Note: Descriptions are shown in the official language in which they were submitted.
DEMANDE OU BREVET VOLUMINEUX
LA PRESENTE PARTIE DE CETTE DEMANDE OU CE BREVET COMPREND
PLUS D'UN TOME.
CECI EST LE TOME 1 DE 2
CONTENANT LES PAGES 1 A 185
NOTE : Pour les tomes additionels, veuillez contacter le Bureau canadien des
brevets
JUMBO APPLICATIONS/PATENTS
THIS SECTION OF THE APPLICATION/PATENT CONTAINS MORE THAN ONE
VOLUME
THIS IS VOLUME 1 OF 2
CONTAINING PAGES 1 TO 185
NOTE: For additional volumes, please contact the Canadian Patent Office
NOM DU FICHIER / FILE NAME:
NOTE POUR LE TOME / VOLUME NOTE:
OPTIMAL SOYBEAN LOCI FOR TARGETED TRANSGENE INTEGRATION
CROSS-REFERENCE TO RELATED APPLICATIONS
This application claims the benefit, under 35 U.S.C. 119(e), to U.S.
Provisional Patent
Application No. 61/899,602, filed on November 4, 2013.
BACKGROUND
The genome of numerous types of diem plants, for example soybean plants, was
successfully transformed with transgenes in the early 1990's. Over the last
twenty years,
numerous methodologies have been developed for transforming the genome of
dicot plants, like
soybean, wherein a transgene is stably integrated into the genome of dicot
plants. This
evolution of dicot transformation methodologies has resulted in the capability
to successfully
introduce a transgene comprising an agronomic trait within the genome of dicot
plants, such as
soybean. The introduction of insect resistance and herbicide tolerant traits
within dicot plants in
the late 4990's provided producers with a new and convenient technological
innovation for
controlling insects and a wide spectrum of weeds, which was unparalleled in
cultivation
farming methods. Currently, transgenic dicot plants are commercially available
throughout the
Date regue/Date received 2024-01-16
world, and new transgenic products such as EnlistTM Soybean offer improved
solutions for
ever-increasing weed challenges. The utilization of transgenic dicot plants in
modern
agronomic practices would not be possible, but for the development and
improvement of
transformation methodologies.
However, cum:at transformation methodologies rely upon the random insertion of
transgenes within the genome of dicot plants, such as soybean. Reliance on
random insertion of
genes into a genome has several disadvantages. The transgenic events may
randomly integrate
within gene transcriptional sequences, thereby interrupting the expression of
endogenous traits
and altering the growth and development of the plant. In addition, the
transgenic events may
indiscriminately integrate into locations of the genome that are susceptible
to gene silencing,
culminating in the reduced or complete inhibition of transgene expression
either in the first or
subsequent generations of transgenic plants. Finally, the random integration
of tansgenes
within the plant genome requires considerable effort and cost in identifying
the location of the
transgenic event and selecting transgenic events that perform as designed
without, agronomic
impact to the plant. Novel assays must be continually developed to determine
the precise
location of the integrated transgene for each transgenic event, such as a
soybean transgenic
event. The random nature of plant transformation methodologies results in a
"position-effect"
of the integrated transgene, which hinders the effectiveness and efficiency of
transformation
methodologies.
Targeted genome modification of plants has been a long-standing and elusive
goal of
both applied and basic research. Targeting genes and gene stacks to specific
locations in the
genome of diot plants, such as soybean plants, will improve the quality of
transgenic events,
reduce costs associated with production of transgenic events and provide new
methods for
making transgenic plant products such as sequential gene stacking. Overall,
targeting trangenes
to specific genomic sites is likely to be commercially beneficial. Significant
advances have
been made in the last few years towards development of methods and
compositions to target
and cleave genomic DNA by site specific nucleases (e.g., Zinc Finger Nucleases
(ZFNs),
Meganucleases, Transcription Activator-Like Effector Nucelases (TALENS) and
Clustered
Regularly Interspaced Short Palindromic Repeats/CR1SPR-associated nuclease
(CRISPR/Cas)
with an engineered crRNA/tracr RNA), to induce targeted mutagenesis, induce
targeted
deletions of cellular DNA sequences, and facilitate targeted recombination of
an exogenous
donor DNA polynucleotide within a predetermined genomic locus. See, for
example, U.S.
Patent publication No. 20030232410; 20050208489; 20050026157; 20050064474; and
2
Date regue/Date received 2024-01-16
20060188987, and International Patent Publication No. WO 2007/014275 _ U.S.
Patent
Publication No. 20080182332 describes use of non- canonical zinc finger
nucleases (ZFNs)
for targeted modification of plant &gnomes and U.S. Patent Publication No.
20090205083
describes ZFN- mediated targeted modification of a plant EPSPs genomic locus_
Current
methods for targeted insertion of exogenous DNA typically involve co-
transformation of
plant tissue with a donor DNA polynucleotide containing at least one transgene
and a site
specific nuclease (e.g., ZFN) which is designed to bind and cleave a specific
genomic locus of
an actively transcribed coding sequence. This causes the donor DNA
polynucleotide to
stably insert within the cleaved genomic locus resulting in targeted gene
addition at a
specified genomic locus comprising an actively transcribed coding sequence.
An alternative approach is to target the transgene to preselected target
nongenic loci
within the genome of dicot plants like soybean. In recent years, several
technologies have been
developed and applied to plant cells for the targeted delivery of a transgene
within the genome
of dicot plants like soybean. However, much less is known about the attributes
of genomic sites
that are suitable for targeting. Historically, non-essential genes and
pathogen (viral) integration
sites in genomes have been used as loci for targeting The number of such sites
in genomcs is
rather limiting and there is therefore a need for identification and
characterization of targetable
optimal genomic loci that can be used for targeting of donor polynucleotide
sequences. In
addition to being amenable to targeting, optimal genomic loci are expected to
be neutral sites
that can support transgene expression and breeding applications. A need exists
for
compositions and methods that define criteria to identify optimal nongenic
loci within the
genome of dicot plants, for example soybean plants, for targeted transgene
integration.
=
SUMMARY
In an embodiment, the subject disclosure relates to a recombinant sequence,
comprising:
a nucleic acid sequence of at least 1 Kb and having at least 90%, 95%, or 99%
sequence
identity with a nongenic sequence selected from the group consisting of soy
OGL_1423 (SEQ
ID NO:639), soy OGL 1434 (SEQ ID NO:137), soy_OGL_4625 (SEQ ID NO:76),
soy OGL_6362 (SEQ ID NO:440), soy_OGL_308 (SEQ ID NO:43), soy_OGL_307 (SEQ ID
NO:566), soy_OGL_310 (SEQ ID NO:4236), soy OGL 684 (SEQ II) NO:47), soy
OGL_682
(SEQ ID NO:2101), and soy OGL_685 (SEQ NO:48). In one embodiment, the
insertion of
the DNA of interest modifies the original sequence of the nongenic loci by
alterations of the
3
Date regue/Date received 2024-01-16
nongenic loci sequence proximal to the insertion site including for example
deletions,
inversions, insertions, and duplications of the nongenic Joci sequence. In a
further aspect, an
embodiment relates to a DNA of interest, wherein the DNA of interest is
inserted into Said
nongenic sequence. In another aspect, an embodiment comprises the recombinant
sequence,
wherein a DNA of interest is inserted proximal to a zinc finger target site.
In another aspect, an
embodiment comprises the recombinant sequence, wherein a DNA of interest is
inserted at a
zinc finger target site. In another embodiment, the recombinant sequence
comprises an inserted
DNA of interest that further comprises an analytical domain. In another
embodiment, the
recombinant sequence _comprises an inserted DNA of interest that does not
encode a peptide. In
a further embodiment, the recombinant sequence comprises a DNA of interest
that encodes a
peptide. In yet another embodiment, the recombinant sequence comprises an
inserted DNA of
interest that further comprises a gene expression cassette. In an embodiment,
the gene
expressions cassette contains a gene comprising an insecticidal resistance
gene, herbicide
tolerance gene, nitrogen use efficiency gene, water use efficiency gene,
nutritional quality gene,
DNA binding gene, and selectable marker gene. In a further embodiment, the
recombinant
sequence comprises two or more gene expression cassettes. In another
embodiment, the
recombinant sequence comprises two or more of said nongenic sequences that are
located on a
same chromosome. In an additional embodiment, the recombinant sequence
comprises the
DNA of interest and/ot the nongenic sequence are modified during insertion of
said DNA of
interest into the nongenic sequence. In another embodiment, the subject
disclosure relates to a
soybean plant, .soybean plant part, or soybean plant cell comprising a
recombinant sequence.
In a further embodiment, the disclosure relates to a method of making a
transgenic plant
cell comprising a DNA of interest. In another aspect of the disclosure, the
method comprises
selecting a target nongenic soybean genomic locus having at least 900/, 95%,
or 99% sequence
identity with a target nongenic soybean genomic locus selected from the group
consisting of
soy OGL 1423 (SEQ 11) NO:639), soy_OGL_1434 (SEQ ID NO:137), soy OGL 4625 (SEQ
ID NO:76), soy OGL_6362 (SEQ NO:440),
soy_OGL_308 (SEQ ID NO:43),
soy OGL 307 (SEQ ID NO:566), soy OGL 310 (SEQ ID NO:4236), soy_OGL 684 (SEQ ID
NO:47), soy_OGL_682 (SEQ ID NO:2101), and soy_OGL_685 (SEQ ID NO:48);
selecting a
site specific nuclease that specifically binds and cleaves said target
nongenic soybean genomic
locus; introducing said site specific nuclease into a soybean plant cell;
introducing the DNA of
interest into the plant cell; inserting the DNA of interest into said target
.nongenic soybean
genomic loci; and, selecting transgcnic plant cells comprising the DNA of
interest targeted to
4
Date regue/Date received 2024-01-16
said nongenic locus. In a further aspect, an embodiment relates to a method of
making a
transgenic plant cell. In another embodiment, the DNA of interest comprises an
analytical
domain. In an embodiment, the DNA of interest does not encode a peptide. In
yet another
embodiment, the DNA of interest encodes a peptide. In a further embodiment,
the DNA of
interest comprises a gene expression cassette comprising a transgene. In
another embodiment,
the DNA of interest comprises two or more gene expression cassettes. In a
subsequent
embodiment, the site specific nuclease is selected from the group consisting
of a zinc finger
nuclease, a CRISPR nuclease, a TALE, , a horning endonuclease or a
meganuclease. In an
embodiment, the said DNA of interest is integrated within said nongenic locus
via a homology
directed repair integration method. In another embodiment, the said DNA of
interest is
integrated within said nongenic locus via a non-homologous end joining
integration method. In
a further embodiment, the method of making a transgenic plant cell provides
for two or more of
said DNA of interest that are inserted into two or more of said target
nongenic soybean genomic
loci. In another embodiment, the method of making a transgenic plant cell
comprises two or
more of said target nongenic soybean genomic loci that are located on a same
chromosome. In
an additional embodiment, the method of making a transgenic plant cell
comprises the DNA of
interest and/or the nongenic sequence that are modified during insertion of
said DNA of interest
into the nongenic sequence.
In accordance with one embodiment, a purified soybean polynucleotide loci is
disclosed
herein, wherein the purified sequence comprises a nongenic sequence of at
least 1 Kb. In one
embodiment the nongenic sequence is hypomethylated, exemplifies evidence of
recombination
and is located in proximal location to an expressing genic region in the
soybean genome. In
one embodiment, the nongenic sequence has a length ranging from about 1 Kb to
about 8.4 Kb. ,
In one embodiment, the DNA of interest comprises exogenous DNA sequences,
including for
example regulatory sequences, restriction cleavage sites, RNA encoding regions
or protein
encoding regions. In one embodiment, the DNA of interest comprises a gene
expression
cassette comprising one or more transgenes. In another embodiment, the
purified sequence
comprises a nongenic sequence having at least 90%, 95%, or 99% sequence
identity with a
nongenic sequence selected from the group consisting of soy OGL_1423 (SEQ ID
NO:639),
soy OGL 1434 (SEQ ID NO:137), soy_OGL_4625 (SEQ ID NO:76), soy OGL 6362 (SEQ
ID NO:440), soy_06L_308 (SEQ ID NO:43), soy_OGL_307 (SEQ ID NO:566),
soy OGL_310 (SEQ ID NO:4236), soy_OGL_684 (SEQ ID NO:47), soy_OGL_682 (SEQ ID
NO:2101), and soy_OGL_685 (SEQ ID NO:48). In a further embodiment, the
purified
5
Date regue/Date received 2024-01-16
nongenic soybean genomic loci comprise a DNA of interest, wherein said DNA of
interest is
inserted into said nongenic sequence. In another aspect, an embodiment
comprises the purified
nongenic soybean genomic loci, wherein said DNA of interest is inserted
proximal to a zinc
finger target site. In a different aspect, an embodiment comprises the
purified nongenic
soybean genomic loci, wherein said DNA of interest is inserted between a pair
of zinc finger
target sites. In yet another aspect, an embodiment comprises the purified
nongenic soybean
genomic loci, wherein said DNA of interest comprises an analytical domain. In
another aspect,
an embodiment comprises the purified nongenic soybean genomic loci, wherein
said DNA of
interest does not encode a peptide. In a subsequent aspect, an embodiment
comprises the
purified nongenic soybean genomic loci, wherein said DNA of interest encodes a
peptide. In an
embodiment, the gene expression cassette contains a gene comprising an
insecticidal resistance
gene, herbicide tolerance gene, nitrogen use efficiency gene, water use
efficiency gene,
nutritional quality gene, DNA binding gene, and select-able marker gene. In a
subsequent
embodiment, the site specific nuclease is selected from the group consisting
of a zinc finger
nuclease, a CRISPR nuclease, a TALEN, a homing endonuclease or a meganuclease.
In an
embodiment, the said DNA of interest is integrated within said nongenic
sequence via a
homology directed repair integration method. In another embodiment, the said
DNA of interest
is integrated within said nongenic sequence via a non-homologous end joining
integration
method. In a further embodiment, the DNA of interest comprises two or more
gene expression
cassettes. In a further embodiment, purified nongenic soybean genomic loci
provides for two or
more of said DNA of interest that are inserted into two or more of said target
nongenic soybean
genomic loci. In another embodiment, the purified nongenic soybean genomic
loci provides for
two or more of said target nongenic soybean genomic loci that are located on a
same
chromosome. In an additional embodiment, the purified nongenic soybean genomic
comprises
the DNA of interest and/or the nongenic sequence that are modified during
insertion of said
DNA of interest into the nongenic sequence. In another embodiment, the DNA of
interest is
inserted via a homology directed repair or a non-homologous end joining repair
mechanism.
In another embodiment, the subject disclosure provides for a plant comprising
a
recombinant sequence, said recombinant sequence comprising: a nucleic acid
sequence having
at least 90%, 95%, or 99% sequence identity with a nongenic sequence; and, a
DNA of interest,
wherein the DNA of interest is inserted into said nongenic sequence. In
another embodiment,
the nongenic sequence is selected from the group consisting of soy_OGL_1423
(SEQ ID
NO:639), soy OGL 1434 (SEQ ID NO:137), soy_OGL_4625 (SEQ ID NO:76),
6
=
Date regue/Date received 2024-01-16
soy OGL 6362 (SEQ ID NO:440), soy_OGL_308 (SEQ ID NO:43), soy_OGL_307 (SEQ ID
NO:566), soy_OGL_310 (SEQ ID NO:4236), soy OGL_684 (SEQ ID NO:47), soy OGL 682
(SEQ ID NO:2101), and soy OGL 685 (SEQ ID NO:48). In an additional embodiment,
the
plant comprises two or more of said recombinant sequences. In a further
aspect, an
embodiment comprises the plant, wherein said recombinant sequences are located
on the same
chromosome. In another aspect, an embodiment comprises the plant, wherein said
DNA of
interest is inserted proximal to a zinc finger target site. In a subsequent
aspect, an embodiment
comprises the plant, wherein said DNA of interest is inserted between a pair
of zinc finger
target sites_ In an embodiment, said DNA of interest comprises an analytical
domain. In a
further unbodiment, said DNA of interest does not encode a peptide. In yet
another
embodiment, said DNA of interest encodes a peptide. In a subsequent
embodiment, said DNA
of interest comprises a gene expression cassette comprising an insecticidal
resistance gene,
herbicide tolerance gene, nitrogen use efficiency gene, water use efficiency
gene, nutritional
quality gene, DNA binding gene, and selectable marker gene. In another aspect,
an
embodiment comprises the plant, wherein, said DNA of interest and/or said
nongenic sequence
are modified during insertion of said DNA of interest into said nongenic
sequence.
In another embodiment, the purified sequence comprises a nongenic sequence
having at
least 90%, 95%, or 99% sequence identity with a nongenic sequence selected
from the group
consisting of soy_OGL_1423 (SEQ NO:639),
soy_OGL_1434 (SEQ ID NO:137),
soy OGL 308 (SEQ ID NO:43), soy OGL_307 (SEQ ID NO:566), soy_OGL_310 (SEQ ID
N04236), soy OGL_684 (SEQ ID N0:47), soy_OGL_682 (SEQ ID N02101), and
soy OGL 685 (SEQ ID NO:48).
In another embodiment, the purified sequence comprises a nongenic sequence
having at
least 90%, 95%, or 99% sequence identity with a nongenic sequence selected
from the group
consisting of soy OGL_1423 (SEQ ID NO:639), and soy_OGL 1434 (SEQ ID NO:137).
In another embodiment, the purified sequence comprises a nongenic sequence
having at
least 90%, 95%, or 99% sequence identity with a nongenic sequence selected
from the group
consisting of soy_OGL_308 (SEQ ID NO:43), soy_OGL 307 (SEQ ID NO:566), and
soy_OGL_310 (SEQ ID NO:4236).
ln another embodiment, the purified sequence comprises a nongenic sequence
having at
least 9004, 95%, or 99% sequence identity with a nongenic sequence selected
from the group
consisting of soy_OGL_684 (SEQ ID NO:47). soy OGL_682 (SEQ ID NO2101), and
soy OGL 685 (SEQ ID NO:48).
7
Date regue/Date received 2024-01-16
In another embodiment, the purified sequence comprises a nongenic sequence
having at
least 90%, 95%, or 99% sequence identity with a nongenic sequence selected
from the group
consisting of soy_OGL_1423 (SEQ ID NO:639), soy OGL_1434 (SEQ ID NO:137),
soy_OGL_308 (SEQ ID NO:43), soy_OGL_307 (SEQ ID NO:566), and soy_OGL_310 (SEQ
ID
NO:4236).
In another embodiment, the purified sequence comprises a nongenic sequence
having at
least 90%, 95%, or 99% sequence identity with a nongenic sequence selected
from the group
consisting of soy_OGL_308 (SEQ ID NO:43), soy_OGL 307 (SEQ ID NO:566),
soy_OGL_310
(SEQ ID NO:4236), soy_OGL_684 (SEQ ID NO:47), soy_OGL_682 (SEQ ID NO:2101),
and
soy_OGL_685 (SEQ ID NO:48).
In another embodiment, the purified sequence comprises a nongenic sequence
having at
least 90%, 95%, or 99% sequence identity with a nongenic sequence selected
from the group
consisting of soy OGL 4625 (SEQ ID NO:76), soy OGL 6362 (SEQ ID NO:440), and
soy_OGL_308 (SEQ ID NO:43).
In an embodiment, there is provided a recombinant nucleic acid molecule, said
recombinant
nucleic acid molecule comprising: a nongenic nucleic acid molecule of at least
1 Kb, wherein a.
the level of methylation of said nongenic nucleic acid molecule is 1% or less;
b. the nongenic
nucleic acid molecule shares less than 40% sequence identity over its full
length with any other
nucleic acid molecules contained in the soybean genome; c. the nongenic
nucleic acid molecule is
located within a 40 Kb region of a known or predicted expressive soybean
coding nucleic acid
molecule; and d. the nongenic nucleic acid molecule exhibits a recombination
frequency within
the soybean genome of greater than 0.01574 cM/Mb, wherein said nongenic
nucleic acid molecule
has at least 90% sequence identity with the full length of a sequence selected
from the group
consisting of soy_OGL_1423 (SEQ ID NO:639), soy OGL_1434 (SEQ ID NO:137),
soy_OGL_4625 (SEQ ID NO:76), soy_OGL_6362 (SEQ ID NO:440), soy_OGL_308 (SEQ ID
NO:43), soy_OGL 307 (SEQ ID NO:566), soy_OGL 310 (SEQ ID NO:4236), soy_OGL_684
(SEQ ID NO:47), soy_OGL 682 (SEQ ID NO:2101), and soy OGL 685 (SEQ ID NO:48),
and a
DNA of interest, wherein the DNA of interest is inserted into said nongenic
nucleic acid molecule
to produce said recombinant nucleic acid molecule.
In an embodiment, there is provided a soybean plant cell comprising a
recombinant
sequence as described herein.
8
Date regue/Date received 2024-01-16
In an embodiment, there is provided a method of making a transgenic plant cell
comprising a DNA of interest, the method comprising: a_ selecting a target
nongenic soybean
genomic locus of at least 1 Kb, wherein i. the level of methylation of said
target nongenic
soybean genomic locus is 1% or less; ii. the target nongenic soybean genomic
locus shares
less than 40% sequence identity over its full length with any other locus
contained in the
soybean genome; iii. the target nongenic soybean genomic locus is located
within a 40 Kb
region of a known or predicted expressive soybean coding nucleic acid
molecule; and iv.
the target nongenic soybean genomic locus exhibits a recombination frequency
within the
soybean genome of greater than 0.01574 cM/Mb, wherein said target nongenic
soybean
genomic locus has at least 90% sequence identity with the full length of a
sequence selected
from the group consisting of soy_OGL_1423 (SEQ ID NO:639), soy_OGL_1434 (SEQ
ID
NO:137), soy_OGL 4625 (SEQ ID NO:76), soy_OGL 6362 (SEQ ID NO:440),
soy OGL 308 (SEQ ID NO:43), soy OGL 307 (SEQ ID NO:566), soy OGL 310 (SEQ
ID NO:4236), soy_OGL_684 (SEQ ID NO:47), soy_OGL_682 (SEQ ID NO:2101), and,
soy_OGL_685 (SEQ ID NO:48), b. selecting a site specific nuclease that
specifically
binds and cleaves said target nongenic soybean genomic locus; c. introducing
said site
specific nuclease into a soybean plant cell; d.
introducing the DNA of interest into
the plant cell; e.
inserting the DNA of interest into said target nongenic soybean
genomic locus; and, f. selecting transgenic plant cells comprising the DNA of
interest
targeted to said target nongenic soybean genomic locus.
In an embodiment, there is provided an isolated nongenic soybean genomic locus
of
at least 1 Kb, wherein a. the level of methylation of said nongenic soybean
genomic locus
is 1% or less; b. the nongenic soybean genomic locus shares less than 40%
sequence identity
over its full length with any other locus contained in the soybean genome; c.
the nongenic
soybean genomic locus is located within a 40 Kb region of a known or predicted
expressive
soybean coding nucleic acid molecule; and d. the nongenic soybean genomic
locus exhibits
a recombination frequency within the soybean genome of greater than 0.01574
cM/Mb,
wherein said purified nongenic soybean genomic locus has at least 90% sequence
identity
with the full length of a sequence selected from the group consisting of soy
OGL_1423
(SEQ ID NO:639), soy_OGL 1434 (SEQ ID NO:137), soy_OGL 4625 (SEQ ID NO:76),
soy_OGL_6362 (SEQ ID NO:440), soy_OGL_308 (SEQ ID NO:43), soy_OGL 307 (SEQ
ID NO:566), soy_OGL_310 (SEQ ID NO:4236), soy_OGL_684 (SEQ ID NO:47),
soy_OGL_682 (SEQ ID NO:2101), and soy_OGL_685 (SEQ ID NO:48).
8a
Date regue/Date received 2024-01-16
In an embodiment, there is provided a plant cell comprising a recombinant
nucleic
acid molecule, said recombinant nucleic acid molecule comprising: a nongenic
nucleic acid
molecule of at least 1 Kb, wherein a. the level of methylation of said
nongenic nucleic acid
molecule is 1% or less; b. the nongenic nucleic acid molecule shares less than
40% sequence
identity over its full length with any other nucleic acid molecules contained
in the soybean
genome; c. the nongenic nucleic acid molecule is located within a 40 Kb region
of a known
or predicted expressive soybean coding nucleic acid molecule; and d. the
nongenic nucleic
acid molecule exhibits a recombination frequency within the soybean genome of
greater
than 0.01574 cM/Mb, wherein said nongenic nucleic acid molecule has at least
90%
sequence identity with the full length of a sequence selected from the group
consisting of
soy_OGL_1423 (SEQ ID NO:639), soy_OGL_1434 (SEQ ID NO:137), soy OGL 4625
(SEQ ID NO:76), soy OGL_6362 (SEQ ID NO:440), soy_OGL_308 (SEQ ID NO:43),
soy OGL 307 (SEQ ID NO:566), soy OGL 310 (SEQ ID NO:4236), soy OGL 684 (SEQ
ID NO:47), soy OGL 682 (SEQ ID NO:2101), and soy_OGL_685 (SEQ ID NO:48), and
a DNA of interest, wherein the DNA of interest is inserted into said nongenic
nucleic acid
molecule.
BRIEF DESCRIPTION OF THE DRAWINGS
Fig. 1. Represents a three dimensional graph of the 7,018 select genomic loci
clustered into 32 clusters. The clusters can be graphed three dimensionally
and distinguished
by color or other indicators. Each cluster was assigned a unique identifier
for ease of
visualization, wherein all select genomic loci with the same identifier
belonging to the same
cluster. After the clustering process, a representative select genomic loci
was chosen from
each cluster. This was performed by choosing a select genomic loci, within
each cluster, that
was closest to the centroid of that cluster.
Fig. 2. Provides a schematic drawing indicating the chromosomal distribution
of the
optimal genomic loci, selected for being closest to the centroid of each of
the 32 respective
clusters.
Fig. 3. Provides a schematic drawing indicating the soybean chromosomal
location
.. of the optimal genomic loci selected for targeting validation.
Fig. 4. Representation of the universal donor polynucleotide sequence for
integration
via non-homologous endjoining (NHEJ). Two proposed vectors are provide wherein
a DNA
of interest (DNA X) comprises one or more (i.e., "1-N") zinc finger binding
sites (ZFN BS)
8b
Date regue/Date received 2024-01-16
at either end of the DNA of interest. Vertical arrows show unique restriction
sites and
horizontal arrows represent potential PCR primer sites.
8c
Date regue/Date received 2024-01-16
Fig. 5. Representation of the universal donor polynucleotide sequence for
integration
via homologous-directed repair (HDR). A DNA of interest (DNA X) comprising two
regions
of homologous sequences (HA) flanking the DNA of interest with zinc finger
nuclease binding
sites (ZPN) bracketing the DNAX and HA sequences. Vertical arrows show unique
restriction
sites and horizontal arrows represent potential PCR primer sites.
Fig. 6. Validation of soybean selected genomic loci targets using NHEJ based
Rapid
Targeting Analysis (RTA) method.
Fig. 7. Plasmid map of pDAB124280 (SEQ ID NO:7561). The numbered elements
(i.e., GmPPLO I ZF391R and GMPPLO1ZF391L) correspond with zinc finger nuclease
binding
sequences of about 20 to 35 base pairs in length that are recognized and
cleaved by
corresponding zinc finger nuclease proteins. These zinc finger binding
sequences and the
annotated "UZI Sequence" (which is a 100-150 bp template region containing
restriction sites
and DNA sequences for primer design or coding sequences) comprise the
universal donor
cassette. Further included in this plasmid design is the "104113 Overlap"
which are sequences
that share homology to the plasmid vector for high throughput assembly of the
universal donor
cassettes within a plasmid vector (i.e., via Gibson assembly).
Fig. 8. Plasmid map of pDAB124281 (SEQ ID NO:7562). The numbered elements
(i.e., GmPPLO2ZE411R and GMPPLO2ZF411L) correspond with zinc finger nuclease
binding
sequences of about 20 to 35 base pairs in length that are recognized and
cleaved by
corresponding zinc finger nuclease proteins. These zinc finger binding
sequences and the
annotated "UZI Sequence" (which is a 100-150 bp template region containing
restriction sites
and DNA sequences for primer design or coding sequences) comprise the
universal donor
cassette. Further included in this plasmid design is the "104113 Overlap"
which are sequences
that share homology to the plasmid vector for high throughput assembly of the
universal donor
cassettes within a plasmid vector (i.e., via Gibson assembly).
Fig. 9. Plasmid map of pDAB121278 (SEQ ID NO:7563). The numbered elements
(i.e., GmPPL18 4 and (JMPPL18_3) correspond with zinc finger nuclease binding
sequences
of about 20 to 35 base pairs in length that are recognized and cleaved by
corresponding zinc
finger nuclease proteins. These zinc finger binding sequences and the
annotated "UZI
Sequence" (which is a 100-150 bp template region containing restriction sites
and DNA
sequences for primer design or coding sequences) comprise the universal donor
cassette.
Further included in this plasmid design is the "104113 Overlap" which are
sequences that share
9
Date regue/Date received 2024-01-16
homology to the plasmid vector for high throughput assembly of the universal
donor cassettes
within a plasmid vector (i.e., via Gibson assembly).
Fig. 10. Plasmid map of pDAB123812 (SEQ ID NO:7564). The numbered elements
(i.e., ZF538R and ZF538L) correspond with zinc finger nuclease binding
sequences of about 20
to 35 base pairs in length that are recognized and cleaved by corresponding
zinc finger nuclease
proteins. These zinc finger binding sequences and the annotated "UZI Sequence"
(which is a
100-150 bp template region containing restriction sites and DNA sequences for
primer design
or coding sequences) comprise the universal donor cassette, Further included
in this plasmid
design is the "104113 Overlap" which are sequences that share homology to the
plasmid vector
for high throughput assembly of the universal donor cassettes within a plasmid
vector (i.e., via
Gibson assembly).
Fig. 11. Plasmid map of pDAB121937 (SEQ ID NO:7565). The numbered elements
(i.e., GmPPL34ZF598L, GmPPL34ZF598R, CmiPPL36ZF599L, GmPPL36ZF599R,
GmPPL36ZF600L, and GmPPL36ZF600R) correspond with zinc finger nuclease binding
sequences of about 20 to 35 base pairs in length that are recognized and
cleaved by
corresponding zinc finger nuclease proteins. These zinc finger binding
sequences and the
annotated "UZI Sequence" (which is a 100-150 bp template region containing
restriction sites
and DNA sequences for primer design or coding sequences) comprise the
universal donor
cassette. Further included in this plasmid design is the "104113 Overlap"
which are sequences
that share homology to the plasmid vector for high throughput assembly of the
universal donor
cassettes within a plasmid vector (i.e., via Gibson assembly).
Fig. 12, Plasmid map of pDAB123811 (SEQ ID NO:7566). The numbered elements
(i.e., ZF 560L and ZF 560R) correspond with zinc finger nuclease binding
sequences of about
20 to 35 base pairs in length that are recognized and cleaved by corresponding
zinc finger
nuclease proteins. These zinc finger binding sequences and the annotated "UZI
Sequence"
(which is a 100-150 bp template region containing restriction sites and DNA
sequences for
primer design or coding sequences) comprise the universal donor cassette.
Further included in
this plasmid design is the "104113 Overlap" which are sequences that share
homology to the,
plasmid vector for high throughput assembly of the universal donor cassettes
within a plasmid
vector (i.e.., via Gibson assembly).
Fig. 13. Plasmid map of pDAB124864 (SEQ ID NO:7567). The numbered elements
(i.e., ZF631L and ZF63IR) correspond with zinc finger nuclease binding
sequences of about 20
to 35 base pairs in length that are recognized and cleaved by corresponding
zinc finger nuclease
Date regue/Date received 2024-01-16
proteins. These zinc finger binding sequences and the annotated "UZI Sequence"
(which is a
100-150 bp template region containing restriction sites and DNA sequences for
primer design
or coding sequences) comprise the universal donor cassette. Further included
in this plasmid
design is the "104113 Overlap" which are sequences that share homology to the
plasmid vector
for high throughput assembly of the universal donor cassettes within a plasmid
vector (i.e., via
Gibson assembly).
Fig. 14. Plasmid map of pDAB7221 (SEQ ID NO:7569). This plasmid contains the
Cassava Vein Mosaic Virus Promoter (CsVMV) driving the GFP protein and flanked
by the
Agrobacterium tumefaciens (AtuORF 24 3'UTR).
Figs. 15A-24C. Histrogram of characteristics (length, expression of coding
region
within 40 Kb of loci, and recombination frequency) for the identified optimal
nongenic soybean
loci Fig. ISA illustrates a distribution of the polynueleotide sequence
lengths of the optimal
genoinic loci (OGL). Fig. 15B illustrates the distribution of the optimal
nongenic maize loci
relative to their recombination frequency. Fig, 15C illustrates the
distribution of expressed
nucleic acid sequences relative to their proximity (log scale) to the optimal
genomic loci
(OGL).
DETAILED DESCRIPTION
DEFINITIONS
In describing and claiming the invention, the following terminology will be
used in
accordance with the definitions set forth below.
The term "about" as used herein means greater or lesser than the value or
range of
values stated by 10 percent, but is not intended to designate any value or
range of values to only
this broader definition. Each value or range of values preceded by the term
"about" is also
intended to encompass the embodiment of the stated absolute value or range of
values.
As used herein, the term "plant" includes a whole plant and any descendant,
cell, tissue,
or part of a plant. The term "plant parts" include any part(s) of a plant,
including, for example
and without limitation: seed (including mature seed and immature seed); a
plant cutting; a plant
cell; a plant cell culture; a plant organ (e.g., pollen, embryos, flowers,
fruits, shoots, leaves,
roots, stems, and explants). A plant tissue or plant organ may be a seed,
callus, or any other
group of plant cells that is organized into a structural or functional unit..
A plant cell or tissue
culture may be capable of regenerating a plant having the physiological and
morphological
characteristics of the plant from which the cell or tissue was obtained, and
of regenerating a
11
Date regue/Date received 2024-01-16
plant having substantially the same genotype as the plant. In contrast, some
plant cells are not
capable of being regenerated to produce plants. Regenerable cells in a plant
cell or tissue
culture may be embryos, protoplasts, meristematic cells, callus, pollen,
leaves, anthers, roots,
root tips, silk, flowers, kernels, ears, cobs, husks, or stalks.
Plant parts include harvestable parts and parts useful for propagation of
progeny plants.
Plant parts useful for propagation include, for example and without
limitation: seed; fruit; a
cutting; a seedling; a tuber; and a rootstock. A harvestable part of a plant
may be any useful
part of a plant, including, for example and without limitation: flower;
pollen; seedling; tuber;
leat stern; fruit seed; and root
A plant cell is the structural and physiological unit of the plant. Plant
cells, as used
herein, includes protoplasts and protoplasts with a cell wall. A plant cell
may be in the form of
an isolated single cell, or an aggregate of cells (e.g., a friable callus and
a cultured cell), and
may be part of a higher organized unit (e.g., a plant tissue, plant organ, and
plant). Thus, a
plant cell may be a protoplast, a gamete producing cell, or a cell or
collection of cells that can
regenerate into a whole plant. As such, a seed, which comprises multiple plant
cells and is
' capable of regenerating into a whole plant, is considered a "plant part" in
embodiments herein.
The term "protoplast", as used herein, refers to a plant cell that had its
cell wall
completely or partially removed, wills the lipid bilayer membrane thereof
naked. Typically, a
protoplast is an isolated plant cell without cell walls which has the potency
for regeneration into
cell culture or a whole plant.
As used herein the terms "native" or "natural" define a condition found in
nature. A
"native DNA sequence" is a DNA sequence present in nature that was produced by
natural
means or traditional breeding techniques but not generated by genetic
engineering (e.g., using
molecular biology/transformation techniques).
As used herein, "endogenous sequence" defines the native form of a
polynucleotide,
gene or polypeptide in its natural location in the organism or in the genome
of an organism.
The term "isolated" as used herein means having been removed from its natural
environment.
The term "purified", as used herein relates to the isolation of a molecule or
compound in
a form that is substantially free of contaminants normally associated with the
molecule or
compound in a native or natural environment and means having been increased in
purity as a
result of being separated from other components of the original composition.
The term
12
Date regue/Date received 2024-01-16
"purified nucleic acid" is used herein to describe a nucleic acid sequence
which has been
separated from other compounds including, but not limited to polypeptides,
lipids and
carbohydrates.
The terms "polypeptide, "peptide" and "protein" are used interchangeably to
refer to a
polymer of amino acid residues. The term also applies to amino acid polymers
in which one or
more amino acids are chemical analogues or modified derivatives of a
corresponding naturally-
occurring amino acids.
As used herein an "optimal dicot genomic loci", "optimal nongenic dicot loci",
"optimal nongenic loci", or "optimal genomic loci (OGL)" is a native DNA
sequence found in
the nuclear genome of a dicot plant that has the following properties:
nongenic,
hypomethylated, targetable, and in proximal location to a genic region,
wherein the genomic
region around the optimal dicot genomic loci exemplifies evidence of
recombination.
As used herein an "optimal soybean genomic loci", "optimal nongenic soybean
loci",
"optimal nongenic loci", or "optimal genomic loci (0(L)" is a native DNA
sequence found in
the nuclear genome of a dicot plant that has the following properties:
nongenic,
hypomethylated, targetable, and in proximal location to a genic region,
wherein the genomic
region around the optimal dicot genomic loci exemplifies evidence of
recombination.
As used herein, a "nongenic dicot sequence" or "nongenic dicot genomic
sequence" is a
native DNA sequence found in the nuclear genome of a dicot plant, having a
length of at least 1
Kb, and devoid of any open reading frames, gene sequences, or gene regulatory
sequences.
Furthermore, the nongenic dicot sequence does not comprise any intron sequence
(i.e., inhons
are excluded from the definition of nongenic). The nongenic sequence cannot be
transcribed or
translated into protein. Many plant genomes contain nongenic regions. As much
as 95% of the
genome can be nongenic, and these regions may be comprised of mainly
repetitive DNA.
As used herein, a "nongenic soybean sequence" or "nongenic soybean genomic
sequence" is a native DNA sequence found in the nuclear genome of a soybean
plant, having a
length of at least 1 Kb, and devoid of any open reading frames, gene
sequences, or gene
regulatory sequences. Furthermore, the nongenic soybean sequence does not
comprise any
intron sequence (i.e., introns are excluded from the definition of nongenic).
The nongenic
sequence cannot be transcribed or translated into protein. Many plant genomes
contain
nongenic regions. As much as 95% of the genome can be nongenic, and these
regions may be
comprised of mainly repetitive DNA.
13'
Date regue/Date received 2024-01-16
As used herein, a "genic region" is defined as a polynucleotide sequence that
comprises
an open reading frame encoding an RNA and/or polypeptide. The genic region may
also
encompass any identifiable adjacent 5' and 3' non-coding nucleotide sequences
involved in the
regulation of expression of the open reading frame up to about 2 Kb upstream
of the coding
region and 1 Kb downstream of the coding region, but possibly further upstream
or
downstream. A genic region further includes any inirons that may be present in
the genic
region. Further, the genic region may comprise a single gene sequence, or
multiple gene
sequences interspersed with short spans (less than 1 Kb) of nongenic
sequences.
As used herein a "nucleic acid of interest", "DNA of interest", or "donor" is
defined as a
nucleic acid/DNA sequence that has been selected for site directed, targeted
insertion into the
dicot genome, like a soybean genome. A nucleic acid of interest can be of any
length, for
example between 2 and 50,000 nucleotides in length (or any integer value
therebetween or
thereabove), preferably between about 1,000 and 5,000 nucleotides in length
(or any integer
value therebetween). A nucleic acid of interest may comprise one or more gene
expression
cassettes that further comprise actively transcribed and/or translated gene
sequences.
Conversely, the nucleic acid of interest may comprise a polynucleotide
sequence which does
not comprise a functional gene expression cassette or an entire gene (e.g.,
may simply comprise
regulatory sequences such as a promoter), or may not contain any identifiable
gene expression
elements or any actively transcribed gene sequence. The nucleic acid of
interest may optionally
contain an analytical domain. Upon insertion of the nucleic acid of interest
into the dicot
genome of soybean for example, the inserted sequences are referred to as the
"inserted DNA of
interest". Further, the nucleic acid of interest can be DNA or RNA, can be
linear or circular,
and can be single-stranded or double-stranded. It can be delivered to the cell
as naked nucleic
acid, as a complex with one or more delivery agents (e.g., liposomes,
poloxamers, 1-strand
encapsulated with proteins, etc.,) or contained in a bacterial or viral
delivery vehicle, such as,
for example, Agrobacterium tumefaciens or an adenovirus or an adeno-associated
Virus (AAV),
respectively.
As used herein the term "analytical domain" defmes a nucleic acid sequence
that
contains functional elements that assist in the targeted insertion of nucleic
acid sequences. For
example, an analytical domain may contain specifically designed restriction
enzyme sites, zinc
finger binding sites, engineered landing pads or engineered transgene
integration platforms and
may or may not comprise gene regulatory elements or an open reading frame.
See, for
14
Date regue/Date received 2024-01-16
example, U.S. Patent Publication No 20110191899.
As used herein the term "selected dicot sequence" defines a native genomic DNA
sequence of a dicot plant that has been chosen for analysis to determine if
the sequence
qualifies as an optimal nongenic dicot genomic loci.
As used herein the term "selected soybean sequence" defines a native genomic
DNA
sequence of a soybean plant that has been chosen for analysis to determine if
the sequence
qualifies as an optimal nongenic soybean genomic loci.
As used herein, the teint "hypomethylation" or "hypomethylated", in reference
to a
DNA sequence, defines a reduced state of methylated DNA nucleotide residues in
a given
sequence of DNA. Typically, the decreased methylation relates to the number of
methylated
adenine or cytosine residues, relative to the average level of methylation
found in nongenic
sequences present in the genome of a dicot plant like a soybean plant.
As used herein a "targetable sequence" is a polynucleotide sequence that is
sufficiently
unique in a nuclear genome to allow site specific, targeted insertion of a
nucleic acid of interest
into one specific sequence.
As used herein the term "non-repeating" sequence is defined as a sequence of
at least 1
Kb in length that shares less than 40% identity to any other sequence within
the genome of a
dicot plant, like soybean. Calculations of sequence identity can be determined
using any
standard technique known to those skilled in the art including, for example,
scanning a selected
genomic sequence against the dicot genome, e.g., soybean c.v. Williams82
genome, using a
BLAST based homology search using the NCBI BLASTIN+ software (version 2.2.25)
run
using the default parameter settings (Stephen F. Altschul et al (1997),
"Gapped BLAST and
PSI-BLAST: a new generation of protein database search programs", Nucleic
Acids Res.
25:3389-3402). For example, as the selected soybean sequences (from the
Glycine max c.v.
Williams82 genuine) were analyzed, the first BLAST*14 hit identified from such
a search
represents the dicot sequence, e.g., soybean c.v. Williams82 sequence, itself.
The second
BLASTrm hit for each selected soybean sequence was identified and the
alignment coverage
(represented as the percent of the selected soybean sequence covered by the
BLASTTm hit) of
the hit was used as a measure of uniqueness of the selected soybean sequence
within the
genome of a dicot plant, such as soybean. These alignment coverage values for
the second
BLASTrm hit ranged from a minimum of 0% to a maximum of 39.97% sequence
identity. Any
sequences that aligned at higher levels of sequence identity were not
considered.
Date recue/Date received 2024-01-16
The term "in proximal location to a genic region" when used in reference to a
nongenic
sequence defines the relative location of the nongenic sequence to a genic
region. Specifically,
the number of genic regions within a 40 Kb neighborhood (i.e., within 40 Kb on
either end of
the selected optimal soybean genomic loci sequence) is analyzed. This analysis
was completed
by assaying gene annotation information and the locations of known genes in
the genome of a
known dicot, such as soybean, that were extracted froma moncot genome
database, for example
the Soybean Genome Database. For each of the optimal nongenic soybean genomic
loci, e.g.,
7,018 optimal nongenic soybean genomic loci, a 40 Kb window around the optimal
genomic
loci sequence was defined and the number of annotated genes with locations
overlapping this
window was counted. The number of genic regions ranged from a minimum of 1
gene to a
maximum of 18 genes within the 40 Kb neighborhood.
The term "known soybean coding sequence" as used herein relates to any
polynucleotide sequence identified from any dicot genomic database, including
the Soybean
Genomic Database (vvww,soybape.org. $)pmaker, R.C. et al. SoyBase, the USDA-
ARE
soybean genetics and genomics database. Nucleic Acids Res. 2010
jan:38(Database
issue):D843-(4) that comprise an open reading frame, either before or after
processing of intron
sequences, and are transcribed into raRNA and optionally translated into a
protein sequence
when placed under the control of the appropriate genetic regulatory elements.
The known
soybean coding sequence can be a eDNA sequence or a genomic sequence. In some
instances,
the known soybean coding sequence can be annotated as a functional protein. In
other
instances, the known soybean coding sequence may not be annotated. -
The term "predicted dicot coding sequence" as used herein relates to any
Expressed
Sequence Tag (EST) polynucleotide sequences described in a dicot genomic
database, for
example the the Soybean Genomic Database. ESTs are identified from cDNA
libraries
constructed using oligo(dT) primers to direct first-strand synthesis by
reverse transcriptase. The
resulting ESTs are single-pass sequencing reads of less than 500 bp obtained
from either the 5'
or 3' end of the cDNA insert. Multiple ESTs may be aligned into a single
contig. The identified
EST sequences are uploaded into the dicot genomic database, e.g., Soybean
Genomic Database
and can be searched via bioinformatics methods to predict corresponding
genomic
polynucleotide sequences that comprise a coding sequence that is transcribed
into mRNA and
optionally translated into a protein sequence when placed under the control of
the appropriate
genetic regulatory elements.
16
Date regue/Date received 2024-01-16
The term "predicted soybean coding sequence" as used herein relates to any
Expressed
Sequence Tag (EST) polynucleotide sequences described in a soybean genomic
database, for
example the the Soybean Genomic Database. ESTs are identified from cDNA
libraries
constructed using oligo(dT) primers to direct first-strand synthesis by
reverse transcriptase. The
resulting ESTs are single-pass sequencing reads of less than 500 bp obtained
from either the 5'
or 3' end of the cDNA insert. Multiple ESTs may be aligned into a single
contig. The identified
EST sequences are uploaded into the soybean genomic database, e.g., Soybean
Genomic
Database and can be searched via bioinfonpatics methods to predict
corresponding genomic
polynucleotide sequences that comprise a coding sequence that is transcribed
into mRNA and
optionally translated into a protein sequence when placed under the control of
the appropriate
genetic regulatory elements,
The term "evidence of recombination" as used herein relates to the meiotic
recombination frequencies between any pair of dicot genomic markers, e.g.,
soybean genomic
markers, across a chromosome 'region comprising the selected soybean sequence.
The
recombination frequencies were calculated based on the ratio of the genetic
distance between
markers (in centimorgan (cM)) to the physical distance between the markers (in
megabases
(Mb)). For a selected soybean sequence to have evidence of recombination, the
selected
soybean sequence must contain at least one recombination event between two
markers flanking
the selected soybean sequence as detected using a high resolution marker
dataset generated
from multiple mapping populations.
As used herein the term "relative location value" is a calculated value
defining the
distance of a genomic locus from its corresponding chromosomal centromere. For
each
selected soybean sequence, the genomic distance from the native location of
the selected
soybean sequence to the centromere of the chromosome that it is located on, is
measured (in
Bp). The relative location of selected soybean sequence within the chromosome
is represented
as the ratio of its genomic distance to the centromere relative to the length
of the specific
chromosomal arm (measured in Bp) that it lies on. These relative location
values for the optimal
nongenic soybean genomic loci can be generated for different dicot plants, the
relative location
values for the soybean dataset ranged from a minimum of 0 to a maximum of
0.99682 ratio of
genomic distance.
The term "exogenous DNA sequence" as used herein is any nucleic acid sequence
that
has been removed from its native location and insetted into a new location
altering the
17
Date regue/Date received 2024-01-16
sequences that flank the nucleic acid sequence that has been moved. For
example, an
exogenous DNA sequence may comprise a sequence from another species.
"Binding" refers to a sequence-specific, interaction between macromolecules
(e.g.,
between a protein and a nucleic acid). Not all components of a binding
interaction need be
sequence-specific (e.g., contacts with phosphate residues in a DNA backbone),
as long as the
interaction as a whole is sequence-specific. Such interactions are generally
characterized by a
dissociation constant (1(d). "Affinity" refers to the strength of binding:
increased binding
affinity being correlated with a lower binding constant (KA).
A "binding protein" is a protein that is able to bind to another molecule. A
binding
protein can bind to, for example, a DNA molecule (a DNA-binding protein), an
RNA molecule
(an RNA-binding protein) and/or a protein molecule (a protein-binding
protein). In the case of a
protein-binding protein, it can bind to itself (to form homodimers,
homotrimers, etc.) and/or it
can bind to one or more molecules of a different protein or proteins. A
binding protein can have
more than one type of binding activity. For example, zinc finger proteins have
DNA-binding,
RNA-binding and protein-binding activity.
As used herein the term "zinc fingers," defines regions of amino acid sequence
within a
DNA binding protein binding domain whose structure is stabilized through
coordination of a
zinc ion.
A "zinc finger DNA binding protein" (or binding domain) is a protein, or a
domain
within a larger protein, that binds DNA in a sequence-specific manner through
one or more zinc
fingers, which are regions of amino acid sequence within the binding domain
whose structure is
stabilized through coordination of a zinc ion. The term zinc finger DNA
binding protein is often
abbreviated as zinc finger protein or ZFP. Zinc finger binding domains can be
"engineered" to
bind to a predetermined nucleotide sequence. Non-limiting examples of methods
for
engineering zinc finger proteins are design and selection. A designed zinc
finger protein is a
protein not occurring in nature whose design/composition results principally
from rational
criteria. Rational criteria for design include application of substitution
rules and computerized
algorithms for processing information in a database storing information of
existing ZFP designs
and binding data. See, for example, U.S. Pat. Nos. 6,140,081; 6,453,242;
6,534,261 and
6,794,136; see also WO 98/53058; WO 98/53059; WO 98/53060; WO 02/016536 and WO
03/016496.
A "TALE DNA binding domain" or "TALE" is a polypeptide comprising one or more
TALE
repeat domains/units. The repeat domains are involved in binding of the TALE
to its cognate target
18
Date regue/Date received 2024-01-16
DNA sequence. A single "repeat unit" (also referred to as a "repeat") is
typically 33-35 amino acids
in length and exhibits at least some sequence homology with other TALE repeat
sequences within a
naturally occurring TALE protein. See, e.g., U.S. Patent Publication No.
20110301073
The CRISPR (Clustered Regularly Interspaced Short Palindromie Repeats)/Cas
(CRISPR Associated) nuclease system. Briefly, a "CRISPR DNA binding domain" is
a short
stranded RNA molecule that acting in conc:er with the CAS enzyme can
selectively recognize,
bind, and cleave genomic DNA. The CRISPR/Cas system can be engineered to
create a
double-stranded break (DSB) at a desired target in a genome, and repair of the
DSB can be
influenced by the use of repair inhibitors to cause an increase in error prone
repair. See,
Jinek et al (2012) Science 337, p. 816-821, Jinek et al, (2013), eLife
2:e00471, and David
Segal, (2013) eLife 2:000563).
Zinc finger, CRISPR and TALE binding domains can be "engineered" to bind to a
predetermined nucleotide sequence, for example via engineering (altering one
or more amino
acids) of the recognition helix region of a naturally occurring zinc finger.
Similarly, TALES
can be "engineered" to bind to a predetermined nucleotide sequence, for
example by
engineering of the amino acids involved in DNA binding (the repeat variable
diresidue or RVD
region), Therefore, engineered DNA binding proteins (zinc fingers or TALEs)
are proteins that
are non-naturally occurring. Non-limiting examples of methods for engineering
DNA-binding
proteins am design and selection. A designed DNA binding protein is a protein
not occurring in
nature whose design/composition results principally from rational criteria.
Rational criteria for
design include application of substitution rules and computerized algorithms
for processing
information in a database storing information of existing ZFP and/or TALE
designs and binding
data. See, for example, U.S. Patents 6,140,081; 6,453,242; and 6,534,261; see
also
WO 98/53058; WO 98/53059; WO 98/53060; WO 02/016536 and WO 03/016496 and U.S.
Publication Nos. 20110301073,20110239315 and 20119145940.
A "selected" zinc finger protein, CRISPR or TALE is a protein not found in
nature
whose production results primarily from an empirical process such as phage
display, interaction
trap or hybrid selection. See e.g., U.S. Patent Nos. 5,789,538; US 5,925,523;
US 6,007,988;
US 6,013,453; US 6,200,759; WO 95/19431; WO 96/06166; WO 98/53057; WO
98/54311;
W000/27878; WO 01/60970 WO 01/88197 and WO 02/099084 and U.S. Publication Nos.
20110301073,20110239315 and 20119145940.
19
Date regue/Date received 2024-01-16
"Recombination" refers to a process of exchange of genetic information between
two
polynucleotides, including but not limited to, donor capture by non-homologous
end joining
(NHEJ) and homologous recombination. For the purposes of this disclosure,
"homologous
recombination (HR)" refers to the specialized form of such exchange that takes
place, for
example, during repair of double-strand breaks in cells via homology-directed
repair
mechanisms. This process requires nucleotide sequence homology, uses a "donor"
molecule to
template repair of a "target" molecule (i.e., the nucleotide sequence that
experienced the
double-strand break), and is variously known as "non-crossover gene
conversion" or "short tract
gene conversion," because it leads to the transfer of genetic information from
the donor to the
target. Without wishing to be bound by any particular theory, such transfer
can involve
mismatch correction of heteroduplex DNA that forms between the broken target
and the donor,
and/or "synthesis-dependent strand annealing" in which the donor is used to
resynthesize
genetic information that will become part of the target, and/or related
processes. Such
specialized HR often results in an alteration of the sequence of the target
molecule such that
part or all of the sequence of the donor polynucleotide is incorporated into
the target
polynucleolide. For HR-directed integration, the donor molecule contains at
least 2 regions of
homology to the genome ("homology arms") of least 50-100 base pairs in length.
See, e.g., U.S.
Patent Publication No. 20110281361.
in the methods of the disclosure, one or more targeted nucleases as described
herein
create a double-stranded break in the target sequence (e.g., cellular
chromatin) at a
predetermined site, and a "donor" polynucleotide, having homology to the
nucleotide sequence
in the region of the break for HR mediated integration or having no homology
to the nucleotide
sequence in the legion of the break for NHEJ mediated integration, can be
introduced into the
cell. The presence of the double-stranded break has been shown to facilitate
integration of the
donor sequence. The donor sequence may be physically integrated or,
alternatively, the donor
polynucleotide is used as a template for repair of the break via homologous
recombination,
resulting in the introduction of all or part of the nucleotide sequence as in
the donor into the
cellular chromatin. Thus, a first sequence in cellular chromatin can be
altered and, in certain
embodiments, can be converted into a sequence present in a donor
polynucleotide. Thus, the
use of the terms "replace" or "replacement" can be understood to represent
replacement of one
nucleotide sequence by another, (i.e., replacement of a sequence in the
informational sense),
and does not necessarily require physical or chemical replacement of one
polynucleotide by
another.
Date regue/Date received 2024-01-16
In any of the methods described herein, additional pairs of zinc-finger
proteins,
CRISP RS or TALEN can be used for additional double-stranded cleavage of
additional target
sites within the cell.
Any of the methods described herein can be used for insertion of a donor of
any size
and/or partial or complete inactivation of one or more target sequences in a
cell by targeted
integration of donor sequence that disrupts expression of the gene(s) of
interest. Canines with
partially or completely inactivated genes are also provided.
Furthermore, the methods of targeted integration as described herein can also
be used to
integrate one or more exogenous sequences. The exogenous nucleic acid sequence
can
comprise, for example, one or more genes or cDNA molecules, or any type of
coding or
noncoding sequence, as well as one or more control elements (e_g., promoters).
In addition, the
exogenous nucleic acid sequence (tramsgene) may produce one or more RNA
molecules (e.g.,
small hairpin RNAs (shRNAs), inhibitory RNAs (RNAis), microRNAs (miRNAs),
etc.) or
protein.
"Cleavage" as used herein defines the breakage of the phosphate-sugar backbone
of a
DNA molecule. Cleavage can be initiated by a variety of methods including, but
not limited to,
enzymatic or chemical hydrolysis of a phosphodiester bond. Both single-
stranded cleavage and
double-stranded cleavage are possible, and double-stranded cleavage can occur
as a result of
two distinct single-stranded cleavage events. DNA cleavage can result in the
production of
either blunt ends or staggered ends. In certain embodiments, fusion
polypeptides are used for
targeted double-stranded DNA cleavage. A "cleavage domain" comprises one or
more
polypeptide sequences which possesses catalytic activity for DNA cleavage. A
cleavage domain
can be contained in a single polypeptide chain or cleavage activity can result
from the
association of two (or more) polypeptides.
A "cleavage half-domain" is a polypeptide sequence which, in conjunction with
a
second polypeptide (either identical or different) forms a complex having
cleavage activity
(preferably double-strand cleavage activity). The terms "first and second
cleavage half-
domains;" "+ and ¨ cleavage half-domains" and "right and left cleavage half-
domains" are used
interchangeably to refer to pairs of cleavage half-domains that dimerize.
An "engineered cleavage half-domain" is a cleavage half-domain that has been
modified
so as to form obligate heterodimers with another cleavage half-domain (e.g.,
another engineered
cleavage half-domain). See, also, U.S. Patent Publication Nos. 2005/0064474,
20070218528,
2008/0131962 and 2011/0201055.
21
Date regue/Date received 2024-01-16
A "target site" or "target sequence" refers to a portion of a nucleic acid to
which a
binding molecule will bind, provided sufficient conditions for binding exist.
Nucleic acids include DNA and RNA, can be single- or double-stranded; can be
linear,
branched or circular; and can be of any length. Nucleic acids include those
capable of forming
duplexes, as well as triplex-forming nucleic acids. See, for example, U.S,
Pat, Nos. 5,176,996
and 5,422,251. Proteins include, but are not limited to, DNA-binding proteins,
transcription
factors, chromatin remodeling factors, methylated DNA binding proteins,
polymerases,
rnethylases, demethylases, =acetylases, deacetylases, kinases, phosphatases,
integrases,
recombinases, ligases, topoisomerases, gyrases and helicases.
A "product of an exogenous nucleic acid" includes both polynucleotide and
polypeptide
products, for example, transcription products (polynucleotides such as RNA)
and translation
products (polypeptides).
A "fusion" molecule is a molecule in which two or more subunit molecules are
linked,
for example, covalently. The subunit molecules can be the same chemical type
of molecule, or
______________________________________________________________ can be dare,
ent chemical types of molecules. Examples of the first type of fusion molecule
include, but are not limited to, fusion proteins (for example, a fusion
between a ZFP DNA-
binding domain and a cleavage domain) and fusion nucleic acids (for example, a
nucleic acid
encoding the fusion protein described supra). Examples of the second type of
fusion molecule
include, but are not limited to, a fusion between a triplex-forming nucleic
acid and a
polypeptide, and a fusion between a minor groove binder and a nucleic acid.
Expression of a
fusion protein in a cell can result from delivery of the fusion protein to the
cell or by delivery of
a polynucleotide encoding the fusion protein to a cell, wherein the
polynucleotide is transcribed,
and the transcript is translated, to generate the fusion protein. Trans-
splicing, polypeptide
cleavage and polypeptide ligation can also be involved in expression of a
protein in a cell.
Methods for polynucleotide and polypeptide delivery to cells are presented
elsewhere in this
disclosure.
For the purposes of the present disclosure, a "gene", includes a DNA region
encoding a
gene product (see infra), as well as all DNA regions which regulate the
production of the gene
product, whether or not such regulatory sequences are adjacent or operably
linked to coding
and/or transcribed sequences. Accordingly, a gene includes, but is not
necessarily limited to,
promoter sequences, terminators, translational regulatory sequences such as
ribosome binding
sites and internal ribosome entry sites, enhancers, silencers, insulators,
boundary elements,
replication origins, matrix attachment sites and locus control regions.
22
Date regue/Date received 2024-01-16
"Gene expression" refers to the conversion of the information, contained in a
gene, into
a gene product. A gene product can be the direct transcriptional product of a
gene (e.g., mRNA,
tRNA, rRNA, antisense RNA, interfering RNA, ribozymc, structural RNA or any
other type of
RNA) or a protein produced by translation of a mRNA. Gene products also
include RNAs
which are modified, by processes such as capping, polyadenylation,
methylation, and editing,
and proteins modified by, for example, rnethylation, acetylation,
phosphorylation,
ubiquitination, ADP-ribosylation, myristilation, and glycosylation.
Sequence identity: The term "sequence identity" or "identity," as used herein
in the
context of two nucleic acid or polypeptide sequences, refers to the residues
in the two
sequences that are the same when aligned for maximum correspondence over a
specified
comparison window.
As used herein, the term "percentage of sequence identity" refers to the value
determined by comparing two optimally aligned sequences (e.g., nucleic acid
sequences, and
amino acid sequences) over a comparison window, wherein the portion of the
sequence in the
comparison window may comprise additions or deletions (i.e., gaps) as compared
to the
reference sequence (which does not comprise additions or deletions) for
optimal alignment of
the two sequences. The percentage is calculated by determining the number of
positions at
which the identical nucleotide or amino acid residue occurs in both sequences
to yield the
number of matched positions, dividing the number of matched positions by the
total number of
positions in the comparison window, and multiplying the result by 100 to yield
the percentage
of sequence identity.
Methods for aligning sequences for comparison are well-known in the art.
Various
programs and alignment algorithms are described in, for example: Smith and
Waterman (1981)
Adv. Appl. Math. 2:482; Needleman and Wunsch (1970) J. Mol. Biol. 48:443;
Pearson and
Lipman (1988) Proc. Natl. Acad. Sci. U.S.A. 85:2444; Higgins and Sharp (1988)
Gene 73:237-
44; Higgins and Sharp (1989) CABlOS 5:151-3; Corpet et al. (1988) Nucleic
Acids Res.
16:10881-90; Huang et al. (1992) Comp. Appl. Biosci. 8:155-65; Pearson et at
(1994) Methods
Mol. Biol. 24:307-31; Tatiana et al. (1999) FEMS Microbiol. Lett. 174:247-50.
A detailed
consideration of sequence alignment methods and homology calculations can be
found in, e.g.,
Altschul et al. (1990) J. Mol. Biol. 215:403-10. The National Center for
Biotechnology
Information (NCB1) Basic Local Alignment Search Tool (BLASTTm; Altschul et a).
(1990)) is
available from several sources, including the National Center for
Biotechnology information
(Bethesda, MD), and on the intemet, for use in connection with several
sequence analysis
23
Date regue/Date received 2024-01-16
programs. A description of how to determine sequence identity using this
program is available
on the internet under the "help" section for BLAST"4. For comparisons of
nucleic acid
sequences, the -Blast 2 sequences" function of the BLASTnd (Blastn) program
may be
employed using the default parameters. Nucleic acid sequences with even
greater similarity to
the reference sequences will show increasing percentage identity when assessed
by this method,
Specifically hybridizable/Specifically complementary: As used herein, the
terms
"specifically hybridizable and "specifically complementary" are tenns that
indicate a sufficient
degree of complementarity, such that stable and specific binding occurs
between the nucleic
acid molecule and a target nucleic acid molecule. Hybridization between two
nucleic acid
molecules involves the formation of an anti-parallel alignment between the
nucleic acid
sequences of the two nucleic acid molecules, The two molecules are then able
to form
hydrogen bonds with corresponding bases on the opposite strand to form a
duplex molecule
that, if it is sufficiently stable, is detectable using methods well known in
the art. A nucleic acid
molecule need not be 100% complementary to its target sequence to be
specifically
hybridizable. However, the amount of sequence complementarity that must exist
for
hybridization to be specific is a function of the hybridization conditions
used.
Hybridization conditions resulting in particular degrees of stringency will
vary
depending upon the nature of the hybridization method of choice and the
composition and
length of the hybridizing nucleic acid sequences. Generally, the temperature
of hybridization
and the ionic strength (especially the Na+ and/or Mg4-1- concentration) of the
hybridization
buffer will determine the stringency of hybridization, though wash times also
influence
stringency. Calculations regarding hybridization conditions required for
attaining particular
degrees of stringency are known to those of ordinary skill in the art, and are
discussed, for
example, in Sambrook et al. (ed.) Molecular Cloning: A Laboratory Manual, 2nd
ed., vol. 1-3,
Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 1989, chapters 9
and II; and
Hames and Higgins (eds.) Nucleic Acid Hybridization, RI, Press, Oxford, 1985.
Further
detailed instruction and guidance with regard to the hybridization of nucleic
acids may be
found, for example, in Tijssen, "Overview of principles of hybridization and
the strategy of
nucleic acid probe assays," in Laboratory Techniques in Biochemistry and
Molecular Biology-
Hybridization with Nucleic Acid Probes, Part 1, Chapter 2, Elsevier, NY, 1993;
and Ausubel et
al., Eds., Current Protocols in Molecular Biology, Chapter 2, Greene
Publishing- and Wiley-
Interscience, NY, 1995.
24
Date regue/Date received 2024-01-16
As used herein, "stringent conditions" encompass conditions under which
hybridization
will only occur if there is less than 20% mismatch between the hybridization
molecule and a
sequence within the target nucleic acid molecule. "Stringent conditions"
include fluffier
particular levels of stringency. Thus, as used herein, "moderate stringency"
conditions are
those under which molecules with more than 20% sequence mismatch will not
hybridize;
conditions of "high stringency" are those under which sequences with more than
10% mismatch
will not hybridize; and conditions of "very high stringency" are those under
which sequences
with more than 5% mismatch will not hybridize. The following are
representative, non-limiting
hybridization conditions.
High Stringency condition (detects sequences that share at least 90% sequence
identity):
Hybridization in 5x SSC buffer (wherein the SSC buffer contains a detergent
such as SDS, and
additional reagents like salmon sperm DNA, EDTA, etc.) at 65 C for 16 hours;
wash twice in
2x SSC buffer (wherein the SSC buffer contains a detergent such as SDS, and
additional
reagents like salmon sperm DNA, EDTA, etc.) at room temperature for 15 minutes
each; and
wash twice in 0.5x SSC buffer (wherein the SSC buffer contains a detergent
such as SDS, and
additional =gents like salmon sperm DNA, EDTA, etc.) at 65 C for 20 minutes
each.
Moderate Stringency condition (detects sequences that share at least 80%
sequence
identity): Hybridization in 5x-6x SSC buffer (wherein the SSC buffer contains
a detergent such
as SDS, and additional reagents like salmon sperm DNA, EDTA, etc.) at 65-70 C
for 16-20
hours; wash twice in 2x SSC buffer (wherein the SSC buffer contains a
detergent such as SDS,
and additional reagents hie salmon sperm DNA, EDTA, etc.) at room temperature
for 5-20
minutes each; and wash twice in lx SSC buffer (wherein the SSC buffer contains
a detergent
such as SDS, and additional reagents like salmon sperm DNA, EDTA, etc.) at 55-
70 C for 30
minutes each.
Non-stringent control condition (sequences that share at least 50% sequence
identity
will hybridize): Hybridization in 6x SSC buffer (wherein the SSC buffer
contains a detergent
such as SDS, and additional reagents like salmon sperm DNA, EDTA, etc.) at
room
temperature to 55 C for 16-20 hours; wash at least twice in 2x-3x SSC buffer
(wherein the
SSC buffer contains a detergent such as SDS, and additional reagents like
salmon sperm DNA,
EDTA, etc.) at room temperature to 55 C for 20-30 minutes each.
As used herein, the term "substantially homologous" or "substantial homology,"
with
regard to a contiguous nucleic acid sequence, refers to contiguous nucleotide
sequences that
hybridize under stringent conditions to the reference nucleic acid sequence.
For example,
Date regue/Date received 2024-01-16
nucleic acid sequences that are substantially homologous to a reference
nucleic acid sequence
are those nucleic acid sequences that hybridize under stringent conditions
(e.g., the Moderate
Stringency conditions set forth, supra) to the reference nucleic acid
sequence. Substantially
homologous sequences may have at least 80% sequence identity. For example,
substantially
homologous sequences may have from about 80% to 100% sequence identity, such
as about
81%; about 82%; about 83%; about 84%; about 85%; about 86%; about 87%; about
88%; about
89%; about 90%; about 91%; about 92%; about 93%; about 94% about 95%; about
96%; about
97%; about 98%; about 98.5%; about 99%; about 99.5%; and about 100%. The
property of
substantial homology is closely related to specific hybridization. For
example, a nucleic acid
molecule is specifically hybridizable when there is a sufficient degree of
complementarity to
avoid non-specific binding of the nucleic acid to non-target sequences under
conditions where
specific binding is desired, for example, under stringent hybridization
conditions.
