Note : Les descriptions sont présentées dans la langue officielle dans laquelle elles ont été soumises.
MIS34 UC-9C
EXPRESSION LINKERS
~The invention herein provides for deoxynucleotide
- sequences coding for amino acid sequences which are
ribosomal binding site linkers, and are useful ln
recombinant DNA techno]ogy.
This application is a division of copending
Canadian pa~ent application Serial No. 371,674 filed
February 29, 1980. The parent application describes and
claims a specific cleavage linker comprising a
deoxynucleotide sequence coding for a specific cleavage
sequence comprising a sequence of two or more amino
acids which is specifically recognized and cleavable by
enzymatic means.
Recent advances in biochemistry and in recombinant
DNA technology have made it possible to achieve the
synthesis of specific proteins under controlled
conditions independent of the higher organism from which
they are normally isolated. Such biochemical synthetic
methods employ enzymes and sub-cellular components of
the protein synthesizing machinery of living cells,
either ln v _ o, in cell-free systems, or ln vivo, in
microrganisms. In either case, the key element is
provision of a deoxyribonucleic acid ~DNA) of specific
sequence which contains the information necessary to
specify the desired amino acid sequence. Such a
specific DNA is herein termed a DNA coding segment. The
coding relationship whereby a deoxynucleotide sequence
is used to specify the amino acid sequence of a protein
is described briefly, infra, and operates according to a
fundamental set of principles that obtain throughout the
whole o the known realm of living organisms.
A cloned DNA may be used to specify the amino acid
sequence of proteins synthesized by in vitro systems.
DNA-directed protein synthesizing systems are well-known
in the art, see, e.g. Zubay, Go~ Ann. Rev. Genetics 7,
267 (19733. In addition~ single-stranded DNA can be
77t,~
induced to act as messenger RNA ln vitro, resulting in
high fidelity translation of the DNA sequence ISalas, J.
et al, J. Biol. Chem. 243, 1012 ~1968)~ Other
techniques well known in the art may be used in
combination with the above procedures to enhance yields.
Developments in recombinant DNA technology have
made it possible to isolate specific genes or portions
thereof from higher organisms, such as man and other
mammals, and to transfer the genes or fragments to a
microorganism, such as bacteria or yeast. The
transferred gene is replicated and propagated as the
transformed microorganism replicates. As a result, the
transformed microorganism may become endowed with the
capacity to make whatever protein the gene or fragment
encodes, whether it be an enzyme, a hormone, an antigen
or an antibody, or a portion thereofO The microorganism
passes on this capability to its progeny, so that in
effect, the transfer has resulted in a new strain,
having the described capability. See, ~or example,
Ullrich, A. et al., Science 196, 1313 (19771, and
Seeburg, P.H., et al., Nature 270, 486 (1977). A basic
fact underlying the application of this technology for
practical purposes is that DNA of all living organisms,
from microbes to man, is chemically similar, being
composed of the same four nucleotidesO The significant
differences lie in the sequences of these nucleotides in
the polymeric DNA molecule. The nucleotide sequences
~~ are used to specify the amino acid sequences of proteins
that comprise the organism. Although most of the
proteins of different organisms differ from each other,
the coding relationship between nucleotide sequence and
amino acid sequence is fundamentally the same for all
organisms. For example, the same nucleotide sequence
which is the coding segment or the amino acid sequence
of human growth hormone in human pituitary cells, will,
when transferred to a microorganisml be recognized as
coding for the same amino acid sequence.
Abbreviations used herein are given in Table 1.
Table_l
DNA - deoxyribonucleic acid A - Adenine
RNA - ribonucleic acid T - Thymine
cDNA - complementary DNA G - Guanine
(enzymatically synthe- C - Cytosine
sized from an mRNA U - Uracil
sequence) ATP - adenosine triphos-
mRNA - messenger RNA phate
dATP - deoxyadenosine triphos- TTP - Thymidine tr.iphos-
phate phate
10 dGTP - deoxyguanosine triphos- EDTA Ethylenediamine-
phate tetraacetic acid
dCTP - deoxycytidine triphos-
phate
The coding relationships between nucleotide
sequence in DNA and amino acid sequence in protein are
collectively known as the genetic code, shown in Table
2.
Table 2
Genetic Code
20 PhenylalaninetPhe) TTK Histidine(His) CAK
Leucine(Leu) X~Y Glutamine(Gln) CAJ
Isoleucine~Ile~ ATM Asparagine(Asn) AAK
Methionine(Met) ATG Lysine(Lys) AAJ
Valine(Val) GTL Aspartic acid(Asp) GAK
25 Serine(Ser) QRS Glutamic acid(Glu) GAJ
Proline(Pro) CCL Cysteine(Cys) TGK
Threonine(Thr) ACL Tryptophan~Try) TGG
Alanine(Ala) GCL Arginine(Arg) WGZ
Tyrosine(Tyrj TAK Glycine(Gly) GGL
30 Termination signal TAJ
Termination signal TGA
Key: Each 3-letter deoxynucleotide ~riplet corresponds
to a trinucleotide of mRNA, having a 5'-end on the left
and a 3'-end on the right. All DNA sequences given
here.in are those of the strand whose sequence
corresponds to the mRMA sequence, with thymine
substituted for uracil. The letters stand for the
purine or pyrimidine bases forming the deoxynucleotide
sequence.
~2~ 7~
A = adenine J = A or G
G = guanine K = T or C
C = cytosine L = A, T, C or G
T = thymine M = A, C or T
X - T ox C if Y is A or G
5 X = C i Y is C or T
= A, G, C or T if X is C
Y = A or G if X is T
W = C or A if Z is A or G
W - C if Z is C or T
10 z = A, G, C or T if W is C
Z = A or G if W is A
QR = TC if S is A, G, C or T
QR = AG if S is T or C
S = A, G, C or T if QR is TC
lS S = ~ or C if QR is AG
An important feature of the code, for present
purposes, is the fact that each amino acid is specified
by a trinucleotide sequence, also known as a nucleotide
triplet. The phosphodiester bonds joining adjacent
triplets are chemically indistinguishable from all other
internucleotide bonds in DNA. ~herefore, the nucleotide
sequence cannot be read to code for a unique amino acid
sequence without additional information to determine the
reading frame, which is the term used to denote the
grouping of triplets used by the cell in decoding the
genetic message~
In procaryotic cells, the endogenous coding
segments are typically preceded by nucleotide sequences
having the functions of initiator of transcription (mRNA
synthesis) and initiator of txanslation (protein
synthesis), termed the promoter and ribosomal binding
site, respectively. The coding segment begins around 3
to 11 nucleotides distant frcm the ribosomal binding
; site. The exact number of nucleotides intervening
between the ribosomal binding site and the initiation
codon of the coding segment does not appear to be
critical for translation of the coding segment in
correct reading frame. The term "expression control
segment" is used herein to denote the nucleotlde
7t~
sequences comprising a promoter, ribosomal binding site
and a 3 to 11 nucleotide spacer following the ribosomal
binding site. In eucaryotic cells, regulation of
- transcription and translation may be somewhat more
complicated but also involve such nucleotide sequences.
Many recombinant DNA techniques employ two classes
of~compounds, transfer vectors and xestriction enzymes,
to be discussed in turn. A transfer vector is a DNA
molecule which contains, inter alia, genetic information
which insures its own replication when transferred to a
host microorganism strain. Examples of transfer vectors
commonly used in bacterial genetics are plasmids and the
DNA of certain bacteriophages. Although plasmids have
been used as the transfer vectors for the work described
herein, it will be understood that other types of
transfer vectors may be employed. Plasmid is the term
applied to any autonomously replicating DNA unit which
might be found in a microbial cell, other than the
genome of the host cell itself. A plasmid is not
genetically linked to the chromosome of the host cell.
Plasmid DNA's exist as double-stranded ring structures
generally on the order of a few million daltons
molecular weight, although some are greater than 108
daltons in molecular weight. They usually represent
only a small percent of the total DNA of the cell.
Transfer vector DNA is usually separable from host cell
DNA by virtue of the great difference in size between
them. Transfer vectors carry genetic information
enabling them to replicate within the host cell, in most
cases independently of the rate of host cell division.
Some plasmids have the property that their replication
rate can be controlled by the investigator by variations
in the growth condi-tions. By appropriate techniques,
the plasmid DNA ring may be opened, a fragment of
heterologous DNA inserted, and the ring reclosed,
forming an enlarged molecule comprising the inserted DNA
segment. Bacteriophage DNA may carry a segment of
heterologous DNA inserted in place of certain
non-essential phage genes~ Either way, the transfer
P~'7~
vector serves as a carrier or vector for an inserted
fragment of heterologous DNA.
