits
cleavage of at least
one strand of DNA in the junction polynucleotide with an RNA dependent DNA
endonuclease,
RNA dependent DNA binding protein, or RNA dependent DNA nickase which
recognizes the
PAM site when a guide RNA complementary to sequences adjacent to the PAM site
is present.
[0066] As used herein, the term "plant" includes a whole plant and any
descendant, cell,
tissue, or part of a plant. The term "plant parts" include any part(s) of a
plant, including, for
example and without limitation: seed (including mature seed and immature
seed); a plant cutting;
a plant cell; a plant cell culture; or a plant organ (e.g., pollen, embryos,
flowers, fruits, shoots,
leaves, roots, stems, and explants). A plant tissue or plant organ may be a
seed, protoplast, callus,
or any other group of plant cells that is organized into a structural or
functional unit. A plant cell
or tissue culture may be capable of regenerating a plant having the
physiological and
morphological characteristics of the plant from which the cell or tissue was
obtained, and of
regenerating a plant having substantially the same genotype as the plant.
Regenerable cells in a
plant cell or tissue culture may be embryos, protoplasts, meristematic cells,
callus, pollen, leaves,
anthers, roots, root tips, silk, flowers, kernels, ears, cobs, husks, or
stalks. In contrast, some plant
cells are not capable of being regenerated to produce plants and are referred
to herein as "non-
regenerable" plant cells.
[0067] The term "purified," as used herein defines an isolation of a
molecule or
compound in a form that is substantially free of contaminants normally
associated with the
molecule or compound in a native or natural environment and means having been
increased in
purity as a result of being separated from other components of the original
composition. The term
"purified nucleic acid" is used herein to describe a nucleic acid sequence
which has been
separated from other compounds including, but not limited to polypeptides,
lipids and
carbohydrates.
[0068] The term "recipient", as used herein, refers to the plant or plant
line receiving the
trait, transgenic event or genomic segment from a donor, and which recipient
may or may not
-11-
CA 03188282 2022-12-23
WO 2022/026379 PCT/US2021/043170
have the have trait, transgenic event or genomic segment itself either in a
heterozygous or
homozygous state.
[0069] As used herein the term "recurrent parent" or "recurrent plant"
describes an elite
line that is the recipient plant line in a cross and which will be used as the
parent line for
successive backcrosses to produce the final desired line.
[0070] As used herein the term "recurrent parent percentage" relates to
the percentage
that a backcross progeny plant is identical to the recurrent parent plant used
in the backcross. The
percent identity to the recurrent parent can be determined experimentally by
measuring genetic
markers such as SNPs and/or RFLPs or can be calculated theoretically based on
a mathematical
formula.
[0071] The terms "selfed," "selfing," and "self," as used herein, refer
to any process used
to obtain progeny from the same plant or plant line as well as to plants
resulting from the process.
As used herein, the terms thus include any fertilization process wherein both
the ovule and pollen
are from the same plant or plant line and plants resulting therefrom.
Typically, the terms refer to
self-pollination processes and progeny plants resulting from self-pollination.
[0072] The term "selecting", as used herein, refers to a process of
picking out a certain
individual plant from a group of individuals, usually based on a certain
identity, trait,
characteristic, and/or molecular marker of that individual.
[0073] As used herein, the phrase "a transgenic locus excision site"
refers to the DNA
which remains in the genome of a plant or in a DNA molecule (e.g., an isolated
or purified DNA
molecule) wherein a segment comprising, consisting essentially of, or
consisting of a transgenic
locus has been deleted. In a non-limiting and illustrative example, a
transgenic locus excision
site can thus comprise a contiguous segment of DNA comprising at least 10 base
pairs of DNA
that is telomere proximal to the deleted transgenic locus or to the deleted
segment of the
transgenic locus and at least 10 base pairs of DNA that is centromere proximal
to the deleted
transgenic locus or to the deleted segment of the transgenic locus.
[0074] As used herein, the phrase "transgene element" refers to a segment
of DNA
comprising, consisting essentially of, or consisting of a promoter, a 5' UTR,
an intron, a coding
region, a 3'UTR, or a polyadenylation signal. Polyadenylation signals include
transgene elements
referred to as "terminators" (e.g., NOS, pinII, rbcs, Hsp17, TubA).
[0075] To the extent to which any of the preceding definitions is
inconsistent with
definitions provided in any patent or non-patent reference incorporated herein
by reference, any
- 12 -
CA 03188282 2022-12-23
WO 2022/026379 PCT/US2021/043170
patent or non-patent reference cited herein, or in any patent or non-patent
reference found
elsewhere, it is understood that the preceding definition will be used herein.
[0076] Genome editing molecules can permit introduction of targeted
genetic change
conferring desirable traits in a variety of crop plants (Zhang et al. Genome
Biol. 2018; 19: 210;
Schindele et al. FEB S Lett. 2018;592(12):1954). Desirable traits introduced
into crop plants such
as maize and soybean include herbicide tolerance, improved food and/or feed
characteristics,
male-sterility, and drought stress tolerance. Nonetheless, full realization of
the potential of
genome editing methods for crop improvement will entail efficient
incorporation of the targeted
genetic changes in germplasm of different elite crop plants adapted for
distinct growing
conditions. Such elite crop plants will also desirably comprise useful
transgenic loci which confer
various traits including herbicide tolerance, pest resistance (e.g.; insect,
nematode, fungal
disease, and bacterial disease resistance), conditional male sterility systems
for hybrid seed
production, abiotic stress tolerance (e.g., drought tolerance), improved food
and/or feed quality,
and improved industrial use (e.g., biofuel). Provided herein are methods
whereby targeted genetic
changes are efficiently combined with desired subsets of transgenic loci in
elite progeny plant
lines (e.g., elite inbreds used for hybrid seed production or for inbred
varietal production). Also
provided are plant genomes containing unique transgenic locus excision sites,
DNA molecules
comprising the unique transgenic locus excision sites and/or plants comprising
the same,
biological samples containing the DNA, nucleic acid markers adapted for
detecting the DNA
molecules, and related methods of identifying the elite crop plants comprising
unique transgenic
locus excision sites.
[0077] Provided herein are methods for the directed excision of
transgenic loci in
transgenic plants. In certain embodiments, methods for the excision of the
transgenic loci include
targeted excision of a given transgenic locus in certain breeding lines to
facilitate recovery of
germplasm with subsets of transgenic traits tailored for specific geographic
locations and/or
grower preferences. Other useful applications of the methods for the excision
of the transgenic
loci include removal of transgenic traits from certain breeding lines when it
is desirable to
replace the trait in the breeding line without disrupting other transgenic
loci and/or non-
transgenic loci. In certain embodiments, excision of transgenic loci can be
accompanied or
followed by insertion of new transgenes that confer a replacement or other
desirable trait at the
genomic location of the excised transgenic locus (i.e., the transgenic locus
excision site which
remains in the genome following excision of the transgenic locus).
- 13 -
CA 03188282 2022-12-23
WO 2022/026379 PCT/US2021/043170
[0078] Methods provided herein can be used to excise any transgenic locus
where the 5'
and 3' junction sequences comprising the endogenous non-transgenic genomic DNA
and the
heterologous transgenic DNA which are joined at the site of transgene
insertion in the plant
genome are known or have been determined. In certain embodiments provided
herein, transgenic
loci can be removed from crop plant lines to obtain crop plant lines with
tailored combinations of
transgenic loci and optionally targeted genetic changes. Such 5' and 3'
junction sequences are
readily identified in new transgenic events by inverse PCR techniques using
primers which are
complementary the inserted transgenic sequences. In certain embodiments, the
5' and 3' junction
sequences are published. Examples of transgenic loci which can be improved and
used in the
methods provided herein include the maize, soybean, cotton, and canola
transgenic loci set forth
in Tables 1, 2, 3, and 4, respectively. Transgenic junction sequences for
certain events are also
depicted in the drawings. Such transgenic loci set forth in Tables 1-4 are
found in crop plants
which have in some instances been cultivated, been placed in commerce, and/or
have been
described in a variety of publications by various governmental bodies.
Databases which have
compiled descriptions of approved transgenic loci including the loci set forth
in Tables 1-4
include the International Service for the Acquisition of Agri-biotech
Applications (ISAAA)
database (available on the world wide web intemet site
"isaaa.org/gmapprovaldatabase/event"),
the GenBit LLC database (available on the world wide web intemet site
"genbitgroup.com/en/gmo/gmodatabase"), and the Biosafety Clearing-House (B CH)
database
(available on the http intemet site ch. cbd.int/database/organisms").
[0079] Table 1. Maize Events (transgenic loci)
Event Name Patent or Patent ATCC or Trait expression SEQ ID NO
(traits)1 Application NCIMB cassette(s)
Number(s)2 Deposit
Designation
BVLA430101 (Q) CN2013103194381A phyA2
Bt10 (IR, HT) Cry lAb, PAT
Bt 1 1 (IR, HT) US 6,342,660; US ATCC 209671 Cry lAb and PAT
6,403,865;
US 6,943,282
Bt176 Cry lAb, PAT
CBH-351 (HT, IR) JP 2006197926 A PAT, Cry9c
- 14 -
CA 03188282 2022-12-23
WO 2022/026379 PCT/US2021/043170
Event Name Patent or Patent ATCC or
Trait expression SEQ ID NO
(traits)2 Application NCIMB cassette(s)
Number(s)2 Deposit
Designation
DAS-59122-7 (IR, US 6127180; US PTA-11384 cry34Ab1, SEQ ID NO:
HT) 6340593; US cry35Ab1, PAT 1
6548291; US
6624145; US
6893872; US
6900371; US 7323556
(Event); US 7695914
(Event); US 7696341;
US 7956246 (Event);
US 8592653 (Event);
US 8952223 (Event);
RE 43,373; US
9878321 (Event)
DAS-40278 (HT) US 20120244533 PTA-10244 aad-1 SEQ ID NO:
22
DBT418 (IR, HT) Cry lAc, PAT, pinII
DP-4114 (IR, HT) US 8,575,434; US PTA-11506 CrylAb, cry34Ab1, SEQ ID NO:
10,190,179; US cry35Ab1, PAT 2 (Fig. 2)
20190136331
DP-32138 (MS, US 20130031674 PTA-9158 Zm Ms45, Zm aal SEQ ID NO:
MSR) US 20090038026 gene, DsRed2 24
US 20060288440
DP-33121 (IR. US 20150361446 PTA-13392 Cry2A.127, SEQ ID NO:
HT) Cry1A.88, 23
VIP3Aa20, PAT
GA21 (HT) US 2005086719; US ATCC 209033 EPSPS
6,040,497; US
6,762,344; US
7,314,970
HCEM485 (HT) US 8759618 B2 PTA-12014 zmEPSPS SEQ ID NO:
- 15 -
CA 03188282 2022-12-23
WO 2022/026379 PCT/US2021/043170
Event Name Patent or Patent ATCC or
Trait expression SEQ ID NO
(traits)2 Application NCIMB cassette(s)
Number(s)2 Deposit
Designation
LY038 (Q) US 7157281 PTA-5623 cordapA SEQ ID NO:
26
MON810 (IR, HT, US 6,852,915 PTA-6260 CrylAb, g0xv247,
AR) cp4epsps
M0N832 (HT) Goxv247, cp4
epsps, nptII
M0N863 (IR) US 7705216 PTA-2605 Cry3Bb1
M0N87403 (YG) US 20170088904 PTA-13584 athb17 SEQ ID NO:
27
M0N87411 (IR, US 10,316,330 PTA-12669 cry3Bb1, cp4epsps, SEQ ID NO:
HT) dvsnf7 3
M0N87419 (HT) US 2015/0267221 PTA-120860 DMO, PAT SEQ ID NO:
28
M0N87427 US 8,618,358 PTA-7899 cp4epsps
(HT/MS)3
M0N87460 (AST) US 8450561 PTA-8910 cspB SEQ ID NO:
29
M0N88017 (IR, US 8,212,113; US PTA-5582 cry3Bbl, cp4epsps
HT) 8,686,230
M0N89034 (IR)4 US 9,428,765 PTA-7455 cry2Ab2, cry1A.105 SEQ ID NO:
4
MIR162 (IR, MU) US 8,455,720 PTA-8166 VIP3Aa20 SEQ ID NO:
MIR604 (IR, MU) US 7,897,748 none cry3A055 SEQ ID NO:
6
M53 Barnase, PAT
M56 barnase
- 16 -
CA 03188282 2022-12-23
WO 2022/026379 PCT/US2021/043170
Event Name Patent or Patent ATCC or
Trait expression SEQ ID NO
(traits)2 Application NCIMB cassette(s)
Number(s)2 Deposit
Designation
MZHGOJG (HT) US_201662346688_P PTA-122835 ZmEPSPS, PAT SEQ ID NO:
W02017214074 30
MZIR098 (IR, US 20200190533 PTA-124143 ecry3.1Ab, mcry3A, SEQ ID NO:
HT) PAT 31
MYDTO9Y
DP-E29
NK603 (HT) US 8,273,959 PTA-2478 cp4epsps SEQ ID NO:
7
SYN-E3272-5 US 8,093,453 PTA-9972 amy797E SEQ ID NO:
(BF, MU) 8
T14 (HT) PAT
T25 (HT) PAT
TC1507 (IR, HT) US 8,901,378; US PTA-5448 cry1Fa2, PAT SEQ ID NO:
8,502,047 (Inbred 9
BE1146BMR);
PTA-8519
(LLDO6BM)
TC6275 (IR, HT) PAT, moCrylF
VC0-01981-5 US 9,994,863 NCIMB 41842 EPSPS SEQ ID NO:
(HT) 32
676 (MS, HT) dam, PAT
678 (MS, HT) dam, PAT
680 (MS,HT) dam, PAT
98140 (HT) US 7,928,296 PTA-8296 zm-hra, GAT SEQ ID NO:
33
5307 (IR, MU) US 8,466,346 PTA-9561 ecry3.1Ab SEQ ID NO:
- 17 -
CA 03188282 2022-12-23
WO 2022/026379 PCT/US2021/043170
1 Traits: IR=Insect Resistance; HT=Herbicide Tolerance; AR=Antibiotic
Resistance;
MU=mannose utilization; BF=Biofuel; MS=Male Sterility; MSR=Male Sterility
Restoration; Q=Food and/or Feed Quality; AST=Abiotic Stress Tolerance;
YG=Yield/Growth.
2 Each US Patent or Patent Application Publication is incorporated herein by
reference in
its entirety.
3 A single transgene confers vegetative tolerance to glyphosate and exhibits
glyphosate-
induced male sterility.
4Resistance to coleopteran and lepidopteran insect pests.
[0080] Table 2. Soybean Events (transgenic loci)
Event Name (traits)4 Patent or Patent ATCC;3 Trait SEQ ID NO
Application NCIMB4 expression
Number(s)2 Deposit cassette(s)
Number; or
Commercial
Source
A5547-127(HT) US 20080196127 NCIMB PAT
RE44962 41660
DA544406-6 (HT)5 US 9,540,655 PTA-11336 Aad-12, SEQ ID NO: 11
US 10,400,250 2mepsps,
PAT
DA568416-4 (IR, US 9,738,904 PTA-10442 Aad-12, PAT SEQ ID NO: 12
HT)6 PTA-12006
DA581419-2 (IR, HT) US 8680363 PTA-12006 crylAc, SEQ ID NO: 13
US 8632978 cry1F, PAT
US 9695441
US 9738904
GTS 40-3-2 (HT) US 20070136836 M690GT 10.9 cp4epsps
RM Soybean'
M0N87701 (IR) US 8049071 PTA-8194 crylAc SEQ ID NO: 14
M0N87708 (HT)8 US 9447428 PTA-9670 DMO SEQ ID NO: 15
M0N89788 (HT) US 9944945 PTA-6708 cp4epsps SEQ ID NO: 16
MST-FG072-3 (HT)9 US 8592650 NCIMB hppdPF SEQ ID NO: 34
41659 W336,
2mepsps
SYHT0H21 US 10,184,134 PTA-11226 cAvHPPD-03
'Traits: IR=Insect Resistance; HT=Herbicide Tolerance; AR=Antibiotic
Resistance;
MU=mannose utilization; BF=Biofuel; MS=Male Sterility.
- 18 -
CA 03188282 2022-12-23
WO 2022/026379 PCT/US2021/043170
2 Each US Patent or Patent Application Publication is incorporated herein by
reference in its
entirety.
3 ATCC is the American Type Culture Collection, 10801 University Boulevard
Manassas, VA
20110 USA (for "PTA-XXXXX" deposits).
4 NCIMB is the National Collection of Industrial, Food and Marine Bacteria,
Ferguson Building,
Craibstone Estate, Bucksburn, Aberdeen AB9YA, Scotland.
HT to 2,4-D; glyphosate, and glufosinate; also refered to as pDAB8264.44.06.1.
6 Independent IR/HT and HT events combined by breeding. IR/HT event (Cry1F,
Cry lAc synpro
(CrylAc), and PAT) is DA581419-2, deposited with ATCC under PTA-12006, also
referred to
as DA581419-2.
7 Elk Mound Seed, 308 Railroad Street Elk Mound, WI, USA 54739.
8HT to dicamba.
9 HT to both glyphosate and isoxaflutole herbicides.
1 HT to glufosinate and mesotrione herbicides.
[0081] Table 3. Cotton Events (transgenic loci)
Event Name (traits) Patent ATCC Trait SEQ ID NO
1 Number(s) Deposit expression
cassette(s)
DAS-21023-5 (IR, US 7,179,965 PTA-6233 Cry lAc, PAT SEQ ID NO: 17
HT)
DAS-24236-5(IR, US 7,179,965 PTA-6233 Cry1F, PAT SEQ ID NO: 18
HT)
COT102 (IR, AR) 2 US 7,371,940 Vip3A(a), SEQ ID NO: 19
LLcotton25 (HT) US PTA-3343 PAT
20030097687
M0N15985 (IR, AR, US 9,133,473 PTA-2516 crylAc,
SM) 3 cry2Ab2
M0N88701 (HT)4 US 8,735,661 PTA-11754 DMO, PAT SEQ ID NO: 20
M0N88913 (HT) US 7,381,861 PTA-4854 cp4 epsps
Traits: IR=Insect Resistance; HT=Herbicide Tolerance; AR=Antibiotic
Resistance;
SM=Screenable Marker.
2 Both cry lAc cotton event 3006-210-23 and crylF cotton event 281-24-236
described in US
7,179,965; seed comprising both events deposited with ATCC as PTA-6233.
3 Contains both the M0N531 chimeric CrylA and M0N15985X Cry2Ab insertions.
4 Tolerance to dicamba and glufosinate herbicides.
[0082] Table 4. Canola Events (transgenic loci)
Event Name Patent or Patent ATCC Trait SEQ ID NO
(traits)1 Application Deposit Expression (Figure Number)
Publication cassette
Number(s)
GT73 (HT) US 8,048,632 PTA- cp4 epsps
US 9,474,223 121409
HCN28/T45
(HT)
- 19 -
CA 03188282 2022-12-23
WO 2022/026379
PCT/US2021/043170
M0N88302 US 9,738,903 PTA-10955 cp4 epsps SEQ
ID NO: 21
(HT)
M58 (MS) US2003188347 PTA-730
RF3 (HT) US2003188347 PTA-730
Traits: HT=Herbicide Tolerance; MS=Male Sterility.