In some instances "homologous" may be used to refer to the relationship of a
first gene
to a second gene by descent from a common ancestral DNA sequence. In such
instances, the
term, homolog, indicates a relationship between genes separated by the event
of speciation (see
ortholog) or to the relationship between genes separated by the event of
genetic duplication (see
paralog). In other instances "homologous" may be used to refer to the level of
sequence
identity between one or more polynucleotide sequences, in such instances the
one or more
polynucelotide sequences do not necessarily descend from a common ancestral
DNA sequence.
Those with skill in the art are aware of the interchangeably of the term
"homologous" and
appreciate the proper application of the term.
As used herein, the term "ortholog" (or "orthologous") refers to a gene in two
or more
species that has evolved from a common ancestral nucleotide sequence, and may
retain the
same function in the two or more species.
As used herein, the term "paralogous" refers to genes related by duplication
within a
genome. Orthologs retain the same function in the course of evolution, whereas
paralogs evolve
new functions, even if these new functions are unrelated to the original gene
function.
As used herein, two nucleic acid sequence molecules are said to exhibit
"complete
complementarity" when every nucleotide of a sequence read in the 5' to 3'
direction is
complementary to every nucleotide of the other sequence when read in the 3' to
5' direction. A
nucleotide sequence that is complementary to a reference nucleotide sequence
will exhibit a
sequence identical to the reverse complement sequence of the reference
nucleotide sequence.
26
Date regue/Date received 2024-01-16
These terms and descriptions are well defined in the art and are easily
understood by those of
ordinary skill in the art.
When determining the percentage of sequence identity between amino acid
sequences, it
is well-known by those of skill in the art that the identity of the amino acid
in a given position
provided by an alignment may differ without affecting desired properties of
the polypepddes
comprising the aligned sequences. In these instances, the percent sequence
identity may be
adjusted to account for similarity between conservatively substituted amino
acids. These
adjustments are well-known and commonly used by those of skill in the art.
See, e.g., Myers
and Miller (1988) Computer Applications in Biosciences 4:11-7. Statistical
methods are known
in the art and can be used in analysis of the identified 7,018 optimal genomic
loci.
As an embodiment, the identified optimal genomic loci comprising 7,018
individual
optimal genomic loci sequences can be analyzed via an F-distribution test. In
probability theory
and statistics, the F-distribution is a continuous probability distribution.
The F-distribution test
is a statistidal significance test that has an F-distribution, and is used
when comparing statistical
models that have been fit to a data set, to identify the best-fitting model.
An F-distribution is a
continuous probability distribution, and is also known as Snedecor's F-
distribution or the
Fisher-Snedecor distribution. The F-distribution arises frequently as the null
distribution of a
test statistic, most notably in the analysis of variance. The F-distribution
is a right-skewed
distribution. The F-distribution is an asymmetric distribution that has a
minimum value of 0, but
.. no maximum value. The curve reaches a peak not far to the right of 0, and
then gradually
approaches the horizontal axis the larger the F value is. The F-distribution
approaches, but
never quite touches the horizontal axisit will be appreciated that in other
embodiments,
variations on this equation, or indeed different equations, may be derived and
used by the
skilled person and are applicable to the analysis of 7,018 individual optimal
gcnomic loci
.. sequences.
Operably linked: A first nucleotide sequence is "operably linked" with a
second
nucleotide sequence when the first nucleotide sequence is in a functional
relationship with the
second nucleotide sequence. For instance, a promoter is operably linked to a
coding sequence if
the promoter affects the transcription or expression of the coding sequence.
When
recombinantly produced, operably linked nucleotide sequences are generally
contiguous and,
where necessary to join two protein-coding regions, in the same reading frame.
However,
nucleotide sequences need not be contiguous to be operably linked.
27
Date regue/Date received 2024-01-16
The term, "operably linked," when used in reference to a regulatory sequence
and a
coding sequence, means that the regulatory sequence affects the expression of
the linked coding
sequence. "Regulatory sequences," "regulatory elements", or "control
elements," refer to
nucleotide sequences that influence the timing and level/amount of
transcription, RNA
processing or stability, or translation of the associated coding sequence.
Regulatory sequences
may include promoters; translation leader sequences; introns; enhancers; stem-
loop structures;
repressor binding sequences; termination sequences; polyadenylation
recognition sequences;
etc. Particular regulatory sequences may be located upstream and/or downstream
of a coding
sequence operably linked thereto. Also, particular regulatory sequences
operably linked to a
coding sequence may be located on the associated complementary strand of a
double-stranded
nucleic acid molecule.
When used in reference to two or more amino acid sequences, the term "operably
linked" means that the first amino acid sequence is in a functional
relationship with at least one
of the additional amino acid sequences.
The disclosed methods and compositions include fusion proteins comprising a
cleavage
domain operably linked to a DNA-binding domain (e.g., a ZFP) in which the DNA-
binding
domain by binding to a sequence in the soybean optimal genomic locus directs
the activity of
the cleavage domain to the vicinity of the sequence and, hence, induces a
double stranded break
in the optimal genomic locus. As set forth elsewhere in this disclosure, a
zinc finger domain
can be engineered to bind to virtually any desired sequence. Accordingly, one
or more DNA-
binding domains can be engineered to bind to one or more sequences in the
optimal genomic
locus. Expression of a fusion protein comprising a DNA-binding domain and a
cleavage
domain in a cell, effects cleavage at or near the target site.
EMBODIMENTS
Targeting transgenes and transgene stacks to specific locations in the genome
of dicot
plants, like a soybean plant, will improve the quality of transgenic events,
reduce costs
associated with production of transgenic events and provide new methods for
making
transgenic plant products such as sequential gene stacking. Overall, targeting
trangenes to
specific genomic sites is likely to be commercially beneficial. Significant
advances have been
made in the last few years towards development of site-specific nucleases such
as aNs,
CRISPRs, and TALENs that can facilitate addition of donor polynucleotides to
pre-selected
sites in plant and other genomes. However, much less is known about the
attributes of genomic
28
Date regue/Date received 2024-01-16
sites that are suitable for targeting. Historically, non-essential genes and
pathogen (viral)
integration sites in genomes have been used as loci for targeting. The number
of such sites in
genomes is rather limiting and there is therefore a need for identification
and characterization of
optimal genomic loci that can be used for targeting of donor polynucleotide
sequences. In
addition to being amenable to targeting, optimal genomic loci are expected to
be neutral sites
that can support transgene expression and breeding applications.
Applicants have recognized that additional criteria are desirable for
insertion sites and
have combined these criteria to identify and select optimal sites in the dicot
genome, like the
soybean genome, for the insertion of exogenous sequences. For targeting
purposes, the site of
selected insertion needs to be unique and in a non-repetitive region of the
genome of a dicot
plant, like a soybean plant. Likewise, the optimal genomic site for insertion
should possess .
minimal undesirable phenotypic effects and be susceptible to recombination
events to facilitate
introgression into agronomically elite lines using traditional breeding
techniques. In order to
identify the genomic loci that meet the listed criteria, the genome of a
soybean plant was
scanned using a customized bioinfomiatics approach and genome scale datasets
to identify
novel genomic loci possessing characteristics that are beneficial for the
integration of
polynuckotide donor sequence and the subsequent expression of an inserted
coding sequence.
I. Identification of Nongenic Soybean Genomic Loci
In accordance with one embodiment a method is provided for identifying optimal
nongenic soybean genomic sequence for insertion of exogenous sequences. The
method
comprises the steps of first identifying soybean genomic sequences of at least
1 Kb in length
that are hypomethylated. In one embodiment the hypomethylated genomic sequence
is 1, 1.5,
2, 25,3, 33, 4, 43, 5, 53, 6,63, 7, 7.5, 8, 83, 9, 10, 11, 12, 13, 14, 15, 16
or 17 Kb in length.
In one embodiment the hypomethylated genomic sequence is about 1 to about 5.7
Kb in length
and in a further embodiment is about 2 Kb in length. A sequence is considered
hypomethylated
if it has less than 1% DNA methylation within the sequence. In one embodiment
the
methylation status is measured based on the presence of 5-methylcytosine at
one or more CpG
dinucleotides, CHG or CHH trinucleotides within a selected soybean sequence,
relative to the
amount of total cytosines found at corresponding CpG dinucleotides, CHG or CHH
trinucleotides within a normal control DNA sample. More particularly, in one
embodiment the
selected soybean sequence has less than 1, 2 or 3 methylated nucleotides per
500 nucleotides of
the selected soybean sequence. In one embodiment the selected soybean sequence
has less than
29
Date re gu e/Date received 2024-01-16
one, two, or three 5-methylcytosines at CpG dinucleotides per 500 nucleotides
of the selected
soybean sequence. In one embodiment the selected soybean sequence is 1 to 4 Kb
in length and
comprises a 1 Kb sequence devoid of 5-methyleytosines. In one embodiment the
selected
soybean sequence is 1, 1.5, 2, 2.5, 3, 3,5, 4,4.5, 5, 5.5, or 6, Kb in length
and contains 1 or 0
methylated nucleotides in its entire length. In one embodiment the selected
soybean sequence
is 1, 1.5, 2, 2.5, 3, 3.5, 4, 4.5, 5, 5.5, or 6, Kb in length and contains no
5-methylcytosines at
CpG dinucleotides within in its entire length. In accordance with one
embodiment the
methylation of a selected soybean sequence may vary based on source tissue. In
such
embodiments the methylation levels used to determine if a sequence is
hypomethylated
represents the average amount of methylation in the sequences isolated from
two or more
tissues (e.g., from root and shoot).
In addition to the requirement that an optimal genornic site be
hypomethylated, the
selected soybean sequence must also be nongenic. Accordingly, all
hypomethylated genomic
sequences are further screened to eliminate hypomethylated sequences that
contain a genic
region. This includes any open reading frames regardless of whether the
transcript encodes a
protein. Hypomethylated genomic sequences that include genic regions,
including any
identifiable adjacent 5' and 3' non-coding nucleotide sequences involved in
the regulation of
expression of an open reading frame and any introns that may be present in the
genic region, are
excluded from the optimal nongenic soybean genomic locus of the present
disclosure.
Optimal nongenic soybean genomic loci must also be sequences that have
demonstrated
evidence of recombination. In one embodiment the selected soybean sequence
must contain at
least one recombination event between two markers flanking the selected
soybean sequence as
detected using a high resolution marker dataset generated from multiple
mapping populations.
In one embodiment the pair of markers flanking a 0.5, 1, 1.5 Mb diem genomic
sequence, such
as a soybean genomic sequence, comprising the selected soybean sequence are
used to calculate
the recombinant frequency for the selected soybean sequence. Recombination
frequencies
between each pairs of markers (measured in centimorgan (cM)) to the genomic
physical
distance between the markers (in Mb)) must be greater than 0.0157 cM/Mb. In
one
embodiment the recombination frequency for a 1 Mb soybean genomic sequence
comprising
the selected soybean sequence ranges from about 0.01574 cM/Mb to about 83.52
cM/Mb. In
one embodiment an optimal genomic loci is one where recombination events have
been
detected within the selected soybean sequence.
Date regue/Date received 2024-01-16
An optimal nongenic soybean genomic loci will also be a targetable sequence,
i.e., a
sequence that is relatively unique in the soybean genome such that a gene
targeted to the
selected soybean sequence will only insert in one location of the soybean
genome. hi one
embodiment the entire length of the optimal genomic sequence shares less than
30%, 35%, or
40%, sequence identity with another sequence of similar length contained in
the soybean
genome. Accordingly, in one embodiment the selected soybean sequence cannot
comprise a 1
Kb sequence that share more than 25%, 30%, 35%, or 40% sequence identity with
another 1 Kb
sequence contained in the soybean genome. In a further embodiment the selected
soybean
sequence cannot comprise a 500 bp sequence that share more than 30%, 35%, or
40% sequence
identity with another 500 bp sequence contained in the soybean genome. In one
embodiment
the selected soybean sequence cannot comprise a 1 Kb sequence that share more
than 40%
sequence identity with another 1 Kb sequence contained in the genome of a
dicot plant, like a
soybean plant.
An optimal nongenic soybean genomic loci will also be proximal to a genic
region,
More particularly, a selected soybean sequence must be located in the vicinity
of a genic region
(e.g., a genic region must be located within 40 Kb of genomic sequence
flanking and
contiguous with either end of the selected soybean as found in the native
genome). In one
embodiment a genic region is located within 10, 20, 30 or 40 Kb of contiguous
genomic
sequence located at either end of the selected soybean sequence as found in
the native soybean
genome, In one embodiment two or more genic regions are located within 10,
20,30 or 40 Kb
of contiguous genomic sequence flanking the two ends of the selected soybean
sequence. In
one embodiment 1-18 genic regions are located within 10, 20, 30 or 40 Kb of
contiguous
genomic sequence flanking the two ends of the selected soybean sequence. In
one embodiment
two or more genic regions are located within a 20, 30 or 40 Kb genomic
sequence comprising
the selected soybean sequence. In one embodiment 1-18 genic regions are
located within a 40
Kb genomic sequence comprising the selected soybean sequence. In one
embodiment the genic
region located within a 10, 20, 30 or 40 Kb of contiguous genomic sequence
flanking the
selected soybean sequence comprises a known gene in the genome of a dicot
plant, such as a
soybean plant.
In accordance with one embodiment a modified nongenic soybean genomic loci is
provided wherein the loci is at least 1 Kb in length; is nongenic, comprises
no methylated
cytosine residues, has a recombination frequency of greater than 0.01574 cM/Mb
over a 1Mb
genomic region encompassing the soybean genomic loci and a I Kb sequence of
the soybean
31
Date regue/Date received 2024-01-16
genomic loci shares less than 40% sequence identity with any other 1 Kb
sequence contained in
the dicot genome, wherein the nongenic soybean genomic loci is modified by the
insertion of a
DNA of interest into the nongenic soybean genomic loci.
A method for identifying optimal nongenic soybean genomic loci is provided. In
some
embodiments, the method first comprises screening the dicot gem= to create a
first pool of
selected soybean sequences that have a minimal length of 1 Kb and are
hypomethylated,
optionally wherein the genomic sequence has less than 1% methylation,
optionally wherein the
genomic sequence is devoid of any methylated cytosine residues. This first
pool of selected
soybean sequences can be further screened to eliminate loci that do not meet
the requirements
for optimal nongenic soybean genomic loci. Dicot genomic sequences, such as
those obtained
from soybean, that encode dicot transcripts, share greater than 40% or higher
sequence identity
with another sequence of similar length, do not exhibit evidence of
recombination, and do not
have a known open reading frame within 40 Kb of the selected soybean sequence,
are
eliminated from the first pool of sequences, leaving a second pool of
sequences that qualify as
optimal nongenic soybean loci. In one embodiment any selected soybean
sequences that do not
have a known dicot gene (i.e., a soybean gene), or a sequence comprising a 2
Kb upstream
and/or 1 Kb downstream region of a known dicot gene, within 40 Kb of one end
of said
nongenic sequence are eliminated from the first pool of sequences. In one
embodiment any
selected soybean sequences that do not contain a known gene that expresses a
protein within 40
Kb of the selected soybean sequence are eliminated. In one embodiment any
selected soybean
sequences that do not have a recombination frequency of greater than 0.01574
cM1Mb are
eliminated.
Using these selection criteria applicants have identified select optimal
genomic loci of
dicot, such as soybean, that serve as optimal nongenic soybean genomic loci,
the sequences of
which are disclosed as SEQ ID NO: 1-SEQ ID NO: 7,018. The present disclosure
also
encompasses natural variants or modified derivatives of the identified optimal
nongenic
soybean genomic loci wherein the variant or derivative loci comprise a
sequence that differs
from any sequence of SEQ ID NO: 1-SEQ ID NO; 7,018 by 1, 2, 3, 4, 5, 6, 7, 8,
9 or 10
nucleotides. In one embodiment optimal nongenic soybean genomic loci for use
in accordance
with the present disclosure comprise sequences selected from SEQ ID NO: 1-SEQ
ID NO:
7,018 or sequences that share 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or
99%
sequence identity with a sequence selected from SEQ ID NO: I -SEQ ID NO:
7,018.
32
Date regue/Date received 2024-01-16
In another embodiment, dicot plants for use in accordance with the present
disclosure
comprise any plant selected from the group consisting of a soybean plant, a
canola plant, a rape
plant, a Brassica plant, a cotton plant, and a sunflower plant. Examples of
dicot plants that can
be used include, but are not limited to, canola, cotton, potato, quinoa,
amaranth, buckwheat,
safflower, soybean, sugarbeet, sunflower, canola,, rape, tobacco, Arabidopsis,
Brassica, and
cotton.
In another embodiment, optimal nongenic soybean genomic loci for use in
accordance
with the present disclosure comprise sequences selected from soybean plants.
In a father
embodiment, optimal nongenic soybean genomic loci for use in accordance with
the present
disclosure comprise sequences selected from Glycine max inbreds. Accordingly,
a Glycine max
inbred includes agronomically elite varieties thereof. In a subsequent
embodiment, optimal
nongenic soybean genomic loci for use in accordance with the present
disclosure comprise
sequences selected from transformable soybean lines. In an embodiment,
representative
transformable soybean lines include; Maverick, Williams82, Merrill JackPeldng,
Suzuyutaka,
Fayette, Enrei, Mikawashima, WaseMidori, Jack, Leculus, Morocco, Serena, Maple
prest,
Thorne, Bert, Jungery, A3237, Williams, Williams79, AC Colibri, Hefeng 25,
Dongnong 42,
Hienong 37, Jilin 39, Jiyu 58, A3237, Kentucky Wonder, Minidolca, and
derivatives thereof.
One of skill in thc art will appreciate that as a result of phylogenetic
divergence, various types
of soybean lines do not contain identical genomic DNA sequences, and that
polymorphisms or
allelic variation may be present within genomic sequences. In an embodiment,
the present
disclosure encompasses such polymorphism or allelic variations of the
identified optimal
nongenic soybean genomic loci wherein the polymorphisms or allelic variation
comprise a
sequence that differs from any sequence with SEQ ID NO: 1-SEQ ID NO: 7,018 by
1, 2, 3,4, 5,
6, 7, 8, 9 or 10 nucleotides. In a further embodiment, the present disclosure
encompasses such
polymorphisms or allelic variations of the identified optimal nongenic soybean
genomic loci
wherein the sequences comprising the polymorphisms or allelic variation share
90%, 91%,
92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity with any sequence
of SEQ ID
NO: I-SEQ ID NO: 7,018.
The identified optimal genomic loci comprising 7,018 individual sequences can
be
categorized into various subgroupings by further analysis using a multivariate
analysis method.
Application of any multivariate analysis statistical programs is used to
uncover the latent
structure (dimensions) of a set of variables. A number of different types of
multivariate
algorithms can be used, for example the data set can be analyzed using
multiple regression
33
Date regue/Date received 2024-01-16
analysis, logistic regression analysis, discriminate analysis, multivariate
analysis of variance
(MANOVA), factor analysis (including both common factor analysis, and
principal component
analysis), cluster analysis, multidimensional scaling, correspondence
analysis, conjoint analysis,
canonical analysis, canonical correlation, and structural equation modeling.
In accordance with one embodiment the optimal nongenic soybean genomic loci
are
further analyzed using multivariate data analysis such as Principal Component
Analysis (PCA).
= Only a brief description will be given here, more information can be
found in H. Martens, T.
Naas, Multivariate Calibration, Wiley, N.Y,, 1989. PCA
evaluates the underlying
dimensionality (latent variables) of the data, and gives an overview of the
dominant patterns
and major trends in the data. In one embodiment, the optimal nongenic soybean
genomic loci
can be sorted into clusters via a principal component analysis (PCA)
statistical method. The
PCA is a mathematical procedure that uses an orthogonal transformation to
convert a set of
observations of possibly correlated variables into a set of values of linearly
uncorrelated
variables called principal components. The number of principal components is
less than or
equal to the number of original variables. This transformation is defined in
such a way that the
first principal component has the largest possible variance (that is, accounts
for as much of the
variability in the data as possible), and each succeeding component in turn
has the highest
variance possible under the constraint that it be orthogonal to (i.e.,
uncoffelated with) the
preceding components. Principal components are guaranteed to be independent if
the data set is
jointly normally distributed. PCA is sensitive to the relative scaling of the
original variables.
Examples of the use of PCA to cluster a set of entities based on features of
the entities include;
Ciampitti, 1. et al., (2012) Crop Science, 52(6); 2728-2742, Chemometrics: A
Practical Guide,
Kenneth R. Beebe, Randy J. Pell, and Mary Beth Seasholt2, Wiley-Interscience,
1 edition,
1998, U.S. Patent No. 8,385,662, and European Patent No. 2,340,975.
In accordance with one embodiment a principal component analysis (PCA) was
conducted on the 7,018 optimal soybean genomic loci using the following 10
features for each
identified optimal soybean genomic loci:
1. Length of the hypo-methylated region around the optimal soybean
genomic loci (OGL)
a. DNA
methylation profiles of root and shoot tissues isolated from a dicot plant,
e.&, Glycine Max cultivar Williams82, were constructed using a high throughput
whole genome sequencing approach. Extracted DNA was subjected to bisulphite
treatment that converts unmethylated cytosines to uracils, but does not affect
methylated cytosines, and then sequenced using Illumine HiSeq technology
(Krueger, F. et al. DNA methylome analysis using short bisulfite sequencing
34
Date regue/Date received 2024-01-16
data. Nature Methods 9, 145-151 (2012)). The raw sequencing reads were
mapped to the dicot reference sequence, e.g., Glycine max reference sequence,
using the RismarkTM mapping software (as described in Krueger F, Andrews SR
(2011) Bismark: a flexible aligner and methylation caller for Bisulfite-Seq
applications. (Bioinformatics 27: 1571-1572)). The length of the hypo-
methylated region around each of the OGLs was calculated using the described
methyl ation profiles.
2. Rate of Recombination in a 1MB region around the OGL
a. For each OGL, a pair of markers on either side of the OGL, within a 1Mb
window, was identified. Recombination frequencies between each pairs of
markers across the chromosome were calculated based on the ratio of the
genetic
distance between markers (in centimorgan (cM)) to the genomic physical
distance between the markers (in Mb).
3. Level of OGLsequence uniqueness
a. For each OGL, the nucleotide sequence of the OGL was scanned against the
genome of a dicot plant, e.g., soybean c.v. Williams82 genome, using a BLAST
based homology search. As these OGL sequences are identified from the
genome of a dicot plant, e.g., soybean c.v. Williams82 genome, the first BLAST
hit identified through this search represents the OGL sequence itselL The
second
BLAST hit for each OGL was identified and the alignment coverage of the hit
was used as a measure of uniqueness of the OGL sequence within the dicot
genome, e.g., soybean genome.
4. Distance from the OGLto the closest gene in its neighborhood
a. Gene annotation information and the location of known genes in the dicot
genome, e.g., soybean c.v. Williams82 genome, were extracted from a known
dicot genome database, e.g., Soybean Genome Database (www.soybase.org).
For each OGL, the closest annotated gene in its upstream or downstream
neighborhood was identified and the distance between the OGL sequence and
the gene was measured (in bp).
5. GC % in the OGL neighborhood
a. For each OGL, the nucleotide sequence was analyzed to estimate the number
of
Guanine and Cytosine bases present. This count was represented as a percentage
of the sequence length of each OGL and provides a measure for GC %.
6. Number of genes in a 40 Kb neighborhood around the OGL
a. Gene annotation information and the location of known genes in the dicot
genome, e.g., soybean c.v, Williams82 genome, were extracted from a known
dicot genomic database, e.g., Soybean Genome Database (www.soybase.org).
For each OGL, a 40 Kb window around the OGL was defined and the number of
annotated genes with locations overlapping this window was counted.
7. Average gene expression in a 40 Kb neighborhood around the OGL.
a. Transcript level expression of dicot genes, e.g., soybean genes, was
measured by
analyzing transcriptorne profiling data generated from dicot plant tissues,
e.g.,
Date regue/Date received 2024-01-16
soybean c.v. Williams82 root and shoot tissues, using RNAseq technology. For
each OGL, annotated genes within the dicot genome, soybean c.v. Wi1liams82
genome, that were present in a 40 Kb neighborhood around the OGL were
identified. Expression levels for each of the genes in the window were
extracted
from the transcriptome profiles and an average gene expression level was
calculated.
8. Level of Nucleosome occupancy around the OGL
a. Discerning the level of nucleosome occupancy for a particular nucleotide
sequence provides information about chromosomal functions and the genomic
context of the sequence. The NuPoPTM statistical package provides a user-
friendly software tool for predicting the nucleosome occupancy and the most
probable nucleosome positioning map for genomic sequences of any size (Xi, L.,
Fondufe-Mittesidor, Y, Xia, L., Flatow, J., Widom, J. and Wang, J.-P.,
Predicting nuckosome positioning using a duration Hidden Markov Model,
BMC Bioinformatics, 2010, doi:10.1186/1471-2105-11-346). For each OGL, the
nucleotide sequence was submitted to the NuPoPTM software and a nucleosome
occupancy score was calculated.
9. Relative location within the chromosome (proximity to centromere)
a. Information on position of the centromere in each of the dicot chromosomes,
e.g., soybean chromosomes, and the lengths of the chromosome arms was
extracted from a dicot genomic database, e.g., Soybean Genome Databae
(www.soybase.org). For each OGL, the genomic distance from the OGL
sequence to the centromere of the chromosome that it is located on, is
measured
(in bp). The relative location of a OGL within the chromosome is represented
as
the ratio of its genomic distance to the centromere relative to the length of
the
specific chromosomal arm that it lies on.
10. Number of OGLs in a 1 Mb region around the OGL
a. For each OGL,, a 1 Mb genomic window around the OGL location is defined and
the number of OGLs, in the dicot 1 Kb OGL dataset, whose genomic locations
overlap with this window is tallied.
The results or values for the score of the features and attributes of each
optimal
nongenic soybean genomic loci are further described in Table 3 of Example 2.
The resulting
dataset was used in the PCA statistical method to cluster the 7,018 identified
optimal nongenic
soybean genomic loci into clusters. During the clustering process, after
estimating the "p"
principle components of the optimal genomic loci, the assignment of the
optimal pnomic,loci
to one of the 32 clusters proceeded in the "p" dimensional Euclidean space.
Each of the "p"
axes was divided into "k" intervals. Optimal genomic loci assigned to the same
interval were
grouped together to form clusters. Using this analysis, each PCA axis was
divided into two
intervals, which was chosen based on a priori information regarding the number
of clusters
36
Date regue/Date received 2024-01-16
required for experimental validation. All analysis and the visualization of
the resulting clusters
were carried out with the Molecular Operating EnvironmentTM (MOE) software
from Chemical
Computing Group Inc. (Montreal, Quebec, Canada). The PCA approach was used to
cluster the
set of 7,018 optimal soybean genomic loci into 32 distinct clusters based on
their feature values,
described above.
During the PCA process, five principal components (PC) were generated, with
the top
three PCs containing about 90% of the total variation in the dataset (Table
4). These three PCs
were used to graphically represent the 32 clusters in a three dimensional plot
(see Fig. I). After
the clustering process, was completed, one representative optimal genomic loci
was chosen
from each cluster. This was performed by choosing a select optimal genomic
locus, within each
cluster, that was closest to the centroid of that cluster by computational
methods (Table 4). The
chromosomal locations of the 32 representative optimal genomic loci are
uniformly distributed
among the soybean chromosomes as shown in Fig. 2.
In accordance with one embodiment a modified optimal nongenic soybean genomic
loci
is provided wherein the optimal nongenic soybean genomic loci has been
modified and
comprise one or more nucleotide substitutions, deletions or insertions. In one
embodiment the
optimal nongenic soybean genomic loci is modified by the insertion of a DNA of
interest.
In an embodiment the optimal nongenic soybean genomic loci to be modified is a
genomic sequence selected from any sequence described in Table 7 and 8 of
Example 7. In one
embodiment the optimal nongenic soybean genomic loci to be modified is a
genomic sequence
selected from soy OGL _1423 (SEQ ID NO:639), soy OGL _1434 (SEQ ID NO:137),
soy_
OGL _4625 (SEQ NO:76), soy_ OGL _6362 (SEQ ID NO:440), soy_OGL_308 (SEQ 11)
NO:43), soy_OGL_307 (SEQ ID NO:566), soy_OGL_310 (SEQ ID NO:4236), soy OGL 684
(SEQ ID NO:47), scy_OGL_682 (SEQ ID NO:2101), and soy OGL_685 (SEQ ID NO:48).
In
one embodiment the optimal nongenic soybean genomic loci to be modified is a
genomic
sequence selected from soy_ OGL _1423 (SEQ ID NO:639), In one embodiment the
optimal
nongenic soybean genomic loci to be modified is a genomic sequence selected
from soy OGL
_1434 (SEQ ID NO:! 37). In one embodiment the optimal nongenic soybean genomic
loci to be
modified is a genomic sequence selected from soy_ OGL _4625 (SEQ ID NO:76), In
one
embodiment the optimal nongenic soybean genomic loci to be modified is a
genomic sequence
selected from soy OGL _6362 (SEQ ID NO:440). In one embodiment the optimal
nongenic
soybean genomic loci to be modified is a genomic sequence selected from soy
OGL 308 (SEQ
ID NO:43). In one embodiment the optimal nongenic soybean genomic loci to be
modified is a
37
Date regue/Date received 2024-01-16
genomic sequence selected from soy_OGL 307 (SEQ ID N0:566). In one embodiment
the
optimal nongenic soybean genomic loci to be modified is a genomic sequence
selected fkom
soy OGL 310 (SEQ ID NO:4236). In one embodiment the optimal nongenic soybean
genomic
loci to be modified is a genomic sequence selected from soy OGL_684 (SEQ ID
NO:47). In
one embodiment the optimal nongenic soybean genomic loci to be modified is a
genomic
sequence selected from soy_OGL_682 (SEQ ID NO:2101). In one embodiment the
optimal
nongenic soybean genomic loci to be modified is a genomic sequence selected
from
soy OOL 685 (SEQ ID NO:48).
In a further embodiment the optimal nongenic soybean genomic loci to be
modified is a
genomic sequence selected from soy OGL _1423 (SEQ ID NO:639), soy_ OGL _1434
(SEQ
ID NO:137), and soy OGL 4625 (SEQ ID NO:76). In a further embodiment the
optimal
nongenic soybean genomic loci to be modified is a genomic sequence selected
from loci_ soy_
OGL _6362 (SEQ ID NO:440), and soy_OGL_308 (SEQ ID NO:43),õ In a further
embodiment
the optimal nongenic soybean gnomic loci to be modified is a genomic sequence
selected from
soy OGL 307 (SEQ ID NO:566), soy OGL 310 (SEQ ID NO:4236), soy_OGL 684 (SEQ ID
NO:47), soy_OGL_682 (SEQ ID NO:2101), and soy_OGL_685 (SEQ ID NO:48). In a
further
embodiment the optimal nongenic soybean genomic loci to be modified is a
genotnic sequence
selected from loci soy OGL 307 (SEQ ID NO:566), soy OGL_310 (SEQ ID NO:4236),
soy OGL 684 (SEQ ID NO:47), and soy OGL 682 (SEQ ID NO:2101). In a further
embodiment the optimal nongenic soybean genomic loci to be modified is a
genomic sequence
selected fium loci soy OGL 307 (SEQ ID NO:566), soy OGL 310 (SEQ ID NO:4236),
and
soy OGL 684 (SEQ ID NO:47). In a further embodiment the optimal nongenic
soybean
genomic loci to be modified is a genomic sequence selected from loci soy
OGL_307 (SEQ ID
NO:566), and soy_OGL 310 (SEQ ID NO:4236). In a further embodiment the optimal
nongenic soybean genomic loci to be modified is a genomic sequence selected
from loci
soy OGL 310 (SEQ ID NO:4236), soy_OGL_684 (SEQ NO:47), soy_OGL_682 (SEQ ID
NO:2101), and soy OGL 685 (SEQ ID NO:48). In a further embodiment the optimal
nongenic
soybean genomic loci to be modified is a genomic sequence selected from loci
soy OGL 684
(SEQ ID NO:47), soy_OGL 682 (SEQ ID NO:2101), and soy OGL_685 (SEQ ID NO:48).
In
a further embodiment the optimal nongenic soybean genomic loci to be modified
is a genomic
sequence selected from loci soy_OGL_682 (SEQ ID NO:2101), and soy_OGL_685 (SEQ
ID
NO:48).
38
Date regue/Date received 2024-01-16
In a further embodiment the optimal nongenic soybean genomic loci to be
modified is a
genomic sequence selected from loci soy_OGL_307 (SEQ ID NO:566), soy OGL 310
(SEQ
ID NO:4236), and soy OGL 308 (SEQ ID NO:566). In a further embodiment the
optimal
nongenic soybean genomic loci to be modified is a genomic sequence selected
from loci
soy OGL 6362 (SEQ 1D NO:440), soy_OGL_4625 (SEQ ID NO:76), and soy OGL_308
(SEQ ID NO:566). In a further embodiment the optimal nongenic soybean genomic
loci to be
modified is a genomic sequence selected from loci soy OGL 1423 (SEQ ID NO:639)
and
soy OGL_1434 (SEQ NO:137). In a further embodiment the optimal nongenic
soybean
genomic loci to be modified is a genomic sequence selected from loci soy
OGL_682 (SEQ ID
NO:47), soy OGL 684 (SEQ ID NO:2101), and soy OGL_85 (SEQ ID NO:48).
In one embodiment the optimal nongenic soybean genomic loci is selected from
the genomic
sequences of soy ogl_2474 (SEQ ID NO: 1), soy ogl_768 (SEQ ID NO: 506), soy
ogl_2063
(SEQ ID NO: 2063), soy og,1_1906 (SEQ ID NO: 1029), soy ogl_1112 (SEQ ID NO:
1112),
soy ogl_3574 (SEQ ID NO: 1452), soy ogl_2581 (SEQ ID NO: 1662), soy_ogl_3481
(SEQ ID
NO: 1869), soy ogl_1016 (SEQ ID NO: 2071), soy_ogl 937 (SEQ ID NO: 2481),
soy ogl_6684 (SEQ ID NO: 2614), soy_ogl_6801 (SEQ ID NO: 2874), soy_ogl_6636
(SEQ ID
NO; 2970), soy ogl 4665 (SEQ ID NO: 3508), soy 00_3399 (SEQ ID NO: 3676),
soy ogl 4222 (SEA) ID NO: 3993), soy_ogl 2543 (SEQ ID NO: 4050), soy ogl_275
(SEQ ID
NO: 4106), soy_ogl_598 (SEQ ID NO: 4496), soy ogl_1894 (SEQ ID NO: 4622),
soy ogl_5454 (SEQ ID NO: 4875), soy og1_6838 (SEQ ID NO: 4888), soy_ogl_4779
(SEQ ID
NO: 5063), soy ogl_3333 (SEQ ID NO: 5122), soy ogl_2546 (SEQ ID NO: 5520),
soy ogl_796 (SEQ ID NO: 5687), soy ogl_873 (SEQ ID NO: 6087), soy_ogl_5475
(SEQ ID
NO; 6321), soy ogl_2115 (SEQ ID NO: 6520), soy ogl_2518 (SEQ ID NO: 6574),
soy ogl_5551 (SEQ ID NO: 6775), and soy ogl_4563 (SEQ ID NO: 6859).
In one embodiment the optimal nongenic soybean genomic loci is selected from
the
genomic sequences of soy_og1_308 (SEQ ID NO: 43), soy ogl_307 (SEQ ID NO:
566),
soy ogl_2063 (SEQ ID NO: 748), soy ogl_1906 (SEQ ID NO: 1029), soy ogl_262
(SEQ ID
NO: 1376), soy ogl_5227 (SEQ ID NO: 1461), soy_ogl 4074 (SEQ ID NO: 1867),
soy ogl_3481 (SEQ ID NO: 1869), soy...00_1016 (SEQ ID NO: 2071), soy ogl_937
(SEQ ID
NO: 2481), soy ogl_5109 (SEQ ID NO: 2639), soy_ogl_6801 (SEQ ID NO: 2874),
soy ogl_6636 (SEQ ID NO: 2970), soy_ogl 4665 (SEQ ID NO: 3508), soy_og1_6189
(SEQ ID
NO: 3682), soy ogi_4222 (SEQ ID NO: 3993), soy ogl_2543 (SEQ ID NO: 4050),
soy ogl_310 (SEQ ID NO: 4326), soif ogl 2353 (SEQ ID NO: 4593), soy_ogl_l 894
(SEQ ID
39
Date regue/Date received 2024-01-16
NO: 4622), soy ogl_3669 (SEQ ID NO: 4879), soy og,1_3218 (SEQ ID NO: 4932),
soy ogl_5689 (SEQ ID NO: 5102), soy_ogl_3333 (SEQ ID NO: 5122), soy_ogl_2546
(SEQ 11)
NO: 5520), soy ogl_1208 (SEQ ID NO: 5698), soy_ogl_873 (SEQ ID NO: 6087),
soy ogl_5957 (SEQ ID NO: 6515), soy_ogl 4846 (SEQ ID NO: 6571), soy_ogl_3818
(SEQ ID
NO: 6586), soy_ogl_5551 (SEQ ID NO: 6775), soy 00_7 (SEQ ID NO: 6935), soy OGL
684
(SEQ ID NO: 47), soy OGL 682 (SEQ I1) NO: 2101), soy_OGL_685 (SEQ ID NO: 48),
soy_
OGL _1423 (SEQ ID NO: 639), soy OGL _1434 (SEQ ID NO: 137), soy_ OGL _4625
(SEQ
ID NO: 76), and soy_ OGL _6362 (SEQ ID NO: 440),
In one embodiment the optimal nongenic soybean genomic loci is targeted with a
DNA
of interest, wherein the DNA of interest integrates within or proximal to the
zinc finger
nuclease target sites, In accordance with an embodiment, exemplary zinc finger
target sites of
optimal maize select genomic loci are provided in Table 8. In accordance with
an embodiment,
integration of a DNA of interest occurs within or proximal to the exemplary
target sites of: SEQ
ID NO: 7363 and SEQ ID NO: 7364, SEQ ID NO: 7365 and SEQ ID NO: 7366, SEQ ID
NO: 7367 and
SEQ ID NO: 7368, SEQ ID NO: 7369 and SEQ ID NO: 7370, SEQ ID NO: 7371 and SEQ
ID NO:
7372, SEQ ID NO: 7373 and SEQ ID NO: 7374, SEQ ID NO: 7375 and SEQ ID NO:
7376, SEQ ID
NO: 7377 and SEQ ID NO: 7378, SEQ ID NO: 7379 and SEQ ID NO: 7380, SEQ ID NO:
7381 and
SEQ ID NO: 7382, SEQ ID NO: 7383 and SEQ ID NO: 7384, SEQ ID NO: 7385 and SEQ
ID NO:
7386, SEQ ID NO: 7387 and SEQ ID NO: 7388, SEQ ID NO: 7389 and SEQ ID NO:
7390, SEQ ID
NO: 7391 and SEQ ID NO: 7392, SEQ ID NO: 7393 and SEQ ID NO: 7394, SEQ ID NO:
7395 and
SEQ ID NO: 7396, SEQ ID NO: 7397 and SEQ ID NO: 7398, SEQ ID NO: 7399 and SEQ
ID NO:
7400, SEQ ID NO: 7401 and SEQ ID NO: 7402, SEQ ID NO: 7403 and SEQ NO: 7404,
SEQ ID
NO: 7405 and SEQ ID NO: 7406, SEQ ID NO: 7407 and SEQ ID NO: 7408, SEQ ID NO:
7409 and
SEQ ID NO: 7410, SEQ ID NO: 7411 and SEQ ID NO: 7412, SEQ ID NO: 7413 and SEQ
1D NO:
7414, SEQ ID NO: 7415 and SEQ ID NO: 7416, SEQ ID NO: 7417 and SEQ ID NO:
7418, SEQ ID
NO: 7419 and SEQ ID NO: 7420, SEQ ID NO: 7421 and SEQ ID NO: 7422, SEQ ID NO:
7423 and
SEQ ID NO: 7424, SEQ ID NO: 7425 and SEQ ID NO: 7426.
" In one
embodiment the optimal nongenic soybean genomic loci is targeted with a DNA
of interest, wherein the DNA of interest integrates within or proximal to the
zinc finger
nuclease target sites. In accordance with an embodiment, the zinc finger
nuclease binds to the
zinc finger target site and cleaves the unique soybean genomic polynucleotide
target sites,
whereupon the DNA of interest integrates within or proximal to the soybean
genomic
polynucleofide target sites. In an embodiment, integration of the DNA of
interest occurs within
the zinc finger target site may result with rearrangements. In accordance with
one embodiment,
Date regue/Date received 2024-01-16
the rearrangements may comprise deletions, insertions, inversions, and
repeats. In an
embodiment, integration of the DNA of interest proximal to the zinc finger
target site.
According to an aspect of the embodiment, the integration of the DNA is
proximal to the zinc
finger target site, and may integrate within 1.5 Kb, 1.25 Kb, 1.0 Kb, 035 Kb,
0.5 Kb, or 0.25
Kb to the zinc finger target site. Insertion within a genomic region proximal
to the zinc finger
target site is known in the art, see US Patent Pub No, 2010/0257638 AL
In accordance with one embodiment the selected nongenic sequence comprise the
following characteristics:
a) the nongenic sequence does not contain greater than 1% DNA
methylatiort
within the sequence;
b) the nongenic sequence has a relative location value from 0.211 to 0.976
ratio of
genomic distance from a soybean chromosomal centroman;
c) the nongenic sequence has a guanine/cytosine percent content range of
25.62 to
43.76 %; and,
d) the nongenic sequence is from about 1 Kb to about 4.4 Kb in length.
II. Recombinant Derivatives of Identified Optimal Nongenic Soybean Genomic
Loci
In accordance with one embodiment, after having identified a genomic loci of a
dicot
plant, such as a soybean plant, as a highly desirable location for inserting
polynucleotide donor
sequences, one or mom nucleic acids of interest can be inserted into the
identified genomic
locus, in one embodiment the nucleic acid of interest comprises exogenous gene
sequences or
other desirable polynucleotide donor sequences, In another embodiment, after
having identified
a genomic loci of a dicot plant, such as a soybean plant, as a highly
desirable location for
inserting polynucleotide donor sequences, one or more nucleic acids of
interest or the optimal
nongenic soybean genomic loci can optionally be deleted, excised or removed
with the
subsequent integration of the DNA of interest into the identified genomic
locus. In one
embodiment the insertion of a nucleic acid of interest into the optimal
nongenic soybean
genomic loci comprises removal, deletion, or excision of the exogenous gene
sequences or
other desirable polynucleotide donor sequences.
The present disclosure further relates to methods and compositions for
targeted
integration into the select soybean genomic locus using ZENs and a
polynucleotide donor
construct. The methods for inserting a nucleic acid sequence of interest into
the optimal
41
Date regue/Date received 2024-01-16
nongenic soybean genomic loci, unless otherwise indicated, use conventional
techniques in
molecular biology, biochemistry, chromatin structure and analysis, cell
culture, recombinant
DNA and related fields as are within the skill of the art. These techniques
are fully explained in
the literature. See, for example, Sambrook et al. MOLECULAR CLONING: A
LABORATORY MANUAL, Second edition, Cold Spring Harbor Laboratory Press, 1989
and
Third edition, 2001; Ausubel et al., CURRENT PROTOCOLS IN MOLECULAR BIOLOGY,
John Wiley & Sons, New York, 1987 and periodic updates; the series METHODS IN
ENZYMOLOGY, Academic Press, San Diego; Wolfe, CHROMATIN STRUCTURE AND
FUNCTION, Third edition, Academic Press, San Diego, 1998; METHODS IN
ENZYMOLOGY, Vol. 304, "Chromatin" (P. M. Wassatman and A. P. Wolfe, eds.),
Academic
Press, San Diego, 1999; and METHODS IN MOLECULAR BIOLOGY, Vol. 119, "Chromatin
Protocols" (P. B. Becker, ed.) Humana Press, Totowa, 1999.
Methods for Nucleic Acid Insertion into the Soybean Genome
Any of the well known procedures for introducing polynucleotide donor
sequences and
nuclease sequences as a DNA construct into host cells may be used in
accordance with the
present disclosure. These include the use of calcium phosphate transfection,
polybrene,
protoplast fusion, PEG, electroporation, ultrasonic methods (e.g.,
sonoporation), liposomes,
microinjection, naked DNA, plasmid vectors, viral vectors, both episomal and
integrative, and
any of the other well known methods for introducing cloned genomic DNA, cDNA,
synthetic
DNA or other foreign genetic material into a host cell (see, e.g., Sambrook et
al., supra). It is
only necessary that the particular nucleic acid insertion procedure used be
capable, of
successfully introducing at least one gene into the host cell capable of
expressing the protein of
choice.
As noted above, DNA constructs may be introduced into the genome of a desired
plant
species by a variety of conventional techniques. For reviews of such
techniques see, for
example, Weissbach & Weissbach Methods for Plant Molecular Biology (1988,
Academic
Press, N.Y.) Section VIII, pp. 421-463; and Grierson & Corey, Plant Molecular
Biology (1988,
2d Ed.), Blackie, London, Ch. 7-9. A DNA construct may be introduced directly
into the
genomic DNA of the plant cell using techniques such as electroporation and
microinjection of
plant cell protoplasts, by agitation with silicon carbide fibers (See, e.g.,
U.S. Patents 5,302,523
and 5,464,765), or the DNA constructs can be introduced directly to plant
tissue using biolistic
methods, such as DNA particle bombardment (see, e.g., Klein et al. (1987)
Nature 327:70-73).
42
Date regue/Date received 2024-01-16
Alternatively, the DNA construct can be introduced into the plant cell via
nanoparticle
transfonnation (see, e.g., US Patent Publication No. 20090104700.
Alternatively, the DNA
constructs may be combined with suitable T-DNA border/flanking regions and
introduced into
a conventional ,Agrobacterium tumefaciens host vector. 44grobacieriwn
tumefaciens-rnediated
transformaiion techniques, including disarming_ and use of binary vectors, are
well described
in the scientific literature. See, for example Horsch at al. (1984) Science
233:496-498, and
Fraley et al. (1983) Proc. Nat'l. Acad. Sci. USA 80:4803.
In addition, gene transfer may be achieved using non-Agrobacterium bacteria or
viruses
such as Rhizobium sp. NGR234, Sittorhizoboiurn meliloti, Mesorhizobium lot,
potato virus X,
cauliflower mosaic virus and cassava vein mosaic virus and/or tobacco mosaic
virus, See, e.g.,
Chung et al. (2006) Trends Plant Sci. 11(0:1-4. The virulence functions of the
Agrobacterium
turnefaciens host will direct the inscation of a T-strand containing the
construct and adjacent
maker into the plant cell DNA when the cell is infected by the bacteria using
binary T DNA
vector (Bevan (1984) Nuc. Acid Res. 12:8711-8721) or the co-cultivation
procedure (Horsch et
al. (1985) Science 227:1229-1231). Generally, the Agrobacterium transformation
system is
used to engineer dicotyledonous plants (Bevan at al, (1982) Ann, Rev, Genet.
16:357-384;
Rogers et al. (1986) Methods Enzymol. 118:627-641). The Agrobacterium
transformation
system may also be used to transform, as well as transfer, DNA to
monocotyledonous plants
and plant cells. See U.S. Pat. No. 5,591,616; Hernalsteen et al. (1984) EMBO
J. 3:3039-3041;
Honykass-Van Slogteren et al. (1984) Nature 311:763-764; Grirnsley et al.
(1987) Nature
325:1677-179; Boulton at al. (1989) Plant Mol. Biol. 12:31-40; and Gould et
al. (1991) Plant
Physiol, 95:426-434.
Alternative gene transfer and transformation methods include, but are not
limited .to,
protoplast transfomiation through calcium-, polyethylene glycol (PEG)- or
electropomtion-
mediated uptake of naked DNA (see Paszkowski et al, (1984) EMBO J. 3:2717-
2722, Potrykus
et al. (1985) Molec. Gen. Genet. 199:169-177; Fromm at al. (1985) Proc. Nat.
Acad. Sci. USA
82:5824-5828; and Shimamoto (1989) Nature 338:274-276) and electroporation of
plant tissues
(D'Halluin et al. (1992) Plant Cell 4:1495-1505). Additional methods for plant
cell
transformation include microinjection, silicon carbide mediated DNA uptake
(Kaeppler at al.
(1990) Plant Cell Reporter 9:415-418), and rnicroprojectile bombardment (see
Klein et al.
(1988) Proc. Nat. Acad, Sci. USA 85:4305-4309; and Gordon-Kamm et al. (1990)
Plant Cell
2:603-618).
43
Date regue/Date received 2024-01-16
In one embodiment a nucleic acid of interest introduced into a host cell for
targeted
insertion into the genome comprises homologous flanking sequences on one or
both ends of the
targeted nucleic acid of interest. In such an embodiment, the homologous
flanking sequences
contain sufficient levels of sequence identity to a dicot genornic sequence,
such as a genomic
sequence from soybean, to support homologous recombination between it and the
genomic
sequence to which it bears homology. Approximately 25, 50, 100, 200, 500, 750,
1000, 1500, or
2000 nucleotides, or more of sequence identity, ranging from 70% to 100%,
between a donor
and a genomic sequence (or any integral value between 10 and 200 nucleotides,
or more) will
support homologous recombination therebetween.
In another embodiment the targeted nucleic acid of interest lacks homologous
flanking
sequences, and the targeted nucleic acid of interest shares low to very low
levels of sequence
identity with a genomic sequence.
In other embodiments of targeted recombination and/or replacement and/or
alteration of
a sequence in a region of interest in cellular chromatin, a chrom' osomal
sequence is altered by
homologous recombination with an exogenous "donor" nucleotide sequence. Such
homologous
recombination is stimulated by the presence of a double-stranded break in
cellular chromatin, if
sequences homologous to the region of the break are present. Double-strand
breaks in cellular
chromatin can also stimulate cellular mechanisms of non-homologous end
joining. In any of
the methods described herein, the first nucleotide sequence (the "donor
sequence") can contain
sequences that are homologous, but not identical, to genomic sequences in the
region of
interest, thereby stimulating homologous recombination to insert a non-
identical sequence in
the region of interest. Thus, in certain embodiments, portions of the donor
sequence that are
homologous to sequences in the region of interest exhibit between about 80,
85, 90,95, 97.5, to
99% (or any integer therebetween) sequence identity to the genomic sequence
that is replaced.
In other embodiments, the homology between the donor and genomic sequence is
higher than
99%, for example if only 1 nucleotide differs as between donor and genomic
sequences of over
100 contiguous base pairs.
In certain cases, a non-homologous portion of the donor sequence can contain
sequences
not present in the region of interest, such that new sequences are introduced
into the region of
interest. In these instances, the non-homologous sequence is generally flanked
by sequences of
50 to 2000, base
pairs (or any integral value therebetween) or any number of base pairs greater
than 2,000, that are homologous or identical to sequences in the region of
interest. In other
44
Date regue/Date received 2024-01-16
embodiments, the donor sequence is non-homologous to the first sequence, and
is inserted into
the genome by non-homologous recombination mechanisms.
In accordance with one embodiment a zinc finger nuclease (ZFN) is used to
introduce a
double strand break in a targeted genomic locus to facilitate the insertion of
a nucleic acid of
interest. Selection of a target site within the selected genomic locus for
binding by a zinc finger
domain can be accomplished, for example, according to the methods disclosed in
U.S. Patent
6,453,242, that also discloses methods for designing zinc finger proteins
(ZFPs) to bind to
a selected sequence. It will be clear to those skilled in the art that simple
visual inspection
of a nucleotide sequence can also be used for selection of a target site.
Accordingly, any
means for target site selection can be used in the methods described herein.
For ZFP DNA-binding domains, target sites are generally composed of a
plurality of
adjacent target subsites. A target subsite refers to the sequence, usually
either a nucleotide
triplet or a nucleotide quadruplet which may overlap by one nucleotide with an
adjacent
quadruplet that is bound by an individual zinc fmger. See, for example, WO
02/077227. A
target site generally has a length of at least 9 nucleotides and, accordingly,
is bound by a zinc
finger binding domain comprising at least three zinc fingers. However binding
of, for example,
a 4-finger binding domain to a 12-nucleotide target site, a 5-finger binding
domain to a 15-
nucleotide target site or a 6-finger binding domain to an 18-nucleotide target
site, is also possible.
As will be apparent, binding of larger binding domains (e.g., 7-, 8-, 9-finger
and more) to longer
target sites is also consistent with the subject disclosure.
In accordance with one embodiment, it is not necessary for a target site to be
a multiple
of three nucleotides. In cases in which cross-strand interactions occur (see,
e.g., U.S. Patent
6,453,242 and WO 02/077227), one or more of the individual zinc fingers of a
multi-finger
binding domain can bind to overlapping quadruplet subsites. As a result, a
three-finger protein
can bind a 10-nucleotide sequence, wherein the tenth nucleotide is part of a
quadruplet bound
by a terminal finger, a four-finger protein can bind a 13-nucleotide sequence,
wherein the
thirteenth nucleotide is pan of a quadruplet bound by a terminal finger, etc.
The length and nature of amino acid linker sequences between individual zinc
fmgers in
a multi-finger binding domain also affects binding to a target sequence. For
example, the
presence of a so-called "non-canonical linker," "long linker" or "structured
linker" between
adjacent zinc fingers in a multi-finger binding domain can allow those fingers
to bind subsites
Date regue/Date received 2024-01-16
which are not immediately adjacent. Non-limiting examples of such linkers are
described, for
example, in U.S. Pat. No. 6,479,626 and WO 01/53480. Accordingly, one or more
subsites, in
a target site for a zinc finger binding domain, can be separated from each
other by 1, 2, 3, 4, 5
or more nucleotides. One nonlimiting example would be a four-finger binding
domain that
binds to a 13-nucleotide target site comprising, in sequence, two contiguous 3-
nucleotide
subsites, an intervening nucleotide, and two contiguous triplet subsites.
While DNA-binding polypeptides identified from proteins that exist in nature
typically
bind to a discrete nucleotide sequence or motif (e.g., a consensus recognition
sequence), methods
exist and are known in the art for modifying many such DNA-binding
polypeptides to recognize a
different nucleotide sequence or motif. DNA-binding polypeptides include, for
example and
without limitation: zinc finger DNA-binding domains; leucine zippers; UPA DNA-
binding
domains; GALA; TAL; LexA; a Tet repressor; LacR; and a steroid hormone
receptor.
In some examples, a DNA-binding polypeptide is a zinc finger. Individual zinc
ranger
motifs can be designed to target and bind specifically to any of a large range
of DNA sites.
Canonical Cys2His2 (as well as non-canonical Cys3His) zinc finger polypeptides
bind DNA by
inserting an u-helix into the major groove of the target DNA double helix.
Recognition of
DNA by a zinc finger is modular; earl' finger contacts primarily three
consecutive base pairs in
the target, and a few key residues in the polypeptide mediate recognition. By
including multiple
zinc finger DNA-binding domains in a targeting endonuclease, the DNA-binding
specificity of the
targeting aidonuclease may be further increased (and hence the specificity of
any gene regulatory
effects conferred thereby may also be increased). See, e.g.,Urnov et a/.
(2005) Nature 435:646-51.
Thus, one or more zinc finger DNA-binding polypeptides may be engineered and
utilized such that
a targeting endonuclease introduced into a host cell interacts with a DNA
sequence that is unique
within the genome of the host cell.Preferably, the zinc finger protein is non-
naturally occurring
in that it is engineered to bind to a tenet site of choice. See, for example,
Beerli ci al. (2002)
Nature Biotechnol. 20:135-141; Pabo et al, (2001) Ann. Rev. Biochem. 70:313-
340; halm et al.
(2001) Nature Biotechnol. 19:656-660; Segal et al. (2001) Curt Opin.
Biotechnol. 12:632-637;
Choo et al. (2000) Curr. Opin. Struct. Biol. 10:411-416; U.S. Patent Nos.
6,453,242; 6,534,261;
6,599,692; 6,503,717; 6,689,558; 7,030,215; 6,794,136; 7,067,317; 7,262,054;
7,070,934;
7,361,635; 7,253,273; and U.S. Patent Publication Nos. 2005/0064474;
2007/0218528;
2005/0267061.
An engineered zinc finger binding domain can have a novel binding specificity,
compared to a naturally-occurring zinc finger protein. Engineering methods
include, but are not
46
Date regue/Date received 2024-01-16
limited to, rational design and various types of selection. Rational design
includes, for
example, using databases comprising triplet (or quadruplet) nucleotide
sequences and individual
zinc finger amino acid sequences, in which each triplet or quadruplet
nucleofide sequence is
associated with one or more amino acid sequences of zinc fingers which bind
the particular
triplet or quadruplet sequence. See, for example, co-owned U.S. Patents
6,453,242 and
6,534,261.
Alternatively, the DNA-binding domain may be derived from a nuclease. For
example,
the recognition sequences of homing endonucleases and meganucleases such as I-
Scel, 1-CeuI,
PI-PspI, PI-Sce, 1-Sce1V, I-CsmI, I-PanI, 1-Ppol,
I-Crel, I-Tevl, I-TevIl and I-
TevIll are known. See also U.S. Patent No. 5,420,032; U.S. Patent No.
6,833,252; Belfort et
al. (1997) Nucleic Acids Res. 25:3379-3388; Dujon et al. (1989) Gene 82:115-
118; Pcrler et
al. (1994)Nucleic Acids Res. 22, 1125-1127; Jasin (1996) Trends Genet. 12:224-
228;. Gimble
et al. (1996) J. Mol. Biol, 263;163-180; Argast et al, (1998) J. Mol, Biol.
280;345-353 and the
New England Biolabs catalogue. In addition, the DNA-binding specificity of
homing
endonucleases and meganucleases can be engineered to bind non-natural target
sites. See, for
example, Chevalier et al, (2002) Molec. Cell 10:895-905; Epinat et al. (2003)
Nucleic Acids
Res. 31:2952-2962; Ashworth et aL (2006) Nature 441:656-659; Paques et al.
(2007) Current
Gene Therapy 7:49-66; U.S. Patent Publication No. 20070117128.
As another alternative, the DNA-binding domain may be derived from a leucine
zipper
protein. Leucine zippers are a class. of proteins that are involved in protein-
protein interactions
in many emkaryotic regulatory proteins that are important transcription
factors associated with
gene expression. The leucine zipper refers to a common structural motif shared
in these
transcriptional factors across several kingdoms including animals, plants,
yeasts, etc. The
leucine zipper is formed by two polypeptides (homodimer or heterodimer) that
bind to specific
DNA sequences in a manner where the leucine residues are evenly spaced through
an a-helix,
such that the leucine residues of the two polypeptides end up on the same face
of the helix. The
DNA binding specificity of leucine zippers can be utilized in the DNA-binding
domains
disclosed herein.
In some embodiments, the DNA-binding domain is an engineered domain from a TAL
effector derived from the plant pathogen Xanthomonas (see, Miller et al.
(2011) Nature
Biotechnology 29(2):143-8; Bach et al, (2009) Science 29 Oct 2009
(10,I126/science.117881)
and Moscou and Bogdanove, (2009) Science 29 Oct 2009 (I
0.1126/science.I178817; and U.S.
Patent Publication Nos. 20110239315,2011014594) and 20110301073).
47
Date re gu e/Date received 2024-01-16
The CR1SPR (Clustered Regularly Interspaced Short Palindromic RepeatsyCas
(CR1SPR Associated) nuclease system is a recently engineered nuclease system
based on a
bacterial system that can be used for genome engineering. It is based on part
of the adaptive
immune response of many bacteria and Archea. When a virus or plasmid invades a
bacterium,
segments of the invader's DNA are converted into CRISPR RNAs, (crRNA) by the
'immune'
response. This crRNA then associates, through a region of partial
complementarity, with
another type of RNA called tracrRNA to guide the Cas9 nuclease to a region
homologous to the
crRNA in the target DNA called a "protospacer". Cas9 cleaves the DNA to
generate blunt ends
at the DSB at sites specified by a 20-nucleotide guide sequence contained
within the crRNA
transcript. Cas9 requires both the crRNA and the tracrRNA for site specific
DNA recognition
and cleavage, This system has now been engineered such that the crRNA and
tracrRNA can be
combined into one molecule (the "single guide RNA"), and the crRNA equivalent
portion of the
single guide RNA can be engineered to guide the Cas9 nuclease to target any
desired sequence
(see Jinek et al (2012) Science 337, p. 816-821, Jinek et al, (2013), eLife
2:e00471, and David
Segal, (2013) eLife 2:e00563). Thus, the CRISPR/Cas system can be engineered
to create a
double-stranded break (DSB) at a desired target in a genome, and repair of the
DSB can be
influenced by the use of repair inhibitors to cause an increase in error prone
repair.
In certain embodiments, Can protein may be a "functional derivative" of a
naturally
occurring Cas protein. A "functional derivative of a native sequence
polypeptide is a
compound having a qualitative biological property in common with a native
sequence
polypeptide. "Functional derivatives" include, but are not limited to,
fragments of a native
sequence and derivatives of a native sequence polypeptide and its fragments,
provided that they
have a biological activity in common with a corresponding native sequence
polypeptide. A
biological activity contemplated heiran is the ability of the functional
derivative to hydrolyze a
DNA substrate into fragments. The term "derivative" encompasses both amino
acid sequence
variants of polypeptide, covalent modifications, and fusions thereof. Suitable
derivatives of a
Cas polypeptide or a fragment thereof include but are not limited to mutants,
fusions, covalent
modifications of Cas protein or a fragment thereof. Cas protein, which
includes Can protein or a
fragment thereof as well as derivatives of Cas protein or a fragment thereof,
may be obtainable
from a cell or synthesized chemically or by a combination of these two
procedures. The cell
may be a cell that naturally produces Can protein, or a cell that naturally
produces Can protein
and is genetically engineered to produce the endogenous Cas protein at a
higher expression
level or to produce a Cas protein from an exogenously introduced nucleic acid,
which nucleic
48
Date regue/Date received 2024-01-16
acid encodes a Cas that is same or different from the endogenous Can. in some
case, the cell
does not naturally produce Cas protein and is genetically engineered to
produce a Cas protein.
The Cas protein is deployed in mammalian cells (and putatively within plant
cells) by co-
expressing the Cas nuclease with guide RNA. Two forms of guide RNAs can be ued
to
facilitate Cas-mediated genome cleavage as disclosed in Le Gong, F. el al.,
(2013) Science
339(6121):819-823.
In other embodiments the DNA-binding domain may be associated with a cleavage
(nuclease) domain. For example, homing endonucleases may be modified in their
DNA-
binding specificity while retaining nuclease function. In addition, zinc
linger proteins may also
be fined to a cleavage domain to form a zinc finger nuclease (ZFN). The
cleavage domain
portion of the fusion proteins disclosed herein can be obtained from any
endonuclease or
exonuclease_ Exemplary endonucleases from which a cleavage domain can be
derived include,
but are not limited to, restriction endonucleases and homing endonucleases.
See, for example,
2002-2003 Catalogue, New England Biolabs, Beverly, MA; and Belfort et al.
(1997) Nucleic
Acids Res. 25:3379-3388. Additional enzymes which cleave DNA are known (e.g.,
S1
Nuclease; mung bean nuclease; pancreatic DNase I; mierococcal nuclease; yeast
NO
endonuclease; see also Liam et al. (eds.) Nucleases, Cold Spring Harbor
Laboratory
Press,1993). Non limiting examples of homing endonucleases and meganucleases
include 1-
See!, 1-Ceul, PI-PspI, P1-See, 1-SceIV, I-Csml, I-Panl, I-Scell, I-Ppol, 1-
Sce111, 1-CreL I-TevI,
1-TevIl and I-TevIII are known. See also U.S. Patent No. 5,420,032; U.S.
Patent No.
6,833,252; Belfort et al. (1997) Nucleic Acids Res. 25:3379-3388; Dujon et al.
(1989) Gene
82:115-118; Paler et al. (1994) Nucleic Acids Res. 22, 1125-1127; Jasin (1996)
Trends =
Genet. 12:224-228; Gimble et al. (1996) J. Mol. Biol, 263:163-180; Argast et
al. (1998) J.
MoL Biol. 280:345-353 and the New England Biolabs catalogue. One or more of
these
enzymes (or functional fragments thereof) can be used as a source of cleavage
domains and
cleavage half-domains.
Restriction endonucleases (restriction enzymes) are present in many species
and are
capable of sequence-specific binding to DNA (at a recognition site), and
cleaving DNA at or
near the site of binding. Certain restriction enzymes (e.g., Type 11S) cleave
DNA at sites
removed from the recognition site and have separable binding and cleavage
domains. For
example, the Type 115 enzyme Fokl catalyzes double-stranded cleavage of DNA,
at 9
nucleotides from its recognition site on one strand and 13 nucleotides from
its recognition site
on the other. See, for example, US Patents 5,356,802; 5,436,150 and 5,487,994;
as well as Li et
49
Date regue/Date received 2024-01-16
al. (1992) Proc. Natl. Acad. Sci, USA 89:4275-4279; Li et al. (1993) Proc.
Natl. Acad. Sci.
USA 90:2764-2768; Kim et al. (1994a) Proc. Natl. Acad. Sci USA 91:883-887; Kim
et al.
(1994b)3.Biol. Chem. 269:31,978-31,982. Thus, in one embodiment, fusion
proteins comprise
the cleavage domain (or cleavage half-domain) from at least one Type XIS
restriction enzyme
and one or more zinc finger binding domains, which may or may not be
engineered.
An exemplary Type US restriction enzyme, whose cleavage domain is separable
from
the binding domain, is FokI. This particular enzyme is active as a ditner.
Bitinaite at al, (1998)
Proc. Natl. Acad. Sci. USA 95: 10,570-10,575. Accordingly, for the purposes of
the present
disclosure, the portion of the Fokl enzyme used in the disclosed fusion
proteins is considered a
cleavage half-domain. Thus, for targeted double-stranded cleavage and/or
targeted replacement
of cellular sequences using zinc finger-Fokl fusions, two fusion proteins,
each comprising a
Fold cleavage half-domain, can be used to reconstitute a catalytically active
cleavage domain.
Alternatively, a single polypeptide molecule containing a zinc finger binding
domain and two
Fold cleavage half-domains can also be used. Parameters for targeted cleavage
and targeted
sequence alteration using zinc finger-Fold fusions are provided elsewhere in
this disclosure.
A cleavage domain or cleavage half-domain can be any portion of a protein that
retains
cleavage activity, or that retains the ability to multimerize (e.g., dimerize)
to form a functional
cleavage domain. Exemplary Type US restriction enzymes are described in
International
Publication WO 2007/014275.
To enhance cleavage specificity, cleavage domains may also be modified. In
certain
embodiments, variants of the cleavage half-domain are employed these variants
minimize or
prevent homodimerization of the cleavage half-domains. Non-limiting examples
of such
modified cleavage half-domains are described in detail in WO 2007/014275.
In certain
embodiments, the cleavage domain comprises an engineered cleavage half-domain
(also referred to as dimerization domain mutants) that minimize or prevent
homodimerization.
Such embodiments are known to those of skill the art and described for example
in U.S.
Patent Publication Nos. 20050064474; 20060188987; 20070305346 and 20080131962.
Amino acid residues at positions 446, 447, 479, 483, 484, 486, 487, 490, 491,
496, 498, 499,
500, 531, 534, 537, and 538 of Fokl are all targets for influencing
dimerization of the Fold
cleavage half-domains.
Additional engineered cleavage half-domains of Fold that form obligate
heterodimers
can also be used in the ZFNs described herein. Exemplary engineered cleavage
half-domains of
Date regue/Date received 2024-01-16
Fok I that form obligate heterodimess include a pair in which a first cleavage
half-domain
includes mutations at amino acid residues at positions 490 and 538 of Fok 1
and a second
cleavage half-domain includes mutations at amino acid residues 486 and 499. In
one
embodiment, a mutation at 490 replaces Glu (E) with Lys (K); the mutation at
538 replaces Is()
(1) with Lys (K); the mutation at 486 replaced Gin (Q) with Gin (E); and the
mutation at
position 499 replaces Is (I) with Lys (K). Specifically, the engineered
cleavage half-domains
described herein were prepared by mutating positions 490 (E¨+K) and 538 (1-4()
in one
cleavage half-domain to produce an engineered cleavage half-domain designated
"E490K:1538K" and by mutating positions 486 (Q-0E) and 499 (1--+L) in another
cleavage
half-domain to produce an engineered cleavage half-domain designated
"Q486E1499L". The
engineered cleavage half-domains described herein are obligate heterodimer
mutants in which
aberrant cleavage is minimized or abolished. See, e.g., U.S. Patent
Publication No.