Transfer is accomplished by a process known as
- transformation. Durlng transformation, host cells mixed
with plasmid DNA incorporate entire plasmid molecules
into the cells. Although the mechanics of the process
remain obscure, it is possible to maximize the
proportion of host cells capable of taking up plasmid
DNA and hence of being transformed, by certain
empirically determined treatments. Once a cell has
incorporated a plasmid, the latter is replicated within
the cell and the plasmid replicas are distributed to the
daughter cells when the cell divides. Any genetic
information contained in the nucleotide sequence of the
plasmid DNA can, in principle, be expressed in the host
cell. Typically, a transformed host cell is recognized
by its acquisition of traits carried on the plasmid,
such as resistance to certain antibiotics. Different
plasmids are recognizable by the different capabilities
or combination of capabilities which they confer upon
the host cell containing them~ Any given plasmid may be
made in quantity by growing a pure culture of cells
containing the plasmid and isolating the plasmid DNA
therefrom.
Restriction endonucleases are hydrolytic enzymes
capable of catalyzing site-specific cleavage of DNA
molecules. The locus of restriction endonuclease action
is determined by the existence of a specific nucleotide
sequence~ Such a sequence is termed the recognition
site for the restriction endonuclease. Restriction
endonucleases from a variety of sources have been
isolated and characterized in terms of the mlcleotide
sequence of their recognition sites. Some restriction
endonucleases hydrolyze the phosphodiester bonds on both
strands at the same point, producing blunt ends. Others
catalyze hydrolysis of bonds separated by a few
nucelotides from each other, producing free single
stranded regions at each end of the cleaved molecule.
Such single stranded ends are self-complementary, hence
coheslve, and may be used to rejoin the hydrolyzed DNA.
Since any DNA susceptible of cleavage by such an enzyme
~ must contain the same recognition site, the same
cohesive ends wlll be produced, so that it is possible
to join heterologous sequences of DNA which have been
treated with a restriction endonuclease to other
sequences similarly treated. See Roberts, R.J.,
Cri~.Rev.BiochemO 4, 123 (1976). Res-triction sites are
relatively rare, however the general utility of
restriction endonucleases has been greatly amplified by
the chemical synthesis of double stranded
oligonucleotides bearing the restriction site sequence.
Therefore, virtually any segment of DNA can be coupled
to any other segment simply by attaching the appropriate
restriction oligonucleotide to the ends of the
molecule, and subjecting the product to the hydrolytic
action of the appropriate restriction endonuclease,
thereby producing the requisite cohesive ends. See
Heyneker, ~.L., et al., Nature 263, 748 (1976) and
Scheller, R.H., et al., Science 196, 177 11977). An
important feature of ~he distribution of restriction
endonuclease recognition sites is the fact that they are
randomly distributed with respect to reading frame.
Consequently, cleavage by restriction endonuclease may
occur between adjacent codons or it may occur within a
codon.
More general methods of DNA cleavage or for end
sequence modification are available. A variety of
non-specific endonucleases may be used to cleave DNA
randomly, as discussed infra. End sequences may be
modified by creation of oligonucleotide tails of dA on
one end and dT at the other, or of dG and dC, to create
sites for joining without the need for specific linker
sequences.
The term "expression" is used in recognition of the
fact that an organism seldom if ever makes use of all
its genetically endowed capabilities at any given time.
Even in relativel~ simple organisms such as bacteria,
many proteins which the cell is capable of synthesizing
'7~5
are not synthesized, although they may be synthesized
under appropriate environmental conditions. When the
~ protein product, coded by a given gene, is synthesized
- by the organism, the gene is said to be expressed. If
the protein product is not made, the gene is not
expressed. Normally, the expression of genes in E. coli
is regulated as described generally, infra, in such
manner that proteins whose function is not us~ful in a
given environment are not synthesized and metabolic
energy is conserved.
10The means by which gene expression is controlled in
E. coli and yeast is well understood, as the result of
-
extensive studies over the past twenty years. See,
generally, Hayes, W., The Genetics of Bacteria And Their
Viruses, ~d edition, John Wiley & Sons, Inc., New ~ork
~1968), and Watson, J.D., The Molecular Biolo~ of the
Gene, 3d edition~ Benjamin, Menlo Park, California
(1976). These studies have revealed that several genes,
usually those coding for proteins carrying ou-~ related
functions in the cell, may be found clustered together
in continuous sequence. The cluster is called an
operon. Al] genes in the operon are transcribed in the
same direction, beginning with the codons coding for the
;N-terminal amino acid of the first protein in the
sequence and continuing through to the C-terminal end of
~he last protein in the operon. At the beginning of the
operon, proximal to the N-terminal amino acid codon,
there exists a region of the DNA, termed t~ control
region, which includes a variety of controlling elements
including the operator, promoter and sequences for the
binding of ribosomes. The function of these sites is to
permit the expression of those genes under their control
to be responsive to the needs of the organismO For
example, those genes coding for enzymes required
exclusively for utilization of lactose are normally not
appreciably expressed unless lactose or an analog
thereof is actually present in the medium. The control
region functions that must be present for expression to
occur are the initiation of transcription and the
'7~
initiation of translation. The minimal requirements for
independent expression of a coding segment are therefore
~- a promoter, a ribosomal binding site, and a 3 to 11
- nucleotide spacer segment. The nucleotide sequences
contributing these functions are relatively short, such
that the major portion of an expression control segment
might be on the order of 15 to 25 nucleotides in length.
Expression of the first gene in the sequence is
initiated by the initiation of transcription and
translation at the position coding for the N-terminal
amino acid of the first protein of the operon. The
expression of each gene downstream from that point is
also initiated in turn, at least until a termination
signal or another operon is encountered with its own
control region, keyed to respond to a different set of
environmental cues. While there are many variations in
detail on this general scheme, the important fact is
that, to be expressed in a host such a E~ coli, or a
eucaryote such as yeast, a gene must be properly located
with respect to a control region having initiator of
transcription and initiator of translation functions.
It has been demonstrated that genes not normally
part of a given operon can be inserted within the operon
and controlled by it. The classic demonstration was
made by Jacob, F., et al., J.Mol.Biol. 13, 704 (1965)~
In that experiment, genes coding for enzymes involved in
a purine biosynthesis pathway were transferred to a
region controlled by the lactose operon. The expression
of the purine biosynthetic enzyme was then observed to
be repressed in the absence of lactose or a lactose
analog, and was rendered unresponsive to the
environmental cues normally regulating its expression.
In addition to the operator region regulating the
initiation of transcription of genes downstream from it,
there are known to exist codons which function as stop
signals, indicating the C-terminal end of a given
protein. 5ee Table 2. Such codons are known as
termination signals and also as nonsense condons, since
they do not normalIy code for any amino acid. Deletion
of a termination signal between structural genes of an
operon creates a fused gene which could result in the
synthesis of a chimeric or fusion protein consisting of
two amino acid sequences coded by adjacent genes, joined
by a peptide bond. That such chimeric proteins are
synthesized when genes are fused was demonstrated by
~enzer, S., and Champe, S.P., PTO_~at A~d , -c; USA 48,
114 (1962).
Once a given gene has been isolated, purified and
inserted in a transfer vector, the over-all result of
which is termed the cloning of the genet its
availability in substantial quantity is assured. The
cloned gene is transferred to a suitable microorganism,
wherein the gene replicates as the microorganism
proliferates and from which the gene may be reisolated
by conventional means. Thus is provided a continuously
renewable source of the gene for further manipulations,
modifications and transfers to other vectors or other
loci within the same vector.
Expression has been obtained in the prior art by
transferring the cloned gene, in proper orientation and
reading frame, into a control region such that
read-through from the host gene results in synthesis of
a chimeric protein comprising the amino acid sequence
coded by the cloned gene. Techniques for constructing
an expression transfer vector having the cloned gene in
proper juxtaposition with a control region are described
in Polisky, B. et al., ProcONat.Acad. Sci USA 73, 3900
(1976~; Itakura, K., et al., Science 198, 1056 (1977);
Villa-Komaroff, L., et al., Proc.Nat. Acad.Sci USA 75,
3727 (1978); Mercereau-Puijalon, O~ et al., Nature 275,
505 (1978~; Chang, A.C.Y., et al, Nature 275 617 (1978),
and in our copending Canadian patent application Serial
No. 333,646, filed August 13, 1979.
As described in Serial No. 333,646, the cloned gene
is joined to a host control fragment in order to obtain
expression of the genea This control fragment may
consist of no more than that part of the contxol region
providing for initiation of transcription and initiation
P~7~j
11
of translation, or may additionally include a portion of
a structural gene, depending on the locatlon of the
~ insertion site. Thus, the expression product would be
- either a protein coded by the cloned gene, hereinafter
referred to as a non-fusion protein, or a fusion protein
coded in part by the procaryotic structural gene, in
part by the cloned gene, and in part by any intervening
nucleotide sequences linking the two genes. The peptide
bond between the desired protein or peptide, comprising
the C-terminal portion of the fusion protein, and the
remainder, is herein termed the "junction bond".