[0083] Sequences of the 5' and 3' junction polynucleotides as well as the
transgenic
insert(s) of certain transgenic loci which can be excised by the methods
provided herein are set
forth in Tables 1-4 (e.g., SEQ ID NO: 1-34), the patent references set forth
therein and
incorporated herein by reference in their entireties, and elsewhere in this
disclosure. Allelic or
other variant sequences corresponding to the sequences set forth in Tables 1-4
and elsewhere in
this disclosure which may be present in certain variant transgenic plant loci
can also be improved
by identifying sequences in the variants that correspond to the sequences of
Tables 1-4 (e.g., SEQ
ID NO: 1-34), the patent references set forth therein and incorporated herein
by reference and
incorporated herein by reference in their entireties, and elsewhere in this
disclosure by
performing a pairwise alignment (e.g., using CLUSTAL 0 1.2.4 with default
parameters) and
making corresponding changes in the allelic or other variant sequences. Such
allelic or other
variant sequences include sequences having at least 85%, 90%, 95%, 98%, or 99%
sequence
identity across the entire length or at least 20, 40, 100, or 500, 1,000,
2,000, 4,000, 8,000, 10,000,
or 12,000 nucleotides of the sequences set forth in Tables 1-4 (e.g., SEQ ID
NO: 1-34), the patent
references set forth therein and incorporated herein by reference in their
entireties, and elsewhere
in this disclosure. Also provided are plants, genomic DNA, and/or DNA obtained
from plants set
forth in Tables 1-4 which comprise one or more transgenic loci excision sites
wherein a segment
comprising, consisting essentially of, or consisting of a transgenic locus is
deleted. Also
provided herein are methods of detecting plants, genomic DNA, and/or DNA
obtained from
plants set forth in Tables 1-4 comprising a transgenic locus excision site.
[0084] Methods provided herein can be used in a variety of breeding
schemes to obtain
elite crop plants comprising subsets of desired transgenic loci and transgenic
loci excision sites
where undesired transgenic loci have been removed. Such methods are useful at
least insofar as
they allow for production of distinct useful donor plant lines each having
unique sets of
transgenic loci and, in some instances, targeted genetic changes that are
tailored for distinct
geographies and/or product offerings. In an illustrative and non-limiting
example, a different
product lines comprising transgenic loci conferring only two of three types of
herbicide tolerance
(e.g.., glyphosate, glufosinate, and dicamba) can be obtained from a single
donor line comprising
- 20 -
CA 03188282 2022-12-23
WO 2022/026379 PCT/US2021/043170
three distinct transgenic loci conferring resistance to all three herbicides.
In certain aspects,
plants comprising the subsets of undesired transgenic loci and transgenic loci
excision sites can
further comprise targeted genetic changes. Such elite crop plants can be
inbred plant lines or can
be hybrid plant lines. In certain embodiments, at least two transgenic loci
(e.g., transgenic loci in
Tables 1-4 or modifications thereof wherein a selectable marker gene and/or
non-essential DNA
are deleted) are introgressed into a desired donor line comprising elite crop
plant germplasm and
then subjected to genome editing molecules to recover plants comprising one of
the two
introgressed transgenic loci as well as a transgenic loci excision site
introduced by excision of the
other transgenic locus by the genome editing molecules. In certain
embodiments, the genome
editing molecules can be used to remove a transgenic locus and introduce
targeted genetic
changes in the crop plant genome. Introgression can be achieved by
backcrossing plants
comprising the transgenic loci to a recurrent parent comprising the desired
elite germplasm and
selecting progeny with the transgenic loci and recurrent parent germplasm.
Such backcrosses can
be repeated and/or supplemented by molecular assisted breeding techniques
using SNP or other
nucleic acid markers to select for recurrent parent germplasm until a desired
recurrent parent
percentage is obtained (e.g., at least about 95%, 96%, 97%, 98%, or 99%
recurrent parent
percentage). A non-limiting, illustrative depiction of a scheme for obtaining
plants with both
subsets of transgenic loci and the targeted genetic changes is shown in the
Figure 11 (bottom
"Alternative" panel), where two or more of the transgenic loci ("Event" in
Figure 11) are
provided in Line A and then moved into elite crop plant germplasm by
introgression. In the non-
limiting Figure 11 illustration, introgression can be achieved by crossing a
"Line A" comprising
two or more of the modified or unmodified transgenic loci to the elite
germplasm and then
backcrossing progeny of the cross comprising the transgenic loci to the elite
germplasm as the
recurrent parent) to obtain a "Universal Donor" (e.g. Line A+ in Figure 11)
comprising two or
more of the modified or unmodified transgenic loci. This elite germplasm
containing the
modified or unmodified transgenic loci (e.g. "Universal Donor" of Figure 11)
can then be
subjected to genome editing molecules which can excise at least one of the
modified or
unmodified transgenic loci ("Event Removal" in Figure 11) and introduce other
targeted genetic
changes ("GE" in Figure 11) in the genomes of the elite crop plants containing
one of the
transgenic loci and a transgenic locus excision site corresponding to the
removal site of one of
the transgenic loci. Such selective excision of transgenic loci can be
effected by contacting the
genome of the plant comprising two transgenic loci with gene editing molecules
(e.g., RdDe and
-21 -
CA 03188282 2022-12-23
WO 2022/026379 PCT/US2021/043170
gRNAs, TALENS, and/or ZFN) which recognize one transgenic loci but not another
transgenic
loci. Distinct plant lines with different subsets of transgenic loci and
desired targeted genetic
changes are thus recovered (e.g., "Line B-1," "Line B-2," and "Line B-3" in
Figure 11). In
certain embodiments, it is also desirable to bulk up populations of inbred
elite crop plants or their
seed comprising the subset of transgenic loci and a transgenic locus excision
site by selfing.
Such inbred progeny of the selfed plants can be used either as is for
commercial sales where the
crop can be grown a varietal, non-hybrid crop (e.g., commonly though not
always in soybean,
cotton, or canola) comprising the subset of desired transgenic loci and one or
more transgenic
loci excision sites. In certain embodiments, inbred progeny of the selfed
plants can be used as a
pollen donor or recipient for hybrid seed production (e.g., most commonly in
maize but also in
cotton, soybean, and canola). Such hybrid seed and the progeny grown therefrom
can comprise a
subset of desired transgenic loci and a transgenic loci excision site.
[0085] Hybrid plant lines comprising elite crop plant germplasm, at least
one transgenic
locus and at least one transgenic locus excision site, and in certain aspects,
additional targeted
genetic changes are also provided herein. Methods for production of such
hybrid seed can
comprise crossing elite crop plant lines where at least one of the pollen
donor or recipient
comprises at least the transgenic locus and a transgenic locus excision site
and/or additional
targeted genetic changes. In certain embodiments, the pollen donor and
recipient will comprise
germplasm of distinct heterotic groups and provide hybrid seed and plants
exhibiting heterosis. In
certain embodiments, the pollen donor and recipient can each comprise a
distinct transgenic locus
which confers either a distinct trait (e.g., herbicide tolerance or insect
resistance), a different type
of trait (e.g., tolerance to distinct herbicides or to distinct insects such
as coleopteran or
lepidopteran insects), or a different mode-of-action for the same trait (e.g.,
resistance to
coleopteran insects by two distinct modes-of-action or resistance to
lepidopteran insects by two
distinct modes-of-action). In certain embodiments, the pollen recipient will
be rendered male
sterile or conditionally male sterile. Methods for inducing male sterility or
conditional male
sterility include emasculation (e.g., detasseling), cytoplasmic male
sterility, chemical hybridizing
agents or systems, a transgenes or transgene systems, and/or mutation(s) in
one or more
endogenous plant genes. Descriptions of various male sterility systems that
can be adapted for
use with the elite crop plants provided herein are described in Wan et al.
Molecular Plant; 12,
3, (2019):321-342 as well as in US 8,618,358; US 20130031674; and US
2003188347.
- 22 -
CA 03188282 2022-12-23
WO 2022/026379 PCT/US2021/043170
[0086] In certain embodiments, it will be desirable to use genome editing
molecules to
excise transgenic loci and/or make targeted genetic changes in elite crop
plant or other
germplasm. Techniques for effecting genome editing in crop plants (e.g.,
maize,) include use of
morphogenic factors such as Wuschel (WUS), Ovule Development Protein (ODP),
and/or
Babyboom (BBM) which can improve the efficiency of recovering plants with
desired genome
edits. In some aspects, the morphogenic factor comprises WUS1, WUS2, WUS3,
WOX2A,
WOX4, WOX5, WOX9, BBM2, BMN2, BMN3, and/or ODP2. In certain embodiments,
compositions and methods for using WUS, BBM, and/or ODP, as well as other
techniques which
can be adapted for effecting genome edits in elite crop plant and other
germplasm, are set forth in
US 20030082813, US 20080134353, US 20090328252, US 20100100981, US
20110165679, US
20140157453, US 20140173775, and US 20170240911, which are each incorporated
by
reference in their entireties. In certain embodiments, the genome edits can be
effected in
regenerable plant parts (e.g.; plant embryos) of elite crop plants by
transient provision of gene
editing molecules or polynucleotides encoding the same and do not necessarily
require
incorporating a selectable marker gene into the plant genome (e.g., US
20160208271 and US
20180273960, both incorporated herein by reference in their entireties;
Svitashev et al. Nat
Commun. 2016; 7:13274).
[0087] In certain embodiments, edited transgenic plant genomes,
transgenic plant cells,
parts, or plants containing those genomes, and DNA molecules obtained
therefrom, can comprise
a desired subset of transgenic loci and/or comprise at least one transgenic
locus excision site. In a
non-limiting and illustrative example where a segment comprising an original
transgenic locus
has been deleted, the transgenic locus excision site can comprise a contiguous
segment of DNA
comprising at least 10 base pairs of DNA that is telomere proximal to the
deleted segment of the
transgenic locus and at least 10 base pairs of DNA that is centromere proximal
to the deleted
segment of the transgenic locus wherein the transgenic DNA (i.e., the
heterologous DNA) that
has been inserted into the crop plant genome has been deleted. In certain
embodiments where a
segment comprising a transgenic locus has been deleted, the transgenic locus
excision site can
comprise a contiguous segment of DNA comprising at least 10 base pairs DNA
that is telomere
proximal to the deleted segment of the transgenic locus and at least 10 base
pairs of DNA that is
centromere proximal DNA to the deleted segment of the transgenic locus wherein
the
heterologous transgenic DNA and at least 1, 2, 5, 10, 20, 50, or more base
pairs of endogenous
DNA located in a 5' junction sequence and/or in a 3' junction sequence of the
original transgenic
- 23 -
CA 03188282 2022-12-23
WO 2022/026379 PCT/US2021/043170
locus that has been deleted. In such embodiments where DNA comprising the
transgenic locus is
deleted, a transgenic locus excision site can comprise at least 10 base pairs
of DNA that is
telomere proximal to the deleted segment of the transgenic locus and at least
10 base pairs of
DNA that is centromere proximal to the deleted segment of the transgenic locus
wherein all of
the transgenic DNA is absent and either all or less than all of the endogenous
DNA flanking the
transgenic DNA sequences are present. In certain embodiments where a segment
consisting
essentially of an original transgenic locus has been deleted, the transgenic
locus excision site can
be a contiguous segment of at least 10 base pairs of DNA that is telomere
proximal to the deleted
segment of the transgenic locus and at least 10 base pairs of DNA that is
centromere proximal to
the deleted segment of the transgenic locus wherein less than all of the
heterologous transgenic
DNA that has been inserted into the crop plant genome is excised. In certain
aforementioned
embodiments where a segment consisting essentially of an original transgenic
locus has been
deleted, the transgenic locus excision site can thus contain at least 1 base
pair of DNA or 1 to
about 2 or 5, 8, 10, 20, or 50 base pairs of DNA comprising the telomere
proximal and/or
centromere proximal heterologous transgenic DNA that has been inserted into
the crop plant
genome. In certain embodiments where a segment consisting of an original
transgenic locus has
been deleted, the transgenic locus excision site can contain a contiguous
segment of DNA
comprising at least 10 base pairs of DNA that is telomere proximal to the
deleted segment of the
transgenic locus and at least 10 base pairs of DNA that is centromere proximal
to the deleted
segment of the transgenic locus wherein the heterologous transgenic DNA that
has been inserted
into the crop plant genome is deleted. In certain embodiments where DNA
consisting of the
transgenic locus is deleted, a transgenic locus excision site can comprise at
least 10 base pairs of
DNA that is telomere proximal to the deleted segment of the transgenic locus
and at least 10 base
pairs of DNA that is centromere proximal to the deleted segment of the
transgenic locus wherein
all of the heterologous transgenic DNA that has been inserted into the crop
plant genome is
deleted and all of the endogenous DNA flanking the heterologous sequences of
the transgenic
locus is present. In any of the aforementioned embodiments or in other
embodiments, the
continuous segment of DNA comprising the transgenic locus excision site can
further comprise
an insertion of 1 to about 2, 5, 10, 20, or more nucleotides between the DNA
that is telomere
proximal to the deleted segment of the transgenic locus and the DNA that is
centromere proximal
to the deleted segment of the transgenic locus. Such insertions can result
either from endogenous
DNA repair and/or recombination activities at the double stranded breaks
introduced at the
- 24 -
CA 03188282 2022-12-23
WO 2022/026379 PCT/US2021/043170
excision site and/or from deliberate insertion of an oligonucleotide. Plants,
edited plant genomes,
biological samples, and DNA molecules (e.g., including isolated or purified
DNA molecules)
comprising the transgenic loci excision sites are provided herein. Nucleic
acid markers adapted
for detecting the transgenic loci excision sites as well as methods for
detecting the presence of
DNA molecules comprising the transgenic loci excision sites are also provided
herein.
[0088] In certain embodiments provided herein, a modified version of an
approved
transgenic locus which in its unmodified form (in certain embodiments, the
"unmodified form" is
the "original form," "original transgenic locus," etc.) comprises at least one
selectable marker
gene. In the modified version, at least one selectable marker has been deleted
with genome
editing molecules as described elsewhere herein from the unmodified approved
transgenic locus.
In certain embodiments, the deletion of the selectable marker gene does not
affect any other
functionality of the approved transgenic locus. In certain embodiments, the
selectable marker
gene that is deleted confers resistance to an antibiotic, tolerance to an
herbicide, or an ability to
grow on a specific carbon source, for example, mannose. In certain
embodiments, the selectable
marker gene comprises a DNA encoding a phosphinothricin acetyl transferase
(PAT), a
glyphosate tolerant 5-enol-pyruvylshikimate-3-phosphate synthase (EPSPS), a
glyphosate
oxidase (GOX), neomycin phosphotransferase (npt), a hygromycin
phosphotransferase (hyg), an
aminoglycoside adenyl transferase, or a phosphomannose isomerase (pmi). In
certain
embodiments, the modified locus does not contain a site-specific recombination
system DNA
recognition site, for example, in certain embodiments, the modified locus does
not contain a lox
or FRT site. In certain embodiments, the selectable marker gene to be deleted
is flanked by
operably linked protospacer adjacent motif (PAM) sites in the unmodified form
of the approved
transgenic locus. Thus, in certain embodiments of the modified locus, PAM
sites flank the
excision site of the deleted selectable marker gene. In certain embodiments,
the PAM sites are
recognized by an RNA dependent DNA endonuclease (RdDe); for example, a class 2
type II or
class 2 type V RdDe. In certain embodiments, the deleted selectable marker
gene is replaced in
the modified approved transgenic locus by an introduced DNA sequence as
discussed in further
detail elsewhere herein. For example, in certain embodiments, the introduced
DNA sequence
comprises a trait expression cassette such as a trait expression cassette of
another transgenic
locus. In addition to the deletion of a selectable marker gene, in certain
embodiments at least one
copy of a repetitive sequence has also been deleted with genome editing
molecules from an
unmodified approved transgenic locus. In certain embodiments, deletion of the
repetitive
- 25 -
CA 03188282 2022-12-23
WO 2022/026379 PCT/US2021/043170
sequence enhances the functionality of the modified approved transgenic locus.
In certain
embodiments, the approved transgenic locus which is modified is: (i) a Btll,
DAS-59122-7, DP-
4114, GA21, MON810, M0N87411, M0N87427, M0N88017, MIR162, MIR604, NK603,
SYN-E3272-5, 5307, DAS-40278, DP-32138, DP-33121, HCEM485, LY038, M0N863,
M0N87403, M0N87403, MON87419, M0N87460, MZHGOJG, M2IR098, VC0-01981-5,
98140, and/or TC1507 transgenic locus in a transgenic maize plant genome; (ii)
an A5547-127,
DAS44406-6, DAS68416-4, DAS81419-2, GTS 40-3-2, MON87701, M0N87708, M0N89788,
MST-FG072-3, and/or SYHT0H2 transgenic locus in a transgenic soybean plant
genome; (iii) a
DAS-21023-5, DAS-24236-5, COT102, LLcotton25, MON15985, M0N88701, and/or
M0N88913 transgenic locus in a transgenic cotton plant genome; or (iv) a GT73,
HCN28,
M0N88302, and/or MS8 transgenic locus in a transgenic canola plant genome.
Also provided
herein are plants comprising any of aforementioned modified transgenic loci.
[0089] In certain embodiments, edited transgenic plant genomes and
transgenic plant
cells, plant parts, or plants containing those edited genomes, comprising a
modification of an
original transgenic locus, where the modification comprises a deletion of a
segment of the
original transgenic locus are provided. In certain embodiments, the
modification comprises two
or more separate deletions and/or there is a modification in two or more
original transgenic plant
loci. In certain embodiments, the deleted segment comprises, consists
essentially of, or consists
of a segment of non-essential DNA in the transgenic locus. Illustrative
examples of non-essential
DNA include but are not limited to synthetic cloning site sequences,
duplications of transgene
sequences; fragments of transgene sequences, and Agrobacterium right and/or
left border
sequences. In certain embodiments, the non-essential DNA is a duplication
and/or fragment of a
promoter sequence and/or is not the promoter sequence operably linked in the
cassette to drive
expression of a transgene. In certain embodiments, excision of the non-
essential DNA improves a
characteristic, functionality, and/or expression of a transgene of the
transgenic locus or otherwise
confers a recognized improvement in a transgenic plant comprising the edited
transgenic plant
genome. In certain embodiments, the non-essential DNA does not comprise DNA
encoding a
selectable marker gene. In certain embodiments of an edited transgenic plant
genome, the
modification comprises a deletion of the non-essential DNA and a deletion of a
selectable marker
gene. The modification producing the edited transgenic plant genome could
occur by excising
both the non-essential DNA and the selectable marker gene at the same time,
e.g., in the same
modification step, or the modification could occur step-wise. For example, an
edited transgenic
- 26 -
CA 03188282 2022-12-23
WO 2022/026379 PCT/US2021/043170
plant genome in which a selectable marker gene has previously been removed
from the
transgenic locus can comprise an original transgenic locus from which a non-
essential DNA is
further excised and vice versa. In certain embodiments, the modification
comprising deletion of
the non-essential DNA and deletion of the selectable marker gene comprises
excising a single
segment of the original transgenic locus that comprises both the non-essential
DNA and the
selectable marker gene. Such modification would result in one excision site in
the edited
transgenic genome corresponding to the deletion of both the non-essential DNA
and the
selectable marker gene. In certain embodiments, the modification comprising
deletion of the non-
essential DNA and deletion of the selectable marker gene comprises excising
two or more
segments of the original transgenic locus to achieve deletion of both the non-
essential DNA and
the selectable marker gene. Such modification would result in at least two
excision sites in the
edited transgenic genome corresponding to the deletion of both the non-
essential DNA and the
selectable marker gene. In certain embodiments of an edited transgenic plant
genome, prior to
excision, the segment to be deleted is flanked by operably linked protospacer
adjacent motif
(PAM) sites in the original or unmodified transgenic locus and/or the segment
to be deleted
encompasses an operably linked PAM site in the original or unmodified
transgenic locus. In
certain embodiments, following excision of the segment, the resulting edited
transgenic plant
genome comprises PAM sites flanking the deletion site in the modified
transgenic locus. In
certain embodiments of an edited transgenic plant genome, the modification
comprises a
modification of a Btll, DAS-59122-7, DP-4114, GA21, MON810, M0N87411,
M0N87427,
M0N88017, MIR162, MIR604, NK603, SYN-E3272-5, 5307, DAS-40278, DP-32138, DP-
33121, HCEM485, LY038, M0N863, M0N87403, M0N87403, M0N87419, M0N87460,
MZHGOJG, MZIR098, VC0-01981-5, 98140, and/or TC1507 original transgenic locus
in a
transgenic corn plant genome. In certain embodiments of an edited transgenic
plant genome, the
modification comprises a modification of an A5547-127, DA544406-6, DA568416-4,
DA581419-2, GTS 40-3-2, M0N87701, M0N87708, M0N89788, MST-FG072-3, and/or
SYHT0H2 original transgenic locus in a transgenic soybean plant genome. In
certain
embodiments of an edited transgenic plant genome, the modification comprises a
modification of
a DAS-21023-5, DAS-24236-5, COT102, LLcotton25, M0N15985, M0N88701, and/or
M0N88913 original transgenic locus in a transgenic cotton plant genome. In
certain
embodiments of an edited transgenic plant genome, the modification comprises a
modification of
- 27 -
CA 03188282 2022-12-23
WO 2022/026379 PCT/US2021/043170
an GT73, HCN28, M0N88302, and/or MS8 original transgenic locus in a transgenic
canola plant
genome.