2008/0131962. In cestain embodiments, the engineered cleavage half-domain
comprises
mutations at positions 486, 499 and 496 (numbered relative to wild-type Fokl),
for instance
mutations that replace the wild type Gin (Q) residue at position 486 with a
Glu (E) residue,
the wild type Iso (1) residue at position 499 with a Leu (L) residue and the
wild-type Asn (N)
residue at position 496 with an Asp (D) or Glu (E) residue (also referred to
as a "ELD"
and "ELE" domains, respectively), In other embodiments, the engineered
cleavage half-domain
comprises mutations at positions 490, 538 and 537 (numbered relative to wild-
type Fokl), for
instance mutations that replace the wild type Glu (E) residue at position 490
with a Lys (K)
residue, the wild type Iso (I) residue at position 538 with a Lys (K) residue,
and the wild-type
His (H) residue at position 537 with a Lys (K) residue or a Arg (R) residue
(also referred
to as "KKK" and "KKK" domains, respectively). In other embodiments, the
engineered
cleavage half-domain comprises mutations at positions 490 and 537 (numbered
relative to
wild-type Fold), for instance mutations that replace the wild type Glu (E)
residue at position
490 with a Lys (K) residue and the wild-type His (II) residue at position 537
with a Lys (K)
residue or a Arg (R) residue (also referred to as "KIK" and "KIR" domains,
respectively).
(See US Patent Publication No. 20110201055). In
other embodiments, the engineered
cleavage half domain comprises the "Sharkey" and/or "Sharkey' "mutations (see
Guo et al,
(2010) J. Mol, Biol, 400(1):96-107),
Engineered cleavage half-domains described herein can be prepared using any
suitable
method, for example, by site-directed mutagenesis of wild-type cleavage half-
domains (Fok I)
as described in U.S. Patent Publication Nos. 20050064474; 20080131962; and
20110201055.
51
Date regue/Date received 2024-01-16
Alternatively, nucleases may be assembled in vivo at the nucleic acid target
site using so-called
"split-enzyme" technology (see e.g. U.S. Patent Publication No. 20090068164),
Components
of such split enzymes may be expressed either on separate expression
constructs, or can be
linked in one open reading frame where the individual components are
separated, for example,
by a self-cleaving 2A peptide or IRES sequence. Components may be individual
zinc finger
binding domains or domains of a meganuclease nucleic acid binding domain.
Nucleases can be screened for activity prior to use, for example in a yeast-
based
chromosomal system as described in WO 2009/042163 and 20090068164. Nuclease
expression
constructs can be readily designed using methods known in the art. See, e.g.,
United States
Patent Publications 20030232410; 20050208489; 20050026157; 20050064474;
20060188987;
20060063231; and International Publication WO 07/014275, Expression of the
nuclease may
be under the control of a constitutive promoter or an inducible promoter, for
example the
galactokinase promoter which is activated (delep ____________________ essed)
in the presence of raffinose and/or
galactose and repressed in presence of glucose.
Distance between target sites refers to the number of nucleotides or
nucleotide pairs
intervening between two target sites as measured from the edges of the
sequences nearest each
other. In certain embodiments in which cleavage depends on the binding of two
zinc finger
domain/cleavage half-domain fusion molecules to separate target sites, the two
target sites can
be on opposite DNA strands. In other embodiments, both target sites are on the
same DNA
strand. For targeted integration into the optimal genomic locus, one or more
ZPPs are
engineered to bind a target site at or near the predetermined cleavage site,
and a fusion protein
comprising the engineered DNA-binding domain and a cleavage domain is
expressed in the
cell Upon binding of the zinc finger portion of the fusion protein to the
target site, the DNA is
cleaved, preferably via a double-stranded break, near the target site by the
cleavage domain.
The presence of a double-stranded break in the optimal genomic locus
facilitates
integration of exogenous sequences via homologous recombination. Thus, in one
embodiment
the polynucleotide comprising the nucleic acid sequence of interest to be
inserted into the
targeted genomic locus will include one or more regions of homology with the
targeted
genomic locus to facilitate homologous recombination.
In addition to the fusion molecules described herein, targeted replacement of
a selected
genomic sequence also involves the introduction of a donor sequence. The
polynucleotide
donor sequence can be introduced into the cell prior to, concurrently with, or
subsequent to,
expression of the fusion protein(s). The donor polynucleotide contains
sufficient homology to
52
Date regue/Date received 2024-01-16
the optimal genomic locus to support homologous recombination between it and
the optimal
, genomic locus genomic sequence to which it bears homology. Approximately 25,
50, 100, 200,
500, 750, 1,000, 1,500, 2,000 nucleotides or more of sequence homology between
a donor and a
genomic sequence, or any integral value between 10 and 2,000 nucleotides or
more, will
support homologous recombination. In certain embodiments, the homology arms
are less than
1,000 basepairs in length. In other embodiments, the homology arms are less
than 750 base
pairs in length. Additionally, donor polynucleotide sequences can comprise a
vector molecule
containing sequences that are not homologous to the region of interest in
cellular chromatin. A
donor polynucleotide molecule can contain several, discontinuous regions of
homology to
cellular chromatin. For example, for targeted insertion of sequences not
normally present in a
region of interest, said sequences can be present in a donor nucleic acid
molecule and flanked
by regions of homology to sequence in the region of interest. The
donor polynucleotide
can be DNA or RNA, single-stranded or double-stranded and can be introduced
into a cell in
linear or circular form. See, e.gõ U.S. Patent Publication Nos. 20100047805,
20110281361,
20110207221 and U.S. Application No. 13/889,162. If introduced in linear form,
the ends of the
donor sequence can be protected (e.g., from exonucleolytic degradation) by
methods known to
those of skill in the art. For example, one or more dideoxynucleotide residues
are added to the
3' terminus of a linear molecule and/or self-complementary oligonucleotides
are ligated to one
or both ends. See, for example, Chang et at (1987) Proc. Natl. Aced Sci, USA
84:4959-4963;
Nehls et al. (1996) Science 272:886-889. Additional methods for protecting
exogenous
polynucleofides from degradation include, but are not limited to, addition of
terminal amino
group(s) and the use of modified intemucleotide linkages such as, for example,
phosphorothioates, phosphoramidates, and 0-methyl ribose or deoxyribose
residues.
In accordance with one embodiment a method of preparing a transgenic dicot
plant,
such as a soybean plant, is provided wherein a DNA of interest has been
inserted into an
optimal nongenic soybean genomic locus. The method comprises the steps of:
a. selecting an optimal nongenic soybean locus as a target for insertion of
the
nucleic acid of interest;
b. introducing a site specific nuclease into a dicot plant cell, such as a
soybean
plant cell, wherein the site specific nuclease cleaves the nongenic sequence;
c. introducinethe DNA of interest into the plant cell; and
d. selecting transgenic plant cells comprising the DNA of interest targeted
to said
nongenic sequence.
$3
Date regue/Date received 2024-01-16
In accordance with one embodiment a method of preparing a transgenic dicot
protoplast
cell, like a soybean protoplast cell, is provided wherein a DNA of interest
has been inserted into
an optimal nongenic soybean genomic locus. The method comprises the steps of:
a. selecting an optimal nongenic soybean locus as a target for insertion of
the
nucleic acid of interest;
b. introducing a site specific nuclease into a dicot protoplast cell, like
a soybean
protoplast cell, wherein the site specific nuclease cleaves the nongenic
sequence;
c. introducing the DNA of interest into the diet* protoplast cell, like a
soybean
protoplast cell; and
d. selecting the
transgenic dicot protoplast cell, like a soybean protoplast cell,
comprising the DNA of interest targeted to said nongenic sequence.
In one embodiment the site specific nuclease is selected from the group
consisting of a
Zinc Finger nuclease; a CRISPR nuclease, a TALEN nuclease, or a megarmclease,
and more
particularly in one embodiment the site specific nuclease is a Zinc Finger
nuclease. In
accordance with one embodiment the DNA of interest is integrated within said
nongenic
sequence via a homology directed repair integration method. Alternatively, in
some
embodiments the DNA of interest is integrated within said nongenic sequence
via a non-
homologous end joining integration method. In additional embodiments, the DNA
of interest
is integrated within said nongenic sequence via a previously undescribed
integration method. In
one embodiment the method comprises selecting a optimal nongenic soybean
genomic locus for
targeted insertion of a DNA of interest that has the following
characteristics:
a. the nongenic sequence is at least 1 Kb in length and does not contain
greater than
1% DNA methylation within the sequence
b. the nongenic sequence exhibits a 0.01574 to 83.52 cM/Mb rate of
recombination
within the dicot genome, like a soybean genome;
c. the nongenic sequence exhibits a 0 to 0.494 level of nucleosome
occupancy of
the dicot genome, like a soybean genome;
d. the nongenic sequence shares less than 40% sequence identity with any
other
sequence contained in the dicot genome, like a soybean genome;
e. the nongenic
sequence has a relative location value from 0 to 0.99682 ratio of
genomic distance from a dicot chromosomal centrornere, like soybean;
f. the
nongenic sequence has a guanine/cytosine percent content range of 14.4 to
45.9%;
54
Date regue/Date received 2024-01-16
g. the nongenic sequence is located proximally to a genic sequence; and,
h. a 1 Mb region of dicot genomic sequence, like a soybean genomic
sequence,
comprising said nongenic sequence comprises one or more additional nongenic
sequences_ In
one embodiment the optimal nongenic soybean locus is selected from a loci of
cluster 1, 2, 3, 4,
5, 6, 7, 8, 9, 10, 11, 2, 3, 4, 5, 6, 7, 8, 9, 20, 21, 22, 23, 24, 25, 26, 27,
28, 29, 30, 31 OF 32.
Delivery
The donor molecules disclosed herein are integrated into a genome of a cell
via targeted,
homology-independent and/or homology-dependent methods. For such targeted
integration, the
genome is cleaved at a desired location (or locations) using a nuclease, for
example, a fusion
between a DNA-binding domain (e.g, zinc finger binding domain, CRISPR or TAL
effector
domain is engineered to bind a target site at or near the predetermined
cleavage site) and
nuclease domain (e.g., cleavage domain or cleavage half-domain). In certain
embodiments, two
fusion proteins, each comprising a DNA-binding domain and a cleavage half-
domain, are
explessed in a cell, and bind to target sites which are juxtaposed in such a
way that a functional
cleavage domain is reconstituted and DNA is cleaved in the vicinity of the
target sites. In one
embodiment, cleavage occurs between the target sites of the two DNA-binding
domains. One
or both of the DNA-binding domains can heengineered. See, also, U.S. Patent
No. 7,888,121;
U.S. Patent Publication 20050064474 and International Patent Publications
W005/084190,
W005/014791 and W0031080809.
The nucleases as described herein can be introduced as polypeptides and/or
polynucleotides. For example, two polynucleotides, each comprising sequences
encoding one
of the aforementioned polypeptides, can be introduced into a cell, and when
the polypeptides
are expressed and each binds to its target sequence, cleavage occurs at or
near the target
sequence. Alternatively, a single polynucleotide comprising sequences encoding
both fusion
polypeptides is introduced into a cell. Polynucleotides can be DNA, RNA or any
modified
forms or analogues or DNA and/or RNA.
Following the introduction of a double-stranded break in the region of
interest, the
transgene is integrated into the region of interest in a targeted manner via
non-homology
dependent methods (e.g., non-homologous end joining (NHEJ)) following
linearization of a
double-stranded donor molecule as described herein. The double-stranded donor
is preferably
linearized in vivo with a nuclease, for example one or more of the same or
different nucleases
that are used to introduce the double-stranded break in the genome.
Synchronized cleavage of
Date regue/Date received 2024-01-16
the chromosome and the donor in the cell may limit donor DNA degradation (as
compared to
linearization of the donor molecule prior to introduction into the cell). The
nuclease target sites
used for linearization of the donor preferably do not disrupt the transgene(s)
sequence(s).
The transgene may be integrated into the genome in the direction expected by
simple
ligation of the nuclease overhangs (designated "forward" or "AB" orientation)
or in the
alternate direction (designated -reverse" or -BA" orientation). In certain
embodiments, the
transgene is integrated following accurate ligation of the donor and
chromosome overhangs. In
other embodiments, integration of the transgene in either the BA or AB
orientation results in
deletion of several nucleotides.
Through the application of techniques such as these, the cells of virtually
any species may
be stably transformed. In some embodiments, transfomiing DNA is integrated
into the genome of
the host cell. In the case of multicellular species, transgenic cells may be
regenerated into a
transgenic organism. Any of these techniques maybe used to produce a
transgenic plant, for
example, comprising one or more donor polynucleotide acid sequences in the
genome of the
transgenic plant.
The delivery of nucleic acids may be introduced into a plant cell in
embodiments of the
invention by any method known to those of skill in the art, including, for
example and without
limitation: by transformation of protoplasts (See, e.g.,U U.S. Patent
5,508,184); by
desiccation/inhibition-mediated DNA uptake (See, e.g., Potrykus et al. (1985)
Mol. Gen. Genet.
199:183-8); by electroporation (See, e.g., U.S. Patent 5,384,253); by
agitation with silicon carbide
fibers (See, e.g., U.S. Patents 5,302,523 and 5,464,765); by Agrobacterium-
mediated
transformation (See, e.g, U.S. Patents 5,563,055, 5,591,616,5,693,512,
5,824,877, 5,981,840, and
6,384,301);, by acceleration of DNA-coated particles (See, e.g., U.S. Patents
5,015,580, 5,550,318,
5,538,880,6,160,208,6,399,861, and 6,403,865) and by Nanoparticles,
nanocarriers and cell
penetrating peptides (W0201126644A2; W02009046384A1; W02008148223A1) in the
methods to deliver DNA, RNA, Peptides and/or proteins or combinations of
nucleic acids and
peptides into plant cells.
The most widely-utilized method for introducing an expression vector into
plants is based
on the natural transformation system of Agrobacterium. A. noncraciens and A.
rhizogenes are
plant pathogenic soil bacteria that genetically transform plant cells. The I";
and Rj plasmids of A.
tumfaciens and A. rhizogenes, respectively, carry genes responsible for
genetic transformation of
the plant. The TI(tumor-inducing)-plasmids contain a large segment, known as T-
DNA, which is
transferred to transformed plants. Another segment of the Ti plasmid, the vii
region, is responsible
56
Date regue/Date received 2024-01-16
for T-DNA transfer. The T-DNA region is bordered by left-hand and right-hand
borders that are
each composed .of terminal repeated nucleotide sequences. In some modified
binary vectors, the
tumor-inducing genes have been deleted, and the functions of the vir region
are utilized to transfer
foreign DNA bordered by the T-DNA border sequences. The T-region may also
contain, for
example, a selectable marker for efficient recovery of transgenic plants and
cells, and a multiple
cloning site for inserting sequences for transfer such as a nucleic acid
encoding a fusion protein of
the invention.
Thus, in some embodiments, a plant transformation vector is derived from a Ti
plasmid of
A. twnefaciens (See, e.g., U.S. Patent Nos. 4,536,475, 4,693,977, 4,886,937,
and 5,501,967; and
European Patent EP 0 122 791) or a 12; plasmid of A. rhizogenes. Additional
plant transformation
vectors include, for example and without limitation, those described by
Herrera-Estrella et a/.
(1983) Nature 303:209-13; Bevan et aL (1983), supra-, Klee et al. (1985)
Bioffechnol. 3:637-42;
and in European Patent El' 0 120516, and those derived from any of the
foregoing. Other
bacteria, such as Sinorhfrobium,Rhizobium, and Mesorhizobium, that naturally
interact with plants
can be modified to mediate gene transfer to a number of diverse plants. These
plant-associated
symbiotic bacteria can be made competent for gene transfer by acquisition of
both a disarmed Ti
plasmid and a suitable binary vector.
The Nucleic Acid of Interest
The polynucleotide donor sequences for targeted insertion into a genomic locus
of a
dicot plant, like a soybean plant, typically range in length from about 10 to
about 5,000
nucleotides. However, nucleotides substantially longer, up to 20,000
nucleotides can be used,
including sequences of about 5, 6, 7, 8, 9, 10, 11 and 12 Kb in length.
Additionally, donor
sequences can comprise a vector molecule containing sequences that are not
homologous to the
replaced region. In one embodiment the nucleic acid of interest will include
one or more
regions that share homology with the targeted genomic loci. Generally, the
homologous
region(s) of the nucleic acid sequence of interest will have at least 50%
sequence identity to a
genomic sequence with which recombination is desired. In certain embodiments,
the
homologous region(s) of the nucleic acid of interest shares 60%, 70%, 80%,
90%, 95%, 98%,
990/, or 99.9% sequence identity with sequences located in the targeted
genomic locus.
However, any value between I% and 100% sequence identity can be present,
depending upon
the length of the nucleic acid of interest.
57
Date regue/Date received 2024-01-16
A nucleic acid of interest can contain several, discontinuous regions of
sequence sharing
relatively high sequence identity to cellular chromatin, For example, for
targeted insertion of
sequences not normally present in a targeted genomic locus, the unique
sequences can be
present in a donor nucleic acid molecule and flanked by regions of sequences
that share a
relatively high sequence identity to a sequence present in the targeted
genomic locus.
A nucleic acid of interest can also be inserted into a targeted genomic locus
to serve as a
reservoir for later use. For example, a first nucleic acid sequence comprising
sequences
homologous to a nongenic region of the genome of a dicot plant, like a soybean
plant, but
containing a nucleic acid of interest (optionally encoding a ZFN under the
control of an
inducible promoter), may be inserted in a targeted genomic locus. Next, a
second nucleic acid
sequence is introduced into the cell to induce the insertion of a DNA of
interest into an optimal
nongenic genomic locus of a dicot plant, like a soybean plane Either the first
nucleic acid
sequence comprises a ZFN specific to the optimal nongenic soybean genomic
locus and the
second nucleic acid sequence comprises the DNA sequence of interest, or vice
versa, In one
embodiment the ZFN will cleave both the optimal nongenic soybean genomic locus
and the
nucleic acid of interest. The resulting double stranded break in the genome
can then become
the integration site for the nucleic acid of interest released from the
optimal genomic locus.
Alternatively, expression of a ZFN already located in the genome can be
induced after
introduction of the DNA of interest to induce a double stranded break in the
genome that can
then become the integration site for the introduced nucleic acid of interest.
In this way, the
efficiency of targeted integration of a DNA of interest at any region of
interest may be
improved since the method does not rely on simultaneous uptake of both the
nucleic acids
encoding the ZFNs and the DNA of interest.
A nucleic acid of interest can also be inserted into an optimal nongenic
soybean
genomic locus to serve as a target site for subsequent insertions. For
example, a nucleic acid of
interest comprised of DNA sequences that contain recognition sites for
additional ZFN designs
may be inserted into the locus. Subsequently, additional ZFN designs may be
generated and
expressed in cells such that the original nucleic acid of interest is cleaved
and modified by
repair or homologous recombination. In this way, reiterative integrations of
nucleic acid of
interests may occur at the optimal nongenic genomic locus of a dicot plant,
like a soybean plant.
Exemplary exogenous sequences that can be inserted into an optimal nongenic
soybean
genomic locus include, but are not limited to, any polypeptide coding sequence
(e.g., cDNAs),
promoter, enhancer and other regulatory sequences (e.g., interfering RNA
sequences, shRNA
58
Date regue/Date received 2024-01-16
expression cassettes, epitope tags, marker genes, cleavage enzyme recognition
sites and various
types of expression constructs. Such sequences can be readily obtained using
standard
molecular biological techniques (cloning, synthesis, etc.) and/or are
commercially available.
To express ZFNs, sequences encoding the fusion proteins are typically
subcloned into
an expression vector that contains a promoter to direct transcription.
Suitable prokaryotic and
eukaryotie promoters are well known in the art and described, e.g., in
Sambrook et at.,
Molecular Cloning, A Laboratory Manual (2nd ed. 1989; 3rd ed., 2001);
1Criegler, Gene
Transfer and Expression: A Laboratory Manual (1990); and Current Protocols in
Molecular
Biology (Ausubel et al., supra. Bacterial expression systems for expressing
the ZFNs are
available in, e.g.. E. coli, Bacillus sp., and Salmonella (PaIva et al,, Gene
22:229-235 (1983)).
Kits for such expression systems are commercially available. Eukaryotic
expression systems
for mammalian cells, yeast, and insect cells are well known by those of skill
in the art and are
also commercially available.
The particular expression vector used to transport the genetic material into
the cell is
selected with regard to the intended use of the fusion proteins, e.g.,
expression in plants,
animals, bacteria, fungus, protozoa, etc. (see expression vectors described
below). Standard
bacterial and animal expression vectors are known in the art and are described
in detail, for
example, U.S. Patent Publication 20050064474A1 and International Patent
Publications
W005/084190, W005/014791 and W003/080809.
Standard transfection methods can be used to produce bacterial, mammalian,
yeast or
insect cell lines that express large quantities of protein, which can then be
purified using
standard techniques (see, e.g., Colley et al., J. Biol. Chem. 264:17619-17622
(1989); Guide to
Protein Purification, in Methods in Enzymology, vol, 182 (Deutscher, ed.,
1990)).
Transformation of eulcaryotic and prokaryotic cells are performed according to
standard
techniques (see, e.g., Morrison, J. Bad. 132:349-351 (1977); Clark-Curtiss &
Curtiss, Methods
in Enzymology 101:347-362 (Wu et al., eds., 1983).
The disclosed methods and compositions can be used to insert polynucleotide
donor
sequences into a predetermined location such as one of the optimal nongenic
soybean genomic
loci. This is useful inasmuch as expression of an introduced transgene into
the soybean genome
depends critically on its integration site. Accordingly, genes encoding
herbicide tolerance,
insect resistance, nutrients, antibiotics or therapeutic molecules can be
inserted, by targeted
recombination.
59
Date regue/Date received 2024-01-16
In one embodiment the nucleic acid of interest is combined or "stacked" with
gene
encoding sequences that provide additional resistance or tolerance to
glyphosate or another
herbicide, and/or provides resistance to select insects or diseases and/or
nutritional
enhancements, and/or improved agronomic characteristics, and/or proteins or
other products
useful in feed, food, industrial, pharmaceutical or other uses. The "stacking"
of two or more
nucleic acid sequences of interest within a plant genome can be accomplished,
for example, via
conventional plant breeding using two or more events, transformation of a
plant with a
construct which contains the sequences of interest, re-transformation of a
transgenic plant, or
addition of new traits through targeted integration via homologous
recombination.
Such polynucleotide donor nucleotide sequences of interest include, but are
not limited
to, those examples provided below:
1. Genes or Coding Sequence (e.g. iRNA) That Confer Resistance to Pests or
Disease
(A) Plant Disease Resistance Genes. Plant defbnses are often activated by
specific
interaction between the product of a disease resistance gene (R) in the plant
and the product of a
corresponding avirulence (Avr) gene in the pathogen. A plant variety can be
transformed with
cloned resistance gene to engineer plants that are resistant to specific
pathogen strains.
Examples of such genes include, the tomato Cf-9 gene for resistance to
Cladosporium fulvum
(Jones et al., 1994 Science 266:789), tomato Pto gene, which encodes a protein
kinase, for
resistance to Pseudomonas syringae pv. tomato (Martin et al., 1993 Science
262:1432), and
Arabidopsis RSSP2 gene for resistance to Pseudomonas syringae (Mindrinos et
al., 1994 Cell
78:1089).
(B) A Bacillus thuringiensis protein, a derivative thereof or a synthetic
polypeptide
modeled thereon, such as, a nucleotide sequence of a Bt Erendotoxin gene
(Geiser et al., 1986
Gene 48:109), and a vegetative insecticidal (VIP) gene (see, e.g., Estruch et
al. (1996) Proc.
Natl. Acad. Sci. 93:5389-94). Moreover, DNA molecules encoding 8-endotoxin
genes can be
purchased from American Type Culture Collection (Rockville, Md.), under ATCC
accession
numbers 40098,67136, 31995 and 31998.
(C) A lectin, such as, nucleotide sequences of several Clivia miniata mannose-
binding
lectin genes (Van Damme et al., 1994 Plant Molec. Biol. 24:825).
(D) A vitamin binding protein, such as avidin and avidin homologs which are
useful as
larvicides against insect pests. See U.S. Pat. No. 5,659,026.
Date regue/Date received 2024-01-16
(E) An enzyme inhibitor, e.g., a protease inhibitor or an amylase inhibitor.
Examples of
such genes include a rice cysteine proteinase inhibitor (Abe et at, 1987 J.
Biol. Chem,
262:16793), a tobacco proteinase inhibitor 1 (Huub et al., 1993 Plant Molec_
Biol. 21:985), and
an a-amylase inhibitor (Surnitani et al., 1993 Biosci. Biotech. Biochem.
57:1243).
(F) An insect-specific hormone or pheromone such as an ecdysteroid and
juvenile
hormone a variant thereof, a mimetic based thereon, or an antagonist or
agonist thereof, such as
baculovirus expression of cloned juvenile hormone esterase, an inactivator of
juvenile hormone
(Hammock et al., 1990 Nature 344:458).
(G) An insect-specific peptide or neuropeptide which, upon expression,
disrupts the
physiology of the affected pest (J. Biol. Chem. 269:9). Examples of such genes
include an
insect diuretic hormone receOtor (Regan, 1994), an allostatin identified in
Diploptem punctata
(Pratt, 1989), and insect-specific, paralytic neurotoxins (U.S. Pat. No.
5,266,361).
(H) An insect-specific venom produced in nature by a snake, a wasp, etc., such
as a
scorpion insectotoxic peptide (Pang, 1992 Gene 116:165).
(I) An enzyme responsible for a hyperaccumulation of monoterpene, a
sesquiterpene, a
steroid, hydroxamic acid, a phenylpropanoid derivative or another non-protein
molecule with
insecticidal activity.
(4 An enzyme involved in the modification, including the post-translational
modification, of a biologically active molecule; for example, glycolytic
enzyme, a proteolytic
enzyme, a lipolytic enzyme, a nuclease, a cyclase, a transaminase, an
esterase, a hydrolase, a
phosphatase, a kinase, a phosphorylase, a polymerase, an elastase, a chitinase
and a glucanase,
whether natural or synthetic. Examples of such genes include, a callas gene
(PCT published
application W093/02197), chitinase-encoding sequences (which can be obtained,
for example,
from the ATCC under accession numbers 3999637 and 67152), tobacco hookworm
chitinase
(Kramer et al.õ 1993 Insect Molec. Biol. 23:691), and parsley ubi4-2
polyubiquitin gene
(Kawalleck et al., 1993 Plant Molec. Biol. 21:673).
(K) A molecule that stimulates signal transduction. Examples of such molecules
include
nucleotide sequences for mung bean calmodulin cDNA clones (Botella et al.,
1994 Plant Molec.
Biol. 24:757) and a nucleotide sequence of a soybean cahnodulin cDNA clone
(Griess et al.,
1994 Plant Physiol. 104:1467).
(L) A hydrophobic moment peptide. See U.S. Pat. Nos. 5,659,026 and 5,607,914;
the
latter teaches synthetic antimicrobial peptides that confer disease
resistance.
61
Date regue/Date received 2024-01-16
(M) A membrane permease, a channel former or a channel bloater, such as a
cecropin-P
lytic peptide analog (Jaynes e4 aL, 1993 Plant Sci. 89:43) which renders
transgenic tobacco
plants resistant to Pseudomonas solanacearum.
(N) A viral-invasive protein or a complex toxin derived therefrom. For
example, the
accumulation of viral coat proteins in transformed plant cells imparts
resistance to viral
infection and/or disease development effected by the virus from which the coat
protein gene is
derived, as well as by related viruses. Coat protein-mediated resistance has
been conferred upon
transformed plants against alfalfa mosaic virus, cucumber mosaic virus,
tobacco streak virus,
potato virus X, potato virus Y, tobacco etch virus, tobacco rattle virus and
tobacco mosaic virus.
See, for example, Beachy et al. (1990) Ann. Rev. Phytopatkol. 28:451.
(0) An insect-specific antibody or an immunotoxin derived therefrom. Thus, an
antibody targeted to a critical metabolic function in the insect gut would
inactivate an affected
enzyme, killing the insect. For example, Taylor et al. (1994) Abstract #497,
Seventh Intl.
Symposium on Molecular Plant-Microbe Interactions shows enzymatic inactivation
in
transgenic tobacco via production of single-chain antibody fragments.
(P) A virus-specific antibody. See, for example, Tavladoraki et al. (1993)
Nature
266:469, which shows that transgenic plants expressing recombinant antibody
genes are
protected from virus attack.
(Q) A developmental-arrestive protein produced in nature by a pathogen or a
parasite.
Thus, fungal endo a-1,4-D polygalacturonases facilitate fimgal colonization
and plant nutrient
release by solubilizing plant cell wall homo-a-1,4-D-galacturonase (Lamb et
at., 1992)
Bio/Technology 10:1436. The cloning and characterization of a gene which
encodes a bean
endopolygalacturonase-inhibiting protein is described by Toubart et al. (1992
Plant J. 2:367).
(R) A developmental-arrestive protein produced in nature by a plant, such as
the barley
ribosome-inactivating gene that provides an increased resistance to fungal
disease (Longemann
et al., 1992). Bio/Technology 10:3305.
(S) RNA interference, in which an RNA molecule is used to inhibit expression
of a
target gene. An RNA molecule in one example is partially or fully double
stranded, which
triggers a silencing response, resulting in cleavage of dsRNA into small
interfering RNAs,
which are then incorporated into a targeting complex that destroys homologous
mRNAs. See,
e.g., Fire et al., US Patent 6,506,559; Graham et al. US Patent 6,573,099.
2. Genes That Confer Resistance to a Herbicide
62
Date regue/Date received 2024-01-16
(A) Genes encoding resistance or tolerance to a herbicide that inhibits the
growing point
or meristem, such as an imidazalinone, sulfonanilide or sulfonylurea
herbicide. Exemplary
genes in this category code for mutant acetolactate synthase (ALS) (Lee et
al., 1988 EMBOJ.
7:1241) also known as acetohydroxyacid synthase (AHAS) enzyme (Miki et al.,
1990 Theor.
Appl. Genet. 80:449).
(B) One or more additional genes encoding resistance or tolerance to
glyphosate
imparted by mutant EPSP synthase and aroA genes, or through metabolic
inactivation by genes
such as DOT-28, 2mEPSPS, OAT (glyphosate acetyltransferase) or OGX (glyphosate
oxidase)
and other phosphono compounds such as glufosinate (pat,bar, and dsm-2 genes),
and
aryloxyphenoxypropionic acids and cyclohexanediones (ACC.ase inhibitor
encoding genes).
See, for example, U.S, Pat. No. 4,940,835, which discloses the nucleotide
sequence of a form of
EPSP which can confer glyphosate resistance. A DNA molecule encoding a mutant
aroA gene
can be obtained under ATCC Accession Number 39256, and the nucleotide sequence
of the
mutant gene is disclosed in U.S. Pat. No. 4,769,061. European patent
application No. 0 333 033
and U.S. Pat. No. 4,975,374 disclose nucleotide sequences of glutamine
synthetase genes which
confer resistance to herbicides such as L-phosphinothricin. The nucleotide
sequence of a
phosphinothricinacetyl-transferase gene is provided in European application
No. 0 242 246. De
Greef et al. (1989) Bio/Technology 7:61 describes the production of transgenic
plants that
express chimeric bar genes coding for phosphinothricin acetyl transferase
activity. Exemplary
of genes conferring resistance to aryloxyphenoxypropionic acids and
cyclohexanediones, such
as sethoxydim and haloxyfop, are the Accl-S1, Accl-S2 and Accl-S3 genes
described by
Marshall et al. (1992) Theor. Appl. Genet. 83:435.
(C) Genes encoding resistance or tolerance to a herbicide that inhibits
photosynthesis,
such as a triazine (psbA and gs+ genes) and a benzonitrile (nitrilase gene).
Przibilla et al. (1991)
Plant Cell 3:169 describe the use of plasmids encoding mutant psbA genes to
transform
Chlamydomonas. Nucleotide sequences for nitrilase genes are disclosed in U.S.
Pat. No.
4,810,648, and DNA molecules containing these genes are available under ATCC
accession
numbers 53435, 67441 and 67442. Cloning and expression of DNA coding for a
glutathione S-
transferase is described by Hayes et al. (1992) Biochem. I. 285:173.
(D) Genes encoding resistance or tolerance to a herbicide that bind to
hydroxyphenylpyruvate dioxygenases (HPPD), enzymes which catalyze the reaction
in which
para-hydroxyphenylpyruvate (HPP) is transformed into homogentisate. This
includes herbicides
such as iscotazoles (EP418175, EP470856, EP487352, EP527036, EP560482,
EP682659, U.S.
63
Date regue/Date received 2024-01-16
Pat. No. 5,424,276), in particular isoxaflutole, which is a selective
herbicide for soybean,
diketonitriles (EP496630, EP496631), in, particular 2-cyano-3-cyclopropy1-1-(2-
S02CH3-4-
CF3 ph enyl)propane-1,3-di one and 2-
cyano-3-cyclopropy1-1-(2-SO2CH3-4-
2,3C12phenyppropane-1,3-dione, triketones (EP625505, EP625508, U.S. Pat. No.
5,506,195),
in particular suleotrione, and pyrazolinates. A gene that produces an
overabundance of HPPD in
plants can provide tolerance or resistance to such herbicides, including, for
example, genes
described in U.S. Patent Nos. 6,268,549 and 6,245,968 and U.S. Patent
Application, Publication
No. 20030066102.
(E) Genes encoding resistance or tolerance to phenoxy auxin herbicides, such
as 2,4-
dichlorophenoxyacetic acid (2,4-0) and which may also confer resistance or
tolerance to
aryloxyphenoxypropionate (AOPP) herbicides. Examples of such genes include the
a-
ketoglutarate-dependent dioxygenase enzyme (and- I) gene, described in U.S.
Patent No.
7,838,733.
(F) Genes encoding resistance or tolerance to phenoxy auxin herbicides, such
as 2,4-
dichlorophenoxyacetic acid (2,4-0) and which may also confer resistance or
tolerance to
pyridyloxy auxin herbicides, such as fluroxypyr or triclopyr. Examples of such
genes include
the a-ketoglutarate-dependent dioxygenase enzyme gene (aad-12), described in
WO
2007/053482 A2.
(G) Genes encoding resistance or tolerance to dicamba (see, e.g., U.S.
Patent
Publication No. 20030135879).
(H) Genes providing resistance or tolerance to herbicides that inhibit
protoporphyrinogen oxidase (PPO) (see U.S. Pat. No. 5,767,373).
(1) Genes providing resistance or tolerance to triazine herbicides (such as
atrazine) and
urea derivatives (such as diuron) herbicides which bind to core proteins of
photosystem II
reaction centers (PS 11) (See Brussian et. at., (1989) EMBO .1. 1989, 8(4):
1237-1245.
1 Genes That Confer or Contribute to a Value-Added Trait
(A) Modified fatty acid metabolism, for example, by transforming soybean or
Brassies
with an antisense gene or stearoyl-ACP desaturase to increase stearic acid
content of the plant
(ICnultzon et al., 1992) Proc. Nat. Acad. Sci. USA 89:2624.
(B) Decreased phytate content
64
Date regue/Date received 2024-01-16
(1) Introduction of a phytase-encoding gene, such as the Aspergillus niger
phytase gene
(Van Hartingsveldt at al., 1993 Gene 127:87), enhances breakdown of phytate,
adding more
free phosphate to the transformed plant.
(2) A gene could be introduced that reduces phytate content. In dicots, this,
for example,
could be accomplished by cloning and then reintroducing DNA associated with
the single allele
which is responsible for soybean mutants characterized by low levels of phytic
acid (Raboy et
al., 1990 Maydica 35:383).
(C) Modified carbohydrate composition effected, for example, by transforming
plants
with a gene coding for an enzyme that alters the branching pattern of starch.
Examples of such
enzymes include, Streptococcus mucus fructosykransferase gene (Shiroza at al.,
1988) 1
Bacteriol. 170:810, Bacillus subtilis levansucrase gene (Steinmetz et al, 1985
Mol. Gen. Genel.
200:220), Bacillus licheniformis a-amylase (Pen et al., 1992 BiofTechnology
10:292), tomato
invertase genes (Elliot at al., 1993), barley amylase gene (Sogaard et al.,
1993 I. Biol. Chem.
268:22480), and soybean endosperm starch branching enzyme II (Fisher at al.,
1993 Plant
Physiol. 102:10450).
III. Recombinant Constructs
As disclosed herein the present disclosure provides recombinant genomic
sequences
comprising an optimal nongenic soybean genomic sequence of at least 1 Kb and a
DNA of
interest, wherein the inserted DNA of interest is inserted into said nongenic
sequence. In one
embodiment the DNA of interest is an analytical domain, a gene or coding
sequence (e.g.
iRNA) that confers resistance to pests or disease, genes that confer
resistance to a herbicide or
genes that confer or contribute to a value-added trait, and the optimal
nongenic soybean
genomic sequence comprises the following characteristics:
a. the nongenic sequence is about 1 Kb to about 5.7 Kb in length and does
not
contain a methylated polynucleotide;
b. the nongenic sequence exhibits a 0.01574 to 8152 cWMb rate of
recombination
within the genome of a dicot plant, like a soybean plant;
c. the nongenic sequence exhibits a 0 to 0.494 level of nucleosome
occupancy of
the dicot genome, like a soybean genome;
d. the nongenic sequence shares less than 40% sequence identity with any
other
sequence contained in the dicot genome, like a soybean genome;
6$
Date regue/Date received 2024-01-16
e. the nongenic sequence has a relative location value from 0 to 0.99682
ratio of
genomic distance from a dicot chromosomal centromere, like a soybean
chromosomal center;
f. the nongenic sequence has a guanine/cytosine percent content range of
14.4 to
45.9%;
g. the nongenic
sequence is located proximally to an genic sequence, comprising a
known or predicted dicot coding sequence, such as a soybean coding sequence,
within 40 Kb of
contiguous genomic DNA comprising the native nongenic sequence; and,
h. the
nongenic sequence is located in a 1 Mb region of dicot genomic sequence,
such as a genomic sequence, that comprises at least a second nongenic
sequence.
In one embodiment the optimal nongenic soybean genomic sequence is further
characterized as having a genic region cornprisings 1 to 18 known or predicted
soybean coding
sequence within 40 Kb of contiguous genomic DNA comprising the native nongenic
sequence.
In one embodiment the optimal nongenic soybean locus is selected from a loci
of cluster 1,2, 3,
4, 5, 6, 7, 8, 9, 10, 11, 2, 3, 4, 5, 6, 7, 8, 9, 20, 21, 22, 23, 24, 25, 26,
27, 28, 29, 30, 31 or 32.
IV. Transgenic Plants
Transgenic plants comprising the recombinant optimal nongenic soybean loci are
also
provided in accordance with one embodiment of the present disclosure. Such
transgenic plants
can be prepared using techniques known to those skilled in the art.
A transformed dicot cell, callus, tissue or plant (i.e., a soybean cell,
callus, tissue or
plant) may be identified and isolated by selecting or screening the engineered
plant material for
traits encoded by the marker genes present on the transforming DNA. For
instance, selection
can be performed by growing the engineered plant material on media containing
an inhibitory
amount of the antibiotic or herbicide to which the transforming gene construct
confers
resistance. Further, transformed cells can also be identified by screening for
the activities of
any visible marker genes (e.g., the yellow fluorescence protein, green
fluorescence protein, red
fluorescence protein, beta-glucuronidase, luciferase, B or CI genes) that may
be present on the
recombinant nucleic acid constructs. Such selection and screening
methodologies are well
known to those skilled in the art.
Physical and biochemical methods also may be used to identify plant or plant
cell
transformants containing inserted gene constructs. These methods include but
are not limited
to: 1) Southern analysis or PCR amplification for detecting and determining
the structure of the
recombinant DNA insert 2) Northern blot, S1 RNase protection, primer-extension
or reverse
66
Date regue/Date received 2024-01-16
transcriptase-PCR amplification for detecting and examining RNA transcripts of
the gene
constructs; 3) enzymatic assays for detecting enzyme or ribozyme activity,
where such gene
products are encoded by the gene construct; 4) protein gel electrophoresis,
Western blot
techniques, immunoprecipitation, or enzyme-linked immunoassays (EL1SA), where
the gene
construct products are proteins. Additional techniques, such as in situ
hybridization, enzyme
staining, and immunostaining, also may be used to detect the presence or
expression of the
recombinant construct in specific plant organs and tissues. The methods for
doing all these
assays are well known to those skilled in the art.
Effects of gene manipulation using the methods disclosed herein can be
observed by, for
example, Northern blots of the RNA (e.g., mRNA) isolated from the tissues of
interest.
Typically, if the mRNA is present or the amount of mRNA has increased, it can
be assumed
that the corresponding transgene is being expressed. Other methods of
measuring gene and/or
encoded polypeptide activity can be used. Different types of enzymatic assays
can be used,
depending on the substrate used and the method of detecting the increase or
decrease of a
reaction product or by-product. In addition, the levels of polypeptide
expressed can be
measured hnxnunochemically, i.e., EL1SA, R1A, EIA and other antibody based
assays well
known to those of sldll in the art, such as by electrophoretic detection
assays (either with
staining or western blotting). As one non-limiting example, the detection of
the AAD-12
(aryloxyalkanoate dioxygenase; see WO 2011/066360) and PAT (phosphinothricin-N-
acetyl-
transferase (PAT)) proteins using an ELISA assay is described in U.S. Patent
Publication No.
20090093366. The transgene may be selectively expressed in some tissues of the
plant or
at some developmental stages, or the transgcne may be expressed in
substantially all plant
tissues, substantially along its entire life cycle. However, any combinatorial
expression mode
is also applicable.
One of skill in the an will recognize that after the exogenous polynucleotide
donor
sequence is stably incorporated in transgenic plants and confirmed to be
operable, it can be
introduced into other plants by sexual crossing. Any of a number of standard
breeding
techniques can be used, depending upon the species to be crossed.
The present disclosure also encompasses seeds of the transgenic plants
described above
wherein the seed has the transgene or gene construct. The present disclosure
further
encompasses the progeny, clones, cell lines or cells of the transgenic plants
described above
.. wherein the progeny, clone, cell line or cell has the transgene or gene
construct
67
Date regue/Date received 2024-01-16
Transformed plant cells which are produced by any of the above transformation
techniques can be cultured to regenerate a whole plant which possesses the
transformed
genotype and thus the desired phenotype. Such regeneration techniques rely on
manipulation of
certain phytohormones in a tissue culture growth medium, typically relying on
a biocide and/or
herbicide marker which has been introduced together with the desired
nucleotide sequences.
Plant regeneration from cultured protoplasts is described in Evans, et at.,
"Protoplasts Isolation
and Culture" in Handbook of Plant Cell Culture, pp. 124-176, Macmillian
Publishing Company,
New York, 1983; and Binding, Regeneration of Plants, Plant Protoplasts, pp. 21-
73, CRC Press,
Boca Raton, 1985. Regeneration can also be obtained from plant callus,
explants, organs,
pollens, embryos or parts thereof. Such regeneration techniques are described
generally in Klee
et al. (1987) Ann. Rev. of Plant Phys. 38:467-486.
A transgenic plant or plant material comprising a nucleotide sequence encoding
a
polypeptide may in some embodiments exhibit one or more of the following
characteristics:
expression of the polypeptide in a cell of the plant; expression of a portion
of the polypeptide in
a plastid of a cell of the plan import of the polypeptide from the cytosol of
a cell of the plant
into a plastid of the cell; plastid-specific expression of the polypeptide in
a cell of the plant;
and/or localization of the polypeptide in a cell of the plant. Such a plant
may additionally have
one or more desirable traits other than expression of the encoded polypeptide.
Such traits may
include, for example: resistance to insects, other pests, and disease-causing
agents; tolerances to
herbicides; enhanced stability, yield, or shelf-life; environmental
tolerances; pharmaceutical
production; industrial product production; and nutritional enhancements.
In accordance with one embodiment a transgenic dicot protoplast (i.e., a
soybean
protoplast) is provided comprising a recombinant optimal nongenic soybean
locus, More
particularly, a dicot protoplast, such as a soybean protoplast, is provided
comprising a DNA of
interest inserted into an optimal nongenic soybean genomic loci of the dicot
protoplast (i.e, a
soybean protoplast), wherein said nongenic soybean genomic loci is about 1 Kb
to about 5.7 Kb
in length and lacks any methylated nucleotides. In one embodiment the
transgenic dicot
protoplast (i.e., a transgenic soybean protoplat), comprises a DNA of interest
inserted into the
optimal nongenic soybean genomic locus wherein the DNA of interest comprises
an analytical
domain, and/or an open reading frame. In one embodiment the inserted DNA of
interest
encodes a peptide and in a further embodiment the DNA of interest comprises at
least one gene
expression cassette comprising a transgene.
68
Date regue/Date received 2024-01-16
In accordance with one embodiment a transgenic dicot plant, dicot plant part,
or dicot
plant cell (i.e., a transgenic soybean plant, soybean plant part, or soybean
plant cell) is provided
comprising a recombinant optimal nongenic soybean locus. More particularly, a
dicot plant,
dicot plant part, or dicot plant cell (i.e., a soybean plant, soybean plant
part, or soybean plant
cell) is provided comprising a DNA of interest inserted into an optimal
nongenic soybean
genomic loci of the dicot plant, dicot plant part, or dicot plant cell (i.e.õ.
a soybean plant,
soybean plant part, or soybean plant cell), wherein said nongenic soybean
genomic loci is about
1 Kb to about 5.7 Kb ,in length and lacks any methylated nucleotides. In one
embodiment the
transgenic dicot plant, dicot plant part, or dicot plant cell (Le, a
transgenic soybean plant,
soybean plant part, or soybean plant cell) comprises a DNA of interest
inserted into the optimal
nongenic soybean genomic locus wherein the DNA of interest comprises an
analytical domain,
and/or an open reading frame. In one embodiment the inserted DNA of interest
encodes a
peptide and in a fiuther embodiment the DNA of interest comprises at least one
gene expression
cassette comprising a transgene.
EXAMPLES
Example 1: Identification of Targetable Genomic Loci in Soybean
The soybean genome was screened with a bioinformatics approach using specific
criteria
to select optimal genomic loci for targeting of a polynucleotide donor. The
specific criteria used
for selecting the genomic loci were developed using considerations for optimal
expression of a
transgene within the plant genome, considerations for optimal binding of
genomic DNA by a
site specific DNA-binding protein, and transgenic plant product development
requirements. In
order to identify and select the genomic loci, genomic and epigenomic datasets
of the soybean
genome were scanned using a bioinformatics approach. Screening genomic and
epigenomic
datasets resulted in select loci which met the following criteria: 1)
hypomethylated and
greater than 1 Kb in length; 2) targetable via site specific nuclease-mediated
integration of a
polynucleotide donor; 3) agronomically neutral or non-genic; 4) regions from
which an
integrated transgene can be expressed; and 5) regions with recombination
within/around the
locus. Accordingly, a total of 7,018 genomic loci (SEQ ID NO:1 ¨ SEQ ID
NO:7,018) were
identified using these specific criteria. The specific criteria are further
described in detail
below.
Hypomethylat ion
69
Date regue/Date received 2024-01-16
The soybean genome was scanned to select optimal genomic loci larger than 1 Kb
that
were DNA bypomethylated. DNA methylation profiles of root and shoot tissues
isolated from
Glycine Max cultivar Williams82 were constructed using a high throughput whole
genome
sequencing approach. Extracted DNA was subjected to bisulphite treatment that
converts
unmethylated cytosines to uracils, but does not affect methylated cytosines,
and then sequenced
using 111umina HiSeq technology (Krueger, F. et al. DNA methylome analysis
using short
bisulfite sequencing data. Nature Methods 9,145-151 (2012)). The raw
sequencing reads were
collected and mapped to the soybean c,v. Williams82 reference genome using the
BismarkTM
mapping software as described in Krueger F, Andrews SR (2011) Bismark: a
flexible aligner
and methylation caller for Bisulfite-Seq applications. Bioinformatics 27: 1571-
1572).
Since, during the bisulphite conversion process, cytosines in the DNA sequence
that are
methylated do not get converted to uracils, occurence of cytosine bases in the
sequencing data
indicate the presence of DNA methylation. The reads that are mapped to the
reference sequence
were analyzed to identify genomic positions of cytosine residues with support
for DNA
methylation. The methylation level for each cytosine base in the genome was
calculated as a
percentage of the number of tnethylated reads mapping a particular cytosine
base location to the
total number of reads mapping to that location. The following hypothetical
explains how
methylation levels were calculated for each base within the soybean genome.
For example,
consider that there is a cytosine base at position 100 in chromosome 1 of the
soybean c.v.
Williams82 reference sequence. If there are a total of 20 reads mapped to
cytosine base at
position 100, and 10 of these reads are methylated, then the methylation level
for the cytosine
base at position 100 in chromosome 1 is estimated to be 50%. Accordingly, a
profile of the
methylatiom level for all of the genomic DNA base pairs obtained from the root
and shoot tissue
of soybean was calculated. The reads that could not be correctly mapped to
unique locations in
-- the soybean genome matched repetitive sequences that are widespread in the
soybean genome,
and are known in the ad to be predominantly methylated.
Using the above described protocol, the methylation levels for the soybean
c.v.
Williams82 genome were measured. As such, regions of the soybean genome
containing
methylated reads indicated that these regions of the soybean genome were
methylated.
-- Conversely, the regions of the soybean genome that were absent of
methylated reads indicated
these regions of the soybean genome were non-methylated. The regions of the
soybean genome
from the shoot and root tissues that were non-methylated and did not contain
any methylated
reads are considered as "hypomethylated" regions. To make the root and shoot
methylation
Date regue/Date received 2024-01-16
profiles available for visualization, wiggle plots
(ttp://usaast.ensembl.org/info/websitelupload/wig.html) were generated for
each of the
soybean c.v. Williams82 chromosomes.
After obtaining the DNA methylation level at the resolution of a single base
pair in root
and shoot tissues, as described above, the soybean genome was screened using
100 bp windows
to identify genomic regions that are methylated. For each window screened in
the genome, a
DNA methylation level was obtained by calculating the average level of
methylation at every
cytosine base in that window. Genomic windows with a DNA methylation level
greater than
1% were termed as genomic regions that were methylated. The methylated windows
identified
in root and shoot profiles were combined to create a consensus methylation
profile. Conversely,
regions in the genome that did not meet these criteria and were not identified
as methylated
regions in the consensus profile were termed as hypo-methylated regions. Table
1 summarizes
the identified hypo-methylated regions.
Table 1. Hypomethylation profile of soybean c.v. Williams82 genome.
Total soybean c.v. Williams82 genome size ¨970 Mb
Total=combined length of hypomethylated region ¨354 Mb (36.5% of the
soybean
c.v. Williams82 genome)
Number of hypomethylated regions above 100 Bp 763,709
Number of hypomethylated regions above 1 Kb ¨94,745
Number of hypomethylated regions above 2 Kb 19,369
Number of hypomethylated regions above 10 Kb ¨ 354
Minimum length of hypomethylated region 100 Bp
Maximum length of hypomethylated region 84,100 Bp
These hypomethylated regions of the soybean c.v. WILIJAMS82 genome were
further
characterized to identify and select specific genomic loci as the methylation
free context of
these regions indicated the presence of open chromatin. As such, all
subsequent analyses were
conducted on the identified hypomethylated regions.
Targetability
71
Date regue/Date received 2024-01-16
The hypoinethylated sites identified in the soybean c.v. WILL1AMS82 were
further
analyzed to determine which sites were targetable via site specific nuclease-
mediated
integration of a polynucleotide donor. Glydne max is known to be a
paleopolyploid crop
which has undergone genome duplications in its genomic history (Jackson et al
Genome
sequence of the palaeopolyploid soybean, Nature 463, 178-183 (2010)). The
soybean
genome is known in the art to contain long stretches of highly repetitive DNA
that are
methylated and have high levels of sequence duplication. Annotation
information of known
repetitive regions in the soybean genome was collected from the Soybean Genome
Database
(www.soybase.org, Shoemaker. R.C. et al. SoyBase. the USDA-ARS soybean
genetics and
genomics database, Nudeic Acids Res. 2010 Jan:38(Database issue):D843-6).
Accordingly, the hypomethylated sites identified above were screened to remove
any
sites that aligned with known repetitive regions annotated on the soybean
genome. The
remaining hypomethylated sites that passed this first screen were subsequently
scanned using a
BLASTIN based homology search of a soybean genomic database via the NCBI
BLASTrm+
software (version 2.2.25) run using default parameter settings (Stephen F.
Altschul et al (1997)
Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs.
Nuckic Acids Res. 25:3389-3402). As a result of the BLASTIN screen, any
hypomethylated
sites that had significant matches elsewhere in the genome, with sequence
alignment coverage
of over 40%, were removed from further analyses.
Agronomically Neutral or Nongenic
The hypomethylated sites identified in the soybean c.v. Will iam82 were
further analyzed
to determine which sites were agronomically neutral or nongenic. As such, the
hypomethylated
sites described above were screened to remove any sites that overlapped or
contained any
known or predicted endogenous soybean c.v. William82 coding sequences. For
this purpose,
annotation data of known genes and mapping information of expressed sequence
tag (EST) data
were collected from Soybean Genomic Database (vvww.soybase.org - version 1.1
gene
models were used, Jackson et al Genome sequence of the palaeopolyploid soybean
Nature
463, 178-183 (2010)). Any genomic region immediately 2 Kb upstream and I Kb
downstream
to an open reading frame were also considered. These upstream and downstream
regions may
contain known or unknown conserved regulatory elements that are essential for
gene function.
The hypomethylated sites previously described above were analyzed for the
presence of the
known genes (including the 2 Kb upstream and 1 Kb downstream regions) and
ESTs. Any
72
Date regue/Date received 2024-01-16
hypomethylated sites that aligned with or overlapped with known genes
(including the 2 Kb
upstream and 1 Kb downstream regions) or ESTs were removed from downstream
analysis.
Expression
The hypomethylated sites identified in the soybean c.v. Williams82 were
further analyzed
to determine which sites were within proximity to an expressed soybean gene.
The transcript
level expression of soybean genes was measured by analyzing transcriptome
profiling data
generated from soybean c.v. Williams82 root and shoot tissues using RNAscqTM
technology as
described in Mortazavi et al. Mapping and quantifying mammalian transcriptomes
by
RNA-Seq. Nat Methods. 2008;5(7):621-628, and Shoemaker RC et aL, RNA-Seq Atlas
of
Glydne max: a guide to the soybean Transeriptome, BMC Plant Bid 2010 Aug
5;10:160.
For each hypomethylated site, an analysis was completed to identify any
annotated genes
present within a 40 Kb region in proximity of the hypomethylated site, and an
average
expression level of the annotated gene(s) located in proximity to the
hypomethylated site.
Hypomethybted sites located greater than 40 Kb from an annotated gene with a
non-zero
average expression level were determined to not be proximal to an expressed
soybean gene and
were removed from further analyses.
Recombination
The hypomethylated sites identified in the soybean c.v. Williams82 were
further analyzed
to determine which sites had evidence of recombination and could facilitate
introgression of the
optimal genomic loci into other lines of soybean via conventional breeding.
Diverse soybean
genotypes are routinely crossed during conventional breeding to develop new
and improved
soybean lines containing traits of agronomic interest. As such, agronomic
traits that are
introgress,ed into optimal genomic loci within a soybean line via plant-
mediated transformation
of a transgene should be capable of further being introgressed into other
soybean lines,
especially elite fines, via meiotic recombination during conventional plant
breeding. The
hypomethylated sites described above were screened to identify and select
sites that possessed
some level of meiotic recombination. Any hypomethylated sites that were
present within
chromosomal regions characterized as recombination "cold-spots" were
identified and
removed. In soybean, these cold spots were defined using a marker dataset
generated from
recombinant inbred mapping population (Williams 82 x P1479752). This dataset
consisted of
73
Date regue/Date received 2024-01-16
-16;600 SNP markers that could be physically mapped to the Glycine max
reference
genome sequence.
The meiotic recombination frequencies between any pair of soybean genomic
markers
across a chromosome were calculated based on the ratio of the genetic distance
between
markers (in centimorgan (cM)) to the physical distance between the markers (in
megabases
(Mb)). For example, if the genetic distance between a pair of markers was 1
cM, and the
physical distance between the same pair of markers was 2 Mb, then the
calculated
recombination frequency was determined to be 0.5 cM/Mb. For each
hypomethylated site
identified above, a pair of markers at least 1 Mb apart was chosen and the
recombination
frequency was calculated. Deployment of this method was used to calculate the
recombination
frequency of the hypomethylated sites. Any hypomethylated sites with a
recombination
frequency of 0 cM/Mb were identified and removed from further analysis. The
remaining
hypomethylated regions comprising a recombination frequency greater than 0
cM/Mb were
selected for further analysis.
Identification of Optimal Genomic Loci
Application of the selection criteria described above resulted in the
identification of a
total of 90,325 optimal genomic loci from the soybean genome. Table 2
summarizes the
lengths of the identified optimal genomic loci. These optimal genomic loci
possess the
following characteristics: 1) hypomethylated genomic loci greater than 1 Kb in
length; 2)
genomic loci that are targetable via site specific nuclease-mediated
integration of a
polynucleotide donor; 3) genomic loci that are agronomically neutral or
ncmgenic; 4) genomic
loci from which a transgene can be expressed; and 5) evidence of recombination
within the
genomic loci. Of all of the optimal genomic loci described in Table 2, only
the optimal
genomic loci that were greater than 1 Kb were further analyzed and utilized
for targeting of a
donor polynucleotide sequence. The sequences of these optiml genomic loci are
disclosed as
SEQ ID NO:! ¨ SEQ 11) NO:7,018. Collectively, these optimal genomic loci are
locations
within the soybean genome that can be targeted with a donor polynucleotide
sequence, as
further demonstrated herein below.
Table 2. Lists the size range of optimal Filmic loci identified in the soybean
genome that are
hypomethylated, show evidence of recombination, targetable, agronomically
neutral or
nongenic, and are in proximity to an expressed endogenous gene.
74
Date regue/Date received 2024-01-16
¨Number of optimal genomic loci larger than 100 Hp - 90,325
Number of optimal genomic loci larger than 1 Kb 7,018
Number of optimal genomic loci larger than 2 Kb 604
Number of optimal genomic loci larger than 4 Kb 9
Example 2: F-Distribution and Principal Component Analysis to Cluster Optimal
Genomic
Loci From Soybean
The 7,018 identified optimal genomic loci (SEQ ID NO: 1- SEQ ID NO: 7,018)
were
further analyzed using the F-distribution and Principal Component Analysis
statistical methods
to define a representative population and clusters for grouping of the optimal
genomic loci.
F-Distribution Analysis
The identified 7,018 optimal genomic loci were statistically analyzed using a
continuous
probability distribution statistical analysis. As an embodiment of the
continuous probability
distribution statistical analysis, an F-distribution test was completed to
determine a
representative number of optimal genomic loci. The F-distribution test
analysis was completed
using equations and methods known by those with skill in the art. For more
guidance, the F-
distribution test analysis as described in K.M Remund, D. Dixon, DL. Wright
and LR. Holden.
Statistical considerations in seed purity testing for transgenic traits. Seed
Science Research
(2001) 11, 101-119, is a non-limiting example of an F- distribution test. The
F-distribution
test assumes random sampling of the optimal genomic loci, so that any non-
valid loci are evenly
distributed across the 7,018 optimal genomic loci, and that the number of
optimal genomic led
sampled is 10% or less of the total population of 7,018 optimal genomic loci.
The F-distribution analysis indicated that 32 of the 7,018 optimal genomic
loci provided
a representative number of the 7,018 optimal genomic loci, at a 95% confidence
level.
Accordingly, the F-distribution analysis showed that if 32 optimal genomic
loci were tested and
all were targetable with a donor polynucleotide sequence, then these results
would indicate that
91 or more of the 7,018 optimal genomic loci are positive at the 95%
confidence level. The
best estimate of validating the total percentage of the 7,018 optimal genomic
loci would be if
100% of the 32 tested optimal genomic loci were targetable. Accordingly, 91%
is actually the
lower bound of the true percent validated at the 95% confidence level. This
lower bound is
based on the 0.95 quantile of the F-distribution, for the 95% confidence level
(Remund K,
Date regue/Date received 2024-01-16
Dixon 13, Wright D, and Holden L. Statistical considerations in seed purity
testing for
transgenic traits. Seed Science Research (2001) 11, 101-119).
Principal Component Analysis
Next, a Principal Component Analysis (PCA) statistical method was completed to
further
assess and visualize similarities and differences of the data set comprising
the 7,018 identified
optimal genomic loci to enable sampling of diverse loci for targeting
validation. The PCA
involves a mathematical algorithm that transforms a larger number of
correlated variables into a
smaller number of uncorrelated variables called principal components.
The PCA was completed on the 7,018 identified optimal genomic loci by
generating a set of
calculable features or attributes that could be used to describe the 7,018
identified optimal
genomic loci. Each feature is numerically calculable and is defined
specifically to capture the
genomic and epigenomic context of the 7,018 identified optimal genomic loci. A
set of 10
features for each soybean optimal genomic loci was identified and are
described in greater
detail below.
I. Length of the optimal genomic loci
a. The length of the optimal genomic loci in this data set ranged from a
minimum
of 1,000 Bp to a maximum of 5,713 Bp.
2. Recombination frequency in a 1 MB region around the optimal genomic loci
a. In soybean, recombination frequency for a chromosomal location was defined
using an internal high resolution marker dataset generated from multiple
mapping populations.
b. Recombination frequencies between any pairs of markers across the
chromosome were calculated based on the ratio of the genetic distance between
markers (in centimorgan (cM)) to the physical distance between the markers (in
Mb). For example, if the genetic distance between a pair of markers is 1 cM
and
the physical distance between the same pairs of markers is 2 Mb, the
calculated
recombination frequency is 0.5 cM/Mb. For each optimal genomic loci, a pair of
markers at least 1 Mb apart was chosen and the recombination frequency was
calculated in this manner. These recombination values ranged from a minimum
of 0.01574 cM/Mb to a maximum of 83.52 cM/Mb.
3. Level of optimal genomic loci sequence uniqueness
76
Date regue/Date received 2024-01-16
a. For each optimal genomic loci, the nucleotide sequence of the optimal
genomic
loci was scanned against the soybean c.v. Williams82 genome using a BLASTrm
based homology search using the NCB1 BLASTm+ software (version 2.2.25)
run using the default parameter settings (Stephen F. Altschul et al (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402). As these optimal genomic loci
sequences are identified from the soybean c.v. Williams82 genome, the first
BLAST"' hit identified through this search represents the soybean c.v.
Williams82 sequence itself. The second BLAST" hit for each optimal genomic
loci sequence was identified and the alignment coverage (represented as the
percent of the optimal genomic loci covered by the BLASTTP4 hit) of the hit
was
used as a measure of uniqueness of the optimal genomic loci sequence within
the
soybean genome. These alignment coverage values for the second BLAST"' hit
ranged from a minimum of 0% to a maximum of 39.97% sequence identity.
Any sequences that aligned at higher levels of sequence identity were not
considered.
4. Distance from the optimal genomic loci to the closest gene in its
neighborhood
a. Gene annotation information and the location of known genes in the Soybean
genome were extracted from Soybean Genome Database (available at,
www.soybase.org - version 1.1 gene models were used, Jackson et al Genome
sequence of the pal aeopolyploid soybean, Nature 463, 178-183 (2010)). For
each
optimal genomic loci, the closest annotated gene, considering both upstream
and
downstream locations, was identified and the distance between the optimal
genomic loci sequence and the gene was measured (in Bp). For example, if a
optimal genomic locus is located in chromosome Gm01 from position 2,500 to
position 3,500, and the closest gene to this optimal genomic locus is located
in
chromosome Gm01 from position 5,000 to position 6,000, the distance fiwo the
optimal genomic loci to this closest gene is calculated to be 1500 Bp, These
values for all 7,018 of the optimal genomic loci dataset ranged from a minimum
of 1,001 Bp to a maximum of 39,482 Bp.
5. GC % in the optimal genomic loci sequence
a. For each optimal genomic locus, the nucleotide sequence was analyzed to
estimate the number of Guanine and Cytosine bases present. This count was
77
Date regue/Date received 2024-01-16
represented as a percentage of the sequence length of each optimal genomic
locus and provides a measure for GC%. These GC% values for the soybean
optimal genomic loci dataset range from 14.4% to 45.9%.
6. Number of genes in a 40 Kb neighborhood around the optimal genomic loci
sequence
a, Gene annotation information and the location of known genes in the soybean
c,v.
Williams82 genome were extracted from Soybean Genome Database. For each
of the 7,018 optimal genomic loci sequence, a 40 Kb window around the optimal
genomic kci sequence was defined and the number of annotated genes with
locations overlapping this window was counted. These values ranged from a
minimum of 1 gene to a maximum of 18 genes within the 40 Kb neighborhood.
7. Average gene expression in a 40 Kb neighborhood around the optimal genomic
loci
a. Transcript level expression of soybean genes was measured by analyzing
available transcriptome profiling data generated from soybean c.v. Williams82
root and shoot tissues using RNAseqTM technology. Gene annotation information
and the location of known genes in the soybean c.v. Williams82 genome were
extracted from Soybean Genome Database For each optimal genomic locus,
annotated genes within the soybean c.v. Williams82 prime that were present in
a 40 Kb neighborhood around the optimal genomic loci were identified.
Expression levels for each of the genes were extracted from the transcriptome
profiles described in the above referenced citations and an average gene
expression level was calculated. Expression values of all genes within The
genome of soybean vary woody. The average expression values for all of the
7,018 optimal genomic loci dataset ranged from a minimum of 0.000415 to a
maximum of 872.7198.
8. Level of nucleosome occupancy around the optimal genomic loci
a. Understanding the level of nucleosome occupancy for a particular nucleotide
sequence provides information about chromosomal functions and the genomic
context of the sequence. The NuPoPm statistical package was used to predict
the
nucleosome occupancy and the most probable nucleosome positioning map for
any size of genomic sequences (Xi, L., Fondufe-Mittendor, Y., Xia, L., Flatow,
J., Widom, J. and Wang,
Predicting nucleosome positioning using a
duration Hidden Marb:w Model, BMC Bioinformatics, 2010, doi:10.1186/1471-
2105-11-346.). For each of the 7,018 optimal genomic loci, the nucleotide
78
Date regue/Date received 2024-01-16
sequence was submitted for analysis with the NuPoPTM software and a
nucleosome occupancy score was calculated. These nucleosome occupancy
scores for the soybean optimal genomic loci dataset ranged from a minimum of 0
to a maximum of 0.494.
9. Relative location within the chromosome (proximity to centromere)
a. A centromere is a region on a chromosome that joins two sister chromatids.
The
portions of a chromosome on either side of the centromere are known as
chromosomal arms. Genomic locations of cantromeres on all 20 Soybean
chromosomes were identified in the published soybean c.v. Williams82
reference sequence (Jackson at al Genome sequence of the palaeopolyploid
soybean Nature 463, 178-183 (2010)). Information on the position of the
centromere in each of the Soybean chromosomes and the lengths of the
chromosome arms was extracted from Soybean Genome Database. For each
optimal genomic locus, the genomic distance from the optimal genomic locus
sequence to the centromere of the chromosome that it is located on, is
measured
(in Bp). The relative location of optimal genomic loci within the chromosome
is
represented as the ratio of its genomic distance to the centromere relative to
the
length of the specific chromosomal arm that it lies on. These relative
location
values for the soybean optimal genomic loci dataset ranged from a minimum of
0 to a maximum of 0.99682 ratio of genomic distance.
10. Number of optimal genomic loci in a 1 Mb region
a. For each optimal genornic loci, a 1 Mb genomic window around the optimal
genomic loci location was defined and the number of other, additional optimal
genomic loci present within or overlapping this region were calculated,
including
the optimal genomic loci under consideration. The number of optimal genomic
loci in a 1 Mb ranged from a minimum of 1 to a maximum of 49.
All of the 7,018 optimal genomic loci were analyzed using the features and
attributes
described above. The results or values for the score of the features and
attributes of each
optimal genomic locus are further described in Table 3. The resulting dataset
was used in
the PCA statistical method to cluster the 7,018 identified optimal genomic
loci into clusters.
During the clustering process, after estimating the "p" principle components
of the optimal
genomic loci, the assignment of
79
Date regue/Date received 2024-01-16
the optimal genomic loci to one of the 32 clusters proceeded in the "p"
dimensional Euclidean
space. Each of the "p" axes was divided into "k" intervals. Optimal genomic
loci assigned to
the same interval were grouped together to form clusters. Using this analysis,
each PCA axis
was divided into two intervals, which was chosen based on a priori information
regarding the
number of clusters required for experimental validation. All analysis and the
visualization of the
resulting clusters were carried out with the Molecular Operating Environmenfrm
(MOE)
software from Chemical Computing Group Inc. (Montreal, Quebec, Canada).