After the protein has been produced, it must then
be purified. Several advantages and disadvantages exist
for the purification of either the non-fusion protein or
the fusion protein. The non-fusion protein is produced
within the cell. As a consequence, the cells must be
lysed or otherwise treated in order to release the
non-fusion protein. The lysate will contain all of the
proteins of the cell in addition to the non-fusion
protein, which may make purification of the protein
difficult. Another consequence is that the non-fusion
protein may be recognized as a foreign protein and
undergo rapid degradation within the cell. Therefore
non-fusion proteins may not be obtainable in reasonable
yields. A major advantage of a non-fusion protein is
that the protein itself is the desired final product.
The stability of the expression product is
frequently enhanced by expression of a fusion protein.
The host portion of the fusion protein frequently
stabilizes the expression product against intracellular
degradation. Further, it is often possible to choose a
host protein which is protected from degradation by
compartmentalization or by excretion from the cell into
the growth medium. The cloned gene can then be attached
to the host gene Eor such a protein. A fusion protein
consisting of an excreted or compartmentalized host
protein (N-terminal) and an eucaryotic pro~ein
(C-terminal), is likely to be similarly excreted from
the cell or compartmentalized within it because the
12
signal sequence of amino acids that confers
secretability is on the N terminal portion of the fusion
protein. In the case of a Eusion protein excreted into
the cell medium, purification is greatly simplifi~d. In
some instances, the host portion may have distinctive
physical properties that permit the use of simple
purification procedures. A major disadvantage of the
fusion protein is that the host protein must be removed
from the fusion protein in order for the eucaryotic
protein to be obtained.
Direct expression as a non-fusion protein will
generally be preferred if the protein is stable in the
host cell. In many instances t the disadvantage of
having to purify the expression product from a cell
lysate will be overcome by the advantage of not having
to employ specific cleavage means to remove an
N-terminal portion. Most advantageously, as provided
herein by the present inventionl the desixed protein may
be expressed as a fusion protein comprising an
N-terminal sequence having distinctive physical
properties useful for purification and provided with a
structure at the junction point with the desired
C-terminal portion such that the junction bond, as
defined supra, can be cleaved by means which do not
appxeciably affect the desired C-texminal protein or
peptide.
Many methods for chemical cleavage of peptides have
been proposed and tested. Spande, T.F., et al, Adv~
Protein Chem. 24, 97 (1970). However, many of these are
_
non-specific, i.e. they cleave at many sites in a
protein. Sce also a brief discussion in The Proteins,
3rd Ed., Neuratht H. and Hill, R.L~, Ed., Academic
Press, Vol. 3, pp. 50~57 (1977). Hydrolysis of peptide
bonds is catalyzed by a variety of known proteolytic
enzymes. See ~ , 3rd Ed., Boyer, P.D., Ed.,
Academic Press, Vol. III (1971); Methods in Enzymology,
Vol. XIX, Perlmann, G.E. and Lorand, L. Ed., Academic
Press (1970); and, Methods in Enzy~ y, Vol. XLV,
Lorand L., Ed., Academic Press (19761. However, many
13
proteolytic enzymes are also non-specific, with respect
to the cleavage site.
The specificity of each chemical or enzymatic means
for cleavage is generally described in terms of amino
acid residues at or near the hydrolyæed peptide bond.
The hydrolysis of a peptide bond in a protein or
polypeptide is herein termed a cleavage of the protein
or polypeptide at the site of the hydrolyzed bond. The
peptide bonds which are hydrolyzed by chemical or
enzymatic means are generally known. (See the
above-identified references). For example, trypsin
(3.4.4.4) cleaves on the carboxyl side of an arginine or
lysine residue. (The number in parentheses after the
enzyme is its specific identifying nomenclature as
established by the International Union of Biochemists.)
Thus, trypsin is said to be specific for arginine or
lysine~ Since trypsin hydrolyzes only on the carboxyl
side of arginine or lysine residues, it is said to have
a narrow specificity. Pepsin (3.4.4.1), on the other
hand, has a broad specificity and will cleave on the
carboxyl side of most amino acids but preferably
phenylalanine/ tyrosine, tryptophan, cysteine, cystine
or leucine residues. A few specific chemical cleavaye
reactions are known. For example, CNBr will cleave only
at methlonine residues under appropriate conditions.
However, the difficulty with all specific cleavage
means, whether chemical or enzymatic, which depend upon
the existence of a single amino acid residue at or near
the cleavage point is that such methods will only be
useful in specific instances where it is known that no
such residue occurs internally in the amino acid
sequence of the desired protein. The larger the desired
protein, the greater the likelihood that the sensitive
residue will occur internally. Therefore, a technique
generally useful for cleaving fusion proteins at a
desired point is preferably based upon the existence of
a sequence of amino acids at the junction bond which has
a low likelihood of occurrence internally in the desired
protein.
~,Z~1 p'~
The specifici~y for the site of the hydrolyzed
peptide bond is generally termed the primary specificity
of the enzyme. Thus, trypsin has a primary specificity
for arginine and lysine residues. The primary
specificity of enzymes has been the subject of
considerable investigation. It has determined that a
par-ticular enzyme would recognize and bind the amino
acid residue within a protein molecule corresponding to
the enzyme's primary specificity and cleave the protein
at that point~ ~he part of an enzyme which recognizes
and binds the substrate and catalyzes the reaction is
known as the active site. For example, trypsin would
recognize and bind an arginine residue within a protein
and cleave the protein on the carboxyl side of the
arginine. For many years it was thought that only the
amino acid residues corresponding to the primary
specificity affected the specificity of hydrolysis of
the peptide bond by the enzyme. However, it has been
noted that amino acids in the immediate vicinity of the
site of hydrolysis may affect the binding affinity of
the enzyme at that site. Several examples of this
effect can be shown for trypsin. Considering the
sequence - x - Arg - Y where x and y are amino acids, it
has been found that the binding affinity of trypsin at
the Arg-y bond is significantly reduced when x is Glu or
Asp. Similarly, it has been shown that the binding
affinity at an arginine or lysine residue, in repetitive
sequences of lysine, arginine or combination thereof, is
greater than if a single arginine or lysine residue were
present. That is, the enzyme preferentially binds at
-Arg-Arg-X compared to y-Arg-x. Also, trypsin does not
appear to hydrolyze the ~Arg-Pro- or -Lys-Pro peptide
bind. See Xasper, C.B., at p. 137 in Protein Sequence
Determinatlon, Needleman, S.B., Ed. Springer-Verlag, New
York (1970).
Recently, it has also been determined that amino
acids in the vicinity of the site of hydrolysis will
also be recognized and bound by the enzyme. Yor
example, Schechter, I. et al., Blochem. Biophys. Res.
'77~
Comm., 27, 157 (1967) reported that papain (3.3.4.10)
binds several amino acid residues in its active site as
~` determined from the hydrolysis of peptides of various
lengths. An active site which binds several amino acids
is often termed an extended active site. The
specificity of an enzyme for the adclitional amino acids
not at the immediate site of hydrolysis is sometimes
termed the secondary specificity of the enzyme. It has
now been shown that many enæymes have extended active
sites. Several additional examples of enzymes having
extended active sites include: elastase ~3.4.4.7)
Thompson, R.C., et al., Proc.NatOAcad.Sci. USA 67, 1734
(1970); ~ -chymotrypsin (3.4.4.5~ - Bauer, C.A., et al.,
Biochem. 15 1291 and 1296 (1976~; chymosin (3.4.23.4) -
Visser, S., et al., Biochem.Biophys.Acta 438 265 (1976~;
and enterokinase (3.4.4.8) Maroux, S., et al.,
J.Biol.Chem. 246, 5031 (1971). ~See also Fruton, J.S.,
Cold Spring Harbor Conf. Cell Prolif. 2, 33 (1975).)
The extended active site appears to at least increase
the catalytic efficiency of the en~yme. It may also
increase the binding affinity of the enzyme for the
peptide~ See Fruton, J.S., supra. For example,
Schechter, I. et al., Biochem.Bio~h~s.Res Comm. 32, 898
(1969) found that the phenylalanine in the sequence
-x-Phe-y-z where x, y and z are amino acids enhances the
susceptibility of the peptide to hydrolysis by papain
and directs the en~ymatic attack at the y-z peptide
b~nd. Valine and leucine may also provide similar
results when substituted for Phe in the above sequence.
This could be an explanation for the broad specificity
of papain~ See Glazer, A.N. et al at p. 501 in The
Enzymes, supra. Thus, an enzyme may have a narrow
specificity as a result of its primary specificity alone
or in combination with its secondary specificity (i.e.,
the enzyme has an extended active site).