[0090] Methods and reagents (e.g., nucleic acid markers including nucleic
acid probes
and/or primers) for detecting plants, edited plant genomes, and biological
samples containing
DNA molecules comprising the transgenic loci excision sites and/or non-
essential DNA deletions
are also provided herein. Detection of the DNA molecules can be achieved by
any combination
of nucleic acid amplification (e.g., PCR amplification), hybridization,
sequencing, and/or mass-
spectrometry based techniques. Methods set forth for detecting junction
nucleic acids in
unmodified transgenic loci set forth in US 20190136331 and US 9,738,904, both
incorporated
herein by reference in their entireties, can be adapted for use in detection
of the nucleic acids
provided herein. In certain embodiments, such detection is achieved by
amplification and/or
hybridization-based detection methods using a method (e.g., selective
amplification primers)
and/or probe (e.g., capable of selective hybridization or generation of a
specific primer extension
product) which specifically recognizes the target DNA molecule (e.g.,
transgenic locus excision
site) but does not recognize DNA from an unmodified transgenic locus. In
certain embodiments,
the hybridization probes can comprise detectable labels (e.g., fluorescent,
radioactive, epitope,
and chemiluminescent labels). In certain embodiments, a single nucleotide
polymorphism
detection assay can be adapted for detection of the target DNA molecule (e.g.,
transgenic locus
excision site).
[0091] Excision of transgenic plant loci and production of transgenic
loci excision sites
can be obtained by using suitable gene editing molecules which can introduce
blunt or staggered
double stranded DNA breaks in 5' and 3' junction polynucleotides of transgenic
loci. Such blunt
or staggered dsDNA breaks can be introduced in non-transgenic plant genomic
DNA of the
junction polynucleotide, in the inserted transgenic DNA of the junction
polynucleotide, or can
span the junction comprising both non-transgenic plant genomic DNA and
inserted transgenic
DNA of the junction polynucleotide. In certain embodiments, the gene editing
molecules can
comprise zinc finger nucleases, zinc finger nickases, TALENs, and/or TALE
nickases which
introduce double stranded breaks in junction polynucleotides. In certain
embodiments, the gene
editing molecules comprise RdDe and guide RNAs directed to DNA targets in the
junction
polynucleotides comprising pre-existing PAM sites which are operably linked to
the DNA
junction polynucleotides of the transgenic locus in the transgenic plant
genome. Such PAM sites
can be recognized by RdDe and suitable guide RNAs directed to DNA sequences
adjacent to the
- 28 -
CA 03188282 2022-12-23
WO 2022/026379 PCT/US2021/043170
PAM to provide for cleavage within or near the two junction polynucleotides.
In certain
embodiments, the PAMs are recognized by the same class and/or type of RdDe
(e.g., Class 2 type
II or Class 2 type V) or by the same RdDe (e.g., both PAMs recognized by the
same Cas9 or Cas
12 RdDe). Guide RNAs can be directed to the junction polynucleotides by using
a pre-existing
PAM site located within or adjacent to a junction polynucleotide of the
transgenic locus. Non-
limiting examples of such pre-existing PAM sites present in junction
polynucleotides which can
be used by suitable guide RNAs to direct RdDe or RNA dependent nickases in a
5' or 3' junction
polynucleotide are set forth in Table 5 of the Examples.
[0092] In certain embodiments, edited transgenic plant genomes provided
herein can lack
one or more selectable and/or scoreable markers found in an original event
(transgenic locus).
Original transgenic loci (events), including those set forth in Tables 1-4
(e.g., SEQ ID NO: 1-34),
the patent references set forth therein and incorporated herein by reference
in their entireties, and
depicted in the drawings, can contain selectable transgenes markers conferring
herbicide
tolerance, antibiotic resistance, or an ability to grow on a carbon source.
Selectable marker
transgenes which can confer herbicide tolerance include genes encoding a
phosphinothricin
acetyl transferase (PAT), a glyphosate tolerant 5-enol-pyruvylshikimate-3-
phosphate
synthase (EPSPS), an a glyphosate oxidase (GOX). Selectable marker transgenes
which can
confer antibiotic resistance include genes encoding a neomycin
phosphotransferase (npt), a
hygromycin phosphotransferase, an aminoglycoside adenyl transferase.
Transgenes encoding a
phosphomannose isomerase (pmi) can confer the ability to grow on mannose.
Original
transgenic loci (events), including those set forth in Tables 1-4, can contain
scoreable transgenic
markers which can be detected by enzymatic, histochemical, or other assays.
Scoreable markers
can include genes encoding beta-glucuronidase (uid) or fluorescent proteins
(e.g., a GFP, RFP, or
YFP). Such selectable or scoreable marker transgenes can be excised from an
original transgenic
locus by contacting the transgenic locus with one or more gene editing
molecules which
introduce double stranded breaks in the transgenic locus at the 5' and 3' end
of the expression
cassette comprising the selectable marker transgene (e.g., an RdDe and guide
RNAs directed to
PAM sites located at the 5' and 3' end of the expression cassette comprising
the selectable
marker transgenes) and selecting for plant cells, plant parts, or plants
wherein the selectable or
scoreable marker has been excised. In certain embodiments, the selectable or
scoreable marker
transgene can be inactivated. Inactivation can be achieved by modifications
including insertion,
deletion, and/or substitution of one or more nucleotides in a promoter
element, 5' or 3'
- 29 -
CA 03188282 2022-12-23
WO 2022/026379 PCT/US2021/043170
untranslated region (UTRs), intron, coding region, and/or 3' terminator and/or
polyadenylation
signal of the selectable marker transgene. Such modifications can inactivate
the selectable or
scoreable marker transgene by eliminating or reducing promoter activity,
introducing a missense
mutation, and/or introducing a pre-mature stop codon. In certain embodiments,
the selectable
and/or scoreable marker transgene can be replaced by an introduced transgene.
In certain
embodiments, an original transgenic locus that was contacted with gene editing
molecules which
introduce double stranded breaks in the transgenic locus at the 5' and 3' end
of the expression
cassette comprising the selectable marker and/or scoreable transgene can also
be contacted with a
suitable donor DNA template comprising an expression cassette flanked by DNA
homologous to
remaining DNA in the transgenic locus located 5' and 3' to the selectable
marker excision site.
In certain embodiments, a coding region of the selectable and/or scoreable
marker transgene can
be replaced with another coding region such that the replacement coding region
is operably
linked to the promoter and 3' terminator or polyadenylation signal of the
selectable and/or
scoreable marker transgene.
[0093] In certain embodiments, edited transgenic plant genomes provided
herein can
comprise additional new introduced transgenes (e.g., expression cassettes)
inserted into the
transgenic locus of a given event. Introduced transgenes inserted at the
transgenic locus of an
event subsequent to the event's original isolation can be obtained by inducing
a double stranded
break at a site within an original transgenic locus (e.g., with genome editing
molecules including
an RdDe and suitable guide RNA(s); a suitable engineered zinc-finger nuclease;
a TALEN
protein and the like) and providing an exogenous transgene in a donor DNA
template which can
be integrated at the site of the double stranded break (e.g. by homology-
directed repair (HDR) or
by non-homologous end-joining (NHEJ). In certain embodiments, introduced
transgenes can be
integrated in a 5' junction polynucleotide or a 3' junction polynucleotide
using a suitable RdDe,
guide RNA, and either a pre-existing PAM site. In other embodiments, pre-
existing PAM sites
located in both the a 5' junction polynucleotide or a 3' junction
polynucleotide can be used to
delete the transgenic locus and replace it with one or more new expression
cassettes. In certain
embodiments, such deletions and replacements are effected by introducing dsDNA
breaks in both
junction polynucleotides and providing the new expression cassettes on a donor
DNA template or
other DNA template suitable for integration by NHEJ or MMEJ (microhomology
mediated end
joining). Suitable expression cassettes for insertion include DNA molecules
comprising
promoters which are operably linked to DNA encoding proteins and/or RNA
molecules which
- 30 -
CA 03188282 2022-12-23
WO 2022/026379 PCT/US2021/043170
confer useful traits which are in turn operably linked to polyadenylation
signal or terminator
elements. In certain embodiments, such expression cassettes can also comprise
5' UTRs, 3'
UTRs, and/or introns. Useful traits include biotic stress tolerance (e.g.,
insect resistance,
nematode resistance, or disease resistance), abiotic stress tolerance (e.g.,
heat, cold, drought,
and/or salt tolerance), herbicide tolerance, and quality traits (e.g.,
improved fatty acid
compositions, protein content, starch content, and the like). Suitable
expression cassettes for
insertion include expression cassettes contained in any of the events
(transgenic loci) listed in
Tables 1-4 (e.g., SEQ ID NO: 1-34), the patent references set forth therein
which are
incorporated in their entirety, or set forth in the drawings which confer
insect resistance,
herbicide tolerance, biofuel use, male sterility, or other useful traits.
[0094] In certain embodiments, plants provided herein, including plants
with one or more
transgenic loci and/or comprising transgenic loci excision sites can further
comprise one or more
targeted genetic changes introduced by one or more of gene editing molecules
or systems. Also
provided are methods where the targeted genetic changes and one or more
transgenic loci
excision sites are removed from plants either in series or in parallel (e.g.,
as set forth in the non-
limiting illustration in Figure 11, bottom "Alternative" panel, where "GE" can
represent targeted
genetic changes induced by gene editing molecules and "Event Removal"
represents excision of
one or more transgenic loci with gene editing molecules). Such targeted
genetic changes include
those conferring traits such as improved yield, improved food and/or feed
characteristics (e.g.,
improved oil, starch, protein, or amino acid quality or quantity), improved
nitrogen use
efficiency, improved biofuel use characteristics (e.g., improved ethanol
production), male
sterility/conditional male sterility systems (e.g., by targeting endogenous
M526, M545 and
MSCA1 genes), herbicide tolerance (e.g., by targeting endogenous ALS, EPSPS,
HPPD, or other
herbicide target genes), delayed flowering, non-flowering, increased biotic
stress resistance (e.g.,
resistance to insect, nematode, bacterial, or fungal damage), increased
abiotic stress resistance
(e.g., resistance to drought, cold, heat, metal, or salt ), enhanced lodging
resistance, enhanced
growth rate, enhanced biomass, enhanced tillering, enhanced branching, delayed
flowering time,
delayed senescence, increased flower number, improved architecture for high
density planting,
improved photosynthesis, increased root mass, increased cell number, improved
seedling vigor,
improved seedling size, increased rate of cell division, improved metabolic
efficiency, and
increased meristem size in comparison to a control plant lacking the targeted
genetic change.
Types of targeted genetic changes that can be introduced include insertions,
deletions, and
-31-
CA 03188282 2022-12-23
WO 2022/026379 PCT/US2021/043170
substitutions of one or more nucleotides in the crop plant genome. Sites in
endogenous plant
genes for the targeted genetic changes include promoter, coding, and non-
coding regions (e.g., 5'
UTRs, introns, splice donor and acceptor sites and 3' UTRs). In certain
embodiments, the
targeted genetic change comprises an insertion of a regulatory or other DNA
sequence in an
endogenous plant gene. Non-limiting examples of regulatory sequences which can
be inserted
into endogenous plant genes with gene editing molecules to effect targeted
genetic changes
which confer useful phenotypes include those set forth in US Patent
Application Publication
20190352655, which is incorporated herein by example, such as: (a) auxin
response element
(AuxRE) sequence; (b) at least one D1-4 sequence (Ulmasov et al. (1997) Plant
Cell, 9:1963-
1971), (c) at least one DRS sequence (Ulmasov et al. (1997) Plant Cell, 9:1963-
1971); (d) at least
one m5-DRS sequence (Ulmasov et al. (1997) Plant Cell, 9:1963-1971); (e) at
least one P3
sequence; (f) a small RNA recognition site sequence bound by a corresponding
small RNA (e.g.,
an siRNA, a microRNA (miRNA), a trans-acting siRNA as described in U.S. Patent
No.
8,030,473, or a phased sRNA as described in U.S. Patent No. 8,404,928; both of
these cited
patents are incorporated by reference herein); (g) a microRNA (miRNA)
recognition site
sequence; (h) the sequence recognizable by a specific binding agent includes a
microRNA
(miRNA) recognition sequence for an engineered miRNA wherein the specific
binding agent is
the corresponding engineered mature miRNA; (i) a transposon recognition
sequence; (j) a
sequence recognized by an ethylene-responsive element binding-factor-
associated amphiphilic
repression (EAR) motif; (k) a splice site sequence (e. g., a donor site, a
branching site, or an
acceptor site; see, for example, the splice sites and splicing signals set
forth in the internet site
lemur[dot]amu[dot]edu[dot]pl/share/ERISdb/home.html); (1) a recombinase
recognition site
sequence that is recognized by a site-specific recombinase; (m) a sequence
encoding an RNA or
amino acid aptamer or an RNA riboswitch, the specific binding agent is the
corresponding
ligand, and the change in expression is upregulation or downregulation; (n) a
hormone responsive
element recognized by a nuclear receptor or a hormone-binding domain thereof;
(o) a
transcription factor binding sequence; and (p) a polycomb response element
(see Xiao et al.
(2017) Nature Genetics, 49:1546-1552, doi: 10.1038/ng.3937). Non limiting
examples of target
maize genes that can be subjected to targeted gene edits to confer useful
traits include: (a)
ZmIPK1 (herbicide tolerant and phytate reduced maize; Shukla et al., Nature.
2009;459:437-41);
(b) ZmGL2 (reduced epicuticular wax in leaves; Char et al. Plant Biotechnol J.
2015;13:1002);
(c) ZmMTL (induction of haploid plants; Kelliher et al. Nature. 2017;542:105);
(d) Wxl (high
- 32 -
CA 03188282 2022-12-23
WO 2022/026379 PCT/US2021/043170
amylopectin content; US 20190032070; incorporated herin by reference in its
entirety); (e) TMS5
(thermosensitive male sterile; Li et al. J Genet Genomics. 2017;44:465-8); (f)
ALS (herbicide
tolerance; Svitashev et al.; Plant Physiol. 2015;169:931-45); and (g) ARGOS8
(drought stress
tolerance; Shi et al., Plant Biotechnol J. 2017;15:207-16). Non-limiting
examples of target
soybean genes that can be subjected to targeted gene edits to confer useful
traits include: (a)
FAD2-1A, FAD2-1B (increased oleic acid content; Haun et al.; Plant Biotechnol
J. 2014;12:934-
40); (b) FAD2-1A, FAD2-1B, FAD3A (increased oleic acid and decreased linolenic
content;
Demorest et al., BMC Plant Biol. 2016;16:225); and (c) ALS (herbicide
tolerance; Svitashev et
al.; Plant Physiol. 2015;169:931-45). A non-limiting examples of target
Brass/ca genes that can
be subjected to targeted gene edits to confer useful traits include: (a) the
FRIGIDA gene to confer
early flowering (Sun Z, et al.. J Integr Plant Biol. 2013;55:1092-103); and
(b) ALS (herbicide
tolerance; US 20160138040, incorporated herein by reference in its entirety).
Non-limiting
examples of target genes in crop plants including corn and soybean which can
be subjected to
targeted genetic changes which confer useful phenotypes include those set
forth in US Patent
Application Nos. 20190352655,20200199609,20200157554, and 20200231982, which
are each
incorporated herein in their entireties; and Zhang et al. (Genome Biol. 2018;
19: 210).
[0095] Gene editing molecules of use in methods provided herein include
molecules
capable of introducing a double-strand break ("DSB") or single-strand break
("SSB") in double-
stranded DNA, such as in genomic DNA or in a target gene located within the
genomic DNA as
well as accompanying guide RNA or donor DNA template polynucleotides. Examples
of such
gene editing molecules include: (a) a nuclease comprising an RNA-guided
nuclease, an RNA-
guided DNA endonuclease or RNA directed DNA endonuclease (RdDe), a class 1
CRISPR type
nuclease system, a type II Cas nuclease, a Cas9, a nCas9 nickase, a type V Cas
nuclease, a
Cas12a nuclease, a nCas12a nickase, a Cas12d (CasY), a Cas12e (CasX), a Cas12b
(C2c1), a
Cas12c (C2c3), a Cas12i, a Cas12j, a Cas14, an engineered nuclease, a codon-
optimized
nuclease, a zinc-finger nuclease (ZFN) or nickase, a transcription activator-
like effector nuclease
(TAL-effector nuclease or TALEN) or nickase (TALE-nickase), an Argonaute, and
a
meganuclease or engineered meganuclease; (b) a polynucleotide encoding one or
more nucleases
capable of effectuating site-specific alteration (including introduction of a
DSB or SSB) of a
target nucleotide sequence; (c) a guide RNA (gRNA) for an RNA-guided nuclease,
or a DNA
encoding a gRNA for an RNA-guided nuclease; (d) donor DNA template
polynucleotides; and
(e) other DNA templates (dsDNA, ssDNA, or combinations thereof) suitable for
insertion at a
- 33 -
CA 03188282 2022-12-23
WO 2022/026379 PCT/US2021/043170
break in genomic DNA (e.g., by non-homologous end joining (NHEJ) or
microhomology-
mediated end joining (MMEJ).
[0096] CRISPR-type genome editing can be adapted for use in the plant
cells and
methods provided herein in several ways. CRISPR elements, e.g., gene editing
molecules
comprising CRISPR endonucleases and CRISPR guide RNAs including single guide
RNAs or
guide RNAs in combination with tracrRNAs or scoutRNA, or polynucleotides
encoding the
same, are useful in effectuating genome editing without remnants of the CRISPR
elements or
selective genetic markers occurring in progeny. In certain embodiments, the
CRISPR elements
are provided directly to the eukaryotic cell (e.g., plant cells), systems,
methods, and compositions
as isolated molecules, as isolated or semi-purified products of a cell free
synthetic process (e.g.,
in vitro translation), or as isolated or semi-purified products of in a cell-
based synthetic process
(e.g., such as in a bacterial or other cell lysate). In certain embodiments,
genome-inserted
CRISPR elements are useful in plant lines adapted for use in the methods
provide herein. In
certain embodiments, plants or plant cells used in the systems, methods, and
compositions
provided herein can comprise a transgene that expresses a CRISPR endonuclease
(e.g., a Cas9, a
Cpfl-type or other CRISPR endonuclease). In certain embodiments, one or more
CRISPR
endonucleases with unique PAM recognition sites can be used. Guide RNAs
(sgRNAs or
crRNAs and a tracrRNA) to form an RNA-guided endonuclease/guide RNA complex
which can
specifically bind sequences in the gDNA target site that are adjacent to a
protospacer adjacent
motif (PAM) sequence. The type of RNA-guided endonuclease typically informs
the location of
suitable PAM sites and design of crRNAs or sgRNAs. G-rich PAM sites, e.g., 5'-
NGG are
typically targeted for design of crRNAs or sgRNAs used with Cas9 proteins.
Examples of PAM
sequences include 5'-NGG (Streptococcus pyogenes), 5'-NNAGAA (Streptococcus
thermophilus
CRISPR1), 5' -NGGNG (Streptococcus thermophilus CRISPR3), 5' -NNGRRT or 5' -
NNGRR
(Staphylococcus aureus Cas9, SaCas9), and 5'-NNNGATT (Neisseria meningitidis).