The PCA approach was used to cluster the set of 7,018 identified optimal
genomic loci
into 32 distinct clusters based on their feature values, described above.
During the PCA process,
five principal components (PC) were generated, with the top three PCs
containing about 90% of
the total variation in the dataset (Table 4), These three PCAs were used to
graphically represent
the 32 clusters in a three dimensional plot (Fig. 1). After the clustering
process, was completed,
one representative optimal genomic locus was chosen from each cluster. This
was performed by
choosing a select optimal genomic locus, within each cluster, that was closest
to the centroid of
that cluster (Table 4). The chromosomal locations of the 32 representative
optimal genomic loci
are uniformly distributed among the 20 soybean chromosomes and are not biased
toward any
particular genomic location, as shown in Fig. 2.
Table 4. Description of the 32 soybean representative optimal genomic loci
identified from the
PCA
Optimal denomic Loci Genomie Location Length Cluster SEQ 1D
Name (Bp) Number NO:
soy ogl 2474 Gm08:2764201..2766752 2552 1 1
soy_ogl 768 Gm03:339101..341100 2000 ¨ 2 506
' soy ogl 2063 Gm06:43091928..43094600 2673 ¨ 3 748
soy ogl 1906 0m06:11576991..11578665 1675 4 1029
soy ogl 1112 Gm03:46211408..46213400 1993 5 1166
soy_ogl_3574 Gm10:46279901 .46281026 1126 6 1452
soy_pg1_2581 Gm08:9631801.9632800 1000 7 1662
soy_ogl 3481 Gm10:40763663..40764800 1138 8 1869
soy_ogl_1016 Gm03A1506001.41507735 1735 9 2071
soy ogl 937 Gm03:37707001..37708600 1600 10 2481
soy_ogl_6684 Gm20:1754801..1755800 1000 11 2614
soy_ogl_6801 Gm20:36923690..36924900 1211 12 2874
soy ogl _6636 Gm19:49977101..49978357 1257 13 2970
soy 4_4665 Gm14:5050547..5051556 1010 _ 14 3508
soy_ogl_3399 Gm10:6612501..6613500 .1000 15 3676
soy oit4 4222 Gm13:23474923..23476160 1178 16 3993
soy ogl 2543 Gm08:7532001õ7534800 2800 17 4050
soy_og,1 275 Gm01:51869201..51870400 1200 18 4106
Date regue/Date received 2024-01-16
soy_ogl 598 Gm02:41665601..41667900 2300 19 4496
soy_ogl_1894 Gm06:10540801..10542300 1500 20 ' 4622
soy ogl 5454 Gm17:1944101.,1945800 1700 ¨21 4875
soy_ogl 6838 Gm20:38263922..38265300 1379 22 4888
soy ogl 4779 Gm14:45446301.45447700 1400 23 5063
soy_ogl_3333 Gm10:2950701..2951800 1100 24 5122
soy_ogl 2546 Gm08:7765875õ7767500 1626 25 5520
soy_ogl_796 Gm03:1725501..1726600 1100 ¨26 5687
soy_ogl_873 Gm03:33650665..33653000 2336 27 6087
soy_ogl_5475 Gm17:3403108..3404200 1093 28 6321
soy ogl 2115 6m07:1389701..1390900 1200 ¨29 6520
soy_ogl 2518 Gm08:5229501.,5230667 1167 30 6574
soy_og1_5551 Gm17:6541901..6543200 1300 31 6775
=soy_ogl_4563 Gm13:38977701..38978772
1072 32 6859
Final Selection of Genomic Loci for Targeting of a Polynucleotide Donor
Folynucleotide
Sequence
A total of 32 genomic loci were identified and selected for targeting with a
donor
polynucleotide sequence from the 7,018 genomic loci that were clustered within
32 distinct
clusters. For each of the 32 clusters, a representative genomic locus (closest
to the centroid of
the cluster as described above in Table 4) or an additional locus with
homology to targeting line
were chosen. The additional optimal genomic loci were selected by first
screening all of the
7,018 selected optimal genomic sequences against a whole genome database
consisting of
.. genomic DNA sequence data for both Glycine max c.v. Maverick
(transformation and targeting
screening line) and Glycine max c.v. Williams82 (reference line) to determine
the coverage
(how many optimal genomic loci were present in both genomes) and percentage of
sequence
identity in the genome from both lines. The optimal genomic loci with 100%
coverage (the
entire sequence length of the optimal loci aligned between both genomes) and
100% identity in
the Williams82 genomic databases were selected for targeting validation. Other
criteria such as
genomic loci size, extent of uniqueness, GC% content and chromosomal
distribution of the
optimal genomic loci were also taken into consideration in selecting the
additional optimal
genomic loci. The chromosomal location of the 32 selected optimal genomic loci
and the
specific genomic configuration of each soybean optimal genomic loci are shown
in Fig. 3 and
Table 5, respectively.
Table 5. Description of the 32 soybean selected optimal genomic loci chosen
for targeting
validation. From these optimal genomic loci listed in this table,
exemplification of cleavage
81
Date regue/Date received 2024-01-16
and targeting of 32 soybean optimal genomic loci are representative of the
identified total of
7,018 soybean selected optimal genomic loci.
Optimal Genomic Length'
Ouster SEQ 1D
Loci Name Genomic Location = (Bp) Number NO:
soy ogl 308 .Gm02:1204801_1209237 4437 1 43
soy ogl 307 Gm02:1164701-1168400 3700 2 566 '
. soy ogl_2063 Gm06:43091928..43094600 2673 3 748
soy ogl 1906 , C1E106:11576991..11578665 1675 4 1029
soy ogl 262 Gm01:51061272..51062909 _ 1638 5 1376
soy ogl 5227 Gm16:1298889..1300700 1812 6 1461
soy ogl 4074 Gm12:33610401..33611483 1083 7 1867
soy ogl 3481 _ Gm10:40763663.,40764800 . 1138 , _ 8 1869 ,
soy ogl 1016 Gm03:41506001-41507735 1735 9 2071
. ¨ ¨
soy ogl 937 Gm03:37707001_37708600 1600 10 2481
soy ogl 5109 6m15:42391349..42393400 2052 11 2639
_ soy ogl 6801 _ Gm20:36923690..36924900 . 1211 , 1.2 , 2874 _
soy ogl 6636 Gm19:49977101..49978357 _ 1257 13 2970
soy ogl 4665 Grn14:5050547..5051556 1010 14 3508 .
soy ogl 6189 Gin 18:55694401.55695900 1500 15 3682
soy ogl 4222 Gm13:23474923..23476100 _ 1178 16 3993
_soy ogl 2543 _Gm08:7532001-7534800 _ 2800 17 4050
soy 081_310 Gm02:1220301-1222300 2000 18 4326
soy ogl 2353 Gm07:17194522..17196553 2032 19 4593
4oy ogl_1894 _Gm06:10540801-10542300 , 1500 20 , 4622
soy ogl 3669 _ Gm1,1:624301..626200 _ 1900 , 21 4879
soy ogl 3218 Gm09:40167479-40168800 1322 22 , 4932
soy ogl 5689 _ Gin 17:15291601..15293400 1800 23 5102
soy ogl_333 _ Gin10:2950701..2951800 1100 , 24 5122 .
. soy ogl 2546 _ 6m08:7765875-7767500 _ 1626 25 5520
. , .
soy ogl 1208 Q04:4023654..4025650 1997 26 5698
soy ogl 873 Gm03:33650665..33653000 2336 27 6087
soy ogl 5957 _ Gm 1 8; 6057701..6059100 _ 1400 28 , 6515
soy ogl 4846 , Gm 15:924901..926200 1300 29 6571
soy ogl 3818 Gm11:10146701-10148200 1500 30 6586
_
soy ogl 5551 , 6m17:6541901..6543206 1300 31 6775
,soy ogl_7 _ Gm05:3263,1801-32633200 _ 1400 32 6935
soy OGL_684 6m02:45903201-45907309 4100 1 47
soy OGL_682 6m02:45816543..45818777 2235 9 2101 ,
soy OGL 685 6m02:45910591_45913200 2700 1 ' , 48
soy OGL_1423 , 6m0445820631..45822916 . 2286 2 639
soy OGL_1434 Gm04:46095801-46097968 .2168 1 137
soy OGL_4625 , Gm14:3816738-3820070 3333 1 76
.. . ..
_ soy OGL 6362 6m19:5311001.5315000 4000 1 440
82
Date regue/Date received 2024-01-16
A large suite of 7,018 genomic locations have been identified in the soybean
genome as
optimal gnomic loci for targeting with a donor polynucleotide sequence using
precision
genome engineering technologies. A statistical analysis approach was deployed
to group the
7,018 selected genomic loci into 32 clusters with similar genomic contexts,
and to identify a
subset of 32 selected genomic loci representative of the set of 7,018 selected
genomic loci. The
32 representative loci were validated as optimal genomic loci via targeting
with a donor
polynucleotide sequence. By performing the PCA statistical analysis for the
numerical values
generated for the ten sets of features or attributes that are described above,
the ten features or
attributes were computed into PCA components of fewer dimensions. As such, PCA
components were reduced into five dimensions that are representative of the
ten features or
attributes described above (Table 6). Each PCA component is equivalent to a
combination of
the ten features or attributes described above. From these PCA components
comprising five
dimensions, as computed using the PCA statistical analysis, the 32 clusters
were determined.
83
Date regue/Date received 2024-01-16
0
n)
iii
53
K-)
c
a)
Table 6. The five PCA components (F'CA1, PCAZ,
PCA3, PCA4, and PCA5) that define each of the 32 clusters and the scqur..au=:.
(SEQ ID NO:1 -SEQ ID
p
NO:7,018) which make up each cluster. These five
dimensions are representative of the ten features or attributes described
above that were used to identify the
SD
6 olimal genomic loci. The minimum (Min), mean, median and
maximum (Max) values for each PCA component are provided.
53
1 Clusterl Clus0)r2 Cluster3
Cluster9 g d].uste '
O , (SEQ ID PM ID (SEQ ID auster4
Cluster5 auster6 Cluster? Cluster") (SEQ ID auster10 (SEQ
ID
CD NO:1 - NO:506 = NO:748- (SEQ ID NO: (513Q
ID NO; (51Q ID NO: (515Q ID NO: (SEQ ID NO: NO:2071- ($102 ID
NO: NO:2614 -
SEQ ID - SEQ ID SEQ ID 1029-SEQ 1166-SEQ
1452-SEQ 1662-SEQ 1.869-SEQ SEQ ID 2481-SEQ SEQ ID
0. , NO:505) ,.. NO:747) )10:10213) ID 80:11651
11) 80:1451) ID 801661) 10 80:1868) 10 801070) NO:2480) ID
NO:2613) ` 80 :2873)
iv 0.02204
o
iv MIn -1.70227
6 -4.54911 -1.72266 -0.36976 0.287697 -3.34863 -
1.0806 -1.5084417 -0.06921 -425854
0.81263
0 Mean 0.349775 4 -1.47305 -0.00185
0.540899 : 0.96791 -0.58521 0.313491 0.178145825 '
0146656 -1.77485
P 0.79632
(3) c Median 0363103 1 -1.18164 0.049082 -
0.52498 0918269 -0.34364 0291582 0.204892845 ;
0.729936 -1.93613
A 1.83487
1 Max ' 1.507894 1 0.032399 2.027233
1.499719 2.461219 0.417058 1.718384 1.4452823 2,258209 -
0.10335
We -0.65485 -0.6907 -1.37642 -1.15246 -
2.2623 -2.69847 -2.33499 -2115394 -0.85615188 ' -
107918 -1.48917
0.80561
Mean 0.803591 1 0,42863 0.549053 4,97646 .,
4363594 -1.07926 4.67684 0.0131018 0.201017 -0.12584
P .
0.69095 _
C Median , 0.640172 . 3 0.30208 0,435896 -
0.92946 -0.51848 -1.03176 -0.A7675 0.061526693 0,165577
-0.16842
A
2 Max' ; 6.750318_ 4.21356 3.492035
2.037537 , 0.224862 0.316075 0.014994 0.262266 2.8737593
1,883538 2.309063
Den -4.63386 6.20928 -3,64977 -7,46971
-14347 -328026 -2.79672 -136722 -1,7842444 -337428 -2,64864
'
Mean -1.0374 0.87017 -1.09511 -
1.21149 ' -0.49711 -0.30392 -0.4893 -036718 0.137149779
-0.20772 -0.28997
P
C Median . -0.94654 -0.7282 -0.92816 -4,96309 -
0.45901 -0.19996 -0.43677 -027515 0.068803150 -
0.04455, -0,18716
A 0.01014
oo 3 Max 0240454 8 -0.11534 -0.13414,
0.476554 11457804 0.452481 0.453505 0.9092167
0.928412 0.782125
-eu
.
Mln -222011 1.02405 -133923 0,069312 -1.70627 4180904 -129231 0.360563 -
2.9615474 -2,44418 -2.7613
0.28354 -
Mean -0.71495 1 0.212841 1.084988 -
0.35855 0.479481 0.459736 1.348666 1.407512305 ' -
0.75615 , -0.85361
P 0.30610
C Median -0.70787 _ 8 0,209055 1.116651
-0.35772 0.435449 0.436138 1.307628 -128790425 478738 -
0.81593
A 1.57518
4 Max , 0.786678 4 2.221794 2571196
0.75,5949 2664817 2.193427 3.122114 -0.40947.505
0383523 ' 0.985444
-
, Min -0.17971 3.06393 , -0.53749 -4.5557 ,
0.159064 -2.0539 -0.70289 -1.90857 .1.897981 -4.47156 -
2.35152
0.36896 -
Mean 0.943093 5 0,713771 -0,21905 0.876745
0.463248 0.768677 0.285719 0,029561107 -020424 -0.18625
P
C Median 0.854279 03771 ' 0.670629 -0.10817
0.846543 0.459296 0.763885 0.338391 0.034177913 -
0,68409 -0.12264
1 A 2.61381
I 5 Max ' 1513402 5 2279238 2.341478 I
1.913726 1.633977 2.164417 1.422805 0.84937429 .242494
0.940019
0
si.)
6
53
K-)
C
CD
CD
SD 1 C1uster15
6 , Cluster13 Cluster14 (SEQ ID
Cluster16 arster18 E Cluster21
53 ' Cluster12 (SEQ ID ' (SEQ ID
NO-1676 - (SEQ ID Cluster17 (SEQ (SEQ ID Cluster19
Cluster20 (SEQ ID
O (SEQ ID NO) N0T2970 -
NO:3508 - SR ID /403993 - ID 1104050-- 9104106 - (SEQ ID Pa (SR
ID NM N014875 -
a) 2874- SIM SEQ ID SEQ ID 940.3992)
SEQ ID SEQ ID SEQ ID 4496-SEQ 4622-SEQ SR ID
"
CD . ID 940:2969) 940.3507) 940.3675) E
910.4019) 840:4105) 910.44951 ID 940.4621) ID 940.4874)
N0.4887)
a .
n) Mln 4.10567 4.78413 -04362 -3.50478
4.06581 -0.48995 -0.12394 -3.44417 -2.5926 0.041919
C)
n) Mean 0.215254 E 0.402511 0.841125 -
059405 0.054644 0218477 0.705185 -1.60324 -021989 0.498017
4." .
C. Me . 0.167943 0.421486 0.793343 -
0.86435 0.943324 0.186449 0.69873 -1.62442 -0.07645 0.530581
-, PCA1 Max 2.639122 , 1.521265 2.0110E9
0254192 1.078006 1112386 1194809 -0.14778 1.1M113 0.937608
0) .
Min -324885 -2.49287 ' -2.07915 -2.50641 -
2.60289 0.060129 0.131404 , 433368 -0.175632 . -1.56352
Mean -0.53611 -1.09247 -0.94959 -
1.29395 -1.20352 1419729 1150768 1101573 0S43814 -0.4111
..
Malan -033651 -1.08189, -0.91699 -1.14996 -
117679 1.280417 1.065186 0.789798 0.776496 -0.28559 E
PCA2 Max 2,608386 -0,24001 0.020389 -0.4655 -
0.31958 3.9131913 3.040107 6.340514 2.929741 , 0.123387
..
Min -14.6314 -1,01198 -1.91077 -1.7135 -
2.73956 -1.73844 -1.13076 -1.78506 -0.92532 E 0.00053 `
I
Mean -3.0284 0.137956 0.208329
0.071922 -0.21452 427811 0.161876 4.14195 0.233953 0.437291
: Median -1.93463 0.177648 .E 0.305399
0.132791 - -0.00072 -0.15140 0.163129 -0.06546 0.23185
0.450869
AO PCA3 Max 0.72284 1,034171 1.088972 0.998862
0.765974 0.4278E4 1323874 _ 0.16736 1.409277 0.918403
til
-
Mm' -1.00771 -2.10637 . -1.17239 E
-1.48955 -0.78727 -1.60097 -0.69878 -1_09012 0.172103
-051316 ,
Mean 0,594551 -0.85746 4.33529 4.37717
0.438916 . -023831 , 0.47476 0E70052 1.210219 0.100213
Median 0.392421 ' -0.136062 . -0.4333 ,
4.47105 0.356612 -021174 0.451745 0.638494 1.196036 .
0.075167 E
PCA4 Mix 4.86024 0.27396 0.5110863 0378394 2.50E1934
0.871996 1.775630 2.463554 2.614263 0.536589
i Min -18.7726 -0.77506 -353913 E -1.20205 -
351125 0.066136 -0.77069 -0.625334 -1.42543 . 0.258308
Mean -4.21943 0.229577 -0.3992 0.08327 -
0.93398 0.701934 0.233117 0369827 -0.02377 0348857
Median -2.90093 11240883 -0.33338
0.037451 -0.70513 0.602369 0715128 0.29277 -0.01138 0.803204
PCAS Max -0.33401 1.115681 0,396515
1.044241 = 0.040091 2.01268 1.665714 1.937356 1.791794
1.079591
CD
n)
iii
Fii
K-)
c
CD I I
CD 0us1er22
(SEQ ID Cluster23 auster24 Cluster25 Cluster26
Cluster27 ' Meilen' auster29 Cluster30 Cluseer31 Cluster32
6 NO: (SEZ ID PEQ ID (SDI ID (SEQ ID
(SEQ ID (SEQ ID (SEQ ID CSEQ ID (SEQ ID PRI ID
53 4888-- N05063- NO51ZZ - NO:5520 -
NO:5687 - I40:6087-- 940:6321 -- . 940.6520 - N04574-
NO:6775 - N 0 ;6589-
0 SEQ ID SEQ ID SEQ ID SEQ ID SEQ ID
SEQ1D SBQ ID SEQ ID SEQ ID SEQ ID SEQ ID
a)
" NO:50621 710:5121) NO 5519) NO
5686) NO:6086) NO:6520) 940:65191 310*55731 940.67741
NO:651211 NO:70181
CD
a - Min 0.192262 , -3.01097 -2.17545
4,47203 -0.82652 4.22215 -2.6128 . -0.55955 -0.14823 -3.68328
-21948
NJ
o Mean , 0.919859 -1.10273 0.189203
0.026625 0,609339 .1,7704 -0.5307 0.365055 0.695365 -1.17291
.0,20762 ,
n)
Median , 0.860249 -1.05343 0.274006 0.0130548 0.622131 -
1-68559 -0.44093 0372341 0_679/72 -1.05591 -0.97461.
Cl_
PC41 , Max _ 1.90419 0.215051 1.539568 _ 1.204076 _
2.040596 -0.20599 1.025142 _ 10E2771 1342552 Ø04543 1,044939
Cl Mmn -138005 -137504 -129996 -0.49733 -0.35268
-0.8685 -0.39322 4.70938 -1-71589 -1.7904 . -1.39851
_ Mean 407498 -052564 424039 0.701345
0.996746 0.520117 0.744232 456621 Ø41153 Ø82975 440126
Median -0417529 -0.48207 -0.18651 0.497651 0.817435 0384759 0.686377 -0.69103 -
0.33802 -03047 -0.39539
PCA2 Max 0.785801 0.176265 0.87503 3.81110586
4.311936 3,021218 3474901 ' 0.015191 0.704506 411251 0,595757
min . -0.17801 -025777 -0.37688
-0.16467 -0.23246 -0.47501 - -0.00111 0.538379 0.435168
0.337445 0.222405
Mean 0567525 0.293 0.505379 0.71742
1077253 0.78187 . 1005429 ' 1.056894 1.156804 1.045675
1,227425
Median 0.560588 0.264634 0.473588 . 0.674781 1.053549
0.727749 1.007761 1.085427 1.14325 , 1.1336725 1.200613
00 PCA3 Max 1.6357113 0.932042 1i141691
2.234525 2.790854 2.556613 2.483974 1.565017 3.16181
1,973707 2,509435
Os
Min -0.24073 0.213129 0305131 -3.03078 -3.22656 -
2.78298 -0.8606 -/.61996 A 1111714 4.17888 -0.50044
Mean 0.936613 1.158602 1.628149 -
1.25321 , -0.49661 -042577 0.564935 -0.67182 -0.02267
0.109856 0.973061
Median 0.954165 1.088302 1.633074 -1.21889 Ø46274 -
0,40653 0537203 -0.72684 -0.0%174 0.201603 0,930979 _,
PC44 Max , 2.449815 2.046121 23256 -0.007E5
1,301237 1.30015 2.491648 , 0.122389 1.218455 1.682597
2.514142
Min _., 457322 -0.00876 . -1.17026 _ -2.49874 .3.23865 -
2,76549 -4.077112 -0.9589 -1.70771 .141474 .2.02076
Mean 0.282176 059606 0-172591 -0.46655 -0.94402 -0.73067 -1.02591 -0.15265 -
0.4/Ps -0.34837 . -0.70651
. Median 0.263371 0.577423 0.151654 Ø39547 -0.64361
459992 -0.59159 417175 -0.40794 .032927 4,61785
PC.A5 Max 1.412132 1.3224131 1.497953 I
0.404344 I 0.182532 0.480085 I -0.10675 I 0362286 0.446026 0.347785 .
-0.0103
Example 3: Design of Zinc Fingers to Bind Genomic Loci in Soybean
Zinc finger proteins directed against the identified DNA sequences of the
representative
genomic loci were designed as previously described. See, e.g., Umov et aL,
(2005) Nature
435:646-551. Exemplary target sequence and recognition helices are shown in
Table 7
(recognition helix regions designs) and Table 8 (target sites). In Table 8,
nucleotides in the
target site that are contacted by the ZFP recognition helices are indicated in
uppercase letters
and non-contacted nucleotides are indicated in lowercase. Zinc Finger Nuclease
(ZFN) target
sites were designed for all of the previously described 32 selected optimal
genomic loci.
Numerous ZFP designs were developed and tested to identify the fingers which
bound with the
highest level of efficiency with 32 different representative genomic loci
target sites which were
identified and selected in soybean as described above. The specific ZFP
recognition helices
(Table 7) which bound with the highest level of efficiency to the zinc finger
recognition
sequences were used for targeting and integration of a donor sequence within
the soybean
genome.
Table 7. zinc finger designs for the soybean selected genomic loci (N/A
indicates "not
applicable).
pDAB ZFP
F1 -F2 F3 F4 F5 F6
Number Number
SRO ID SEQ ID SEQ ID SEQ ID SEQ ID SEQ ID
NO: 7019 NO: 7020 NO: 7021 NO: 7022 NO: 7023 NO: 7024
124201 QSANRTK HRSSLRR QSANRTK DSSDRKK DRSNRTT DNSNRIK
SEQ ID SEQ ID SEQ ID SEQ ID SEQ ID SEQ ID
391 NO: 7025 NO: 7026 NO: 7027 NO: 7028 NO: 7029 NO: 7030
RSDNLSV QKATRIN RSDHLSE RNDNRKN DRSNRTT RKYYLAK
SEQ ID SEQ ID SEQ ID SEQ ID SEQ ID
NO: 7031 NO: 7032 NO: 7033 NO: 7034 NO: 7035
124221 DRSNRTT : QSAHRIT HAQGLRH QSGRLSR QSGHLSR N/A
SEQ ID SEQ ID SEQ ID SEQ ID
411 NO: 7036 NO: 7037 NO: 7036 NO: 7039
OSOSLTR _ RLDNLPN RPYTLRI, DNSNRIK N/A N/A
- 87 -
Date regue/Date received 2024-01-16
SEQ ID SEQ ID SEQ ID - SEQ ID
NO: 7040 NO: 7041 NO: 7042 NO: 7043
125332 TSGNLTR TSGNLTR gSGDLTR HKNVLRQ N/A N/A
SEQ ID SEQ ID SEQ ID SEQ ID SEQ ID
651 NO: 7044 NO: 7045 NO: 7046 NO: 7047 NO: 7046
QSGHLAR TSSNRKT DSSDRKK QSGNLAR HNSSLKD N/A
SEQ ID SEQ ID SEQ ID SEQ ID SEQ ID SEQ ID
NO: 7049 NO: 7050 NO: 7051 NO: 7052 NO: 7053 NO: 7054
125309 TSGSLSR QLNNLKT QSADRTK DNSNRIK TSGSL8R ,QSGDLTR
SEQ ID SEQ ID SEQ ID SEQ ID
655 NO: 7055 NO: 7056 NO: 7057 NO: 7058
,OISMERTK ,DRSNRTT QSGDLTR HRSSLLN N/A N/A
SEQ ID SEQ ID SEQ ib SEQ ID SEQ ID
NO: 7059 NO: 7060 NO: 7061 NO: 7062 NO: 7063
124884 IDHGRYR DRSNLTR QSGDLTR QSODLTR QRNARTL N/A
SEQ ID SEQ ID SEQ ID SEQ ID SEQ ID, " SEQ ID
195 NO: 7064 NO: 7065 NO: 7066 NO: 7067 NO: 7068 NO: 7069
,TSGNLTR DRTGLRS SQYTLRD TSGHLSR RSDHLSE gswiT
SEQ ID SEQ ID SEQ ID 8E0 ID SEQ ID
NO: 7070 NO; 7071 NO: 7072 NO; 7073 NO: 7074
124234 TNONR/T HSNARKT QSADRTK DNSNRIK RSDALTQ N/A
SEQ ID SEQ ID SEQ ID SEQ ID SEQ ID SEQ ID
424 NO: 7075 NO: 7076 NO: 7077 NO: 7078 NO: 7079 NO: 7080
TSGNLTR Q8NQLRQ gSGNLAR RQEHRVA QSGALAR QSGHLSR
,
SEQ ID SEQ ID SEQ ID SEQ ID SEQ ID SEQ ID
NO: 7061 NO: 7002 NO: 7003 NO: 7084 NO: 7085 NO; 7086
124257 QSGSLTR WRSCRSA QSGNLAR WRISLAA QKHHLGD RSADLSR
SEQ ID SEQ ID SEQ ID SEQ ID SEQ ID
447 NO: 7087 NO: 7088 NO: 7089 NO: 7090 NO: 7091
DRSNRTT QSANRTK QSANRTK DRSNRTT QSGNLAR N/A
SEQ ID SEQ ID SEQ ID SEQ ID SEQ ID SEQ ID
NO: 7092 NO: 7093 NO: 7094 NO: 7095 NO: 7096 NO: 7097
125316 QSGNLAR . TSGNLTR DRSNRTT QNATRIN TSSNRKT QSGHLSR
SEQ ID SEQ ID SEQ ID SEQ ID
662 NO: 7098 NO: 7099 NO: 7100 NO: 7101
DSSTRKT QSGNLAR RSDVLST QSGPLTQ N/A N/A
SEQ ID SEQ ID SEQ ID SEQ ID SEQ ID
NO: 7102 NO: 7103 NO: 7104 NO: 7105 NO: 7106
124265 QSGNLAR DKSCLPT wELNERT TSGNLTR DRSNLTR N/A
SEQ ID SEQ ID SEQ ID SEQ ID SEQ ID SEQ ID
455 NO: 7107 NO: 7108 NO: 7109 NO: 7110 NO: 7111 NO: 7112
DRSDLSR RREHLRA RSDNLAR ONNYRGS RSHSLLR RRDTLLD
SEQ ID SEQ ID SEQ ID SEQ ID SEQ ID SEQ ID
NO: 7113 NO: 7114 NO: 7115 NO: 7116 NO: 7117 NO: 7118
124273 QSGOLTR QSGNLAR HQCCLTS RSANLTR RSANLAR TNQNRIT
SEQ ID SEQ ID SEQ ID SEQ 16 SEQ ID SEQ ID
463' NO: 7119 NO: 7120 NO: 7121 NO: 7122 NO; 7123 NO: 7124
ATBDLAA TSGHLSR RSDNLSE TSSNRKT DRSALAR RSDYLAK
SEQ ID SEQ ID SEQ ID SEQ ID ' SEQ ID SEQ ID
NO: 7125 NO: 7126 NO: 7127 NO: 7128 NO: 7129 NO: 7130
124888 rsdnlar qsnalnr , qkgt1ge qsgsltr rsdsllr wacclrd
SEQ ID SEQ ID SEQ ID SEQ ID SEQ ID
213 NO: 7131 NO: 7132 NO: 7133 NO: 7134 NO: 7135
gsgsltr drsyrnt dqsnirs rhshlts qsgnlar N/A
SEQ ID SEQ ID SEQ ID SEQ ID SEQ ID SEQ ID
NO: 7136 NO: 7137 NO: 7138 NO: 7139 NO: 7140 NO: 7141
tognitr lsqdlnr redsler dssartk rsdhlsa crrnlrn
SEQ ID SEQ ID SEQ ID SEQ ID SEQ ID SEQ ID
124885 215 NO; 7142 NO; 7143 NO: 7144 NO: 7145 NO: 7146 NO: 7147
seadrsk drsnitr drsalsr tssnrkt , ergtlar drsalar
- 88 -
Date regue/Date received 2024-01-16
SEQ ID 1 SEQ ID SEQ ID SW ID SEQ ID SEQ ID
NO: 7148 NO: 7149 NO: 7150 NO: 7151 NO: 7152 NO: 7153
STDYRYP QSGNLAR RSDNLSV Tgwmps RSDELSO TRSPLTT
SEQ ID SEQ ID SEQ ID SRO ID SEQ ID SEQ ID
124610 480 NO: 7154 NO: 7155 NO; 7156 NO: 7157 NO: 7158 NO: 7159
TNQSLHW QSGNLAR RPYTLRL QSGSLTR RSDVLSE TSSNRKT
SEQ ID SEQ ID SEQ ID SEQ ID SKI ID
NO: 7160 NO: 7161 NO; 7162 NO: 7163 NO: 7164
RSDVLST RNSYLIS RSANLAR TNONRIT RSDNLSV _
SEQ ID SEQ ID SEQ ID SEQ ID SEQ ID SEQ ID
124614 464 NO: 7165 NO: 7166 NO: 7167 NO: 7160 NO: 7169 NO: 7170
RSDHLSA RSANLTR LRECHLTR DRSTIAQ HNHDLRN TSGNLTR
SEQ ID SEQ ID SEQ ID SEQ ID SEQ ID
NO: 7171 NO: 7172 NO: 7173 NO: 7174 NO: 7175
OSANRTT QNAHRKT QSGNLAR QRNHRTT QSANRTK N/A
SEQ ID SEQ ID SEQ ID SEQ ID
124636 506 NO: 7176 NO: 7177 NO: 7178 NO: 7179
RSDHLSE TRnSLTR (JSGALAR QSGELSR N/A N/A
SEQ ID SEQ ID SEQ ID SEQ ID SEQ ID SEQ ID
NO: 7180 NO: 7181 NO: 7182 NO: 7183 NO: 7184 NO: 7185
RWLANS TNSNRKR OSANRTT HRSSLRR RSDVLSA ONATRIN
SEQ fb SEQ ID SEQ ID SEQ ID SEQ ID SEQ ID
124648 518 NO: 7186 NO: 7187 NO: 7188 NO: 7189 NO: 7190 NO: 7191
_RSDSLLR QSCARNV RPYTLRL RRSSLRR RSDSLLR QSCARNV
SEQ ID SEQ ID SEQ ID SEQ ID SEQ ID SEQ ID
NO: 7192 NO: 7193 NO; 7194 NO: 7195 NO: 7196 NO: 7197
QSSDLSR THWYLKK QSANRTK DNSNRIK QSGNLAR DRTNLNA
SEQ ID SEQ ID SEQ ID SEQ ID SEQ ID SEQ ID
121225 233 NO: 7196 NO: 7199 NO: 7200 NO: 7201 NO: 7202 NO: 7203
Rumps TSANLSR QSANRTK DNSYLPR LKONLDA RSHHLKA
SEQ ID SEQ ID SEQ ID SEQ ID SEQ ID
NO: 7204 NO: 7205 NO: 7206 NO: 7207 NO: 7208
RSDHLSQ TARLLKL RSDNLTR QSSDLSR YHWYLKK N/A
SEQ ID SEQ ID SEQ ID SEQ ID SEQ ID SEQ ID
121227 235 NO: 7209 NO: 7210 NO: 7211 NO: 7212 NO: 7213 NO: 7214
DRSNLSR TSGNLTR DRSNRTT TNSNRKR RSDSLSV QNANRKT
SEQ ID SEQ ID SEQ ID SEQ ID SEQ ID
NO: 7215 NO: 7214 NO: 7217 NO: 7218 NO: 7219
TSGNLTR QRSHLSD RSDNLSE VRRALSS RSDNLSV N/A
SEQ ID SEQ ID SEQ ID SEQ ID SEQ ID SEQ ID
121233 241 NO: 7220 NO: 7221 NO: 7222 NO: 7223 NO: 7224 NO: 7225
OSSNLAR 7SGSLTR QSGNLAR QKVNRAG TSGSLSR DSSALAK
SEQ ID SEQ ID SEQ ID SEQ ID SE() ID SEQ ID
NO: 7226 NO: 7227 NO: 7228 NO: 7229 NO: 7230 NO: 7231
QSGDLTR RKDPLEE QSGNLAR ATCCLAH QSSDLSR RRDNLHS
SEQ ID SEQ ID SW ID SW ID SEQ ID SEQ ID
121235 243 NO: 7232 NO: 7233 NO: 7234 NO: 7235 NO: 7236 NO: 7237
QSGNLAR HNSSLKD , 0SGALAR QSANRTK RSDHLST RSDHLSR
SEQ ID SEQ ID SEQ ID SEQ ID SEQ ID
NO: 7238 NO: 7239 NO: 7240 NO: 7241 NO: 7242
TSGNLTR ILSINLRA DRSHLAR RSDDLTR ,TSSNRKT N/A
SEQ ID szg ID SEQ ID SEQ ID SEQ :6 SEQ ID
121238 250 NO: 7243 NO: 7244 NO: 7245 NO: 7246 NO: 7247 NO; 7248
TSGNLTR QSGALVI QNAHRKT LKKHLTD RSDNLST DRSNRKT
SEQ ID SEQ ID SRI fD SSG f6 -SEQ fb "
NO: 7249 NO: 7250 NO: 7251 NO: 7252 NO: 7253
DRSALSR RSDALTQ DRSTRTK QSGNLEV RSDNLTR N/A
SEQ ID SEQ ID SEQ ID SEQ ID
121246 259 NO: 7254 NO: 7255 NO: 7256 NO: 7257
DRSNLSR QSGNLAR RSDSLLR WLSSLSA N/A N/A
- 89 -
Date regue/Date received 2024-01-16
SEQ ID ' SEQ ID ' SEQ ID SEQ ID SEQ ID SEQ ID
NO: 7258 NO: 7259 NO: 7260 NO: 7261 NO: 7262 NO: 7263
RSDNLST DSSSRIK GSGALAR OSONLHV RSDVLST RYAYLTS
SEQ ID SEQ ID SEQ ID SEQ ID SEQ ID
121249 262 NO: 7264 NO: 7265 NO: 7266 NO: 7267 NO: 7268
RSDNLSE TRSPLRN QNAHRKT RSDHLSE RNDNRKN N/A
SEQ ID SEQ ID SEQ ID SEQ ID SEQ ID
NO: 7269 NO: 7270 NO: 7271 NO: 7272 NO: 7273
QRTNLVE ASKTRTN RSANLAR RSDHLTQ RSAHLSR N(A
SEQ ID SEQ ID SEQ ID SEQ ID SEQ ID
125324 670 NO: 7274 - NO: 7275 NO: 7276 NO: 7277 NO: 7278
RSDNLSV QNANRIT DQSNLRA QNAERKT RSAHLSR , N/A
SEQ ID SEQ ID SEQ ID SEQ ID SEQ ID SEQ ID
NO: 7279 NO: 7280 NO: 7281 NO: 7282 NO: 7283 NO: 7284
DRSALAR RSDYLAK RODDLSR RNDNRTK RSDHLST HSNTRIOR
SEQ ID SEQ ID SEQ ID SEQ ID
121265 , 282 NO: 7285 NO: 7286 NO: 7287 NO: 7288
RSDVLSE QRSNLKV GSSNLAR QSGELSR ,N049_
SEQ ID SEQ ID 8E0 ID SEQ ID
NO: 7289 NO; 7290 NO: 7291 NO: 7292
DRSDLSR LRFNLRN RSDSLSV QNANRKT N/A N/A ,
SEQ ID SEQ ID SW, ID SEQ ID SEQ ID
121271 288 NO: 7293 NO: 7294 NO: 7295 NO: 7296 NO: 7297
QSGDLTR TSGSLTR RSDDLTR .qviLlap QSGDLTR N/A
,
SRO ID SEQ ID SEQ sb SEQ ID SEQ ID SEQ ID
NO: 7298 NO: 7299 NO: 7300 NO: 7301 NO: 7302 NO: 7303
RSDNLST AACNRNA RPYTLRL QSGSLTR SQYTLRD TSGWV3R
SEQ ID SEQ ID SEQ ID SEQ ID
124666 536 140: 7304 NO: 7505 NO: 7306 NO: 7307
QSANRTK DRSNRTT RSDVLST CRRNLRN N/A N/A
SEQ ID SEQ ID SEQ ID SEQ ID SEQ ID
NO: 7308 NO: 7309 NO: 7310 NO: 7311 NO: 7312
QSGDLTR HRSSLLN THQSLEW QSGNLAR QSGNLAR N/A
SEQ ID SEQ ID SEQ ID SEQ ID SEQ ID SEQ ID
124814 598 140: 7313 NO: 7314 NO: 7315 NO: 7316 NO: 7317 NO: 7318
RSCCLHL RNASRTR QSGNLAR RQEHRVA RSDNLSB TSSNRKT
SEQ ID SEQ ID SEQ ID SRO ID SRO ID SEQ ID
NO: 7319 NO: 7320 NO: 7321 NO: 7322 NO: 7323 NO: 7324
RSDVLSE QRSNLKV QSGALAR YRWLRNS QSANRTT DRSNRTT
SEQ ID SEQ ID SEQ ID SEQ ID SEQ ID SEQ ID
124690 560 NO: 7325 NO: 7326 NO: 7327 NO: 7328 NO: 7329 NO: 7330
QNAHRKT LAHHLVQ HAQGLRH OSOHLSR RSDDLTR RRFTLSK
SEQ ID SEQ ID SEQ ID SF* ID SEQ ID SEQ ID
NO: 7331 NO: 7332 NO: 7333 NO: 7334 NO: 7335 NO: 7336
_RSDN;SE PIESRYK ,NSAHLSR ,RSDDLTR YSETZED TSGELTR
SEQ ID SEQ ID SEQ ID SEQ in SEQ ID
124815 599 NO: 7337 NO: 7330 NO: 7339 NO: 7340 NO: 7341
RSDVLST DNSSRTR RSDALAR RSDSLSA DRSDLSR N/A
SEQ ID SEQ ID SEQ ID SEQ ID SEQ ID
NO: 7342 NO: 7343 NO: 7344 NO: 7345 NO: 7346
GIQGLGI DRSNLTR RNDDRKK RSDVLSE RSSDRTK ,111/A
SEQ ID SEQ ID SEQ ID SEQ ID SEQ ID
124816 600 NO: 7347 NO: 7346 NO: 7349 140: 7350 NO: 7351
QSANRTK DSSHRTR QSANRTK SVGNLNQ TSONLTR N/A
SEQ ID SEQ ID SEQ ID SEQ ID SEQ ID SEQ ID
NO: 7352 NO: 7353 NO: 7354 NO: 7355 NO: 7356 NO: 7357
TNQNRIT HSNARKT QSSHLTR RLDNRTA QSGNLAR WANLIK
SEQ ID SEQ ID SEQ ID SEQ ID SEQ ID
124842 631 NO: 7358 NOt.7359 NO: 7360 NO: 7361 NO: 7362
RSDNLST OKSPLNT OSSDLSR OSSDLSR YHWYLKK N/A
-90-
Date regue/Date received 2024-01-16
SEQ ID SEQ ID SEQ ID SEQ ID
NO: 7574 NO: 7575 NO: 7576 NO: 7577
TSSNRKT RSDELRO RSDTLSA DKSTRTK N/A N/A .
SEQ ID SEQ ID SEQ ID SEQ ID SEQ ID SEQ ID
NO; 7578 NO: 7579 NO; 7500 NO; 7591 NO; 7562 NO; 7583
125338 37 DRSTRTK OSONLHV QNAHRKT OSAARTK TSGSLSR FYMQLSR
Table 8. LIK finger target site of soybean selected genomic loci
Locus Name pDAB ZFP Number and Binding Sites (5'-)3')
ID Number
SEQ ID NO: 7363 SEQ NO: 7364
OOLOI 124201 TACTATTCCTAAGT TOOTACTAGGGGATAA
soy ogl 308 , 391 , TAAA AG
SEQ ID NO: 7365
OGLO2 124221 GGAGGAATTTAGAT SEQ ID NO: 7366
soy og1 307 411 AC TACTTGCTGGTA
00L03 125305
SEQ ID NO: 7367 SEQ ID NO: 7368
soy ogl 2063 651 ATCATCTGCAAA CTTGAATTCCTATGGA
SEQ ID NO: 7369
OGLO4 125309 AACTTGTGAGTAAA SEQ 113 NO: 7370
_soy 081 1906 655 CTGC ATTGCATAATAA
SEQ ID NO: 7371 ¨ SEQ 1D NO: 7372
OGLO5 124884 GTTGTCTTGCTGCT ACACAGGGTATCTTCG
_soy ogl 262 195 AT AT
SEQ ID NO: 7373 SEQ ID NO: 7374
00L06 124234 ATGTACTCATATTC GGAGTAAGGGAAAAAG
soy ogl 5227 _ 424 AT AT
SEQ ID NO: 7375
OGLO7 124257 GCTCGTCATTGAAT SEQ 1D NO: 7376
soy og1 4074 447 TGTGTA GAAAAATAATTAATAC
SEQ ID NO: 7377
00L08 125316 GGATATATAAACGA SEQ ID NO: 7378
soy ogl 3481 662 TGAA ATAATGGAACCC
SEQ ID NO: 7379 SEQ ID NO: 7380
00L09 124265 GACGATCACCTCOA CCOGTOTCAGAGAGGO
soy ogl 1016 455 A CC
. _
SEQ ID NO: 7381 SEQ ID NO: 7382
OGLIO 124273 AATGAGAGAGAGA CAGATCAATCAGGGTC
soy ogl 937 463 GAAGCA _ CC
SEQ ID NO: 7383
OGLI I 124888 CTCTACA'TGOTACC SEQ ID NO: 7384
soy ogl 5109 213 ACTCG GAAAGGCACCTCGTA
SEQ ID NO: 7385 SEQ 113 NO: 7386
00LI2 ATCAGCCACGATCC G'TCGCCCATGTCTGACT
soy ogl 6801 12488$ 215 TOCA CA
SEQ /D NO: 7387 SEQ ID NO: 7388
OGLI3 CTATAGTTTTAAGT TATATGGTATTGGAAAT
soy ogl 6636 124610 480 GAATTA
SEQ ID NO: 7389 SEQ ID NO: 7390
00L14 CATCGTCTCATGCT GATCCTACAAGTGAGA
soy ogl 4665 124614 484T GG
-91 -
Date regue/Date received 2024-01-16
SEQ ID NO: 7391 SEQ ID NO: 7392
OGL15
soy ogl 6189 124636 506 TrITCTTICTCTTTA GGAGTAGTTAGG
SEQ ID NO: 7393 SEQ ID NO: 7394
00L16 AACATCTTTAACTC ATAGTGOTTTTGCATAG
soy ogl 4222 124648 518 ATTGT TG
SEQ ID NO: 7395 SEQ ID NO: 7396
OGL17 CACGAAAAACTAAA AGGTATTTCTAAGATA
soy _ogl 2543 121225 , 233 TTTGCT GG
SEQ ID NO: 7397 SEQ ID NO: 7398
GLIB TTTGCTGAGTGAAG CAAATGTGATAACTGA
soy ogl 319 121227 235 G TGAC
SEQ ID NO: 7399 SEQ ID NO: 7400
OGL19 AAGATGAAGCGAG ATCGTTCAAGAAGTTG
soy ogl 2353 121233 241 AT AA
SEQ NO: 7401 SEQ ID NO: 7402
0GL20 CAGGCTGGCAAAAT GGGTGGTAAGTAL1 1G
soy ogl 1894 121235 243 GGAA AA
SEQ ID NO: 7403 SEQ NO: 7404
06L22 AATGCGTGOCCACG AACTAGCOTAGAGTAG
soy ogl 3218 121238 250 AT AT
SEQ ID NO: 7405
0GL24 GAGAAAGCCATGGT SEQ ID NO: 7406
soy ogl 3333 121246 259 C TGTOTGGAAGAC
SEQ ID NO: 7407
0GL25 TGGATGTCAAGTAT SEQ ID NO: 7408
soy _ogl 2546 121249 262 TCAAG TAGGGGAGAATAC.AG
SEQ ID NO: 7409
0GL28 GOGAGOGAGACCC SEQ ID NO: 7410
soy ogl 5957 125324 670 AA GGGAGAAACAAAAAG
SEQ ID NO: 7411
0GL30 GTTTGGTTAGGCGC SEQ ID NO: 7412
, soy ogl 3818 121265 282 AGATC GGAGAAACAACTG
SEQ ID NO: 7413 SEQ ID NO: 7414
OGL31
soy ogl 5551 121271 288 AAAGTGICATOCC GCAATTGCGGTTGCA
SEQ NO: 7415
00L33 optimal loci_10 GGTATCGTATTGCA SEQ ID NO: 7416
98 124666 538 'TTAG COCACGTAATAA
¨
SEQ ID NO: 7417 SEQ ID NO: 7418
00L34 optimal_loci_97 GAAGAAATTATTGC AATCAGAGGGAAGTGA
772 124814 598 A GA
SEQ ID NO: 7419 SEQ ID NO: 7420
00L35 optimal_loci_23 AACTAACTTGTAAC TTGGCGGGAATTAGTA
6662 124690 560 AACTG GA
SEQ ID NO: 7421
0GL36 optimal loci_13 GATCTTGCGGGGTA SEQ ID NO: 7422
9485 124815 599 GCAG GACCTGGTGOTCATO
SEQ ID NO:7584
ATACGTCAGGOTtant
OGL37 00L37
optimal loci_30 gGTTGTTTAATGAA
- 1175 125338 627 AAGCC
SEQ ID NO: 7423
00L38 optimal loci_15 TCTATGTCGGACTT SEQ ID NO: 7424
2337 124816 600 T GATCATTTAAGGATAA
- 92 -
Date regue/Date received 2024-01-16
SEQ NO: 7425
0GL39 optimal_loci_20 ATGAATTCCCTITTC SEQ ID NO: 7426
2616 124842 _ 631 7TA TTTGCTOCTITATAG
The soybean representative gnomic loci zinc finger designs were incorporated
into zinc
finger expression vectors encoding a protein having at least one finger with a
CCHC structure.
See, U.S. Patent Publication No. 2008/0182332. In particular, the last finger
in each protein had
a CCHC backbone for the recognition helix. The non-canonical zinc finger-
encoding sequences
were fused to the nuclease domain of the type IIS restriction enzyme Fokl
(amino acids 384-
579 of the sequence of Wah el al., (1998) Proc, Natl. Acad. Sci. USA 95:10564-
10569) via a
four amino acid ZC linker and an opaque-2 nuclear localization signal
optimized for soybean to
form zinc-finger nucleases (ZFNs). See, U.S. Patent No. 7,888,121. Zinc
fingers for the
various functional domains were selected for in vivo use. Of the numerous ZENs
that were
designed, produced and tested to bind to the putative genomic target site, the
ZFNs described
in Table 8 above were, identified as having in vivo activity and were
characterized as being
capable of efficiently binding and cleaving the unique soybean genomic
polynucleotide target
sites in planw.
ZFN Construct Assembly
Plasmid vectors containing ZFN gene expression constructs were designed and
completed using skills and techniques commonly known in the art (see, for
example, Ausubel
or Maniatis). Each ZFN-encoding sequence was fused to a sequence encoding an
opaque-2
nuclear localization signal (Maddaloni et al., (1989) Nuc. Acids Res.
17:7532), that was
positioned upstream of the zinc finger nuclease. The non-canonical zinc finger-
encoding
sequences were fused to the nuclease domain of the type XIS restriction enzyme
Fold (amino
acids 384-579 of the sequence of Wah et al. (1998) Proc. Natl. Acad. Sci. USA
95:10564-
10569). Expression of the fusion proteins was driven by a strong constitutive
promoter from
the Cassava vein mosaic virus. The expression cassette also includes a 3' UTR
from the
Agrobacteriwn tumefacieus 0RF23. The self-hydrolyzing 2A encoding the
nucleotide sequence
from Thosea asigna virus (Szymczak ei al., (2004) Nat Biotechnol. 22:760-760)
was added
between the two Zinc Finger Nuclease fusion proteins that were cloned into the
construct.
The plasmid vectors were assembled using the 1NFUS1ONTM Advantage Technology
(Clontech, Mountain View, CA). Restriction endonucleases were obtained from
New England
BioLabs (Ipswich, MA) and T4 DNA Ligase (lnvitrogen, Carlsbad, CA) was used
for DNA
ligation. Plasmid preparations were performed using NUCLEOSPINO Plasmid Kit
(Macherey-
- 93 -
Date regue/Date received 2024-01-16
Nagel Inc_, Bethlehem, PA) or the Plasmid Midi Kit (Qiagen) following the
instructions of the
suppliers. DNA fragments were isolated using QIAQUICK GEL EXTRACTION MTN
(Qiagen) after agarose iris-acetate gel electrophoresis. Colonies of all
ligation reactions were
initially screened by itsbiction digestion of miniprep DNA. Plasmid DNA of
selected clones
was sequenced by a commercial sequencing vendor (Eurofins MWG Operon,
Huntsville, AL).
Sequence data were assembled and analyzed using the SE,QUENCHERni software
(Gene
Codes Corp., Ann Arbor, MI). Plasmids were constructed and confirmed via
restriction enzyme
digestion and via DNA sequencing.
Zinc Finger Cloning Via Automated Workflow
A subset of Zinc Finger Nuclease vectors were cloned via an automated DNA
construction pipeline. Overall, the automted pipeline resulted in vector
constructions with
identical ZFN architecture as described previously. Each Zinc Finger monomer,
which confers
the DNA binding specificity of the ZFN, were divided into 2-3 unique sequences
at a KPF
amino acid motiE Both the 5' and 3' ends of the ZFN fragments were modified
with inclusion
of a Bsal recognition site (GGTCTCN) and derived overhangs. Overhangs were
distributed
such that a 6-8 part assembly would only result in the desired full length
expression clone.
Modified DNA fragments were synthesized de nova (Synthetic Genomics
Incorporated, La
Jolla, CA). A single dicot backbone, pDAB118796 was used in all of the soybean
ZFN builds.
It contained the Cassava Mosaic Virus promoter and the 0paque2 NLS as well as
the Fokl
domain and the 0rf23 3'1JTR from Agrobacterium tumefaciens. Cloned in between
the Opaque
2 NLS and the Fokl domain was a Bsal flanked SacB gene from Bacillus subtilis.
When
putative ligation events were plated on Sucrose containing media, the SacB
cassette acts as a
negative selection agent reducing or eliminating vector backbone
contamination. A second part
repeatedly utilized in all builds was pDAB117443. This vector contains the
first monomer
Fokl domain, the T2A stutter sequence, and the 2nd monomer 0paque2 NLS all
flanked by Bsal
sites.
Using these materials as as the ZFN DNA parts library, a Freedom Evo ISO
(TECAN,
Mannedorf, Switzerland) manipulated the addition of 75-10Ong of each DNA
plasmid or
synthesized fragment from 2D bar coded tubes into a PCR plate (ThermoFisher,
Waltham,
MA). Bsal (NEB, Ipswich, MA) and T4 DNA ligase (NEB, Ipswich, MA) supplemented
with
Bovine Serum Albumin protein (NEB, Ipswich, MA) and 14 DNA Ligase Buffer(NEB,
Ipswich, MA) were added to the reaction. Reactions were cylckd (25X) with
incubations for 3
minutes at 37 C and 4 minutes at 16 C C1000 Touch Thermo Cycler (BioRad,
Hercules CA).
- 94 -
Date regue/Date received 2024-01-16
Ligated material was transformed and screened in Top10 cells (Life
Technologies Carlsbad,
CA) by hand or using a Qpix460 colony picker and LabChip OX (Perkin Elmer,
Waltham,
MA). Correctly digesting colonies were sequence confirmed provided to plant
transformation,
Universal Donor Construct Assembly
To support rapid testing of a large number of target loci, a novel, flexible
universal
donor system sequence was designed and constructed. The universal donor
polynucleotide
sequence was compatible with high throughput vector construction methodologies
and analysis.
The universal donor system was composed of at least three modular domains: a
variable ZFN
binding domain, a non-variable analytical and user defined features domain,
and a simple
plasmid backbone for vector scale up. The non-variable universal donor
polynucleotide
sequence was common to all donors and permits design of a finite set of assays
that can be used
across all of the soybean target sites thus providing uniformity in targeting
assessment and
reducing analytical cycle times. The modular nature of these domains allowed
for high
throughput donor assembly. Additionally, the universal donor polynucleotide
sequence has
other unique features aimed at simplifying downstream analysis and enhancing
the
interpretation of results. It contained an asymmetric restriction site
sequence that allows the
digestion of PCR products into diagnostically predicted sizes. Sequences
comprising secondary
structures that were expected to be problematic in PCR amplification were
removed. The
universal donor polynucleotide sequence was small in size (less than 3.0 Kb).
Finally, the
universal donor polynucleotide sequence was built upon the high copy pUC19
backbone that
allows a large amount of test DNA to be bulked in a timely fashion.
As an embodiment, an example plasmid comprising a universal donor
polynucleotide
sequence is provided as pDAB124280 (SEQ ID NO:7561 and Figure 7). In an
additional
embodiment, a universal donor polynucleotide sequence is provided as:
pDAB124281, SEQ ID
NO:7562, Figure 8; pDAB 121278, SEQ ID NO:7563, Figure 9; pDAB123812, SEQ ID
NO:7564 Figure 10; pDAB 121937, SEQ ID NO:7565, Figure 11; pDAB123811, SEQ 11)
NO:7566, Figure 12; and, pDAB124864 SEQ ID NO:7567, Figure 13. In another
embodiment,
additional sequences comprising the universal donor polynucleotide sequence
with functionally
expressing coding sequence or nonftmctional (promoterless) expressing coding
sequences
can be constructed (Table 11).
-95 -
Date regue/Date received 2024-01-16
Table 11: The various universal domain sequences that were transformed into
the plant
cell protoplasts for donor mediated integration within the genome of soybean
are
, provided. The various elements of the universal domain plasmid system are
described
and identified by base pair position in the accompanying SEQ ID NO:. 'N/A"
meas not
applicable.
Vector Name ZFN binding Analytical Flasmid SEQ ID
domain domain backbone NO:
pDAB124280 1955-2312bp 2313-2422bp 2423-1954bp Al
pDAB124281 1955-2256bp 2257-2366bp 2367-1954bp A2
pDAB121278 1509-1724bp 1725-1834bp 1835-1508bp A3
pDAB123812 1955-2177bp 2178-2287bp 2288-1954bp A4
pDAB121937 1955-2127bp 2128-2237bp 2238-1954bp A5 _
pDAB123811 1955-2187bp 2288-2297bp 2298-1954bp A6
pDAB124864 1952-2185 ,.N/A 2186-1951bp A7
The universal donor polynucleotide sequence was a small 2-3 Kb modular donor
system
delivered as a plasmid. This was a minimal donor, comprising 1, 2, 3, 4, 5, 6,
7, 8, 9, or more
ZFN binding sites, a short 100-150 bp template region referred to as "DNA X"
or "UZI
Sequence" (SEQ ID NO:7568) that carries restriction sites and DNA sequences
for primer
design or coding sequences, and 'a simple plasmid backbone (Fig. 4). The
entire plasmid was
inserted through NHE.1 following DNA double strand breaks at the appropriate
ZFN binding
site; the ZFN binding sites can be incorporated tandemly. This embodiment of a
universal donor
polynucleotide sequence was most suitable for rapid screening of target sites
and ZFNs, and
sequences that were difficult to amplify were minimized in the donor.
Universal donors
without the "uzr sequence but carrying one or more ZFN sites have also been
generated
In a further embodiment the universal donor polynucleotide sequence was made
up of at
least 4 modules and carries ZFN binding sites, homology arms, DNA X with
either just the
approximately 100 bp analytical piece or coding sequences. This embodiment of
the universal
donor polynucleotide sequence was suitable for interrogating HDR mediated gene
insertion at a
variety of target sites, with several ZFNs (Fig. 5).
The universal donor polynucleotide sequence can be used with all targeting
molecules
with defined DNA binding domains, with two modes of targeted donor insertion
(NHEPHDR).
As such, when the universal donor polynucleotide sequence was co-delivered
with the
appropriate ZFN expression construct, the donor vector and the soybean genome
was cut in one
specific location dictated by the binding of the particular ZFN. Once
linearized, the donor can
be incorporated into the genome by NHE1 or HDR. The different analytical
considerations in
- 96 -
Date re gu e/Date received 2024-01-16
the vector design can then be exploited to determine the Zinc Finger which
maximizes the
efficient delivery of targeted integration.
Example 4: Soybean Transformation Procedures
Before delivery to Glycine max c.v. Maverick protoplasts, plasmid DNA for each
ZFN
construct was prepared from cultures of E. coil using the PURE YIELD PLASMID
MAX1PREP SYSTEM (Promega Corporation, Madison, WI) or PLASMID MAXI KIT')
(Qiagen, Valencia, CA) following the instructions of the suppliers.
Protoplast Isolation
Protoplasts were isolated from a Maverick suspension culture derived horn
callus
produced from leaf explants. Suspensions were subcultured every 7 days in
fresh LS medium
(Linsmaier and Skoog 1965) containing 3% (w/v) sucrose, 0.5 mg/L 2,4-D, and 7
g of
bactoagar, pH 5.7 For isolation, thirty milliliters of a Maverick suspension
culture 7 days post
subculturing was transferred to a 50 ml conical tube and centrifuged at 200 g
for 3 minutes,
yielding about 10 ml of settled cell volume (SCV) per tube. The supernatant
was removed and
twenty milliliters of the enzyme solution (0.3% pectolyase (320952; MP
Biomedicals), 3%
cellulose ("Onozulca" RIOTM; Yakult Pharmaceuticals, Japan) in MMG solution (4
mM MES,
0.6 M mannitol, 15 mM ivIgC12, pH 6.0) was added for every 4 SCV of suspension
cells and the
tubes were wrapped with ParafilmTM. The tubes were placed on a platform rocker
overnight
(about 16-18 hr) and an aliquot of the digested cells was viewed
microscopically to ensure the
digestion of the cell wall was sufficient.
Protoplast Purification
Thirty milliliters of a soybean c.v. Maverick suspension culture 7 days post
subculturing
was transferred to a 50 ml conical centrifuge tube and centrifuged at 200 g
for 3 minutes,
yielding about 10 ml of settled cell volume (SCV) per tube. The supernatant
was removed
without disturbing the cell pellet. Twenty milliliters of the enzyme solution
(0,3% pectolyase
(320952; MP Biomedicals), 3% cellubse ("Onozuka" RIOTM; Yakult
Pharmaceuticals, Japan)
in MMG solution (4 mM MES, 0.6 M mannitol, 15 mM MgCl2, pH 6.0) was added for
every 4
SCV of suspension cells and the tubes were wrapped with parafilmTM. The tubes
were placed
on a platform rocker overnight (about 16-18 hr). The next morning, an aliquot
of the digested
cells was viewed microscopically to ensure the digestion of the cell walls was
sufficient.
-97 -
Date regue/Date received 2024-01-16
Protop last Purification
The cells/enzyme solutions were filtered slowly through a 100 p.M cell
strainer. The cell
strainer was rinsed with 10 ml of W5+ media (1,82 mM MES, 192 mM Naa, 154 mM
CaCl2,
4.7 mM KC1, pH 6.0). The filtering step was repeated using a 70 M screen_ The
final volume
was brought to 40 ml by adding 10 ml of W5+ media. The cells were mixed by
inverting the
tube. The protoplasts were slowly layered onto 8 ml of a sucrose cushion
solution (500 mM
sucrose, 1 mM CaC12, 5 mM MES-KOH, pH 6.0) by adding the cushion solution to
the bottom
of a 50 ml conical centrifuge tube containing the cells. The tubes were
centrifuged at 350 x g
for 15 minutes in a swinging bucket rotor. A 5 ml pipette tip was used to
slowly remove the
protoplast band (about 7-8 m1). The protoplasts were then transferred to a 50
ml conical tube
and 25 ml of W5+wash was added. The tubes were inverted slowly and the
centrifuged for 10
minutes at 200 g. The supernatant was removed, 10 ml of MMG solution was added
and the
tube was inverted slowly to resuspend the protoplasts. The protoplast density
was determined
using a haemocytometer or a flow cytorneter. Typically, 4 PCV of cells
suspension yields
about 2 million protoplasts.
Transformation of Protoplasts using PEG
The protoplast concentration was adjusted to 1.6 million/ml with MMG.
Protoplast
aliquots of 300 pl (about 500,000 protoplasts) were transferred into 2 ml
sterile tubes. The
protoplast suspension was mixed regularly during the transfer of protoplasts
into the tubes.
Plasmid DNA was added to the protoplast aliquots according to the experimental
design. The
rack containing the tubes of protoplasts was slowly inverted 3 times for 1
minute each to mix
the DNA and protoplasts. The protoplasts were incubated for 5 minutes at room
temperature.
Three hundred microliters of a polyethlene glycol (PEG 4000) solution (40%
ethylene glycol
(81240-Sigma Aldrich), 0.3 M mannitol, 0_4 M CaC12) was added to the
protoplasts and the
rack of tubes was mixed for 1 min and incubated for 5 min, with gentle
inversion twice during
the incubation. One milliliter of W5+ was slowly added to the tubes and the
rack of tubes
inverted 15-20 times. The tubes were then centrifuged at 350 g for 5 min and
the supernatant
removed without disturbing the pellet. One milliliter of W1 media (4 mM MES
0.6 M mannitol,
20 mM Ka, pH 6.0) was added to each tube and the rack was gently inverted to
resuspend the
pellets. The rack was covered with aluminum foil and laid on its side to
incubate overnight at
23 C.
Measuring Transformation Frequency and Harvesting the Protoplasts
.98..
Date regue/Date received 2024-01-16
Quantification of protoplasts and transformation efficiencies were measured
using a
Quanta Flow CytometerT" (Beckman-Coulter Inc). Approximately 16-18 hours post
transformation, 100 il from each replicate was sampled, placed in a 96 well
plate and diluted
1:1 with WI solution. The replicates were resuspended 3 times and 100 I was
quantified using
flow cytometry. Prior to submitting the samples for analysis, the samples were
centrifuged at
200 g for 5 min, supernatants were removed and the samples were flash frozen
in liquid
nitrogen. The samples were then placed in a -80 C freezer until processing
for molecular
analysis.
Transformation of ZFN and Donor
For each of the selected genomic loci of Table. 5, the soybean protoplasts
were
transfected with constructs comprising a green fluorescent protein (gfp) gene
expressing
control, ZFN alone, donor alone and a mixture of ZFN and donor DNA at a ratio
of 1:10 (by
weight). The total amount of DNA for transfection of 0.5 million protoplasts
was 80 g,. All
treatments were conducted in replicates of three. The gfp gene expressing
control used was
pDAB7221 (Figure 14, SEQ NO:7569) containing the Cassava Vein Mosaic Virs
promoter
¨ green fluorescent protein coding sequence ¨ Agrobacterium Onnefitciens 0RF24
3'UTR gene
expression cassettes. To provide a consistent amount of total DNA per
transfection, either
salmon sperm or a plasmid containing a gfr) gene was used as filler where
necessary. In a
typical targeting experiment, 4 pg of ZFN alone or with 36 pg of donor
plasmids were
transfected and an appropriate amount of salmon sperm or pUG19 plasmid DNA was
added to
bring the overall amount of DNA to the final amount of 80 pig. Inclusion of
gfp gene
expressing plasmid as filler allows assessment of transfection quality across
multiple loci and
replicate treatments.
Example 5: Cleavage of Genomic Loci in Soybean via Zinc Finger Nuclease
Targeting at select genomic loci was demonstrated by ZFN induced DNA cleavage
and
donor insertion using the protoplast based Rapid Targeting System (RTA). For
each soybean
select locus, up to six ZFN designs were generated and transformed into
protoplasts either alone
or with a universal donor polynucleotide and ZFN mediated clevage and
insertion was
measured using Next Generation Sequencing (NGS) or junctional (in-out) PCR
respectively.
ZFN transfected soybean protoplasts were harvested 24 hours post-transfection,
by
centrifugation at 1600 mm in 2 ml EPPENDORFDA tubes and the supernatant was
completely
- 99 -
Date regue/Date received 2024-01-16
removed Genomic DNA was extracted from protoplast pellets using the Q1AGEN
PLANT
DNA EXTRACTION KITT," (Qiagen, Valencia, CA). The isolated DNA was resuspended
in
50 pL of water and concentration was determined by NANODROPci (Invitrogen,
Grand Island,
NY). The integrity of the DNA was estimated by running samples on 0.8% agarose
gel
electrophoresis. All samples were normalized (20-25 ng/pL) for PCR
amplification to generate
amplicons for sequencing (alumina, Inc., SanDiego, CA). Bar-coded PCR primers
for
amplifying regions encompassing each test ZFN recognition sequence from
treated and control -
samples were designed and purchased from IDT (Coralville, IA, HPLC purified).
Optimum
amplification conditions were identified by gradient PCR using 0.2 pM
appropriate bar-coded
primers, ACCUPR1ME PFX SUPERMIXTI, (Invitrogen, Carlsbad, CA) and 100 ng of
template
genomic DNA in a 23.5 pl. reaction. Cycling parameters were initial
denaturation at 95t (5
min) followed by 35 cycles of denaturation (95'C, 15 sec), annealing (55-72V,
30 sec),
extension (68'C, 1 mm) and a final extension (68t, 7 min). Amplification
products were
analyzed on 3.5% TAE agarose gels and appropriate annealing temperature for
each primer
combination was determined and used to amplify amplicons from control and ZFN
treated
samples as described above. All amplicons were purified on 3.5% agarose gels,
eluted in water
and concentrations were determined by NANODROPTM. For Next Generation
Sequencing, 100
ng of PCR amplicon from the ZFN treated and corresponding untreated soybean
protoplast
controls were pooled together and sequenced using llumina Next Generation
Sequencing
(NGS).
The cleavage activity of appropriate ZFNs at each soybean optimal genomic loci
were
assayed. Short amplicons encompassing the ZFN cleavage sites were amplified
from the
genomic DNA and subjected to alumina NGS from ZFN treated and control
protoplasts. The
ZFN induced cleavage or DNA double strand break was resolved by the cellular
NHEI repair
pathway by insertion or deletion of nucleotides (indels) at the cleavage site
and presence of
indels at the cleavage site was thus a measure of ZFN activity and was
determined by NGS.
Cleavage activity of the target specific ZFNs was estimated as the number of
sequences with
indels per 1 million high quality sequences using NGS analysis software
(Patent publication
2012-0173,153, data Analysis of DNA sequences). Activities were observed for
sobyean
selected genomic loci targets and were further confirmed by sequence
alignments that show a
diverse footprint of indels at each ZFN cleavage site. This data suggests that
the soybean
selected genomic loci were amenable to cleavage by ZFNs. Differential activity
at each target
- 100-
Date regue/Date received 2024-01-16
was reflective of its chromatin state and amenability to cleavage as well as
the efficiency of
expression of each ZFN.