The present invention provides for the procaryotic
or eucaryotic expression of a cloned coding segment such
that the desired protein is pxoduced, either as a fusion
protein or a non-fusion protein, as desired, and may be
`'7~
16
provided with a specific additional amino acid sequence
to permit specific cleavage at the junction bond of a
fusion protein and to permit rapid purification. A
number of options are provided for the investigator,
depending on the size and function of the desired
protein, and upon the relative advantages of expression
as a fusion or non-fusion protein, according to
principles well known in the art, as discussed ~
To provide generally useful means for specific
cleavage of the junction bond, a chemical or enzymatic
cleavage means having a narrow specificity will not be
suitable except in special cases. A cleavage means is
not suitable if its cleavage site occurs within the
eucaryotic protein of the fusion protein. For example,
a eucaryotic protein may contain several arginine and/or
lysine residues. Trypsin would cleave on the carboxyl
side of these residues. Since cleavage would occur
within the eucaryotic protein, trypsin would not he
suitable for use for the present invention. This is
also true for many chemical cleavage means. Thus, it
can be seen that in order to obtain more specific
cleavage, it may be necessary to utilize a cleavage
means which will have a cleavage site in a specific
amino acid sequence having two or more amino acid
residues. For example, it would be desirable for the
cleavage means to be specific for an amino acid sequence
- x ~ y - z - and to cleave on the carboxyl side of the
~ residue. The probability of a similar sequence
occurring within the eucaryotic protein would be very
small. Therefore, the probability of cleavage within
the eucaryotic protein would also be very small. The
entire eucaryotic protein can then be removed and
purified.
When a fusion protein is expressed, a specific
cleavage sequence of one or more amino acids may be
inserted hetween the host protein portion and the
eucaryotic portion of the fusion protein~ If the
sequence of the eucaryotic portion is known, it is
7~ D
17
possible to select a specific cleavage sequence of only
one amino acid residue so long as that residue does not
appear in the eUcaryQtic protein. It is preferred,
however, to utilize a specific cleavage sequence which
contains two or more amino acid residues, sometimes
referred to herein as an extended specific cleavage
sequence~ This type of sequence takes advantage OL the
extended active sites of various enzymes. By utiliziny
an extended specific cleavage sequence, it is highly
probable that cleavage will only occur a~ the desired
site, the junction bond, and not wi~hin the desired
protein. By inserting a specifically recognized amino
acid sequence between the host protein portion and the
desired portion of a fusion protein, it is possible to
specifically cleave the desired portion out of the
fusion protein without further affecting the desired
portion. As noted above~ the provision of a specific
cleavage sequence comprising a sequence of two or more
amino acids which is specifically recognized and
cleavable by enzymatic means constitutes the subject o
parent application Serial No. 371,674.
For practical purposes, the specificity of cleavage
at the junction need not be all or nothing with respect
to other potential cleavage sites in the desired
protein. It suffices if the junction bond cleavage site
is sufficiently favored kinetically, either due to
increased binding affinity or enhanced turnover time,
that the junction bond is cleaved preferentially with
respect to other sites, such that a reasonable yield of
the desired protein can be obtained. Reaction
conditions of temperature, buffer, ratio of enzyme to
substrate, reaction time and the like can be selected so
as to maximize the yield of the desired protein, as a
matter of ordinary skill in the art.
One enzyme which may cleave at a specific cleavage
site has been called a signal peptidase. For several
eucaryotic and procaryotic proteins, the initia1
translation produc-t is not the protein itself, but the
protein with approximately 20 additional amino acids on
'7~
1~
the amino terminus of the protein. The additional amino
acid sequence is called a signal peptide. The signal
~~ peptide is thought to be a speclfic signal for the
vectorial transport of the synthesized protein into the
endoplasmic reticulum and is cleaved away from the
protein during this phase. See Blobel, G. et al, J.
Cel . 67, 835 (1975). A specific cleavage enzyme,
i.e., signal peptidase, has been observed in a cell-free
system which hydrolyzes the peptide bond between the
signal peptide and the active proteln in association
with passage ~hrough a cell membrane. See Blobel, G. et
al, Proc. Nat. Acad. Sci. USA 75, 361 (1978).
. _ _
A specific cleavage linker may be synthesized which
can be attached to the end of the isolated DNA segment
coding for the N-terminus of the protein prior to
insertion of the segment into the transfer vector. The
specific cleavage linker codes for an amino acid
sequence which contains a specific cleavage site which
does not occur within the desired protein. Thus, the
specific cleavage within the linker amino acid sequence
results in the isolation of the desired protein from the
fusion protein. An advantage of the presence of such
specific cleavage linkers is the cleavage at the
amino-terminal side of the first amino acid of the
N-terminus of the desired protein. Another advantage is
that little of the desired protein is degraded during
the cleavage procedure.
For the purpose of providing expression as a
non-fusion protein, synthetic oligonucleotide linkers
comprising a promoter, a ribosomal binding site, and a 3
to 11 nucleotide spacer may be used. This linker,
coupled with a coding segment, provides for direct
expression of the coding segment when inserted into a
transfer vector and used to transform a suitable host.
The provision of a ribosomal binding site linker
comprising a first deoxynucleotide sequence which is
homologous to the 3'-end of 165 ribosomal RNA and a
second deoxynucleotide sequence comprising 3 to 11
deoxynucleotides joined to the first DNA sequence forms
'7~
19
the subject of this invention.
Using such a ribosomal binding site ]inker, the
coding segment may be expressed even though ;nserted in
a "silent" region of the vector, thus increasing the
range of choice of suitable insertion sites.
Preferably, direct expression of the coding segment is
obtained without resorting to a synthetic promoter
segment. A ribosomal binding site linker, toqether with
a 3 to ll nucleotide spacer, directs the relnitiation of
translation of mRNA initiated at a naturally occurring
promoter site. Therefore, as long as the coding segment
and expression linker are inserted in a transfe- vector
gene under naturally occurring promoter control,
reinitiation at the inserted ribosomal binding site
results in direct expression of the attached coding
segment. Most preferably, the insertion is made
adjacent to the existing promoter, between it and the
structural gene it normally controls.
For the purpose of improving purification of the
fusion or non fusion protein, a linker coding for amino
acid sequences which function to enhance ease of
purification may be provided. The provision of a
specific purification linker comprising a
deoxynucleotide sequence coding for an amino acid
sequence which is selectively bindable to a solid phase
material forms the subject of and is claimed ln our
copending Canadian Patent Application Serial No.
~52,925 filed concurrently herewith and also divided out
of present application Serial No. 371,674.
~or e~ample, a polyanionic amino acid segment or a
polycationic or hydrophobic segment is tightly bound by
a variety of known solid phase adsorben-ts or column
materials. Specific amino acid sequences recoynizable
by specific binding substances can be incorporated on
either end of the desired protein to render it
purifiable by affinity chromatography. As no-ted
earlier, such purification segments can be used in
con~unction with a specific cleavage seyment, thereby to
provide for simple quanti-tative purification of fusion
'7'~
or non-fusion proteins followed by speciic cleavage of
the purification segment and quantitative removal
~ thereof.
- The oligonucleotide linkers used are termed
"segments" herein. Thus, the oligonucleotide coding for
a specific cleavage site is termed a specific cleavage
segment; that coding for initiation of transcription and
translation is termed an expression control segment;
that coding for reinitiation translation is termed an
expression segment; and that coding for specific
purification is termed a purification segment. The
cloned nucleotide sequence coding for the desired
protein is termed the coding segment. The expression
product is a protein or polypeptide bearing various
identifiable portions; where the desired protein or
peptide is expressed as a fusion protein, the N-terminal
amino acid sequence contributed by the host or transfer
vector genome i5 termed the host portion; where a
specific cleavage linker has been employed, the amino
acid sequence resulting from its expression is termed
the specific cleavage portion; and the expression
product of the purification segment is termed the
purification portion. That portion coded by the cloned
coding segment is termed the desired protein, which term
will be used herein to denote any size of polypeptide,
polyamino acid, protein or protein fra~ment specified by
the coding segment.
It is contemplated that the linkers of the present
invention may be attached to either end of the coding
segment, to provide the desired portion at either the
amino ~nd or the carboxyl end of the desired protein.
It will be understood that for the expression of any
portion attached to the carboxyl end of the desired
protein, the coding segment must not contain a
termination codon. It will further be understood that
linkers designed for the expression of a portion
attached to the carboxyl end of the desired protein must
include a termination codon~ appropriately located at
the end of the segment whose expression is desired.
3q~'7~
'1
The present invention opens a variety of options
for the expression of a cloned coding segment, depending
on the properties of the desired protein and of the host
expressiny it. The host may be either procaryotic or
eucaryotic. Where the desired protein is small or
unstable in the host, it may be preferred to express a
fusion protein. The use of a specific cleavage linker
enables the subsequent specific removal of the host
portion of the fusion protein. The purification segment
provides a region of the fusion protein conferring
functional properties exploitable to provide simplified
purification prior to specific cleavage~ Following
specific cleavage, the purification portion remains
attached to the host portion and simplifies the
separation of the host portion from the desired proteinO
In some instances, it may be preferable to express the
desired protein as a non-fusion protein. In that case,
the use of an expression segment or an expression
control segment linker conveniently provides for direct
expression of the coding segment. It will be understood
that such direct expression depends upon the existence
of an initiation codon. If the initiation codon is not
included in the coding segment, it can be provided as
part of the expression segment. Where an N-terminal
methionine is not desired, a specific cleavage segment
may be interposed between the initiating methionine
codon and the coding segment. A puxification segment
linker may be included to provide for rapid purification
of the expression productO
The particular combination of linkers chosen to aid
in the expression of a given desired protein will depend
upon the nature of the desired protein and upon
functional properties of the expression system. Some of
the described linkers are appropriate for procaryotic
and eucaryot.ic hosts, while others are specific for a
particular type of host c~ll. Such choices will be made
as a matter of ordinary skill. Other combinations of
the described linkers not speci~ically disclosed herein
22
are contemplated as within the scope of the present
invention.