T-rich
PAM sites (e.g., 5'-TTN or 5'-TTTV, where "V" is A, C, or G) are typically
targeted for design
of crRNAs or sgRNAs used with Cas12a proteins. In some instances, Cas12a can
also recognize
a 5'-CTA PAM motif Other examples of potential Cas12a PAM sequences include
TTN, CTN,
TCN, CCN, TTTN, TCTN, TTCN, CTTN, ATTN, TCCN, TTGN, GTTN, CCCN, CCTN,
TTAN, TCGN, CTCN, ACTN, GCTN, TCAN, GCCN, and CCGN (wherein N is defined as
any
nucleotide). Cpfl endonuclease and corresponding guide RNAs and PAM sites are
disclosed in
US Patent Application Publication 2016/0208243 Al, which is incorporated
herein by reference
- 34 -
CA 03188282 2022-12-23
WO 2022/026379 PCT/US2021/043170
for its disclosure of DNA encoding Cpfl endonucleases and guide RNAs and PAM
sites.
Introduction of one or more of a wide variety of CRISPR guide RNAs that
interact with CRISPR
endonucleases integrated into a plant genome or otherwise provided to a plant
is useful for
genetic editing for providing desired phenotypes or traits, for trait
screening, or for gene editing
mediated trait introgression (e.g., for introducing a trait into a new
genotype without
backcrossing to a recurrent parent or with limited backcrossing to a recurrent
parent). Multiple
endonucleases can be provided in expression cassettes with the appropriate
promoters to allow
multiple genome site editing.
[0097]
CRISPR technology for editing the genes of eukaryotes is disclosed in US
Patent
Application Publications 2016/0138008A1 and US2015/0344912A1, and in US
Patents
8,697,359, 8,771,945, 8,945,839, 8,999,641, 8,993,233, 8,895,308, 8,865,406,
8,889,418,
8,871,445, 8,889,356, 8,932,814, 8,795,965, and 8,906,616. Cpfl endonuclease
and
corresponding guide RNAs and PAM sites are disclosed in US Patent Application
Publication
2016/0208243 Al. Other CRISPR nucleases useful for editing genomes include
Cas12b and
Cas12c (see Shmakov et al. (2015) Mol. Cell, 60:385 ¨ 397; Harrington et al.
(2020) Molecular
Cell doi:10.1016/j.molce1.2020.06.022) and CasX and CasY (see Burstein et al.
(2016) Nature,
doi:10.1038/nature21059; Harrington et al. (2020) Molecular
Cell
doi :10.1016/j . molce1.2020.06. 022), or Cas12j (Pausch
et al, (2020) Science
10.1126/science.abb1400). Plant RNA promoters for expressing CRISPR guide RNA
and plant
codon-optimized CRISPR Cas9 endonuclease are disclosed in International Patent
Application
PCT/U52015/018104 (published as WO 2015/131101 and claiming priority to US
Provisional
Patent Application 61/945,700). Methods of using CRISPR technology for genome
editing in
plants are disclosed in US Patent Application Publications US 2015/0082478A1
and US
2015/0059010A1 and in International Patent Application PCT/U52015/038767 Al
(published as
WO 2016/007347 and claiming priority to US Provisional Patent Application
62/023,246). All
of the patent publications referenced in this paragraph are incorporated
herein by reference in
their entirety. In certain embodiments, an RNA-guided endonuclease that leaves
a blunt end
following cleavage of the target site is used. Blunt-end cutting RNA-guided
endonucleases
include Cas9, Cas12c, and Cas 12h (Yan et al., 2019). In certain embodiments,
an RNA-guided
endonuclease that leaves a staggered single stranded DNA overhanging end
following cleavage
of the target site following cleavage of the target site is used. Staggered-
end cutting RNA-guided
endonucleases include Cas12a, Cas12b, and Cas12e.
- 35 -
CA 03188282 2022-12-23
WO 2022/026379 PCT/US2021/043170
[0098] The methods can also use sequence-specific endonucleases or
sequence-specific
endonucleases and guide RNAs that cleave a single DNA strand in a dsDNA target
site. Such
cleavage of a single DNA strand in a dsDNA target site is also referred to
herein and elsewhere
as "nicking" and can be effected by various "nickases" or systems that provide
for nicking.
Nickases that can be used include nCas9 (Cas9 comprising a DlOA amino acid
substitution),
nCas12a (e.g., Cas12a comprising an R1226A amino acid substitution; Yamano et
al., 2016),
Cas12i (Yan et al. 2019), a zinc finger nickase e.g., as disclosed in Kim et
al., 2012), a TALE
nickase (e.g., as disclosed in Wu et al., 2014), or a combination thereof. In
certain embodiments,
systems that provide for nicking can comprise a Cas nuclease (e.g., Cas9
and/or Cas12a) and
guide RNA molecules that have at least one base mismatch to DNA sequences in
the target
editing site (Fu et al., 2019). In certain embodiments, genome modifications
can be introduced
into the target editing site by creating single stranded breaks (i.e.,
"nicks") in genomic locations
separated by no more than about 10, 20, 30, 40, 50, 60, 80, 100, 150, or 200
base pairs of DNA.
In certain illustrative and non-limiting embodiments, two nickases (i.e., a
CAS nuclease which
introduces a single stranded DNA break including nCas9, nCas12a, Cas12i, zinc
finger nickases,
TALE nickases, combinations thereof, and the like) or nickase systems can
directed to make cuts
to nearby sites separated by no more than about 10, 20, 30, 40, 50, 60, 80 or
100 base pairs of
DNA. In instances where an RNA guided nickase and an RNA guide are used, the
RNA guides
are adjacent to PAM sequences that are sufficiently close (i.e., separated by
no more than about
10, 20, 30, 40, 50, 60, 80, 100, 150, or 200 base pairs of DNA). For the
purposes of gene editing,
CRISPR arrays can be designed to contain one or multiple guide RNA sequences
corresponding
to a desired target DNA sequence; see, for example, Cong et at. (2013)
Science, 339:819-823;
Ran et at. (2013) Nature Protocols, 8:2281 - 2308. At least 16 or 17
nucleotides of gRNA
sequence are required by Cas9 for DNA cleavage to occur; for Cpfl at least 16
nucleotides of
gRNA sequence are needed to achieve detectable DNA cleavage and at least 18
nucleotides of
gRNA sequence were reported necessary for efficient DNA cleavage in vitro; see
Zetsche et at.
(2015) Cell, 163:759 - 771. In practice, guide RNA sequences are generally
designed to have a
length of 17 - 24 nucleotides (frequently 19, 20, or 21 nucleotides) and exact
complementarity
(i.e., perfect base-pairing) to the targeted gene or nucleic acid sequence;
guide RNAs having less
than 100% complementarity to the target sequence can be used (e.g., a gRNA
with a length of 20
nucleotides and 1 - 4 mismatches to the target sequence) but can increase the
potential for off-
target effects. The design of effective guide RNAs for use in plant genome
editing is disclosed in
- 36 -
CA 03188282 2022-12-23
WO 2022/026379 PCT/US2021/043170
US Patent Application Publication 2015/0082478 Al, the entire specification of
which is
incorporated herein by reference. More recently, efficient gene editing has
been achieved using a
chimeric "single guide RNA" ("sgRNA"), an engineered (synthetic) single RNA
molecule that
mimics a naturally occurring crRNA-tracrRNA complex and contains both a
tracrRNA (for
binding the nuclease) and at least one crRNA (to guide the nuclease to the
sequence targeted for
editing); see, for example, Cong et at. (2013) Science, 339:819 ¨ 823; Xing et
at. (2014) BMC
Plant Biol., 14:327 ¨ 340. Chemically modified sgRNAs have been demonstrated
to be effective
in genome editing; see, for example, Hendel et at. (2015) Nature Biotechnol.,
985 ¨ 991. The
design of effective gRNAs for use in plant genome editing is disclosed in US
Patent Application
Publication 2015/0082478 Al, the entire specification of which is incorporated
herein by
reference.
[0099] Genomic DNA may also be modified via base editing. Both adenine
base editors
(ABE) which convert A/T base pairs to G/C base pairs in genomic DNA as well as
cytosine base
pair editors (CBE) which effect C to T substitutions can be used in certain
embodiments of the
methods provided herein. In certain embodiments, useful ABE and CBE can
comprise genome
site specific DNA binding elements (e.g., RNA-dependent DNA binding proteins
including
catalytically inactive Cas9 and Cas12 proteins or Cas9 and Cas12 nickases)
operably linked to
adenine or cytidine deaminases and used with guide RNAs which position the
protein near the
nucleotide targeted for substitution. Suitable ABE and CBE disclosed in the
literature (Kim, Nat
Plants, 2018 Mar;4(3):148-151) can be adapted for use in the methods set forth
herein. In certain
embodiments, a CBE can comprise a fusion between a catalytically inactive Cas9
(dCas9) RNA
dependent DNA binding protein fused to a cytidine deaminase which converts
cytosine (C) to
uridine (U) and selected guide RNAs, thereby effecting a C to T substitution;
see Komor et at.
(2016)Nature, 533:420 ¨ 424. In other embodiments, C to T substitutions are
effected with Cas9
nickase [Cas9n(D10A)] fused to an improved cytidine deaminase and optionally a
bacteriophage
Mu dsDNA (double-stranded DNA) end-binding protein Gam; see Komor et at., Sci
Adv. 2017
Aug; 3(8):eaa04774. In other embodiments, adenine base editors (ABEs)
comprising an adenine
deaminase fused to catalytically inactive Cas9 (dCas9) or a Cas9 DlOA nickase
can be used to
convert A/T base pairs to G/C base pairs in genomic DNA (Gaudelli et al.,
(2017) Nature
551(7681):464-471.
[00100] In certain embodiments, zinc finger nucleases or zinc finger
nickases can also be
used in the methods provided herein. Zinc-finger nucleases are site-specific
endonucleases
- 37 -
CA 03188282 2022-12-23
WO 2022/026379 PCT/US2021/043170
comprising two protein domains: a DNA-binding domain, comprising a plurality
of individual
zinc finger repeats that each recognize between 9 and 18 base pairs, and a DNA-
cleavage domain
that comprises a nuclease domain (typically Fokl). The cleavage domain
dimerizes in order to
cleave DNA; therefore, a pair of ZFNs are required to target non-palindromic
target
polynucleotides. In certain embodiments, zinc finger nuclease and zinc finger
nickase design
methods which have been described (Urnov et at. (2010) Nature Rev. Genet.,
11:636 ¨ 646;
Mohanta et al. (2017) Genes vol. 8,12: 399; Ramirez et al. Nucleic Acids Res.
(2012); 40(12):
5560-5568; Liu et al. (2013) Nature Communications, 4: 2565) can be adapted
for use in the
methods set forth herein. The zinc finger binding domains of the zinc finger
nuclease or nickase
provide specificity and can be engineered to specifically recognize any
desired target DNA
sequence. The zinc finger DNA binding domains are derived from the DNA-binding
domain of a
large class of eukaryotic transcription factors called zinc finger proteins
(ZFPs). The DNA-
binding domain of ZFPs typically contains a tandem array of at least three
zinc "fingers" each
recognizing a specific triplet of DNA. A number of strategies can be used to
design the binding
specificity of the zinc finger binding domain. One approach, termed "modular
assembly", relies
on the functional autonomy of individual zinc fingers with DNA. In this
approach, a given
sequence is targeted by identifying zinc fingers for each component triplet in
the sequence and
linking them into a multifinger peptide. Several alternative strategies for
designing zinc finger
DNA binding domains have also been developed. These methods are designed to
accommodate
the ability of zinc fingers to contact neighboring fingers as well as
nucleotide bases outside their
target triplet. Typically, the engineered zinc finger DNA binding domain has a
novel binding
specificity, compared to a naturally-occurring zinc finger protein.
Engineering methods include,
for example, rational design and various types of selection. Rational design
includes, for
example, the use of databases of triplet (or quadruplet) nucleotide sequences
and individual zinc
finger amino acid sequences, in which each triplet or quadruplet nucleotide
sequence is
associated with one or more amino acid sequences of zinc fingers which bind
the particular
triplet or quadruplet sequence. See, e.g., US Patents 6,453,242 and 6,534,261,
both incorporated
herein by reference in their entirety. Exemplary selection methods (e.g.,
phage display and yeast
two-hybrid systems) can be adapted for use in the methods described herein. In
addition,
enhancement of binding specificity for zinc finger binding domains has been
described in US
Patent 6,794,136, incorporated herein by reference in its entirety. In
addition, individual zinc
finger domains may be linked together using any suitable linker sequences.
Examples of linker
- 38 -
CA 03188282 2022-12-23
WO 2022/026379 PCT/US2021/043170
sequences are publicly known, e.g., see US Patents 6,479,626; 6,903,185; and
7,153,949,
incorporated herein by reference in their entirety. The nucleic acid cleavage
domain is non-
specific and is typically a restriction endonuclease, such as Fokl. This
endonuclease must
dimerize to cleave DNA. Thus, cleavage by Fokl as part of a ZFN requires two
adjacent and
independent binding events, which must occur in both the correct orientation
and with
appropriate spacing to permit dimer formation. The requirement for two DNA
binding events
enables more specific targeting of long and potentially unique recognition
sites. Fokl variants
with enhanced activities have been described and can be adapted for use in the
methods
described herein; see, e.g., Guo et al. (2010)1 Mol. Biol., 400:96 - 107.
[00101] Transcription activator like effectors (TALEs) are proteins
secreted by certain
Xanthomonas species to modulate gene expression in host plants and to
facilitate the colonization
by and survival of the bacterium. TALEs act as transcription factors and
modulate expression of
resistance genes in the plants. Recent studies of TALEs have revealed the code
linking the
repetitive region of TALEs with their target DNA-binding sites. TALEs comprise
a highly
conserved and repetitive region consisting of tandem repeats of mostly 33 or
34 amino acid
segments. The repeat monomers differ from each other mainly at amino acid
positions 12 and 13.
A strong correlation between unique pairs of amino acids at positions 12 and
13 and the
corresponding nucleotide in the TALE-binding site has been found. The simple
relationship
between amino acid sequence and DNA recognition of the TALE binding domain
allows for the
design of DNA binding domains of any desired specificity. TALEs can be linked
to a non-
specific DNA cleavage domain to prepare genome editing proteins, referred to
as TAL-effector
nucleases or TALENs. As in the case of ZFNs, a restriction endonuclease, such
as Fokl, can be
conveniently used. Methods for use of TALENs in plants have been described and
can be
adapted for use in the methods described herein, see Mahfouz et al. (2011)
Proc. Natl. Acad. Sci.
USA, 108:2623 ¨ 2628; Mahfouz (2011) GM Crops, 2:99 ¨ 103; and Mohanta et al.
(2017)
Genes vol. 8,12: 399). TALE nickases have also been described and can be
adapted for use in
methods described herein (Wu et al.; Biochem Biophys Res Commun.
(2014);446(1):261-6; Luo
et al; Scientific Reports 6, Article number: 20657 (2016)).
[00102] Embodiments of the donor DNA template molecule having a sequence
that is
integrated at the site of at least one double-strand break (DSB) in a genome
include double-
stranded DNA, a single-stranded DNA, a single-stranded DNA/RNA hybrid, and a
double-
stranded DNA/RNA hybrid. In embodiments, a donor DNA template molecule that is
a double-
- 39 -
CA 03188282 2022-12-23
WO 2022/026379 PCT/US2021/043170
stranded (e. g., a dsDNA or dsDNA/RNA hybrid) molecule is provided directly to
the plant
protoplast or plant cell in the form of a double-stranded DNA or a double-
stranded DNA/RNA
hybrid, or as two single-stranded DNA (ssDNA) molecules that are capable of
hybridizing to
form dsDNA, or as a single-stranded DNA molecule and a single-stranded RNA
(ssRNA)
molecule that are capable of hybridizing to form a double-stranded DNA/RNA
hybrid; that is to
say, the double-stranded polynucleotide molecule is not provided indirectly,
for example, by
expression in the cell of a dsDNA encoded by a plasmid or other vector. In
various non-limiting
embodiments of the method, the donor DNA template molecule that is integrated
(or that has a
sequence that is integrated) at the site of at least one double-strand break
(DSB) in a genome is
double-stranded and blunt-ended; in other embodiments the donor DNA template
molecule is
double-stranded and has an overhang or "sticky end" consisting of unpaired
nucleotides (e. g., 1,
2, 3, 4, 5, or 6 unpaired nucleotides) at one terminus or both termini. In an
embodiment, the DSB
in the genome has no unpaired nucleotides at the cleavage site, and the donor
DNA template
molecule that is integrated (or that has a sequence that is integrated) at the
site of the DSB is a
blunt-ended double-stranded DNA or blunt-ended double-stranded DNA/RNA hybrid
molecule,
or alternatively is a single-stranded DNA or a single-stranded DNA/RNA hybrid
molecule. In
another embodiment, the DSB in the genome has one or more unpaired nucleotides
at one or both
sides of the cleavage site, and the donor DNA template molecule that is
integrated (or that has a
sequence that is integrated) at the site of the DSB is a double-stranded DNA
or double-stranded
DNA/RNA hybrid molecule with an overhang or "sticky end" consisting of
unpaired nucleotides
at one or both termini, or alternatively is a single-stranded DNA or a single-
stranded DNA/RNA
hybrid molecule; in embodiments, the donor DNA template molecule DSB is a
double-stranded
DNA or double-stranded DNA/RNA hybrid molecule that includes an overhang at
one or at both
termini, wherein the overhang consists of the same number of unpaired
nucleotides as the
number of unpaired nucleotides created at the site of a DSB by a nuclease that
cuts in an off-set
fashion (e.g., where a Cas12 nuclease effects an off-set DSB with 5-nucleotide
overhangs in the
genomic sequence, the donor DNA template molecule that is to be integrated (or
that has a
sequence that is to be integrated) at the site of the DSB is double-stranded
and has 5 unpaired
nucleotides at one or both termini). In certain embodiments, one or both
termini of the donor
DNA template molecule contain no regions of sequence homology (identity or
complementarity)
to genomic regions flanking the DSB; that is to say, one or both termini of
the donor DNA
template molecule contain no regions of sequence that is sufficiently
complementary to permit
- 40 -
CA 03188282 2022-12-23
WO 2022/026379 PCT/US2021/043170
hybridization to genomic regions immediately adjacent to the location of the
DSB. In
embodiments, the donor DNA template molecule contains no homology to the locus
of the DSB,
that is to say, the donor DNA template molecule contains no nucleotide
sequence that is
sufficiently complementary to permit hybridization to genomic regions
immediately adjacent to
the location of the DSB. In embodiments, the donor DNA template molecule is at
least partially
double-stranded and includes 2-20 base-pairs, e. g., 2, 3, 4, 5, 6, 7, 8, 9,
10, 11, 12, 13, 14, 15, 16,
17, 18, 19, or 20 base-pairs; in embodiments, the donor DNA template molecule
is double-
stranded and blunt-ended and consists of 2-20 base-pairs, e. g., 2, 3, 4, 5,
6, 7, 8, 9, 10, 11, 12,
13, 14, 15, 16, 17, 18, 19, or 20 base-pairs; in other embodiments, the donor
DNA template
molecule is double-stranded and includes 2-20 base-pairs, e. g., 2, 3, 4, 5,
6, 7, 8, 9, 10, 11, 12,
13, 14, 15, 16, 17, 18, 19, or 20 base-pairs and in addition has at least one
overhang or "sticky
end" consisting of at least one additional, unpaired nucleotide at one or at
both termini. In an
embodiment, the donor DNA template molecule that is integrated (or that has a
sequence that is
integrated) at the site of at least one double-strand break (DSB) in a genome
is a blunt-ended
double-stranded DNA or a blunt-ended double-stranded DNA/RNA hybrid molecule
of about 18
to about 300 base-pairs, or about 20 to about 200 base-pairs, or about 30 to
about 100 base-pairs,
and having at least one phosphorothioate bond between adjacent nucleotides at
a 5' end, 3' end, or
both 5' and 3' ends. In embodiments, the donor DNA template molecule includes
single strands of
at least 11, at least 18, at least 20, at least 30, at least 40, at least 60,
at least 80, at least 100, at
least 120, at least 140, at least 160, at least 180, at least 200, at least
240, at about 280, or at least
320 nucleotides. In embodiments, the donor DNA template molecule has a length
of at least 2, at
least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least
9, at least 10, or at least 11
base-pairs if double-stranded (or nucleotides if single-stranded), or between
about 2 to about 320
base-pairs if double-stranded (or nucleotides if single-stranded), or between
about 2 to about 500
base-pairs if double-stranded (or nucleotides if single-stranded), or between
about 5 to about 500
base-pairs if double-stranded (or nucleotides if single-stranded), or between
about 5 to about 300
base-pairs if double-stranded (or nucleotides if single-stranded), or between
about 11 to about
300 base-pairs if double-stranded (or nucleotides if single-stranded), or
about 18 to about 300
base-pairs if double-stranded (or nucleotides if single-stranded), or between
about 30 to about
100 base-pairs if double-stranded (or nucleotides if single-stranded). In
embodiments, the donor
DNA template molecule includes chemically modified nucleotides (see, e.g., the
various
modifications of internucleotide linkages, bases, and sugars described in
Verma and Eckstein
-41 -
CA 03188282 2022-12-23
WO 2022/026379 PCT/US2021/043170
(1998) Annu. Rev. Biochem., 67:99-134); in embodiments, the naturally
occurring
phosphodiester backbone of the donor DNA template molecule is partially or
completely
modified with phosphorothioate, phosphorodithioate, or methylphosphonate
internucleotide
linkage modifications, or the donor DNA template molecule includes modified
nucleoside bases
or modified sugars, or the donor DNA template molecule is labelled with a
fluorescent moiety
(e.g., fluorescein or rhodamine or a fluorescent nucleoside analogue) or other
detectable label
(e.g., biotin or an isotope). In another embodiment, the donor DNA template
molecule contains
secondary structure that provides stability or acts as an aptamer. Other
related embodiments
include double-stranded DNA/RNA hybrid molecules, single-stranded DNA/RNA
hybrid donor
molecules, and single-stranded DNA donor molecules (including single-stranded,
chemically
modified DNA donor molecules), which in analogous procedures are integrated
(or have a
sequence that is integrated) at the site of a double-strand break.