Example 6: Rapid Targeting Analysis of the Integration of a Polynucleotide
Donor
Validation of the targeting of the universal donor polynueleotide sequence
within the
soybean selected genomic loci targets via non-homologous end joining (NHEJ)
meditated donor
insertion, was performed using a semi-throughput protoplast based Rapid
Testing Analysis
method. For each soybean selected genomic loci target, around 3-6 ZFN designs
were tested
and targeting was assessed by measuring ZFN mediated cleavage by Next
Generation
Sequencing methods and donor insertion by junctional in-out PCR (Fig. 6).
Soybean selected
genomic loci that were positive in both assays were identified as a targetable
locus.
ZFN Donor Insertion Rapid Testing Analysis
To determine if a soybean selected genomic loci target can be targeted for
donor
insertion, a ZFN construct and universal donor pelynucleatide construct were
co-delivered to
soybean protoplasm s which were incubated for 24 hours before the genomic DNA
was extracted
for analysis. If the expressed ZFN was able to cut the target binding site
both at the soybean
selected genomic loci target and in the donor, the linearized donor would then
be inserted into
- the cleaved target site in the soybean genome via the non-homologous end
joining (NHEJ)
pathway. Confirmation of targeted integration at the soybean selected genomic
loci target was
completed based on an "Is-Out" PCR strategy, where an "In" primer recognizes
sequence at the
native optimal genomic loci and an "Out" primer binds to sequence within the
donor DNA. The
primers were designed in a way that only when the donor DNA was inserted at
the soybean
selected genomic loci target, would the PCR assay produce an amplification
product with the
expected size. The In-Out PCR assay was performed at both the 5'- and 3 '-ends
of the insertion
junction. The primers used for the analysis of integrated polynucleotide donor
sequences are
provided in Table 9.
ZFN Donor insertion at Target Loci using nested "In-Out" PCR
All PCR amplifications were conducted using a TAICARA EX TAQ HS Tm kit
(Clonetech, Mountain View, CA). The first In-Out PCR was carried out in 25 AL
final reaction
volume that contains 1X TAICARA EX TAQ HST/4 buffer, 0.2 rnM dNTPs, 0.2 M
"Out"
primer, 0.05 M "In" primer (designed from the universal donor cassette
described above), 0.75
unit of TAICARA EX TAQ HS"A polymerase, and 6 ng extracted soybean protoplast
DNA. The
- 101 -
Date regue/Date received 2024-01-16
reaction was then completed using a PCR program that consists of 94 C for 3
min, 14 cycles of
98 C for 12 sec, 60 30 sec and 72 C for 1 min, followed by 72 C tor 10 mar
and held at 4 C.
Final PCR products were run on an agarose gel Mang with 1KB PLUS DNA LADDERTM
(Life
Technologies , Grand Island, NY) for visualization.
The nested In-Out PCR was conducted in 25 AL final reaction volume that
contained 1X
TAKA.RA EX TAQ HSTm buffer, 0.2 rnM dNIPs, 02 AM "Out" primer (Table 9), 0.1
pM
"In" primer (designed from the universal donor cassette described above, Table
10), 0.75 units
of TAICARA EX TAQ HSTM polymerase, and I pL of the first PCR product. The
reaction was
then completed using a PCR program that consisted of 94 C for 3 min, 30
cycles of 98 C for
12 sec, 60 C for 30 sec and 72 C for 45 sec, followed by 72 C for 10 min and
held at 4 C.
Final PCR products were run on an agarose gel along with 1KB PLUS DNA LADDERTM
(Life
Technologies, Grand Island, NY) for visualization.
Table 9. List of all "Out" primers for nested In-Out PCR analysis of optimal
genomic loci.
SEQ ID NO: 7427
5'-end MAS1057 CAAACAAOGAGAGAGCCIAG
SEQ NO: 7428
GM Spec
GATCGACATTGATCTGGCTA '
First PCR -
SEQ ID NO: 7429
3'-end MAS1059
OGCAAGGACACAAACGG
SEQ ID NO: 7430
GM Uzi ATATGTGTCCTACCGTATCAGG
OGLO1
5'-end MAS1058 SEQ ID NO: 7431
TACCCAAGAAGAAACATTAGACC
GM Spec SEQ ID NO: 7432
Nest PCR Nst OTTOCCTTGGTAGGICC
SEQ ID NO: 7433
3'-end MAS1060 ATGTAG1 I GTTTCTCTGCTGTG
SEQ ID NO: 7434
OM Uzi Nat GAGCCATCAGTCCAACAC
SEQ ID NO: 7435
5'-end MAS1061
CACGAGGTT'TACGCCAT
First PCR
SEQ ID NO: 7436
3'-end MAS1063
OGLO2 TaGATAACTTGCTAGTOTGTO
5'-end MAS1062 SEQ ID NO: 7437
GCTGCTCAGTGGATGTC
Nest PCR
SEQ ID NO: 7438
3'-end MAS1064
TCGTTTATCGGGATTGTCTC
SEQ ID NO: 7439
5'-end MAS1133
TTOTTOCTIVTATOCTCCTC
First PCR
3'-end MAS1135 SEQ ID NO: 7440
CGTCGTTGTGGATGAGG
OGLO3 -
SEQ ID NO: 7441
5'-end MAS1134
CCATTGCTGTTCTGCTTG
Nest PCR
8E9 ID NO: 7442
3'-end MAS1136 TGTAGGTGACGGGIGTG
- 102..
Date re cue/Date received 2024-01-16
SEQ ID NO: 7443
5'-end MAS1155
GTGTGTTATTGTCTGTGTTCTC
First PCR
SEQ ID NO: 7444
3'-end MAS1139
GACTCGTATGICiCCTGATTC
OGLO4
SEQ ID NO: 7445
5'-end MAS1156
GAGAACGATGGATAGAAAAGCA
Nest PCR
SEQ 11) NO: 7446
3'-end MAS1140
TTTGTTTCAGTCTTGCTCCT
SEQ ID NO: 7447
5k-end MAS1121
CTACCTATAAACTGGACGGAC
First PCR
SEQ ID NO: 7448
3'-end MAS1123
CGTCAAATGCCCATTATTCAT
OGLO5
SEQ ID NO: 7449
5'-end MAS1122
GATTTGOGCTTGOOCATA
Nest PCR
SEQ ID NO: 7450
3'-end MAS1124
TGAATCCCACTAGCACCAT
SEQ ID NO: 7451
5'-end MAS1065
GGAGATAGAGTTAGAAGGITTTGA
First PCR
SEQ1D NO: 7452
3'-end MAS1067
GAGGTTG111 TGACGCCA
OGLO6 SEQ NO: 7453
5'-end MAS1066 AAGGAAGAAATGTGAAAAAGAAGA
Nest PCR ______________________________________________________
SEQ ID NO: 7454
3'-end MAS1068
AGAGAAGCGAAACCCAAAG
SEQ ID NO: 7455
5'-end MAS1069
GACCCKITTATCrATCCCGTAT
First PCR
SEQ ID NO: 7456
3'-end MAS1071
GGCTCGTATCAUTTCCATTTAG
OGLO7
SEQ ID NO: 7457
5'-end MAS1070
AAGTACGAACAAGATTGGTGAG
Nest PCR
SEQ ID NO: 7458
3'-end MAS1072
TCTATTACATTCCATCCAAAGGC
SEQ ID NO: 7459
5'-end MASI141
GAAACGAGAGAGATGACCAATA
First PCR ¨
SEQ ID NO: 7460
3'-end MAS1143
()GLOB - GGTTCACOGGITCAGC
SEQ ID NO: 7461
5'-end MAS1142 CCTGACGCAAAAGAAGAAATG
Nest PCR
SEQ JD NO: 7462
3'-end MAS1144
CITTATACTTACTOTCACCACGAG
SEQ ID NO: 7463
5'-end MAS1073
TTATTCCTGCOTCTCTCAC
First PCR
SEQ ID NO: 7464
3'-end MAS1075
TIGTGCGTGATAAATAG9GP
OGLO9
SEQ ID NO: 7465
5'-end MAS1074
GATAGTTGATTGTGTTGTTAGCATA
Nest at SEQ ID NO: 7466
3'-end MAS1076
, CTCACCTGTTGCCCGTA
- 103.
Date regue/Date received 2024-01-16
SEQ ID NO: 7467
5'-end MAS1077
GTITGAGTTGGCAGGIGT
First PCR ,
SEQ ID NO: 7468
3'-end MAS1079
CCGTGACTTGIGCTAGAG
OGLIO
SEQ ID NO: 7469
5'-end MAS1078 CTGAA(il IGAcGCCGC
Nest PCR
SEQ ID NO: 7470
3'-end MAS1080
AAGCACAGGACGOTTAGA
SEQ ID NO: 7471
5'-end MAS1125
CACGGGTCACAAATCTAGIT
First PCR
SEQ ID NO: 7472
3'-end MAS1127
CCATTAAGTCTGICTCAACifIC
OGLI I
SEQ ID NO: 7473
5'-end MAS1126
CTGCTTGAGTAGGAAGAAGTG
Nest PCR
SEQ ID NO: 7474
3'-end mAS1128
ATCACCAAAGCCGAGAAC,
SEQ ID NO: 7475
5'-end MAS1129
GTAGGCGTGAAGGCTG
First PCR
SEQ E30NO: 7476
3'-end MAS1131
TGAAACCGCACAATCTCG
OGL12
SEQ ID NO: 7477
5'-end MAS1130
CCCTCCGAAACAATCCG
Nest PCR -
SEQ ID NO: 7478
3'-end MAS1132
ACCCGTTGAATOCGAG
SEQ ID NO: 7479
5'-end MAS1081
AAGGTGGATGGGAGGAA
First PCR -
SEQ ID NO: 7480
3'-end MA51083
TGGCACTAATACATTACATAAGACT
00L13 - ¨
SEQ ID NO: 7481
5'-end MAS1082
ATGTTACTTCAATCCCTCGTC
Nest PCR
SEQ ID NO: 7482
3'-end MAS1084
TGAATAGGOCAAAAACACAC
SEQ ID NO: 7483
5'-end MAS1085 CAAGTGAGCAGGGCG
First PCR
SEQ ID NO: 7484
3'-end MAS1087
OGLI4 CTATCATTCGTAAAGITTGAGGAC
SEQ ID NO: 7485
5'-end MAS1086
AGCCTCACTCACAACAAAG
Nest PCR
SEQ ID NO: 7486
3'-end MAS1088
TGAAACTGTCTTGTGACTTACC
SEQ ID NO: 7487
5'-end MAS1089
GCACTGACATACCAACAATC
First PCR -
SEQ ID NO: 7488
3'-end MAS1091
G1TGTCGGGA1TTCACTTCAT
OGL15
SEQ ID NO: 7489
5"-end MAS1090
GATAGGAGAAAGAGCAAGGAC
Nest PCR
SEQ ID NO: 7490
3'-end MAS1092
TTCTCAACATCAACTCATACACTC
- 104 -
Date re gue/Date received 2024-01-16
SEQ ID NO: 7491
5'-end MAS1093
CTCAAAGCAACATCAACCAT
First PCR
SEQ ID NO: 7492
3'-end MAS1095 AATCCCAAAGCAOCCAAC
00L16
SEQ11) NO: 7493
N 5'-end MAS1094
AAACACAAATCACATCATAGTAAAC
est PCR
SEQ 11) NO: 7494
3'-end MAS1096
GCTAGTATGCTTCTGTCAGTTTA
5' d MAS916 SEQ ID NO: 7495
-en
First PCR ACTAGTTCTTTCCCGAACATT
SEQR) NO: 7496
3' -end MAS918
00L17 CATTTGGTGATTTAACTCATCAGC
SEQ ID NO: 7497
5'-end MAS917
Nest PCR AAATTTACCACGOTTGGTCC
SEQ NO: 7498
3'-end MAS919
TCTGCATTAACTATATCAGGAGG
SEQ NO: 7499
5' -end MAS920
ATTCAACATTTACCCTTCACAA
First PCR.
ID NO: 7500
3' -end MAS922 SEQAATTCTITCTCATACTTGGTTGT
OGL18
SEQ ID NO: 7501
5'-end MAS921
CCTTGTITTCCGTACTATCAATT
Nest PCR
SEQ R) NO: 7502
3' -end MAS923
TATTGGAGTAATGTGGACAAGC
SEQ ID NO: 7503
5'-end MAS924
AACAACTTTCCAACCCACAA
First PCR
SEQ ID NO: 7504
OGL19 3'-end MAS1009
COTTTTACCTTGACTTGACCT
SEQ ID NO: 7505
5' -end MAS925
CCAGAGAGOAACCAGAAGT
Nest PCR
SEQ ID NO: 7506
3'-end MAS1010
CCITAGACAAAACTCOCACTT
SEQ ID NO: 7507
5'-end MAS1011
GAAAGAGAAGACGCCACC
First PCR
- SEQ 7508
3' -end MAS930 NO:
TCATTAGAGGGTC4AAAGTGC
00120 SEQ11) NO: 7509
5'-end MA51012
CCTGAAGAAAAGTGGGAGAA
Nest PCR SEQ NO: 7510
3'-end MAS931 TTCAATCATAA1TAAACTAATAAGA
CTGT
S' d MAS960 SEQ ID NO: 7511
-en
First PCR ACTGAATUTATTOTCCOACG
NO: 7512
3' -end MAS962 SEQID
00L22 GCCCTACATTTTCATITCATTGG
SEQ ID NO: 7513
'-end MAS%1
OTGAGACCOCCCCTT
Nest PCR
3' -end MAS963 SEQ ID NO: 7514
CCACTACTTTTTACTCACAGAAGA
- 105 -
Date re cue/Date received 2024-01-16
SEQ ID NO: 7515
5'-end MAS968
GTCAATTCTCATCAGTTCCATCT
First PCR
SE,Q ID NO: 7516
0G124 3'-end MAS970
CGATGAATAGTATGAGTGCGTAG
SEQ ID NO: 7517
5'-end MAS969
TGCGTCTCTTGCTTCCTA
Nest PCR
SEQ ID NO: 7518
3' -end MAS971
OCCACGAGAGGATAGAATAAT
SEQ E) NO: 7519
5'-end MAS972 TAGTGTACCCTCCTCATCATA
First PCR
SEQ ID NO: 7520
3'-end 00L25 MAS974
GATAATCAAATGAGTGGACGAATA
SEQ ID NO: 7521
5'-end MAS973
TGTATTTGGATAAGTGTGGGAC
Nest PCR
SEQ ID NO: 7522
3'-end MAS975
GATTTTAGCGTGATTGATGGAAG
SEQ ID NO: 7523
5'-end MAS1149
CTGAAGCAAGTGGTGATOTT
First PCR -
SEQ ID NO: 7524
3'-end OGL28 MAS1151
CTTACCACCACCTGCG
SEQ ID NO: 7525
5'-end MAS1150
GCATAAAGGTCAGCAGAGG
= Nest PCR -
SEQ E) NO: 7526
3' -end MAS1152
TACTCTITAGCCATAGCCAAT
SEQ ID NO: 7527
5'-end MAS988
GTTTATTGCCAGAGACGGT
First PCR
SEQ ID NO: 7528
3' -end MAS990
COTCGTTOCTIGCTTGT
OGL30 SEQ ID NO: 7529
5'-end MAS989 GGAAAGACATAAAAGTAAATGGAA
Nest PR
SEQ ID NO: 7530
3'-end MAS991 TAACTACCTGATAACCTCCT1TT
SEQ ID NO: 7531
5'-end MAS992
GCAAAC III AAGTAAACTAGAGGC _
First PCR ¨
SEQ ID NO: '7532
3'-end OGL31 MAS994
AGTGTACTCTAGTCAGATTTTGC
SEQ ID NO: 7533
5'-end MAS993
CAACCCAACAAGCAAACAC
Nest PCR
SEQ ID NO: 7534
3'-end MAS99 CTCGart IGTAGTCATCTATGTA
SEQ ID NO: 7535
5)-encl MAS1101
GATGAATAACAGTOCGAGGA
First PCR ¨
SEQII) NO: 7536
0GL33 3'-end MASSI42 CTGTAATCCTCATTTTGCACG
SEQ ID NO: 7537
5'-end MAS941
OGGGTAGTTACACTTCTOC
Nest PCR
SEQ ID NO: 7538
3'-end MAS943
GGTGTGGTCGGCATATAGA
- 106.
Date regue/Date received 2024-01-16
SEQ NO: 7539
5'-end First MAS944
TTCGCACAAGCCATCC
PCR
SEQ ID NO: 7540
3'-end MAS946
AACGACTTITTGAATAGATGCT
OGL34
SEQ ID NO: 7541
5'-end MAS945
GCATTCCTTCTTGTCTCGT
Nest PCR
SEQ to NO: 7542
32-end MAS947
AACTTAGAGAAACTCATAACTCATC
SEQ NO: 7543
5'-end MAS948
First
TCATAGCTTCAAGGGATTCAC
PCR
SEQ ID NO: 7544
3'-end MAS950
GTTCATCAAAACACGCAAGA
00L35 SEQ II) NO: 7545
5'-end MAS949
CTCATGCCAACAAAAGCC
Nest PCR SEQ ID NO: 7546
3'-end MAS951 GTAGTAACAAAAATGGATAACGCA
G
_
SEQ ID NO: 7547
5'-end MAS936
TATCTGGCTTGAAGCTGAAT
First PCR
SEQ ID NO: 7548
3'-end 0GL36 MA-S938 TTATTTCCTTCGTGGC1TCG
SEQ ID NO: 7549
Nest P 5'-end MAS937
CTCCACAATTTAGCATCCAAG
CR
SEQ ID NO: 7550
3'-end MAS939
CGTCCATGTTTACTTGGCTA
SEQ NO:7570
nc1 MAS952
GTCATCATAATTGCTGTCCCA
First PCR
SEQ ID NO:7571
0GL37 3'-end MAS954
GGATGTOTGCCTGAGC
SEQ NO:7572
5'-end MAS953
Nest PCR ¨
SEQ ID NO:7573
3' -end MAS955 CCTICCTCGTGCCCITA
CCCCTAATCTCATCOCAAG
5'-end MAS932 SEQ ID NO: 7551
TCTGTTGAT'TCCTAATCGTAGC
First PCR
SEQ ID NO: 7552
3'-end MAS934
OGL38 5'-end MAS933
OTGATTGACATTTOTCTATAAGCA
= -
SEQ ID NO: 7553
Nest PCR CCTCTTCACTGTGACTGAAC
SEQ NO: 7554
3'-end MAS935
TTTCGGCTTGACATTTCTTTC
SEQ ID NO: 7555
5'-end
MAS956 TGGCAAATCACACGGTC
First PCR
SEQ NO: 7556
3'-end
MAS958 ACTACCTTGCCCCTAAGATC
OGL39 ¨
SEQ ID NO: 7557
5'-end
MAS957 TOCCACGACAAGAATTICAT
Nest PCR
SEQ ID NO: 7558
31-end MAS959 TGGTGTGATTCCAACGC
- 107 -
Date regue/Date received 2024-01-16
Table 10. List of all "In" primers for nested In-Out PCR analysis of optimal
genomic loci.
First 3 -end SEQ ID NO: 7559
'
PCR GM_UnDo_31F CAAATTCCCACTAAGCGCT
Nest d SEQ ID NO: 7560
n PCR GM_UnDo_3'_NST TAAAGGTGAGCAGAGGCA
Deployment of the In-Out PCR assay in a protoplast targeting system was
particularly
challenging as large amounts of the plasmid DNA was used for transfection, and
the large
amount of DNA remains in the protoplast targeting system and was subsequently
extracted
along with cellular genomic DNA. The residual plasmic!. DNA may dilute the
relative
concentration of the genomic DNA and reduce the overall sensitivity of
detection and can also
be a significant cause of non-specific, aberrant PCR reactions. ZFN induced
NHEJ-based
donor insertion typically occurs in either a forward or a reverse orientation.
In-Out PCR
analysis of DNA for the forward orientation insertion often exhibited false
positive bands,
possibly due to shared regions of homology around the ZFN binding site in the
target and donor
that could result in priming and extension, of unintegrated donor DNA during
the amplification
process. False positives were not seen in analyses that probed for reverse
orientation insertion
products and therefore all targeted donor integration analysis was carried out
to interrogate
reverse donor insertion in the RTA. In order to fluffier increase specificity
and reduce
background, a nested PCR strategy was also employed. The nested PCR strategy
used a second
PCR amplification reaction that amplified a shorter region within the first
amplification product
of the first PCR reaction. Use of asymmetric amounts of "in" and "out" primers
optimized the
junctional PCR further for rapid targeting analysis at selected genomic loci.
The In-Out PCR analysis results were visualized on an agarose gel. For all
soybean
selected genornic loci of Table 12, "ZFN + donor treatments" produced a near
expected sized
band at the 5' and 3' ends. Control ZFN or donor alone treatments were
negative in the KR
suggesting that the method was specifically scoring for donor integration at
the target site of at
least 32 of the optimal nongenic soybean genomic loci. All treatments were
conducted in
replicates of 3-6 and presence of the anticipated PCR product in multiple
replicates ca 1 at both
ends) was used to confirm targeting. Donor insertion through NHEJ often
produces lower
intensity side products that were generated due to processing of linearized
ends at the target
and/or donor ZFN sites. In addition, it was observed that different ZFNs
resulted in different
108 -
Date regue/Date received 2024-01-16
levels of efficiency for targeted integration, with some of the ZFNs producing
consistently high
levels of donor integration, some ZFNs producing less consistent levels of
donor integration,
and other ZFNs resulting in no integration. Overall, for each of the soybean
selected genomic
loci targets that were tested, targeted integration was demonstrated within
the soybean
representative genomic kci targets by one or more Zings, which confirms that
each of these
loci were Utrgetable. Furthermore, each of the soybean selected genomic loci
targets was
suitable for precision gene transformation. The validation of these soybean
selected genomic
loci targets were repeated multiple times with similar results, thus
confirming the
reproducibility of the validation process which includes plasmid design and
construct,
protoplast transformation, sample processing sample analysis.
Conclusion
The donor plasmid and one ZFN designed to specifically cleave soybean selected
genomic loci targets were transfected into soybean protoplasts and cells were
harvested 24
hours later. Analysis of the genomic DNA isolated from control, ZFN treated
and ZFN with
donor treated protoplasts by in-out junctional PCR showed targeted insertion
of the universal
donor polynucleotide as a result of genomic DNA cleavage by the ZFNs (Table
12). These
studies show that the universal donor polynucleotide system can be used to
assess targeting at
endogenous sites and for screening candidate ZFNs. Finally, the protoplast
based Rapid
Targeting Analysis and the novel universal donor polynucleotide sequence
systems provide a
rapid avenue for screening genomic targets and ZFNs for precision genome
engineering efforts
in plants. The methods can be extended to assess site specific cleavage and
donor insertion at
genomic targets in any system of interest using any nuclease that introduces
DNA double or
single strand breaks.
Over 7,018 selected genomic loci were identified by various criteria detailed
above.
The selected genomic loci were clustered using Principal Component Analysis
based on the ten
parameters used for defining the selected genomic loci. A representative of
the clusters in
addition to some other loci of interest were demonstrated to be targetable.
-109 -
Date regue/Date received 2024-01-16
Table 12. Illustrates the results of the integration of a universal donor
polynucleotide sequence
within the soybean selected genomic loci targets.
ZFN
Targets
Name ID (pDA.80 Donor ble
Cluster (pDAB#) Locus
_ Location Assignment_ ) . (YMO
..
oGun soy_ogl_ Gm02:1204801
1 124201 124280 Y
308 ..1209237
00102 soY_081,_ Gm02:1164701
2 124221 124281 Y
307 ..1168400
oGun soy_ogl_ Gm06:4309192
125305 125332 Y
2063 8..43094600 3
,
soy_gl_ Gm06:1157699
OGLO4 o 125309 125330 Y
1906 1õ11578665 4 _
Gun soy_ogl_ Gm01:5106127
124884 124290 Y
262 2..51062909 5_
soy_ogl_
Gm16:1298889
OGLO6 6 124234 123838 Y
5227 ..1300700
soy_ogl_ Gm12:3361040
OGLO7 124257 123839 Y
4074 1..33611483 7
GGL08 soy_ogl_ Gm104076366
125316 125332 Y
3481 3..40764800 8
. '
soy_ogl_ 0m03:4150600
OGLO9 124265 123836 Y
1016 , 1-41507735 9
soy_ogl_ Gm03:3770700
OGLIO 124273 123837 Y
937 1..37708600 10
_ . _ _
soy_ogl_ Gm15:4239134
OGL11 124888 124290 Y
5109 9..42393400 11_
soy_ogl_ Gm20:3692369 r
0GL12 6801 0..36924900 12_ 124885 124291
soy_ogl_ Gm19:4997/10 Y
00L13 6636 1..49978357 13 124610 124294
soy_ogl_ Gm14:5050547 Y
OGL14 4665 ..5051556 14 124614 124845
soy_ogl_ Gm18:5569440 Y
OGL15 6189 1..55695900 15 124636 124293
_
soy_ogl_ 0rn13:2347492 Y
00L16 4222 3..23476100 16 124648 124292
soy_ogl_ Gm08:7532001 Y
OGLI7 254 -7534800 17 121225 121277
_
_ _
soy ogl_ Gm02:1220301
OGL18 _310 -1222300 _ 18_ 121227 121278 , Y
soy_ogl_ Gm07:1719452
OGL19 2353 2..17196553 19 121233 121279 Y
soy_ogl_ Gm06:1054080
OGL20 1894 1..10542300 20 121235 121280 Y
soy_ogl_ Gm09:4016747 Y
OGL22 3218 9..40168800 22 121238 121281
soy ogl_ Gro1102950701 y
00L24 _3333 -2951800 _ 24 121234 121280
, _ .
soy_ogl_ Gm08:7765875 Y
00L25 2546 ..7767500 25 121249 121284
. . ¨
- 110 -
Date regue/Date received 2024-01-16
Gm18:
soy ogl_ 6057701..6059
00L28 5957 100 28 125324 125334
soy ogl_ Gm11:1014670
, 00L30 3818 1..10148200 30 121265 121288
soy ogl_ Gm17:6541901
00L31 5551 _6543200 31 121271 121289
soy 00 Gm02:4590320 1
001.33 L 684* 1õ45907300 _ 124666 123812
¨
soy OG 0m02:4581654 9
0GL34 L..682 3..45818777 124814 121937.
soy _CO Gm02:4591050 1
001.35 1.685 1..45913200 124690 123811
soy ¨2
OGL Gm04:4582063
00136 1423 1_45872916 124815 121937
_
soy_ 1
00137 OGL Gm04:4609580
1434 1õ46097968 125338 124871
soy 1
OGL G m14:3816738
00L38 4625 ..3820070 124816 121937
soy 1
OGL (3m19:5311001
0GL39 6362 ..5315000 124842 124864 Y
Example 7: Optimal Nongenic Soybean Genomic Loci for Transgene Integration
A suite of optimal nongenic soybean genomic loci were identified from the
7,018
optimal nongenic soybean genomic loci to select multiple loci for site
specific targeting and
integration of gene expression cassettes and to generate stacks of gene
expression cassettes
within a single chromosome. The resulting set of three optimal nongenic
soybean genomic loci
are referred to herein as a "Mega Locus". The following criteria were used to
filter the pool of
optimal nongenic soybean genomic loci and select a suite of optimal nongenic
soybean genomic
loci:
1) Location of at least 3 optimal nongenic soybean genomic loci on the same
chromosome in proximity to each other (within 500 Kb of the center optimal
nongenic soybean genomic loci);
2) Optimal nongenic soybean genomic loci greater than 2 Kb in length, and
within 50
Kb of each other; and,
3) The central/middle optimal nongenic soybean genomic loci is greater than 4
Kb in
length.
- 111 -
Date regue/Date received 2024-01-16
Each of the above described criteria were applied to select a suite of optimal
nongenic soybean
genomic loci. The .identified optimal nongenic soybean mimic loci are shown in
Table 13.
Table 13. Optimal nongenic soybean genomic loci identified and selected for
targeting with a
gene expression cassette.
OGL _ID Location _ ______________
Length SEQ Grouping
ID NO: of Three
Loci
soy OGL 308* 0m02:1204801..1209237 4437 43 Targetable
Mega
soy OGL 307* Gm02:1164701..1168400 3700 566 Locus #1
soy OGL 310 Gm02:1220301..1222300 - 2000 4236
soy OGL 684* Gm02:4590320I.A5907300 4100 47 Tat-getable
soy OGL 682 Gm02:45816543..45818777 2235 2101 - LMoecguas #2
soy OGL 685 -bm02:45910501_45913200 2700 -48
*indicates that the OGL is long enough to be targeted by two separate gene
expression
cassettes.
Two additional optimal nongenic soybean genomic loci that were greater than 2
Kb and
within 500 Kb to a known tmnsgenic genomic event that was produced via random
integration
of a T-strand insert (e.g., AAD-12 Event 416: located at soybean chromosomal
position,
0m04:46002956-46005750 as described in International Patent App. No.
W02011066384A1)
were also selected for targeted gene stacking. The selected optimal nongenic
soybean genomic
loci are shown in Table 14.
Table 14. Optimal nongenic soybean genomic loci identified and selected for
targeting with a
gene expression cassette.
_ _____________________________________________________________
OGL _ID Location Length SEQ ID Grouping of
NO: Three Loci
soy OGL _1423 Gm04:45820631_45822916 2286 639 Targetable
= Megalocus 3
soy_ OGL _1434 Gm04:46095801..46097968 2168 137
- 112 -
Date recue/Date received 2024-01-16
A third suite of optimal nongenic soybean genomic loci were identified from
the 7,018
optimal nongenic soybean genomic loci to select a suite of loci for site
specific targeting and
integration of gene expression cassettes and to generate stacks of gene
expression cassettes.
The following criteria were used to filter the pool of optimal nongenic
soybean genomic loci
and select a suite of optimal nongenic soybean genomic loci:
1) Identify optimal nongenic soybean genomic loci greater than 3 Kb in length;
2) Average expression of neighboring genes within a 40 Kb region in root and
shoot
tissues is water than 7.46, which is the 47.7% percentile of all optimal
nongenic
soybean genomic loci;
3) A recombination frequency of 05 - 4, which is below the mean/median for all
of the
optimal nongenic soybean genomic loci;
4) A GC content greater than 25%.
Each of the above described criteria were applied to select a suite of optimal
nongenic soybean
genomic loci. The identified optimal nongenic soybean genomic loci are shown
in Table 15.
All selected optimal nongenic soybean loci were screened for proximity to
known soybean
, Q11.s. Loci that are greater than 3 Kb can be targeted sequentially at the
endogenous sequence.
Table 15. Optimal nongenic soybean genomic loci identified and selected for
targeting with a
. gene expression cassette.
OGL ID -Location Length SEQ ID
NO:
soy OGL 4625 Gm14:3816738.3820070 3333 76
soy OGL _6362 Gm195311001-5315000 4000 --- 440
soy OGL 308 Gm02: 1204801..1209237 4437 43
The optimal nongenic soybean genomic loci that are selected using the above
described
criteria are validated by integrating a gene expression construct that
contains
selectable/reportable markers. This gene expression cassette is stably
integrated into soybean
plants via genomic targeting using a site specific nuclease. The targeted
optimal nongenic
soybean genomic loci that are produced and contain an expressable transgene
are analyzed to
identify single copy events that contain a full length integrated gene
expression cassette. The
expression profiles of the optimal nongenic soybean genomic loci are analyzed
via qRT-PCR,
Western blot, EL1SA, LC-MS MS, and other known RNA or protein detection
methods over
- 113 -
Date regue/Date received 2024-01-16
multiple plant generations (e.g., Ti and T2 generations). In addition, the
effect of the transgene
expression cassette integration within the optimal nongenic soybean genotnic
loci on
neighboring gene expression is assayed, Finally, the effect of the transgene
expression cassette
integration within the optimal nongenic soybean genomic loci on agronomic
properties of
soybean plants is assayed.
- 114 -
Date regue/Date received 2024-01-16
0 goo 06ts In
Distance In 2116 Image 1MB
7arthit_cover to doled neighkrh ewssion (rool Nudenorne Didanceto neighbor.
OGL Lenglh RF(clB) age gene GC% cod shool)
Occupancy adromen hood
soy_00._2474 2552 4,7351184 15,12522 1009 30.17 10
4,1413102 0.18099999 0.903341 22
soy_061._2548 7/5 3 0618 14,11T18 252 26.88 12
17315607 0.221 0.72110317 22
soy_061_2585 256 1. ' 61 10.013577 1042 25.52
12 2.9 '' 0,215 0.6511, 14
soy_00._3627 2218 3,313443 13.51015 251 28.53 10
10.11 023899999 091 il 29
soy_OGL_3814 310 7.074543 19.7; 4, 1; 1' 27.56 8
8.7017796 0,186 0.56518 15
soy061._134 9.5748111 11344078 2519 31,52 9
10.0 0,156 033402 12
soy_OGL,3296 2135 5.3721247 13.621976 1001 28.1 9
13934 0.178 0.9542439 23
soy_OGL_3720 237 7.0181005 82111436 2001 30 11
6.65842S 0204, 0,82 27
soy_001_3726 1 1 859 22.5825
3273 25.06 9 6.604273 0,18000001 0.81016731 19
soy,00.,3828 30 7.030079 21.5 1111 28.86 10
10.91375 0248 0.54653221 29
soy_00._5481 1721 4.7314305 18.2452W 2001 2934 5
11.689716 0.17300001 0,86215E5 33
soy_OGL5636 2500 92479429 16.959960 4619 324 13
6.373 0,198 0.54605746 17
soy_Ok6219 320 6.4955807 16,95035 6360 265 9
11,117101 0.18799999 993683352 26
soy_001_6166 140 8.9007568 15.51 I"; 1165 2576 10
5.2071167 012 0.80512516 11
soy_n_919 1500 6.3260517 15.93332 335 24.8 9
3.57 0.27399Y 0.68844461 26
soy_OGI._1778 lfig 5.2117255 16.101.' 4944
2518 9 3,0771959 0.248 0.39673209 21
soy_OGL_6811 2400 61192668 4.41; ; ;1 3E1 31.08
9 1257293 a '9999 0.798 1 21
soy_061_6851 2100 4,1094298 0 1234 3,14 8
16721213 0.133 0.8247517 26
soy_061_1678 1127 91770983 11,1513 2179 27.5 13
1.451852 0.17299999 0,1146403 16
soy_OGL_2904 1449 13.152136 . 19.047619 1031 23.94 12
3.8311242 9 '9999 0.9829511 22
soy_061._4785 2400 3.5548639 15.583333 1416 2E56 11
28.4805 0.18799999 0.89184189 9
soLOGI.3518 1500 6,1901021 16.933332 2498 2726 10
5.8837963 0.19 0.6981757 31
soy_00._6916 1103 B., le 718 25,454546 9423 2518 10
5.6880126 0.211 0.892 21
soy_061,1134 1393 5.9220409 19.813353 378 23.47 14
2,5466967 0.19 0.97978538 25
soL06L3558 1200 83657079 20 2415 2441 10 8.3999
0.1J 9999 0,82717651 25
soy_OGI._3561 151:0 6.3651079 11.333E3 1761 29 8
5.7050643 0.15000001 0.83111167 31
soy_06L6250 1232 6.0078726 19. '11' 625/ 3.3 9
1.4068537 0.169 0.90713137 28
115
Date regue/Date received 2024-01-16
v00..2715 1, ;' 4 632 18.034752 1001 2188 9
3.6 d <4 0.175 0.44677621 23
soy_061._6471 1.11 520159 15.25 2311
24.37 7 4,715022 11001 0.61283356 11
soy_061._3 1297 4 , 08 24.055513 4908 24.13 7
19.6974E 9999 0.88617796 12
soy_0GL433 1930 6833319 17.133334 1700 2523 9
4.4000506 0.1 - 9999 0.45510169 19
soLOGL338 2200 9103493 1939091 2410 214 7
10018653 0,197 116216217 26
soy_OGL3557 28 6.351079 8,51:1 1001 29.68 11 8.24,
0.148 18271 . 26
soy_DG.L3744 1300 7 534 3.6 3288 28.39 9
15880463 020100001 177727038 26
soy_061_4402 3010 16934502 1,1960133 1646 28.13 13 169
. . 0.21699999 0,5641 23
soy_0e_453 16(1) 1, "202 9. '4 E51 2155 5
7,3128204 0.189 0.76210791 33
soy_OGL_6200 28 6270649 11.857142 2319 27.8 6
5.260211 0.18799, 0.8 d 28
$Dy_OGI.,6583 2264 4,126351 9,2756186 1143 27.38 11
8.0400114 020100001 0.78817469 34
soy_061_5173 TO 10.05123 10.0 4033 3.68 6 4.6494E6 0.12
0,86561 15
y_061,236 3276 11.009411 3601 N., 2539 2466 10
8.8741141 0.14300001 0,; 20
soy_06L239 3100 1 .239 17.709617 7350 27.32 11 9,071 ,
0,149 0.84753241 21
soy_06L_270 7B0 1E0378 16.221212 3100 21.95 11
8.8036137 0,197 0,891 , 18
soy_OGL308 4437 10227943 19.855759 1858 3.89 9
5.7789779 0.15000001 0.94 ", ; 13
soy_06L421 232 14106673 1.4693534 '2 123 11 6.0209504
0.17299999 0.69735664 21
soy_OGL_647 2011 6.9747391 22,204 3240 19.69 7
10.0:'n 0.17200001 0,75310385 28
soLOGL661 2300 1356471 2047826 5455 23.82 12
2.647/65 0.1 N 9999 0.76741651 36
soy_061_614 4100 11121198 16208213 334 24.07 8
18.511317 0.162 0,8031781 20
soy_061._685 HOC 11.121198 3.223 1012 21.22 8
18,51137 022800001 0.ei 109 20
soy_OGL_686 1120 11.121198 10.101117 4098 22.23
11 17.722566 115000001 0.80465043 21
soy..001.,789 2294 736 3.3565824 1915 24.71 8
8.8841038 0.148 0.88734376 10
soy_00._1036 420 13006811 29.6784 4187 25.08 11
26.2 I 7 0.13600001 0.83635819 26
soy_00._1046 2437 5.3530307 30,73451 1715 18.58 10
14.27531 0.1500001 0.84816562 28
8oLOGI...1055 4.5279164 0 4596 181 8
11,090158 0.107 0. = 7 27
soLOGI._1056 1100 4.5279164 7.555553 2099 24.16 8
11,090158 0,153 0, , 1105 27
soy_001._1168 220 9,2707253 16.9 5528 2135
6 9.3 . 6 0.241 0.9131282 25
soy_OGL.1238 2717 18961325 1.8770703 3133 162 9
19.53434 0.18700001 0.75490791 25
soy_031J 251 330 10.150949' 0 2/18 22.16 8 10,2 ,
118799 0.711838 19
soy_OGL1461 120 9.5639515 10 5138 22.56 5 17178242
0.211 O. 76 30
116
Date regue/Date received 2024-01-16
soy_OGL_1515 2700 7.6185937 0 4504 24.62 8 9,4041
0.193 0.86921974 33
soy_OGL_1812 3188 5.1060555 24,337122 2001 372 8
4,1260514 0,19 0.784, 21
soy_OGL_2266 2164 7.154383 1.8946396 1001 28.83 7
5.91,', 0.167 0.636535 44
soy_OGL_2562 300 5.6103273 7.0714,.. 2203 23 12
6.5078921 0.198 0.70459002 22
soy_001_2681 3100 1232581 21096175 4844 24/2 11 10,
I. 9134 0.4',' 26
soy_OGL_262 390 10232581 1.814671 2079 21.68 11
6.1938624 0.15700001 0,4983741 26
soLOGI._2694 2433 61054287 8.0551977 1001 3.19 13 8.25757
0, i','999 0.47756642 20
soy_OGL_2944 2192 10211808 27,181814 23.85 9 6,9297071 0,14
0,90811 17
soy_OGL_3211 2129 6.4012876 13.246655 6180 24.94 9
0.17661087 0.14 0.691' ,4 ., 36
soy_00._3219 1633 IR 0 2001 24.11 9 6.8092341
0.191 0.7113119 48
5001,3240 3149 9.1938437 3.0134211 1377 30.89 8 6,71 0
0.114 0.7291112 36
soy_OG1_3319 2462 16.211069 0 4312 3.71 9 10.893387
0.113 0.891'12 23
soy_061,3690 300 7.535667 0 2854 26.5 14 13.1232
0.147 0.89913303 17
soy_O6L_3, rie 8.0179386 19.805447 326 21.71 11
15.37037 0.205 0,971., 4 10
soy_OG1_4473 1952 7.4516363 17.05425 635 23.82 9 11.7
0.122 0,706, r1 29
soy_061._4487 2200 7.7733254 1.272723 4030 21.59 8
5.26235 0.155 0.72137427 31
soy_OGL,4619 4982 7.73742 19.991972 1070 3213 9
7,26331 0.18100001 0,76514311 26
soy_OGL_4625 3833 3.3/67221 8,94I. 4312 25.68 7 10.564915
0.168 0.75032222 32
soy_OGI._4802 4100 6173721 3247 21.53
12 2.91,r ,999 0. .1839 19
soy_OGL_4975 3103 11.117381 4.1129031 4197 26.54 9 13,07315
0.1.,0' 997 0.7242327 17
soy_OGL_5184 I 1231167 0 5107 2139 6 45.37344
0.141 0,92 , 19
soy_001._5254 2388 11.939192 0 2336 25.92
93.3', , 0.16 0.8552538 21
soy_001_5201 3103 20.713139 0 3072 312 6 20.31
0.20100001 0,73317436 24
soy_OGL_5488 2109 4.1314305 11.095305 1001 24.98 7
13,6i7 0.19400001 0.86175029 32
soLOGL5514 20 5,3180718 235 2070 20,6 8 5.4827714
0.176 0.81447512 20
soy_001_553 1632 1101812 22,0533 4055 158 7
5.245314 0.207 0.7.-ic 24
soy_OGL_5779 2110 14.55392 7.1500001 232 3.25 6
7.0112343 0.11900001 0.8351377 42
soy_001._5786 19) 1421938 7.6842103 25. 5
15.91K 0.18799999 0.85008776 40
84061_5859 2801 363 3.45545 5712 339 7 6,445461
0 9999 0.934 111 22
soy_OGL_6220 1711 90777 8.9411161 1616 3.05 5
10,91, 0.191 0.87290728 30
soy_O10L_6278 212 5.9430509 5.654/18 2488 2227
10 3,8" 1 0.206 0.934 1 23
117
Date regue/Date received 2024-01-16
soLOGL6433 1 10.893449 17.016178 2614 2216 7 6.1063437 0.211 0.552836
34
soy_031_6502 3742 8013426 9,29184 4741 22 7
0.4471345 0.079000004 0.68702793 24
soy_Oa_6542 200 15.158372 1.40 2.13 7 7,9943948 0.16
0.74816188 32
soy_OGL6613 2374 8.614484 18144734 2J01 22,02 9
8.2163639 0.16599999 087919116 17
soyfia_6634 3719 7.9076147 23432432 6419 227 9 828, ,
0.20299999 0,97, 22
soy_001_676 BO 10.85284 103 74 WA Z02 10 15.174n 0.1
9999 0.77170449 20
soy_00L6937 231 10.14607 6.0417428 1001 216 10 7.5568152
0.193 0.90/91065 19
soyfia_41 30 8,7112885 11,4 , 10149 2124 5 13,350 0
1909 0,88145153 31
soy_OG1_656 3700 6 884 1.5 351 395 6 2.9133
0,146 0.76011183 29
soLOGL679 203 10.176669 705 1119 3,2 6 2.5467901
0,146 0.7901415 19
soy_OGL,901 233 9380168 1,7183511 361 93.59 4 2.0566175 0,162
0.' 23
soy_OGL_1022 3100 5.5469222 1167742 8194 641 5
3.7565172 0.21699999 0.82373(8 28
soy_061_1122 2312 22730639 3.5413153 4733 24.11 8
13.075109 0.19499! 0.98064148 15
so/061_126 343 0644204 6,357128 209 8 5,8595628 0,211 0.7691
.7 20
soy_O6t_1348 391 9201719 16.551458 2439 24.73 7 9,6657457
0.189 0.73 ' 14
6oy401376 2/10 53269979 14,0981 10182 28.04 5
7.8668766 0.17900001 0.7946115 35
soy_Csa,1429 11,38756 17,346939 1342 2124 . 8 20,120493 0,11
0.8711143 22
soyfia_1996 7145 6.4805918 5,391E211 261 27.32 10
25.927139 0.206 0.4 11v 19
B(1_061_2086 3246 12425809 10.967344 1760 2.15 8 17.76191
0.161 0.7 , 1,', 14
80y_00._2180 2490 9.0E373 2.5833333 2095 23.45 5 5,6044245
0.107 0.8021915 26
soy_Oa_2224 1923 6E1266 1f)6142 340 19.96 10
5,2993641 0.19599999 0,72 16
soy_OGL2404 1942 11937738 1,6992791 9305 26.12 7 1,135i
0,118 06996527 26
80y...061_2418 1964 1167738 0 258 19.9
6 4,0673123 0.178 0.71491784 28
soy_00._246 1844 11.22036 6,996617 4522 2048 6
8.6511011 02200001 0.7250E6 26
soy_OGL_3914 2188 93036687 0 1001 27.02 4 8,021
0.142 0.79138416 23
soy_OGL_4128 3196 10.772899 11,631462 8127 6.99 4 6.7534123
0,102 0.82132293 33
soy_00._4319 MS 4.18932 2.82 1 31 131 9 6: 40 0.111
0.42551167 22
soLOGL526 2148 11.202606 17.039106 7789 24.2 8
3.5827219 0.17399999 0.80591. 19
80y_061_5428 2030 6,1e 702 12.31345 3065 25.51 5 4,695316
0.13 0.98236934 11
soy_061_5974 361 111E359 20,18165 330 24.44 8 7.8374125
0.161 0.63691068 18
v4_0613301 W8 5.0896368 10.555118 2467 275 7 5.991315
0.1E3 0.9E2547 9
118
Date regue/Date received 2024-01-16
soy_061,6447 1753 8131873 19.224 ,, 3678 23.5 7
11,891234 121699999 15717336 30
soy_01_6764 12 11530166 11.8 9t$7 21.73 6
23516748 0,198 0,7451E0 21
soy_00.3769 1NO 6.. 698 14,611111 3442 19.72 S
7,071579 121799999 0,74.roi 21
soy_OGL.1664 26 11103802 0 5441 27.68 5 16,161953
aiz000 093931501 27
soy_001._1098 2210 8.7746096 14.5 2536 14
21793364 0,192 0.93314361 19
soy_n_193 2903 12.300065 11.103448 3821 32.56 8
6,3777089 0.17 0.55932/9 24
soy_001...2469 2132 31032016 17.964354 X 2121 11
36.975015 0.197 0.90916512 19
soy_00._3630 2513 7.9034634 14484679 2001 27.17 11
5.841 0. '1,9999 0.92303057 30
soy_061._825 1800 8.984251 23.1. 1427 25.44 5 10,534933 0.2
032489014 23
soy_OGI..211 2459 13475348 11819439 ", 3029 6
2.9730742 1114 0,82010963 26
soy_061_217 2000 12,A26331 17.15 2368 215 8 8,3443651
0.193 0.82301438 28
so1161_293 2191 11.654119 26,882702 4551 24.96 8
3.448247 0.142 0.91k 0'. 25
sot06L345 3186 19483228 27.251865 4374 25.87 9
23.6496 0.20299999 0.85119432 27
soy_061.362 310 12.818034 18,1. 2298 V 9 4.6235716
0.147 17511393 28
soy_0G(.1146 2200 51307361 1.2727273 4426 27.45 11
19.53536 0.108 0.9651390 28
soL06L1409 , 14.723554 11173167 /121 23.16 12
6.1446075 0,191 183887750 21
soy_06I_1434 2168 10191735 14,391144 2101 3.47 11
25,839136 0.23100001 0.879125 23
soy_0GL.1528 156 3.1372461 2073955 2720 24.06 7
4.42591175 0.15000001 0.'ii , 34
soy_061._1763 2620 11391621 3.718626 2101 27.74 .11
19,', 0.13 0,95692062 11
soL061_2142 1911 6.6979451 22,135109 2292 2438 7
6,36i 0,148 0.86464626 30
soy_OGL_2155 2100 3.6362858 25.476111 3448 25.19 8
15.8'i ei 0.25799999 0.851 32
soy_061_2192 1745 11131039 21610315 7907 21.87 6 4.181w
021699999 0.7; ,r,. 28
soy_061.3414 319 1937738 18,2 3405 2143 5 25,48056
0,106 0.7 , . 32
soy_OGL_2590 2400 3.931226 25.41w'. 2627 25.12 10 282295/2 0.162
0.7211678 22
soy_06L2916 2212 9.6217709 11771576 4786 2635 10
10.522021 0.207 0,s 1864 28
soy_06L3193 2164 8.3576651 5.4528651 3498 3.75 7
14392322 0.071000002 0.68317459 32
soy_00._3225 3618 7.501536 27.224987 3109 8
9.0807581 0,163 0.71375972 46
soy_06L_351l 2330 5.4506187 9.491357 1192 27,91 7
3,8604512 0.107 0.84 41
soy_061.373 2103 8.0193291 16. 1 2294 7138 12
1444897 1169 180768239 20
soy_061_3765 2200 12.909667 12.451545 2108 26.9 11
10.4/2178 0.16500001 0.73578113 21
soy_00L_413 2100 10.603049 0 4932 29.2 9
24.335198 0.154 0.83131945 27
119
Date regue/Date received 2024-01-16
soy_OGL4653 1911 6.4915478 19.73 5177 22.66 B
33.99 '6' 0.171 0,70 29
soy_061._4090 30 10.074121 21 3438 304 B
4.15446 0.199 0.62565362 39
so7_00._4799 30 13.103085 15.95 1437 25.3 6 4.0823611
0.118 0,919335 14
soy_OGL.483 2116 16.127125 17.932148 2189 2548 10
11.493875 0.2 0.9687271 21
soy_OGL_4950 2124 92E2205 36311326 2179 22.36 6
5.8310401 0,175 0.75E91 34
soy_OGL_4986 23 9.4515498 18.181818 2790 377 8
6.9631076 0.12899999 0.7081E1 27
soL06L5220 2010 10.696481 16.0g 5169 24.67 8 31.523197
0.192 0.93544155 27
soy_061_5237 1922 101406966 10,05411 1611 25.49 5
8,452627 0,155 0.8081 25
soy_OGL_5301 1913 24.034395 16.71993 1602 347 6
4,156173 0.10799999 0.7001387 24
soy_001._5491 2850 4.1314305 15.368421 3253 373 8
32.013E 0.064999998 0.86023754 34
soy_OGL_5520 1 8.5462761 19.787233 3327 24.14 9
9,9577217 0,13699999 0.8011, 4 27
soy_001_5538 230 8.6176863 13.64 432 2456 7 26,087861
0.'i'0002 0.7823014 26
soy_061._5610 , 25.029232 8.8675213 301 2117 5
6.21(,µ,', 021600001 0.63164753 27
soy_OGL_5795 1915 14,27938 7.132 7062 3,24 6 13,465201
0,184 0.8 40
soy_061._5800 229 12.976668 0 21.65 8
16,874744 0.127 0.85081108 37
soy_OGL_5836 230 13.562174 32.04348 3063 2221 6
6,9067574 0.15099999 0.96286136 n
soy_OGL_5880 2100 10.30918 11,518518 8563 2125 11
6.131 0.077 0,89';66 35
soy_n_5898 23/9 10.121329 20.915 5199 20.75 6 4.4611 ,
0.1399999 0.8765E9 31
soy_00,6286 23 6.7950077 23.301348 7145 24.86 11
8.0094951 0,1/200001 0.91097483 29
soy_061._6560 311 11.064569 7383251 1128 27,9 11
6,809772 0,17900001 0,76571991 38
soy_061_6784 11.164678 19.15347 4087 24.42 10
10.84142 0.123 0.771012 20
soy_061._255 t 12.48174 34.7824 4408 2213 5
6.2371118 0.241 0.86751757 19
soy_0GL_2173 23 4202 19.85 3672 26.7 5 13.323011
0,155 0.8139173 25
soy_OGL_3479 1 6.0115023 20.2722 2511 3.2 7
21.81 " 0.17900001 0.6473169 27
soLOG1.3417 1700 10213449 11 3065 24.93 7 19,881 e
0,16 0.541, r' 32
soLOGL_4496 333 7,115381 23,70 11669 24.34 6 1119861
0.177 0.7365315 34
soy_OGL_31 2100 10.719623 14.9523131 12355 30.47
7 8.898572 0.088 0.8966E7 31
soy_Oa_939 2388 12,449766 17.58194 0073 24.87 8 9.2474315
0.1, 111001 0.709333 28
soy_061._1974 230 11.715036 19.130434 5621 28 7
10,322206 0,204 0A8. ' 1 26
soy_061._2995 1 9.352879 31.35736 3915 2335 '
6 10,341913 0.126 0.80432314 21
soy_OGL_4173 2523 ,20.926271 15.973048 1135 332 12
5.4792271 0.133 0.1, m 15
120
Date regue/Date received 2024-01-16
soy_0GL_4497 2080 7 .,,381 3,15 6799 23.25 6
16284371 0.117 0136702 34
soy_001_4549 1718 9.4051356 19,9r) 957 23.69 5 10,767612
0139 0,1562225 35
soy_OGt_5530 ON 11.696812 32.15 21.36 6 6.71,',14
0.17 0.79837913 24
soy_a_6319 203 10211255 10.476191 6516 27.85 6
11.106761 0.072999999 993558723 20
soy_OGL_961 153 11.99724 31111112 2171 311 9 0,141
975862414 42
soy_a_3635 1727 7111796 16.2751 1001 2217 T
3,9901657 0.14399999 0,93002641 32
soy_00._4134 2090 10.342244 0 2920 3.8 5
5.599796 0.1, e' 9997 992999235 32
soy_OG1_525 1 i 11.59192 17.864923 2M1 222 8 9493231
9200001 0.65100184 19
soy_061._5810 2010 12.425729 14.9 A; 2.7 6
9.6553631 0,133 0.91 1821 37
soy_OGL7006 2334 7,8199791 13,4533 21A1 23.9 12 10,84462
0.09359997 0.97709811 10
soy.01_246 1962 19037194 949 3.61 9 19016417
0.I:''0001 0,657 .1 1 20
soy_061_1289 22 6.69865 12.25315 1149 23.18 9
3.4124357 0.161000001 0,6535131 16
soy_001..1691 2135 62321088 21351315 2001 20,42
7 21.17968 0.106 0.60464188 21
soy_a_393 199 881037665 19.31579 351 221 6 1.5740127
0,142 0,82249334 19
soy_061._351 198 352428 13.3222 2105 20.66 B 6.7967112
0,175 0.6450E48 29
soy_a_716 205 9,0348651 0 2849 24.66 9 3.811
0.12 985511122 26
soy_a_936 1/20 12.449766 2.151129 1499 21.16 9
7.3953012 0.17299999 030 e1 28
soy_OGL_1691 2101 9.17/0983 1.6630177 3744 2517 11
2.1957674 0. 14999 0.7234054 17
soy_a_1769 206 5,2067265 0 2222 21.14 10 11333743
0.138 0.90911365 20
soy_OGL_3220 135 9 OR 0 i 181 9 7.967824 0205,
0,71141201 48
soy_061._3476 12 762891 13.71511 4728 21.91 10
3.8649E 0.184 0.641R 30
soy_OGL83 1411 8,729229 11.71793 , 3907 22.16 6
6.21513 0,156 0,79721209 29
soy,X,212 1144 9.373096 0 4436 2.99 6 5.737356
0. ,) 999 0.8993965 26
soy_OGL_2611 1400 8.0021572 21,785715 1979 2121 8
2.9736359 0.17900001 a 105 21
80y_a_6512 130 .223 16,1. 1998 116 6
5.6606731 0.2059991 0.692133 26
soy_00._3634 1 1, S.' 147 13 335 3.81 6 .
7.210133 0.111 0.92831. 31
soy_OGL_6991 1619 5..1 111 13.220134 21 23.71 10 10.86411
0.15700001 0.95283E8 27
soy_OGL1154 2197 5.8307361 17,7. 2001 398 8
15.16216 0.016000001 0.9 !µ '17 26
sol_a_323 2112 6549 26.97431 242 22.78 9 5.0474343 0.106
0.7162751 44
soy_a_483 319 16.127125 122, 2.99 8 4,9981112 0.132
0.96713979 22
soy_OG15496 2125 4.6115062 27.435293 *87 22.44 9
9,8971109 0.1,.1110004 0.8489282 29
121
Date regue/Date received 2024-01-16
soy_061._5811 2000 12.916668 12.4 3441 2385
8 5041 1127 0,86174273 30
soy_001..8553 1700 13.347547 10.8230 3134 23.11
8 5.1382 0,133 0.75892162 33
soy_OG1_4964 1D1 8.548089 11.5 2154 M94 7 9151243
0.122 0,74193734 24
soy_00...5780 1513 1427938 0 azi 5 15.90 . 0.1
. "9997 185027719 40
soy_061_2985 1456 12.115561 24,931318 10898 2.11 7 2.9643612
0,168 0.82077861 26
soy_061._5246 1HI 8.1961266 3028 21.55
5 4.147183 0.122 0.86. 3 22
soLOGL3124 1M0 913 19.8. 2302 23.4 9 14.7116" ..
0.147 0.54 'µ .. 23
soy_OGI._4703 1500 5.5082192 162. 2490 MEÃ 7
17,01. 0,111 0,59407192 34
soy_OGL_240 SO 10. 239 9.15T;1 e 211.94 9 5.946 .
020200001 0.847 .11 21
soy_OGL311 2117 12.280725 1.3226261 1217 7522 14
7.8014 ; 0.162 0.9400315 13
soy_001_1494 2337 72145576 0 1001 26.87 8
4.5038624 0.2 0,9767E9 21
soy_OGL1518 2100 6.1312461 0 3505 M95 7
4.2856436 0.18700001 0.91. 4 34
soLOGL1837 2200 72193756 50454545 3271 2159 10
12.419031 0.18799999 0,75034738 27
soy_061...3692 2200 7.5335667 78363635 1525 214
11 15,188411 1183 0.89615081 17
soy_Oa_4505 2014 1.49/6664 0 2429 2118 11
6.9530216 0.17200001 0,74377134 34
601_00..4624 t 437704 22631578 3336 2173 10 10711843
'0.186 0,75147712 31
soy.061.,5 1721 72103503 13,607411 2269 24.14 11
6.7771 0.21799999 0,70901 11
soy_OGL6 2085 53763165 3213412 4319 2128 10
7.6018333 0.17200001 0.80457884 18
soy_OGL6988 1718 5.3196578 7217 , 2924 27 8
10.061532 0.192 0.95072281 33
soy..06L88 2093 7.4370308 0 t 30,4 5 6,78.,
0,115 0.77714516 29
soy_OGIJ 1.11 66517758 5'r 2367 24.77 9 3.7714791 0.171
0.6; 22
say_00._3976 2517 5.9767532 , 3,5756153 2310 28.77 8
13.1' 0.222 0.90913398 8
soLOGL.,4413 1403 70793177 23,928572 21 10 10.01301
0.29300001 0,58219443 15
soy_OGL2233 1000 72443314 3,47 2001 2548 8 8.1796113
0.138 0.705781 19
soy_061._433 2200 10.613906 1.2727273 2790 24.09 10
18.749006 0.226 0.67552251 20
soy_OGL952 1(60 13.818732 31771111 4255 26.72 8
7.0253372 0,191 0,744 N7 21
soy_Oa_1239 1.11 934244 7.9444447 2914 24.11 10
24.082441 0.208 0.76365717 23
soLOGL1231 t I 91644204 52631578 3898 2403 9 34.550797
0.102 0.7621491 23
say_OGL1399 1W 13.123453 0 1007 23,83 9 52277102
020299999 0.82409471 30
soy_CN31_1530 1573 7 011 0 3556 261 6 3.78 N
0.18800001 0.88955E5 35
soy_Oa_2182 1755 8A397182 0 2801 23.87 9
17.951363 .. 0.189 0.84325397 .. 30
122
Date regue/Date received 2024-01-16
soy_OGL280 1813 8,9753227 8.38385 4155 /94 13
8.157503 022499999 0.86943179 21
soy_031_2043 1815 15211808 4,065140 101 23.9 8
6.8633733 0.175 0.90931743 17
soy_OGL3732 374 8292532 0 2/11 2836 7
4,6587062 024600001 0.797921 25
soy_a_3741 1600 92434353 6.613 4840 21.62 9 32,9P.
0.182 0.7823024 25
soy_OG1._4676 2064 10.891823 0 2441
3.38 6 31,375703 02399999 0.6471 38
soy_061...5893 157 10.1 893 1,8301963 2238
25.77 B 20,4 A , 024600001 0,8,, ( 36
soy_Ok103 170 12.34506 13.41R; 7 24,11 7 2.4379919
0.244 0,74107518 20
soyfia_733 ND 9048711 0 N6 24.05 8 7,377760
5146 0,81441813 12
soy_00._1467 1654 9.10515 0 i 2866 6 15.43951
0.154 0.92667878 30
soy_OGL2431 1303 10.83329 19.07 .1 369 10
3.3376044 02109999 0,7300313 21
K1_011_340 1961 8.8457031 4,02' 101 3.79 9
a9416848 0.21799999 0.61824048 18
soy_a_6578 216 4 ,, 28 0 7/.55 6 9A7
0.17399999 0.78334481 31
soy_011._2407 1 is 1157738 2.66107 208 31.5
5 5.637001 0.132 0,70392632 31
5006L...2976 110) 11"558 8.526315/ 1248 352 6
7.9338775 0.141 0,83243106 23
soi_061._199 1l 11.833065 11 1511 28.62 7 4,6893544
0.171 0.81033242 27
soy_061...460 1771 8.1218634 3.3871163 2513 287 7
9.3,, 758 0.11 0.6754052 28
soy_061.,1050 1745 53172867 . 9,3928176 1001 25.94 9
29.520901 " 9999 0.8542254 29
soy_00(.1755 1 14.15444 4,71 1475 24.19 B
19.939315 0.185 O.' r 6 20
soy_OGL175 231 17.31621 0 1031 24.33 10 43.45808
0.16 0.95947725 13
soy.061.,2941 ,Lk 11.741648 3,972535 1057 23.49 13
21141 0. !r13001 0,91E8196 20
soy_a_3140 153 1260842 3,1578918 1147 28.31 13 90.
1,, 0,16 0.5641 29
84_011_4673 20(5 10.891823 0 1893 156 6 12.506
0.112 0.64!, '11 35
soy_OGL5306 IN 23.026314 2,875 351 362 9 9.947315
0,175 0.69432026 24
soy_OGi_5;i 1700 9.1074429 4.82 335 23.35 7 49.04506
0.176 0.93057144 24
soy_011_38 1501 10.190989 9.46, 3.66 4 192706
0,16500001 0.8 '1 20
soy_061_5315 1703 18.329891 11.411765 381 2823 3
4.287770 0.21699999 0.6752 27
soy_a_5590 201) 6.050163 6.09' " 2431 26.5 9
24.15383 0.108 0.670165 21
sny_061._1261 128) 12.536279 24.833334 204 375 6
10.101346 0.229 0.71 1 21
soy_00...1'1 101 11111177 11,77 211 26.92 7 4,3141499
0,163 0.66101266 21
soy_OG1._1373 133 5.739979 15.4' NH 2472 7
4.500225 0.193 0.79273224 33
soy_0f1_1513 150 6.1372461 13.0 . 4088 24.16 7 6.2125831
0.182 0.92167264 22
123
Date regue/Date received 2024-01-16
soy_061._723 1900 0155138 1,6311 3262 27.73 11 5.21 v;
0.118 036414163 21
soy_061._1. 1782 72193756 0 1131 Z86 10
3.8830335 0,141 0,74372137 29
soy_OGL_545 1742 4.4415636 4.9943247 4856 21.46 8
11.51i,, 1 0.111 684781313 29
soy(131.3628 1300 93168287 11,92577 5280 2184 10
7.9379002 0.19 0.96419327 24
soy_OGL_4808 1703 5; 4 678 5.4111646 4842 MI 8
10,632457 0.13500001 0,94147074 15
soy_Ok_4967 1655 10245035 11103065 301 2(75 8
7.0114961 0.146 0.7360903 16
soy_OGL3201 1163 6.9610649 12.03/833 1556 24.41 7
6.0217009 0.199 0.86019353 26
soy_OGL_295 e. 11220014 9,36 8120 21.66 10 12,.
6208 0,9121152 24
soy_O31_1440 IV 8.1369084 0 751 1154 14 17,44/
" 021600001 0.89828491 25
soy_OGL_2156 1100 ; 7155 0 2123 2188 7 13.;
737 0.127 0.. 1.. 32
soy_061._465 1E3 7.6261792 5.565381 1001 21.29 9
14.6785 0,156 0,68531615 24
soy_061._4706 1527 9.078599 6.024852 2126 2419 11
2.5662351 0.153 0.601 s; 32
soy_O6L_4934 1378 9.3127365 3.26824 ;',1 23.58 11
18.761217 0.162 0.76324475 40
R1_060486 1100 41314305 0 2610 24,5 6
14419121 0,162 0.86336017 33
soy_OG1_196 1196 10.74993 0 6449 24.44 8 6,32,
0.13500001 ono 22
soy_O6L316 1180 12282213 1.8531326 4972 21.4 9
4.0902534 0.156 692767209 14
8oy_OGL,428 1684 1223607 0 2762 25.35 7
6,0587306 0.13600001 06e4401e3 22
soy_OGL_991 140 9.5245228 5.851149 2844 24.5 4
2.0967381 0., 10001 0.7725571 30
soyfia_1415 1651 11.014842 7.1816535 5183 2311 9
3.6490135 0.13600001 0.85397673 16
soy_OGL,2645 = 1331 7.4653587 14,8 k< 3664 2151 9
8.N7 0.183 0,515443 26
soy_0GL_4675 1520 10.891823 0 5118 .21.11 6
31.075103 0.11 0.64735377 36
soy_OGL6350 153 54339896 . 0 1236 26.12 6
2.6293054 0.114 0.88745105 23
soy_OGL,675 1454 9.5540066 0 3234 23.38 5
4.105713 0.166 67 ,411 31
soy_OGL_1034 157 6.3006811 5,324 2001 27.14 10
10.70154 0.127 0.8354183 26
soy_00.381 1263 11540062 19.08153 2 . 24.54 8
12.144063 0.19 0.7912647 23
soLOGL_1171 135 1592926 11.94565 3450 2111 8 11.654327 0.153 0.90199
27
soy_Ork1 11C0 5.7269979 16 4828 2427 8
11.415156 0.1940001 0.7 "7 35
soLOGL1131 1213 5.3739777 24.072548 1001 1044 11
32.1513/9 0.226 0.';;;f 16
soy_CGL4701 132 1078599 13,26053 2566 24.3 10
11.920633 020299999 0,61070565 39
soy_OGL_4915 1405 17.40024 12.; i; '3 23.62 8
16.69357 116500001 0.7804594 22
soy_061._575 1200 14.27 ; 7.3333335 1349 24.33 6
11.4!,,444 0.201 0.85328239 40
124
Date regue/Date received 2024-01-16
soy_OG1..2417 1310 11.11738 13.0 , , 1001 147 5
14991415 0,156 0.71307361 28
soy_OGL3825 19)3 7.7598202 14133333 3127 25.8 8 15,441713
0.12899999 0.55381912 21
soy_001._101 1 ' 52190602 16,2 , ,'., , 2339 24.57 11
1035182 0.176 180811375 20
soy_001_1015 2442 82068859 12776413 1031 26 12
53322392 118799999 0.931651 17
soy_001_2857 215 5. , 61 11915073 524 24.58 12
8,187376 113300001 179344147 18
soy_OGI...6951 1538 4.4201926 25.09753
3102 72E 7 3.7845838 123 0.93982443 32
soy_01.310 2140 7 1: .91 15233644 1001 24.71 9
2.0661132 0121 0,6H /.. 17
soy_06_736 2100 9E48711 19,619017 z ' ! 8 157 9
7,4709315 0. 1'9999 0,8: '' 10
sot.00._989 2100 1E45228 18.047619 6144 176 4 2.096/381
0.226 0.11216/31 31
soy_061..2572 2100 6.9173665 11.333333 2E3 105
9 5,, i' 0.197 0,6H. '( 16
soy_001...2713 2010 452632 28,08111 318 2431 10
4,31 I 0.191 0,4473187 23
soLOGI._2725 30/0 651216 24.592834 3550 27.62 9 5.9576149
020100001 0,42973426 17
soy_OGL4341 3567 5.011349 1271 , 1045 192 10 2,65615
0,17200001 0.46536359 15
soy_O6L4399 OD 82000438 13,357W 6215 12.03 7
2.25117E . 0.169 0,56037229 25
soy_0GL.5142 3210 4,3852158 29.813 tel5 28.21 7 8,10.
eA 0.10700001 034" ,:., 21
soyO6L.5761 2200 9, . ' 997 26.8181E 3585 113 7 3.73' w
, 023600001 0.71670193 14
soy..081.,6158 2913 5.215831 22,142122 5499 29 6
15651112 0,148 0.71457057 18
soy_00._669 BS 4.2763388 12932873 , i 28.05 10 a87
' O. e:10001 0.77518195 31
RA..317 1783 1232213 21.536136 222 192 6 7.4557204
117939999 0,92616033 14
soLOGL,412 2538 11.200636 27,659575 2215 21.34 10 6,645132 O.