In copending Canadian patent application Serial ~o.
452,927 filed concurrently herewith and also a division
of parent application Serial No. 371,674, there is
described and claimed a composite linker comprising a
first deoxynucleotide sequence having a restriction site
which is recogni~ed and cleavable b~ a restriction
endonuclease~ a second deoxynucleotide sequence which is
homologous to the 3'-end of 16S ribosomal RNA, a thixd
deoxynucleotide sequence having 3 to ll
deoxynucleotides, a fourth deoxynucleoti~e sequence
having the initiation codon, a fifth ~eoxynucleotide
sequence coding for an amino acid seqlence which is
selectively bindable to a solid phase material and a
sixth deoxynucleotide sequence coding ior a specific
cleaving sequence comprising a sequence of one or more
amino acids which is specifically recognized and
cleavable by enz~matic or chemical means. The first,
second, third, fourth, fifth and sixth deoxynucleotide
sequences are joined together in the direction of
translation.
Specific cleavage linkers which may be used in this
invention are deoxynucleotide sequences coding for amino
acid sequences which contain specific cleavage sites. A
specific cleavage linker is attached to a coding segment
prior to its transfer to a microorganism. The advantage
of a specific cleavage linker is that it provides a
specific cleavage sequence having a specific cleavage
site at the junction bond of the fusion protein. This
bond can he cleaved to produce the desired protein.
Using current recombinant DN~ technoloc~y, it is
possible to insert an isolated coding segment into a
transfer vector, transform a microorganism with this
transfer vector, and under appropriate conditions have
the coding segment expressed by the microorganismO
Frequently, it is desirable to connect the coding
segment to a portion of a host gene, which codes for a
= j protein that is normally excreted from the cell. This
~3
is done so that the expresslon product, a fusion protein
comprising a host protein portion and th~ desired
~ protein, is compartmentalized or excreted from the cell
- into the culture medium. This process is desirable
because it reduces or eliminates the degradation of the
desired protein within the cell. In the case of a
fusion protein excreted into the culture medium, it is
easier to purify the fusion protein. The fusion protein
is easier to purify because there is less total protein
in the culture medium than in a whole cell lysate.
A separate advantage of fusion protein expression
is that there are frequently well-known means for
purifying the host portion. Such means will often be
applicable to the fusion protein as well. Af~inity
chromatography is especially preferred, where
applicable.
The major difficulty encountered with this process
is the need to remove the desired protein from the host
portion in the fusion protein. This step is required in
order to purify the desired protein. This is difficult
because there is usually not a specific cleavage site
located between the amino terminus of the desired
portion and the carboxy terminus of the host portion
which can be attacked uniquely by specific chemical or
enzymatic means. A specific cleavage sequence may be
provided between the desired protein and the host
portion of the fusion protein.
There are many methods for cleaving proteins as
discussed above. Examples of chemical means include
cyanogen bromide (CNBr) and hydroxylamine. See Spande,
T.F. et alr, supra. Examples of proteolytic enzymes
include trypsin, papain, pepsin, thrombin (3.4.4.13) and
enterokinase. See The Proteins, ~ , Meth.Enzymol.,
Vol. XIX, supra, and Meth.Enzymol., Vol. XLV, supra.
However, many of these means do not show enough
specificity to be useful for the present invention.
That is, many of these means only recognize a specific
amino acid residue and cleave at this point. Thus,
7'~
24
except in very few situations, these same means will
cause cleavage~to occur within the desired protein.
~~As discussed above, a restriction enzyme will
- recogniæ~ a specific sequence of DNA and cleave the DNA
at this point. The specific cleavage linker is a
specific amino acid sequence containing on~ or more
amino acid residues which is recognized by a particular
chemical or enzymatic cleavage means. The specific
amino acid sequence is incorporated into a fusion
protein between the host portion and the desired
protein. This is accomplished by chemically
synthesizing a deoxynucleotide sequence which codes ~or
the specific amino acid sequence. This DNA sequence,
the specific cleavage linker, is then attached to an
isolated gene prior to its incorporation in a transfer
vector. The specific amino acid sequence is herein
termed a specific cleavage portion. The specific
cleavage portion contains a speci~ic cleavage site~ The
specific cleavage portion is selected so that it does
not or is unlikely to occur within the desired protein.
In this manner, the desired protein is separated from
the host portion of the fusion protein without itself
being degraded.
In selecting a specific cleavage sequence, several
factors must be considered. If the amino acid sequence
of the desired protein is known, it is a fairly simple
matter to select a specific cleavage sequence. In this
case it is preferred that the specific cleavage sequence
not be found within the desired protein. For example,
human proinsulin does not contain any methionines.
Therefore, methionine could be selected as the specific
cleavage sequenceO I the DNA sequence codiny for
methionine (ATG) were attached to the isolated human
proinsulin ~ene prior to insertion in a transfer vector,
the fusion protein produced upon expression could be
treated with CNBr under appropriate conditions to cleave
human proinsulln from the host protein. See Konigsberg,
W.~. et al. at p. 2 ir- The Proteins, supra. Similarly,
human proinsulin does not contain the sequence
7~
X-Phe-Arg~Y. The enzyme kallikrein B (304.21.8)
recognizes this sequence and cleaves on the carboxyl
~ side of the arginine. See Fiedler, F. at p. 289 in
- Meth.Enzymol.~ Vol. XLV, supra. Thus, by attaching the
DNA sequence coding ~or Phe-Arg (TTK WGZ) to the
isolated human proinsulin gene prior to insertion, the
fusion protein produced upon expression could be cleaved
with kallikrein B to obtain human proinsulin. Thus,
when the desired protein sequence is known, it is
possible to select any amino acid sequence as the
specific cleavage sequence which is specifically
recognized by a chemical or enzymatic cleavage means and
does not appear in the desired protein sequence.
Selecting the specific cleavage sequence is more
difficult where the amino acid sequence of the desired
protein i5 unknown. In this case, it is preferred to
use a sequence having at least two amino acid residues.
The greater the number of amino acid residues in the
specific cleavage sequence, the more unlikely the
probability of a similar sequence occurring within the
desired protein. This would increase the probability of
uniquely cleaving the desired protein from the host
portion. When at least two amino acid residues are
required for the specific recognition site, the
preferred cleavage means is enzymaticO One possible
chemical means which could be used is hydroxylamine.
Hydroxylamine cleaves the -Asn-Z~bond where Z may be
Gly, Leu or Ala. The rate of hydrolysis of Z=Gly is
much faster than for Z-Leu or Ala. See Konigsberg, W~Ho
et al, supra.
Another factor which can effect the selection of
the specific cleavage sequence is the rate of hydrolysis
of a particular cleavage means for similar amino acid
sequences. For example, enzyme A recognizes and cleaves
on the carboxyl side of C or D in the following amino
~5 acid sequences- -A-B C- or -A-B-D-. However, the rate
of hydrolysis of the former is much greater than that
for the latter. Assume -A-B-C- is chosen as the
specific recognition sequence and ~A~B D- exists in the
26
protein. By exhaust:ive hydrolysis with enzyme A it is
possible to get cleavage on the carboxyl side "C" and on
~` the carboxyl side of "D'l. However, the rate of
- hydrolysis for ~A-B-C- is much greater than that for
-A-B-D- so that most of the initial cleavages will occur
in -A-B-C-, i.eO, on the carboxyl side of C. Therefore,
a selective cleavage at the desired site can be achieved
by resorting to a partial hydrolysis. Although the
yield may be reduced, it should still be significan~
enough to warrant the use of enzyme A in this situation.
However, this situation is not the preferred one.
The extended active site is the most impor~ant
factor to consider in selecting the appropriate enzyme.
The enzyme must be able to recognize at least two amino
acid residues and preferably more than two. This will
decrease the probability of cleavage wi~hin the desired
protein as discussed above. For example, an enzyme
which recognizes the amino acid sequence -X-Y-Z- and
cleaves on the carboxyl side of Z would be useful for
the present invention. An enzyme which recognizes a
sequence of several amino acids but may cleave on the
carboxyl side of two different amino acids when
substituted in the sequence may also be useful if the
rates of hydrolysis for the two are different as
discussed above. An enzyme which cleaves in the inner
part of the specific cleavage sequence would also be
useful when used in conjunction with specific
aminopeptidases. For example, an enzyme which
recognizes the amino acid sequence -A-B-C~D- and cleaves
on the carboxyl side of B would be useful when used in
conjunction with an aminopeptidase which would
specifically cleave C~D from the remainder of the
desired protein. This enæyme would also be useful if
C-D- is the N-terminus of the desired protein.