[00103] Donor DNA template molecules used in the methods provided herein
include
DNA molecules comprising, from 5' to 3', a first homology arm, a replacement
DNA, and a
second homology arm, wherein the homology arms containing sequences that are
partially or
completely homologous to genomic DNA (gDNA) sequences flanking a target site-
specific
endonuclease cleavage site in the gDNA. In certain embodiments, the
replacement DNA can
comprise an insertion, deletion, or substitution of 1 or more DNA base pairs
relative to the target
gDNA. In an embodiment, the donor DNA template molecule is double-stranded and
perfectly
base-paired through all or most of its length, with the possible exception of
any unpaired
nucleotides at either terminus or both termini. In another embodiment, the
donor DNA template
molecule is double-stranded and includes one or more non-terminal mismatches
or non-terminal
unpaired nucleotides within the otherwise double-stranded duplex. In an
embodiment, the donor
DNA template molecule that is integrated at the site of at least one double-
strand break (DSB)
includes between 2-20 nucleotides in one (if single-stranded) or in both
strands (if double-
stranded), e.g., 2, 3, 4, 5, 6, 7, 8,9, 10, 11, 12, 13, 14, 15, 16, 17, 18,
19, or 20 nucleotides on one
or on both strands, each of which can be base-paired to a nucleotide on the
opposite strand (in the
case of a perfectly base-paired double-stranded polynucleotide molecule). Such
donor DNA
templates can be integrated in genomic DNA containing blunt and/or staggered
double stranded
DNA breaks by homology-directed repair (HDR). In certain embodiments, a donor
DNA
template homology arm can be about 20, 50, 100, 200, 400, or 600 to about 800,
or 1000 base
pairs in length. In certain embodiments, a donor DNA template molecule can be
delivered to a
- 42 -
CA 03188282 2022-12-23
WO 2022/026379 PCT/US2021/043170
plant cell) in a circular (e.g., a plasmid or a viral vector including a
geminivirus vector) or a
linear DNA molecule. In certain embodiments, a circular or linear DNA molecule
that is used
can comprise a modified donor DNA template molecule comprising, from 5' to 3',
a first copy of
the target sequence-specific endonuclease cleavage site sequence, the first
homology arm, the
replacement DNA, the second homology arm, and a second copy of the target
sequence-specific
endonuclease cleavage site sequence. Without seeking to be limited by theory,
such modified
donor DNA template molecules can be cleaved by the same sequence-specific
endonuclease that
is used to cleave the target site gDNA of the eukaryotic cell to release a
donor DNA template
molecule that can participate in HDR-mediated genome modification of the
target editing site in
the plant cell genome. In certain embodiments, the donor DNA template can
comprise a linear
DNA molecule comprising, from 5' to 3', a cleaved target sequence-specific
endonuclease
cleavage site sequence, the first homology arm, the replacement DNA, the
second homology
arm, and a cleaved target sequence-specific endonuclease cleavage site
sequence. In certain
embodiments, the cleaved target sequence-specific endonuclease sequence can
comprise a blunt
DNA end or a blunt DNA end that can optionally comprise a 5' phosphate group.
In certain
embodiments, the cleaved target sequence-specific endonuclease sequence
comprises a DNA end
having a single-stranded 5' or 3' DNA overhang. Such cleaved target sequence-
specific
endonuclease cleavage site sequences can be produced by either cleaving an
intact target
sequence-specific endonuclease cleavage site sequence or by synthesizing a
copy of the cleaved
target sequence-specific endonuclease cleavage site sequence. Donor DNA
templates can be
synthesized either chemically or enzymatically (e.g., in a polymerase chain
reaction (PCR)).
[00104] Various treatments are useful in delivery of gene editing
molecules and/or other
molecules to a plant cell. In certain embodiments, one or more treatments is
employed to deliver
the gene editing or other molecules (e.g., comprising a polynucleotide,
polypeptide or
combination thereof) into a eukaryotic or plant cell, e.g., through barriers
such as a cell wall, a
plasma membrane, a nuclear envelope, and/or other lipid bilayer. In certain
embodiments, a
polynucleotide-, polypeptide-, or RNP-containing composition comprising the
molecules are
delivered directly, for example by direct contact of the composition with a
plant cell.
Aforementioned compositions can be provided in the form of a liquid, a
solution, a suspension,
an emulsion, a reverse emulsion, a colloid, a dispersion, a gel, liposomes,
micelles, an injectable
material, an aerosol, a solid, a powder, a particulate, a nanoparticle, or a
combination thereof can
be applied directly to a plant, plant part, plant cell, or plant explant
(e.g., through abrasion or
- 43 -
CA 03188282 2022-12-23
WO 2022/026379 PCT/US2021/043170
puncture or otherwise disruption of the cell wall or cell membrane, by
spraying or dipping or
soaking or otherwise directly contacting, by microinjection). For example, a
plant cell or plant
protoplast is soaked in a liquid genome editing molecule-containing
composition, whereby the
agent is delivered to the plant cell. In certain embodiments, the agent-
containing composition is
delivered using negative or positive pressure, for example, using vacuum
infiltration or
application of hydrodynamic or fluid pressure. In certain embodiments, the
agent-containing
composition is introduced into a plant cell or plant protoplast, e.g., by
microinjection or by
disruption or deformation of the cell wall or cell membrane, for example by
physical treatments
such as by application of negative or positive pressure, shear forces, or
treatment with a chemical
or physical delivery agent such as surfactants, liposomes, or nanoparticles;
see, e.g., delivery of
materials to cells employing microfluidic flow through a cell-deforming
constriction as described
in US Published Patent Application 2014/0287509, incorporated by reference in
its entirety
herein. Other techniques useful for delivering the agent-containing
composition to a eukaryotic
cell, plant cell or plant protoplast include: ultrasound or sonication;
vibration, friction, shear
stress, vortexing, cavitation; centrifugation or application of mechanical
force; mechanical cell
wall or cell membrane deformation or breakage; enzymatic cell wall or cell
membrane breakage
or permeabilization; abrasion or mechanical scarification (e.g., abrasion with
carborundum or
other particulate abrasive or scarification with a file or sandpaper) or
chemical scarification (e.g.,
treatment with an acid or caustic agent); and electroporation. In certain
embodiments, the agent-
containing composition is provided by bacterially mediated (e.g.,
Agrobacterium sp., Rhizobium
sp., Sinorhizobium sp., Mesorhizobium sp., Bradyrhizobium sp., Azobacter sp.,
Phyllobacterium
sp.) transfection of the plant cell or plant protoplast with a polynucleotide
encoding the genome
editing molecules (e.g., RNA dependent DNA endonuclease, RNA dependent DNA
binding
protein, RNA dependent nickase, ABE, or CBE, and/or guide RNA); see, e.g.,
Broothaerts et at.
(2005) Nature, 433:629 ¨ 633). Any of these techniques or a combination
thereof are
alternatively employed on the plant explant, plant part or tissue or intact
plant (or seed) from
which a plant cell is optionally subsequently obtained or isolated; in certain
embodiments, the
agent-containing composition is delivered in a separate step after the plant
cell has been isolated.
[00105] In some embodiments, one or more polynucleotides or vectors
driving expression
of one or more genome editing molecules or trait-conferring genes (e.g.;
herbicide tolerance,
insect resistance, and/or male sterility) are introduced into a plant cell. In
certain embodiments, a
polynucleotide vector comprises a regulatory element such as a promoter
operably linked to one
- 44 -
CA 03188282 2022-12-23
WO 2022/026379 PCT/US2021/043170
or more polynucleotides encoding genome editing molecules and/or trait-
conferring genes. In
such embodiments, expression of these polynucleotides can be controlled by
selection of the
appropriate promoter, particularly promoters functional in a eukaryotic cell
(e.g., plant cell);
useful promoters include constitutive, conditional, inducible, and temporally
or spatially specific
promoters (e.g., a tissue specific promoter, a developmentally regulated
promoter, or a cell cycle
regulated promoter). Developmentally regulated promoters that can be used in
plant cells include
Phospholipid Transfer Protein (PLTP), fructose-1,6-bisphosphatase protein,
NAD(P)-binding
Rossmann-Fold protein, adipocyte plasma membrane-associated protein-like
protein, Rieske
[2Fe-2S] iron-sulfur domain protein, chlororespiratory reduction 6 protein, D-
glycerate 3-kinase,
chloroplastic-like protein, chlorophyll a-b binding protein 7, chloroplastic-
like protein,
ultraviolet-B-repressible protein, Soul heme-binding family protein,
Photosystem I reaction
center subunit psi-N protein, and short-chain dehydrogenase/reductase protein
that are disclosed
in US Patent Application Publication No. 20170121722, which is incorporated
herein by
reference in its entirety and specifically with respect to such disclosure. In
certain embodiments,
the promoter is operably linked to nucleotide sequences encoding multiple
guide RNAs, wherein
the sequences encoding guide RNAs are separated by a cleavage site such as a
nucleotide
sequence encoding a microRNA recognition/cleavage site or a self-cleaving
ribozyme (see, e.g.,
Ferre-D'Amare and Scott (2014) Cold Spring Harbor Perspectives Biol.,
2:a003574). In certain
embodiments, the promoter is an RNA polymerase III promoter operably linked to
a nucleotide
sequence encoding one or more guide RNAs. In certain embodiments, the RNA
polymerase III
promoter is a plant U6 spliceosomal RNA promoter, which can be native to the
genome of the
plant cell or from a different species, e.g., a U6 promoter from maize,
tomato, or soybean such as
those disclosed US Patent Application Publication 2017/0166912, or a homologue
thereof; in an
example, such a promoter is operably linked to DNA sequence encoding a first
RNA molecule
including a Cas12a gRNA followed by an operably linked and suitable 3' element
such as a U6
poly-T terminator. In another embodiment, the RNA polymerase III promoter is a
plant U3, 75L
(signal recognition particle RNA), U2, or U5 promoter, or chimerics thereof,
e.g., as described in
US Patent Application Publication 20170166912. In certain embodiments, the
promoter
operably linked to one or more polynucleotides is a constitutive promoter that
drives gene
expression in eukaryotic cells (e.g., plant cells). In certain embodiments,
the promoter drives
gene expression in the nucleus or in an organelle such as a chloroplast or
mitochondrion.
Examples of constitutive promoters for use in plants include a CaMV 35S
promoter as disclosed
- 45 -
CA 03188282 2022-12-23
WO 2022/026379 PCT/US2021/043170
in US Patents 5,858,742 and 5,322,938, a rice actin promoter as disclosed in
US Patent
5,641,876, a maize chloroplast aldolase promoter as disclosed in US Patent
7,151,204, and the
nopaline synthase (NOS) and octopine synthase (OCS) promoters from
Agrobacterium
tumefaciens.
In certain embodiments, the promoter operably linked to one or more
polynucleotides encoding elements of a genome-editing system is a promoter
from figwort
mosaic virus (FMV), a RUBISCO promoter, or a pyruvate phosphate dikinase
(PPDK) promoter,
which is active in photosynthetic tissues. Other contemplated promoters
include cell-specific or
tissue-specific or developmentally regulated promoters, for example, a
promoter that limits the
expression of the nucleic acid targeting system to germline or reproductive
cells (e.g., promoters
of genes encoding DNA ligases, recombinases, replicases, or other genes
specifically expressed
in germline or reproductive cells). In certain embodiments, the genome
alteration is limited only
to those cells from which DNA is inherited in subsequent generations, which is
advantageous
where it is desirable that expression of the genome-editing system be limited
in order to avoid
genotoxicity or other unwanted effects. All of the patent publications
referenced in this
paragraph are incorporated herein by reference in their entirety.
[00106]
Expression vectors or polynucleotides provided herein may contain a DNA
segment near the 3' end of an expression cassette that acts as a signal to
terminate transcription
and directs polyadenylation of the resultant mRNA, and may also support
promoter activity.
Such a 3' element is commonly referred to as a "3'-untranslated region" or "3'-
UTR" or
"terminator" or a "polyadenylation signal." In some cases, plant gene-based 3'
elements (or
terminators) consist of both the 3'-UTR and downstream non-transcribed
sequence (Nuccio et al.,
2015). Useful 3' elements include: Agrobacterium tumefaciens nos 3', tml 3',
tmr 3', tms 3', ocs
3', and tr7 3' elements disclosed in US Patent No. 6,090,627, incorporated
herein by reference,
and 3' elements from plant genes such as the heat shock protein 17, ubiquitin,
and fructose-1,6-
biphosphatase genes from wheat (Triticum aestivum), and the glutelin, lactate
dehydrogenase,
and beta-tubulin genes from rice (Oryza sativa), disclosed in US Patent
Application Publication
2002/0192813 Al. All of the patent publications referenced in this paragraph
are incorporated
herein by reference in their entireties..
[00107]
In certain embodiments, the plant cells can comprise haploid, diploid, or
polyploid
plant cells or plant protoplasts, for example, those obtained from a haploid,
diploid, or polyploid
plant, plant part or tissue, or callus. In certain embodiments, plant cells in
culture (or the
regenerated plant, progeny seed, and progeny plant) are haploid or can be
induced to become
- 46 -
CA 03188282 2022-12-23
WO 2022/026379 PCT/US2021/043170
haploid; techniques for making and using haploid plants and plant cells are
known in the art, see,
e.g., methods for generating haploids in Arabidopsis thaliana by crossing of a
wild-type strain to
a haploid-inducing strain that expresses altered forms of the centromere-
specific histone CENH3,
as described by Maruthachalam and Chan in "How to make haploid Arabidopsis
thaliana",
protocol available
at
www [dot] op enwetware [dot] org/images/d/d3/Hapl oi d Arab i dop si
s_protocol [dot] p df; (Ravi et at.
(2014) Nature Communications, 5:5334, doi: 10.1038/nc0mm56334). Haploids can
also be
obtained in a wide variety of monocot plants (e.g., maize, wheat, rice,
sorghum, barley) or dicot
plants (e.g., soybean, Brass/ca sp. including canola, cotton, tomato) by
crossing a plant
comprising a mutated CENH3 gene with a wildtype diploid plant to generate
haploid progeny as
disclosed in US Patent No. 9,215,849, which is incorporated herein by
reference in its entirety.
Haploid-inducing maize lines that can be used to obtain haploid maize plants
and/or cells include
Stock 6, MHI (Moldovian Haploid Inducer), indeterminate gametophyte (ig)
mutation, KEMS,
RWK, ZEM, ZMS, KMS, and well as transgenic haploid inducer lines disclosed in
US Patent
No. 9,677,082, which is incorporated herein by reference in its entirety.
Examples of haploid
cells include but are not limited to plant cells obtained from haploid plants
and plant cells
obtained from reproductive tissues, e.g., from flowers, developing flowers or
flower buds,
ovaries, ovules, megaspores, anthers, pollen, megagametophyte, and
microspores. In certain
embodiments where the plant cell or plant protoplast is haploid, the genetic
complement can be
doubled by chromosome doubling (e.g., by spontaneous chromosomal doubling by
meiotic non-
reduction, or by using a chromosome doubling agent such as colchicine,
oryzalin, trifluralin,
pronamide, nitrous oxide gas, anti-microtubule herbicides, anti-microtubule
agents, and mitotic
inhibitors) in the plant cell or plant protoplast to produce a doubled haploid
plant cell or plant
protoplast wherein the complement of genes or alleles is homozygous; yet other
embodiments
include regeneration of a doubled haploid plant from the doubled haploid plant
cell or plant
protoplast. Another embodiment is related to a hybrid plant having at least
one parent plant that
is a doubled haploid plant provided by this approach. Production of doubled
haploid plants
provides homozygosity in one generation, instead of requiring several
generations of self-
crossing to obtain homozygous plants. The use of doubled haploids is
advantageous in any
situation where there is a desire to establish genetic purity (i.e.
homozygosity) in the least
possible time. Doubled haploid production can be particularly advantageous in
slow-growing
plants or for producing hybrid plants that are offspring of at least one
doubled-haploid plant.
- 47 -
CA 03188282 2022-12-23
WO 2022/026379 PCT/US2021/043170
[00108] In certain embodiments, the plant cells used in the methods
provided herein can
include non-dividing cells. Such non-dividing cells can include plant cell
protoplasts, plant cells
subjected to one or more of a genetic and/or pharmaceutically-induced cell-
cycle blockage, and
the like.
[00109] In certain embodiments, the plant cells in used in the methods
provided herein can
include dividing cells. Dividing cells can include those cells found in
various plant tissues
including leaves, meristems, and embryos. These tissues include, but are not
limited to dividing
cells from young maize leaf, meristems and scutellar tissue from about 8 or 10
to about 12 or 14
days after pollination (DAP) embryos. The isolation of maize embryos has been
described in
several publications (Brettschneider, Becker, and Lorz 1997; Leduc et al.
1996; Frame et al.
2011; K. Wang and Frame 2009). In certain embodiments, basal leaf tissues
(e.g., leaf tissues
located about 0 to 3 cm from the ligule of a maize plant; Kirienko, Luo, and
Sylvester 2012) are
targeted for HDR-mediated gene editing. Methods for obtaining regenerable
plant structures and
regenerating plants from the HDR-mediated gene editing of plant cells provided
herein can be
adapted from methods disclosed in US Patent Application Publication No.
20170121722, which
is incorporated herein by reference in its entirety and specifically with
respect to such disclosure.
In certain embodiments, single plant cells subjected to the HDR-mediated gene
editing will give
rise to single regenerable plant structures. In certain embodiments, the
single regenerable plant
cell structure can form from a single cell on, or within, an explant that has
been subjected to the
HDR-mediated gene editing.