999 0,72619647 16
soy_0(1_697 1712 11.121198 20.5E33/ 1992 25.64 8 5.81318
0.167 0.81611233 18
soy_00._772 2203 10,280827 22.045451 3211 14 10
9,2871 , 0.226 0.95328122 17
soy_00...10E6 tie 8,3014231 11 1613 2.9
11 3.5724134 117399999 0,93261 17
soLOGL_1185 31 4.3098682 18.25 7015 2158 10 15.21 '
0.20100001 0.89430348 28
soy_001,2217 2900 6.146626 29.703104 2050 27.27 8 4.55409 117
0.713532 25
soLOGI._351 219 5.1E4751 31.247126 2001 27.5 6
5,7113924 1 , 999 0.85348511 32
soy_061_3625 1N4 3:. 1173 23,839104 1 74.44 12
7.009E23 0,176 0,91.; 25
soytki_3746 2108 7. i 534 14.1 yi ' 2103 2/.52 12
5.8663383 0.114 0.71,s ' .1 26
soy_061..4094 21) 12.218921 16. ' ,, 30.32 7
7.4986134 0.11700001 a 66347319 19
soy0k4107 2055 12218921 9.1511, 1715 29.92 8 2,611 '
e. 0.1 99998 0.69881 ' 19
604_5212 1700 7.9554181 23.411764 7811 2/.41 7 6.3313933 0.138
0.95401319 26
125
Date regue/Date received 2024-01-16
801_00..5249 1N 92919841 25.9112 1031 as 7 45305872
0.243 0,86161075 21
soy_OGL_5255 303 11.09192 13,642214 1538 30.98 9
4,3969364 020200001 0,85347563 21
soy_00._5631 2735 92179429 23.10701 1001 3.51 12
6,4867195 0.126 0.54 . 17
soy_00..589 2100 8A169607 5.4347825 2133 26.52 15
6,1049166 0.131 0.94951022 16
soy_n_6246 2710 5.8414173 16,498196 1184 2539 13 11639893
O. 9991 0.902 If 20
soy_OGL_6821 39 6.4448819 23.171e. 4912 3118 6 9,70' 'Y.
0.164 03011155 33
soy_OGL6923 170 8 e718 14.9579J/ 14., 28.04 4 8.97. '.
021199998 0,89673113 26
soyfia_6949 1845 10. 934 24,814319 1103 2124 8
9,6910143 0,204 0,92379749 22
soy_OGL_42.91 103 5.0144984 24.5127/5 331 25.03 11
6,4427238 0.148 03101 22
soL06L_3645 DS 5.1482658 25.58436 201 2622 6
10.9002 0,139 0,9367313 29
soLOGL_2695 1o= 11964287 30.333334 1460 24.61 10 7,0172319
0.191 0.47 A 21
soy_OGI._2249 2330 3.1746132 35.391301 4750 3.6 7
13.574811 0.215 0.65801376 27
soLOGL_3180 1161 9111809 22,544006 1124 2E12 6
19500123 0.109999 0,668r 24
soy_00._4445 20) 6,1747808 24,6H, 310 113 7
15,452124 0,147 0,63'i 17
soy_OGL_4534 106 7.105409 14.919838 9449 2479 8
2,6231 0.11200001 0.77642133 30
soy_00._4291 212 4,9816347 30.017005 1319 2Z4 9
4,82.. 16 0.108 038516104 25
soy_OGL_357 137 4.0336118 30.1633 6418 21.74 7 1,0748441
0,182 0,83;'17 29
soy_Oa_1701 190 6.6/42897 21.933332 2105 23.13 9 22142594
0. 110001 0.814 29
soy_OGL11. 133 5060555 32.153817 2408 21.92 8
6308113 0.204 0,78341556 21
soy_061_2251 199 4.5184188 39.075313 301 20.45 11
7,4144316 0,183 0,65510146 25
soy_OG1_2253 1318 4.5184188 35.237389 "iit 21.06 10
196 02)900001 0,65384406 26
sol_061_2295 1627 9.7439314 19.711027 301 2156 9
26099521 0.14300001 0.60603174 28
soy_00...2934 140 10.117199 29,071428 501 23,07 8
4,4632311 0.176 0.93 4 17
soy_OGI. 3542 .1 8.9636507 17.15 4672 26 9
236., 0.14399999 1179961874 24
soLOGL_4581 107 5,9314781 30.238241 1200 21.74 8
17000861 0.099999 0.83575362 19
soy_OGL_5261 1500 10.745309 25.8. o 2860 24.4 9 11348195
0.11200001 0.8161034 15
soy_OGL6977 1 4.486526 2025 3762 24.81 8 9,0974151
0,132 0.94331371 33
sol_00...6990 1703 5. I. 171 20.17617 7750 Z47 10
10,86401 0,141 0,95219348 27
soy_OG1.1474 1115 9.0316148 6.66. 1143 3,3 11 16160032 0,109
0,93958235 27
soLOGL_2124 1309 83117144 27.1101 3130 22.3 8
3.2018571 0.178 0.90213 19
soy.OGL2160 13/7 8. .; 585 18.22801 301 25.12 8 7,01. ,
0.6399999 0.84549648 30
126
Date regue/Date received 2024-01-16
64_03..6199 1403 7.301752 21.142157 2703 235 6
5.260211 0.147 0,8606233 28
64_001_625 1212 11E6825 22,755419 2256 25.85 6
5.633136 0,163 0.86637127 31
soy_n_6622 1110 92474756 30.17647 5029 24.3 6
6,07333 0,13 0,9519209 15
6403..5239 1624 91026649 12. $ 4540 27.13 5 3.9811876
0.103 0.882 le4( 25
soy_03._5481 140 4.1314305 11' 5587 3.3 6 14,21213 0,113
0.86412644 33
soy_03._6901 120 7.0E479 18.611111 309 75.38 7
5.4564981 0.1, 110001 0.8718214 24
soy.03.376 1411 3.8E949 17.531164 3118 285 8
6.16913 0.2 0.78103495 25
soy_061._1445 1705 10143933 86217012 310 291 9
6,5441034 0,169 0.90603346 27
soysci_375/ 1; 11 7.36008 12.44444 2106 28.17 6
16.883402 0.184 0,751344 22
soy_03._5251 1533 1.3134089 18.284841 4057 311 5
11.3. 0.189 0.86 r 22
soy_001...6575 130 41296428 16.033334 3103 24.75 5
6.8 1'. 0.20100001 0.782E01 30
soy_00._1428 1213 11.38756 18.931653 2054 2435 8
4.20340E6 0.10100001 0.8768263 22
so/A.3834 1 4.1180404 5.13 2229 346 6
4.441812 0,12899 081214923 35
50061_6871 1300 83E586 17,15347 4250 24.02 9
6,512116 0.19599999 0.8434788 27
soy_03.,98 133 10.343252 15.230799 1767 3.3 7
6.515188 0.10300001 0.76221818 22
001_03...100 2100 11.020363 1.7619017 10167 28 5 8.09353
0.193 0.7534517 24
soy_03...321 2390 6 1, 898 18,859561 5181 233 6
477Q7V. 0.22400001 0.90000151 14
soy_OGL472 3100 6.0021934 1387R 2C9 28.83 4 1.15. 1 0.221
0.53551352 25
sol_03._497 3545 5.061452 2.905307 6941 23.44 6
20.43902 0.17200001 0.47.1 24
soy_03._831 2316 8.4033613 20.03367 6129 21.04 6
11,6423 0.17 0,71822065 23
soLOGI._858 30 7.8715821 5.131818 381 2295 6
0.82502114 0.211 0. 25 14
soLOGL1217 2000 5.75/6227 1.65 1118 2295 7 11,4
0.126 0.8133302 23
soLOGL1977 8.880722 0 2474 27,14 4 14,890017
0.21699999 0,481 27
soy_CGL2276 1255 13.33581 14.422311 11152 213 5 11.
2763 0.227 0.6270358 42
$003...2379 2000 7.808226 4.2413703 3810 27.03 8
5.2150187 0.121 0.51221417 12
say_061._2540 " 4.4011967 1,172333 301 3.3 7
4.7407203 0126 0,74230272 19
soy_0Ct_2636 3143 7.912515 22.271715 7E5 22/1 6
6.4081903 0.193 O. J82 22
s0y_OGL2662 2400 6.8734031 2.161E7 9747 27.58 8
0.31657952 0,18709999 0.52677619 25
soyfirk303 2104 6315397 14.2111 .. 2768 22.14 6
15,03731 0,11 0.74' ' 19
soy_03._4210 4684 3.355544 7.450813 5E1 23.12 10
26.0 0.11900001 0.241433 13
soy_03._4339 2000 5.1 ,i1764 8.5172415 6500 24.75 8
16.733919 0.154 0.461 91 19
127
Date regue/Date received 2024-01-16
soy_OGL_4352 234 3.4308596 6.5132601 1508 A54 7
9,60730E6 0192 048610762 17
soy_061_4355 3111 4.5183697 19,705883 3128 2526 7
1710124 0149 0.49001426 17
soy_061._4378 2E0 6.6361041 9.034413 36.51 5
9.7372732 0205 0.52832258 21
soy_OGL_4429 130 8.8796873 11263158 2305 24.31 6
21.11966 0,198 0,6153318 23
soy_061_4485 2100 7.7/33254 18,3 k 1E0 23.61 7
5,858;' 0.162 0.162 0.72115958 30
soy_O61_5041 1960 7.523974 11614433 E6 20 5 10,342859
0.192 0,65014249 21
so1,061.5163 1 6.641861 11.79841 1496 20.91 3
6.011 ;; 0,19599999 0.82316812 15
soy_OGL_5601 2011 4.599137 3.5 3525 19 7 8.9:.'
118100001 164968199 21
soy_00._5672 2192 63148546 10.74'.1 3149 22.81 6 13.487383
0.199 048682407 22
soy_061.5953 241 87/46323 19759035 5537 25.3 7
17.545338 0.108 169564337 20
soy_OGL_6215 233 6,9321399 0 10633 24.86 5 12,1: .
0.204 18695337 30
soy_OGL_6397 11111 6$150654 15,1..4 6470 2166 10
14. 0.184 0,46793768 12
soy_061._.'. 2349 8.5538664 6343124 3344 A58 7
62517105 111 au 19
soy_061._6679 5713 '169 34.430248 .e,,1 32.06
7 1064067081 0.2499999 0.016 17 28
soy_OGL_6724 2211 .,)'958 17.5 1104 7 7,8579574
0.171 ammo 8
soy_OGL6740 1910 9.4566698 0 11112 21.7 6
6.0555354 . 0.186 0.72915387 28
soy_061.,5158 240 42149191 0 1791 23.99
1 10,243546 015700001 0,7835453 19
soy_001._93 240 10.351217 31.2' 1 0 36.6 5
7.370636 0.36100001 0.76853335 23
soy_OGL381 8.0134126 17.921978 11732 36,68 7
1.7226105 113 178774232 20
8061,467 1757 5.5086857 17.1' 5053 /48 7 4,71. ..
0.17299999 0,Mn 22
soy_OGL_533 230 10.494274 15.681818 24.81 B 3,223358
O. 19999 0.317491 21
soy_061._613 1900 3=145 17.789474 4033 23.68 7
7.4752541 0.14 0.69285786 21
sol_00._997 FM 16706457 16.200001 1003 24A 5
6,4818726 0.126 0.78823107 16
soy_00._2181 2164 9133373 31.61' 33 8E3 22.04 5
7.6967459 0.182 0.801, 26
soy_OGLJ 241 9.1252251 3.375 12193 26.45 6 3.9;
0.043000001 1043000001 0.63564223 43
soy_OG1._3130 143 1050887 16,23134 1824 24.37 5
17,139071 0.162 0.55230165 25
soy_061._3257 1617 5M3763 22.4 72.95 7
14.8,m 0,193 0.82994741 17
soy_n_5051 3742 6.131026 2181 26 6 7.7.1 N
0.142 06131324 12
so/5E1.5746 1760 11020522 11,9;c 5874 23.75 7
7,71 0. '4001 0.70817673 15
soy_OG1_6182 2411 63319771 1,54Irrr4 6E0 26.45 6
4.0068455 0,1 0.82842111 12
soy_061...6420 2529 10.43449 17.12131 5737 26.37 4
26,06337 0.4I. 0.9325 33
128
Date regue/Date received 2024-01-16
soy_OGL_1350 1493 11.76944 12.79305 2/11 2116 1 1,601
11, 0001 0.74645257 18
soy_00._2836 316 5.5548873 0 3196 23.4 3 12647965
1131 0.66565418 23
soy_OGt_4773 2 6.7910485, 8.5934W 7/68 25.18
3 21501 . 0,229 0.84077072 9
soy_06_5640 3400 82322464 0 9564 32 5 19.1
0.132 0.53314173 18
soy_n_5753 6.5565777 12,57, A "94 27.11 3
4,0766213 . 0,214 0.7 '1 7 15
soy_OGL_6105 /1/2 046364269 12.13146 1001 20.9 4
3.7327101 0.14399999 0.67 J. 11 12
soy_061.,61 35 2500 35176268 5.8000002 2416 3
21.362064 0.19 0.76276702 15
soyfi6t_6209 250 5.0035438 0 20044 23.5 3 0.89782125
1207 0,8687125 29
soy_n_6339 1100 5 ,+ 897 15,8; 15429 71.11 4 9.21057
0,204 0,9111' , 28
soy_061_6362 4000 12353655 0 15107 27.67 4
7.4683405 .. 0,152 0.77 , 76 .. 5
soy_OGL_6477 2004 8,4090519 18,0 ;r 1 6947 0.3 6
5,8847322 0.1 999 0,63581556 17
soy_001_1959 1962 17.340572 19.77574 6113 3147 6
6,4762211 0.257 0.50349152 22
soy_061_2320 2440 11.951895 26321312 3263 S47 7
10.14554 0.15099999 0.53030715 17
soy_00L_6443 1200 9.47616 19,1 3015 RI 3 14,66
0,208 0,560624 35
soy_061._81 113 8.729229 7210535 . 22.42 4
11.630946 0.122 0,79 4 19 26
soLOGI._667 2119 3,790732 21205703 2410 2037 5
8,545 0.094999999 0,771. 13 31
soy_061_832 215 8. 0162 52558141 4316 21.05 7
8.5962257 0.104 0,11450102 22
soy_OGL_2483 1510 6.4331512 14.238411 I 222 8
5.Q981 0.16599999 0.88733184 22
soy_061._3910 2000 9.3006687 10.5 3726 Rh 6
5.2159028 0.107 0.7. , 22
soy_CG1._5464 1100 4.7314305 14314206 1740 23.71 6
14,019121 0.161 0,8636515 33
soy _061._922 1510 11.336674 754 . 5431 2101
6 5.78197/2 0.15700001 0.69631636 26
801_0(31_2i , 1847 1.2675809 .13.643746 1142 17.16
9 16.82111 0.17299999 0.75613505 14
soy_061._5942 115 9.668354 14.411765 097 2.11 5
3.3608044 0,146 0,724576 23
soy_OGL435 1517 7.2716579 19.28161 301 23.59 8
5.2458792 0.123 0,51 q 20
soL0GI._4612 2012 6.7005437 7.2067595 6243 23.5 . 8 3,0957599
0.093000002 0.8325553 8
soy...0GL.4713 1235 5.6724916 11,497975 1155 205 7
8,433548 0,193 0.58384871 33
soy_Oa 5668 1 71953877 11.171111 447 19.51 6
6.55478 0.145 0.49533039 20
soy_06L_3010 2161 6.7379055 0 1474 2945 4
8.9494091 119499999 0.7755317 21
y1_061_3152 25E 92013507 2.964427 3711 X% 6
14,045343 0.20100001 0,58 ,f 19
soy_OGL_6500 1732 8.81 26 8.5450314 11' 7122 8 2.7512544
0.219 0.6853066 26
soy_061._1673 1100 9.1770983 10.147 5162 25.47
9 18.361E45 0,191 0.7053867 15
129
Date regue/Date received 2024-01-16
so/AI...2411 1616 11.967738 24463007 30.48 5 5343383
0.18700001 0.7065366 32
soyffil_4947 125 9.454356 10,3v 511 23.72 5
9.1166709 025500001 0.7565734 36
soy_061._5159 1913 42149191 2.9850745 2031 23.05 2
24,92251 0.198 0.7843183 19
soy_011._4720 1700 5.4238782 5471 2709 2417
8 0015002 0.15700001 0,57624835 23
soy_011_6207 1518 5155438 0 1319 24.01 5 1.0745676
0,169 0.8684752 29
soy_00._1980 175 9.5791806 13,343947 27.34 6
7,6422003 0.17900001 0.417544 26
soy_0GL4712 115 51714916 13.581315 10205 21.16 7
8.433548 0.177 0,58394402 33
soy_061_6154 2015 5245831 35491" 7764 29.44 2
9.8333807 0.204 0.78884023 17
soy_OGL69 1400 11.87641 1357144 14934 21 4 4,89,.14.
0.234 0.82011 7 32
soyfiCk212 15,3 13.005701 2 11342 27.61 4 10,11 ".
0.183 082123142 26
soy_001...2416 1644 11167738 0 27.43 5 25,6585
0.13 07111845 30
soy_OGL_5631 1.I 24.815081 49382115 1Y 72.53 9 8972052
0,163 160237413 13
60y_011,5747 1741 15.796243 2,9867802 2872 2178 3
4.3049611 0.147 0.71982247 14
soy_OGL.,5924 1311 .4283 17,461583 571 342 6
16,722326 0.2 083017349 15
so1_OGL_5040 116 7.183974 0 5E3 24.06 5 10.34,,
.. 0.155 0,65019111 .. 21
soy_011.3185 1.,1 6E0361 0 ,A 2521 5 1.701 0.138
083841509 15
80011,4303 151 44824991 15,95918 2423 21.18 7
21,680133 017200001 0,38;11 25
soy_011.1665 1671 8.735938 11.011371 23.15 9 2,9340968
0.145 0.62717831 10
soy_01_4343 324 8,1137762 0 251 22,11 10
5.8134742 0.119 0.4673584 18
soy,011.4381 1703 61147962 1,647 254 23.58 7 5.9475094
0,156 0.53130158 25
soy_011._57 1251 3915419 0 12018 24.38 6 3.03.1 ..
0.184 0,811 e' .. 23
soy_011..471 1913 61821934 0 .1 26.86 7 5.015277
0.1 9997 0.53613454 25
soy_OGL,3013 174 12.431061 0 1E6 21.58 6 9,0727768 0.1
0,7.' 25
soLO6I__4073 12 5/943801 9.333333 3242 228 6
5.60rµ, 0.175 0.5256/106 19
soy_011_5382 1648 9,385705 4.1'.1 5890 199 6 7.34658
0.156 0.6870241 14
soy_011._809 1643 7,4630521 20.93735 125 23.73 5
1,44 14 0,207 0,81670314 14
soy_Oa_3699 1.,1 7.536667 26.610767 5186 27 5
7.8273826 0.229 0.8779121 12
soy_OGL4453 2448 3166691 18.86601 4254 25.73 9
15, 0.1 100i 0,66401017 10
soy_011._614 3173745 1344444 6133 3.11 6
8.1308317 0,177 06929354 21
soy_011_2532 244 7.7228384 1,3557929 Y, 31.07 7 4,78' '
0.t,,0002 0.7583636 13
soy_011...3394 2732 5534336 22.144919 23.14 5
3.148823 0.212 0.69702762 18
130
Date regue/Date received 2024-01-16
soy_n_5981 17E 7.1452026 24,650612 4329 23.7 6 3.3525434
0.18700001 0.61847448 16
soy_n_1637 2169 3161047 9.9585066 7215 24.90 9 3.6471E2
0.124 0.564',, 9
soy_OG1_990 1111 9.5245228 24,15 1,=,, 5391 34 4
2.0967381 0.221 077283508 30
soy_OGL_4630 1E0 3.3767221 20.5 8529 27.61 5
10.339016 0.208 0.747 i4 33
soy_061._2541 1E7 41527185 18,077116 4706 26.03
8 8.8115702 0,079E0004 0,737814E 18
soy_OGL_3729 1425 6.7715597 21.052631 4497 2435 6 3.371511
0. 999 0901209 22
.soy_0GI._6348 1703 5.6151908 8.338220 73E4 20.71
3 10,773304 0,156 0.; 23
soy_00._184 1400 5.E559 14.571 ; 3217 as 6 2,980,
0,164 0.77 15
soy_OGL_6482 1X 8.3500423 21.2307/ 6163 23.15 9 6,26L
0.16 0.6443123 16
soy_a_454 1700 3.3159845 9.3529415 2410 23.11 8 4.808
0.133 0.57919818 12
soy_OGL_3557 1400 5.4506187 0 3757 245 5 7.5929127
0.154 0.83 1 34
soy_OGL_5229 1700 10238331 51176472 0, 26.17 12
12.134748 0.122 0.91863112 21
soy_00._1826 iv 9.0145245 0 7651 27.03 8 9.03,
0.090000004 0.76443505 24
soy_OGL_768 2001 11.362736 23.35 3239 2695 12
11,601129 0,206 0,97335154 12
soy_OGL_942 1 12.449766 18.2461W 1001 29.51 7
6,27,1,1 0.156 0.71129572 25
soy_02,961 VIT 12.178034 16.730852 2414 3255 9 4.5433E8
0.191 0.75064492 28
soy_061_2183 11% 9.9214792 30,351171 NI 25 7
7,9453473 0.226 0,79772037 27
soy_Oa_4143 2201 11.0E471 19.121 ,, 4030 33.12
6 14.314800 0.189 0.85446519 29
soy_061._4442 2010 83314889 14.65 2145 19
11 12,568135 0.115 0.63501424 20
soy_0GL_6853 1109 8.131E42 23,05 /58 10 6.6614132
0.16 0.82800 24
soy_tEl_6978 1785 4.4E526 22.235201 SE 27.E 9 8.35IV4
0.16 0.94344151 33
soy_00.363 137 12.433824 27.987E3 27E 2721 8 4,3812647
0.199 0,75394434 30
soy_OGL_5945 1537 1045343 250916 2011 2943 8 16.51646
0.17399999 0.716 , 25
soy_OGt_244 1i 15.037194 25.5 1524 31.62 7 15.09
0.163 0.85760373 20
soy_031_4514 IN 89380184 14.43 el 2367 20.111 8
0994E91 0.139 0.74891138 36
soLOGL_4645 IX 44523932 26,07 3054 24.38 10 9,1603413
0,19 0,72213727 33
soy_CGL_1079 161/ 7.'1 04 24.8 11 3801 25.47 12
17.474819 0.131 0.89246321 15
soy_Oa_3489 1, 5.4E621 19.,,f 3524 26.81 10 18.32E56
0.1E99999 0., )(' 21
soy_0G1,426 1625 13117153 22.092300 MI 29.96 10
13,58034 0.154 0.68:' 4'1 24
soy_OGL_966 111:0 11.93724 26.363536 2390 29.63 10 14.7197/1
0.24600001 0.75831 39
soyfia_1101 1796 8.7/46096 19.54E3 3575 29.51 13 30.
ir,171 0.1;'999 0. 18
131
Date regue/Date received 2024-01-16
soyf.k.1220 150 8.7576227 32.533E3 1412 25 13
37.990582 0.244 0.80702633 21
soy_01_4383 1µ' 8,395863 19.940475 = 27.5 10 26,531061
0.175 0.53652424 21
soy_OGL_1448 2110 10.671152 12.420192 6514 3t82 9 22.41 .
021699999 0.9084E5 32
soy_OGL_3693 250 7,535667 S 2085 23.28 14
22.348626 117900001 0,8 17
soy_00._6944 1431 11781964 29,89547 21 24.8 B
20,972143 02400001 0.92171919 21
soy_OGL_1251 24% 1420903 21.033653 21101 27.52 10
14.015292 1156 0.72517734 18
soy_06L.22,65 1913 9.22904 20.02055 3965 28.66
6 6.5033641 0.122 0.63. . 17 44
soy_061._2286 212 12293853 28,762543 4437 24.45
9 12.3 0,171 0,62194532 40
so_O01_2 i 2420 11.57738 3677 1/25 24.95 5 4,08 vi
0.168 17027526 30
soyfia_2614 2900 8,5876789 27.655172 3624 2106 12
45,4401 0.0720004 0.59165244 23
soy_OGL_3214 250 8.518399 25, 1, , 8357 25.57 9
13,597588 0.147 071 N 42
soy_CGL_3311 1831 14.175031 28.017012 2483 2264
10 6.1557183 0.129999 0.90 lu 19
soy_OG1._4424 3705 9.7329644 33.711201 5271 3141
11 24.442911 0.23 0.61441493 24
soy_061_4700 1114 8,5891142 23,424191 5715 2427 9 14,301408
1214 0,6135317 37
soy_OGL_5215 3316 9.6/46111 37.786491 1071 25.18 7
4.4966764 0.1 '9998 0,951 , 1 28
soy_061...5522 2930 8,5462761 9.5563145 , 2921 11
35.497897 0.15700001 0,797912 26
soy_CGL,5766 VI 2016419 23, '0 3843 24.81 7
2.6367111 0.155 0.8107065 22
soy_OGL5712 1/00 11448713 18.5 7124 35 6
7.1170144 0.19499999 0.8199442 30
soy_06L3522 312 21291259 23.009554 2214 2102 10
11Ø '0 0.156 0.7141 177 21
soy_a_6747 1958 3512024 3.6772215 3775 27.47 8 11.37267
0.132 17340122 26
soy_OGL_1726 1' 27.73612 22.322101 1001 29.89 11
7.4522734 0.164 0.84480655 24
soy_00._2270 1900 11181895 32.694212 2140 24.52 10
11.421723 0.205 0.63278443 42
soy_02._3501 1823 47.600048, 39.056499 1967 21 5
8,1240253 02 0,717332 21
soy_09._3511 1, 47 648 29.045895 2427 29.28 6
5.0673656 0.178 0.72791547 23
soy_061._3740 1724 92434053 21.05585 6640 26.56
11 27.1 0.132 0.78246349 25
soy_O6_4508 1183 8.835184 21.592121 2488 28.18 9
34.511875 0.219 0,74633116 37
soy_OGL_4631 1768 21 N753 23.2' I 5118 2105 7 12.1
t 0.14300001 0.745789 36
soy_00._4680 1531 110823 26.453211 2001 2E91 8 = 17.022524
0.163 0.64442283 39
so/061_5219 2219 10E081 32.13152 2001 28.72 8 31,523197
0,141 0,9356258 27
soy_OGL_5234 1700 1324619 24.64 3546 31.7 7
36.420975 0.115 0.90520734 27
soLOGL5300 1700 21178029 14 2811 27.23 9 7.364119
0,16 0.71 ,7 27
132
Date regue/Date received 2024-01-16
soL00L5607 131 24.915646 21484121 4214 2fl3 10 3.54882 1189
16339129 28
soy_01_5786 1. 14.27938 35,1'1 2E1 3.58 4
19.41422 0.167 0,84 1 40
soyfla_5796 1400 14.27938 3 643 21.07 6 8.096',". 0.155
0.85439301 40
soy_0GL_6521 no 21.201258 26.9 3518 X5 9 5.823893 0.113
0.70841658 21
soy_OGI._953 1920 13.818732 27.395134 1707 26.92 5
10,377764 0.17399999 174614412 21
soy_OGL_15/4 2E8 91763494 22.517321 5223 3194 5 43.074E6 0,116
0.79642E2 28
soy_OGL4475 1703 7.9195275 21411764 141 10 34,6E6 0.149
0.71 .i2 28
soy_OGL1952 1757 2116124 24,811E1 ,1 24.07 8 113., +
0213 0.5153715 15
soy_001._3191 1648 83576651 314+4'1 5556
3127 7 14.371E4 0.142 0,68810278 30
soy_Oa_5767 1131 20.915419 25436181 7411 E.4 7
2.6367111 0.182 0.81r ,i7 23
soy_OGL,554 2148 21.11812 16,759117 3105 31.56 9 5.3065062 0,161
0,32 1 18
soy_031._307 3701 10.227943 9.4324722 1217 25.62 8 240.
'e's 0.191 0.947E91 13
84_061_1935 2102 18.734249 3244529 2398 25.73 9
9.77 .+1 0.152 0.54510707 26
soy_061_3217 1400 8.3544016 314,. 7 , 2464 6 27235914
0.208 0,70145 42
soy_Oa_3346 300 10.06963 2157143 315 30.1 10 151.46315 0,171
0.85016E 22
soy_061,34E 165 471E048 29.051-' 3427 24.64 5 5.8800721 0.14
0.71 41 18
soy_06L3507 1414 47E0048 3387553 1381 317 7
4,6008244 0.16500001 0,72355372 22
soy_OG1_4146 1518 13.177082 33135104 3294 21.47 7 33.811
1 0.139 0.:. 30
soy_OGL_4507 1100 8.4976664 24.277779 5487 27.33 8
38.817326 0.13699991 0.74 3/
soy_OGL_5301 1400 24,034395 31.857143 E0 28.21 9
23,516148 0.13600001 0,70665246 27
soL001_5338 1300 46.125168 22539162 4111 25.92 9
5.11 iI 0.176 0.54373703 11
soy_O6L_5624 1200 3655751 oaointo 1622 25.66 5
4.41767 0.206 0.61, 293 29
4001.7,5845 242 12. ;249 24.804361 221 31.08 7 =
4689 m 0.13 0.9741N' 20
soLOG1_6540 2574 16.822715 30,03108 3903 3.48 7
17,233465 0.097000003 0,7451E 31
soy_0GL_6750 1723 26.599495 29.8E727 2001 101 7
7.1662169 0,126 0.73562831 28
soy_OGL.,6 1513 1.0806479 3524E7 2236 21.35 6 46,349056 0.16
0,86713584 26
soy_OG1_1576 2014 8.3843002 5.4121151 2432 30.48 5
43.074696 0.052999999 0.7'01109 28
soy_00L_3213 1427 85918398 19.101E2 ." 26.06 8
9.6544733 0.15700001 0.7030892 42
soy_OGL_3330 NOD 11347876 32,400E2 2552 22.3 9
14.164609 0,115 0,87435025 30
soy_OGL_4137 1100 111873235 36. A 3169 21.11 12
6,112E16 0.164 0.83400319 29
soy_OGL_4824 15/0 11127125 22.3 4015 24.2 9
4.744E87 117299990 0.9678E18 22
133
Date regue/Date received 2024-01-16
$4_061_5781 1367 14.565392 82662764 5263 26.84 7
7.581) 0.161 0.8361E7 42
soy_061._5908 1165 1.1141469 28,441127 1765 3,54 9
16.557247 0.154 0.86143517 32
soy_061_6786 1740 111Ã47929 19.45159 1734 24.65
10 12,953485 0.148 0.774532 22
soy_OGL1725 1747 27.231612 3.777905 1176 346 12
10.561194 0.146 0.8,444 '1, 23
soy_061_5783 1419 14.565392 8.1747/13 2001 2248 B
31,74159 0,104 0.84E841 41
soy_OGL_2940 1W 11108299 24õ: 3 N11 25.58 10
3733241 0.115 0.92434901 17
soy_061_3500 1511 CH 048 0 7 24.28 6 5,2' i
0.164 0.71.,4.( 16
soy_061_4643 136 17.51983 35.5625 1001 25.15 8
14,192457 0,16 0.72736 33
soy_061_493 134 14.59184 24.68344 2361 371 8
7,8557811 0.193 0,77202168 32
soy_061._5236 132 /53023 28.674122 1717 21.8 5
1.45312 021699999 0.89545133 23
8oy_061_3581 1189 6.0E26/ 23.5492 = = 24.13 10
29,5482 0.11500001 0,84933777 38
soy_061_5634 1748 24.815081 21.6E14 353 21.96 9
17,939118 0.122 0.611 13
soy_01_2667 1700 6.8734031 22. A 2781 25 9
16.412588 0 1, 0997 a51916655 21
soy_061._1161 1178 17.394621 36,' 8 3663 22.66 7
22,315786 0.183 0.9578934 12
soy_001_3351 1579 12.108066 23.622515 2001 24.88
B 32.483772 0.115 0.82612538 16
soy_031._3506 1178 47.600048 21.392191 3553 33.44
7 6.9910103 0.125 0.7232202 22
soy_061_4632 250 21 ,:753 26,700001 5760 26,3 B
10.8, 0,954000001 0,74402157 36
soy_061_4678 1100 11 '1823 31,354515 1730 25 6
23.104298 0.15099999 O. = (11 40
soy_061.3875 1,111 8,3950 13.171118 7104 25.38 7 50.97037
0.101 0.8455056 25
84_091_84 1200 11.49644 18.75 3667 358 8 17,917261 0,223
29
soy_061._934 150 12.449766 25.1 4918 24.2 9
8.5 , 0.273 0.71'1 17 28
$0061_1212 1169 9.544204 18.937252 5097 21.86 9
36.605e 0.25 0.16116188 23
54_060216 1240 8.5244122 15,967742 3467 27.17
5 18,444304 022499999 0.7055229 42
$4_001_1717- 1023 33.748749 16.226784 7374 25,7 9 6.13627 03999" 0.83484447
26
84_061_3503 1200 47.600048 7.91 . 6016 3041 6
6.608542 0.175 0.71777231 21
soy_061,3501 1595 47.600048 7,2721275 5730 *9 7
10.301006 0,182 0.7214502 23
soy_Ctl_593 2001 3.541531 19.7 4615 30.05 10 8il
6 0330051 0.77391326 5
$4_061_3231 ii, 8.2360296 12.4315 /019 31 1
19.9432E6 0,138. 0.7227562 31
$4_061_6012 1314 8.529718 252533 524 N73 7
28.266319 0.186 0.89648189 17
. $4_061_443 1247 9.7329044 27,90657 7 2197 9
26.94837 05900001 0,61491328 . 24
soy_06L2621 1164 3.0686056 18.531415 2610 2121 9
34.005161 0.15099", 0.58312027 .23
134
Date regue/Date received 2024-01-16
K1_06(4405 1643 86647367 19.111382 17 24.52 10 52.01,
a176 0,571E74 24
soy_091._1949 12 24 ,1.584 25.91 .. 3913 27.58
7 3,2484913 023199999 0.52193832 16
soy_00._3540 1E5 8.9E6507 14.12987 1 ,. E37 9
114.39545 015700001 .. 0.79/8101 .. 24
soy_0a_5285 1645 17.3E168 25.957447 1001 29.93 9 56.3052
alea 0.7408753 23
soy_091_5302 1061 240395 24.12E81 5318 3.12 9 21,633183
0.175 0,706110 26
soy_061,_5623 12 36.55751 0 4473 31.05
5 6.557972 0.116 0,61190419 28
soL0GL958 1400 13.85167 16.1 3628 342 8 06872473
0.168 0,74753E 21
soy_OGL_374 1276 8.1E1738 25,2352 3E5 EN 11 25,4435/
0,168 0,80449212 22
soy_091._5231 1493 966486 17357143 1373 E21 9
19,261192 0.1E9999 0,91337806 21
soy_00.3226 1400 11.29869 17.142857 2015 24.28 11
10,320093 ossoopoi 0.87921244 27
soy_001._3253 1766 8.24548 15,117581 2166 2592
10 29,595303 0.113 0.74'['', A. 16
soyfia_4638 14110 19.31402 0 5167 157 9
160512 0.1E9999 0.7344771 37
soy_OGL1102 15/4 8,7746096 21.664549 1001 " 24.33
12 32,941418 0.148 0.93547E5 18
soy_091_5414 1393 4.9895315 104 2108 B 33,051857 0.131
0.86970E4 28
soy_Oa_5613 1152 27.376841 18.663185 2044 2169 13
11.49055 0.229 0.62964171 25
soy_061.3''. 130 104E934 17 8/67 27.33 7
22.889725 0.19300001 0.92332995 22
soy_061,4476 1330 7.9195275 22.781966 4155 , 3.39
10 33,945286 0,156 0.7090 28
soy_081._4931 1255 9.3127365 28.52512 301 26.93
13 87.926178 0.105 17. 33
soy_Oa_27 1600 10.054278 21.13 3426 3.87 10
6.4305115 01199 0.90348482 31
soy_091_1141 1900 5.5214667 33,47 8367 24.14 10 16,8 i
0,169 0.97E4212 26
soy_OGL_1150 1414 5. 361 25.530411 2534 9 26.8;
1 021600001 0,96014512 28
soy_091._1411 1838 16.339678 21.490151 2499 27,52
11 4,9253087 0.207 0.84094576 22
soy_061,143 22E 11.385625 23.1 21 309 8
10.548765 0,186 CM' ,' 23
soy_OGL1472 1E5 92116108 18.867924 3343 29 9
19.226234 119413001 0.936619E6 26
soy_OGL1531 1900 7.5/94353 30.9473E 1836 27.1 5
3,870E11 0.13500001 0.8.. 38
soy_Oa_2145 1915 7.0182421 27,55784 2901 322 9
4,6601334 0.15099999 0.85752 30
soy_061_2193 130 10.131039 37.384611 23.38 10 4.008E5
I .11001 0.785E44 28
soy_091_2671 1947 6.8134031 33.590137 1001 24.29 12
12.8167/8 0.21600001 0.50812138 23
soy_00._3191 1114 9272277 22, 1445 27.39 8 16436827
0.189 0.673124E 29
soy_061_3199 11E &51.;86 21.4 .1 2 ar 10
5.7195139 0.151 0.691/335 34
soy_061._3241 2138 9.3938437 11.693172 6445 32.03
B 9.3002E4 0.1 14999 0,72918106 36
135
Date regue/Date received 2024-01-16
soy_00._3784 1641 13.260455 32.604736 1001 24.52 9
10.863132 0.21600001 0.69624078 17
soy_00(4488 1, 7.7133254 31.1 69 251 0.94 8
5,2659235 11399999 0.7214373 31
soy_Oa_4489 1 ,, 8275254 14.3" 3305 21.75 12 4.H1 12
0,163 0.72284567 30
soyfia_483 1 1127125 19444445 6385 28.38 0
4.7448487 0.178 0.9678155 22
soy_Oa_5031 ZOO 1022226 25,892857 351 31.67 7 1,79
0,147 0.6,1 9 30
soyfia_5035 ZOO 94548454 31.9 151 2E35 11
6,303185 0.22400001 0.65617/93 27
soy_Oa_5264 23/0 11202606 20 2365 27.72 10 9.3787441
0.125 0.8071 ,,1 19
soy_00._5325 22 11453777 2176 1135 29.76 9 16,15383 0,163
0.661 ' 25
soy_OGL_5815 11 1156554 166728M 4572 2165 7
5.864871 0.113 0.89 , 23
soy_061._5905 2400 7.0267756 285 27.41 9
2.8602943 0.121 0.86127554 34
soy_0GL,6216 ;' 7.7151871 24, 251 27.02 6 11. .477
0.17200001 186978137 30
soy_Oa_6606 INT 8.314484 260117/4 1ti 24.84 12
21.33568 0.11 0.8, 16
8001.3994 215 5.2089171 24110731 1001 2141 9
12. 0.13600001 0.953653 27
80y_061_719 2000 9 ,1 .51 31,5 1325 23.85 9
6,1124072 0.161 0,8 26
soy_0GL_1532 1877 1.5794353 36 760 159 2167 5 3.871 11
0.18799- 0.88614861 38
soy_00...2203 2606 7.6249928 31, 101 2358 218
8 9.8363342 0.123 0.7., 157 29
soy_OGL2429 22 11.372036 3227432 2001 2161 7
6.182131 0.152 172551356 25
soyfia_5477 1312 4.'05315 36,046646 22.37 10
25.076777 0.19599999 0.8677E5 29
soyfi6_5873 151 10.500387 36.915638 5789 18 10
3.3439326 0.18/00001 0.91037750 34
soy_Oa_6251 223 51960298 21814816 354 27.77 10
14.it 0,057999998 0.913211E6 23
soy_Oa_223 1 1122773 2551051 407/
30.15 10 22.820234 0.164 0.83174.4 24
soy_Oa_1489 1805 7.653698 23333334 3684 26.77 11
30.461131 0.16599"Li 0.98786794 24
soy_OGL,1562 85 11973433 31400662 2/A1 26.51 8
10.441794 0.161 0.8251972 25
soy_Oa_1913 23.127859 34. ;2001 2121 12
13.055576 0.233 12
soy_0a_2921 2280 93318186 26,870057 3826 2157 12
11.694722 0.116 0. .1' 75 29
soy..061._3221 7.6237597 30,611111 3280 31.44 6 14.6
020100001 0.7121183 49
soy_Oa_4609 26 1024121 25716864 2126 27.77 11
8,31379 0,141 0.6291341 38
soyfi6_4926 2200 14.30184 33.451544 7349 3032 9
7.1 ,1 0.178 0.751025 37
soy_0(1.5837 3300 13.52174 29,1 , 1650 31.19 4 8.2 .
0.138 0,96
soy_Oa_6528 I 2121258 24 807903 1467 5.21 10
8.0183768 0.132 0.71722135 17
$000..6547 ,; 13.347547 24.1 2127 7/.76 10 8.11. i;
0,14399999 0.7521515 30
136
Date regue/Date received 2024-01-16
soy_OGL6554 102 13.341547 36.930294 4579 2187 9
1441062 0.177 0.7590152 33
soy_00L6744 157 06065119 29,133611 2031 2125 12
118857 1159999 0.73132/53 29
soy_061._68 BIA 12.37355 3055555 4442 31.03 B
5,31. 0.139 0,82415/58 35
soy_061._296 2974 10153501 34, '333 107 10 14452727
0112 oilasosi 25
soy_061_2294 VA 065/3048 36.700001 433 25.6 11
15,0.0'1 0.193 010835779 31
soy_00._4517 231 8.122776 28.666187 2469 27.12 8
7.8041 O., 9999 0,75331491 35
soL0GL1833 1400 13344145 S 4 24.5 9 12165135
0.19499999 075635064 .. 26
say_OGL3021 11 10.0243 23,751301 2416 26.3 7
10.581325 0,118 075239363 21
soy_n_4433 2000 8.4435787 30,7' 2332 214 9 8.6412135
0.126 0.621105 25
sk0G1,5014 2242 8.0536013 29.438002 2249 28.54 7
16.801319 0.14389999 0.61438793 22
soy_00L688 1630 11.121198 2288345 8707 2134 8
89658375 0.141 080 1 21
soy_OGL,1389 1531 6.9438424 21,032E5 10716 292 6
10.681188 0.154 0.8h 34
soy_06L1404 1161 14.126931 33,241643 8151 24.59 8
4.2285218 0.211 0.82983249 20
soy_001._2269 1126 9.1252251 31,705151 12334 21.26
7 4.8073325 I -999 0,63552177 43
soy_n_6440 1137 10.461443 28232189 5131 26.82 6
3,2,1 0.193 0.55712956 36
so/461,6515 1500 7.4094133 28.79 5179 21.86 6
13.651012 0183 0.690 1 29
soy..061õ6894 2191 7.01N79 27, 1 a43 6 13,1
0,101 0.86751841 26
soLOGI..3350 2126 10.122426 3214'1 30/6 21.56 5
10.524301 0.142 0.84 " 25
soy_OGL4531 2500 6.1637272 36.400002 8835 7/.52 8
16.166748 0.18099991 077136E4 28
soy..0GL,6431 2134 10.461443 26.2418 3311 29.28 5
7.5097105 0.17900001 0.55621582 36
soy_001_6956 233 5.7448678 29.7 12593 2195 6 18.r'
0.14300001 0.92951544 30
soy_061._342 1114 9.517172 31,175468 6041 25.97 6
16.186171 0.19 0.8571534 29
so/A..373 1415 7.252614 33194916 2131 2196 10
29.82854 0.156 0.805820 22
soLOGL2120 9.8124828 31.099614 2631 135 8 21,71
0.147 0.91686179 18
soy_OGL2932 215 99275036 28.04216 0122 21.23 7
22.389673 0.12800001 0.93375319 18
soy_OGL2919 275 9.1764411 26.681318 2654 36.98 9
41130013 0.106 0.9241332 17
soy_OGL4481 2104 7210852 29.70532 31.08 10 24.04722
0.117 0.711E64 30
80y_001_6426 I' 1023449 18,318E1 4740 31.31
8 10.54 11 0.30E0004 0.54680353 34
soy_06L6810 1590 13950586 218. 3646 322 7 33.717191
0.132 0,84256208 27
soy_00._1754 14.60705 24125132 327 28.89 9
181410/5 O. '9999 0.96996105 20
soLOGL3236 1663 9.8079872 35.417919 4285 2139 8
9.5296211 0,125 0.724!1 16 38
137
Date regue/Date received 2024-01-16
soy_00._3318 2200 113E83 31454544 222 28.45 9
9.13 9998 0.89383411 25
soy_01_4914 1380 17.460024 31384617 2483 2138 7
17.170074 0,167 0.78050131 22
soy_OGL_347 1 6.2113775 27. in.N 58E2 2E57 9 5,1741 0
0.104 0.8479138 30
soy_0GL_692 1404 11.121198 25,569801 1441 23.86 11
5.3050137 0.184 aoinsus 21
soy_OGL_3344 1700 10.744105 22294117 2001 158 8
1.1472249 113 0,85 24
soy_00._4545 1667 5 523 29. . , 1 Be 23.27 11 46827121
0,145 0.1874376 32
soy_0GL5030 14/9 10.;' 26 20,622042 1E67 27.31 7 2.6
c 0.146 0,66018401 30
soy_OGI._5835 1660 11632174 19, . 7677 2E8 8
5,9149113 0.131 0,96110 22
soy_Ok_3246 1354 8. , .376 20,605614 UR 25.48 11
10.8/4005 0.161 0.73364365 33
soy_06L_5872 1 , 1E506387 32,853718 3108 23.92
9 2.9763439 0.14399999 0.91052419 34
soy_OGL_979 1619 13.02616 2E374306 , 21.16 9 3,89 1
0.115 0.76735747 33
soy_n_1527 7200 7 011 18,681818 1726 28.68 9
5,7201 0.346 0.89211 37
soy_OGL_3554 1405 6.3657079 33.523132 1001 22.56 11
14.619552 0.168 0.82557756 21
soy_OGL_3943 1205 24.13867 38.672113 3523 /13 10
6,2774024 0.199999 0,87572414 28
soy_OGL_4644 1 ;$'.1 4.3523932 21,481482 1. 27.14
11 16.568615 0.07 0.72375 33
soy_061._5780 14/8 14.565392 15.493111 2001 31.79 6
7.0112343 0.117 0.83589792 42
soy_n_5846 1444 9,67E3773 36.7 v 1278 426 9
15.171015 0.1 999 0,971 20
soy_OGL_6963 1488 16247258 28071420 41' 28.18 9
6,2t? 0.1;'9999 0,934126 32
soy_031._4927 1 . 14.5E6184 31,927711 3772 21.65
10 6.87/8412 0.14399999 0.76 39
soy_061_201 12(X) 11333065 31,1 4641 24.83 .7 5,
5 ' , 0.169 0,81045198 27
soy_OGL_329 1500 10.351954 36. 23.53 7 4,7436218 0.139
0.87806155 22
soy_Ok_2400 1730 18.483459 24.393084 1459 2E41 9
11.04 0.126 0.68 J41 ' 16
soy,0GL..5283 1413 16.257269 27.285715 2535 25.78 6
2.327015 0.15700001 0.7 . 22
soy_n_2504 17/0 11125324 28.418079 2120 72.88 11
21.1 4 0.124 0.63154012 17
=
6oy_031._3773 1724 12,101471 13.921114 3948 28.94 7
9.7000217 0.093000002 0.71687019 20
soy_001._4511 1152 8 c 184 37. = 1 12911 am 9 121.
0.11030001 0.74820551 37
soy_OGL_5275 1 82274832 30,3333N 4248 23.16 10
5.4211, 0.114 0.77700001 20
soy_00L5024 1379 12,416456 23.277737 1330 28.71 6
8.5845113 0.1 .10001 0.66555148 28
8oy_OGL_29 1559 10279623 31. , ' 1001 2E49 6
4,5591029 0.1 ' 999 0,89715401 31
say_OGL_804 1816 9.4305977 36,24/331 3632 2425 8
13.643888 0.097999997 0,84 4 3 21
soy_061_4557 1970 14/23227 24.162437 2001 26.44 8
17.821413 0.1 9 0.802 3 24
138
Date regue/Date received 2024-01-16
soy_OG(5819 1E3 13314646 9375 2113 243 7 4201,
a13699999 0.90405017 23
soy_061,1928 1E3 11733195 1133E33 215 30.8 7
7.1148205 0. e 0001 0,55287337 26
soy_00._5587 1732 5E5071 29.05M41 2E1 256 12
27,347927 a ,110001 0,67: 7 19
soy_OGL_3309 1100 14.902535 27.545464 4609 X9 9
8.55:,' 18 0,1E9939 0.9131797 19
soy_061._5223 1071 11 , 1604 25,77 206 25.58 8
20,011751 O. 19999 0,9329713 25
soy_OGL_920 151 11.336674 7.389461 5962 32.34 6
5.781E72 0. 110001 0.69622552 28
soy_00..3 1600 19E507 13.375 4063 29,25 7 9.13353
0.116 0.79317262 24
50y_Oa_2063 2613 1, , ;655 8,567153 7930 26.88 5
0.260 , 0.17E0001 0,5;:"48 9
soy_OGL_157 19E 4.11 .633 11.466942 4M 266 3
2,893321 0.113 0,69683546 12
soy_Oa_1611 1600 1,1755582 20.9375 10792 24 2
1.67m 0.233 0.33335352 4
soy_Oa_2019 1768 2.1072574 16,063349 5663 25.33 2
3,0507793 0.1E0001 035471 5
soy_00._2: ii a,. 1916 27.8' ' 13E3 25.38 2
12.59563 a .10001 0.3217E72 10
soy_031._38913 1000 1.596808 23.700001 37044 28,7 1
0.19858819 0.24 0.66117364 4
soy..00._4035 120 1.414 18 23,333331 ' 27,5
1 0.068491544 0.235 0,541 ?,e8 3
soy_Oa_5415 1523 41E185 20.22244 111 25.8 4
13.873E 0.17E0001 0.8309111 4
soy_061._5694 le 1.387786 33.57143 22790 30.07 2 25.497341
0.257 0.4030115 13
soy,00,6012 17E 1.527503 15,043227 3577 3.24 3
4.9021716 0,139 0.49522781 7
54_0(1_1601 1100 5X103 26.353636 16168 3.81 2
18,951331 0.16 0.68E1384 14
soy_0GL2341 2000 11.14712 1 '4' 6444 Z95
5 15.280161 0,299999 am 6,7 12
soy_0GL_5365 1916 9,3E475 94699379 4,1 31.41 4 =
4,8025694 0,088 0,6183159 15
K4_01_5426 1E3 12267535 26.214303 5221 E63 5
7,83t; a 10001 0.9817239 11
soy_Oa_2745 2017 55443225 19.832755 3E4 123 7
19.901 , e 0.185 0.33241 21
soy_OGI.,876 4. 20722638 13,52459 25.59 3 7,9523935
0,185 062296516 8
soy_00.30 255 11.010665 1635 1E43 24.5 4
3.9521847 007E0002 0.63914518 28
soy_001._900 1517 6,5197372 19.84486 13378 24.36 7
13.296107 0.14 0.670E378 31
soy_Oa_1957 2000 19348343 11,5 4136 24 5 1,460, 1
0.121 0,50. 19
soy_Oa_4984 le 9.9015322 20.21425 , 25.85 2 2.62'
0. ;'999 0.71046478 26
soy_00._4998 1215 8,613404 26.030534 7275 21.06
4 21.437262 0.,1 10001 0.701 25
so/1E1_451 4.9833407 14.346154 4115 26.69
6 6,6225529 0. ' 998 055246201 19
soy_OGL 499 17E 4.4E1186 12.941116 5526 2.05 4
2.8332477 0.11399999 0.47367117 25
8061..811 2E0 7.571846 16.5E54 26.63 4 3.2197626 0.206
0.81 12
139
Date regue/Date received 2024-01-16
so/061_2412 143 11.37738 9.4235117 1321 28.78 5
5.3432283 0.153 0.70683815 32
soy_001_2421 1652 11.967738 1.6949153 11816 24.63 3 7.46128 0,138
0.72274816 26
soy_061._2595 131 37431359 22.9 7158 24.1 6 ..
27.161163 .. 0.178 0.62'4 i% .. 15
soy_061_3131 230 1887 19.41363 10203 2964 3
20.754673 0.213 055461466 24
soy_Oa_3138 2043 83777838 6.99951M 14141 Z97 4
7,151. ; 0.17399999 0,55954438 27
soy_061_4215 231 4.431444 3.744014 7217 23.68 5 23.191051 0.193
0.2531832 23
soyfi6_6679 130 9.2814445 33.41 ,; 2814 1816 6
7.8512616 0.235 0.46775478 15
soy_061_6092 3167 0,69722927 11,833472 13643 24.68 2 5.961226
0,213 05
soy_061._6138 2113 13918011 6,7303319 1310 24.19
4 22 I, 0,156 0,76.ii" t, 14
soy_n_6337 123 5.6879897 20.41, 13062 3.08 3
10131947 0,224 Q,90 4t 28
soy_Oa_2425 1163 11.967738 21,941217 8652 28.5 4 5954741 0192
0.72049 27
soy_061._59 M 11.04541 1.179221 12319 24.61 3 84.12931 0.12
034121209 28
soy_00L418 2100 12., 779 25.190475 7738 2547 6
5.1838717 0.118 0.70735133 17
soy_061_886 2200 134151517 27454516 371 3.31
4 46,20338 0.18799999 Q,653i 9 14
soy_00._183 2811 82352183 26.23577 11819 7/.07 7
13.834111 0.107 0,76614612 25
soy_061._3370 1800 14.506085 19.611111 9106 26.77
7 5.508E 0.13 0.71547002 15
soy_061._3383 1714 55155735 25201201 3013 3.24
6 43.6347 0.167 0.71830809 17
soy_OGL4220 1i 4'355 19.563 2575 8 26396314 0,142
0.2606367 32
soy_OGL5241 1 8.6306667 25.7; 74 9133 Z63 4
11.693774 0.112 0.8807317 24
so/061_5618 2359 28,530188 83020767 15721 29.84 6 4.6432841 0,16
0.6262033 22
soy_Oa_5948 130 11. ,87 32.933134 7267 728 5
6.3404379 0. '9999 0.11.;9 28
soy_061._5959 22 9.0571718 24.861164 4713 3(96
5 12.7. 0,115 0.69034183 17
soy_Oa_1324 1351 0,3154867 22,05113 28.34 1
4.4111633 0,226 0.62 ;'11 14
soy_00._6353 130 5223477 58421051 13103 2105 2 0.65211523 0.127
0.87871915 18
loy_061._133 1503 9.538628 19.627411 38445 29.67 2
0.6061 0.126 0.6001 . 7
soy_061._185 235 5113559 5903332 21614 29.62 3
2.9207801 0.16500001 0.78117519 12
soy_Ca_488 310 199 2134,1, 2478 6 5.445317 0.1300001 0.50045496
13
soyfia_500 1707 0E1186 2636338 14848 3,6 4 3,6943085 0.149
0.47246748 25
soyfia_545 2101 10.749329 22,i 3708 31,6 3
3.53i,, 0.12800001 0.358518 18
soy_Oa_547 NO 10/49329 13428512 VON 26 3 3,53$:.i 0.175
035, 1 18
soyfia_588 1200 1'181 31.5 0 3.83 2
5.3180141 02160031 0.608'4 8
140
Date regue/Date received 2024-01-16
soy_OGL_1306 300 1170864 = 175 31,1 25 1 3.311 1,
0,1 ;99998 0.57921912 14
soy_061._1310 310 2.039863 4.488107 1 31.21 3
2.905505 0,105 0.5910E2 13
soy_Oa_1342 107 7.1417031 23,31312 2320 25.01 2
18.97870 0.153 0.72815711 13
8oy_OGL1593 1400 5281703 2.143511 35041 27.92 1
0.56343122 0.138 0.7014905 18
soy_061._1.11 1547 5281703 12,023211 ; 2196
1 4,0281311 0. 9999 0,68'K (2 15
soy_061_1616 140 1.131759 39261,; 35129 217 1
20.237619 0.184 0.39871537 8
soy_OGL1620 1541 1,1600796 3E.* ;* ; ; 729 2 164;1
0.153 0.411 04 1
soy_001._1645 1400 1.0183088 251011428 1391 24.64 4
13,197153 0,183 0,59004705 21
soy_O3L_1641 ZICO 7.0483088 23,1. 12618 77.95 3
11.689715 1.012999999 0,591116 21
soy_OGL_1900 000 94963474 18.0125 11*1 24.68 7
11.013497 0.16 0.64954721 11
soy_CGL_1916 11.715036 10 328134 14722 21.78 4
3,4388063 0,134 0,48464611 27
soy_OGL_1988 335 8.0979553 25,257W 9744 2153 5
3.2884071 0.101 0.46221101 19
soy_OGL_190 1228 1.018448 211288744 10614 21.85 5
9.4129648 0.184 0.46813119 19
soy_OGL_203 210 3.1L 773 30,444445 11294 71.96 3
29.05121 0.081 0,397 3
soy_06L_2324 711 11.537634 22559315 7471 25.86 4
5.500103 0.011999997 0.5203231 15
soy_OGL_2325 2482 11537634 2/.07494 ;*= 3.83 4
5.5001063 0.18000001 0.52013481 15
soy_061.3355 1930 2 ; i"939 E947360 2362 24.84 1
0,20712424 0,149 0,2053518 13
soy_OGL_24 ; 25/2 6.0134031 1497006 21893 247 2 27.01I1
0.11900001 0.53234017 25
soy_OGL_2614 2233 8.56392 24,774167 20237 28.88 3
7.6726513 0.15000001 0.50403494 23
$0061_3052 100 32.517826 11368421 18117 2E31 2
0,1126/93 0,134 0.5. I 4
soy_OGL_3059 120 12.11379 19, 11124 21.66 3 10.63656
0.178 0.4911013 3
soy_00._3078 1900 0.60136071 13,78074 21832 3.21 2
0.3k*) I* 0.20 0.22142391 10
soy_OGL_3087 1494 1,0152045 2E171352 II X7 2 6,441017
0.081 0,28211615 6
soy_OGL_3418 le 0.4680596 37,791496 27061 2173 1
19.78811 0,141 0.53421845 6
soy_OGL_3854 1795 10.560259 11,14361 1811 2123 7
10.48702 0.111 0.27942491 18
soy_OGL_33/ 2430 0,02/143367 23,41 13164 24.25 2 4,51i
0.024 0,4i ; = 8
say_OGL_3911 1700 9.3106687 2.882328 µ0 1 X64 2
0.7746707 0. ; 99997 0.793531 22
soy_06L4216 1165 4, 0'1444 11941019 1324 25.84 5
5.3800344 0.134 0.25340 23
soy_061._4734 1300 1.3152759 14,692311 39119 25.92 1
14,7s 0.141 0,15031909 9
soy_001._4735 10 1.262759 34.57143 36919 22.78 1
14.711 0.00000004 0.15021 9
soy_OGL_554 20 6.5931026 2E715128 W9 19.14 5
10.150006 0.134 0.60710613 13
141
Date regue/Date received 2024-01-16
soy_00.,5078 21050.32877564 47771135 2/d05 20.96 1 0.01417108
0,183 0.4146761 4
soy_061_5107 1600 6.100357 12,6815 24814 25.3 6
0,54625005 0.1 9999 0.2911 8
soy_06L_5133 1100 3.93869 22941171 21 3.76 2
22,635124 0.7200001 0.61, 17 9
soy_OGL5156 2700 3=906 18' 24322 25.11 1
3.532383 6171 0,77 . 3 19
soy_061_5157 1254 6.310122 23.3031 21.35 1 16243546 0,13
0.781 21
soy_OGL_51911 2111 113E328 12174325 11881 2E81 3 18.651997
0.131 0.9655157 14
6001..5646 2400 9.1" 301 17.625 14465 27.5 5
8.9514186 0.18100001 0.53610114 17
soy_00._5727 2300 4.60037 16217311 22936 343 2
33,2233 018700001 0,5731184 5
soy_061...5735 1173 4.9124145 21729753 16455 21.73
1 0.7241438 0.23199 0.65991E5 8
soy_OGL6053 1400 1i 1891 125 30016 24.28 2
12.860514 0.1 '99!" 0.1M 6
soy_OGL6093 1104 0,89722927 11,61327 6939 21.21 2
0.36923388 0,133 0, .1.... 6
say_061._6214 1100 66037278 0 29333 24.94 3
10.153718 0.154 35 29
say_O3L_6354 1600 51497817 36.9315 38385 28.06 1
0,3447381 0.061000001 0.87572765 17
84_061...6673 340 9.935132 24.1 ' 1. 9 21.27
2 3.3256476 0.12800001 6012364150 27
soy_OGL6s 2300 7.6147938 12.21731 2169 2(13 5
33.670317 0.145 0.021964621 20
soy_O6i_6703 205 01472784 0 3356 3.11 1 60005.
0.125 049371275 6
soLOG1j711 1100 23221162 128,4 35E3 19.29 1 0,21;
0.125 0.6571113 8
soLOGI._83 1842 r89J 26613188 1305 3.07 3 20. 17
0.169 0.72134829 23
soy_OGL853 2300 4.8E2522 26173014 5262 3.78 4
37.614822 0. H 0002 0, 1Y = 14
80LOGL1822 135 8.2052183 22.271063 19149 25.56 6
16.013433 0,147 0.7663572 25
soy_OG1_232 1700 13.338867 25.53111 1311 21.05 3
34.384678 0.15700001 0.62522417 41
soy_06L3143 2200 111, 563 24045154 14729 21.18
5 61601712 0.071000002 0. .; 28
soy_061.)318 1400 10.39937 28 7874 3.92 4 22.. 1
0,199 0.75291246 13
soy_061õ4 +' 1E0 12162311 38,46154 12758 23.15 2
2.6295288 0.177 0.71067101 26
soy_061_5342 231 1.1243448 28.803156 4077 24.41 6
25.42353 0.03000003 0.5200364 . 9
aoy_OG1_2185 1638 9.8723383 26,26/879 11235 /69 6
4.263367 0,138 0.79561461 30
soy_CGL_5964 1E0 332 28.307692 21.23 8 5,,
0.19499999 666733164 20
soy_061._133 300 5.1550312 6.9130135 11i 25.86 5 18.130026
Om, 0.78951525 29
soy_0a_2500 1514 7.4874678 19,881109 24.04 ,5 11,. 75
0.132 0,, 18
soy_00.,_2531 137 4.4041961 32.017915 19.1 6
8.770051 0 99999 0.74310142 19
soy_001...283 1154 5.5548873 1.9384265 12364 18.47
4 8.042365 0.138 0.6616393 22
142
Date regue/Date received 2024-01-16
soy_Oa_4240 1181 19723435 32.260E6 5842 1179 8 2.87 IN
e 0,1500001 0.2751481 31
soy_01_5180 1709 14.850507 3.978935 13331 25.39 5
3.5211779 0.000003 0.90364504 17
soy_OGL_473 136 6221934 17.05/1 5/05 2164 6 4,82331
4162 0.53430182 25
soy_Oa_1455 . 1200 789 416, ; 17052 2175
5 8,1625299 0,200001 0.91609341 31
soy_061._3687 1300 1.565667 18,538462 11470 338 6
8.6794538 0.15019999 0.90339 15
soy_00._4316 ZOO 6.631041 3,6500001 4341 3.2 5
21,347528 0,044 0.5279389 26'
soy_081,1908 1713 14.749738 31. P le 24E6 /.65 6
5.0572111 0.121 0.61745411 13
8 081_3775 12/7 1185534 25.6r, 2115 7 10123025
11500001 0,71 44 21
soy_061._166 110 1.9087936 16.454546 3307 71.09 1
6,6193571 0.t 110002 0,72573495 8
soy_081._167 1100 1.9087936 31. r 20007 219 1
6.61935/1 0,106 172584683 8
soy_001_458 1818 4.031258 18.423155 1051 369
5 4,3419032 0.1 U.9999 0.565056 16
soy_OGL_854 1000 5.031836 304 I'Y 3.6 3 18.;' 1
O. e '9999 0.59444529 14
soy_00._1994 63444653 24.96515 29351 1167 3 2,1
7 0.1 9917 0.45259503 19
soy_00._3065 1 13119327 26.3' A+ 2/42 7281 3
4,08; 0,092 5
soy_0131._3421 191 0,8430994 21.1,, 25024 251 2
1,851 0. 9999 0,40824127 5
soy_00._4017 1616 7.057925 23.1, 20784 22.67 1 2.18; 4
0.07319919 169131426 16
soy_081.,5082 1247 20.251705 23,5 16300 24,69
2 137830243 0,106 0.39'' 73 4
soy_061_5131 1476 63039489 30.14. .9 2418 3
5.8196912 O. , 10001 0,6536039 8
soy_081._1 .s! 1548 8.2513695 12.015501 1939 26.42
3 4,Q7I4 0.11 649155205 25
soy_001,275 1744 4463285 2,40 r 20712 211 4
19,453114 0,051 0.02731467 12
R1_081_3398 1573 2.8835902 22.059759 9125 23.58 7
23.053424 0.092 0.6953736 18
soy_OGL6716 1016 2.7221162 0 3753 20.81 1 1222:
0.111 0,65714628 8
soyfia_400 1402 8.1793365 19.71425 1 . 1128 4
10,513146 0478000002 0,7 26
soy_01_1 ; 11111 7.132494 27.86434 17473 3.21 3
18.67334 0.116 0.6583 18
soy_OGL3. 1774 10,036083 11.83 6210 27.5 4
30,001681 0.057999" , 421071244 24 .
soy_00...4161 IX 16214922 3634 2801
1191 5 7,5592118 0.159999 0,17. '1 15
soy_0GL_496 1400 161452 21.9285/2 4441 a07
5 23,518349 0. r, '9999 0.47624776 24
soy_00L4686 1141 10.8/0666 44691633 24189 3109 3
2.3219402 0.045000002 0,63.(- 40
soy_081._3=1. , 1010 18148384 18.875 3018 2525
7 11,513681 0,182 625557043 19
soy_OGL_1340 130 1.931037 0 1463 2478 B 1.7481443
10001 0312222 12
soy_06_3435 7/27 7.3611013 0 11857 2546 8
50,337318 0.142 0,54 t 13
143
Date regue/Date received 2024-01-16
soyfia_3470 1890 82E6069 2.73E333 1349/ 16.86 5 2.8540747
0.133 0.63255203 25
soy_001._4269 1., 4,1622143 4.01653E 12143 E.52
6 6.7" 44 0,149 0.39. , 18 28
soy_OGL_5354 1900 2,9911871 1,473642 8415 22.78 4 9.9!