It is contemplated that any enzyme which recognizes
a specific sequence and causes a specific cleavage can
be utilized in conjunction with the specific cleavage
linker. This specific recognition and cleavage may be
the function of tXe enzyme under its normal en ymatic
3~3~'7~3
27
conditions or under special restricted conditionsO For
example, it has been shown that Aspergillopeptidase B
~ has a very narrow specificity at 0C, whereas it has a
fairly broad specificity at 37~C. See Spadari, S. et
al., Biochem.Biophys.Acta 3 , 267 (1974). The
following enzymes are examples of enzymes which are
expected to be useful: enterokinase, kallikrein B or
chymosin. Enterokinase recognizes the sequence
X-(Asp)n-Lys~Y where n=2-4 and cleaves on the carboxyl
side of Lys. The rate of binding increases by 10-20
times as n increases from 2 to 4, as shown by studies
with synthetic peptides. See Maroux, S. et al., ~
It has recently been determined that Glu or a
combination of Asp and Glu can be substituted for the
Asp and that Arg can be substituted for Lys. See
Liepnieks, J., Ph.D. Thesis, Purdue University (1978).
Kallikrein B recognizes the sequence X-Phe-Arg-Y and
cleaves on the carboxyl side of Arg. See Fiedler, F.
. Chymosin recognizes the sequence
X-Pro-His-Leu-Ser-Phe-Met-Ala-Ile-Y and cleaves the
Phe~Met bond. See Vesser, S. et al., ~ , and Vesser,
S. et al., Biochem Biophys.Acta 481, 171 (1977). Two
other enzymes which should prove to be useful once their
extended ac-tive sites have been studied thoroughly are
urokinase (3.4.99.263 and thrombin. Urokinase has been
shown to recognize and cleave only an Arg~Val bond found
in the sequence X-Arg-Val-Y of plasminogen. See
Robbins, K.C., et alO, J.Biol.Chem. 242, 2333 (1967).
Thrombin cleaves on the carboxyl side of Arg but will
only cleave at specific arginyl bonds. It has been
shown that the sequence X-Phe(Z)6-Arg-Y where Z can be
any combination of amino acids is present in several of
the substrates for thrombin. See Magnusson, S~ at p.277
in The Enzy~mes, Vol. III, supra.
Another enzyme which may be use~ul is the "signal
peptidase". See Blobel, G., su~ra, and Jackson, R.C. et
al., Proc.Nat.Acad.Sci. USA 74, 5598 ~1977). This
. .
enzyme recognizes and cleaves the si~nal peptide from a
protein. By incorporating the signal pep-tide between
7'7~
28
the desired protein and the host portion of the fusion
protein, specific cleavage may be accomplished during
secretion of the fusion protein from the host to yield
- the desired protein.
Any chemical or enzymatic means which recognizes a
specific sequence and causes a specific cleavage can be
utilized. First, the appxoprlate cleavage means for a
particular desired protein is chosenO Then a DNA
sequence is chemically synthesized which codes for the
specific amino acid cleavage sequence dictated by the
appropriate cleavage means. The DNA sequence is
synthesized by the phosphotriester method as described
by Itakura, K et al, J. Biol. Chem. 250, 4592 (1975),
and Itakura, K. et al, J~ Am. Chem. Soc. 97, 7326 (19753
or other suitable synthetic means. For example, where
enterokinase is selected as the cleavage means, a DNA
sequence which codes for an amino acid sequence
recognized by enterokinase is synthesized. This DNA
sequence would be of the general formula ~GAL)(n)AAJ or
(GAL)(n)WGZ, where n is the number of the triplet codons
GAL in the DNA sequence and may be 2, 3, or 4. As a
further example, the enterokinase recognizes the
se~uence Asp-Asp Asp-Asp-Lys, and the DNA sequence
coding for that amino acid sequence would be
GAXlGAK2GAK3GAK4AAJ5. A preferred DNA sequence will be
based upon a consideration of the codons preferentially
employed in the host cell. For example, in E. coli, the
preferred~DNA sequence would be GATGATG~TGATA~Ao DNA
coding for a desired protein is isolated using
conventional techniques, such as the c~NA technique.
See, for example, Ullricht A. et al, suprar and Seeburg,
P.H. et al, supra. The chemically synthesized DNA
sequence is then attached to the isolated DNA by DNA
ligase-catalyzed blunt end ligation as described by
Sgaramella, V. et al, Proc. Nat. Ac_d. Sci. USA 67, 1468
(1970)~ This specific cleavage lin]ser-gene DNA is then
treated by addition of a second deoxynucleotide sequence
containing a restriction site, for example, the plus
strand sequence CCAAGCTTGG, which comprises a
Z~,,7,~,sj
29
recognition site for the restriction endonuclease Hind
III. This sequence could be attached to the specific
~` cleavage linker-gene DNA by DNA ligase~catalyzed blunt
- end ligation. Restriction site linkers and their use
have been described by Heyneker, H.L., et al, supra, and
by Scheller, R.L. et al, ~ . Such restriction site
linkers are modified to provide 0, 1 or 2 additional
deoxynucleotides. The latter deoxynucleotides provide
for all three reading frames. Alternatively, linkers
could be synthesized which contain a restriction linker,
0, 1 or 2 additional deoxynucleotides and a specific
cleavage linker. This composite linker could then be
attached to the isolated coding sequence by a single
blunt end ligation step. Or, two DNA sequences could be
synthesized - one containing a restriction linker and 0,
1 or 2 deoxynucleotides and the other containing the
specific cleavage linker. These two sequences could be
joined by blunt end ligation and then attached to the
isolated coding sequence by blunt end ligation. The
final product, i.e. res~ric~ion linker-0,1 or 2
deoxynucleotides - specific cleavage linker - DNA coding
sequence is then inserted in a transfer vector using
conventional techniques. It will be understood in the
art that the foregoing steps of blunt end ligation will
attach the linker sequences at both ends of the coding
segment. However, as the latter will contain or will be
provided with a termination codon, the coding sequences
~ttached downstream, in the direction of translation
from the termination codon, will remain untranslated. A
microorganism can then be transformed with the transfer
vector and expression of the gene is obtained under
appropriate conditions. Techniques for accomplishing
the above are more fully described in our copending
Canadian patent application Serial No. 360 9 565 filed
September 11 7 19 80 and our copending application Serial
No. 333,646, filed August 13, 1979. The fusion product
resulting from expression is purified, preferably as
described infra, and subjected to cleavage by the
selected means.
~3~
Purification segments coding for amino acid
sequences that contribute ease of purification can be
~` included as linkers, such that the added purification
portion is on the N-terminal side of the junction bond
and thereby removed following specific cleavage. Such
linkers may be separately ligated or incorporated with
other linker segments in a single composite linker. For
example, the plus strand sequence
(GAL)(m)AAK(GAL)(n)AAJ, where m and n are the number of
triplet codon GAL in the DNA sequence~ m may be 1, 2, 3,
or 4, and n may be 2, 3, or 4, comprises a specific
cleavage linkage for enterokinase as well as a specific
purification linker coding for an amino acid sequ~nce
which is selectively bindable to a solid phas~ material.
The kinds of amino acid sequence that contribute
ease of purification include polyanionic segments
(ASp/Glu?s-2o and polycationic segments (Lys/Arg)5 20
that will bind readily to ion exchangers. A polyanionic
segment can serve a dual function as an enterokinase
extended site sequence if provided with a C-terminal
lysine or arginine residue. A hydrophobic segment may
be (leu/ileu/val/phe)10 20. More specific, single step
purification, can be achieved by the use of affinity
chromatography. In principle, the affinity adsorbent
could bind any part of the expressed protein.
Preferably, the specific binding is directed toward that
portion destined to be removed from the desired protein.
Given a fusion protein, the specific affinity could be
an immunochemical binding of the procaryotic portion.
Alternatively, the specificity could be provided by the
purification segment. For example, a linker segment
coding for bradykinin would be incorpoxated to provide
the bradykinin sequence as part of the fusion pro~ein.
An immunoadsorbent specific for bradykinin (comprising
bradykinin antibody) then specifically binds the fusion
protein. The desired protein is then removed from the
adsorbed complex by specific cleavage, the unwanted
portion remains adsorbed and is readily separated.
Other examples will be apparent to those ordinarily
t7
31
skilled in the art. Providing a highly hydrophobic
purification segment also permits rapid and specific
~ separation, by absorption to hydrophobic (reverse phase)
solid phase carriers, by selective precipitation, and by
differential solubility in non-aqueous media.