[00110] In some embodiments, methods provided herein can include the
additional step of
growing or regenerating a plant from a plant cell that had been subjected to
the improved HDR-
mediated gene editing or from a regenerable plant structure obtained from that
plant cell. In
certain embodiments, the plant can further comprise an inserted transgene, a
target gene edit, or
genome edit as provided by the methods and compositions disclosed herein. In
certain
embodiments, callus is produced from the plant cell, and plantlets and plants
produced from such
callus. In other embodiments, whole seedlings or plants are grown directly
from the plant cell
without a callus stage. Thus, additional related aspects are directed to whole
seedlings and plants
grown or regenerated from the plant cell or plant protoplast having a target
gene edit or genome
edit, as well as the seeds of such plants. In certain embodiments wherein the
plant cell or plant
protoplast is subjected to genetic modification (for example, genome editing
by means of, e.g., an
RdDe), the grown or regenerated plant exhibits a phenotype associated with the
genetic
- 48 -
CA 03188282 2022-12-23
WO 2022/026379 PCT/US2021/043170
modification. In certain embodiments, the grown or regenerated plant includes
in its genome two
or more genetic or epigenetic modifications that in combination provide at
least one phenotype of
interest. In certain embodiments, a heterogeneous population of plant cells
having a target gene
edit or genome edit, at least some of which include at least one genetic or
epigenetic
modification, is provided by the method; related aspects include a plant
having a phenotype of
interest associated with the genetic or epigenetic modification, provided by
either regeneration of
a plant having the phenotype of interest from a plant cell or plant protoplast
selected from the
heterogeneous population of plant cells having a target gene or genome edit,
or by selection of a
plant having the phenotype of interest from a heterogeneous population of
plants grown or
regenerated from the population of plant cells having a target gene edit or
genome edit.
Examples of phenotypes of interest include herbicide resistance, improved
tolerance of abiotic
stress (e.g., tolerance of temperature extremes, drought, or salt) or biotic
stress (e.g., resistance to
nematode, bacterial, or fungal pathogens), improved utilization of nutrients
or water, modified
lipid, carbohydrate, or protein composition, improved flavor or appearance,
improved storage
characteristics (e.g., resistance to bruising, browning, or softening),
increased yield, altered
morphology (e.g., floral architecture or color, plant height, branching, root
structure). In an
embodiment, a heterogeneous population of plant cells having a target gene
edit or genome edit
(or seedlings or plants grown or regenerated therefrom) is exposed to
conditions permitting
expression of the phenotype of interest; e.g., selection for herbicide
resistance can include
exposing the population of plant cells having a target gene edit or genome
edit (or seedlings or
plants grown or regenerated therefrom) to an amount of herbicide or other
substance that inhibits
growth or is toxic, allowing identification and selection of those resistant
plant cells (or seedlings
or plants) that survive treatment. Methods for obtaining regenerable plant
structures and
regenerating plants from plant cells or regenerable plant structures can be
adapted from published
procedures (Roest and Gilissen, Acta Bot. Neerl., 1989, 38(1), 1-23; Bhaskaran
and Smith, Crop
Sci. 30(6):1328-1337; Ikeuchi et al., Development, 2016, 143: 1442-1451).
Methods for
obtaining regenerable plant structures and regenerating plants from plant
cells or regenerable
plant structures can also be adapted from US Patent Application Publication
No. 20170121722,
which is incorporated herein by reference in its entirety and specifically
with respect to such
disclosure. Also provided are heterogeneous or homogeneous populations of such
plants or parts
thereof (e.g., seeds), succeeding generations or seeds of such plants grown or
regenerated from
the plant cells or plant protoplasts, having a target gene edit or genome
edit. Additional related
- 49 -
CA 03188282 2022-12-23
WO 2022/026379 PCT/US2021/043170
aspects include a hybrid plant provided by crossing a first plant grown or
regenerated from a
plant cell or plant protoplast having a target gene edit or genome edit and
having at least one
genetic or epigenetic modification, with a second plant, wherein the hybrid
plant contains the
genetic or epigenetic modification; also contemplated is seed produced by the
hybrid plant. Also
envisioned as related aspects are progeny seed and progeny plants, including
hybrid seed and
hybrid plants, having the regenerated plant as a parent or ancestor. The plant
cells and derivative
plants and seeds disclosed herein can be used for various purposes useful to
the consumer or
grower. In other embodiments, processed products are made from the plant or
its seeds,
including: (a) maize, soy, cotton, or canola seed meal (defatted or non-
defatted); (b) extracted
proteins, oils, sugars, and starches; (c) fermentation products; (d) animal
feed or human food
products (e.g., feed and food comprising maize, soy, cotton, or canola seed
meal (defatted or
non-defatted) and other ingredients (e.g., other cereal grains, other seed
meal, other protein meal,
other oil, other starch, other sugar, a binder, a preservative, a humectant, a
vitamin, and/or
mineral; (e) a pharmaceutical; (f) raw or processed biomass (e.g., cellulosic
and/or
lignocellulosic material); and (g) various industrial products.
Embodiments
[00111] Various embodiments of the plants, genomes, methods, biological
samples, and
other compositions described herein are set forth in the following sets of
numbered embodiments.
[00112] Embodiment List One
[00113] 1. A method of obtaining a transgenic plant cell containing an
edited transgenic
plant genome comprising: (a) contacting a transgenic plant genome comprising a
first transgenic
locus and a second transgenic locus with: (i) at least a first and at least a
second guide RNA
directed to genomic DNA adjacent to two PAM sites, wherein the PAM sites are
operably linked
to a 5' and a 3' DNA junction polynucleotide of the first transgenic locus;
and (ii) one or more
RNA dependent DNA endonucleases (RdDe) which recognize the PAM sites; wherein
the
unedited transgenic plant genome is in a transgenic plant cell; and (b)
selecting a transgenic plant
cell, transgenic plant part, or transgenic plant comprising the edited
transgenic plant genome,
wherein the first transgenic locus has been excised and the second transgenic
locus is present.
[00114] 2. A method for obtaining a transgenic plant cell containing an
edited transgenic
plant genome comprising:(a) contacting the transgenic plant genome of the
donor inbred parent
plant line with gene editing molecules which introduce a blunt or staggered
double stranded
- 50 -
CA 03188282 2022-12-23
WO 2022/026379 PCT/US2021/043170
DNA break in a 5' and a 3' DNA junction polynucleotide of the first transgenic
locus; and (b)
selecting a transgenic plant cell, transgenic plant part, or transgenic plant
comprising the edited
transgenic plant genome, wherein the first transgenic locus has been excised
and the second
transgenic locus is present.
[00115] 3. The method of embodiment 2, wherein the gene editing molecules
comprise
one or more TALEN, TALE-nickases, Zinc Finger Nucleases, or Zinc Finger
nickases which
cleave a 5' and a 3' DNA junction polynucleotide of the first transgenic
locus.
[00116] 4. The method of embodiment 1, wherein the transgenic plant genome
is contacted
in step (a) by introducing one or more compositions comprising or encoding the
RdDe(s) and
gRNAs into a transgenic plant cell comprising the transgenic plant genome.
[00117] 5. The method of any one of embodiments 1 to 4 , wherein the
transgenic plant
genome in step (a) further comprises a third transgenic plant locus.
[00118] 6. The method of any one of embodiments 1 to 4, wherein the
transgenic plant
genome in step (a) is further contacted in step (a) with a donor DNA template
molecule
comprising an introduced transgene and a transgenic plant cell comprising an
edited transgenic
plant genome comprising an insertion of the introduced transgene in genomic
DNA comprising
the excision site of the first transgenic locus is selected in step (b).
[00119] 7. The method of any one of embodiments 1 to 4 , wherein the
transgenic plant
genome in step (a) is further contacted in step (a) with: (i) a donor DNA
template molecule
comprising an introduced transgene; and (ii) one or more DNA editing molecules
which
introduce a double stranded DNA break in the second transgenic locus; and a
transgenic plant
cell comprising an edited transgenic plant genome comprising an insertion of
the introduced
transgene in the second transgenic locus is selected in step (b).
[00120] 8. The method of any one of embodiments 1 to 7further comprising
contacting the
transgenic plant genome in step (a) with one or more gene editing molecules
that provide for
excision or inactivation of a selectable marker transgene of the second
transgenic locus and
selecting for a transgenic plant cell, transgenic plant part, or transgenic
plant wherein the
selectable marker transgene has been excised or inactivated.
[00121] 9. The method of any one of embodiments 1 to 8, wherein the gene
editing
molecules include a donor DNA template containing an expression cassette or
coding region
which confers a useful trait and the transgenic plant cell, transgenic plant
part, or transgenic plant
-51 -
CA 03188282 2022-12-23
WO 2022/026379 PCT/US2021/043170
is selected for integration of the expression cassette at the site of the
selectable marker transgene
excision or inactivation.
[00122] 10. The method of any one of embodiments 1 to 9, further
comprising inducing at
least one targeted genetic change in the transgenic plant genome with one or
more genome
editing molecules.
[00123] 11. The method of any one of embodiments 1 to 10, further
comprising:(c)
contacting the edited transgenic plant genome in the selected transgenic plant
cell of step (b)
with: (i) a donor DNA template molecule comprising an introduced transgene;
and (ii) one or
more DNA editing molecules which introduce a double stranded DNA break in or
near genomic
DNA comprising the excision site of the first transgenic locus or in the
second transgenic locus;
and, (d) selecting a transgenic plant cell, transgenic plant part, or
transgenic plant comprising a
further edited transgenic plant genome comprising an insertion of the
introduced transgene in or
near the excision site of the first transgenic locus or in the second
transgenic locus.
[00124] 12. The method of any one of embodiments 1 to 11, wherein the
transgenic plant
cell is a transgenic maize plant cell and wherein the first, second, and/or
third transgenic locus
comprises Bt11, DAS-59122-7, DP-4114, GA21, M0N810, MON87411, M0N87427,
M0N88017, M0N89034, MIR162, MIR604, NK603, SYN-E3272-5, 5307, DAS-40278, DP-
32138, DP-33121, HCEM485, LY038, M0N863, M0N87403, M0N87403, M0N87419,
M0N87460, MZHGOJG, M2IR098, VC0-01981-5, 98140, TC1507 transgenic locus, or
modification thereof comprising a deletion of at least one selectable marker
gene and/or non-
essential DNA, in a transgenic maize plant genome.
[00125] 13. The method of any one of embodiments 1 to 11, wherein the
transgenic plant
cell is a transgenic soybean plant cell and wherein the first, second, and/or
third transgenic locus
comprises an A5547-127, DAS44406-6, DAS68416-4, DAS81419-2, GTS 40-3-2,
M0N87701,
M0N87708, M0N89788, MST-FG072-3, SYHT0H2 transgenic locus, or modification
thereof
comprising a deletion of at least one selectable marker gene and/or non-
essential DNA, in a
transgenic soybean plant genome.
[00126] 14. The method of any one of embodiments 1 to 11, wherein the
transgenic plant
cell is a transgenic cotton plant cell and wherein the first, second, and/or
third transgenic locus
comprises a DAS-21023-5, DAS-24236-5, C0T102, LLcotton25, M0N15985, M0N88701,
M0N88913 transgenic locusõ or modification thereof comprising a deletion of at
least one
selectable marker gene and/or non-essential DNA, in a transgenic cotton plant
genome.
- 52 -
CA 03188282 2022-12-23
WO 2022/026379 PCT/US2021/043170
[00127] 15. The method of any one of embodiments 1 to 11, wherein the
transgenic plant
cell is a transgenic canola plant cell and wherein the first, second, and/or
third transgenic locus
comprises a GT73, HCN28, M0N88302, MS8 transgenic locus, or modification
thereof
comprising a deletion of at least one selectable marker gene and/or non-
essential DNA, in a
transgenic canola plant genome.
[00128] 16. A method for obtaining inbred transgenic plant germplasm
containing
different transgenic traits comprising: (a) introgressing at least a first
transgenic locus and a
second transgenic locus into inbred germplasm to obtain a donor inbred parent
plant line
comprising the first and second transgenic loci; (b) contacting the transgenic
plant genome of the
donor inbred parent plant line with: (i) at least a first guide RNA directed
to genomic DNA
adjacent to two PAM sites, wherein the PAM sites are operably linked to a 5'
and a 3' DNA
junction polynucleotide of the first transgenic locus; and (ii) one or more
RNA dependent DNA
endonucleases (RdDe) which recognize the PAM sites; and (c) selecting a
transgenic plant cell,
transgenic plant part, or transgenic plant comprising an edited transgenic
plant genome in the
inbred germplasm, wherein the first transgenic locus has been excised and the
second transgenic
locus is present in the inbred germplasm.
[00129] 17. A method for obtaining inbred transgenic plant germplasm
containing
different transgenic traits comprising:(a) introgressing at least a first
transgenic locus and a
second transgenic locus into inbred germplasm to obtain a donor inbred parent
plant line
comprising the first and second transgenic loci; (b) contacting the transgenic
plant genome of the
donor inbred parent plant line with gene editing molecules which introduce a
blunt or staggered
double stranded DNA break in a 5' and a 3' DNA junction polynucleotide of the
first transgenic
locus; and (c) selecting a transgenic plant cell, transgenic plant part, or
transgenic plant
comprising an edited transgenic plant genome in the inbred germplasm, wherein
the first
transgenic locus has been excised and the second transgenic locus is present
in the inbred
germplasm.
[00130] 18. The method of embodiment 17, further comprising inducing at
least one
targeted genetic change in the transgenic plant genome with one or more genome
editing
molecules.
[00131] 19. The method of embodiment 17, wherein the gene editing
molecules comprise
one or more TALEN, TALE-nickases, Zinc Finger Nucleases, or Zinc Finger
nickases which
cleave a 5' and a 3' DNA junction polynucleotide of the first transgenic
locus.
- 53 -
CA 03188282 2022-12-23
WO 2022/026379 PCT/US2021/043170
[00132] 20. The method of embodiment 17, further comprising contacting the
transgenic
plant genome in step (b) with one or more gene editing molecules that provide
for excision or
inactivation of a selectable marker transgene of the second transgenic locus
and selecting for a
transgenic plant cell, transgenic plant part, or transgenic plant wherein the
selectable marker
transgene has been excised or inactivated.
[00133] 21. The method of embodiment 20, wherein the gene editing
molecules include a
donor DNA template containing an expression cassette or coding region which
confers a useful
trait and the transgenic plant cell, transgenic plant part, or transgenic
plant is selected for
integration of the expression cassette at the site of the selectable marker
transgene excision or
inactivation.
[00134] 22. The method of embodiment 17, wherein a third transgenic locus
is
introgressed or introduced into the inbred germplasm to obtain a donor inbred
parent plant line
comprising the first, second, and third transgenic loci.
[00135] 23. The method of embodiment 17, further comprising contacting the
transgenic
plant genome with a second guide RNA directed to genomic DNA adjacent to two
PAM sites,
wherein the PAM sites are operably linked to a 5' and a 3' DNA junction
polynucleotide of the
second or third transgenic locus; and (ii) one or more RNA dependent DNA
endonucleases
(RdDe) which recognize the PAM sites in step (b); and selecting a transgenic
plant cell,
transgenic plant part, or transgenic plant wherein the second or third
transgenic locus has been
excised in step (c).
[00136] 24. The method of embodiment 17, wherein the transgenic plant
genome is
contacted in step (b) by introducing one or more compositions comprising or
encoding the
RdDe(s) and gRNAs into a transgenic plant cell comprising the transgenic plant
genome.
[00137] 25. The method of embodiment 17, wherein the transgenic plant
genome of step
(b) further comprises a third transgenic plant locus.
[00138] 26. The method of embodiment 17, wherein the transgenic plant
genome is further
contacted in step (b) with a donor DNA template molecule comprising an
introduced transgene
and a transgenic plant cell comprising an edited transgenic plant genome
comprising an insertion
of the introduced transgene in genomic DNA comprising the excision site of the
first transgenic
locus is selected in step (c).
[00139] 27. The method of embodiment 17, wherein the transgenic plant
genome is further
contacted in step (b) with: (i) a donor DNA template molecule comprising an
introduced
- 54 -
CA 03188282 2022-12-23
WO 2022/026379 PCT/US2021/043170
transgene; and (ii) one or more DNA editing molecules which introduce a double
stranded DNA
break in the second transgenic locus; and a transgenic plant cell comprising
an edited transgenic
plant genome comprising an insertion of the introduced transgene in genomic
DNA comprising
the excision site of the second transgenic locus is selected in step (b).
[00140] 28. The method of embodiment 17, further comprising: (d)
contacting the edited
transgenic plant genome in the selected transgenic plant cell of step (c)
with: (i) a donor DNA
template molecule comprising an introduced transgene; and (ii) one or more DNA
editing
molecules which introduce a double stranded DNA break in or near the excision
site of the first
transgenic locus or in the second transgenic locus; and, (e) selecting a
transgenic plant cell,
transgenic plant part, or transgenic plant comprising a further edited
transgenic plant genome
comprising an insertion of the introduced transgene in or near the excision
site of the first
transgenic locus or in the second transgenic locus.
[00141] 29. The method of any one of embodiments 17 to 28, wherein the
transgenic plant
germplasm is transgenic maize plant germplasm and wherein the first, second,
and/or third
transgenic locus comprises a Bt11, DAS-59122-7, DP-4114, GA21, MON810,
M0N87411,
M0N87427, M0N88017, M0N89034, MIR162, MIR604, NK603, SYN-E3272-5, 5307, DAS-
40278, DP-32138, DP-33121, HCEM485, LY038, M0N863, M0N87403, M0N87403,
M0N87419, M0N87460, MZHGOJG, MZIR098, VC0-01981-5, 98140, TC1507 transgenic
locus, or modification thereof comprising a deletion of at least one
selectable marker gene and/or
non-essential DNA, in a transgenic maize plant genome.
[00142] 30. The method of any one of embodiments 17 to 28, wherein the
transgenic plant
germplasm is transgenic soybean plant germplasm and wherein the first, second,
and/or third
transgenic locus comprises an A5547-127, DAS44406-6, DAS68416-4, DAS81419-2,
GTS 40-3-
2, M0N87701, M0N87708, M0N89788, MST-FG072-3, SYHT0H2 transgenic locus, or
modification thereof comprising a deletion of at least one selectable marker
gene and/or non-
essential DNA, in a transgenic soybean plant genome.
[00143] 31. The method of any one of embodiments 17 to 28, wherein the
transgenic plant
germplasm is transgenic cotton plant germplasm and wherein the first, second,
and/or third
transgenic locus comprises a DAS-21023-5, DAS-24236-5, COT102, LLcotton25,
M0N15985,
M0N88701, M0N88913 transgenic locus, or modification thereof comprising a
deletion of at
least one selectable marker gene and/or non-essential DNA, in a transgenic
cotton plant genome.
- 55 -
CA 03188282 2022-12-23
WO 2022/026379 PCT/US2021/043170
[00144] 32. The method of any one of embodiments 17 to 28, wherein the
transgenic plant
germplasm is transgenic canola plant germplasm and wherein the first, second,
and/or third
transgenic locus comprises a GT73, HCN28, M0N88302, MS8 transgenic locus in a
transgenic
canola plant genome, or modification thereof comprising a deletion of at least
one selectable
marker gene and/or non-essential DNA.
[00145] 33. The method of embodiment 1, wherein the RdDe is a class II or
class V RdDe.
[00146] 34. The method of embodiment 17, wherein the introgression
comprises crossing
germplasm comprising the first and/or second transgenic plant locus with the
inbred germplasm,
selecting progeny comprising the first or second transgenic plant locus, and
crossing the selected
progeny with the inbred germplasm as a recurrent parent.
[00147] Embodiment List Two
[00148] 1. A method of producing an elite crop plant comprising a targeted
genetic change
and at least one approved transgenic locus comprising steps of: (i) inducing
at least one targeted
genetic change in the genome of the crop plant with one or more genome editing
molecules in an
elite crop plant comprising a first approved transgenic locus or modification
thereof comprising a
deletion of at least one selectable marker gene and/or non-essential DNA, and
a second approved
transgenic locus or modification thereof comprising a deletion of at least one
selectable marker
gene and/or non-essential DNA; (ii) excising a DNA segment comprising all or
most of the first
approved transgenic locus or modification thereof with genome editing
molecules by (a)
contacting genomic DNA of said plant with: (i) at least a first and at least a
second guide RNA
directed to genomic DNA adjacent to two PAM sites, wherein the PAM sites are
operably linked
to a 5' and a 3' DNA junction polynucleotide of the first approved transgenic
locus; and (ii) one
or more RNA dependent DNA endonucleases (RdDe) which recognize the PAM sites;
and (iii)
selecting an elite crop plant wherein the first approved transgenic locus or
modification thereof is
excised, the second approved transgenic locus or modification thereof is
present, and the targeted
genetic change is present.
[00149] 2. The method of embodiment 1, wherein steps (i) and (ii) are
performed
sequentially.
[00150] 3. The method of embodiment 1, wherein steps (i) and (ii) are
performed
simultaneously.
- 56 -
CA 03188282 2022-12-23
WO 2022/026379 PCT/US2021/043170
[00151] 4. The method of embodiment 1, wherein the targeted genetic change
confers a
desirable agronomic or quality trait.
[00152] 5. The method of embodiment 1, wherein all of the first approved
transgenic locus
and one or more nucleotides of endogenous chromosomal DNA of the plant genome
in the 5' and
a 3' DNA junction polynucleotide is excised.
[00153] 6. The method of embodiment 1, wherein all but at least one
nucleotide of the
heterologous DNA of the 5' and/or 3' DNA junction polynucleotide of the first
approved
transgenic locus is excised
[00154] 7. The method of embodiment 1, further comprising the step of
obtaining the elite
crop plant comprising a first approved transgenic loci and a second approved
transgenic loci of
step (i).
[00155] 8. The method of any one of embodiments 1 to 7, wherein the first
approved
transgenic locus comprises a Btll, DAS-59122-7, DP-4114, GA21, MON810,
M0N87411,
M0N87427, M0N88017, M0N89034, MIR162, MIR604, NK603, SYN-E3272-5, 5307, DAS-
40278, DP-32138, DP-33121, HCEM485, LY038, M0N863, M0N87403, M0N87403,
M0N87419, M0N87460, MZHGOJG, MZIR098, VC0-01981-5, 98140, TC1507 transgenic
locus, or modification thereof comprising a deletion of at least one
selectable marker gene and/or
non-essential DNA, in a transgenic maize plant genome.
[00156] 9. The method of any one of embodiments 1 to 7, wherein the second
approved
transgenic locus comprises a Btll, DAS-59122-7, DP-4114, GA21, MON810,
M0N87411,
M0N87427, M0N88017, M0N89034, MIR162, MIR604, NK603, SYN-E3272-5, 5307, DAS-
40278, DP-32138, DP-33121, HCEM485, LY038, M0N863, M0N87403, M0N87403,
M0N87419, M0N87460, MZHGOJG, MZIR098, VC0-01981-5, 98140, TC1507 transgenic
locus, or modification thereof comprising a deletion of at least one
selectable marker gene and/or
non-essential DNA, in a transgenic maize plant genome.
[00157] 10. The method of any one of embodiments 1 to 7, wherein the first
approved
transgenic locus comprises a A5547-127, DAS44406-6, DAS68416-4, DAS81419-2,
GTS 40-3-
2, M0N87701, M0N87708, M0N89788, MST-FG072-3, SYHT0H2 transgenic locus, or
modification thereof comprising a deletion of at least one selectable marker
gene and/or non-
essential DNA, in a transgenic soybean plant genome.
[00158] 11. The method of any one of embodiments 1 to 7, wherein the
second approved
transgenic locus comprises a A5547-127, DAS44406-6, DAS68416-4, DAS81419-2,
GTS 40-3-
- 57 -
CA 03188282 2022-12-23
WO 2022/026379 PCT/US2021/043170
2, M0N87701, M0N87708, M0N89788, MST-FG072-3, SYHT0H2 transgenic locus, or
modification thereof comprising a deletion of at least one selectable marker
gene and/or non-
essential DNA, in a transgenic soybean plant genome.
[00159] 12. The method of any one of embodiments 1 to 7, wherein the first
approved
transgenic locus comprises a DAS-21023-5, DAS-24236-5, COT102, LLcotton25,
M0N15985,
M0N88701, M0N88913 transgenic locus, or modification thereof comprising a
deletion of at
least one selectable marker gene and/or non-essential DNA, in a transgenic
cotton plant genome.
[00160] 13. The method of any one of embodiments 1 to 7, wherein the
second approved
transgenic locus comprises a DAS-21023-5, DAS-24236-5, COT102, LLcotton25,
M0N15985,
M0N88701, M0N88913 transgenic locus, or modification thereof comprising a
deletion of at
least one selectable marker gene and/or non-essential DNA, in a transgenic
cotton plant genome.
[00161] 14. The method of any one of embodiments 1 to 7, wherein the first
approved
transgenic locus comprises a GT73, HCN28, M0N88302, MS8 transgenic locus, or
modification
thereof comprising a deletion of at least one selectable marker gene and/or
non-essential DNA,
in a transgenic canola plant genome.
[00162] 15. The method of any one of embodiments 1 to 7, wherein the
second approved
transgenic locus comprises a GT73, HCN28, M0N88302, MS8 transgenic locus, or
modification
thereof comprising a deletion of at least one selectable marker gene and/or
non-essential DNA,
in a transgenic canola plant genome.
[00163] 16. An elite crop plant or part thereof comprising at least one
approved first
transgenic locus and a transgenic locus excision site wherein all of a second
approved transgenic
locus and one or more nucleotides of endogenous chromosomal DNA of the plant
genome in the
5' and a 3' DNA junction polynucleotide of the second approved transgenic
locus is excised.
[00164] 17. The elite crop plant or part thereof of embodiment 16, wherein
about 5 to
about 25 nucleotides of endogenous chromosomal DNA of the plant genome in the
5' and a 3'
DNA junction polynucleotide of the second approved transgenic locus is
excised.
[00165] 18. The elite crop plant or part thereof of embodiment 16, wherein
the crop plant
is a maize plant and wherein first approved transgenic locus comprises a Btll,
DAS-59122-7,
DP-4114, GA21, MON810, M0N87411, M0N87427, M0N88017, M0N89034, MIR162,
MIR604, NK603, SYN-E3272-5, 5307, DAS-40278, DP-32138, DP-33121, HCEM485,
LY038,
M0N863, M0N87403, M0N87403, M0N87419, M0N87460, MZHGOJG, MZIR098, VCO-
- 58 -
CA 03188282 2022-12-23
WO 2022/026379 PCT/US2021/043170
01981-5, 98140, TC1507 transgenic locus, or modification thereof comprising a
deletion of at
least one selectable marker gene and/or non-essential DNA, in a transgenic
maize plant genome.
[00166] 19. The elite crop plant or part thereof of embodiment 16, wherein
the second
approved transgenic locus comprising a DAS-59122-7, DP-4114, MON87411,
M0N89034,
MIR162, MIR604, NK603, SYN-E3272-5, 5307, DAS-40278, DP-32138, DP-33121,
HCEM485, LY038, M0N863, M0N87403, M0N87403, M0N87419, M0N87460, MZHGOJG,
MZIR098, VC0-01981-5, 98140, TC1507 transgenic locus, or modification thereof
comprising
a deletion of at least one selectable marker gene and/or non-essential DNA, is
excised.
[00167] 20. The elite crop plant or part thereof of embodiment 16, wherein
the plant
further comprises a third transgenic locus comprising a selectable marker gene
which confers a
selectable marker trait of a DAS-59122-7, DP-4114, MON87411, MIR162, MIR604,
NK603,
SYN-E3272-5, 5307, DAS-40278, DP-32138, DP-33121, HCEM485, LY038, M0N863,
M0N87403, M0N87403, MON87419, M0N87460, MZHGOJG, M2IR098, VC0-01981-5,
98140, TC1507 transgenic locus.
[00168] 21. The elite crop plant or part thereof of embodiment 16, wherein
the crop plant
is a soybean plant and wherein the first approved transgenic locus comprises a
A5547-127,
DAS44406-6, DAS68416-4, DAS81419-2, GTS 40-3-2, MON87701, M0N87708, M0N89788,
MST-FG072-3, SYHT0H2 transgenic locus, or modification thereof comprising a
deletion of at
least one selectable marker gene and/or non-essential DNA, in a transgenic
soybean plant
genome.
[00169] 22. The elite crop plant or part thereof of embodiment 16, wherein
the crop plant
is a soybean plant and wherein the second approved transgenic locus comprises
a A5547-127,
DAS44406-6, DAS68416-4, DAS81419-2, GTS 40-3-2, MON87701, M0N87708, M0N89788,
MST-FG072-3, SYHT0H2 transgenic locus, or modification thereof comprising a
deletion of at
least one selectable marker gene and/or non-essential DNA, in a transgenic
soybean plant
genome.
[00170] 23. The elite crop plant or part thereof of embodiment 16, wherein
the crop plant
is a cotton plant and wherein the first approved transgenic locus comprises a
DAS-21023-5,
DAS-24236-5, COT102, LLcotton25, M0N15985, M0N88701, M0N88913 transgenic
locus, or
modification thereof comprising a deletion of at least one selectable marker
gene and/or non-
essential DNA, in a transgenic cotton plant genome.
- 59 -
CA 03188282 2022-12-23
WO 2022/026379 PCT/US2021/043170
[00171]
24. The elite crop plant or part thereof of embodiment 16, wherein the crop
plant
is a cotton plant and wherein the second approved transgenic locus comprises a
DAS-21023-5,
DAS-24236-5, COT102, LLcotton25, M0N15985, M0N88701, M0N88913 transgenic
locus, or
modification thereof comprising a deletion of at least one selectable marker
gene and/or non-
essential DNA, in a transgenic cotton plant genome.
[00172]
25. The elite crop plant or part thereof of embodiment 16, wherein the crop
plant
is a canola plant and wherein the first approved transgenic locus comprises a
GT73, HCN28,
M0N88302, MS8 transgenic locus, or modification thereof comprising a deletion
of at least one
selectable marker gene and/or non-essential DNA, in a transgenic canola plant
genome.
[00173]
26. The elite crop plant or part thereof of embodiment 16, wherein the crop
plant
is a canola plant and wherein the second approved transgenic locus comprises a
GT73, HCN28,
M0N88302, MS8 transgenic locus, or modification thereof comprising a deletion
of at least one
selectable marker gene and/or non-essential DNA, in a transgenic canola plant
genome.
[00174]
27. The elite crop plant or part thereof of any one of embodiments 16 to 26,
wherein the plant further comprises a targeted genetic change.
[00175]
28. A method for obtaining the elite crop plant of any one of embodiments 16
to
27, comprising the steps of: (a) obtaining a crop plant comprising at least
the approved first
transgenic locus or modification thereof comprising a deletion of at least one
selectable marker
gene and/or non-essential DNA,
and a second transgenic locus; (b) introgressing the first
approved transgenic locus or modification thereof and the second approved
transgenic locus into
the germplasm of the elite crop plant; (c) excising a DNA segment comprising
the second
approved transgenic locus from the elite crop plant of step (b) with genome
editing molecules
and optionally inducing at least one targeted genetic change in the genome of
the crop plant of
step (b) with one or more genome editing molecules; and (d) selecting an elite
crop plant
comprising: (i) the approved first transgenic locus or modification thereof
and a transgenic locus
excision site wherein all of the second approved transgenic locus and one or
more nucleotides of
endogenous chromosomal DNA of the plant genome in the 5' and a 3' DNA junction
polynucleotide of the second approved transgenic locus is excised; and
optionally (ii) the targeted
genetic change.
[00176]
29. The method of embodiment 28, wherein the introgression comprises: (i)
crossing the crop plant of (a) to a plant comprising the elite crop germplasm
but lacking both the
first and the second transgenic locus; (ii) selecting a progeny plant
comprising the first and the
- 60 -
CA 03188282 2022-12-23
WO 2022/026379 PCT/US2021/043170
second transgenic locus; (iii) backcrossing the progeny plant to a recurrent
parent crop plant
comprising the elite crop germplasm but lacking the first and second
transgenic locus; and (iv)
selecting a progeny plant comprising the first and the second transgenic
locus.
[00177] 30. A method for obtaining a bulked population of inbred seed for
commercial
seed production comprising selfing the elite crop plant of any one of
embodiments 16 to 27 and
harvesting seed from the selfed elite crop plants.
[00178] 31. A method of obtaining hybrid crop seed comprising crossing a
first crop plant
comprising the elite crop plant of any one of embodiments 16 to 27, to a
second crop plant and
harvesting seed from the cross.
[00179] 32. The method of embodiment 31, wherein the first crop plant and
the second
crop plant are in distinct heterotic groups.
[00180] 33. The method of embodiment 31, wherein either the first or
second crop plant
are pollen recipients which have been rendered male sterile.
[00181] 34. The method of embodiment 33, wherein the crop plant is
rendered male sterile
by emasculation, cytoplasmic male sterility, a chemical hybridizing agent or
system, a transgene,
and/or a mutation in an endogenous plant gene.
[00182] 35. The method of any one of embodiments 31 to 34, further
comprising the step
of sowing the hybrid crop seed.
[00183] 36. DNA comprising a transgenic locus excision site wherein all of
an approved
transgenic locus and one or more nucleotides of endogenous chromosomal DNA of
the plant
genome in the 5' and a 3' DNA junction polynucleotide of the approved
transgenic locus is
excised.
[00184] 37. The DNA of embodiment 36, wherein the original approved
transgenic locus
is a Bt11, DAS-59122-7, DP-4114, GA21, MON810, M0N87411, M0N87427, M0N88017,
M0N89034, MIR162, MIR604, NK603, SYN-E3272-5, 5307, DAS-40278, DP-32138, DP-
33121, HCEM485, LY038, M0N863, M0N87403, M0N87403, M0N87419, M0N87460,
MZHGOJG, MZIR098, VC0-01981-5, 98140, TC1507 transgenic locus.
[00185] 38. The DNA of embodiment 36, wherein the original approved
transgenic locus
is an A5547-127, DAS44406-6, DAS68416-4, DAS81419-2, GTS 40-3-2, M0N87701,
M0N87708, M0N89788, MST-FG072-3, and/or SYHT0H2 transgenic locus.
- 61 -
CA 03188282 2022-12-23
WO 2022/026379 PCT/US2021/043170
[00186] 39. The DNA of embodiment 36, wherein the original approved
transgenic locus
is a DAS-21023-5, DAS-24236-5, COT102, LLcotton25, M0N15985, M0N88701, and/or
M0N88913 transgenic locus.
[00187] 40. The DNA of embodiment 36, wherein the original approved
transgenic locus
is a GT73, HCN28, M0N88302, or MS8 transgenic locus.
[00188] The DNA of any one of embodiments 36 to 40, wherein the DNA is
purified or
isolated.
[00189] 41. A nucleic acid marker adapted for detection of genomic DNA or
fragments
comprising a transgenic locus excision site wherein all of an approved
transgenic locus and one
or more nucleotides of endogenous chromosomal DNA of the plant genome in the
5' and a 3'
DNA junction polynucleotide of the approved transgenic locus is excised and
wherein the marker
does not detect an approved transgenic locus which has not been excised.
[00190] 42. The nucleic acid marker of embodiment 41, comprising a
polynucleotide of at
least 18 nucleotides in length which spans the selectable marker gene excision
site.
[00191] 43. The nucleic acid marker of embodiment 41, wherein the marker
further
comprises a detectable label.
[00192] 44. The nucleic acid marker of embodiment 41, wherein the approved
transgenic
locus is a Bt11, DAS-59122-7, DP-4114, GA21, MON810, M0N87411, M0N87427,
M0N88017, M0N89034, MIR162, MIR604, NK603, SYN-E3272-5, 5307, DAS-40278, DP-
32138, DP-33121, HCEM485, LY038, M0N863, M0N87403, M0N87403, M0N87419,
M0N87460, MZHGOJG, MZIR098, VC0-01981-5, 98140, and/or TC1507 transgenic
locus.
[00193] 45. The nucleic acid marker of embodiment 41, wherein the approved
transgenic
locus is an A5547-127, DAS44406-6, DAS68416-4, DAS81419-2, GTS 40-3-2,
M0N87701,
M0N87708, M0N89788, MST-FG072-3, and/or SYHT0H2 transgenic locus.
[00194] 46. The nucleic acid marker of embodiment 41, wherein the approved
transgenic
locus is a DAS-21023-5, DAS-24236-5, COT102, LLcotton25, M0N15985, M0N88701,
and/or
M0N88913 transgenic locus.
[00195] 47. The nucleic acid marker of embodiment 41, wherein the approved
transgenic
locus is a GT73, HCN28, M0N88302, or MS8 transgenic locus.
[00196] 48. A biological sample comprising plant genomic DNA or fragments
thereof,
said genomic DNA or fragments comprising a transgenic locus excision site
wherein all of an
approved transgenic locus and one or more nucleotides of endogenous
chromosomal DNA of the
- 62 -
CA 03188282 2022-12-23
WO 2022/026379 PCT/US2021/043170
plant genome in the 5' and a 3' DNA junction polynucleotide of the approved
transgenic locus is
excised.
[00197] 49. The biological sample of embodiment 48, wherein the approved
transgenic
locus is a Bt11, DAS-59122-7, DP-4114, GA21, MON810, M0N87411, M0N87427,
M0N88017, M0N89034, MIR162, MIR604, NK603, SYN-E3272-5, 5307, DAS-40278, DP-
32138, DP-33121, HCEM485, LY038, M0N863, M0N87403, M0N87403, M0N87419,
M0N87460, MZHGOJG, MZIR098, VC0-01981-5, 98140, and/or TC1507 transgenic
locus.
[00198] 50. The biological sample of embodiment 48, wherein the approved
transgenic
locus is an A5547-127, DAS44406-6, DAS68416-4, DAS81419-2, GTS 40-3-2,
M0N87701,
M0N87708, M0N89788, MST-FG072-3, and/or SYHT0H2 transgenic locus.
[00199] 51. The biological sample of embodiment 48, wherein the approved
transgenic
locus is a DAS-21023-5, DAS-24236-5, COT102, LLcotton25, M0N15985, M0N88701,
and/or
M0N88913 transgenic locus.
[00200] 52. The biological sample of embodiment 48, wherein the approved
transgenic
locus is a GT73, HCN28, M0N88302, or MS8 transgenic locus.
[00201] 53. A method of identifying the plant, DNA, or biological sample
of any one of
embodiments 36 to 52, comprising detecting a polynucleotide comprising a
transgenic locus
excision site wherein all of an approved transgenic locus and one or more
nucleotides of
endogenous chromosomal DNA of the plant genome in the 5' and a 3' DNA junction
polynucleotide of the approved transgenic locus is excised with a nucleic acid
detection assay.
[00202] 54. The method of embodiment 53, wherein the detection assay does
not detect
the approved transgenic locus which was excised.
[00203] 55. The method of embodiment 53, wherein the detection assay
comprises
contacting the biological sample with the nucleic acid marker of any one of
embodiments 41 to
47.
[00204] 56. An elite crop plant or part thereof comprising at least one
approved first
transgenic locus or modification thereof comprising a deletion of at least one
selectable marker
gene and/or non-essential DNA, and a transgenic locus excision site wherein
all but at least one
to 50 nucleotides of the heterologous DNA of the 5' and/or 3' DNA junction
polynucleotide of a
second approved transgenic locus is excised.
[00205] 57. The elite crop plant or part thereof of embodiment 56, wherein
the crop plant
is a maize plant and wherein the first approved transgenic locus comprises a
Btl 1, DAS-59122-7,
- 63 -
CA 03188282 2022-12-23
WO 2022/026379 PCT/US2021/043170
DP-4114, GA21, MON810, M0N87411, M0N87427, M0N88017, M0N89034, MIR162,
MIR604, NK603, SYN-E3272-5, 5307, DAS-40278, DP-32138, DP-33121, HCEM485,
LY038,
M0N863, M0N87403, M0N87403, M0N87419, M0N87460, MZHGOJG, MZIR098, VCO-
01981-5, 98140, TC1507 transgenic locus, or modification thereof comprising a
deletion of at
least one selectable marker gene and/or non-essential DNA, in a transgenic
maize plant genome.
[00206] 58. The elite crop plant or part thereof of embodiment 56, wherein
the crop plant
is a maize plant and wherein the second approved transgenic locus comprising a
DAS-59122-7,
DP-4114, MON87411, M0N89034, MIR162, MIR604, NK603, SYN-E3272-5, 5307, DAS-
40278, DP-32138, DP-33121, HCEM485, LY038, M0N863, M0N87403, M0N87403,
M0N87419, M0N87460, MZHGOJG, M2IR098, VC0-01981-5, 98140, TC1507, or
modification thereof comprising a deletion of at least one selectable marker
gene and/or non-
essential DNA, transgenic locus is excised.
[00207] 59. The elite maize plant or part thereof of embodiment 58,
wherein the crop plant
is a maize plant and wherein the plant further comprises a third transgenic
locus comprising a
selectable marker gene which confers a selectable marker trait of a DAS-59122-
7, DP-4114,
M0N87411, MIR162, MIR604, NK603, SYN-E3272-5, 5307, DAS-40278, DP-32138, DP-
33121, HCEM485, LY038, M0N863, M0N87403, M0N87403, M0N87419, M0N87460,
MZHGOJG, MZIR098, VC0-01981-5, 98140, or TC1507 transgenic locus.
[00208] 60. The elite crop plant or part thereof of embodiment 56, wherein
the crop plant
is a soybean plant and wherein the first approved transgenic locus comprises a
A5547-127,
DAS44406-6, DAS68416-4, DAS81419-2, GTS 40-3-2, MON87701, M0N87708, M0N89788,
MST-FG072-3, SYHT0H2 transgenic locus, or modification thereof comprising a
deletion of at
least one selectable marker gene and/or non-essential DNA, in a transgenic
soybean plant
genome.
[00209] 61. The elite crop plant or part thereof of embodiment 56, wherein
the crop plant
is a soybean plant and wherein the second approved transgenic locus comprises
a A5547-127,
DAS44406-6, DAS68416-4, DAS81419-2, GTS 40-3-2, MON87701, M0N87708, M0N89788,
MST-FG072-3, SYHT0H2 transgenic locus, or modification thereof comprising a
deletion of at
least one selectable marker gene and/or non-essential DNA, in a transgenic
soybean plant
genome.
[00210] 62. The elite crop plant or part thereof of embodiment 56, wherein
the crop plant
is a cotton plant and wherein the first approved transgenic locus comprises a
DAS-21023-5,
- 64 -
CA 03188282 2022-12-23
WO 2022/026379 PCT/US2021/043170
DAS-24236-5, COT102, LLcotton25, M0N15985, M0N88701, M0N88913 transgenic
locus, or
modification thereof comprising a deletion of at least one selectable marker
gene and/or non-
essential DNA, in a transgenic cotton plant genome.
[00211] 63. The elite crop plant or part thereof of embodiment 56, wherein
the crop plant
is a cotton plant and wherein the second approved transgenic locus comprises a
DAS-21023-5,
DAS-24236-5, COT102, LLcotton25, M0N15985, M0N88701, M0N88913 transgenic
locus, or
modification thereof comprising a deletion of at least one selectable marker
gene and/or non-
essential DNA, in a transgenic cotton plant genome.
[00212] 64. The elite crop plant or part thereof of embodiment 56, wherein
the crop plant
is a canola plant and wherein the first approved transgenic locus comprises a
GT73, HCN28,
M0N88302, MS8 transgenic locus, or modification thereof comprising a deletion
of at least one
selectable marker gene and/or non-essential DNA, in a transgenic canola plant
genome.
[00213] 65. The elite crop plant or part thereof of embodiment 56, wherein
the crop plant
is a canola plant and wherein the second approved transgenic locus comprises a
GT73, HCN28,
M0N88302, or MS8 transgenic locus in a transgenic canola plant genome
[00214] 66. The elite crop plant or part thereof of any one of embodiments
56 to 65,
wherein the plant further comprises a targeted genetic change.
[00215] 67. A method for obtaining the elite crop plant of any one of
embodiments 56 to
66, comprising the steps of: (a) obtaining a crop plant comprising at least
the approved first
transgenic locus or modification thereof and a second transgenic locus or
modification thereof;
(b) introgressing the first approved transgenic locus or modification thereof
and a second
approved transgenic locus or modification thereof into the germplasm of the
elite crop plant; (c)
excising a DNA segment comprising the second approved transgenic locus from
the elite crop
plant of step (b) with genome editing molecules and optionally inducing at
least one targeted
genetic change in the genome of the crop plant of step (b) with one or more
genome editing
molecules; and (d) selecting an elite crop plant comprising: (i) the approved
first transgenic locus
or modification thereof and a transgenic locus excision site wherein all of
the second approved
transgenic locus or modification thereof and one or more nucleotides of
endogenous
chromosomal DNA of the plant genome in the 5' and a 3' DNA junction
polynucleotide of the
second approved transgenic locus or modification thereof is excised; and
optionally (ii) the
targeted genetic change.
- 65 -
CA 03188282 2022-12-23
WO 2022/026379 PCT/US2021/043170
[00216] 68. The method of embodiment 67, wherein the introgression
comprises: (i)
crossing the crop plant of (a) to a plant comprising the elite crop germplasm
but lacking both the
first and the second transgenic locus; (ii) selecting a progeny plant
comprising the first and the
second transgenic locus; (iii) backcrossing the progeny plant to a recurrent
parent crop plant
comprising the elite crop germplasm but lacking the first and second
transgenic locus; and (iv)
selecting a progeny plant comprising the first and the second transgenic
locus.
[00217] 69. A method for obtaining a bulked population of inbred seed for
commercial
seed production comprising selfing the elite crop plant of any one of
embodiments 56 to 66 and
harvesting seed from the selfed elite crop plants.
[00218] 70. A method of obtaining hybrid crop seed comprising crossing a
first crop plant
comprising the elite crop plant or part thereof of any one of embodiments 56
to 66, to a second
crop plant and harvesting seed from the cross.
[00219] 71. The method of embodiment 70, wherein the first crop plant and
the second
crop plant are in distinct heterotic groups.
[00220] 72. The method of embodiment 71, wherein either the first or
second crop plant
are pollen recipients which have been rendered male sterile.
[00221] 73. The method of embodiment 72, wherein the crop plant is
rendered male sterile
by emasculation, cytoplasmic male sterility, a chemical hybridizing agent or
system, a transgene,
and/or a mutation in an endogenous plant gene.
[00222] 74. The method of any one of embodiments 70 to 73, further
comprising the step
of sowing the hybrid crop seed.
[00223] 75. DNA comprising a transgenic locus excision site wherein all
but at least one to
50 nucleotides of the heterologous DNA of the 5' and/or 3' DNA junction
polynucleotide of an
approved transgenic locus is excised.
[00224] 76. The DNA of embodiment 75, wherein the original approved
transgenic locus
is a Bt11, DAS-59122-7, DP-4114, GA21, MON810, M0N87411, M0N87427, M0N88017,
M0N89034, MIR162, MIR604, NK603, SYN-E3272-5, 5307, DAS-40278, DP-32138, DP-
33121, HCEM485, LY038, M0N863, M0N87403, M0N87403, M0N87419, M0N87460,
MZHGOJG, MZIR098, VC0-01981-5, 98140, or TC1507 transgenic locus.
[00225] 77. The DNA of embodiment 75, wherein the original approved
transgenic locus
is an A5547-127, DAS44406-6, DAS68416-4, DAS81419-2, GTS 40-3-2, M0N87701,
M0N87708, M0N89788, MST-FG072-3, and/or SYHT0H2 transgenic locus.
- 66 -
CA 03188282 2022-12-23
WO 2022/026379 PCT/US2021/043170
[00226] 78. The DNA of embodiment 75, wherein the original approved
transgenic locus
is a DAS-21023-5, DAS-24236-5, COT102, LLcotton25, M0N15985, M0N88701, and/or
M0N88913 transgenic locus.
[00227] 79. The DNA of embodiment 75, wherein the original approved
transgenic locus
is a GT73, HCN28, M0N88302, or MS8 transgenic locus.
[00228] 80. The DNA of any one of embodiments 75 to 79, wherein the DNA is
purified
or isolated.
[00229] 81. A nucleic acid marker adapted for detection of genomic DNA or
fragments
comprising a transgenic locus excision site wherein all but at least one to 50
nucleotides of the
heterologous DNA of the 5' and/or 3' DNA junction polynucleotide of an
approved transgenic
locus is excised and wherein the marker does not detect an approved transgenic
locus which has
not been excised.
[00230] 82. The nucleic acid marker of embodiment 81, comprising a
polynucleotide of at
least 18 nucleotides in length which spans the transgenic locus excision site.
[00231] 83. The nucleic acid marker of embodiment 81, wherein the marker
further
comprises a detectable label.
[00232] 84. The nucleic acid marker of embodiment 81, wherein the original
approved
transgenic locus is a Btll, DAS-59122-7, DP-4114, GA21, MON810, M0N87411,
M0N87427,
M0N88017, M0N89034, MIR162, MIR604, NK603, SYN-E3272-5, 5307, DAS-40278, DP-
32138, DP-33121, HCEM485, LY038, M0N863, M0N87403, M0N87403, M0N87419,
M0N87460, MZHGOJG, MZIR098, VC0-01981-5, 98140, and/or TC1507 transgenic
locus.
[00233] 85. The nucleic acid marker of embodiment 81, wherein the original
approved
transgenic locus is an A5547-127, DAS44406-6, DAS68416-4, DAS81419-2, GTS 40-3-
2,
M0N87701, M0N87708, M0N89788, MST-FG072-3, and/or SYHT0H2 transgenic locus.
[00234] 86. The nucleic acid marker of embodiment 81, wherein the original
approved
transgenic locus is a DAS-21023-5, DAS-24236-5, COT102, LLcotton25, M0N15985,
M0N88701, and/or M0N88913 transgenic locus.
[00235] 87. The nucleic acid marker of embodiment 81, wherein the original
approved
transgenic locus is a GT73, HCN28, M0N88302, or MS8 transgenic locus.
[00236] 88. A biological sample comprising the plant genomic DNA or
fragments thereof,
said genomic DNA or fragments comprising a transgenic locus excision site
wherein all but at
- 67 -
CA 03188282 2022-12-23
WO 2022/026379 PCT/US2021/043170
least one to 50 nucleotides of the heterologous DNA of the 5' and/or 3' DNA
junction
polynucleotide of an approved transgenic locus is excised.
[00237] 89. The biological sample of embodiment 81, wherein the original
approved
transgenic locus is a Btll, DAS-59122-7, DP-4114, GA21, MON810, M0N87411,
M0N87427,
M0N88017, M0N89034, MIR162, MIR604, NK603, SYN-E3272-5, 5307, DAS-40278, DP-
32138, DP-33121, HCEM485, LY038, M0N863, M0N87403, M0N87403, M0N87419,
M0N87460, MZHGOJG, MZIR098, VC0-01981-5, 98140, TC1507 transgenic locus.
[00238] 90. The biological sample of embodiment 81, wherein the original
approved
transgenic locus is an A5547-127, DAS44406-6, DAS68416-4, DAS81419-2, GTS 40-3-
2,
M0N87701, M0N87708, M0N89788, MST-FG072-3, and/or SYHT0H2 transgenic locus.
[00239] 91. The biological sample of embodiment 81, wherein the original
approved
transgenic locus is a DAS-21023-5, DAS-24236-5, COT102, LLcotton25, M0N15985,
M0N88701, and/or M0N88913 transgenic locus.
[00240] 92. The biological sample of embodiment 81, wherein the original
approved
transgenic locus is a GT73, HCN28, M0N88302, or MS8 transgenic locus.
[00241] 93. A method of identifying the plant, DNA, or biological sample
of any one of
embodiments 56 to 66, 75 to 80, or 81 to 92, comprising detecting a
polynucleotide comprising a
transgenic locus excision site wherein all but at least one to 50 nucleotides
of the heterologous
DNA of the 5' and/or 3' DNA junction polynucleotide of an approved transgenic
locus is excised
with a nucleic acid detection assay.
[00242] 94. The method of embodiment 93, wherein the detection assay does
not detect
the approved transgenic locus which was excised.
[00243] 95. The method of embodiment 93, wherein the detection assay
comprises
contacting the biological sample with the nucleic acid marker of any one of
embodiments 81 to
87.
Examples
[00244] The following Examples are provided for purposes of illustration
only, and are not
intended to be limiting.
[00245] Example 1. Excision of Transgenic Loci
- 68 -
CA 03188282 2022-12-23
WO 2022/026379 PCT/US2021/043170
[00246] Transgenic plant genomes containing one or more of the following
transgenic loci
(events) are contacted with a class 2 type II RdDe (e.g., Cas9) or class 2
type V RdDe (e.g.,
Cas12) and guide RNAs which recognize the indicated target DNA sites (guide
RNA coding plus
PAM site for class 2 type II or PAM site plus guide RNA coding for class 2
type V) in the 5' and
3' junction polynucleotides of the event. Plant cells, callus, parts, or whole
plants comprising a
deletion of the transgenic loci from the transgenic plant genome are selected.
[00247] Table 5. Use of pre-existing Genomic DNA target and PAM sites in
Event
(transgenic loci) 5' Junction and 3' Junction polynucleotides to excise
transgenic loci with Class
2 type II RdDe
CORN Selectable Selectable Marker Gene Selectable Marker Gene
EVENT Marker Flanking DNA 1 polynucleotide Flanking DNA 2
polynucleotide
NAME Gene target DNA (Guide RNA coding target DNA (Guide RNA
coding
sequence+ PAM for Class 2 sequence+ PAM for Class 2
type II) type II)
DAS-59122- PAT GAAGAAAATCTTCGTCAAC TCCAGGGCGAGCTCGGTACC
7 ATGG (SEQ ID NO:35) CGG (SEQ ID NO:36)
DP-4114 PAT GGCCGCGGACCGAATTCCC ATCGTGGCCTCTTGCTCTTC
ATGG (SEQ ID NO:37) AGG (SEQ ID NO:38)
M0N87411 CP4 EPSPS CGAGGCAAGCTTGTCGAAA AAACACTGATAGTTTAAACG
ATGG (SEQ ID NO: 39) CGG (SEQ ID NO: 40)
MIR162 PMI TGCACTGCAGGCATGCAAG TGTACTGAATTGTCTAGACC
CTGG (SEQ ID NO: 41) CGG (SEQ ID NO: 42)
NK603 pOS-ACT- CGCGTTAACAAGCTTACTCG AGATCGGGGATAGCTTCTGC
CP4 EPSPS AGG (SEQ ID NO: 43) AGG (SEQ ID NO: 44)
SYN-E3272- PMI TGCACTGCAGGCATGCAAG GGCACCGGTAAATTTCCTGC
CTGG (SEQ ID NO: 45) AGG (SEQ ID NO: 46)
5307 PMI TGCACTGCAGGCATGCAAG ACTAGATCTGCTAGCCCTGC
CTGG (SEQ ID NO: 47) AGG (SEQ ID NO: 48)
SOYBEAN
EVENT
NAME
DAS68416-4 CGCGGCCGCTTAATTAAGGC CGGGTTTCTAGTCACCGGTT
CGG (SEQ ID NO: 49) AGG (SEQ ID NO: 50)
M0N89788 EPSPS TTTGGACTGAGAATTAGCTT TTTCTCATCTAAGCCCCCAT
CCACTCG ((SEQ ID NO: 51; TTGGACG (SEQ ID NO: 52)
CLASS 2 TYPE V PAM+GRNA ;CLASS 2 TYPE V PAM+GRNA
CODING) CODING)
M0N89788 EPSPS TTCTGCAGGTCCTGCTCGAG CGGCCGCTTCGAGTGGCTGC
TGG (SEQ ID NO: 53 ;CLASS 2 AGG (SEQ ID NO: 54;CLASS 2
TYPE 2 GRNA CODING TYPE II GRNA CODING
+PAM) +PAM)
COTTON
EVENT
NAME
COT102 aph4 (hpt) GTACGCCATGCTGGCCGCCC CTTGGCTCCAAATCCGGTAC
- 69 -
CA 03188282 2022-12-23
WO 2022/026379 PCT/US2021/043170
GGG (SEQ ID NO: 55) CGG (SEQ ID NO: 56)
CANOLA
EVENT
NAME
MON88302 EPSPS TTCTGCAGGTCCTGCTCGAG ATCGATGCGGCCGCTTCGAG
TGG (SEQ ID NO: 57) TGG (SEQ ID NO: 58)
[00248] Table 6. Use of pre-existing Genomic DNA target and PAM sites in
Event
(transgenic loci) 5' Junction and 3' Junction polynucleotides to excise
transgenic loci
with Class 2 type V RdDe
MAIZE 5' Junction polynucleotide target DNA 3' Junction polynucleotide
EVENT (PAM+ Guide RNA coding sequence) target DNA (PAM + Guide
NAME RNA coding sequence)
DAS- TTTCCCGCCTTCAGTTTAAACTATCAG TTTAATGTACTGAATTGCGT
59122-7 (SEQ ID NO: 59) ACGATTG (SEQ ID NO: 60)
DP-4114 TTTAAACGCTCTTCAACTGGAAGAGCG TTTAATGTACTGAATTGTCT
(SEQ ID NO: 61) AGTAGCG (SEQ ID NO: 62)
MON87411 TTTATGACTTGCCAATTGATTGACAAC TTTAATCATATTGTTAAGGA
(SEQ ID NO: 63) TATAATT (SEQ ID NO: 64)
M0N89034 TTTGGCGCGCCAAATCGTGAAGTTTCT TTTGGCGCGCCAAATCGTG
(SEQ ID NO:65 ) AAGTTTCT (SEQ ID NO: 66)
MIR162 TTTCCCGCCTTCAGTTTAAACTATCAG TTTAATGTACTGAATTGTCT
(SEQ ID NO: 67) AGACCC (SEQ ID NO: 68)
NK603 TTTGGACTATCCCGACTCTCTTCTCAA TTTGAGTGGATCCTGTTATC
(SEQ ID NO: 69) TCTTCTC (SEQ ID NO: 70)
SYN- TTTCCCGCCTTCAGTTTAAACTATCAG TTTGTTTACACCACAATATA
E3272-5 (SEQ ID NO: 71) TTTCAAG (SEQ ID NO:72 )
TC1507 TTTGTGGGACAGTATGTCTGCCACTTT TTTGCCAGTGGGCCCAGCCT
(SEQ ID NO: 73) GGCCCAG (SEQ ID NO: 74)
5307 TTTGTGGGACAGTATGTCTGCCACTTT TTTGCCAGTGGGCCCAGCCT
(SEQ ID NO: 75) GGCCCAG (SEQ ID NO: 76)
SOYBEAN 5' Junction polynucleotide target DNA 3' Junction polynucleotide
EVENT (PAM + Guide RNA coding sequence) target DNA ( PAM + Guide
NAME RNA coding sequence)
MON87701 TTTGACACACACACTAAGCGTGCCTGG TTTCCTAAATTAGTCCTACT
(SEQ ID NO: 77) TTTTGAT (SEQ ID NO: 78)
M0N89788 TTTAAACTATCAGTGTTTGGAGCTTGA TTTATAATAACGCTCAGACT
(SEQ ID NO: 79) CTAGTGA (SEQ ID NO: 80)
COTTON 5' Junction polynucleotide target DNA 3' Junction polynucleotide
EVENT (PAM + Guide RNA coding sequence) target DNA (PAM + Guide
NAME RNA coding sequence)
- 70 -
CA 03188282 2022-12-23
WO 2022/026379 PCT/US2021/043170
COT102 TTTGTTTACCTGAATATTTGCCTTTTT TTTAATAAATATGGGCAAT
(SEQ ID NO: 81) CTTTCCCT (SEQ ID NO: 82)
CANOLA 5' Junction polynucleotide target DNA ( 3' Junction polynucleotide
EVENT PAM + Guide RNA coding sequence) target DNA ( PAM + Guide
NAME RNA coding sequence)
M0N88302 TTTCCCGCCTTCAGTTTAAACTATCAG TTTACAATTGACCATCATAC
(SEQ ID NO: 83) TCAACTT (SEQ ID NO: 84)
[00249] The breadth and scope of the present disclosure should not be
limited by any of
the above-described embodiments.
- 71 -