0. .10001 049296105 14
s (4_00,5748 1091 13413713 0 13E8 13.82 3
5.3990297 0.171 0.72106701 14
soy_031._6211 1511 64037278 41694241 26944 2118
3 9.7:i 021E0001 0,86891752 29
soy_Oa_6321 1E2 9.49E562 0 1E79 2109 4 4.8501E3
0.163 0.93124419 18
soy_001,1984 1 9. '! 522 14 2082 28.06 4
13.0614 0.800001 0.4710372 21
soy_Oa_15.5 1200 5.5040874 20,91 15128 23.66 5
2.300E39 0.2E30001 0.69191112 11 .
soy_Oa_3422 1785 0. ci994 6.6274E 23340 2123 2
1.851, , 0.17399999 0.4083E41 5
600/61_1601 1E8 5281703 0 21574 20.89 1 18.61 ,
0.156 0.68E2262 14 =
soy_Ork_1999 I, 7,0577431 11,55624 11722 21.8 4 2,511
0.22400001 0,44319187 15
soyfia_2331 1E0 61192159 9.647r 7298 22.94 6
5.9548397 0.159999 0,49474311 4
soL06L310 1300 1.1479118 11384615 29225 27.15 2 0.01692008
0.108 0.4129E43 7
soyfia_4034 1400 12E419 14142858 21E5 245 1 6.4727707
0,17 0.54184228 3
soy_Oa_465 1034 10270666 0 31367 214 3
2,3279402 0.15000001 0.6385541 40
soy_00._4736 1375 1.3E2759 17. 24744 23.27 2 9.51',
0.205 014941993 9
soy_0a_4741 1 1.3662759 08181193 34040 117 1 11.856342 0,17 0,1041915
3
soy_061._4777 14ii 6.54E3987 17.41 71 13015 22.06 3
9.6603918 0.2 0.8567332 4
soy_060_5709 1830 6.578464 15.628415 8091 22.73 2
7.3E411 0.183 0.096362837 3
say_061._5940 1200 29.318493 0 22143 28
3 2.8638413 021799999 072558165 23
soy_01_6023 1484 1 773 8.5579519 20159 23.38 3
10.079192 0.13600001 0.3891 14
K4_001_6423 1100 11 9 11.909091 18544 25.72 3
6.732/8E 0.20999' 0, 0.5440E45 33
soy_00.,6680 1121 9.40E839 14.468382 3622 27.77 2 2,7664933 0.176
0,01 25
soy_Oa_6668 1E1 6.142E15 22.243713 '. 23.85 6
23. 0.167 0.024979337 18
soy_OGI.J687 1100 6.1426415 31.09101 13548 25.72 6
23.564967 0.204 0.024870763 18
soy_01_1304 1810 1.8215753 20.883E8 2438 /87 2 72.7174
0.211 0.57. .1 12
soy_OGL3375 1249 11 937 26.741394 11 24.57 5 36.17532
0.205 0.7516E02 13
soy_06_6659 1087 15.682825 31.922724 2546 2179 10 6.8296838 0.226
0 1/
8oy_OGI._4019 1990 7.0647925 0 21.57 4 2.5
0.054000001 069 ei 16
soy_Oa_5361 1550 9.3E08632 16, = . 7198 21.8 8
9,5277758 0.156 0.59821469 9
soyfia_1948 1500 24208584 7.4 . 7043 25,8 6
3.71 0.132 0.52205E3 16
144
Date regue/Date received 2024-01-16
soy_01._5065 1482 5 ,1 674 15384615 4115 21.86 5
1.9739037 0.139 0.565E8 6
soy_061_2368 1141 3.9981964 19 719543 12278 20.85 2
6.2265E4 0.12099999 0.1017917 10
54_0GL...2377 118 0.7/929288 11 6706 17.4 2
10.1E65 0.14399999 0,55777109 2
soy_OGL2831 K, 5.5548873 4,9062017 1960/ X78 5
7.9315115 0.974000001 0.66211938 22
soy_0GL_5720 1300 1122605 9.2307612 13816 21.84 3
02847045 0.14300001 0.47 '7 7
soy_OGL_6048 1212 21657593 8.2503249 18315 219 2
5.04. t+ 0.108 0.19643E8 9
soy061._6370 EN 1.1393538 10.77348 32697 23.48 2
0.59,v. 0.119 0.63070 6
soy_091._884 244 8 815 27,93E11 E31 121 6
10.633586 0.167 0,64 - 8
soy_OGL_2314 2100 7.41575 244. 7E9 X85 5
9.0/62024 0.14300001 0.55283946 17
Ny001_2716 147 4.6E632 11.7 3051 28.84 7 4.4625683
1102 0.4466213 23
soy_OGL_4364 2200 7 , 1838 20.5941 11, 186 8
25786703 0,193 0.51230 20
soy_0GL_6145 7E2 7.3E6766 31524357 2340 X16 3
0.1855005 0.14300001 0.7756E1 17
soy_061_31E 1480 10353642 30.785715 7535 25.64 3
8.186414 . 9999 0.55779552 26
soy_OGL_6113 3127 1,5760107 3.4210102 2931 28.23 5
12.577261 O. 3E2 0,71180075 3
soy_061._474 321 6.121934 16.724391 7065 35 8
8,7325516 0.12 0.53176129 26
80y_00._2637 1200 7.9126515 33.083332 4452 24.08 6
7.14. 0.189 0.5580486 21
$001,2692 ,. 9.1915058 20.1107 t 27.6
8 59151450 0.1"9999 0A8456752 22
soy_OGL_2736 1930 6.8346286 31,7' 74 34.57 8 3.70014
0.177 0.40786713 18
soy_06L_3013 2000 12289925 27. 3235 259 7 1.2276733
0.103 0.6740213 11
soy_OGL_3133 1722 8,1150887 27,4806 2001 Zl 4
6.0131369 0.1E99", 0.55501E 24
soy_OGL_3;.1 148 9.8148384 24,931881 1001 75.74 6
0.69444478 0.18000091 0,4, 2 23
soy_08._492 c 81126404 28.884058 6361 21.37 6
5.2647204 0.169 0.70491385 26
soy_061_5938 1634 1.4355073 31293758 9984 25.33 7
7.819572 0.17200001 173681122 22
soy_00._6336 UP 5879897 39.4 9358 24.61 3
10.131111 0.212 0.902103 28
soLOGL5738 1410 13263012 28,1,106 2075 23.54 3
0.3217134 0.1100001 0.68725723 14
soy_06_168 SO 1,9087936 3213E35 20107 E 1 6.6193511
0.184 0.7254678 8
soy_0GL_504 2153 4.4821186 27 217136 8317 27.91 5 3,7
17 0.146 0., . 11i12 23
soy_0GL_509 2213 4421186 14,053321 4660 29.91 5
9,4460554 0.1 0.45832431 22
soy_06L_527 2163 2,3637695 9.061441 16275 30.28 3
0.721 . 0.134 0.410E271 12
soy_OGL_839 1E9 5. 59 31 47045 6418 2142 6
1.6754E3 0.153 0.65231735 15
soy(a_1301 2358 1.5215753 55131 31538 3179 2 0.084305748
0.133 0.56809/35 8
145
Date regue/Date received 2024-01-16
soy_OGL1617 227 1.131759 20.7 6166 24.42 1
1.7349792 0.132 0.4013279 8
soy_OGL_2370 1400 4.1625123 29,071428 2E2 2821
2 0.028759131 0.01" 9998 0.099165142 6
soy_OGL_3034 7.153666 31662453 532 23 1
0.19352168 0,229 0.71 19 6
soy_001._4040 313 0.4582673 24.297449 222 25.03
4 8.340618 , 4997 0.42546874 10
soy_Oa_4067 1345 125801 30,9 723 24.83 4 2,8227994 0,161
0,51614004 18
soy_OGL_4204 7 3.197732 20,75374 14179 2108 5
6.9959784 0.2 0,2211 s 2 19
soyfia_4251 9.7208376 11.91, 1' 3010 2126 6
1.8767226 0.108 0.304E79 14
soy_OGL_4739 1186 1.3E759 32.041414 9129 /51 1
11,054619 1146 0.131 , 2 11
soy_061._5099 1801 8.4C6477 26.76309 7215 24.93 3
2,1648073 0.15/00001 0.088501026 5
soy_OGL_5119 1900 4.1253789 29.94732 1312 25.89 3
1.61254 0.18000001 0.38078424 13
soy_OG1,5127 1510 1.3629088 22,727212 23360 36.29 2
9,5343218 0.105 0.58761337 2
so7_0(1_5733 125 0.21211389 19,34502 21495 2141 4
9.8207941 0.063000001 0.6451925 8
soy_06_6059 3004 2.0422838 24.467371 21973 32.29 2
5.6778218 12E0001 0.0558224 12
soy_OGL,6087 122 0.40784842 31.75 1' /33 3
3.6954246 0.18700001 0,41711571 3
soy_0GL_6715 - 1349 2.7221162 36.1 , 32143 27.42
1 2.604495 0.19400001 0.6569152 8
soLOGI._27913 1305 31879214 31.541218 26275 24.87 1
2.7024755 0.1 "999 0.17261888 4
400,4119 1019 7,7E329 35.84 , 1572 24.02 3 10059. 9999
0.79822719 26
soy_OGL_4196 El 3.1617231 27.220425 5893 25.99 6
1.311E8 0.046 0.21 19
soy_061._4409 , 8.125645 22.42E7 10573 119 5
3.9247718 0.104 0.56113619 25
soy_OGL_4760 2140 0,84740651 32,15212 3821 2.23 1
19351781 0,163 174142903 5
soy_OGI._5120 1/97 4.134584 32.913791 221 2164 2
0.372; 46 0.161 0.3817337 13
soy_OGL_6403 ti I 61150654 34.125 5447 /12 5
4.5854707 0,18799999 0.47604614 16
soy_a_2243 121 7.322978 3175322 2114 22.9 5
9,7351145 0. 's ' 9999 0,681213 14
soy_OGL_91/ 2ri 63260517 26.651141 1/633 30./6 6
4.83; 0,132 0,6;' 28
soLOGL_918 120 63E517 29.533333 14497 133 6 4,831
, 0.169 0.6506819 26
soy_01_134 1139 7,2529912 319' ;1 , 1 , 2144 2
18,978703 0.1E0001 0,72913414 13
soy_OGL_4190 2127 5.3633652 11.8011, , 29.38 7 7,6 114
0. " 9999 0,20 21
soy...O6l..4332 16 6.1024008 33,37: 1288 /288 24.02
8 4.2601452 0.146 0.4464521 19
soLOGL4763 ti 6.1066917 37,9315 1, 2812 2 30.5445
011900001 0.80818021 7
soLOGL5742 130 11E0522 27.923017 957 27.15 5 4.9611
11E0001 0, , 7 16
soy_06L,5967 120 75982332 29.736911 6910 2173 6
10,515461 0,104 0.6621275 15
146
Date regue/Date received 2024-01-16
soyfia_399 1393 8.1701508 28..' 105 25.69 5 9,2546844
0.161 0.759130 25
soy_Ca_3134 1700 81E642 39,23534 24.35 4 6.3981316
0.197 0.55735125 26
soy_061,_2788 1700 4.243212 27.64/0 42/8 N 6
1,3534534 EP -999 0.21804 . 11
soy_OGL_5129 1400 6.3039489 31.785115 10156 23,5 3
5.81! 2 0.13 0.65343911 8
soy_CGL_5695 1357 1.387786 28,887251 23.87 1
14.639076 0,113 0.41/ 13
soy_00._6155 1112 5245831 18,131 18917 27.1 3
7,2431712 0.1 110001 17
soy_00._486 1403 4.1801826 31845333 1367 24.37 3
1.37 .!N 0. 1110004 0.50920251 17
soy_OG1_1308 1869 1,1E3864 26,055115 5857 2.95 2
4,3 0.066 0.59019161 13
soy_O3L_1319 1101 0.24154867 25.71( 1. 1E40 2.52 1
1078865454 0,131 0.6193515 14
soy_OGL_3080 SOO 0.;036 32.315 2451 21 2
7.820918 0.1, (1 0002 0.24502492 10
soy 4L5639 1100 12410429 28,272/28 2319 2513 6
2.50337 0.125 0.5439808 17
soy_00._6022 1 17T3 22,972174 21143 26.99 4
7,9570532 0 0.38921937 14
soy_OGL6381 11953118 25.43413 11q, 24.32 2
8.1805372 0,048 0.3519087 7
soy_OGL,2327 1512 8.2941523 27171155 03 24.61 4
2.3475461 1124 151797897 14
soy_Ca_3119 1161 5.1961874 30,915195 1001 24.69 5
8,4402161 0.081 15 15
soy_Oa_4764 1500 5.11 917 30,1. 1334 24 3
21754265 1120001 0.81.' 6
soyfia_6395 1410 6113654 33,01143 436 2.5 8
16.02133 0. w999 0A6563077 12
soy_Oa_563 1400 1.'...153 20,9285/2 3.21 6 7.311.
0.105 0,4' 7 20
soy_00._890 1400 8,0151517 15 5811 22.07 4
6.93001/6 0.123 0.66013514 21
soy_00._5650 1219 1N 297 32.911852 13465 23.37 7
11.2 41 0,114 0.52911105 18
soy_Oa_5681 1300 9 -5 3730 2418 3.61 5 3.9527252
0.171 0.464 .1 14
soy_OG1_1589 1753 1281703 16.71125 1001 24.87 5
19.030168 0.142 0.73010117 9
soy_00.,416 368 3415179 10,1004 225 21.01 6
0,82826314 0.11299999 0,211 10
soyfia_1292 1900 6.4559865 14.57804? 3.68 6 24.1 0.13
0.64475441 15
soy_OG1,147 1112 1,313149 7.2429105 1112 2109 3
195013291 0,13600001 0.67611695 11
soy_Oa_3099 2010 1,1419118 2.9353235 14146 219 3
5,47 0.077 0.39951476 5
soy_Oa_5098 1841 1.4158103 131590 13017 3152 5
2,8900735 0.1(l4999 0.085949935 5
soy_Ok_5754 1280 6.06777 21 12026 2166 3 4.07073
0.178 0.1591;; 15
soy_06,6061 1241 Z0422838 20.225 ;;; 2184 2
5.677278 O. 9999 0.05572827 12
soy_OGL_6305 1000 1.49986 28 35129 3.2 2
1.8399013 0.20900001 0.34145 . 3
soy_Oa_2764 1107 3,2010031 11.540714 4851 21.35 5
11.330 0.018000002 0.3 12
147
Date regue/Date received 2024-01-16
soy_001.305 1010 1211379 2425/425 12625 25.84 2
5.9110146 0.12 649249144 3
soy_001_6020 1500 2.3629057 22,0 , 4516 25.46 5
19,742116 9999 0,39511856 12
soy_00.3720 111 2.1721162 24,1062 13166 25.38 1
6.73 n? 0.114 0,66t 10
80y_Oa_2808 1100 1.0325171 34.81818 1245 25.27 1
32.910032 0.109 0.35491/07 5
soy_Oa_855 1 , 5.0917836 16,14', 1 31.73 3 18, 1
0,024 0.594315/7 14
soy_Oa_6414 1200 11.411439 14,91E7 11405 30 5
2,5536406 0.1, 9999 0,53r 1 26
soy_031,153 1512 4 , 654 0 55Ã6 21.62 2 4.5511,
0.134 0.681152191 13
soy_061_447 1014 5.0306467 0 25413 2122 2 0.612 I
0.132 0,6045151 12
soy_OGL_130/ 1011 11163864 2.6743076 23392 aoi 1 3,31li
0.119 0.57Il3 14
soy_Oa_1906 1615 21127859 26.995075 2816 33.13 9 20.41 ,
" , a 9999 0,62 I' 13
soy_061._3178 1413 13249586 31,847131 7428 24.55
7 2,4444396 0,183 0.6527/516 24
soy_Oa_5595 ai 43595667 32.107143 2240 2417 9
40.722958 0.051999998 0.65579695 18
soy_Oa_6525 2201 21,291258 33.530212 5219 21.94 4
5.1091422 0.19 0.71314/16 16
soy_031,3502 1610 41.000048 25.291111 4491 31.42
6 1,7834482 0.1 41991 071742034 21
soy_Oa_3510 1460 41.603048 29.71425 3330 31.28 6 01645057
0.123 0,72754461 23
soy_Oa_5311 1'11 11329891 36.891131 8511 26.42 7
6.0563107 0,14300001 0681 ,7 21
soy_0GI._6753 . 10211542 32 1143 2126 5
29,763126 0.123 0,73768336 32
soy_Oa_6801 , 62192668 8.69230/5 + 2613 B
140.3575 0.015300003 079624516 22
soyfia_561 2260 21.124374 17.318182 1819 31.09 8 6.647234
0.111 0,32300801 18
K1_00...3038 152 48.141987 16,727942 2/.63 3
34,836491 0,234 0,6i 12
soy_00._4361 2153 5.1334582 34.4N 4119 28.37 8 53.
0.191 0.5013773 21
soy_061,1718 2311 34.12348 17.263102 4425 19.2 8
262.189/6 0.04599' , 0,837r, 25
soy_001._3042 1/19 4342528 351691
1013 31.41 5 29.241043 O. 0001 0,6790515 12
soy_OGL 3495 1314 47 M1048 24,702331 13037 3.59 5
34.229294 0.177 0.710517 17
sol_001._4110 1030 61.380577 21.9535 4052 323 8
21.569421 0.14 0.1558564 7
soy_001.3309 2499 10.026672 22,609013 56 3205. 6
98,548611 0,1 9997 0.96912127 14
soy_Oa_3041 1121 4322528 24.2991/2 12E1 25.35 5
29.241043 0.19100001 0.6792531 12
soy_OGL_3112 150 12.822569 24,421053 6292 3126 7
48,784161 0.1, 44001 0.64465207 21
soy_00._6521 1382 21211258 30.53505 2341 2192 5 11934219
0,118 0,7149626 16
soy_Oa_1951 131 11.51387 32,08435 2031 2123 9 18.22419 0.17/
0.64630193 10
soy_Oa_2415 1315 11.57738 31.939163 301 24.33 5
25.778419 0,1300001 0,71084511 30
148
Date regue/Date received 2024-01-16
soy_061._5310 1300 18329891 33.2307/ 5381 23.61 7
6.0563107 0.177 0,68210363 27
soy_061_5764 1554 11E8831 21726343 3179 21.42 6
15.051555 0.112 0.78961123 20
soy_061._6751 IX 21103409 32,91, . 2181 29.75 5
7.5691195 0.11 0.73581336 28
soy_061_2614 1404 11232581 35E621 4127 21.36 10
21762367 0.15800001 0.49218678 25
54_061_52E 1290 3113139 30E97674 23.33 5 23,7; 0,131
0.73397624 23
5(1_061_3495 1100 41 liii 17.818102 1i ; 29.18 5
31.906487 0.117 0.710E31 17
50061_213 1616 1H95701 26.361385 4917 2/.16 3
13.415797 0.01E0003 0.82146/04 27
50061_19E 1638 24.549034 24,358974 3319 2187 7
4.25 0.1 0002 0,5 1,,, 16
50061_2280 1800 11338867 27.555555 5242 30.16 3
33...,I 0 0.6 42
sby_061_5619 1500 3.539919 20.200001 7421 31.33 5
4.1,.-#1 0.071000002 0,625;;'7 22
5(1_061_3834 174 7.7E1862 22,644377 4144 31.66 9
5235/771 0.167 0.54112017 25
soy_061_1025 1341 5.5469222 32.736163 7199 3.84 10
85.8i 0.145 0.8 . 29
50061_711 1400 8.4636536 24.071428 9128 3.85 8
48.681385 0.178 0.8474E65 23
50061_3049 1100 , '179 20454546 6278 2E72 3
1,5717312 0.244 0,631 2
soy_061_4 310 5.509479 34 28.3 9 65.369675 0.17200001 . 21
soy_061_5141 1300 29.346493 8 10143 31.46 5
3.5833595 0.115 0.72496939 23
50061_985 1227 9.0324665 38,30481 33 21.84 9
194,09158 0,176 0.77136374 32
soy_061_1721 1919 31.72348 24,679323 9134 = 9 232.;r 0.117
0.83819854 25
soy_06L_3541 2163 1162E7 34.99 3012 32.4 7
147.04/12 0.17299899 0.79022332 24
50061,6419 1200 10163449 17.5 2231 27 6
20,151438 0,139 0.54211769 33
50061_5759 1E 14.102677 30,444445 NZ 2161 6
9.6564511 0.121 Out v; 13
soy_061_6761 2173 10.113653 23.653934 3742 29.26 5
5.4842174 0.37000002 0,74222335 31
50061_938 1500 12,449766 37.733334 7819 27.53 8
9,2474375 0.153 0.70957142 28
soy_061_1575 911E3494 29.1815 5146 31.56 5 43.07 ,
0.15000001 179617262 28
soy_061.2295 1377 9.7430394 39.651417 4257 26.36 8
19.807732 0.161 0.6042E25 28
soy_061_4614 1751 11870666 3813053 6912 29.18 4
3,006197 0.17399999 0.64076471 40
5(7_061_5627 24.815081 31.813146 2066 31.7 10 8,7 1
0.117 0,60539166 16
soy_061_6754 1905 10217542 34,760/01 0219 13.14 5
29.763126 0.15700001 0.73775755 33
soy_061_77 1E0 9.6698225 18,411/64 3102 E.94 5
15.03484 0,088 0.80050302 26
soy_Oa_1736 1E4 11.655291 25,511513 7016 29.09 7
15.562757 0.106 0.86. 13
50061_1927 2414 14105339 26.6 31.89 5
5.4319173 0.1 1, 0.55343461 26
149
Date regue/Date received 2024-01-16
soL06L2625 2/2 8.794776 33.916094 6434 2152 9
17.67 0.146 958034611 24
soy_00(4410 2021 8.6647367 33.349827 5164 X39 8
41,276947 0,186 0,5777E016 17
soyfia_5313 1/4 18329891 35,830642 '4 X49 7
4,2586493 0.15800001 0,68057722 28
soLOGI...5897 3163 11121329 33,096745 10720 28.45 8
56085744 0 0.87685364 31
soy_061._5 4, 1707 28.910582 3837141 3047 292
6 2,7672619 0,177 0.7522/72 15
soy_OGL4 2100 8A823227 28.857143 4432 /.52 6
23.2, 0.1 100D2 0.8k 24
soy_OGL5 1003 18329891 2438 2717 3233 4
8.5175724 0.1 .1 0002 0.68601120 30
soy_Oa_1390 1311 6.9431424 30,816172 6340 X62 6
7,5768118 0.123 0,808" 33
soyfia_2267 IV 9.122251 16.9' 1 " *12 6
3.9890997 0.111 0,6358E5 43
soyila_1541 1410 19113004 32.142857 6933 27.78 7
14.763446 0.115 0.85917975 30
R061_3141 I 12.681842 24,611111 2946 3916 9 9,9564734 0.1 0.5650107
29
soy_OGL_4916 1191 17.460024 32.913517 5815 28.71 8
16.693867 0.11300001 0.7804151 22
soy_OG1_4667 116 8.714469 25.287355 6333 27.84
8 14.779904 0.019109998 0.60' (6 35
soy_061._5628 1, 24.815081 27 242 le 11 11,1
0,037 0,60427201 15
soy_061._3367 1800 11.584485 31.111111 1064 7/88 7
30.5828 0.018999" 0.7815521 10
soy_OGL1 1* 9.51515 33. s' 9168 3,11 6 15.43951
0.1 ,'!9' 0.92659191 30
soy_OGL3045 1* 32217867 39127212 34 28.9 4
1.191 0.118 0.66907445 10
soy..091_3233 13/ A, 296 37.911301 535/ X1
4 18.3 0.1 0.7237141 38
soy_OGL2613 1500 8276789 31.333334 1379 3986 9
62.81 = 0.125 0.591 23
v061,2672 153 6./34031 31.772152 VO 2105 8
48.160/2 0.15099- 0.50570/1 23
soy_061._5857 1* 8370719 383 l X45 8
6(1290184 02 0.9457E7 18
soy_061..557 2282 227 22217354 21.38 8
15.432343 0.15899999 0.32503/5 18
$061_2619 1511 8/86056 23,815104 25.89 7 3039316
0,131 0.5141 1, 23
soy_091._6288 1775 4 1311 15. 5143 2552 3
54,334961 0.112 0.91601052 25
soy_061...70 1900 11,427641 17.947369 11134 3942 4
4.8 0.061000001 0.81985455 31
soy_061._2665 1912 6/34031 37.170387 1162 22.17 9
29.879412 0.1/00001 0.52342057 23
soy_061_3048 BO 32.134468 21333134 331 X4E 2
5,1259212 0,176 0,6373 '; 2
soy_061...552 1332 11677822 28,v. 9619 24,62 1 .
9.4437119 0.17200001 0.33481639 17
soy_00.348 1375 62E626 24,072727 19571 29.89 4
24,76137 0.104 0.75542953 29
soy_061_1305 1763 1.5215753 30,74352 1001 24.78 2
72,7159 0.162 0.57723874 12
soL06L2685 1200 10232581 3111 3127 2516 6
23.647154 0.17200001 0,491 , 25
150
Date regue/Date received 2024-01-16
soy_OGI...301 1300 1 1..968 33076023 6316
16.84 4 30.753051 0.12000001 0.7568E4 22
soLOGI._3037 1472 32.088409 27 581522 11 2166 5
12.912634 0,117 06947'7 11
soy_00,518 225 2.537695 39.81818 16218 21.9 4 137.0137 0.131
0.4271454 14
soy_00._551 1703 18.677822 3315186 8706 27.18 7
9.4437199 0.16500001 0.3350551 17
soy_061._875 81 24122638 33467945 4634 2539 4 76,0,-
0.1 9999 0.62010319 8
soy_OGL_3067 1703 43383347 39E4706 15019 27.17 1 51538152 0.17
0.1294468 6
soy_OGL5136 2207 3.0146505 32.351 4. 1' c. 3072 5
71401242 0.012 17156351 12
soy_06(5340 1000 24.855507 33,0L,J 21', 303 3 21,225416 0,115
15333314 '10
soy_OGL6 2100 12.019349 38.476189 1 I 30.51 6
29.363952 0.14 0.0074- 5 22
soy_OCL3142 1299 10.859563 3103E2 6041 3.17 5
5.1601712 .. 0.155 0,56. 4 .. 28
soy.001.,6436 1;µ 11.181879 21.055154 7710
Z4E 5 7.7375259 0.1 ' 9999 0.55547/79 38
soy_Oa_492 1300 513427 X 11 9 2569
4 37.3i. 1 0.1,410002 0,4841559 19
soLOGL5196 1356 132328 32.079647 16159 2158 3 18.667997 0.113
0.96093 14
soy.,00.,6424 1014 10293449 26.81'N 16765 27.87
4 6,3985171 0,092 0.5444138 33
soy_061._3352 145 12108066 37.64),7 8379 25.5 6
41.25135 0,092 0,82 s 17
soLOGL6526 139 21291258 32.757378 72 2119 4 3.9353161 0.127
171364462 16
soLOOL,325 131 52613763 37226734 4124 21.73 3 87,866577 0
0.82664037 14
soy_OGL_5089 133 3.146672 34.4589,2 2153 2455 3 6.1058717 0.131
0,22572347 2
soy_061,3259 1100 4.8718433 28.727212 333 2581 4 42.123
. 0.219 0.916 24
soy_061,1925 1i 12236749 19,1125 1337 2187 8
23,261513 0,175 0.55736312 24
soy_OGL_564 1160 21.4E308 28.i 5438 252 8 9.4132E
0,207 0,314', '7 23
soLOGL3051 130 32.511826 1.8333334 17761 33.44 3
0.07693483 0.031000001 0,5974E1 4
6061...3376 190 10.919937 13.8 13513 222 4
45,104172 0,097999997 0.75441015 13
soy_OGL_3868 1900 9.8148384 14.052631 2611 21.21 7 32,0703
0.112 0.2 19
soy_OGL_558 130 20.815227 26 7 2161 8 11432343 0.175
0.32491443 18
soLOGI..1260 1100 8.5117651 30.635364 1588 25 6
116.62761 0.12 0.67767972 26
soy_OGL71 1139 10.1E795 13.696 9009 2/48 5 19,5683 0,123
0.81612492 31
sol_061._6421 1 10143449 14.741784 4207 2134 2
52.109713 0.146 0.543E27 33
soy_061._4022 1100 7,0667925 3636363 203 21.3 ' 6
64,452332 0.133 0 'lc 16
soy_Ok_3254 1296 52893763 24.382115 4388 2223 2
128,39332 0.051 0.8 41 14
soL0GL297 1'.1+ 8.1388817 35.333332 1185 2116 7 16.61 0.121
0.9191E4 17
151
Date regue/Date received 2024-01-16
sol_061._3484 1900 5426621 29.631578 7452 27B 7
21,54 '< 0.121 0.64939725 27
soy_061._4230 1716 4.200228 23,31024 d7
331 9 20.532913 0. c. '999 0.26', ' 30
soy_061_910 1438 5922388 33.0312 ',1 337 3 21.9',
0.1920001 0.6776365 27
soy_00._195 16. 10.74993 39.51104 13543 249 6 11.;
0.07200004 0.80353546 22
soy_061_929 1101 11.994018 36.625515 4031 24.5 4
3.8874454 0,139 0.70332021 24
soy_OGL,417/ 1457 10.37288 29.169527 14627 3.71 3
9.0029306 0.1 110001 0,82NeA ,e 32
scry_06L5197 2157 13.332328 34.31 I, 2215 31.33 3
18.667997 0.141 096503 14
soy_061_6213 120 64037278 32,5 , 31933 3321 3
10,153118 0.004 0.86906475 29
soy_n_549 1,11 17.431976 26.3125 3138 32 7 7.0138831
0.121 0,3372269 21
soy_001._2565 142 6.5413885 31,25 11612
31.2 4 46.581635 0. 010002 0.69273424 19
8oy(0L3852 1I 9.9024754 37 7310 2/75 10 26.97
0,107 0,2871 14
soy_001._829 120 9.622899 38.33E32 208 27.55 5 19.251E9
0.F49997 0,726108 23
soy_061._3853 1675 91224754 32.507015 5210 25.55
9 22.39007 0,102 0.28692275 14
soy_06L_3380 112 10.29937 35.636364 4612 24 6
16,953121 0,171 0.75214744 12
soy_OGL_1962 1E0 7.7554264 26.192942 r" 2164 5
8.5045691 0.108 04937525 24
soy_061._2640 120 '7.9126515 32.42857 1425 378 4
10.050557 0, '09997 0.5555244 22
soyAl.,1929 120 15.320704 27,7 ,f 722 3R76 6
8.1030178 0,104 0,55257469 25
soy_001_66511 1.4 13.017652 37.32033 1001 3.44
7 9.7676115 0,147 0,1237325 20
soy_00._6669 1i 9.9655132 29,5625 2074 3.93
7 13.592624 042000004 0,010651038 22
50061_4375 125 6.6361041 31,780n 3079 25,84 6 24.<
0,19599999 0,52756917 25
soy_00...5401 120 9.4738331 21.533333 282 7
20.233E2 0.088 0,7413E66 14
soy_OGL5130 1200 3.8446505 35,6;'; 7032 30.75 5
70.407242 0.1 " 0.71277 12
soy_O61J112 123 5,1327338 42147517 1001 2543 12
13,070252 0.079000004 0.9547293 10
soLOG(.3981 1 ;; 5.9516634 4.8657718 376 5.11 11
6.491572 0.092 0.892 24 14
soy_Oft_6293 1345 6.241422 13.92346 1001 327 10
4.7985878 0.175 0.94773161 22
soy_061,6268 1347 6.712124 12.175201 3033 3,2 11 6.7974467
0.15000001 0,9258029 30
soLOGL6572 150 4 t.. 28 1625 3459 321 6 2.521022
0.12 0,78lI 31
soy_061._4114 1100 8,1381798 18.818182 2035 23.9
10 3.3870571 0.124 0.7', 196 17
soy_061._678 154 3, , 949 13,351374 1001 24.07 8
7,435525 0.108 0,78165364 25
soy_n_5557 1122 6.151978 18.71 4158 232 9 3.045614
0,113 0.73 6 16
solJEL.5497 1167 4.6145062 13.299317 3111 24.16 8
7.2766161 0.088 0.8484722 28
152
Date regue/Date received 2024-01-16
soy_OGL5797 1 ) 12.976668 4.9375 ma 19.18 ..
6 .. 2447962 0.15700001 0.85539258 .. 40
$4_061_783 1700 10160977 11,8 ,! 7010 18.64 8 3.1558492
0,113 0.92783511 18
soy_OG1_1566 1314 10.710433 140 Pt; 1535 7216 5
12,924914 0.156 0,8173455 27
soy_00._3602 MO 4.9321332 0 2151 24.67 8
5.6593542 0.1, '1 0002 0.874062 22
soy_OGL_3994 150 11.197123 17.533333 1445 19.8 8 5.4i 0.16
0.82703159 14
soy_OGL_4618 1W 7.723742 15891195 3938 21.97 8 7.88(
514399" 0.76549762 24
soy_061._5947 1503 10.45343 7.1333332 146 9 14,
0.1500001 0.7165153 24
soy_OGI._803 1 9.435977 20.691547 r" N 8
13, 9997 0.84216336 21
soy_OGL_4150 1515 1) ; 122 17475129 21 20.45 8
18,99112 0.126 0.87., 24
soy_OG1._5809 1W 12,425729 19.615385 c 23.3
7 81762791 0.142 0.871 II, 37
soy,OGL_5868 1415 7.256718 27.044522 el 2114 10
6.4651794 0,162 0.92ii, 1 28
soy_0a_6905 1900 71606479 17 3211 23 9 4.41,
0.06/000002 0.87,413 23
soy_OGL_4641 1653 1741983 15003925 11450 2487
7 1,259223 0.1,c 9999 0.72', 34
soy_OGL_1572 1364 9275494 2622832 3903 20.08 7
17,513138 0.148 0,80084378 26
soy_00._75 1306 9284447 25.421133 5460 136 B 20,390003
0.1500001 0,80523032 25
soy_OGL_4407 1641 8.9647367 13.418336 4366 22.58 11
32,046447 0.106 0.57367444 24
soy_Oa_3637 250 7.1081796 11.5 531 24.95 6 1.703162
0 0,931 1( 32
soy_OGL_5027 2100 7.1732235 1416 101 212 6
9.8929319 0.0 , "9999 0.6634492 29
soy_061_355 1 4.1718922 22.525 450 2235 6
8.91 1T3 0015000003 0.84840214 40
soy_0G1_2409 1145 11.967738 12151012 2365 23.4 5 2.38722
0.176 010490152 31
soy_O6L_51 1284 9" 008 11.6043 501 293 5 12.427788
0.139 0,85624945 30
soLOGL.786 1917 7.6410537 18.727179 3003 2597 9 8.87
0.074030001 0,89633459 19
soy_OGL_151 1W 5.'1 261 34.400002 3168 21 10
3.7625 0.1599999 0.81020749 26
soy_061.5'.' 156 6152465 20.221 n 2515 2,82
11 4,41iii*, 0.19699990 0,9518553 28
soy_OG1_6331 1211 62954488 32.151480 1176 23.6 4 7831115 a
9999 0.91517629 27
soy_00(1501 1473 7. 1678 17.651052 1021 am 6
11289245 0.118 0.83944756 18
soy_n_4579 1205 5.9374781 20 278 224 7 4.5965711
0.192 0.832554 21
soy_06L_5949 1230 11.51946 0 NO 235 5 1.8585605
.110003 0.11 i,13 23
soy_061._1810 1168 5.850555 20.188191 5015 2027
7 5.704601 0.18030001 0.7831 1'4 21
soy_OGL_4227 593 4.0722065 8,7444849 1041 20.57 10 9.08E424
0 0.26637387 30
soy_00...905 1754 6.4160132 26.71458 4281 20,25 6 13.02181
0.149 0.674-f 29
153
Date regue/Date received 2024-01-16
soyfia_3483 1400 5,43621 12.928572 552 23.92 7
21,541 '4 0.113 0.64933163 27
soy_00._3128 1000 62185674 28.79 224 2t1 7 5.78672
0.19/ 0.5505279 26
soy_00._346 in H 62913775 55 32 24.15 7
5822391 01, " 9999 0,84, .1 28
= soy_00._1544 1633 8.1076202
38579302 221 20.15 10 14,0622 0.152 0.871, , 33
soy_061_3646 1914 4.321098 1 2263 8 1547n
0.07E0003 0,9316784 26
soLOGL2 1915 1129328 1,827263 7A1 XII
7 10,617503 0.1 " 9998 0.89651666 17
soy(21..4959 1394 12,134647 0 11, ,, 19.5 9 9,38128
0. . 9999 0,7 1q4,1, 33
soy_OGI._5749 1217 13.513713 20.7'n'. WM 18.98 8
2,5093875 0,11 0.72 5 14
soy_n_16 11N 11.28102 21.3022 3744 21.38 10
6.7505126 0,178 0.9234269 24
soy_0GL3771 125 12.101471 12.86152 2143 23.2 12
5.51 n. 0.112 0,71891308 16
soy_01_4538 1476 7.1E296 14,2" 2031 22,42 11
6.789E67 014300001 0.7785265 34 =
soyfia_3703 1353 85/20577 19.364376 261 216 7
8.5251007 0.124 0.8431625 19
soy_OGL219 1700 11,379414 3,2941177 3787 1188 . 11
11.393044 0.108 0.82. ? 24
so/061,1164 222 9 n 195 0 1001 21.81 10 14,8
0 0,9288E7 19
5oy_OG1._5472 4.9E315 2,4008081 3121 2t15 13
14,221847 0.06360003 0.87303829 26
soy_061._5770 120 2.915419 5.1075
1369 21.25 5 3.5731845 013899997 0.8123323 23
soy_OGL9 1613 1163537 9.2734795 1395 23.44 7
11.031654 0.2100002 0.95723677 15
soyi)GL3154 2D35 171382 0 230 23.49 10 13...
0.911999999 0,591 nn 19
soy_061._4954 157 12.134647 3.50 5714 2,08
6 9,1550274 0,1 010002 07514258 33
soy.,0k6880 1.1 4.201587 3,6111112 2119 a11 9
5,8 0.071010002 0,851 . 19
soy_061._67 12 12.433825 0 172 22.13 8 6.6h e
0.07E0002 0.82' 34
soy_001J69 1144 13.568718 7.2251333 3192 18.78 7 3.3..
72 0.044 0.76307327 36
soy..001...152 133 7,269011 3.325415 212 24,3
6 3.78 . 0.088 0.88978386 35
soLOGL1547 11µ 7.6185937 5,9730248 1 9 11.519375
0.11 0.86792034 33
soy_OGL2908 1600 10.078434 5. 3785 19.93 11
4,877398 0.n0003 0,97812343 25
soy_061._2916 126 101252 3.8176033 1042 205 9
1,5969754 0 0.90516861 17
soyin_3243 1115 91188437 0 3320 17.66 8
7.0554242 0.112 0.7303E9 36
v4_061...4951 129 63E191 0 221 2t96
11 6.51 0,103 0.7543176 36
. 1443 18.300918 0 52 20.3 10
10,35036 0,87129997 0.891 35
soy_00._6951 i 856577 9.125 2052 2112 10
11,32371 0.093000002 0.9274429 25
so/061_260 1N4 9.1737165 4.3333335 00 22.6 7
9.1721563 0. id 0.8752597 22
154
Date regue/Date received 2024-01-16
soy05...663 1411 6.8420768 0 3042 21.66 6
4.8541915 0.1'11998 0.76945116 33
soy_061,..4525 1100 1. '202 0 5330 11.54
8 5.938043 0,119 07615658 33
say_05._4614 102 10.891823 10.714E6 2881 1529 6
12.711862 0,13 a64, 9 35
soy_Ork5319 1438 114771 0.467315/ 2317 1136 8
611/ 0,12 Ø66671342 26
soy_05_5489 1.1i 4,7314305 0 3418 0.41 7 11,32381
0,046 0.86006439 33
say_05._6757 1492 95510066 0 100 72.66 6
2.1711572 0,102 0.73901516 30
so09.3830 1200 6.5125389 1025 2734 22.16 6 3.218195
0. 9999 0.8107525 34
so0G1õ291 120 11.654118 15583313 2183 23.08 8 6,8018123
0,146 990951546 26
8(1_05_1553 1;i 9.3499543 1t6 1, =si 7111 22.32
10 9,61E47 0.(119999 0.84. 9 26
soy_05._1. 15/4 6.035315 18.170267 2440 22.49 13
11.90235/ 0,114 0.80/51109 = 25
soy.95_3340 190 11818196 0 5072 26.68 8 9,7 1.
0 0,85712445 26
soy_05...3517 100 38.161209 0 4653 1941
5 7.2827311 0.153 0.742137 20
8 05_3631 2100 1,9034634 6.095230 2618 24.14 11 5.841
0 0.92214143 30
8 05..4524 190 7. 202 1,7894137 5996 28.47 9 5.802501
0 0.7614105 34
so05._4930 2074 145184 2,1697201 1589 21.84 9 13.455
0.1c = 9999 0,7670033 35
soy_05,..6215 1903 6,1533623 14.413021 2001 22,39
9 8.7061032 0 0.93141121 26
8 05_6788 120 11001762 18.91 4955 /83 10 3.88 , 0,12
0.77730262 25
so05...19 1274 10.21663 12.480377 2470 24.41 6
6.1726184 0.097030003 0.91875756 26
8 061_36 1298 18301256 12.01849 23.11 10 11.044214
0.114 0.892163/3 31
soy_05...1441 1403 8.15094 0 5102 205
13 15047152 0 0,89004 24
soy_05_3725 1301 1 1859 7461530 023 2423 10 4.75563 0
0.81124032 25
soy_061_4696 1114 8,501142 0 6235 118 11 13.6 14
0 0.61440694 39
soy_05..4. = 1260 8,591142 11.1 21.66 10 13,5931
0.07099998 0.61 7 37
soy_05._5900 1000 10.121329 131 2199 VI 6 4,4611 ,
0.13530001 0.87 31
svi_OGL6818 1012 6030595 13.043418 141 20.45 B 11428139
0.108 0.80498101 33
8 05...6970 1(5 4.350809 23.2' " 7 20.2 9 3.2631617
0.146 0.94015691 33
soy_05._200 110 11.833065 17,454546 6541 19.18 7 4,6893544
0.106 0.8104515 2/
soy_OGL690 103 1121198 0 3192 23.89 7
10,019129 0 0.80. .1 21
K1_05,2199 103 8.5138249 0 4231 061 7
7.2241601 0 0.7725045/ 34
soy_05._4842 1247 17.451983 0 10448 19 8
10,2/1504 0. '1' 9999 012. 34
so0GL6 ,11 1245 658716 6.5863452 5069 20.64
7 13.79142 0 0.93141E 33
155
Date regue/Date received 2024-01-16
soy_OGL.,159 190 9.3480543 21,933332 ' 21.46 9 6.77. 1.
0.012999999 0.8421932 25
soL061J92 1279 7.4788356 22201847 369 2.43 8
3.6402405 0,101 0.66312331 25
soy_00._5012 1703 12519186 0 1093 28.23 5 6.4659705
0.03/ 0,6. ,1 28
soy_OGL .1, 119 25.029232 11.0193 ' 4973 22.02 5
4.610301 0.125 0.63283139 27
soy_e_4444 139 810143 187923 2244 21.15 10
14,821145 0,106 0.63653839 19
soy_09_5317 1455 18.2891 0 . 24.74 7 4,1684542
0 0.69073/25 29
soy_001.6897 1180 7.0806479 28,36936 1672 11109 6
11,29283 0.103 0.8683023 27
soy_061._4803 1136 5.. 678 4,1782132 ...7 21.22
16 3,23771'. 1149 0,93438232 14
soy_OGL_271 1426 93673096 0 3602 2,94 7 6.730937
0.14 0.89553016 26
soy_001..362 7.2958274 0 2846 2439 8 4.9784341
0.113 0.82. 7 20
soy_001,438 1. 10.69906 2,2342994 1633 2222 11
13.631361 0,114 0.67411178 19
soy_OGL_1140 193 55214667 0 4131 72.31 11 15.4
0.13600001 0.9765E4 26
soy_OGL1172 1545 84058905 31715209 2151 1161 9
10.213177 0.1;9999 0.9093291 26
soy_OGL_1554 1493 9.3190543 0 3409 22.78 10 9.6182747
1155 0.64851197 26
soy_OGL_5478 112 3,3617556 9,56111 = 2066 1135 9
27.794392 0.214 0.867 ' 30
soy_061._6749 1162 21298864 0 4195 256 7
7.7935801 0.19000001 0.7352973 28
8 00..396 125 9.5874052 0 2603 25.76 8 6,2937213
9.k9997 0,163U; 8 24
soy_00._3644 1438 5.1482658 0 4122 279 6 10. HfI
0.156 0.93651163 28
80y_OGL_5025 197 7.1732235 0 1. 24.9 8 8.4248492
0.11 0.66335481 28
soy_061_6957 1300 5.1221623 0 3461 17.38 5 24,501107
0,193 0.93007935 29
soy_OGL_242 1321 12.019522 14.0%1 1031 23.78 10 3.9513865
0.14399999 0.8490204 20
soy_001._1174 1204 8.3456259 14.711. 5127 275 8
9.514934 0.142 0.90821469 26
soy_0GL_2911 1431 10.078434 8.2517481 201 24.82 7
10.0971 0.125 0.97 26
soy_061_3224 1027 7.031536 5,1611 233 7 10,24 0'
0.142 0,7137933 47
soy_0GL_5211 193 21.185158 4,0131686 4172 2241 7
17.332621 0.131 0.73214663 24
soy_061...5787 1100 1427938 4,5451545 5060 927 5
1190389 0.14399990 0.84 Y. 40
soy_OGL_5813 1W 12.129729 14.5 7121 22.5 8 4.3907647
0.17/ 0,89310/89 25
soy_061_6914 1132 16217258 3.5311689 692 23.93 7
13.337164 0.17200001 0.93534517 33
soy_061._3939 1243 8.8160027 7.96492 7116 225 7
29,01. 0.118 0.8661289 27
soy_061._2123 1117 8.995301 15.39 4247 2211 8
2.5817657 0,121 0.903315/2 17
soy_061._299 12(0 9.1648493 12.583333 2360 23.03 8 4.6'
. = 0.121 0.87991065 18
156
Date regue/Date received 2024-01-16
soy_OGL.150 1280 13180943 11.4025 201 21.32 9 277' '1
0.153 0.86, 1 19
soy_00...4482 120 7.5610652 9,3793447 2346 21.86
9 11.645171 0.142 0.7140724 31
soy_00._45133 1500 8.7601175 4.8. 2186 N
12 5.31,' , 0.139 0.74261755 31
soLOGL_15 1312 10.153842 4.7256098 5879 23.62 10 4.58"
0.012999999 092858785 21
soy_061_206 1271 11.690499 0 2545 21.08 7
8.1446753 0.146 0.8122076 28
soy_OGL_208 1300 14.722309 11.53 7 5.34,1
0.167 0.81572467 25
81001210 1400 6.7576227 3 3363 23.28 10
18.11315 0.01200001 0.82212454 27
soy_061,_1436 1421 10.55134 0 2043 10 14.674491 0.1
,"999 0,8, , 24
soy_00._1534 1070 7.277972 0 5441 19.53 7 9.71'1
. 0.126 0.88594231 30
soy_06L_15113 11, 8.1677341 2.8063612 13(2 18.61
10 11.6 Ht 0.126 0.87325782 31
soy_081,3298 1017 7.098483 5.1130776 5927 /12 10 3893141
199 094' '7 24
soy_OGL3 102 5.426187 5 3382 21.3 8 9.9279194 0.145
0.8 35
soy_OGL4523 1013 1, 202 0 4212 1146 9 5.8025231
0.121 0.76134819 34
soy_OGL4691 1100 101/4121 0 3110 21.27 8 4,15146
0.11' -999 0.62548363 39
soy_OGI_5495 1513 4.270309 0 2001 us 9
12.48159 0.0192002 0.85119176 31
soy_02,5884 1041 10.303918 0 2001 18.53 11
3.7303109 0,1 .010001 0.8937326 35
soy_OG1._6233 1469 820326 0 4446 21.78
10 411 0.13 0.89454645 20
soy_00,6292 I, 61641422 2.48, 1624 2.44 9
5.238739 0., 19997 0.94 7 22
soy_OG1._6829 1141 6.5125389 0 1719 21.2
9 152 , 0.124 0.8102774 34
soy_061_6955 1276 52321976 4.5454545 242 1174 7
24,113876 0.126 0,92;11 26 27
soy_OG1_6972 121 4.3050809 0 2001 1663 9
3.263767/ 0.124 0.94021451 33
soy_OGL6984 1100 4 1946 0 1259 18.72 10
6.3182101 0.103 0.9474226 33
soy_OGL_358 122 8.8643551 0 1760 22,5 8 1614748
0,107 0.76I 25
soy_OGL_1371 112 5.622537 0 152 20.18 6 13.73027 0.122
0.7i 31
soy_00._1857 1116 5.4487619 8.602120 4388 2102 6 11.641130
0.131 0.72757465 37
soy_001._2187 1100 10.96957 0 213 20,9
5 12,632515 0,123 0,7932201 30
soy_OGL_2405 1418 11267738 0 2140 /27 7 7.13 , 0.1
9997 16996427 27
soL0GL_3122 120 8. 553 7,59' " 5116 16.7 13 9.2269335 0.1 0.5
7 24
soy_n_4861 1110 5.113389 11.35132 327 21.17
8 5,809325 0.103 0.94,1 1 17
soy_061. 4'1 VA 14910236 0 728 219 11
11 803347 0.i, ;si003 0.7' 18
soy_OGL4948 1100 9.402356 2.911, 226 21.27 5
10.767612 0.122 arm 35
157
Date regue/Date received 2024-01-16
sol_001_495 1035 12.134647 0 3047 20.5 6 9.1550274 0.108
0.751 33
soy_001._6204 6.3214092 10,408561 2351 2933 7
5.581,,, B 91 v9999 0.86182499 28
soy_05._6792 115 8251083 5.81815 am 2127
9 14747676 0,0 , 9999 0.77947277 24
soy_05._6981 1100 4.8405398 0 4032 22.9 5 10.968753
0.106 0.94421403 33
soy_OGL_1517 115 6.1372461 3.80634 597 5.17 10
2.547615 0.1 021006213 34
soy_05._965 150 12315811 0 1228 23.6 10 13.63,
0.118 0,75751285 37
soy_061._978 11 13.02616 0 3406 231 9 3.897 ,r
0 97671E654 33
soy_001_1209 1415 61576227 84805651 370 5.9 11
16,866644 0,088 0,82 19 27
soy_05._1241 , 1595 819104 1226953 3061 2238
10 19,154311 0.078E60002 0.753542 25
soy_05._2143 1103 6.957392 14 2115 22.9 7 6.5582751
0.122 0.8614405 30
soy_O0&_225 1217 11.505636 9,03162 3570 23 12
11487501 0,119 0,61182112 31
soy_061_2213 150 9.6513048 0 1635 55 11
13.999751 0 0.60886699 30
soy_Oa_3202 1188 82018318 0 2195 2316 10 5.8514123
0 0.69281617 36
soy_061._3244 1173 9.3938437 0 301 23.5 8 7.055432
0.071000002 0,73R1 36
soy_CG1._3823 1001 7.0129119 9.713,e 301 20.9
12 9.815957 0.1 , 0,5561571 26
soy_05._455 1218 8.500184 6.5681443 3005 25.01 8
4.83, ,, 0,';9997 0.747757 37
soy_05._4938 1014 9,3127365 6,0521417 1022 23
9 6,72 9 L! 0003 0,7611443 37
soy_061._5801 1024 12.176668 0 353 22.16 8 16.874744
0.015000093 0.85895151 37
soy_05,6953 1006 8.566577 4.6999 5047 212 11 9.607
9998 0.92811561 25
soy_Oa_970 1000 13 ' 718 0 5492 23.2 7
3.38679/2 0, 0999 0,7631355 36
soy_05._2513 1549 7.454678 0 4391 2613 9 0.553443
0.006 0.8237/525 25
soy_05._14 1211 10.159842 4,459136 4192 24.52 7
1.1481 0.043000001 0.92991513 20
soy_Oa_1424 10 11.305625 0 571 20.6 8 10,548765
9 "9998 0.8686712 23
soy_05._5405 1625 9.4130331 0 1425 22.16 10 10.024912
0 0.74543029 14
K1_05..2191 1092 8.5/38249 11.0, 4', 4002 2522
6 6248331 0.123 0,781v4; 29
soy_05_243 13 13440411 6284236 6312 527 8
13.3243/9 0, 001 0,852132 18
soy_05._658 1149 5. ,26 0 3.37 8 8,6120S2
0,002 0,7543154 36
soy_05._1276 115 7.57959 6.1333332 1651 24,44 9
7.0391445 0 0,6803379 24
soy_51_1372 1100 5.542537 6,909E61 625 331 8 12,9
9057999998 0.7916187 33
soy_Oa_1464 t 9.5639515 9.3896/13 /352 21.66 6
15.9s' 0.11 0,92592114 31
soy_51_3179 1 , 12108178 19.136961 551 23.07 7
7.11, 0.125 0.65487150 22
158
Date regue/Date received 2024-01-16
soy_01&4158 1471 . 871 9.7212182 1031 24A7 6
20.284187 0.078000002 0.89530408 17
soy_001_5816 1100 11055554 2.5451545 3561 21.81 8
5.3142113 0 0,911 23
soy_00._6938 1146 10270785 2,44321 1 3.3 9 62053512
0 0,90 I Is 19
soLOGL3621 140 3.8881525 15.14 8108 314 12
5.9635634 0,097999997 0.91473116 22
soy_OGI._1698 1100 6.9519791 14 2390 24.78
9 2922952 0101 0.8117 27
soLOGL6630 12 83712139 18.931394 333 223 10
4.5709041 0126 0,96"; 24
soL06L1136 150 5.6/38558 39 26 20,6 13
3.7506435 0146 097791231 25
soy_061_1701 1319 6,939791 13,419257 251 354 8
2.6418443 0.057 0,8125231 28
soy_OGL_4567 1189 4.57098 14213625 1001 2144 10
3.04/E 0.014000001 032182181 24
soy_001._2551 134 54913468 24.6. 2031 21.58 10
9.6273718 0.108 0.71'v 11 17
soy_061,5544 1138 7,2413789 23,11072 21.79 9 7.4447684
0,121 0,76690123 17
soy_001._5932 130 7.344454 11.6 4643 3.6
9 5.8285913 0.034000002 0.73194 22
soy_061_3640 1448 5.1121701 22.513813 2875 2168 6
4.961 e 0.092 0.93317268 27
soy_001._4870 1741 5.4112797 23,147615 2001 /V 8
5,8048105 0,1 9999 033586 21
soy_OGt_6261 130 5.350945 14.923071 2492 9 3,6811i
0.142 0,91844952 24
soy_00._262 V; 10. 178 9.4017086 1623 28. 14 7
2.4826207 0.083099 0.87652934 21
soy_061_361 143 72958274 0 2644 28,7 9
5,1810184 0, 00'01 0.826 '1 8 29
soy_061_3571 130 5.45187 9.033313 4557 2183 7
5.103875 0.111 0.64178144 41
64_061...3702 1400 8.0577 12.64 2/34 26
7 11.54735 0.111 034453219 19
soy_0GL8334 1400 53879897 8.5714283 3511 28,5 5
3,5650322 0.1io 0002 0,90121818 29
sol_00._4882 1354 3.914754 11.034433 312 331 13
2.3942809 0.1 119998 0.92349126 19
4 1_00.341 131 8.1319628 14.343211 1001 22.4 12
3.4782381 0.1 1999 0,744I12 21
soy_061._4552 3.8821412 5.5625 , 3424 26.09 12
7,3621919 0.057 0,794336 28
soy_n_7015 1515 7.337347 72100315 2298 2151 12
11.146817 0.0/5999998 0.9 1r41 9
soy_00._1363 1100 53516586 12.818152 3845 23.9 9
7.897551 0,106 0.78521182 24
soy_061._4943 1313 6.4237089 11230769 4849 23,92
10 8,8825189 0. ' 9999 0.97757179 14
soy_031_645 130 8.8196426 13.1 24.58 9 2.561143 0.121
0.68333519 26
soy_05._1697 1030 6.8353257 18,711.1 5342 24.1 8
2.2346623 0.101 0.81080113 26
soy_06L3553 t '4 6.3657079 11.1 ' 5233 25.46 1
5,2021227 0.081 0.831 2 31
soy_n_6323 1430 62954488 2.3076923 3176 26.01 9 4.091 -
0 0.9241E5 19
v4_05_6855 1056 8.4172974 10.795455 3625 24.05 8
1.7651855 0.05/ 0,8311 ,. 23
159
Date regue/Date received 2024-01-16
5061_4472 1550 7.3361325 0 781 1186 9
11.739969 0.127 0.70672017 29
soy_061_5195 163 13.332328 0 2700 183 4
4.9722157 015899999 0.96( 2 16
soy_061.8237 1701 6.1E2364 0 3750 2192 4 0.83648153
0,134 189911013 19
soLOGL1364 1583 5.1467152 0 31 1a95 6 6.94- =
0.117 0.7880905 26
soy_0G_1381 1313 8.1746645 0 ni 2179 3
4,583316 1009000002 0,80135179 35
soy_Ork2255 1105 6.0701208 0 3236 16.65 7 4.0767187
0.112 0.64E3 35
soy_061..3813 = 1521 73470869 14,407334 6814 223
11 9.2487001 9.1, (110004 0.57112873 16
soy_0GL._666 113 11513732 9,6842382 977 21.1 5
8,54 , - 0.107 0,77115111 31
soy_061._1203 1,1 63576227 0 32 2.61 6
0,93 0 0.82813156 25
soy_00..1873 1100 5,0198676 18 11'1 493 381 8
10.197219 0.101 0.7124767 24
sotOGI.,3482 103 5.426621 20714215 2452 18.26 6 25,1
0.1, '9997 0,64922464 27
soy_061_3550 1413 8.9636507 4.071438 9632 19.64 7
2.02 e 0.1' . 0.81.,'.; 22
soLOGL3730 1035 8292532 13,140097 4614 20.86 6
5.4254106 0,090000004 0.79833473 25
$0061_4985 1076 9.4515498 11,710037 ' 2113 5 2,18-
0,119 0,708' = 27
soy_0GL6',. 1200 6.5062184 15 6213 2141 8
12.3695/6 0.118 0,8 ". 21
say_06L3549 1381 8.9636507 0 11515 2162 7
2.0246992 0.097000003 0.80 , 22
say_O6L,143 1014 1122756 20611441 452 21.49 6 2.4276305
0,132 0,8150651 20
soy_OG(663 13 9.374756 14.91 4594 23.41 6
13.821016 0.079030004 0.95823377 19
say_OGL_983 In 5.1012852 0 ", 1 25.12 6
14.617379 0,1 ('', 9'1,( 0.76932734 32
soy_061_6238 OM 6.12023E4 0 4406 26,18 4
0,83648753 0.3000002 0.89967167 19
soy_061...2275 1058 13.513581 0 78.08 5 11.2 nn
0.121 0.627; , 42
v4_061..2632 130 7.913515 0 5498 255 9
3,42514 0.07999!'i; 0.56514406 22
soy,OGL6448 103 8.9351873 18125 9113 26.37 8
10.53612 0.01 0,5713128 29
soLOGL431 1350 12.23607 0 r 21.23 4 12.067479
0.147 0.68254537 21
soy_OG1J 1354 8,7383938 12.555311 2452 21.19 0
28..425 0.15000001 0.61130003 19
say_061._2463 1520 5.313236 23026316 4152 3,32
0 4.5354461 I 0002 0.92401118 17
soy_Oa_91 IX 10.535975 0 4522 23.15 6 415, 71
0.119 0.7722E33 28
soy_00...775 15/2 8.7638731 0 3908 ag 5
2.9653993 0.1, 110002 0.044 1Y; 1/
soy_OGL792 1113 19410403 0 1319 19.27 5
5,0073549 0.113 0.137465407 22
soifia_1365 11 5.1467152 0 4786 17.85 6 6,94
413E99999 0.7 . ; 26
soy_OG1._1370 1146 5.155012 . 0 2001 19.89
4 18.134011 0,127 17902312 32
160
Date regue/Date received 2024-01-16
soy_OGL1818 1100 0.91241473 0 4720 19.63 7 3.8505233
0.101 0.7, .7 31
soy_061._4097 123 12.218921 4,3724694 2309 1151
7 6.4293/ 0,146 0.6731117 23
soy_OGL4629 1114 3.3767221 0. 20.73 6 8.710918
0.126 0.74853515 33
soy_OGL_673 1300 41344703 0 5655 IN 9
2.9671144 0.014000001 0.185033 21
soy_OGL6958 1104 6168716 0 1991 171 7 12.81243
0.0 '9999 0,93136152 32
soy_061._1816 1127 0,91241473 0 21.11 5
3.639823 0.12800001 . 0.7.'L 17 32
80Y_OGL629 1197 41159496 11,`f41, 4084 22.3 9 4.8174324
0.106 0.1161616 19
soLOGL6191 1532 65324054 4,37 1401 21.67 8 9.410353
0,02 0.8483134 15
soy_CO._6434 110 111893449 " 8614 214 6
6.16336 0.13500001 0.55306166 35
soy_OGL1581 1383 7,1159863 0 1356 21.13 5
6.6603101 0.015000003 0.78020100 23
say_OGL.2846 1111 5.5548873 0 6/70 21.45 8
7,0856414 0.044 0,67, q= 26
soy_OGL.4344 1117 26070619 0 3052 2152 11 8.563154
0.014 0.4683433 18
soL0GL4811 1364 51010963 0 367 21.7 7
26.579151 0 0.04318514 14
80061_5529 85 11 , '812 5844149 1155 X45 6
6,0977349 0.125 0.78870517 24
soy_061_5751 135 12 1 519 7,22021 ',N4 23.75 7
2,4657011 0.081 0.1312633 16
soy_OGL5914 11/6 8,4431825 0 8487 238 7
3.1091492 0.061000001 0.8453551 22
soy_OGL5933 1205 7.3914454 5.5601658 6/43 24 9
6.8285913 0.021000001 0.13181731 22
soy_OGL., 10E2 071 7,344636 19.67 9
2.2027183 0.115 0.587'I. 22
8061_6738 1400 349 2,4 ;It 1078 2(85 I
4.9174494 0.041000001 0.72791618 25
soyfi6L6763 1063 8. 166 0 7543 21,26 7 2.5553894
0.081 0,14541259 27
soy_OGl_674 103 3 '7'949 0 0334 24.78 6 1.08',16
0.1., 0.78041115 25
,soy_OG1_5110 1400 8.0355263 0 21.5
6 4.7568/65 0.090000001 0.64976132 18
soy_OGI.,.5574 1035 83179068 0 1113 7
10.1/335 0.015000003 0.699 22
soy_061_6333 ION 51019897 29111 11;- 21.5 5
6,403w,', 0.12899' ' 0.90:iv 'Y 28
soy_031.1713 1400 5267265 2857143 5531 27.07 7
13.050597 0.035999' 1: 0.90101143 24
soy_061_5652 1010 0,1949114 19.449541 1001 UN 9 6.2436256
0.121 0.527 . 21
soy_OG1_4438 1136 '10.04345 563 5470 2194 9
6,7491249 0.1 "9999 0.6233516 26
soy_061_4652 11 11218634 11.8413 2001 213 6 9.1652136
0.112 0.67618102 26
v1_061_6920 133 8 1 718 15.1 24,2 1 7,811'e
0,119 0.8944243 24
soy_0GL_3514 1126 51E13187 25.93305 4026 2162 13 4.391605
0,183 0.83811551 37
soy_061_1043 136 5.353307 14.15457 1001 X69 12 , 15.185414
0.119 0.84714091 2/
161
Date regue/Date received 2024-01-16
loy_001..5909 122 7.9141469 18 , 27.25
10 15.01, 0.147 886097962 31
soy_02,1497 159 8.5196972 12,76453 221 26.74 10
6.33, II,: 0.097000003 0,98240417 20
soy_Oa_3537 1192 8536507 18.1 1001 26.67 7
8.2012906 0.113 0,79350013 24
loy_Oa_1044 1400 5.3539307 13.785714 3247 2107 11 15.811
0.010000002 0.84792066 27
soy_001._3611 1337 52449269 23,485415 21A1 2468
11 22,20457 0.106 0.89043693 17
soy_Oa_5218 1109 11.000355 15.727272 4510 28.45 10
15.081091 0.109 0.94570732 28
soy_061..2' I 1231 13.152136 13.44012 3274 25.34
16 3.1103381 0.133 0,98087233 24
soy_001._5227 1812 11 '387 1,6001415 1001 314
12 7.980475 0,012 0,921;1 I, 22
soy_Oa_3' 1300 8 1224 19.23077 41 24.3 10 14.30653 ..
0.101 0,94696155 .. 10
soy_OGL644 1008 7.262041 17.261 1, 2212 2148 7 .
8.4531349 0. 99! 0.75067461 26
301,21 1244 10.798586 13,102194 4329 71134 7
6,41" , 0.07 0,91791003 26
soy_061._302 1/00 10.392898 20.117647 4230 233 12 34.2I
0.093000002 0.9281338 8
soLOG1._1451 1/00 9.5029097 8,0588236 3496 3682 10 8.294845
0.096000001 0.91187745 33
soy_061._5784 1EN 14.55392 0 25.68 8
32,120431 9, 00002 0.8435939 40
soy_OGL_683 1300 6.5125389 21.461538 4257 24 7
12.50516 0.12300001 0,80;', 37
soy_06L2918 1842 90113396 37296417 221 2136 11 19.157797
0.088 0.96847481 28
sol_061õ4636 In 19.448103 31 3166 21.58 9 7.1176
0.182 0.7303464 39
soy_061._1730 1114 30.668314 3424107/ 251 24.32
12 13,231986 0.148 0,85633632 22
soy_061_4831 1 17.334297 33.533447 1138 21.78 10 ..
13.301957 .. 0.169 0.97894526 .. 15
soy_061._5807 1120 12.425729 25,30303 12786 24.2
7 8.2762794 0.101 0.87957662 37
soy_00_1933 1181 17 ),937 23.624048 3181 21.42 9
5.821 0.162 0.54744446 26
soy_OGL_6448 1307 9.0478334 21.557318 1001 24.44 7
13.615551 0.119 0.57004837 29
soy081_5305 In 24.034395 23.727272 2193 509 6 4.1961785
0.131 0.6999751 24
soy_00._6429 1,1 10.813449 13.1875 1013 211:6 7
10,525334 0.'9999 0.54739104 34
soy_OGL_5883 1106 11300918 32.333644 2162 18.04 14
6.0565968 0.102 0.89506412 36
soy_061._220 1' 11247388 25.883762 2163 23,36 10
13,16 ( 0,I99998 0.82923156 23
soy_00._4703 1818 9.878599 24.6974 2379 2193 12
15.135615 0.017000001 0.60971242 38
soy_061._3649 VI 1.8333012 27.5625 032 2118
9 32,674916 0.1i. , 0.9453533 24
soy_01_5808 1902 12.425729 23.844732 11386 235 7 8,2762791
0.121 0,37!N.1 37
soLOGL4933 1E0 9.3127365 311 ,e 254 24f 11
18,761217 0.0 110002 0.76 1 40
soy_001._3222 1E0 9.1705011 15.9 2415 28.3
6 10. 0.146 0.71338218 49
162
Date regue/Date received 2024-01-16
soy_OGL..3948 1113 20647972 26,56637 2001 Z5 11
12.60 0.13 0.8871 ;.? 20
soy_061_5187 153 12553019 12.6 470 26.53 8 26110304
0,104 0.94050175 19
soy_OGL_1457 1303 9.610642 19.71/17 4125 27.41 7
11.14095 O. r 09999 0.9173E1 32
soLOGL.3210 1400 6.4012876 25,7 41 15 2409 24.78 9
0.28701575 0,112 0.69775975 36
soy_OG1_4513 1292 ih 1184 16.33127 3276 26.62 8
0,9945097 0,14 0,74815154 36
soy_OG1_4615 1581 8.1115069 29,791271 2531 21.11 12
1.6783247 0,124 - 0.7691637 22
soy_OGL.6836 203 31573007 20, "" 3911 3,8 10
1.4578113 0.022 0.81476474 36
soy_061_6274 1600 6.15E623 27.4315 5171 23.37 9 8.7067032
0.iiI0001 0,93134481 26
soy_O6[_4831 SO 19.378592 31,04 1'.=?; Zkli 9 3.6977419
0.121 0.96351E2 16
soy_OGL2964 12.075033 22,533313 ..1 26.2 12
17,462011 0.112 0,86011487 19
soy_00.,4516 1300 8.9632776 22,923077 11. 26.23 9
7,22. 0.115 0.75326562 35
soy_Oa_465 312 19.448103 35.3167 5138 28.69 12
9.0968246 .. 0.116 0.7402165 .. 39
soy_00...6961 130 15.710792 34.615383 2131 26.38 9
13,355711 0.125 0.9323761 33
soy_OGL,5235 1133 32E3028 38.57016 3/11 29.39 12
16.01 0.11 0,9001E97 21
soy_0a_893 1r 7.0511968 31.05105 1951 2154 8
3.078414 0.11 0.6637991 27
soy_OGL_259 135 9.1737165 23.207491 4615 24,3 8
9,224411 0.115 0.8750671 21
soy_061,2260 1(Q1 6 116 19,2/9455 4/13 3.36 7 1,31.