A special case of purification linker involves
incorporating the signal peptide sequence in the
expression product. The amino acid sequences of known
signal peptides are sufficiently short to make feasible
the synthesis of linkers coding thereforO Since the
signal peptide is functional as an N~terminal peptide,
its use will be in conjunction with direct expression of
the desired protein as a non-fusion protein, as
described infra. Furthermore, the use o~ a specific
cleavage linker will be unnecessary, since signal
peptides are normally removed from the desired protein
product by a signal peptidase endogenous in the host
cellO Therefore, the use of a signal peptide linker can
result in secretion of the desired protein and remo~al
of the sigrlal peptide, mediated by endogenous host
functions.
The appropriate use of linkers, in accordance with
this invention provides means for expressing a coding
segment as a non-fusion protein. The required linker
for such direct expression is an expression control
segment comprising a promoter sequence, a ribosomal
binding site sequence, and a spacer of about 3 to ll
nucleotides~ Any coding segment providing an initiation
codon ~ATG) within a distance of 3 to ll nucleotides
from the ribosomal binding site sequence will be
expressed in correct reading frame. It is not necessary
to provide a coding segment having ATG as its 5'-end,
provided the ATG sequence is located within 3 to ll
nucleotides distance from the ribosomal binding site of
the linkerO An example of a procaryotic ribosomal
binding site would have the following sequence in its
plus strand: L(n)TAGGAGGAGCC, where L is A, T, C or G,
and n may be 0, l or 2. For convenience, DNA sequences
are designated by ~he plus strand. However, it will be
32
understood that all such linker segments also have a
minus strand of complem~ntary base sequence and opposite
~ polarity. The foregoing sequence includes the following
elements: a ribosomal binding site sequence
substantially homologous with the 3'-end of the 16S
ribosomal RNA, as shown by Shine and Dalgarno,
Proc.Nat.AcadOSci. USA, 71 1342 (1974), and by Steitz
and Jakes, Proc.Nat.Acad.Sci. USA 72 4734 ~1975). The
ribosomal binding sites so far studied are variable in
their degree of homology with the 16S ribosomal RNA
sequence. The maximum number of complementary bases so
far found is seven~ The above described sequence
contains six. The above-described sequence also
contains a stop codon (TAG) which is designed to preven~
read-through translation of any message initiated
elsewhere. In order that the stop codon be in phase
with the message ~o be terminated, the sequence is
provided with 0, 1 or 2 additional nucleotides. The
inclusion of a termination codon may not be necessary in
some instances. A universal terminator providing
termination in all three phases is provided by the
sequence TAGLTAGLTAGo The above described ribosomal
binding site segment also contains a BamHI linker
sequence, GGATCC. The linker is useful for attaching
additional sequence material to the ribosomal binding
site segment, ~or identifying DNA sequences into which
the linker has been introduced, and in some instances,
for inserting the ribosomal binding site linker.
For joining the ribosomal binding site segment to
the coding segment, a spacer sequence of 3 to 11 base
pairs is desired. This can be done most conveniently by
blunt end ligation of one of the commercially available
restriction site linkers (Scheller et al, supra~~ These
linkers can be modified as desired by treatment with the
appropriate restriction endonuclease followed by filling
or trimming the unpaired ends thus produced to provide
the desired spacer sequence. For example, the EcoRI
linker GGAATTCC can be treated with endonuclease EcoRI
followed by DNA polymerase to fill in the unpaired end
t~
- 33
to provide the sequence AATTCC. The ribosomal binding
site sequence bearing a BamHI linker sequence is
similarly treated with BamHI endonuclease and DNA
- polymerase such that its structure is now
L(n)TAGGAGGATC. Blunt end ligation provides the
sequence L(n)TAGGAGGATCAATTCC. If a coding segment
having a terminal ATG initiation codon is attached, the
initiation codon will be eight base pairs from the
ribosomal binding site.
The function of a ribosomal binding site linker
will vary depending upon the chosen insertion site in
the transfer vector. If the insertion interrupts a
normally translated message, the ribosomal binding site
linker is likely to serve as a reinitiation point for
transcription. However, the efficiency of translation
may be improved by making the insertion at a site
adjacent to an existing, known promoter, in the
direction of normal transcription. For example,
insertion at a site adjacent to the promoter of the
tryptophan operon will result in direct translation of
the in~erted segment in place of the normally expressed
proteins of the tryptophan operon, under control of the
tryptophan promoter. If it is desired to insert the
coding segment in a silent region of the transfer
vector, it will be necessary to provide a promoter
sequence to insure proper initiation of transcription.
Sequences which can function as initia~ors of
procaryotic tr~nscription are known. See for example
Pribnow, D., Proc. Nat. Acad. Sci. USA 72 784 ~1975).
For example, the sequence TATJATJ, where J is A or G,
appears to provide promoter function. In eucaryotes the
sequence TATAAA, or similar sequences TATAAT, TATAAG are
found in the region prior to transcription initiation
and are likely to be part of a promoter region. See
Gaunon, F., et al, Nature, 278 428-34 (1979). However,
other nucleotides outside the described sequence can
modify its efficiency of promoter function in ways which
are not presently predictable. Therefore, while it is
presently feasible to pxovide an expression control
3~
segment linker comprising both a synthetic promoter and
synthetic ribosomal binding site segments, it is
~` preferred to employ naturally occurring promoters,
- either separately cloned or by insertion adjacent
thereto.
Other examples of ribosomal binding site linkers
having attashed promoters include a plus strand sequence
5'-TATJATJAGGAGGAL(m)-3l, where m denotes the number of
L deoxynucleotides in the sequence and is any integer
from 3 to 11.
A ribosomal binding site linker suitable for
expression in eucaryotic cells is provided by a segment
homologous to the terminal sequence of the 18S ribosomal
RNA found in eucaryotes, Hagenbuchle, et al, Cell 13,
551 (1978). The sequence GGATCCTTCC can be synthesized
simply by joining the sequence TTCC to the 3'-end of the
commercially available BamHI linker. The resulting
sequence GGATCCTTCC has eight bases complementary to the
18S ribosomal RNA sequence, and should therefore provide
an excellent initiation site for translation.
Techniques similar to those previously disclosed may be
employed to provide the requisite spacer nucleotides.
In addition, the disclosed eucaryotic ribosomal binding
site sequence can be joined to itself by blunt end
ligation to provide two ribosomal binding sites, one
adjacent to the initiation codon, the other ten base
pairs away~ Similarly, the procaryotic ribosomal
binding site linker previously described can be employed
as a spacer. The latter additionally provides a
termination codon should it prove desirable to prevent
read-through translation. The ribosomal binding site
linker of this invention may be used in combination with
the specific cleavage linker and/or the specific
purification linker discussed in detail above.
A more complete appreciation of the invention will
be realized by reference to the following specific
Examples. It will be understood that only certain of
the Examples specifically relate to the incorporation
and use of a ribosomal binding site linker and that the
~q:~a.~ 5
- 3~
other Examples are included to illustrate the
incorporation and use of the related specific cleavage
~ linker and specific purification linker.
Enterokinase and human proinsulin will be used in
these Examples for illustration purposes onlyO These
Examples are not intended to limit the invention
disclosed herein except to the extent to which
limitations appear in the appended claims. Reference to
a procaryotic host such as E. coli is made for
convenience in the Examples. The linkers of the present
invention are also used for expression by a eucaryotic
host following generally the principles of the invention
and applying ordinary skills in the art.
Example 1
This Example illustrates the preparation of a
cloned human proinsulin gene, synthesis of a specific
cleavage linker and the joining of the twoO
An isolated and purified (hereinafter "cloned") DNA
sequence coding for human proinsulin is prepared as
~escribed in our copending Canadian patent application
Serial No. 360,565.
Enterokinase is chosen as the specific cleavage
means. The specific cleavage sequence for enterokinase
is NH2-Asp-Asp-Asp~Asp-Lys-COOH. The DNA sequence of
the plus strand coding for this amino acid sequence i5
5'-GATGATGATGATAAA~3'. (The plus strand is defined as
the strand whose nucleotide sequence corresponds to the
mRNA sequence. The minus strand is the strand whose
sequence is complementary to the mRNA sequence). This
DNA sequence is the specific linker sequence and is
3Q chemically synthesized using the phosphotriester method
described by Itakura, K., et al, supra.
The foregoing sequence is then blunt end ligated
to the commercially available HindIII linker which, when
cleaved with HindIII endonuclease yields a specific
cleavage linker suitable for insertion at a HindIII
site. The nucleotide sequence of both strands of the
product linker is
AGCTTGGATGATGATGATAA~
ACCTACTACTACTATTT
7~
36
By convention, the upper strand is the plus strand and
is shown with ~he S'-end to the left, the 3'-end to the
~ right, the lower strand having the opposite polarity.
- Expression in either of the other two reading frames is
provided by prior modification of the HindIII linker,
either by the removal of one of the 3' terminal G's, or
by addition of an extra 3' terminal G. The resulting
sequence of the composite linker will be one nucleotide
less or one nucleotide more, respectively, to provide
for expression of the specific cleavage site sequence
and ~he coding segment to which it is attached in
correct reading frame.
The specific cleavage linker is blunt-end ligated
with the cloned human proinsulin gene to produce a
deoxynucleotide sequence of the plus strand containing:
51-H _ III linker-specific cleavage linker-human
proinsulin gene-3'.
Example 2
This Example illustrates the cloning of the
deoxynucleotide sequence from Example 1 into a suitable
expression plasmid and the expression of said coding
sequence.
The specific cleavage linker-human proinsulin gene
is inserted in an expression transfer vector. When
insertion occurs in the correct orientation with respect
to initiation of translation at the insertion site, and
the insert is in reading frame phase with the promoter
and ribosome binding site, the protein product of the
cloned coding segment is synthesized by actively
metabolizing host cells transformed by the transfer
vector.
When the cloned DNA coding segment codes for a
peptide or small protein, it i5 preferable that the
expression transfer vector contains a portion of a
procaryotic gene between the promoter and the insertion
site. The protein produc~ in this instance is a fusion
protein. The fusion protein tends to stabilize the
foreign protein coded by the inser~ed gene in the
37
intracellular milieu of the host. Excretion of the
fusion protein from the host cell may also be
accomplished by fusion with certain excretable host
proteins such as ~-lactamase.
Expression plasmids have been developed wherein
expression is controlled by the lac promoter (Itakura,
K., et al, Science, 193, 1056 (1977), Ullrich, A., et
al, Exce~ Medica (1979) ); and by the ~-lactamase
promoter (see copending Canadian patent application
Serial NoO 353,090, filed May 30, 1930).
The preferred method of constructing an expression
plasmid is to chemically synthesize a DNA sequence
containing a restriction site found within the
~ -lactamase gene and n deoxynecleotides where n=0, l or
2 in order to provide a proper reading frame. This
sequence is ~hen blunt-end ligated ~o the modified human
proinsulln gene prepared in Example l~ This new DNA
sequence and the transfer vector is then treated with
the same restriction enzyme. See Heyneker, H.L.j et
al., 5ue~, and Scheller, R.H. et al., _upra. The new
DNA sequence is then inserted into ~he transfer vector
which is used to transform a host microorganism. A
general inserted DNA sequence of the plus strand in
accordance with the present invention can be shown as
follows: 5'-restric-tion linker - bncm - specific
cleavage linker -cloned gene-3' where b and c may be any
deoxynucleotide base and n and m are integers such that
n + m - 0, l or 2.
Expression is detected by measurement of a product
capable of binding immunochemically with anti-insulin
antibody or anti proinsulin antibody. Fusion proteins
indicative of expression are detected by comparing
molecular weights of the host protein contributing the
N-terminal part of the fusion protein in host cells
transformed by expression plasmids with and without an
insert.
The fusion protein for this specific example,
having the formula X-Asp-Asp-Asp-Asp-Lys-Y, where X is a
portion of the ~-lactamase protein and Y is the human
7 7
38
proinsulin protein, is purified using conventional
techniques. The fusion protein is cleaved using
enterokinase following the procedure as described by
Liepnieks, supra. Gell electrophoresis is conducted to
determine whether proper cleavage is obtained. Human
proinsulin serves as the standard. Two bands are
obtained Erom the cleavage product, one which migrates
with the human proinsulin standard. Human proinsulin is
then purified using conventional techniques.
Example 3
This Example describes the incorporation and use of
a specific purification linker.
A speciEic purification linker is provided by
modifying the linker described in Example 1 having the
sequence 5'-GATGATGATGATAAA-3'. The sequence is
modi~ied at the 3'-end by providing a C or preferably a
T residue in place of the G. The modification can be
accomplished by the use of T~ DNA polymerase in th~
presence of ATP and CTP to remove the 3'-terminal G,
followed by Sl nuclease to remove the 5'-terminal C on
the complementary strand. A, C or preferably a T may be
added to the 3'-end, either by enzymatic or chemical
means. The resulting sequence codes for the amino acids
AspAspAspAspAsn. The modified nucleotide sequence is
then coupled by blunt end ligation to its unmodiied
homolog to yield 5' -GATGATGATGATAATGATGATGATGATAAA-3'.
The foregoing sequence is then connected to a
H _ III linker as described in Example 1, and further
connected with a coding segment as described in Example
1.
When expressed as a fusion pro~ein, as described in
Example 2, the linker will provide that the fusion
protein contains a polyanionic portion of signiEicant
length. The fusion protein will there-Eore bind tightly
to anion exchange materials such as diethylaminoethyl
cellulose, even under conditions of ionic strength where
substantially all other proteins in the cell lysate are
eluted.
3 7~7~
~9
The fusion protein i5 then either eluted from the
ion exchanger or treated in situ with enterokinase. In
__ _
the latter case, preferential cleavage occurs at the
- junction bond and the desired protein is released from
the ion exchanger~ The procaryotic portion, bearing the
polyanionic portion, remains bound to the ion exchanger.
When the fusion protein is eluted from the ion exchanger
prior to enterokinase treatment, incubation with
enterokinase will cleave the junction hond
preferentially and the procaryotic portion may be
removed from the reaction mixture by preferential
binding to an ion exchanger, as beforeO By the
foregoing procedllre, substantially quantitative
purification of the desired protein is achieved in two
steps.
Example 4
In this Example, the expression of a coding
sequence such as that coding for human proinsulin is
facilitated by the use of a ribosomal binding site
linker in accordance with this invention.
The nucleotide sequence AGGA is synthesi~ed
chemically by the method of Itakura, et al, ~ . The
synthetic sequence is then joined chemically or by blunt
end ligation to the BamHI linker, GGATCC, obtained
commercially from New England BioLabs, Cambridge,
Massachusetts. The resulting segment, AGGAGGATCC, is
modified by treatment with BamHI endonuclease followed
by DNA polymerase I to fill in the single stranded
protnlding end to yield AGGAGGATC. Similarly, the
coding segment is treated, first by the addition of a
BamHI linker followed by modification o~ the linker with
BamHI endonuclease and DNA polymerase I. The modified
segments are then joined to each other by blunt end
ligation to yield the sequence AGGAGGATCGATCC-coding
segment. The start of the coding segment i9 then
Iocated eight bases from the ribosomal binding site.
The sequence, ribosomal binding site-spacer-coding
segment (human proinsulin) is further modified by the
attachment of the appropriate restriction linker,
P'7~
depending on the desired insertion site. For example,
EcoRI linker is used for insertion in the gene code for
~ galactosidase. In contrast to prior results,
however, expression does not result in production of a
fusion protein since the ribosomal binding site linker
acts to reinitiate translation so that the segment
coding for human proinsulin is expressed per se. The
expression product is detected by immunochemical mPans.
Example S
The ribosomal binding site linker of Example 4, the
specific purification segment of Example 3, and the
specific cleavage linker of Example 1 are combined by
blunt end ligation to yield a composite linker having
the sequence AGGAGGATCGATCCATGGATGATGATGATAATGATGATGAT-
GATAAA. Described in functional terms, the composite
linker has the se~uence ribosomal binding site-spacer-
staxt codon-purification portion-spe~ific cleavage
site-coding segment. The composite is further modified
by attachment o~ an EcoRI linker, to facilitate
insertion into the Rl site of a plasmid such as pBGP
120, described by Polisky, B., et al,
Transformation with the resulting transfer vector
permits expression of human proinsulin having a
polyanionic N terminal portion. The expression product
is then purified as described in Example 3 followed by
specific cleavage using enterokinase. The combined
techniques result in the production of highly purified
human proinsulin. The princip~l advantage of the
co~bined techniques is due to the fact that, once the
appropriate linkers have been attached to the coding
segment/ expression of the coding segment and specific
purification of the expression product are accomplished
by relatively simple procedures which can be carried out
without difficulty on a large scale~
Examples of composite linkers synthesizable by the
methods of this invention include composite linkers
having the plus strand sequences 5'-CCAAGCTTGGAGGAGGATC-
AATTCCATGGALGALGALGALLLKGALGALGALGALAAJ-3' and S'-CCAAG-
CTTGGAGGAGGATAATTCCATGGALGALGALGALLIKGALGALG~LGALAAJ-3'.
'77~
41
As a further alternative, the above described
composite linker can be further modified, prior to the
~ addition of the restriction site linkers, by the
addition of a se~uence capable of functioning as a
promoter, for example, TATGATG. The use of such a
promoter sequence in combination with the linker
segments just described makes it possible to obtain
expression at a greater variety of insertion sites on
the transer vector, including those which are normally
silent.
10While the invention has been described in
connection with specific embodiments thereof, it will be
understood that it is capable of further modifications
and this application is in-tended to cover any
variations, uses, or adaptations of the invention
following, in general, ~he pxinciples of the invention
and including such departures from the present
disclosure as come within known or customary practice
within the art to which the invention pertains and as
may be applied to the essential features hereinbefore
set forth, and as follows in the scope of the appended
claims.