0.138 0.6311468 44
soy_Oa_3629 1818 32)73443 29.870131 6364 23.43 10
10,1 0.05600001 0.91915293 29
soy_061_2213 V 6.4445391 21413 3611 3,5 9
23.6. 0.1, m0003 0.75217418 27
soyfia_6555 163 13.347547 29.75 379 3.68 9 5,4410612
0.067000002 01516946 33
soy_061_1011 1145 8.4023438 30.131004 1011 2524 7
16.111315 0,12/ 0.84107602 26
soy_0GL_5812 138 12.687993 15. Ho' 7013 30,35 7
3.4897976 0.1,'.110001 0.8x 59 33
600...6867 1116 8.350586 35,11 2/25 24,4 9 19.727076
0.117 0.84010136 26
soy_OGL_6946 1465 10.009709 27.90135 261 2047 7 25.567991
0.1, 19999 0.92242406 22
soy_OGL977 1620 13.02616 38.0" 2552 23,5 7 00367126
0.145 076611122 32
soy_06L_3571 163 5.456187 18.4/1 325 3.36 9
8,9033161 0.60300001 0,8 37
soy_Oa_6224 1440 11.301011 32.5 1361 3.23 11
6.2967348 0.116 0.81490118 27
60l_Oa_1702 1100 6.9589791 22.2221 1417 Z33 8
2.6006143 0.015000002 0.81378114 28
soy_061_2983 146 11.277602 28.921572 1635 2528 7
5.8389182 O. ' '997 0.82.1 (.1 23
soy_OGL_323 VI 7.5872769 22.125 5271 318 8
5.83362 0.035999998 0.7181- 39
soy_OGL1435 1E0 10.61735 24.846153 2/35 26,15 10
28.725206 0.133 0.8794364 23
163
Date regue/Date received 2024-01-16
KOOL4520 3600 :776 15.733331 26.4 11
17.07654 0.090000004 0,7557261 32
soy_061._4913 1402832 15,042511 1001 Z83 9
13,95144 0.097000003 0,7815336 21
soy_061_5891 1249 11 493 1667339 34 25.62 7
18.8 0.124 0.8843133 36
soy_031._5597 143 4.4148474 fl't 2274 22.42
10 37.224129 5111 565514444 18
soy_061_1037 1351 6.30E6811 157317 2679 2.2 9
25791906 0.1,'9991 0.8377335 28
soy_00._1841 1434 7.2193756 145818 6730 25/7 12
17115199 0.1 . 0.7402519 29
soy_061_2262 1527 7.6927543 12639162 1001 3.58 7
7.3205218 5066 0.63797706 44
soy_00._2273 1218 12286147 13,14554 2944 24.64 9
10.253579 0.097000003 0.6306743 41
soy_061_2=.1 4'. 6.0447655 30109124 2229 19.21
11 23... 113 0.093000092 0.9291032 16
soy_OGL_3300 1781 7.8766026 13.0n. 1168 25.09 9
1502729 0 1-9993 594154376 19
soy_061_4702 1100 9.078599 158130 3018 25.64 10
11.920033 0.055 0.61058825 38
soy_Ca_335 130 11.110282 21.1 1469 20.4 11
13,533115 0.106 0.=.µi .1 23
soy_061,343 9.9817172 7.3631215 1031 25.17 10
20.1 mi 0.1. 0.8552E43 2/
soy_061._721 1357 9.4288235 15,25407 1801 3,85 12
18.13203 0.035 0,86316431 21
soy_Oa_1187 1230 43006682 11.63017 3185 23.41 10
16.93492 0.011000001 0,89473552 28
soy_OGLJ 1101 13.123453 7.427536 4421 24.45 9
58353238 0.034000002 0.82456082 30
soyfia_1401 1i 13.110943 15.6 1 1246 23,25 9
2,8514457 0.125 0.8 27
soy_Oa_1526 1146 7.3093705 18673647 ; 22.33 12
3,8379085 0. 4t0001 f497 39
soy_OGL3579 = 61902267 10.53549 231 22.44 11
15031517 0.006 0.84521854 37
soyfia_4939 1'i 9.3127365 15630303 2031 23,48 8 153 .1
0.132 0.75945148 37
soy_OG1_5 r, 1600 12976668 0 152 2162 7 17, ,1
0.03000001 0.85E9 37
soy_061.3565 134 5.I1;16 14.513556 231 22.32 11
28.466328 0 1,99'!, 0.77' 118 35
soy_001._1450 1105 9.5029097 250931 1097 23.09 10
16.49165 0.123 0.91145122 33
soy_00._353 123 4.1118922 33.1 ;r 21.33 10
22,95E68 0 I' 99997 0.84961724 37
soy_00._4634 1233 11448103 30.251419 3391 25.95 11
9.315913 0.071999997 0.74035233 39
soy_00._5613 1100 26.'232 16.272/3 2169 0,36 8
5.7983479 0.132 0.63338897 28
soy_Ca_5614 1930 27.376841 10. . 2061 21.6 12
12,991765 0.123 0.6). r 74 25
soy_OOL5/3 1409 12.976668 11.42112 2007 26.92 9
16.622011 51 09819 0.8 . .7 31
soy_0a_5811 131 12.687993 21.733105 1443 25.59 7
5.81 39 0.075999998 588355005 31
soy_OG1._'.. 1303 11.99724 13. ,,41 1763 22.61 9
20,015448 0.023 0.7 3 42
soy_Oa_1715 10% 31.132702 3.4749036 2001 21.04 9
4,6..1%, 016499',' 0.83142567 31
164
Date regue/Date received 2024-01-16
soy_OGL3508 108 47.600048 0 3567 16.35 6 9.89
0.07 0.7267906 23
soy_00._3949 1300 21424124 0 4.38 11 8,4711914 0
0,8890601 20
soy_OGL_463/ 1300 19.418103 0 3300 27.76 9
8.1162882 0 0.73660785 38
soy_OGL_4822 1921 16,127125 20.91843 2023 22.82 9 3.62/3549
0.057 0.96716553 20
soy_OGL_5523 1577 8.5462761 14,331' 1001 24.66 12 342 0
0,79763967 26
soy_OGL5, 1100 10.120918 9.636364 N9 24.63 9 18.291817 0
0,88217854 35
soy_O3L_622/ 142 11.29869 14.311815 3515 143 10 10.91 1
0.005 0.87924803 27
soy_061.5 1137 16297253 16,446791 3114 26.56 9
11,050739 0.001 0,93584269 33
soy_OGL_198 1016 11.81065 19. I 3447 4.99 8
4.535506 0.121 0.81014419 25
soy_OGL_232 1200 7,944356 19.25 4983 4.58 9 27,6's
0.112 0.84124887 24
,m 1100 11.266098 30 189 8 10.75528 0.132
0.85355143 17
soy_OGL_5w 140 14,406287 15.25 RN 24.5 9
6.9213305 0.1e, 110001 0.9256621 20
soy_00._140 1000 9.5686789 22.6 5413 23.4 5 7.5 9
0.108 0.91672313 32
soy_001._6450 1673 8.1351873 11,018 2640
118 8 10,738296 0.015000002 0,5721 9 29
soy_OGL_46 100 10. 074 21.4 1200 19.6 8
5,662674 0.017999999 0.8, 78 33
soy_0a_4151 1237 10.608291 18.10326 9,, ; 2171
9 18.195381 0.061000001 0.8, 039 23
soy_061_1352 1106 11.526744 24.2743 229 21.09 9
13.541037 0.104 0.7528105 15
soy_OGL_1387 1100 6.9138424 18.6 1816 24.5 5 12,1
0.081 0.80834818 35 -
soy_OGI._261 1647 10.232581 4.5537338 111 23.01 10
39.52501 0.037999' 0. , , 7 27
soy_061._4692 140 8.6883963 16,1 814 161
11 11,499081 0 A9997 0.61911056 40
soLOGL_4932 1 9.3127365 283125 4354 24.75 11
18.761217 0 0.7630164 40
soy_OGL_6548 1792 13,347547 23.2701 1001 122 8
10.00113 0 0.75331311 30
say_OGL1747 1233 13.61608 15.977291 2316 an 9
27,993371 0.037999999 0.98080826 16
soy_OGL_3501 1400 47.6001, 0 6318 72.57 7 6.341
103200012 0.72231119 21
soy_OGL_4 100 14.560184 7.375 2645 28.12 6 11.3795
0 0.76721131 35
soy_061._5612 151 21.376841 7.03125 2031
2128 8 9.4883537 0 0.6301047 25
soy_OGL_5771 100 19.448713 10.6364 201 4.9 7 6.15193/5
0 0.81876177 29
soy_001._6557 1720 13.347547 1.627909 3228 25.69
10 75, 0 0.76207626 35
soy_OGL4681 1310 10.891823 7.328342 2147 27.55 8 18,18025
0.11 0.64345032 40
soy_001._5926 1519 36341531 0 5230
24.09 8 2.41170/8 0.13600001 0.77165306 5
soy_OGL_4008 1647 11.197123 2.003643 4634 23.01 0 52.1,,
0E1000001 0.81911615 20
165
Date regue/Date received 2024-01-16
soLOGL4172 1300 62.188968 0 2190 161 9 10.9. 13
0.154 0.15955379 8
soy_001_17 1337 11816959 16257291 21111 26.02 10
74655128 0.081 0.9235796 26
soy_03._1156 1465 8.7633495 1,9114'; 301 2505 14
12.32705 0 0.9514103 21
soy_OGL2153 1073 64362858 12,48051 S15 116 9
17.83592 0.092 04516376 32
soy_061_5225 1530 11.796818 0 27.66 10 3,374 7
0,t9" 0.93054879 25
soy_OGL_6; ) 1530 6.5125389 2,6... .7 1238 28
9 10.04312 0 .110001 0.8105333 34
aoy_06L3331 1200 13.000942 12,833333 175 7
5.7824102 1105 0.8641 .'7 30
soy_061._339 9,9017172 18,482491 3.73 8
7,87 72 0,124 0.86143118 26
soy_051_976 1315 13.12372 6,920102 43/5 25.85
9 6.8087044 11,010002 0.7. if, 32 .
soyfia_1724 1086 2130612 0 1151 18.32 14 23.1'..
, 0.113 0.84353501 . 24
soy_051...2174 1200 202 14,6 . 2133 116 8
17.203102 0,105 0.811037 27
800..2290 CD 10320536 0 1344 24.8 9 l8e
0 0,61655116 39
6000..4835 1334 17.834297 0 4252 23 13 8,94;;'-
0 0.98213363 14
$0051_4941 1038 93127365 12,386157 332 24.86 10
17,1. 134 0,119 0.7583753 38
soy_031._5713 137 11448713 0 1031
23.59 9 6.3970651 0.097999997 0.82336318 33
soy_OGL2973 1100 11460068 21,363636 1171 23.81 10
21.1530 0.127 0,837r: 23
soi_051_5224 1013 11 1/41.04 14.72507 2817 181 8
20411/51 0,111 0.93 25
soy_0GL6932 1E4 718 2352919 101 3.72 13
32.91V25 0.13500001 0.90 24
sny_OGL_463 130 11479895 0 3521 27.84 9 15.937278
0 0.7325294 35
80y_OGI_4935 1100 9.3127365 10,272727 2058 24,63 10
20,364r 0,055 0,7. 1. 39
soy_0131..6566 103 5.;1,76 14.8 24.1 11
28.4.? 0.31000003 0.71 '1 35
soy_041._108 1358 1530664 11.340206 236 111 9
3.9E379 00999998 0.73307526 14
soy_061...2 137 11232551 14.923189 373 24.94 11
19414194 0 49999 0.49230722 25
soy_00,2879 136 7.0412643 16,10338 4205 22.26 11
21.738546 0.037999999 0.84363723 18
soy_OGL3020 1115 9.2658463 19.372198 2001 2/78 8
17.690765 0.116 0.75402129 21
soy_061._4144 1018 11.497028 12,59542 2368 25.57 5
16,88010 0,113 0.851674E8 29
soy_00._3779 330 16E504 19.583334 3711 26 12
14.654912 0. 110001 0.71 1427 17
soy_02._1607 1006 79.34001 11.63019 2350 25.04 11
4.8013263 0.134 0.4701 2
soy_001_2209 1115 83062983 23.31 3720 25.65 14 48.631416
0,023 0,735275 26
say_OGL20 130 10. '586 12.933E 1881 21.40 8 5.7' 1
0.082000002 0.91786063 26
soy_001_3281 131 29175985 fl.0iAl 3765 23.08 10 23.1
187 0.133 0., 125 26
166
Date regue/Date received 2024-01-16
soy_OGL4502 1400 8.761175 18 3451 25.42 11
6.2841797 0.119 0.74213535 32
soy_001_6'4, 1419 718 20484596 106 E158 9
3.172045 0115 0.89' 167 30
soy_00,1686 1321 9.1770983 28841787 2203 23.08 11
20.957457 0.12 0.7370249 10
soy_OGL_383 168 7.1420999 23.021584 4109 23.5 15
4.3599367 0. 19998 0.77792597 26
soy_061._1514 1115 6.1372461 19,0 1031 2255
11 4.7172575 0 0.9134773 29
soy_OGL_4548 107 5.7242432 28.748964 4453 23.03 11
7.0814991 0.081 0.79158449 32
soy_OGL3555 611 6.367079 36.30004 7 19.09 11
6.6388178 03439990 0.82648957 26
soy_OGL_1492 161 7.306444 20,96015 1901 23.55 9
7.912149 0.037999999 047 22
soy_OGL_4484 1100 7.0 356 27.27028 2204 23.63 11
7.3689119 0.122 0.716102 28
soy_OGL_1708 1431 7.9271779 17.190775 2693 25.43 12
5.556203 0 0.8111 33
soy_OGL_6514 164 15.158372 3017903 1001 25 11 8,74 15
9.071000002 0.7405172 32
soy_OGL_292 162 11.654119 31.238447 1001 0.45 8
6.807840 0.117 0.90' rl 26
soy_OGL2;.I 1434 7.0442643 22288156 2317 24.23 10
22,301723 0.064000003 0.843710 18
soy_061._3351 1293 11.780388 27,' in, 2031 0.89
9 4423105 0.102 083 A. 19
soy_00._3514 M46 iv 507 18.603043 1001 2141
7 5.810135 0.00 0.80181384 24
soy_OGL6758 1025 9.6724033 25.56076 3432 25.65 7
1.3512336 0.119 0.7395466 32
soy_001._2892 1207 89/6227 25517013 A' 23.03 7
9.3781614 0.108 18707916 21
soy_OGL_6913 1164 . '718 27.6001 1723 21.9 9
6.2361555 0,111 0.89254129 19
soy_OGL_4162 1008 9,3938532 3134907 261 2153 8
10.334458 0.112 0.90271091 .15
soy...061_727 1313 9641814 12947449 1001 au 9
3.7183442 0 056920484 20
soy_061_2207 12(0 61E0872 23 054516 5278 2258 9
6,1407647 0. 00001 0.7617676 28
soy_OGL6921 1013 81029718 28,035538 4254 22,8 7
11.318844 0.106 0.89503291 24
soy_OG1_935 1017 12449766 28366162 Wi 4.83 9
85663166 0.113 0161043 28
soy_0131_2990 1769 9.84E093 15545506 1001 126 10
8.94 0.005 0.80850344 23
soy_OGL_3738 , 9237325 30996391 2799 24.49 11
17.253544 0.111 0.78281418 24
soy_OGL_1521 10 6,1372461 23101 , 1 361 2449 8
4.3645771 0.044 0.90723217 34
soy_Oa_2150 20 7.3043337 19582134 059 21.83 11
26.71 0 0.85332193 32
soy_00._6602 623 8.5314484 2531764 4632 21,7 12
16.581352 0.046 0.867633 15
soy_OGL_987 1' 9,5245228 31,184634 1 23.03 6 8.1101476
0.121 0.7723856 31
soy_OGL_1723 1168 392081 30,821918 13,1 3553 13
25.793118 '0 0.1424E23 24
soy_061_422 SO 14.106673 i6. 3112 2626 10
6.3914127 0.I199' 0.69722974 21
167
Date regue/Date received 2024-01-16
80001_769 1211 11.32736 20311655 1001 22.97 12
14,38, rc 0.1',,..999 0.971 14
soy_001_1458 139 11016943 16,15347 437 2484 13 9.710922
0,138 0.920489 31
soy_001_6538 1143 11. .10.1 16360155 221 247 8
9.8061761 -- 0,145 0,74491086 -- 31
8oy_OG1.J. 1134 88734031 22.75124 25.3 12 2011124
0.12 0.52817 26
soy_001_4110 135 018921 22,066422 347 2521 10 12,5533
0,106 0,70 1 15
soy_OGL_48 1314 10.02758 11.111111 231 2.85 8 9.11' 1
0.1 is1001 0.8601212 28
soy_06L312 1419 7.7600741 14.1 W Z58 11 8.6775455 --
0.103 0.81143605 -- 22
soy_n_1169 1080 68010788 17 'w 3116 26 7
7.2338176 0.13500001 0.91220116 27
soy_001_1314 1180 5.739979 13.818112 1539 E81 7 4.536173
0.103 0.7934392 36
80001_2505 1229 1.4074678 14.48332 81 332 11
4.70 0,1 0.1,N 0003 0.835281 21
so0G1_3282 1034 2.316637 15.4722 231 3.69 8
18.584831 0.1, 1002 0,94 26
soy_031_5277 1100 82168961 23.272/3 261 2.45 11
15.129727 0.132 0.77 , 11
8 001_2917 18 9.6217709 12.. 1162 233 11
9.5255142 0,07299998 0,9891t.7 28
8 001_6 1014 7.0800479 20,391062 4131 Z79 7 10,98561
0,11 0,86791611 27
soy_OGI._369 139 82718424 3,8038126 4295 3.58 10
7.3061643 0 03163301 24
soyfik392 131 1.4611053 0 301 358 8 5.7443E8 0
0.7653108 27
sr:y.0,2494 133 1.548306 1525308 2299 24.43 11
24.883781 O.iy9999 0M. 8
soy_0G_3301 1100 9.4088583 8.454545 201 2.81 8
7.5113416 0 0.93574196 18
soy_00._3325 1100 10.,+ 322 9.631364 3734 26,81 7
3.1949787 Q.t 9998 0.380392 26
soy_001_29119 1110 9.6460093 10,510541 4570 2E03
9 9,9341003 0,015 0,130' 1 25
soy_061_3782 1151 13.30455 19.83142 2001 2s1 11
9.3722401 0.112 0.69687033 18
scy_001.3451 1243 9.1464834 10.61942 120 27,03 11 12.57913
0 0.5741474 28
soy_OGL,2581 1000 5237216 236 4219 233 0
10.500379 0.103 0,66318882 15
soy_001_3473 230 82841069 18.73913 1197 2195 4 1.913431
0 0.63 25
so0k4383 130 7.8500838 17.857143 7632 239 8
2.5786703 0.157999" 0.512286 21
8 001_6141 138 4.9215565 20.03511 1001 21,55 4
5.2626381 0.11730003 0.77( .1 16
soy_OGL_816 1400 11.647924 12.571 0 14717 318 7
22195245 0.11E99999 0.75173138 23
soy_061._6489 1316 93729401 19.331396 364 2332 4
5.3833938 0.124 0.65526479 19
8 001_5938 220 6.6873031 14.43011 1144 Z04 5 10,51913
0,023 0.735874 24
soy_OGL_548 2110 10149329 3.11 e. 227 3.3 9
3.8075345 0.015 0.355383 20
84001_895 190 7.0014801 211 691/ 24.26 7
2.1635042 0.1 0002 0.66731843 29
168
Date regue/Date received 2024-01-16
so/01_1290 123 6.4559865 13.26053 525 2141 8
19.324512 0,013000001 0.64861143 16
soy_061_1383 1142 8.1746645 23.9 5414 287 2
5,799150 0.146 '0.801 0, 35
soy_OGL3001 Me 81826014 212r 'Y'T 10518 2407 8
8,777573 0,107 0,7923277 25
soy_061_4948 1022 14E64356 2101 11504 22.89 5 9.11629
6124 0.7567305 36
soy_061_5482 102 4.7314305 29,20021 1277 22.7 7 12,1'
0.13699999 086368505 33
soy_061_6413 1631 7275495 22.1322 257 2.74 10 1757007
0.081 0,6211347 14
m061_6817 140 66239986 20.428572 424 2531 3
6.2747641 0,0" 9999 0.80407619 32
soy_061_125 1129 71176685 22,40212 15258 20.9 2
10,823194 0117 0,58601433 8
64_061_126 1006 5.3318148 16.14).i 33701 245 1 0.33166361
0 0.58729112 8
soy_061359 1707 5.045455 0 9748 21.26 4 0.777270
0.103 0.584122 13
60061_1369 1721 5.159312 2,61475 MR 27.25 5 14,44,
0.015 0,78979486 30
soy_061_2832 100 55518873 2.1 17/93 2.2 5
7.9335485 0.12 0.6624223 22
soy_Oa_282 190 5550873 17.31579 3017 24.68 4
9.226007 0.01200001 0.66507626 23
soy_061_6024 1787 1 .861 15,668718 2091 2.21 4
3.2254357 0.07 0.38677618 14
64_061_6073 1871 1.4229615 5,965i. 1 23.38 5 7,5 ;1:.12
0 0 3
soy_061_6210 1160 5.035438 12536364 24444 2127 2
0.5832207 0209998 086 20
60061_1579 1419 8243002 23.66 75 1001 20.57 5 322,114
0.1 .997 0.791,, 24
soLOGL6338 1100 5.0019697 22,818182 ritA 2236 3 10.7=', e
0.117 0.90 7 28
soy_061_1693 1 9,4963474 11.70805 2182 8
tom 0.118 0.6580362 16
soy_061.,5750 1413 12.480519 15,214, e 24.35 8
0,118 0,7284e5 15
soy_061_3047 1025 32.947975 4.39244 18154 7204 3
40.721748 0.12. 0.66471487 10
soy_061_2997 1400 11117564 11928572 4291 107 6
1.5416789 0.1 0001 0.8033211 21
6 061_3003 1135 6. 621 22,026432 5448 am 4 8.3077583 0,126
0.787 23
soy_OGL_3030 1500 9.2140102 20.6 2175 EA 5
1.5475408 0.094999999 0.73435748 15
soy_061,5168 1100 8$415621 100,- 2901 28.66 5
0.25877857 0.054000001 0.84149159 16
say_061._4063 1137 041112741 33.597187 20.49 4
10.381552 0:122 0.061580112 3
soy_OG1, 1318 7.3934207 32,51r, 2335 .1 2 7 2.2608349
0.104 0.5031885 20
soy_061_5985 1363 6.010385 23.47703 231 2111 8 7.7244382
0.14 0.61011537 15
soy_061_1',' 1000 7.7554264 264 4591 73.2 4 8.3350639
0.145 0.49361532 25
soy_061._1983 1564 9.3477869 22. 11 142 20.71
9 14.358272 0.1 00002 0.4733255 23
soy_061,3232 1456 8.263296 8.4478025 3601 26.51 4
18.384919 0.1 .110001 0.72366023 38
169
Date regue/Date received 2024-01-16
soyfia_3347 1013 11.12724 22.345337 251 377 5 5.69H 0.070000002 0.8414803
25
. v1_001...1190 1415 44395017 25,01 , 5393 72.82
9 8.043172 0.034000002 03042E3 20
= soy_061._29011 1346 10.117564 14.78547 , X26
6 0.36834088 0,108 0.802E17 21
soy_Oa_1227 1445 9.0314204 12283135 10422 23.59 7
6.3736272 0.1 KI10002 0.76927871 20
soy_00._2432 2119 0,7086917 1,840808 21.91 7 2,6701577 0,1
0,74964249 8
soy_061._932 1180 12.419766 18.271128 10190 23.51 8
7,9510646 0.124 0,7071E3 27
soy_08._5293 1429 21.185158 0 11/55 25.75 6
19.147211 0,063000001 0.73244917 24
soy_001_169 1100 1.9087936 15571428 7442 21.85 2
3,8741975 109780003 0,72681591 8
soy_O3I._5R 1# 4.41186 26444701 8155 21.86 5
3,0133138 0.13 0.4668E435 24
soy_OGL_1983 1490 6.3444653 131087248 23.75 6 12.749681
047/ 0.45463314 20
soy_OGL_243 10% 11.87738 9,8455601 1 , 24.71 3
7.4612837 0.105 0.72240337 26
soy_OG1_265 1137 6.8734031 22155145 1001 nis 2
2,22Iez 0.1, 10001 0.5311 r, 25
soy_OGL_5058 1054 6.5004026 12210015 21673 21.61 2
10,64931 0.010999"1 0.60025418 9
soy_OGL_6713 1591 21221162 0 24309 21.26 4 1,34E11
0.011999997 0,6551057
soy_OGL_80 1729229 1491347 5100 21.74 4
11.2264Ã 0.448 0.79952919 26
soy_OGL_3731 1011 8,292532 8,444951 7342 24.53 7
4.6587062 0 . 0.798101 25
soy_061_6415 151 10.411439 19.349722 4; 21.01
5 3,4534619 029000002 0.53727 ' 26
soy_0GL_3921 1716 9.3006687 11.91223 3174 3.76 7
5.3629156 0.001 0,80496311 18
soy_06L_4132 1100 10.342244 0 11720 23.54 7 8.310141
0.023 0.82911622 32
$0061_443 In 9.7329044 9.655111 6734 20.26 8
30273" 1096000001 0.61501351 24
soy_001,557 185 10.512985 0 2416 20.89 5 21.12562
0 0.65375495 24
soy_041._6861 1100 10.103802 0 5139 22.27 5
11.291002 0 0.83 o' 733 28
soy_OGL,6919 14C 9718 0 19332 5.42 7 7.809248
0.001 0.8943207 24
soy_OGL_3,I 1104 1.0910363 13.346614 7285 18.32 5
4.6100678 0.011 0.977/82 22
soy_OGL_6162 1129 16402263 0 341 3.78 4 5.57314
0 0.8201993 16
soy_061._66 1130 9.4738331 0 3072 5.55 5 5.57E6711
0 0.74' iA 14
soy_061._4958 1013 12.134647 15.8 12512 723
8 9.381771 0.11 0.7 7 33
soy_00._824 1328 8.841375 14.533133 4003 25.6 6
9.26E78 1057919998 0.72531813 23
soy_OGL_921 1100 11.56674 14,272127 7241 23.45 6
5.7870272 0.0199997 0,69627601 3
soy_O3L_2410 183 11.87733 14.95134 4532 24.42 5
2.3877332 0.105 0,70541009 , 32
soy_041._4152 1400 9 , ,;871 18.071428 7272 23.14
7 11.020111 1021000001 0.89018904 21
170
Date regue/Date received 2024-01-16
6 091..5023 1644 12549116 0 4019 IN 6 8.5845413 0
0.66562349 28
soy(41._5335 1130 24.160017 17, A% 231 18.76 1
2.454127 0.12 0.56202143 9
64.091_87 1071 74370308 1839101 9102 21.75 4
8.342742 0.1 '9991 0,77 30
soy_091..164 1183 1.6461914 30346577 3904 16.62 3
0.4E4253 0.12800001 0,711/8753 12
soy_091.319 1110 10.951314 17,1 .; 13573 2.69 5
8.1754532 0.1' 110003 0.91154957 14
soy_091,_846 1035 5.E0145 31,7 I' #A 773 18.9 5
3.9663272 0.101 0.640E13 15
soy_091..863 141 1,9338479 19, ; 2031 224 6
8.3454552 0.07259! " 0.56143820 14
soy_OGL.899 1257 6,5197372 14,79714 12146 238 6
10.012576 0.064000003 0,6705454 30
soy_091._1956 ; 19318343 0 12290 25.41 5
2.0861154 0 0.50911235 20
soy_OGL.3140 164 7.3E849 359'i 3954 15.78 4 5.1 .
0.1E0001 0.52646511 17
soy_091,4 1255 51943801 15 219124 1251 29 4
2.1227094 0.050000001 0.5164755 18
soy_091.6128 1831 1.5205039 3,491 15290 1E99 3
1.2916712 0.0 99 0.7453E6 7
64_061_150 1025 4. "f 654 24,390244 3135 19.12 4
5.3307251 02E9 0.68354493 11
64091._254 124 12.798174 0 ' 2.25 4 6.9227238 0.002
0.86745471' 19
soy_OGL_503 150 4.4821186 0 15182 21.13 4
3,758431 0 0.4615915 23
soy_OGL794 1100 93135421 0 18106 23.27 4 7.5178504
0 0.871 . 22
soy_OGL.2002 1185 7.3541341 16,202532 201 20 3
2.8522315 0,117 0,4421458 15
soy_OGL_2015 1199 2.E5314 13 261001 11' . 18.59 6
9.470521 0.05'1199 0.4761 , .< 11
soy_06L.2214 123 7.2443314 15301702 . 18.73 7
7.2036252 0.022 0.70563301 19
6009(.2395 1100 7 . 226 17, ; 1 . 14.1 6 12.7
0, 9999 0.63114941 8
soy_091._2618 159 8,51056 0 ... nip 6
17.240136 0.002 0.59419579 22
soy_OGL.2102 1299 0.60916 13.78168 4003 21.63 2
13.1 4 # ' 0 0.32329145 10
soy.OGL.4045 1386 04324766 0 11620 20.27 2
2,2522611 0 0.40875053 15
soy_091._4224 120 4.0722065 4.692475 15262 21.15 10
23.34E6 0311 0, 41 30
soy_OGL_5155 MO 7.357619 3,66 2122 20.64 1
3.5326513 0 0.77613714 19
soy_OGL_5651 1263 7 297 10,213777 14802 26.17 6
12,44911 0 0.52972412 19
soy_OGL_5741 1000 13.020522 11.8 13357 28 5
4.961042 0.074000001 36991456 16
soy_06L.6040 1511 14939761 0 23781 20.64 3 1.6381 ; 0
0.2230573 7
600..6208 1300 5.535438 0 17944 25.14 4
1.3429111 0.035 0.86870378 29
soL0GL6327 SO 6.754411 5.133E5 15339 2066 7
5.0981179 0 0,91 19 23
64_091..524 1728 ; , 266 28.125 7 22.56 4
3.9502525 0 0.06744684 22
171
Date regue/Date received 2024-01-16
54_061_110 10I6 14.638623 24.30 648 216 5
4,2828245 0.1 9999 0.7271 , 12
soy_06._544 140 10.749329 29.2 11809 23.1 4 . 22191281
0.081 0.3591132 18
soy_06._194 1249 8.3450031 11529223 10121 24.09 8
6.7889334 0 0.8017354 20
soy_061.3480 1154 6.0115023 13.171517 3305 22,01 6
13.355197 0 0.6476264 27
soy_06_1293 1443 6A559865 25.79 L! N4 18 6
24,135013 0.057 0.6441613 15
soy_OGL_3144 11111 9310147 18.891916 11 v4, 24.52 5
5.892726 0 0,569237 27
soLOGL.4774 1(162 6.7980485 29.4/ 426 20.62 3 15.31
0 0.84201354 0
soy_06._5683 934445 32.514179 1031 18.43 6
2.0456254 0.102 0.461995 14
soy_06_805 1010 92155247 13.570741 11 23.86 7 15245289
0.13 0.84214/95 21
soy_OGL_4714 1344 56724916 0 13011 28.57 7 8.433548
0.06100001 0.58303 33
soy_06._2693 140 9.7915058 0 1261 21,05 7 65853783
0,059 0,4.( 22
soy...06_1605 163 531703 19.9 . 21.7 2
14,7. 0,139 0,6836632 14
soy_OGL_2654 1030 6,8734031 0 20336 21,8 2 27,018221
0.121 0.5327028 25
soy_01_2655 19 6.8734031 0 2305 31.53 2
27,018221 0 0,53 25
soy_061_5068 160 491739 20.7- 15574 21.8 4 0,8991F
0.141 055673891 7
soy_06_6041 1400 Q,N 134 7.3571429 11958 121 3
3.46. 0.09069998 0.22245409 8
soy_61,3379 1403 10 '937 13.92672 4674 25.85 4
22.895531 0. , .1 0003 0.752795 13
soy_06._1366 126 5.1467152 6,583333 7714 27 5
7.5851874 0.0190003 0,78811354 26
o06_2228 1418 6A599118 2.0451341 8011 26.16 6
2.9117713 0 0.7216463 17
soy_06_3487 1103 8,949073 16.727722 22.9 7 5,4
=,",' 0,126 0.62752601 19
soy_OGL_732 1 , 9.948711 1,7777178 3032 2133
6 9,4642086 0,011 088 ,7 12
soy_06._2205 1015 6.940923 7.3684211 7123 2622 4
8.3576164 0.0999997 0.76473188 30
soy_061._4011 19 7,0E67925 2,8 4 ( 216
7 5.0208158 0.034030002 0.70561922 15
soy_06(6239 1519 6.1478391 0 29 26.68 4 5.04 ,
0 0.89912931 19
soy_n_6910 1000 7,0806479 8.5 7972 22,6 8 4.0681224
0.012 0.87953 16
0006,815 1003 11$47924 6.301 II' 1419 22,8 7
2.21 0.139999 0759532 23
soy_06_1258 102 10193349 0 196 20.07 7 7,63
0.044 0.7105763 20
soy_061_3387 19 594336 7.4264708 3255 22.35 4
6.402464 0.107 0.709765 17
soy_06._4013 1278 7,037925 0 6787 15.02 3
7.881946 0.190001 0.7037701 15
soy_01_5029 19 7.1732235 0 7 7272 5 9.6955204 =
0.122 0.662249 30
806:6168 1054 10.100551 14.61746 6018 24.66 6 8.0 .
124 0.1, 002 0.8' i1 15
172
Date regue/Date received 2024-01-16
soy_OGL955 133 14.275198 54615313 4112 353 6
9.0945778 0.061989999 074. .1 21
soy_Oa_173 150 11.665291 11.7 9176 22.5 7 15562157
0,117 036817443 13
soy_Oa_2256 1430 68701208 0 6541 3.64 7 48762787
0891 0.648679 36
soy_091._3754 1103 7.7002705 11.93091 5171 22.9
9 19.9 ;, O. 9998 0.7514163 22
soy_O0L_3913 1316 13006687 17336017 5553 2013. 5
8.1068077 0.068999998 0.7881608 22
soy_061._503 137 10.114509 0 459 344 7 16.151352 0
1654,, ., 24
soy_00..,5190 1385 13.332328 3,321 /613 262
6 24.174467 1 ,:,9999 19530152 16
soy_OGL_5193 1203 13.332328 0 3270 24.66 4 9.077354 0
0.95716915 16
soy_Oa_6332 130 6.7954488 23333333 6676 3.16 5 22802701 0
031494471 28
soy_061._6442 1074 9.47616 3313145 1024 23A6
2 21.210107 0.1,'K 4002 156035125 36
soy_Oa_653 1,900 21.291258 26333333 2479 2613 4
5.1097422 0.054000001 0.7130425 16
soy_061._6;, 134 7.515479 0 4451 2.14 7 41.93365 0
0.866002 24
Ny091..4203 1200 38646741 17.5 5861 2208. 8 19338946
0.019000002 021;'4 18
soy_00,5146 133 4.3001404 4,7.',;1 4965 376 2 10o,
0, 999/ 176306772 21
soy_031_61 1010 11.010665 .23030001 11443 26 4
3,9521847 0 0.83901215 28
soyfia_1346 1300 8.1570683 53845154 4060 323 5
5.73,' 1( 0.034000002 0.73316212 12
soy.06t,1586 1400 6165653 3,7857144 6/92 2435 6 17.787373
0 0.7734524 17
soy_061._2059 139 3.252 0 11 22.83 3 5.891237
- 0 0.493638 11
soy_Oa_2057 1715 3.071405 0 2001 25.88 3
11A,, 13 0.002 0.56 1 11
soyfia.,2782 130 2.5031645 11 4833 21,33 6 7.897 ,
0 023408741 10
soy_00._2786 1* 3.111991 13 4556 1136 4 1.8905044
0.103 0.2249565 11
so/0131_2820 1174 2.0155141 11325042 2023 355 2
14.573421 0 0.53.1 16 6
soy_061._3036 1S 98306324 5,4.1 25.93 5
869i. 0 0,70032763 10
soy_00._3427 1329 21198702 10.910459 16/52 3,4 6 8.1391033 0
0,50897437 6
soLOG1._41, 1003 58913801 7 1 255 6 1.887027 0
0.51, 5 18
soy_061,423 1* 4,0/22065 amme 9162 2136 8 27.93349 0 0,2641513
30
soy_061._4218 13 5.4117641 4,77707 31 306 6
7.7247015 0 0.36349437 19
K1_05..4769 1400 6.7980485 as .117 3506 20.78 7
28.525553 0 0.8391 9,!7 9
soyfik.5655 1113 5120719 8 1259 2181 5 5.09377
0.111 0.510215 20
soy_O6t_ 164 9 ' 9.2741,, 5104 2131 5 7.154157 0
0.44900176 8
soy_0613146 1.,1 7.0188165 0 1361 El 3 23176741 0
0,77614742 18
173
Date regue/Date received 2024-01-16
soLOGI.3412 1389 10.411439 3,95' i 225 7
20.2301 0.071000002 0,6321064 22
soy_061_6508 1414 7.9388223 0 q I 26.51 6
9.4914484 0 0,6886E2 23
soy_OGL3381 11E 10.' 937 24 453 22.9 6
16.953121 0.116 0.7520607 12
soLOGL1973 1300 11,715036 2.5334614 26.07 7
10.32225 0 0.48657143 26
soLOGL2675 1100 10.232681 7.727275 E37 572 4 6.7602E2
0 0.5036E6 23
soy_OGL_351 1E0 7.352849 22.61535 , ,4 24.3 5
4.3533444 0.081 0.52625/51 17
soL06L5393 1220 9A848547 19.91E34 7518 V .6Q 4
13130116 0.071 0.71241558 20
soy_00L3791 1200 4,9141066 22,91 , 3251 2016 10
6,685071 0.074000001 0.66741199 10
soyfik,2606 t 72494159 21.035118 2/34 21.03
9 1.92 " 0.1 10002 0,60441581 14
soffia_808 1E0 61196387 39272728 , 1134 19 6
4.7054672 0,1 , 9999 032462502 14
soy_O6L1807 1119 4.150126 22.341375 2E1 134 6 5.9031E4
0.11 0.78493148 20
soy_OGL2250 1* 3.1745132 22.515454 456 7463 9
12.284534 0.09/000003 0.657s= .1 25
, soy_OGL191 1408 83450031 14.485E1 3622 2463 6 3.590
0.009 0.90030334 20
soLOGI._1872 13F1 676 14494876 711 23.27 7
5.167703 0 0.71 24
soy_OGL2819 1171 2.0155141 28.437233 1547 22.51 3 034709105
0.055 0.534'!4 6
soy_Ork6130 12E 33018011 12.567E3 1031 225 6 3.4324322 0 0.76
15
soy_00L217 1516 3.4504049 23.08E7 8218 sio 3
3,31605 0.06900002 0.6410147 12
soy_OGL523 1 2.107695 17. 'ill 5103 22 8
9.9958744 0 0.4170104 12
6(1_0CA...2013 1* 2.7130883 25.200001 16103 719
4 10.42537 0 0,38354871 10
soy_0131..,3411 1170 2,4898665 38205128 9944 16.75
3 1,271538 0 0.610E617 5
soy_061_5151 1200 4.0681992 23.75 6159 23.18 - 2 23851
0.0E99999 0.7755E76 19
soy_061._1889 130 9,4063474 28.75 5478
2311 6 5.0912738 0.09700053 0.66732794 13
soy_OBL5971 105 83158064 24. 3296 717 7 3.41' ,
0.0 ' 9 0,65628064 15
soy_00L_4282 110 5.4775915 3123077 4359 2046 10
71021528 0.097000003 0.37E7521 22
soy_05._505 103 4.4821186 36.79E09 1382 54 3
1.951 , 're 0.015 0.46513784 24
soy,961.,1679 1147 9.1770983 22.4E217 6276
24.06 9 5.563E57 0.1280051 0.7171, ?, 19
soy_OGL526 1119 2.531695 19.677E6 13950 2262 4
1,1714416 0,112 0.41122513 12
soyfia_867 1200 8551517 150. , 16191 2816 4
2.447158 0.1 4001 0.655355 13
soyfia.6881 140 41201587 4,855E34 7550 5.7 7
7,3944702 0134000002 0.85187435 19
soy_061._21;1, 150 1.7034707 16333334 7133 215
8 3,01 , 75 0.1 00004 0.7581917 15
soLO01.J74 1006 102E827 12.127236 9336 an 7
4.9399786 0.052000001 0.946116/5 1/
174
Date regue/Date received 2024-01-16
soy_OGL.,3:11 1257 6 '155 19.093979 2232 23.07
10 6.8811 0.074020001 0.63179487 14
061_5555 1406 6.151978 14,417614 4563 2514 10
11,661 0.("'99998 073495758 17
soy_00._524 1027 2.3637695 13.1430 3508 3.62 6
4,78742/9 0 0.41 12
soy_OGL1327 1448 0,24154867 47651935 nes 2641 4
3.2512007 0.013 063517106 13
soy_0GL_2811 1024 0,41487023 19,824219 6152 18.75 4 0.06323374
0.138 039101377 6
soy_OGL_503 130 624026 14.583333 3993 2416 2
051741338 0 0.5977315 8
soy_OGL.5063 1110 5 d1674 24.414415 4021 21,26 6
1.4199103 0.104 0.56623471 6
soy_OGL_5347 103 2311871 22,19153 3611 19.88 6
2.77 0,13 047 , 4 12
soy_OGL_6045 103 1.461244 21. 1233 21.9 1
9,2988129 0.024 0,20097449 10
4_00..5644 IMO 92479429 25.201011 1919 212 6
5.012624 0.13 0.53131416 11
soy_OGI.,4014 10M 5.03801 11,819021 4660 3,4 6
5.60, 0 0,52510231 19
soy_OG1_6342 116 51157908 8,3033494 21.43 4 85079031
0 0.89553189 24
soy_OGL3481 1 K , 61115023 21,528997 2013 2224
7 16.211184 0.124 0.64770103 27
soy_061,3166 157 10.815026 10,01 ra 1001 20.77 10
8.3528242 0 0.617, KB 16
soy_0a_2967 1 1 N128 29 3017 3.11 5
16.259047 0.1' 0002 0.85343832 19
soy_OGL1938 1705 18.633888 2011302 2509 21.92 8 14.1 ,,
017399! 0,5435487 23
8061,2278 1103 13.593581 36277128 au 23.06 4
14,';167 0.15099! 0.62663764 42
soy_00._3512 1400 45245277 109392 6273 2171 8
17305138 0.079000004 0.7 19
soy_Oa_6174 11 9.950914 36, +1', 2001 225 9
38.534607 0.132 0.81710821 17
soy_OGL_253 le 7.035044 23,I'10 SIM 2427 9
33,786243 0.102 0.6913E112 20
soy_OGL_1943 7/927543 33.625 X81 8
9.383131 0.1s, '99' , 0.5333515 19
soy_OGL5616 1372 27.974483 33236153 7576 14.59 7
14.4. -K 0.103 0.62744445 24
soy_O6L_6427 1000 11 , 9 36, 7640 237 7
10.394670 0.132 0,5469131 34
soy_OGL_2285 1100 12.33853 37,515456 2395 ZS 8
24.46351 0.1 0.62272936 40
soLOGL_3946 1800 3245321 35 SO 316 8
3.9812493 0.003 0.87902057 25
soy_00L_4461 1705 7.5555859 36,13132 2001 2451 11
50,40135 0 0.70177817 24
soy_061_4494 ite 381 2511103 11511 21.63 8
8.0918341 0.117 0,7351 K 31
soy_02._4994 1067 81126404 33,364514 3146 3.61 6
6,4871373 0,127 0.70410007 25 '
soy_Ca_6739 1137 8 349 30, 11 5816 Z24 7 4,9774494
012 0.72794956 26
soy_OGL_503 1697 7.1732235 31;4 , 340 2486 6
8,440314 0.07300004 0.662343 30
soLOGL714 img 81120693 37, , 64 2183 Z59 10 55.71 ,
0.103 0,84', tie 25
175
Date regue/Date received 2024-01-16
soy,00._960 1019 14.874959 31607149 6460 2/16 8
6.040082 0,133 41491288 21
soy_061_1; 1100 5.552063 33.'1..12; 8630 25.81 11 28,75
0,122 013620456 26
soy_00._2271 1000 12.386147 2/7 29,9 8 11531806
0,115 0,63101834 42
soy_001._5297 I 23.118028 33.400002 2447 28.06 9
11.172051 0.071999997 471312803 25
soy_00._4141 1065 12.634075 31051643 NO 25.35 5
9,0971. 4118 0.86415462 30
soy_OGl_5308 1930 18329891 29, 2001 26.1 6 4.'1 0,126
0.6904512 29
soy_00._4414 1115 7.9796275 35,246635 2031 17.17 7
31.545551 0.104 0.70 29
soy_061._' .1 1M0 10.870666 29.5 ' 21 5
2,6011 0.12 0.63719152 40
soy_Oa_5279 8 /1;141 32,818126 5460 2E19 8
17.484406 0.11. 0.76929039 20
soy_06(5532 1700 11 ;',812 31.71; 1 26.11 7 5.51.'
0.1 99998 0.78747123 24
8061_6430 1400 10.461443 38,51143 6431 2118 6
3,24 1.; 1 0.101 0.55747079 36
soy_Oa_3332 1018 13.0E42 30.853174 E1 2559 7
5,7824192 0.116 0.86402/68 30
soLOGL2. 1900 14209874 35,1'A 1414 2189 14 30.237134 0
0.4871E5 25
soy_00._2931 1378 9.9775036 33,;v4, 1362 23.31 7 22A. ;
0.';'00093 0,93399233 18
soy_Oa_5186 1200 11212205 -37,1. -" 4582 2183 7
16.435446 0Ø. 0.93411744 20
soy_Oa_6945 1221 11 II 709 30,876331 7620 27.68 7
25.567091 0.057999998 0.922252 22
soy_Oa_1361 1 5,1467152 28,514117 1001 2568 5
20,7 0.14,19999 018919172 27
soy_Oa_5326 1M0 11147804 37. " 7/61 228 8
2.601275 0.054000001 0.6571E31 23
soy_Oa_2551 1100 3231226 31,272128 5427 24.68 10
28.220612 0.132 0.72111541 22
soy_Oa_4156 17C0 9 871 13, 3111 17.05 5 23.62254
0.059 0,8934 'e 11
soy_Oa_3377 1319 1 " 937 19 711903 1 2524 3 30.21183
O. 00001 0.7530E7 13
soy_Oa_2281 1193 13238867 24,811399 12388 2197 2
50.819614 0.015600001 0.62556702 42
soy_00.,5617 1CCO 24.530188 33,900002 SIN 348 5
19,1 .1 0 0.62672412 22
soy_061._445 - 1099 7E5381 3752217 9794 2149
5 20.38117 04000002 0,73631674 34
soyfia_4179 1000 18.005168 26.1 8478 22,9 6
11.109677 0.14300001 0.17835215 15
soy_OGL6 7X6479 18,846153 7551 2141 6
48.317772 0.064999998 0.86612117 25
soy_061._6011 1Is 691 20.5,1 7 lb 2134 7
11,678254 0,024 0,6; ,! 16
soy_Oa_5424 11% 12267535 32.1, it 5059 23.09 5
8.4590149 0.124 0,9;14518 12
soyfia_4991 1* 8E26404 29,727272 5041 0.18 6
5.2647104 0.126 010415664 26
soy_Oa_4284 1W 5,2715 31. 6554 24.68 10
16.591681 0.125 0,37 hi 25
soy_Oa_4396 1200 82008438 36,333332 5289 215 5
2.9721193 0.118 0.5590116 22
176
Date regue/Date received 2024-01-16
soy_061.304 1700 6.4E132 26.941117 8821 26.11 7 12,832253
0.044 067 30
soy_091_988 1891 9.5245228 22,633E 8944 35 5 1,8149128
0,013 0.7721E1 31
soy_00._5562 1500 71774553 39.. 157 72.21 7 8,33E67
0.07E0001 0.71921456 20
80061..1504 1421 7, ( .223 33.638283 = 24.98 6
9.4914404 0.088 068837774 23 -
soy_061._313 1144 8.3777838 36,3635 DE 23.42 3
8,1' 1,1 0,125 055801493 26
soy_OGL_4245 1400 9.9370441 33.92157 -3195 21.14 10 4.3158221
0.126 018908476 20
soy061..6438 10/0 10.461443 32.616821 9331 25.7 6
3.24:1, 1 0.114 055697411 36
soy_061_1946 1467 24.109264 29.58415 4143 32.58 4 10771916
0,024 0,52529151 18
soy_CGL430 1010 1213607 28.911" 4799 26.23 5 7.6492915
0,122 0.68339479 22
soy_06L..5930 1100 51E252 33.18182 6171 24.12 8
28.24755 0.111 03431533 18
,soy_Ork,6671 1035 9.132 38,647343 1001 2317
6 13175145 0111 0110815876 22
soy_OGL536 1500 10.0/1255 39.40E2 114 73.6 6 5.1524E2
0.07450001 0.37513965 21
soy_0G1._2424 1173 11.937738 29.582268 5449 3.42
4 5.941 0.111 0.72110523 28
say.,061_4428 150 8,8796873 21.68421, 5105 3.52
7 18496197 0001 0.615316 2$
soy_OGL_5240 1000 9 le 649 31,4011' 14440 242 4
4.141242 0.071000002 0.8824144 24
soy_0GL_92 1500 10.535975 34,533333 24.33 5 7.370636
0 0.768 23
80/OG1_2999 1011 8. ? 014 23,43931 2316 26.99 4 17,510834
0,139 07937302 24
soy_00._535 1447 10.491214 25.632064 1001 24.84 5 5.581
0.125 0.3762432 21
soy_O6L4924 1100 14161104 24 8291 2127 6 10.636489
0.103 0.77077025 35
say_061,5946 137 10.471143 11,455451 302 27.61 8 16,51646
0 031 24
soy_01.30 1041 10119623 20.551151 7214 23.72 6 4.90504/9
0.079300084 0.89101211 31
soLOG1_5000 1210 8.' e 253 20 173 22.97 6 12.333051
0.061999999 0.70040965 26
$0061..2274 1314 13.53581 18,436155 330 2919 6 9,6541538
0 0.6281 41
soy_OGL3516 101/2 5161209 19,063014 = 24.4 6 10.8
0.019999998 0.73991593 22
80y_0GL.525 1100 11.175008 34.18182 3824 23 10
30.85E 0.122 0.82970124 16
soy_00,5625 145 155751 18,071428 3716 a.21 9 9.2684906 0 0,6150766
29
say_OG1_6813 1003 8.395586 34,291108 7141 22.43 8
46.517914 0.012999997 0.84444761 27
soLOGL713 111 8.4636536 2717 3305 23.71 8 48.710068
0.1 0.848035 25
soy_061_1716 1107 31.132702 33.87534 301 26.1 8 3.4388704
0 0.833841 30
soy_01_3314 1220 165156 23.032787 4906 23.93 8 9,6485319
0 0.90317971 20
soyfik3505 1100 47.600048 11.545455 3419 27.18 7 5.103E5 0
07224772 21
177
Date regue/Date received 2024-01-16
600..3742 1331 92434053 14 3440 2584 10 31.219353 0
0.7823316 25
soy_061.6536 1158 8.6176863 2153317 1001 23.31 7
18,941451 0,!l'999 0.71 26
soy_OGL566 1032 21.491308 21,14l 1549 21,8 10 2,6/81733
0,104 0.3094435 21
soLOGL4500 103 8.7435341 18,1' , 2478 23.93 6
22,891724 0 0.7381341 36
soy_00._2991 1205 92852879 34,931750 4431 20.99 6
17,602253 0.0 998 0,8375555 24
soy_061._343 1100 47.600048 19.38363 4882 29 4
39.279321 0 0.71214223 11
x0061,563 139 24.815081 21.12307 2596 27.8 8
7.8393497 0.057909998 0.60297322 ; 14
soy_001._5194 130 14.27938 37.1933 3377 22.4 6
1146301 0 0.85381612 40
soy_OGL56 1100 11.04541 213313 5107 3.27 5 51.2874 0
0.84481879 28
soy_OGL3178 1000 16.902504 262N ii 23,8 12 12.075264 0
0.7073301 11
soy_00..,4791 1137 13.341439 20,434573 4370 2453
6 30,0 -le 0,122 0.9124369 14
soy_061_5633 1125 24315081 25.8. ;I 2361 255 9 17.'
0.112 0.6000234 13
soy_081._5987 1322 45.92946 7.1131388 1722 32.14
5 6.8589234 0.03999999 0.60041213 14
soy_001,1137 1102 1755291 19,630725 5174 Z86 7
15.562757 0.122 0.86833215 13
soy_081_3189 1100 1 4178 19.91 1' 2313 24.45 1
7.08781 Q. "9999 0.6549315 22
soy_061._5821 133 13.314646 9.1531458 3359 3.61
5 8.3399916 0.017999999 0.90595192 23
soy_06l_4677 1016 10101823 3,M " 3426 3,1 6 23.11.- 0
0.64664932 39
soLOGL6783 1100 11.164678 25.636364 6787 25.18 9
12.037078 0.115 0.77097458 20
soLOGL4575 1100 4374781 18 2010 23.9 9 17.41903
0 0.8280257 21
soy_O6I.J202 1100 6.3214092 11.121273 4591 25.72 8
3.2832642 0 0.861E677 26
soy_OGL3832 163 71831862 22.33 N 4692 24.97 10 6.055993
0 0.54331 27
soy_0GL351 1600 8.9636507 33,9111 I 1527 194 7
2.83 0.1 ; ; = ; 0.80754806 21
so/001,1385 1466 6.913424 11.051477 5366 32,4 6 15.37776
0.009 0.80617601 37
soy_OGL) 4 1032 10.571202 30.038759 1212 2593 6
5.9921 ; 0.055 0.617 . 1 40
soLOGL972 1258 13.58718 19.236883 10754 236 7
0.8237 ; 0.039999999 0.76140606 36
soLOGI_4154 1251 9,803871 30.855316 5927 21.22 8
9.7893705 1003 0.8931927 20
soy_OGL_2517 130 7.414678 24.41 1,. 1843 24.53 11
20.6 =;; ; 0 0.13 21
soy_061._333 130 9.9528103 V 4701 2115 0
10.634618 0 0.876 1 28
soy_061...8643 108 55271153 21,032392 1001 176 6
12.431443 0.022 0.9356653 26
soy_00._215 1414 1267678 29.20792 1291 3.72 6 13.993950 0.008
0.8224336 29
soy_00t,3951 130 23510066 31.200011 2498 28.4 9
5.5293403 0 0.8922311 20
178
Date regue/Date received 2024-01-16
6oy_081._5211 112 11.000355 39.3 210 242 10
15.08103 0.055 0.94579268 28
soy_001_5200 1027 23178028 28.919182 1001 72 8 12.561
0.066 0.7129353 25
soy_061..: 1500 12.443513 156 318 20M 6 4.1339521 0
0.75551416 34
(.4_0_1132 120 55739777 39.480 2031 3.8 10 34.: 0.035 0.98,
16
soy_0a_3317 1249 16.411713 31,865492 4654 3.14 8 9.698342 0,012
0.8943712 25
soy_0GL_3533 1111 8.9636507 26.37267 7212 2121 10 21.439M 0.044
0.79193574 23
soy_00L6743 1135 9.625119 25.654009 23.Ã2 9 9.613221
0.033 0.7307058 20
soy_n_6824 1M 6.5125389 19,033334 257 3.41 7 12,50 0 080
36
soy_n_6814 1111 13950586 32.8911/ 233 351 8 46.517944 0 0.8444E42
21
soy_130,1924 1412 12,936749 17,071E6 2133 . 7
13.087815 001, 999 0.5577/919 24
soy_00._42 120 8.7112885 2619002 2/.6 6 11,802042
0.013 0,88105152 32
soLOGL1251 1000 11.432598 24.2" 2103 3.5 8 7.91123 0.
111901 0.721339 19
soy_00...1421 130 11.385625 1628 2739 33 5
7.5641316 0.025 0.867513/8 22
soLOGL3215 130 8E44722 3141. t 258 375 5 1844492 0
070541012 43
soy_00._3359 1119 13.178452 36.311161 5104 2287 8
11.239 , 0.111 0.81161281 15
soy_08007 1M 15.172221 31.9 1155 25.5 5 4.82 0
0.81518292 25
soy_061.,2261 102 1, 7543 36.700001 313 /3.7
7 7.3165006 0 0.6300113 44
soy_OGI._5:'I 1100 14.017599 28.639364 3128 24.81 7
11,0'; 0 0.96, , 71 21
soLOG1.315 1100 0.6048651 32.81818 12158 24.9 10 6.216642
0 0.85 , 25
soy_06L926 1M 11.929564 25.72001 4313 23,3 8 14833132 0
0.69985145 24
soy_Oa_1421 1413 11.38756 26.893135 5035 3.4 7 2146118 0
0.8759133 20
80061_1954 1207 21,449512 30.903065 2652 359 10 4.68161.+ 0.002
0.51281148 15
soy_061_3356 1145 13.178452 24116158 234 24.54 7 12,8108 0
0.81180155 15
soy_OGL_1565 10N 10.29399 31.22i 237 3.5 9 51.865131 0.088
0.82041073 27
soLOGI.J182 120 13.715208 25.290001 5215 Z 6
8.5989015 0.124 0.911 17 16
soLOG1_415 1458 13.282036 9.6021048 1001 311 8 4.154063
0427000001 0.7090E878 17
soy_OGL 1675 1081 9.1/70983 34.597595 2484 24:; 12
37.194218 0.102 0.70751141 16
soy_OGL_3175 1011 11522595 21.902018 4E2 3.84 10 4.4895511
0.048999990 0.64831974 22
soy_OGL5536 131)1 5.0065071 14.07 Y.4 1457 3.36 10
30.070 0 0.67897791 19
soy_OGL_1732 1100 3114E44 24.545154 2125 318 13 32.735954 0
0.86079328 17
soyin_1582 1107 7.7159863 29.911e 1810 2173 7
44.191189 0.051999998 0.78661311 21
179
Date regue/Date received 2024-01-16
soy_061._4651 111 8.7303162 24.934153 1001 2835
10 50.50164 0 0.68424433 25 ,
5061_5188 110 12.553019 24.9 4, 3.1 8
26.710304 0 1941317 19
soy_OG1,925 1015 11.929564 21.73913 4830 222 6 15.610137
0.112 0.69'4 26
soy_n_5611 1000 25.14232 32 , 22.3 6 6.04,,
0.048 0.631 , 27'
soy_061_1955 1113 19.095425 22.012519 2429 384 5 13,459276
0,125 0,50 18
soy_OGL_469 1314 5.814384 20.736914 3196 240 7 26.64013
0 0.5421 23
soy_n_1953 1100 21.449512 12.363636 5300 21.9 10 4.660 0
151 * 15
soy_OGL,3789 1000 13.12341 27,2' ' 3490 211 8
17,3014E6 1054030001 0,6 IMi 10
soy_00._5959 1014 11.51946 28,735672 9160 221 = 5 1.8 ,
0.1 999 0.71IM 22
soy_OGL_3431 1100 1311813 35.19162 1284 1145 9 43.401207
0.108 0,51420781 12
soy_OGL_4219 1/0 5.5919851 35,923011 1033 254 9 96,342125
0 0,36612734 19
soy_OGL_562 101 21.41308 31.700001 3/54 20.4 8 9.4132E
0.061999999 0.31529731 24
soy_OGI,_1279 1205 7.1300635 23.1532 4273 24.64
5 23.64435 0 0.66881138 24
soLOGL,4294 1184 3.9414778 39,695946 554 115 11 32.6, '
0 0.3903373 23
soy_OGL_4659 1210 159167 25.51111 118 21.71 6 116.62761 0
167793731 26
soy_OGL_6408 110 64150654 34.11011 356 27.1 5 58.585674
0.078000002 047973934 16
soy_OGL_203 1011 1110499 7,115133 134 3,1 6 6,6491402 '
0 08111916 28 .
soy_OGL_3356 130 11.131104 14.61535 338 2515 7 20.024712
0.074000001 0.82251149 14
soy_OGL6235 110 11202364 18.6 7007 219 5
29.531097 0.063000001 0.89'1, 19
soy_OGL1941 1022 24.109264 0 6243 303 4 10.171916
0 0,52 ,1 18 .
soy_OGL_1991 1200 6311136 1115 i 2541 9 25.63 1,
0.046 0.457, 7 20
soy_OGL_5331 101 32.314224 11,28 6 461 21.02 5
3.659093 O. 111001 0.54Y 11
8(1_001...6890 133 1.0006479 12.533333 1391 341
5 = 57.15 0 0,86611112 25
soy_OGL_560 1100 21.124374 15.515455 7179 3.09 7
7.5 x 0 0.3233176 18
soy_OGL.5004 1010 4348846 30.855385 3972 388 6 18,012811
0.138 0.69220364 20
soy_001._3167 1450 11413348 19.103449 5133 327 9
2,7914271 0.06700002 0.623E4203 15
soy_OGL_3786 110 14.115368 255 3737 22.2 9 5.914100
0.081 0,68 ';5 12
soy_OGL_6850 1219 4.030374 16.810007 5364 24 8 16.279037
0 0.82384717 24
so/SA..195 1000 9,3835421 24 4408 3.1 4 8.754324
0.103 0.8105639 22
soy_OG1_47111 133 5.318872 30.001193 3551 2138 7
7.58930 0. 11003 0.57, 2 27
soy_081._6481 t 8. 664 22.315 3348 2518 7
5.251115 0. 0.64917505 20
180
Date regue/Date received 2024-01-16
soy.00._5400 1120 9.4736331 19.1' 104 = 3312 25.60 6
7.906413 0 0.73 4 20
soy#1_4191 150 5.9133652 31.1 7995 23.4 T
7.6569033 am 110001 0.20371133 21
soy_O3L394 130 9.5174052 15.41,1 5142 3.75 6 6.4867473 0
0.7641 24
soy_061_2612 1244 8.0021572 22.91 2001 23.15 8 6.029750
0 0.59597749 23
soy_061._2845 130 5,548873 32 3709 3.41 8
332; i f 0 0,67571117 24
soy_OGL_5935 1400 7.4355073 17.5 6518 2.78 8
10.077018 0 0.7 . u 7 22
soy_00._1353 115 11426744 26.02515 251 2.18 6
20.69 0, all 'r 0002 0,75391602 14
soyik1910 1503 15216813 18,333334 4526 3.13 6 6,86 0
0,61582142 13
soy_00,826 105 10.746717 36,70051 22 5 10,53E3 0.103
0.7235248 23
soyik901 1299 6.5197372 28 10078 2.64 8
12.647342 am k 999 0.67072812 31
soy_OGL_2971 157 11478155 36,34215 10536 23.13 7
4.8957019 0054000001 0,84 21
soy_00._3190 1400 10.529183 32.714237 2264 25 5
4.7417526 0 0.67169625 28
soLOGI...542 127 12.267535 33.701 ; 11.1' 2595 5
8.4590149 0 0,98036045 12
soy_0GL2624 130 1704776 32,6;;; 4254 311 9 4.46'
0.023 0,58054543 24
soy_Oa_6445 1100 9.0178334 32.54545 2297 24B 6 11.61035 0
0.57496 29
soy_OGI._6524 1100 21291258 25.363636 4079 35 4
5.109743 0 0.71310264 16
30061_3523 1000 1.51256 36,29 ' " 34 7 44,82053
0.01 0.751" 1 17
soy_OG(6887 1200 6.562184 19.1 6711, 333 6 25.491;;
0.1 110003 0.8611 11 24
sq_OGI._3906 1223 9.3006687 20.350368 4136 27.5 6
22.389164 0.071999997 0.76607245 20
soy_OG(.6236 1700 6.13264 7,5294118 3107 30.2 5 24,552103
0 0,8991611 19
soy_OG(.468 1000 5.16857 18.29 234 9 6.4829116 0.033
0.54701352 24
soLOGL706 1421 920959 11481914 422 3.27 6 14.093465
0,01.1999 0.8415483 19
soy_06(.1249 1400 11.287494 13,714206 3836 3.07 7
5,40 . 0,014 0.73023248 19
soy_0GL4206 125 3.6495144 2175 2260 2206 13 22.752178
0.046 0.22943813 16
801_001_6651 1100 1328592 12.363636 5447 25.9 8 3.0539 0
0.71791563 12
soy_OG1,4273 105 4 7567 23.79959 3013 216 6 14.624303
0.046 0.3565542 21
soLOGL615 11M 3.0726745 19 1079 3.72 5 34.027116
0 0.69433415 22
sol_OGL4111 1011 12.218921 15.263645 942 26,08 8 15.36775
0002 0.7082103 15
soy_061_1016 1735 64355277 1,5714697 ' 1001 2.65 9 9,627018
0,222 0,81906343 24
soy_061_5561 128 7.72199 0 , 2.61 10
1971511 021600001 0.71813029 21
soy_061._5581 1000 1.7752442 2366. . 4645 2846
8 7.661.. 0,22400001 0.71931098 20
181
Date regue/Date received 2024-01-16
soy_OGL_438 133 6397066 7.13012 21 2111 13
4.168813 0.206 0.665133 14
soy_001_3783 1413 13.30455 14.64 ; 1342 2526 11 9,2l
0.264 0.6 ; 9 18
soy_OGL_3970 ; 11100904 0 231 21.81 9 16342713
0.161 0,9420336 10
soy_00._5505 1201 5.734904 3.4893721 2031 26.91 0
21.531 023899999 0.83195156 20
soy_00._427 1517 13.017153 2,570/43 4535 3185 9
13.079314 0,219 0.66865764 24
soy_00._6892 1113 7.0106479 0 4570 3115 5 50526379
0,396 0.86; ; 25
soy_06L2680 137 10232581 6.4721971 2447 125 11
10. ; 0.222 149911189 26
soy_001_3195 1103 8.1151594 6,91 11 MO 2118 11
19,127 ; 1200001 0,60446332 32
soy_061._3709 12 10E461 2.5454545 344 21.63 9
21.530109 cal0000l 0.8350E56 23
soy_OGL_5323 1100 11.453777 0 1370 2711 9
16,1 m ; ; 0.252 0.66165245 25
soyjG1._6i. 1168 62792668 27397261 5129 2151 10
24752777 0.228 0.79340176 23 =
soy_OGL_913 110 6.1911.1 6.2307692 2526 2146 8
22.870914 0.2 0.681248 26
soy_OGL_993 130 8.2221594 6 278 29.3 7
15960431 0,299999 0.77285 29
soLOGL,6249 1019 611078726 0 5163 2135 9
21832757 02300001 0,90707/97 28
soy_00._2870 1410 5.5314458 11.14 i; "; 3372 ZS
9 4,272213 023899999 0.79814261 18
soy_0GL_1113 2200 1436457 1.4546455 ; 3116 26.4 12
13.853506 0.139 0,96 I', 1 8
soy_OGL_2484 1500 6,4331512 12.533334 431 BA 9
6,220 ; 0,208 0,8670343 22
soy_061._2521 12 7533769 54444447 1535 V.% 12
11.799416 0.228 0.8164358 18
so/002,5449 1 5134704 2.0325203 1150 27.74 11
6.9900832 0.161 19361319 18
soy_OGL_5919 133 9,5798969 6,453132 2109 28.07 8
4,7703791 11399999 0,83893353 18
soy_061._5202 1517 6245574 11.477 ; 5394 3.04 6
6. ' e 0.185 0.972 ; 20
soy_0(1_5913 130 8.4431925 10.8 5409 212 6
3.5827973 0.205 0.84570108 22
soy_OGL_6999 12 5,7162013 8,125 7770 3,62 7
6.6815712 0 le, 999 0.95974499 21
soy_OGL_7000 1302 5.0714023 15.745001 4581 21.95 8
6.407756 020900001 0.959 75 21
soy_OGL_3491 12 5.426621 15.683346 1/97 ZOO 9
8.4679823 0,199 0.65357959 21
P4_0131...2555 1107 4.8110962 12.009373 21.88 9
10,57 0,176 0J151'' ; 20
soy_0131.559 143 6.24901 4 3045 3.07 9
5.7310119 0.1" 9999 0.76 = 35
soy_001._682 223 10.540062 0 3174 32.61 9 11,1258
0,175 0.79761417 23
64_011_3177 1167 13249586 16.46;' 4061 431 30.64 7 2,444436
0.278 0.652343 24
soy_00._3614 193 52120034 1.38465 2116 11 15.39 "
0.15500001 0.8957833 13
soy_0(1_6986 12 4. 117 0 1; 311.84 10
7.4041352 0.162 0.95001721 35
182
Date regue/Date received 2024-01-16
DEMANDE OU BREVET VOLUMINEUX
LA PRESENTE PARTIE DE CETTE DEMANDE OU CE BREVET COMPREND
PLUS D'UN TOME.
CECI EST LE TOME 1 DE 2
CONTENANT LES PAGES 1 A 185
NOTE : Pour les tomes additionels, veuillez contacter le Bureau canadien des
brevets
JUMBO APPLICATIONS/PATENTS
THIS SECTION OF THE APPLICATION/PATENT CONTAINS MORE THAN ONE
VOLUME
THIS IS VOLUME 1 OF 2
CONTAINING PAGES 1 TO 185
NOTE: For additional volumes, please contact the Canadian Patent Office
NOM DU FICHIER / FILE NAME:
NOTE POUR LE TOME / VOLUME NOTE:
