Note : Les descriptions sont présentées dans la langue officielle dans laquelle elles ont été soumises.
:~2~
MIS57 18-83
Sl3I.ECTION USING
OPINE SYNTHASE GENES
During the past ten years, the ability to splice
5 DNA from a variety of sources into a recombinant DNA
molecule and then to transfer such DNA molecules into
different species of prokaryotes and eukaryotes has led
to the most exciting revolution in the history of
biology. Most of this work has involved the use of
bacteria, fungi and animals. Plants have been
relatively neglected primarily because suitable vectors
were not available. Recently a numher of possible
vectors have become available but in their natural state
they have not been efficient in the transfer and
expression of genes from various sources to plant
species. The present invention describes`some no~el
discoveries which increase the usefulness of naturally
occurring plant DNA vectors in the genetic engineering
of plants.
This application is a division of copending
Canadian patent application Serial No. 462,886 filed
Septe~ber 11, 1984. The parent application describes a
plasmid contaîning no tumor-forming genes and comprising
a first DNA segment that is a replicon capable of
replication in Agrobacterium and a second DNA segment
comprising (a) at least one T-DNA repetitive sequence
located at an end of the second DNA segment, (b) at
least one opine synthase gene that is expressible in a
plant, and (c) at least one heterologous gene that is
expressible in a plant and which is not an ant.ibiotic
resistance gene. Also described is a transformed plant
cell containing the plasmid.
In this speci~ication, reference is made to the
accompanying drawings, wherein:
Figure 1 is a graphical representation o~ the
effect of homoarginine on the growth of two tumor
lines;
Figure 2 shows the nucleotide sequences of a
position of the Ti plasmid 15955 containing the ~-DNA
region;
Figure 3 is a restriction endo nuclease map of the
sequenced region of Figure 2 for five different
restriction enzymes;
Figure 4 is a graphical representation of the
effect of canavanino or the growth of two tissue
culture lines;
Figure 5 is a graphical representation of the
effect of 2 amino-ethyl-cysteine on the growth of two
tissue culture lines;
Figures 6 and 6a illustrate the isolation of
fragments 2 and 2a from plasmid p233;
Figure 7 illustrates the isolation of fragment 1
from plasmid plO2;
Figure 8 illustrates cleavage of plasmid p SUP106
at the Hind III and Cla I sites;
Figure 9 illustrates ligation of fragments 1 and 2
ko produce fragment 3 and ligation of ~ra~ments 3 and 4
to produce fragment 5;
Figure 10 illustrates the isolation of fragment
from plasmid p501;
Figure 11 illustrates the formation o ~ragment 6
from plasmid p403;
25Fiyure 12 illustrates the isolation of fragment 7
from plasmid p501 and ligation of fragments 1, 6 and 7
and further processing of the ligate to form fragment 8;
Figure 13 illustrates the isolation of fragment 9
from plasmid pBR322;
30Figure 14 illustrates the ligation of fragments 6,
7 and 9 to form fragment 10 and the further processing
of fragment 10 to form fragment 11;
Figure 15 illustrates the ligation of ~ragments 6
and 7 to form fragment 12 and isolation of fragment 13
from plasmid p233;
Figure 16 illustrates the recombinant fragment 14
formed by ligation of fragments 1, 12 and 13; and
Figure 17 illustrates ligation of fragments 2 and
13 and llgation o~ that ligate with fragments 1 and 1
to yield fragment 15.
The field of this invention involves the insertion
of foreign DNA which is desired to be expressed in a
plant, into a transformation vector, i.e., a plasmid
capable of introducing the DNA into plant cells and then
maintaining that DNA. Plant cells containing foreign
genes which have been introduced by this transformation
vector, are used to regenerate morphologically normal
plants that carry foreign genes. In an ideal situation,
these forsign genes should be carried through meiosis to
subsequent generations oE plants.
A goal of plant genetic manipulation is to
introduce desired genes into a plant in such a manner
that these genes will be functional in the desired
tissue at the correct time. The most promising vehicle
for such plant genetic manipulations makes use of the
Ti-plasmid of Aqrobacterium tumefa~iens and the Ri-
plasmid of A. rhizoqenes. A number of investigators
have used the soil organism A. rhizo~enes which causes
hairy root disease ~Costantino, P. at al. (1980) Gene
11.79-87~. The transformed plant tissue contains
plasmid-derived DNA sequences and the tissue synthesizes
an opine resembling agropine (Chilton, M-D., et al.
25 (1982) Nature, London 295.432-434; White, F. F. et al.
~1982) Proc. Nat. Acad. Sci. U.S.A. 79:3193-3197). One
advantage of A. rhizoqenes is that, unlike crown gall
tumors, transformed tissue quite easily regenerates into
plantlets containing high concentrations of opines.
In addition, specific foreign DNA fragments have
been inserted into the T-DNA region of the Ti-plasmids
of A. tumefaciens (Leemans, J. et al. tl981) J. Mol.
Appl. Genet. 1:149-164; Ooms, G. et al. (1982) Plasmid
7:15-29). Standard in vitro recombinant DNA technology
was used to insert a chosen restriction ~ragment into a
specific restriction site lying in a cloned portion of
the T-region. A~ter the resulting plasmid was
introduced into an A. tumefaciens strain carrying a wild
type Ti plasmid, then homologous recombination between
the two plasmids produced a Ti~plasmid carrying foreign
DNA in the T-region. Tumors produced by infection of
plants with A. tumefaciens containing this recombined
Ti-plasmid contained the foreign DNA (Garfinkel, D. J.
et al. (1981~ Cell 27:143-153- Ooms, G. et al. (1981)
Gene 14:33_50; Hernalsteens, J. P. et al. (1980) Nature,
London 287:654-656).
Transformation v~ctors, e.g., Ti-plasmids, can
carry Poreign genes and stably introduce them into plant
cells by transfer of the T-DNA regions into the plant
genome. These vectors should be able to transform
single cells or protoplasts. Such a transformation has
been achieved by (i) fusion of bacterial spheroplasts
with protoplasts (Hasezawa, SO et al. (1981) Mol. Gen.
15 Genet. 182:206) (ii) the transformation of protoplasts
with partially regenerated cell walls by intact bacteria
(Martont L. et alO (1979) Nature, London 277:129-131)
and ~iii) the delivery of intact Ti-plasmids into
protoplasts either as free DNA in the presence of
polyethylene glycol and calcium (Krans, F. A. et al.
(19~32) Nature, London 296:72~74), or encapsulated in
liposomes (Draper, J. et al (1982) Plant Cell Physiol.
23:255)
When any of thPse m2thods are used, a selectablP
marker should be available. One possibility is to use
antibiotic resistance markers but it would be
undesirable to spread such resistance genes in the
commercial applications of genetic engineering.
Transformed cells which form tumors are generally to be
avoided because it is sometimes difficult to regenerate
plantlets from such tumor tissue. A possibility of
avoiding tumor formation i5 to use crippled Ti~plasmids
which do not cause the formation of tumors but still
insert th~ir T--DNA into the plant genome (Leemans, J. et
35 alO (1982) EMBO. J. 1:147-152).
In summary, the field of the present invention
involves the construction of plant transformation
vectors which possess maximum efficiency in the transfer
of ~oreign genes to a plant genome and which then can be
amplified in the plant genome whenever desired. These
plant transformation vectors should confer maximum
expression of these foreign genes in the desired tissues
and at the desired time.
crown gall disease of dicotyledonous plants results
from an infection by the gram-negative soil bacterium
Aqrobacterium tumefaciens. The ability of a strain of
A. tumefaciens to trans~orm plant cells and to induce
tumors can be correlated to the presence of a large
single copy plasmid (the Ti plasmid, which ranges in
size from 140 to 235 kilobases). The transformation of
plant cells is the result of transferring genetic
information, i.e., T-DNA, from the Ti plasmid to the
nucleus of the plant cell. Once this transfer has been
achieved, the bacterial cell is no longer needed to
maintaln the transformation (Chilton, M-D., Drummond, ~.
H., Merlo, D. J., Sciaky, D., Montoya, A. L., Gordon, M.
P. and E. W. Nester (1977~ Cell 11:263-271).
The transferred T-DNA produces observable
phenotypes in the host such as opine synthesis. The
earliest opines to be identified resulted from the
condensation of an amino acid and a keto acid (Goldman,
A., Tempe, J. and G. Morel (1968) Compt. Rend. Acad.
Sci. ~Paris) 162:630-631). As noted above, plant tumors
can be grown in the absence of the causative bactaria
and yat they still synthesize opines. Octopine synthase
talso named lysopine dehydrogenase) is a single
polypeptide chain of molecular weight 38,000 to 39,000
and catalyses the condensation of pyruvats with
arginine, histidine, lysine or ornithine (Hack, E. and
J. D. Kemp (1980) Plant Physiol. 65:949-955) using NADH
or NADP~ as co-factor. A second group of opines is
produced by nopaline synthase which is a tetramer of
four identical polypeptide chains, each of which is
approximately ~0,000 molecular weightO Again NADH or
NADPH is used as the co-factor, but the keto acid is ~
ketoglutaric acid and the amino acid is arginine or
ornithine (Kemp, J. D., Sutton, D. W. and E. Hack (1979~
Biochemistry 18:3755-3760). La~er, it was shown that a
3~;
particular strain of A. tume~aciens, which induced
tumors synthesizing, for example, octopine could use
octopine as a sole source of carbon and nitrogen
(Montoya, A. L., Chilton, M. D., Gordon, M. P. Sciaky,
D. and E. W. Nester (1977) J. Bacteriol. 129 101-107)o
Another opine has been identified (Firmin, J. L. and G.
R. Fenwick (1978) Nature, London 276:842~84~). This
opine is agropine and is the result of a condensation
reaction between an amino acid and a sugar (Coxon, D.
T., Davies, A. M. C., Fenwick, G. R., Self, R. Eirmin,
J. L., Lipkin, D. and N. F. James (1980) Tetrahedron
Letters 21:495-~98).
The T-DNA (the DNA tran~ferred ~rom the Ti plasmid
to the plant nucleus) varies from one Ti plasmid group
to another. The octopine A-type plasmids trans~er two
pieces of plasmid DNA to plant cells sither together or
separately tThomashow, M. F., Nutter, R., Montoya, A.
L., Gordon, M. P. and E. W. Nester (1980) Cell
19:729-739~. One piece of a ca. 8 x 106 daltons is
always found in tumors with a frequency of one copy/cell
whereas another piece o~ ca. 5 x 106 daltons i5
~ometimes absent and sometimes present at a frequency of
up to 30 copies/cell. The two pieces are co-linear on
the Ti plasmid restriction endonuclease map but are
integrated into the host plant nucleus as separat~
units. In contrast, the nopaline-type plasmids transfer
a single larger piece of Ti plasmid DNA (ca. 10 x 106
daltons) and ~his i5 maintaihed at a frequency o~ 1-20
copies/tumor cell (Holsters, M. et 31. Plasmid
30 3:212 230).
The transferred T-DNA is integrated into the
chromosomal DNA of the transformed plant cells
(Thomashow, M. F. et al. (1980) supra) and is
extensively transcribed into poly-A-containing mRNA
(Gurley, W. B., Kemp, J. D., Alb~rt, M. J., Sutton, D.
W. and J. Collins (1979) Proc. Nat. Acad. Sci. U.S.A.
76:1273-1277: McPherson, J. C. et al. ~1980) Proc. Nat.
Acad. Sci. U.S.A. 77:2666-2670). Part o~ this
3~
transcription codes for the opine synthases (KoeXman, B.
T. et al. (1979) Plasmid 2O347~357).
Tumor cells containing T-DNA can be maintained in
culture indefinitely. Further, unlike normal plant
cells, tumor cells can be grown on a chemically definsd
medium which lacks added auxins and cytokinins ~plant
growth hormones) (A. C. Braun (1958~ Proc. Nat. Acad.
Sci. U.S.A. 44:344). Mutants of Ti plasmids can be used
to define the location of functional genes such as (i)
loci in the T-DNA which determine tumor morphology and
opine synthesis (ii) loci outside the T-DNA which are
required for virulence and (iii) regions which have no
apparent effect on tumorigenicity (Holsters, M. et al.
(1980) Plasmid 3:212-230; de Greve, H. et al. (1981)
Plasmid 6:235-248; Ooms, G. et al . (1982) Plasmid
7:15-29).
The genetic organization of the T-DNA of a number
of tumors promoted by strains of A. tumefaciens
containing octopine Ti plasmids has been studied (Merlo,
D. J. et al . (1980) Mol. Gen. Genet. 177:637-643: De
Beuckeleer, M. et al. (1981) Mol. Gen. Genet.
183:283-288; Thomashow, M. F. et al. (1980) Cell
19:729_739). In some tumor lines, the T-DNA occurs as
two segments. The left end of the T-DNA is called TL
and includes tms ~tumor morphology shoot), tmr ~tumor
morphology root), tml (tumor morphology large) and,
sometimes, ocs (octopine synthase) while the right end
is called TR. Tumor maintenance requires TL but not TR.
Transformed cells induced by wild type octopine Ti
plasmids have been selected in two ways (i) the tissue
must be able to form tumors and ~ii) the tissue must be
able to grow in vitro in the absence of phytohormones.
A serious problem associated with the use o~ wild type
Ti plasmids is that it is very difficult to regenerate
whole plants from tha tumor tissue.
In order to regenerate plants from transformed
tissue culture, mutants can be obtained in the tms, tmr
and tml loci. However, it then becomes difficult to
distinguish transformed tissues from untransformed
~2~
tissue leading to a requirement for some form of
selection. One form of selection has been by the
insertion of antibiotic resistance genPs into the T-DNA
(Ursic, D. et al. (1981) Biochem. Biophys. Res~ Comms.
101:1031) (Jiminez, A. et al. (1980) Nature (London)
287:869) (Jorgensen, R. A. et al. (1979) Mol. Gen.
Genet. 177:65). In one instance resistance to the
antibiotic G418, which is toxic to tobacco cells in
culture, was incorporated into the T-DNA. In a second
instance, the bacterial transposon Tn5, which confers
resistance to kanamycin, was incorporated into the
T-DNA. A disadvantage to the use of this type of
selection to detect transformed plant tissue is that it
leads to needless spread o~ antibiotic resistance genes.
Such a spread of antibiotic resistance genes would be of
very large significancP if such selection were to be
used in the agricultural commercial applications of gene
transfer via Ti plasmid vectors. Some other method of
differentiating transformed from untransformed plant
tissue would be highly desirable especially if such
selection were to utilize a normal component of Ti
plasmids.
In any program involving the genetic al~-eration of
plants, foreign DNA of interest must be inserted into a
transformation vector, i.e., a plasmid, which in turn
can stably introduce the DNA into plant cells. These
plant cells containing the foreign genes introduced by
way of the transformation vector can then be used to
regenerate morphologically normal plants. In an ideal
situation, the altered plants should transmit the
foreign genes through their seeds.
The best available transformation vector at pr~sent
is the T-DNA fragment which is transferred and
integrated into the plant genome from the Ti-plasmid of
Aqrobacterium tumefaciens following infection. However,
if wild type A. tumefaciens is used, then the plant
develops a crown gall and it becomes difficult to
regenerate whole plants from such crown gall tissu~. If
mutants in the tumor genes (tms, tmr or tml~ are used,
~25-l~E~
then re~eneration of plants becomes a practical
proposition but selection of transformed tissue becomes
di~ficult. 5election c~n be re-established by inserting
an antibiotic resistance gene into the T-DNA but this
method is u~desirable for reasons already discussed (see
above).
After the work described in this specification was
completed, Van Slogteren et al. (Van Slogteren, G. M. S.
(1982) Plant Mol. Biol. 1:133-142) reported that
homoarginine was less toxic to transformed cells than to
normal cells. Although homoarginine is a substrate for
octopine synthase (Otten, L. A. B. (1979) Ph.D. Thesis,
University Leyden, Netherlands; Petit, A. et al. (1966)
Compt. Rend. Soc. Biol. (Paris) 160:1806-1807~, in
independent experiments we did not obtain a selection
for transformed cells by use of homoarginine. Little or
no selectivity by homoarginine for octopine synthase
containing tissues compared to other crown gall or
normal tissues was observed (Fig. 1). Thes~ independent
by us results made it seem unli}cely that the use of any
amino acid analogs to select ~ransformad tissues and
cells would be successfulO
In accordancs with the present invention, there is
provided a method of selecting non-tumorous transformed
~5 plant cells expressing a gene coding for an opine
synthase and containing a plant expressible heterologous
gene from a mixture containing the transformed plant
cells and untransformed plant cells comprising (a)
plating the mixture on a suitable growth medium
containing an amino acid analog toxic to normal cells
and metabolized by a plant cell expressing the opine
synthase encoded by the gene; (b) growing the mixture
on the growth medium for a selected period of time to
provide colonies of plant cells; and (c) selecting from
the colonies those colonies ~xhi~iting greater growth
rat~s.
This invention makes use of unique T-DNA
constructions f:rom the Ti- plasmid of Aqrobacterium
tumefaciens to transfer foreign genes for expression in
new plants and to recognize transformed cells carrying
such foreign genes incorporated into their genomes by
selection for an unalterad T-DNA opine synthase gene.
Such a selection for transformed cells carrying foreign
genes can be done without the development of tumor
tissue which makes plant regeneration difficulk and
without spreading antibiotic resistance genes throughout
the plant population.
These T-DNA constructions may contain only the
direct nucleotide repeats which are involved in the
incorporation of the T-DNA into the plant genome and one
or more opine synthase genes which are used in the
selection to detect and isolate transformed cells.
Preferably, these uni~ue T-DMA constructions contain a
versatile restriction endonuclease site with sticky ends
which are compatible to the sticky ends o~ a number of
restriction endonucleases and which can therefore be
used for the insertion of foreign DNA fragments obtained
with the aid of different restriction endonucleases. In
these T-DNA constructions, the tumor forming genes may
be deletPd and no antibiotic resistance genes need be
utilized.
In the presence of a toxic amino acid analog,
normal, untrans~ormed cell~ ara unable to grow in
culture media or only able ko grow extremely slowly,
whereas transformed cells containing one or more opine
synthase genes are able to detoxi~y the toxic amino acid
analog and so are able to grow. The difference between
the growth rate~ of normal and transformed cells is
quite clear when a variety of toxic amino acid analogs
are used to select for transformed cells or protoplasts.
In the absence of tumor inducing genes, it is easier to
regenerate plantlets from tissue culture cells or
protoplasts.
In addition, the T-DNA constructions used in this
invention permit the recognition of plant cells or
protoplasts which have incorporated only parts of the
TL-DNA, only parts o~ TR-DNA or parts of both TL-DNA and
TR-DNAo Since multiple copies of TR DNA are often ~ound
3~
in a transformed plant genome, this very desirable
feature could be used when a high level of expression o~
foreign genes is required.
This invention involves the construction of
recombinant plasmids derived from the T-DNA region of Ti
plasmids of Aqrobacterium tumefaciens. As mentioned
earlier, these plasmids are claimed in the parent
application. These recombinant plasmids contain a left
and a right direct repeat region normally involved in
the transfer of T-DNA from the Ti-plasmid t~ the plant
genome as well as the octopine synthase gene, which
normally catalyses the condensation of an amino acid
with pyruvate, and/or the agropine/mannopine synthase
genes which normally catalyse the condensation of an
amino acid with a carbohydrate. The preferred
recombinant plasmid constructions described here
specifically delete the gsnes controlling tumor
formation and each construction contains a unique B~lII
site into which foreign DNA ~ragments encompassing one
or more functional prokaryotic or eukaryotic genes can
be inserted. Other constructions containing other
restriction sites, either substituting for or in
addition to the ~g~II site, may be incorporated, as will
be understood by those of ordinary skill in the art.
Plant cells, which have become infected by A
tume~aciens carrying these constructed recombinant
plasmids, may have incorporated the T-DNA section. When
tumor-formation genes are deleted or rendered
inoparative, the cells containing T-DNA do not display
the altered morphology and growth habits that normally
make transformed cells distinguishable from
untransformed cells. In order to recognize which plant
cells have incorporated the T-DNA sections of these
constructed recombinant plasmids lacking tumor genes
into their genomes, the plant cells are grown on certain
toxic amino acid analogs disclosed herein. Those cells
which carry one or more of certain opine synthase genes
can metabolize the toxic amino acid analog to a
non-toxic product and will therefore he able to continue
12
growth while those c~lls which do not contain such opine
synthase genes will incorporate the toxic amino acid
analog into their proteins resulting in death of such
cells.
In order to be able to precisely construct a
variety of recombinant T-DNA plasmids with the
characteristics described above, the complete nucleotide
sequ~nce of T-DNA (22,874 nucleotides) and approximately
soo nucleotides on each side of the T-DNA was obtained.
A number of T-DNA restriction fragments were sub-cloned
into PBR322 and propagated in either E. coli. strains
HB101 or GM33. The individual clones were then
sequenced using the method of Maxam and Gilbert [(1977)
Proc. Nat. Acad. Sci. U.S.A. 74:560] (see Example 1).
The nucleotide sequence of a portion of the Ti
plasmid 15955 containing the T-DNA region is shown (Fig.
2). Only one strand of the DNA seguence is presented.
It is orientated from 5' to 3' and extends continuously
for 24~595 bases, from a BamHI site on the left of
fragment Bam8 to an EcoRI site on the right of fragment
EcoD (Fig. 3). Both strands were sequenced for 90% of
the DNA. The remaining 10% was sequenced on on~ strand
but this was often duplicated by sequencing from
different restriction sitesO
A restriction endonuclease map of the sequenced
region is shown for five different restriction enæymes
(Fig. 3). BamHI, EcoRI and HindIII were used to divide
the T-DNA region into suitable fragments for subcloning
into pBR322. The fragments, indicated by the shaded
areas, were used in the construction of T-DNA
recombinants cloned into pSUP106 for transfer and
subsequent replication in A. tumefaciens. The
construction of thsse T-DNA recombinants was facilitated
by a knowledge of the other restriction Pndonuclease
sites (Table 1). Of the 73 enzymes analys~d, only sites
for EcoK were not present in the Ti sequence. The site
locations of enzymes which would digest the DNA more
than 30 times are not given.
It has been reported that extended direct repeats
of 21-25 bases occur at the borders of the T-DNA (Bevan,
M. W., and Chilton, M-D. (1982) Ann. Rev. Genet.
16:357_384). In this work, these two repeats have bean
shown to start at positions 909 and 23,783,
respectively, and they are marked at positions A and D
(Fig. 3). These two repeats are referred to hereafter
as RoTL(A) and RoTR(D). They are exact direct repeats
for 12 bases but they can be extPnded into 2~ base
imperEect repeats. Assuming repeats RoTL(A) and RoTR(D)
set the outer limits, the total T-region length is
22,874 nucleotides. These border repeat sequences occur
in both octopine and nopaline Ti plasmids and play a
fundamental role in the transfer of the T-region to the
plant genome. In the prasent study, similar repeated
sequences were also found at two locations within the
T-region at positions 14,060 (B) and 15,900 (C). These
two repeats are referred to hereafter as RoTL(B~ and
RoTR(C). The presence of thess internal rapeats is
especially interesting because of the observations that
the T-DNA in octopine crown gall cells has a complex
organization involving one (TL-DNA) or two (TL-DNA and
TR-DNA~ regions (De Beuckeleer, M. et al. (1981~ Mol.
Gen. GenetO 1~3:283-28~, Thomashow, M. F. t al. ~1980~
25 Cell 19:729-739). The TL-DNA contains the tumor
inducing genes (tms, tmr and tml) and occu~s in all
tumor lines so far examined whereas the TR~DNA occurs
only in primary tumors and in some stable tumor lines.
The fact that these two T-DNA regions appear to be able
to integrate independently and that both are bounded by
the basic repeats provides additional evidence of their
fundamental role in the transfer of the T-DNA from the
Ti-plasmid to the plant genome. The nucleotide sequence
of the four repeats is presented here.
~25~
Repeat Nucleotide Sequenc~
RoTL(A) G G C A G G A T A T A T T C A A T T G T A A A T
RoTL(B) G G C A G G A T A T A T A C C G T T G T A A T T
RoTL(C) G G C A G G A T A T A T C G A G G T G T A A A A
RoTL(D) G G C A G G A T A T A T G C G G T T G T A A T T
Within the total T region there are 26 open reading
frames (Fig. 3) longer than 300 nucleotides which start
with an ATG initiation codon. These possible
transcripts would encode polypeptides ranging in size
from 11.2 Xilodaltons to 83.8 kilodaltons. Fourteen of
these open reading frames show possible eukaryotic
promoter sequences with close homology to the Goldberg-
Hogness box~ They also show close agreement to the
possible eukaryotic ribosome binding site reported by
Kozak (M. Kozak (1978) Cell 15:1109-1123; Kozak, M.
[(1979) Nature (London3 280:82-85] and contain possible
poly(A) addition sitas at their 3~~ends which are
thought to act as transcriptional termination signals
(Brawerman, G. (1974) Ann. Rev. Biochem. 43:621-642;
(1975) Prog. Nucl. Acid Res. Mol. Biol. 17~117-148~.
Open raading frame 11 codes for octopine synthase while
open reading frames 24, 25 and 26 code for mannopine and
agropine synthases. It is noteworthy that all the
possible eukaryotic transcripts occur within the TL and
TR-DNA regions. The open reading frames between the
direct repeats RoTL(B) and RoTR(C~ and also to the right
of RoTR(D) and to the left of RoTL(A~ show possible
Shine-Dalgarno ribosome binding sites and thus appear to
be prokaryotic in origin.
The information made available by the prPsent
invention as described above enables the construction of
a variety of recombination plasmids eminently useful in
the transfer of foreign genes and/or foreign DNA into
the genome of recipient plant cells. Foreign gPnes
and/or foreign DNA are here defined as DNA nucleotide,
3~
~5
seguences which are not normally present in the T-DNA
of a Ti-plasmid. Knowledge of the nucleotide sequence
provides information on the locations of the promoter
regions of the various genes and the boundaries of the
open reading frames and therefore, as a corollary, also
gives the amino acid sequence and molecular weight of
the various encoded proteins. In addition, the
nucleotide sequence has located all of the direct repeat
regions which are of vital importance in the transfer of
the T-DNA (including various foreign genes and/or
foreign DNA) from the Ti-plasmid to the plant cell
genome. Examples 2 - 7 give details of the construction
of a number of useful recombinant T-DNA's which can be
inserted into a wide host range plasmid. In each of
these constructions, suitably located unique restriction
sites are available for the insertion of foreign DNA
containing one or more genes. In addition, antibiotic
resistance genes are incorporated in the vector region
of the recombinant plasmid, i.e., outside the T DNA
repetltive regions which include the selective opine
synthase gene and the foreign DNA and/or foreign ~enes.
A novel feature of these T-DNA recombinant
constructions is that the tumor inducing genes (tms, tmr
and tml) are preferably deleted or inactivated with the
result that it becomes easier to regenerate intact
plants from transformed cells. However, it also becomes
more di~ficult to distinguish between transformed an~
normal cells, since they no longer form tumors and so a
new method of selecting transformed cells must be
devised. Van Slogteren et al. [(1982) Plant Mol. BiolO
1:133-142] transformed plant cells into octopine-
synthesizing tumor cells after infection with a strain
of A. tumefaciens carrying an octopine Ti-plasmid.
They claimed that, when small normal shoots and
octopine synthase containing crown gall shoots were
transferred to solidified agar media containing various
levels of homoarginine (HA), growth of normal shoots was
clearly inhibited after two to three weeks. In
contrast, the crown gall shoots were not inhibited at
3~
1~
all at the lower concentrations oE homoarginine and only
slightly inhibited at the higher concentrations.
Van Slogteren et al. ~(1982) ~E~] also tested the
effect of homoarginine on reshly isolated normal and
crown gall protoplasts. After three weeks they observed
a clear di*ference (microscopically) in the growth o~
normal protoplasts compared to crown gall protoplasts.
In seven experiments crown gall protoplast showed no
growth inhibition and hardly any difference was observed
in the crown gall cultures in the presence or absence of
H~, whereas in normal cultures in HA the survival rate
was estimated to be 10% or less.
Independent experiments by us gave different
results. Crown gall tumor lines 15955/1 and 15955/01
were used for these studies: these tissues are derived
from single cell clones obtained ~rom tumors incited on
N. tabacum cv."Xanthi" by A~ tumefaciens strain 15g55
(Gelvin, S. B. et al. (1982) Proc. Nat. Acad. Sci.
U.S.A. 79:76-80). Both lines grow on medium lacking
cytokinins and auxins and both contain T-DNA. However,
octopine is not found in line 15955/l, whereas it is
found in line 15955/01 reflecting the fact that the
octopine synthase gene is not present in the former
line, whereas it is present in the latter line. The
presence of octopine synthase in line 15955/01 and its
absence in line 15955/1 was later zonfirmed. Thus,
these two lines are ideal for testing whether or not
the toxic analog homoarginine could be used to select
octopine synthase containing genes as claimed by van
Slogteren et al. (supra). As can be seen from Figure 1,
homoarginine affected the growth of the two tumor lines
about equally. Clearly, tissue from a line containing
the octopine synthase gene was nok distinguishable from
a line without the octopine synthase gene. The reason
for the discrepancy between our results and those of van
Slogteren et al. is at present unclear.
Surprisingly, therefore, further experimentation
with a number of other amino acid analogs showed that
salection of octopine synthase containing transformed
plant cells was successful with some of the analogs but
not with others. The relative differences in growth of
tissues on medium that contain~d L-2, 4-diamino-n-
butyric acid (an analog o~ L-ornithine) or 2-
thiazolyl-alanine (an analog of histidine) were small
and inconsistent from experiment to experiment and wor~
with these analogs was abandoned.
The same two tissue culture lines (i.e., 15955/1
and 15955/01) as were used to test the selective
abilities of homoarginine, were also used to test the
selective abilities of canavanine-S04 (also an analog of
arginine) and 2 amino-ethyl-cystein~ (an analog of
L-lysine~. In view of the failure to select Por cells
with the ability to synthesize octopine synthase by
growth on medium containing homoarginine, it was most
surprising to find a considerable degree of selection
for such cells when tests were conducted on
canavanine-S04 (CS~ (Fig. 4~. Even more surprising was
the powerful and absolute selection for transformed
octopine ~ynthase producing cells when the selection was
done on medium containing even very low concentrations
of 2-amino-ethyl-cysteine (AEC) (Fig. 5). These two
amino acid analogs (CS and AEC) can be used to select
for transformed cells in tissue cultures and
regenerating plants obtained from these tissue cultures
or for transformed protoplasts.
Furthermore, the same approach to selection is
useful with the agropine synthase genes. Agropine and
mannopine appear to be derived from condensation of
glutamine and a carbohydrate and results ~rom this
invention have also clearly demonstrated that when
agropine/mannopine synthase genes are present in
transformed cells, then the use of a toxic amino acid
analog distinguishes transformed cells from normal
cells. In principle, nopaline synthase could be used to
detoxify an appropriate toxic analog of its arginine
substrate to achieve selection in the described manner.
An appropriate analog has not been identified to date.
3~
18
numbar of strains o f Nicotiana tabacum were
tested for their ability to grow on toxic analogs of
amino acids participating in the agropine mannopine
biosynthetic pathway. Details of the strains used are
5 shown ~TablP 2 ) .
In all experiments 50mg pieces of tissue were used
initially. Three pieces we.re placed on each petri dish
and duplicate dishes were used. These tissue pieces
were grown for 9 weeks before they were harvested, dried
10 and weighed. In one set of experiments two strains of
Nicotiana tabacum cvO Xanthi were tested. One strain
159 No.-l was agropine/mannopine negative while the
other strain 1590-1 was agropine/mannopine positive.
These two strains were tested for their ability to grow
on various levels of glutamic-~ hydrazide (GH-Table 3),
S-carbamyl-L-cysteine ( CC-Table 5 ~ and 6-diazo-5-oxo-L-
norleucine (DON-Table 7). When grown on 20~g GH/ml
medium, the growth rate of Strain 159 No.-1
(agropine/mannopine negative) had declined to 9.1% of
20 the control growth rate (T~ble 3) whereas Strain 15g0-1
(agropine/mannopine positive) had only declined to 86.4%
of the control rate. The differences between the growth
rates of the two strains on this toxic amino acid analog
were clear and striking. When these two strains were
25 grown on 25~g CC/ml medium, there was a claar drop in
the growth rate o:E the agropine/mannopine negative
strain to 6.9~ oE the control growth (Table 5) whereas
there was essentially no drop in the growth rate of the
agropine/mannopine positive strain. Finally, when the
30 agropine/mannopine negative strain was grown on 0 . 25,ug
DON/ml medium, there was no growth whatsoever, whereas
th2 agropine/mannopine positive strain had only declined
to 24% of the control growth rate (Table 7).
In a second set of experiments, an
35 agropine/mannopine negative strain (WC 5~-Table 2 ) and
an agropine/mannopine positive strain (W-B634) of
Nicotiana tabacum cv Wisconsin 38 were tested on various
lev~ls of GH, CC and DON. In the case of GH (Table 4),
the agropine/mannopine negative strain WC58 was dead in
19
the presence of 10~g GH/ml of medium, whereas the growt~
rate of the agropine/mannopine positive strain W-B634
was still 55% of the control growth rate. When the same
two strains were tested on CC tTable 6), the
agropine/mannopine negative strain was dead in the
presence of 50~g CC/ml of medium while the positive
strain showed no decrease at all in the growth rate.
Finally, the results were also quit~ clear cut when
these strains were grown on DON (Table 8). In the
presence of 0.12~g DON/ml of medium, the
agropine/mannopine n~gative strain (W-C58) was dead
while the agropine/mannopine positive strain (W-B63~)
had grown to some extent (i.e., 12% of the control
growth rate).
Thus, the results revealed in this invention teach
a unique method of selecting for transformed tissues,
cells and protoplasks. These results make use of the
fact that untran~formed cells lacking the g~nes for
opina synthesis cannot gxow in the presence of toxic
amino acid analogs, whereas transformed cells containing
opine synthases are able to srow. Furthermore, the
selection can be used either when the octopine synthase
genes are present or when tha agropine/mannopine
synthase genes ara present.
The ability to select for transformed cells by
selecting for the octopine synthase or the
agropine/mannopine synthase genes permits a further
refinement in the engineerin~ oE foreign genes which are
desired to be expressed. Thus, the trans~ormed cells
may be obtained by selecting for one of the opine
synthase biosynthetic pathways and inserting the foreign
gene(s) into the reconstructed T-DNA in such a manner
khat expression of these genes comes under the control
of the other opine synthase. For example, it would be
possible to construct a T-DNA containing RoTL(A~,
octopine synthase, RoTL(B), agropin~/mannopine
synthase-RoTR(D). An analog of lysine, e.g., 2 amino-
ethyl-cysteine could be used to select for transformed
cells by selecting for octopine synthase while the
uniqu~ MstII site (nucleotide 19471 within the
agropine/mannopine genes) could be used to insert any
foreign DNA.
A further advantage of such a T-DNA construction
would be that the two repetitive sequence~ RoTL(A) and
RoTL(B) as well as the octopine synthase gene used to
select for transformed gene(s) which would still be
expressed under the control of the agropine/mannopine
synthase gene promoter region.
In summary, the use of reconstructed T-DNA plasmids
containing only the direct repeats involved in
incorporation of the T-DNA into the plant genome and one
or more opine synthesizing genes has resulted in the
following useful results: 1. The tumor inducing genas
have been deleted resulting in greater success of plant
regeneration from transformed tissue cultures or
protoplasts. 2. The opine synthesizing genes have been
used to select for those plant cells which have
incorporated the T-DNA (and therefore in addition any
foreign genes which have been inserted~. 3. The
invention now permits the recognition of plant cells
which have incorporated only parts of TL, only parts of
TR or parts of both TL and TR. Since multiple copie~ of
TR are found in a transform~d plant genome, this feature
could result in a much hiyher level of expression of
foreign genes incorporated into some of these T-DNA
constructions.
The invention is illustrated by the following
Examples:
Example 1: Sequencin~ of the nucleotides of the
T-DNA from the Ti plasmid pTi 15955
Fragments of T-DNA and the flanking regions
obtained by use of restriction endonucleases were cloned
into pBR322 and then propagated in either E~ coli
strains HB101 or GM33. The îndividual clones were then
sequenced using the method of A. M. Maxam and W. Gilbert
[(1977) Proc. Nat. Acad. Sci. U.S.A. 74:560]. For
sequencing lO~g of the cloned DNA's were cut with a
suitable restriction enzyme and then treated for 30
~5~
21
minutes at 55C with 2.5 units of calf intestinal
alkaline phosphatase after the pH was adjusted by adding
one-tenth Yolume of 1.0 M Tris/HCl pH 8.4 to the
reaction tube. The alkaline phosphatase was removed by
three phenol extractions followed by two ethanol
precipitations. The dephosphorylated DNA was then dried
and taken up in 15~1 water and 15~1 denaturation buffer
consisting of 20mM Tris/HCl, pH 9.5, lmM spermidine and
O.1 mM EDTA. This mixtur~ was incubated at 70C for 5
minlltes and then immediately put into iced water. After
chilling, 4~1 of kinase buffer consisting of 500 mM
Tris/HCl pH9.5, 100 mM MgC12, 50 mM dithiothreitol, 50%
(v/v) glycerol, 100~ Ci of [~-32P] ATP and 2.0 units of
polynucleotide kinase were added and the reaction
mixturP was incubated at 37C for 30 minutes. The
reaction was stopped by ethanol precipitation and the
sample dried. The double end-labelled DNA was digested
with a suitable restriction enzyme to produce single
end-labelled fragments which were then separated on and
eluted from a polyacrylamide gel (procedures 4, 5a, 7
and 9 o~ Maxam and Gilbert)~ The DNA ~equencing
reactions were then carried out as described (Maxam, A.
M. and W. Gilbert (1977) ~upra) with the ~ollowing
modi~ications. The limiting G ~ A reaction was carried
25 out by adding 30~1 of 88% formic acid to the reaction
mix and incubating at 20C ~or 3 minutes. The reaction
was stopped by the addition of 400~1 0.3M Na-acetate
(hydrazine stop). The G reaction time was reduced to 20
seconds and incubated at 20~C. The C + T and C
reactions were reduced to three minutes at 20C and
stopped by the addition of 400~1 hydrazine stop. All
the reactions were then continued as described (Maxam,
Ao M. and W. Gilbert (1977) supra). Long sequencing
gels 20cm wide, lOcm length and 0.2mm thick were used
to separate the oligonucleotides. The gel plates were
treated with a silane (Garoff, H. and Ansorge, W.
(1981) Anal. Biochem. 115:450-457) to bind the
acrylamide chemically to one ~ace plate. The other
supporting plate is a thermostating plate which
22
maintains the gel at 50 throughout electrophoresis.
Samples were separated on 4%, 6% and 16% acrylamide
gels. Differential time loadings were avoided by
applying aach sample to each of the three gels
simultaneously. Gels were run for 14 hours at 3,000
volts to provide adequate ~ross-over o~ the sequencing
ladders from gel to gel. After electrophoresis, the gel
(bonded to the face plat~) was ~ixed in 10~ acetic acid
for 15 minutes, then rinsed in water. The gel dried
directly onto the face plate, shrinking to a thickness
of approximately OOOlmm. Consequently, ~-ray film could
be placed in direct contact wi~h the dried gel resulting
in increased band intensity and resolution. Auto-
radiography was carried out at room temperature without
the use of intensifying screens. Using these
techniques, it was possible to routinely sequence 500
base pairs per fragment. Therefore, by applying 5
fragments to each set o 3 gels, 2500 bases o~ saquence
could be obtained. Analysis of the DNA and protein
sequences were done by computer. The programs used were
those of Dr. 0~ 5mithers and Dr. F. Blattner (University
of Wisconsin, Madison).
Example 2~ Construction of a micro-Ti plasmid
includinq RoTL~A), ~oTL~B~ and the
octopine synthase qene
Clone p233 consists of the Ba~HI fragment 17 and
EcoRI fragment E (Figs. ~ and 6a) cloned into the
vector pBR322 (Bethesda Research ~aboratories, Inc.,
PØ Box 577, Gaithersburg, MD 20760)~ The clone was
cleaved with the restriction endonuclease SmaI (Fig.
6a), the blunt ended SmaI restriction site was converted
to a BqlII site by the use of B~lII linkers and the DNA
was ligated and then transformed into E. coli K802. The
resulting recombinant plasmid was puri~ied and then
transformed into E. coll GM33 which is Dam- and
therefore incapable of methylating adenine residues. In
this strain the ClaI sits at nucleokide 14686 was not
methylated and could be cleaved. Following ClaI and
B~lII digestion, the procedure yielded a T-DNA fragment
(fragment 2a from nucleotide 11207 to nucleotide 14686)
containing the complete octopine synthase gene and the
direct repeat at the right hand border of TL (i.e.,
RoTL(B~). Alternatively, a similar sized fragment
(fragment 2) can be obtained by use of the restriction
endonuclease BclI in place of ClaI (Fig. 6).
Next the HindIII clone plO2 (covering T-DNA
nucleotides 602-3390) previously cloned into the vector
pBR322 and containing a BqlII site (nucleotide 1617) was
cleaved with BglII and HindIII (Fig. 7) to yield a T-DNA
fragment (fraqment 1) containing the direct repeat at
the left hand border of TL (i.e., RoTL(A)~.
Finally, the wide host range plasmid pSUP106 which
will replicate in Aarobacterium umefaciens was clea~ed
with HindIII and ClaI (Fig. 8). These three fragments
have the following restriction sites at their borders:
Fragment 1 has BqlII and HindIII; fra~ment 2 has BqlII
and ClaI; and pSUP106 has ClaHI and HindIII. Since the
restriction sites bounding the three fragments are never
common to more than two fragments, ligation can only
occur in one arrangement (A-ocs-B) ~Fig. 8). The ~
sit~ between ~ragments 1 and 2 is unique site and can be
used to insert any foreign DNA fragment as desired.
This restriction site is very vsrsatile since foreign
DNA sPgments which have been cleaved by BqlII, BamHI,
BclI, MhoI and Sau3A, among others, can be inserted.
Restriction anzymes and ligase were all used
according to the recommendations of the supplier.
Example 3: Construction of ~a m_cro-Ti plasmid
including RoTL(A~, octopine synthase
RoTL(B) RoTR(D~
As described in Example 2, the HindIII clone plO2
(spanning T-DNA nucleotides 602-3390) was used to yield
a T-DNA fragm2nt 1 (Fig. 7) and clone p233 was used to
produce fragment 2 (Fig. 6~. These two fragments were
ligated to produce fragment 3 (Fig. 9) with a HindIII
site a-t c~e end and a BclI site at the other end.
~ragment 3 co:ntains the nucleotide sequences for
RoTL(A), octopine synthase and RoTL(B~. It should be
24
noted that RoTL(B~ could be omitted from the
reconstructed T-DNA plasmid by re~triction cleavage with
BamHI at the BamHI restriction site at nucl20tide 13774,
i.e., 142 nucleotides upstream from the initiation codon
of octopine synthase. When this site was used, it was
found that the octopine synthase gsne expression was
prevented. When the BclI site (nucleotide 14711) was
used to isolate a fragment containing the octopine
synthase gene, then the gene was actively expressed. It
is possible that a di~ferent DNA fracJment could be
substituted for the region between BclI and BamHI to
restore expression of the octopine synthase gene, e.g.,
any of the repetitive sequences, i.e., RoTLtA), RoTLtB),
RoTRtC) or RoTRtD).
The next step is to amplify the EcoRI clone p501
(Fig. 10) previously cloned into pBR322 and to purify
the plasmid. The purified plasmid is then cleaved with
restriction endonucleases StuI and K~I to yield a T-DNA
frayment covering nucleotide~ 21673 to 24337 and
including the repetitive sequence RoTR(D) (fra~ment 4).
The cleavage produced by StuI is blunt ended, whereas
-that produced by KpnI has a 3'-overhang. The blunt-
ended StuI site is converted to a BamHI site by the use
of BamHI linkers. After Ba~HI digestion, fra~ments 3
and 4 are ligatecl together to yi~ld fragment 5 (Fig. 9)
which has a HindIII site at one e~d and a KpnI site at
the other endO It should be noted that the
endonucleases BclI and BamHI produce compatible cohesive
ends.
Then the 3'-overhang produced by cleavage of
fragment 4 with KpnI is made blunt ended using the
3'-exonuclease activity of bacteriophage T4 DNA
polymerase (Maniatis, T. et al. (1982) In Molecular
Cloning p.l~0 Cvld Spring Harbor). Following
inactivation of the polymerase by phenol extraction and
precipitation of the plasmid in cold ethanol, the blunt
end is convertecl to a ~IindIII site by the use of HinclIII
synthetic linkers so that fraqment 5 now has HindIII
3~6
sites at both ends. Fragment 5 is then digested with
the en~yme HindIII.
Finally the wide host range plasmid pSUP106 is
linearized with HindIII and treated with bacterial
alkaline phosphatase. Fragment 5 is then ligated into
the linearized pSUP106 to yield a recombinant plasmid in
which the T-DNA section contains in sequence RoTL(A),
octopine synthase, RoTL(B), and RoTR(D) (A-oc~-B-D)
(Fig. 9). It should be noted that the versatile BglII
site at the junction of ~ragments 1 and 2 can be used to
insert any foreign DNA fragment carrying one or more
genes that are desired to be expressed.
Example 4: Construction of a_ micro-Ti plasmid
including RoTL(A), RoTR(D~_ and the
aqro~ine/mannopine synthase
The agropine mannopine synthase genes include open
reading frames 24, 25, and 26 (Fig. 3) but it is not yet
known which of these open reading frames corresponds to
agropine synthase and which corresponds to mannopine
synthase. Reading frames 24-26 are therefore referred
to as agropine/mannopine synthase genes (ags/mas). The
EcoRI clone p403 (T-DN~ nucleotides 16202 to 216313 and
the EcoRI clone p501 (T-DNA nucleotides 21632 to 24590)
were both cloned into pBR322 and separately transformed
into E coli HB101. Following amplification and
purification, clone p403 is cleaved with SstI at the
T-DNA nucleotide 18,472 (see Fig. 11). The overhanging
3~-end is mada blunt ended using the 3'-exonuclease
activity of bacteriophage T4 DNA polymerase (Maniatis,
T. et al (1982) In Molecular Cloning p.l40 Cold Spring
Harbor). Following inactivation of the polymerase by
phenol extraction and precipitation of the plasmid in
cold ethanol, the blunt ends are converted to BqlII
sites by the use of BqlII synthetic linkers. Then the
DNA is cleaved with ~coRI and ~lII to produce a
fragment from the T-DNA covering nucleotides 18,~72 to
21,631. This fragment (fragment ~) contains some of the
agropine/mannopine synthase genes and is bounded by a
BglII site and an EcoRI site.
3~
2S
Next EcoRI clone p501 (T-DNA nucleotides
21632-24590), pr~viously cloned into pBR322, is cleaved
with restriction endonucleases EcoRI and KpnI. The
resulting fragment 7 (Fig. 12) contains the remainder of
the agropine/mannopine synthase genes (not included in
fragment 6) and, in addition carries th~ repetitive
sequence RoTR(D).
Fragment 1 (Fig. 7), fragment 6 (Fig. 11) and
fragment 7 (Fig. 12) are mixed together and ligated.
Since no more than two of the six ends have compatible
cohesive ends, the three ragments can only ligate in
one orientation to give fragment 8 (Fig. 12)
(A-ags/mas-D) with a HindIII site at one end and a KpnI
site at the other end. Finally, the 3'-overhang at the
KPnI site is removed by T4 DNA polymerase and converted
to a HindIII site by use of synthetic linkers. (Note:
this will convert both ends to bIunt ends and add
HindIII linkers to the HindIII end. This adds 4bp to
that end.) This fragment therefore has HindIII sites at
both ends and can be inserted into pSUP106 after this
wide host range vector has been linearized by
restriction endonuclease HindIII.
Exam~le 5: Construction of a micro-Ti plasmid
includin~ RoTL~B)I _ RoTR(D~ and the
a~ropine synthase genes.
Clone p233 which spans the BamHI fragment 17 and
EcoRI fragment E (Fig. 13) was cloned into the vector
pBR322. The resulting recombinant plasmid was then
transformed into E. coli GM33 which is Dam~ and was
therefore incapable of methylation. In this strain the
BclI site at nucleotide 14711 was not methylated and
could be cleaved. Following amplification, the
recom~inant plasmid is purified and cleaved with the
restriction endonuclease H~aI (Fig. 13). The blunt
ended ~E~I restriction site is converted to a B~lII site
by the use of B~lII linkers. Then the fragment is
cleaved with the restriction endonucleases ~qlII and
BclI. This procedure yields a T-DNA fragment (fragment
9 from nucleotide 13,~00 to nucleotide 14711) which
contains the direct repeat at the right hand border of
TL ~i.e., RoTL(B)l.
A second fragment (fragment 10) which includes the
agropine/mannopine synthase genes and the direct repeat
at the right hand border of TR (i.e., RoTR(D)) was
constructed by mixing fragments 6 and 7 (Fig. 12) with
fragment 9 (Fig. 13) and ligating them together to give
fragment 10 (Fiy. 14). The 3'- overhang at the ~E~I
restriction site is then blunt ended by use of T4 DNA
polymerase and converted to a HindIII site by use of
synthetic linkers. This procedure will convert both
ends to blunt ends and add HindIII linkers to the
HindIII end. Subsequent digestion with HindIII and BclI
will produce a fragment with a BclI site at one end
(compatible with a BamHI site~ and a HindIII site at the
other end (~ragment 11-B-ags/mas-D) (Fig. 143.
The wide host range vector pSUP106 which can
replicate in A~robacterium tume~aciens is then
linearized by digestion with Bam~II and HindIII and
ra~ment 11 is inserted into the linearized vector.
Ex mple 6: Construction of a _micro-Ti ~lasmid
includlnq RoTL(A), tha aqropine/mannopine
synthase_ qenes. RoTR(D~, _the_ octopine
synthase ~ene and RoTL(B)
Fragment 1 was obtained as describ~d in Example 2
(Fig. 7). This fragment has a HindIII site at one end
and a BqlII site at the other end. Fragment 12 was
obtained by ligation o~ fragments 6 and 7 (Fig. 12~ and
has a BqlI1 site at one end and a KpnI site at the other
end~
Clone p233 which spans the BamHI fragment 17 and
EcoRI fragment E (Figs. 6 and 13) was cloned into the
vector pBR322. The resulting recombinant plasmid was
then transformed into E. coli GM33 which is Dam and was
therefore incapable of methylation. In this strain the
BclI site at nucleotide 14711 was not methylated and
could be cleaved with the enzyme BclI. Following
ampli~ication, the recombinant plasmid is purified and
cleaved with the restriction endonucleases BclI and KpnI
28
to yield fraqment 13 spanning T-DNA nucleotides from the
KpnI site (nucleotide 983~) to the BclI site (nucleotide
14711). Ligation of a mixture of fragment 1 (Fig. 7),
fragment 12 (Fig. 12~ and fragment 13 (Fig. 15) yields a
recombinant fragment 14 (Fig. 16~ with a _IindIII site at
one end and a BclI site at the other end (A ags/mas-D-
ocs-B~.
The wide host range plasmid pSUP106 is finally
linearized with the restriction endonucleases BamHI and
_ dIII. After linearization, fragment 14 is inserted
by ligation.
This construction has the advantage that, if
desired, the foreign genes can be inssrted into one of
the opine synthase genes and the promoter of that gene
then used for the expression of the foreign genes while
the second opine synthase gene can be used for the
selection of trans~ormed cells.
Example 7: Construction of a m_cro-Ti plasmid
includin~_ RoTLfA~. duPlicate octopine
synthase genes and RoTL~B~ and_RoTR(D~
The methods of obtaining the fragments used in the
present T-DNA construction have been described in the
previous examples. Fra~mants 1 and 2 were obtainPd as
described in ~xample 2 (Figs. S and 73. Fragment 4 is
obtained as describ~d in Example 3 (Fig. 10) and
fragment 13 is obtained as described in Example 6 ~Fig.
15)-
In the present example, ~ragments 2 and 13 are
ligated together to give fragment 14 containing two
octopine synthase genes and two repetitive RoTL(B)
sequences in opposite ori~ntations (Fig. 17). Following
repurification of the ligated fra~ment, the correct
orientation i5 checked by a restriction endonuclease map
and the purified, ligated fragment 14 is then mixed with
35 fragments 1 and 4 to yield Eragment 15 (Fig. 17)
containing all the required elements. ~ragment 15 is
inserted into thP wide host range mutant pSUP106
following linearization of the ve~tor with the
restriction endonucleases HindIII and BamHI. The
~9
presence of two octopin~ synthase genes available for
selection will increase the ability to select
transformed cells or protoplasts from a mixture of
transformed and normal cells or protoplasts when they
are grown in the presence of a toxic amino acid such as
canavanine or 2-amino-ethyl-cysteine.
Example 8: Preparation o~ a Bacillus thurinqiensis
crystal protein ~ene
pES1 (H. E. Schnepf et al., Eur. Pat. Appl. 63,949,
10 ATCC 31995) is cut with PstI, then mixed with and
ligated to PstI-linearized mWB2344 (W. M. Barnes, et
al. (1933) Nucleic Acids Res. 11:349-368). The
resultant mixture is transformed into E. coli JM103, and
tetracycline resistant transformants are selected.
Double-stranded RFs (replicative form) are isolated from
the transformants and characterized by restriction
mapping. Two types of transformants are found: cells
harboring mWB2344-ESl-A; and cells harboring
mWB2344-ES1-S. These are M13 vectors which when in
single-stranded viral form carry the antisense and sens~
strands of the crystal protein gene of pES1~
The sequence of the crystal protein gene (see
below: b) (H. C. Wong et al. (1983) J. Biol. Chem.
258:1960-1967), if changed at three base-pairs, will
have a ClaI site (5'...AT*CGAT..~3') immediately ahsad
of the ATG translational start site. The
o 1 i g o n u c 1 e o t i d e ( s e e b e 1 o w : a )
5'ATGGAGGTAATCGATGGATAACA3' i9 synthesized by standard
methods, is hybridized to the single strand viral ~orm
of mWB2344-ESl-A, and is used to prime synthesis of a
second strand o~ DNA by the Klenow fragment of E. coli
DNA polymerase 1. After ligation and selection oE
covalently closed circular DNA, the mixture is
transformed into JM103. RF DNAs are isolated from the
infected cells and characterized by restriction enzyme
analysis. A clone descend~d from and containing the
mutant sequence (a) is identi~ied by the presence oE a
novel ClaI site which maps at the 5' end o~ the crystal
protein gene and is labeled mW~2344-ESl-A(Cla)0 The
effect of the mutation can be seen by comparing the
sequences of the oligonucleotide primer (a) with the 5'
end of the crystal protein gene (b~:
a~ 5'ATGGAGGTAAT*CQ ATG GAT AAC ~3'
b) 5'...AGAGATGGAGGTAAC TT/AT5/GAT~AAC/AA~CC...3'
Met ~sp ~sn Asn Pro...
No~e that only three out of 23 base pairs have been
changed (the underlined nucleotides of (a)), thereby
assuring good hybridization propertiesO
The cryskal protein gene is removed from mWB2344-
ES1-A(Cla) by digestion with ClaI and XhoI. The XhoI
sticky ends are converted to ClaI sticky ends by
ligation to a linker, synthesized by standard methods,
having a structure as follows:
XhoI ClaI
5'TCGAGCCCAT3'
3'CGGGTACG5'
Excess linkers are trimmed off of the crystal protein
gene-bearing ~ragment by digestion with ClaI.0 Example 9~ Construction and modification o~ a
promoter vehicle
p~Slll~ which is a pRK290 clone corxesponding to
ths T-DNA clone p403 (Fig. 3) which encodes a gene
covering 1.6kb (C. F. ~ink (1982) ~.S. thesis,
University of Wisconsin~Madison), or p403 itself, is
digested with ClaI and then religated. The ligation mix
is trans~ormed into Eo coli K802 ~W. B. Wood (1966) J.
Mol. Biol. 16-118) and selected for tetracycline
resistance. Plasmids are isolated by doing "minipreps"
(plasmid preparations from small volume cell cultures)
and restriction maps are obtained to prove the
structure. The new vehicle, pKS-proI (see Canadian
Patent Application Serial No. 451,767 ~iled April 11,
1984, can be lin~arized by ClaI.
The above manipulations are done with the following
rationale^ The T~DNA gene in pKSlll is shown below in
summarized form as follows:
31
-ClaI 960 kp 250 bp ClaI 60 ~p 50 kp
5'.. ...TAC~CA~I*OG/~IG/G~C~AIG/... /I~.... AI~CGAT.... AAAI~A... AA~I~A... 3
pro~oter Met Asp M~t~.stop polyadenylation si~s
"1.6'~kbp g2n~
By removing the ClaI fragment, the promot~r reyion of
the "1.6" gene is brought next to the 3'-downstream
region of the gene. This 3' region includes
polyadenylation signals. The resulting structure is
summarized as follows-
E~oe90
ClaI 60 bp 50 bp
5~.~.AIAcAccAAAl*cG~IAGT.. ~........ AA~rAA... A~AIA~A~... 3~ (p~sE~roI)
pr~moter p3lyadenylation si~E~s
Example 10: Insertion of the roI promoter into the
A-ocs-B plasmid (Fiq. 8)
pKS-~E~I is digested with EcoRI and mixed with and
ligated to EcoRI/BamHI linkers, synthesized by standard
procedures having the following structure:
~coRI BamHI
5'AATTCCCCG3'
3'GGGGCCTAG5~
The linkers are trimmed by digestion with Bam~II. After
the T-DNA promoter fragment is purified by gel
electrophoresis, it is mixed with and ligated to
BqlII-linearized A-ocs-B (Example 2, Fig. 8). The
mixture is transformed into E. coli GM33 and
transformants xesistant to chloramphenicol are selected.
Plasmids isolated from such transformants are isolated
and characterized by restriction enzyme analysis. A
plasmid containing the promoter fragment is labeled
pA-ocs-B-proI.
Example 11: Insertion of the crystal protein gene
into the vector
p~-ocs-B-~E~I is linearized with ClaI, and is then
mixed with and ligated to the crystal protein gene-
bearing ~ragment terminated by ClaI sticky ends
constructed above. The resulting plasmids are
transformed into GM33. Plasmids isolated from
transformants resistant to chloramphenicol are
5~
32
characterized by restriction analysis. A colony is
chosen which contains a plasmid, pA-ocs-B~ I~ESl,
having present a single copy of the crystal protein gene
oriented in the same polarity as the ~E~I promoter.
pA-ocs-B-E~I-ES1 is transferred to an appropriat~
Agrobacterium host and used to transform tobacco cells
as described in Example 12.
Example 12: Selection of plant cells transformed by
trans~er of reconstructed T-DNA
recombinant plasmids from Agrobacterium
tumefaciens
The purpose of this example is to demonstrate a
procedure to select transformed cells from mixtures of
transformed and non-transformed cells. Generally,
transformed cells are selected for their hormone
autonomous growth. However, when Ti plasmids that have
been mutated in tms, tmr or tml are used, khen
transformed cells are not autonomous and a selectable
marker becomes desirableO Kanamycin or G418 resistance
is a possibility, but it requires engineering a
resistance gene. AnothPr possibility is the use of
octopine synthase a~ an enzyme to detoxify exogenously
added toxic amino acid analogs, e.g., ~-aminoethyl-
cysteine (2A~C). In this invention, it has been
demonstrated that non-transformed tissues were killed by
low levals of AEC (Fig. 5) whereas crown gall tissues
expressing octopine synthase were not killed.
There~ore, the present example uses Ti-plasmids
that are mutated in tms, tmr or tml but contain a
non-mutated ockopine synthase gene. Plants are first
stem inoculated as previously described (K. A. Barton et
al. (1983) Cell 32:1033-1043). After 10-12 days, fresh
growth is r~moved and shaken in liquid culture until a
number of cells have sloughed off. The culture is then
passed through a filker and the small clumps of cells
are collected. These clumps are plated on a filter
paper placed on top of a feeder culture containing
hormones.
33
Once the cslls have started to grow, the entire
filter is transferred to hormone media containing 2AEC.
The transformed cells will be expressing octopine
synthase that will detoxiEy the amino acid analog thus
allowing them to grow whereas the untransformed cells
will be killed.
Colonies that grow on 2AEC are picked and tested
for octopine synthaseO These cells can then be
regenerated and can be shown to carry T-DNA containing
the octopine synthase gene.
Example 13: Tests for the _relative toxicities of
amino acid analo~s usinq strains 15955/1
and 15955/01 ~rom Nicotia a tabacum
(tobacc~L _v. "Xanthil'
Aqueous solutions of the amino acid analogs were
adjusted to pH 5~6-5.8 and sterilized by filtration
(0.45 micron Millipore filter). Serial dilutions of
each analog were add~d to cytokinin- and auxin-free agar
medium (Linsmaier, E. M. and F. Skoog (1965) Physiol.
20 Plant 8:100-127) that had been autoclaved and allowed to
cool to about 60~C. A number of other plant strains
were us~d ~or initial screening of the analogs. Three
100mg pieces of 4-6 week old tissue were planted on
analog-containing medium in 55mm Petri dishes using
tissue lines from Helianthus annuus ~sunflower) cv.
"Russian Mammoth" ~Kemp, J. D. (1982) In Kahl, G. and J.
S. Schell (eds.) Academic Press, New York, London, Paris
pp~461-474); E228 and Bo5~2, from N. tabacum cv.
"Samsun" (Sacristan, M. D. and G. Melchers tl977) Mol.
30 Gen. Genet. 152~ 117); Braun's teratoma from N.
tabacum cv. "Havanal' (Braun, A. C. and H. N. Wood.
(1976) Proc. Nat. Acad. Sci. U.S.A. 73:496-500); A66
isolated from N tabacum cv. "White Burley" (Finsin, J.
L. and G~ R. Fenwick ~19 7 8) Nature, London 2 7 6:842-844);
35 and W-A6, W-~63~, W-C58 and W-T37 isolated by J.
Tournew, CNRA, Versaillas, from tumors incited on N.
tabacum cvO "Wisconsin 38" by octopine- type A.
tumefaciens strains A6 or B634, or nopaline-type strains
C58 or T37, respectively. The results with all o~ the
34
above strains were essentially the sam~ as those
described for N. tabacum cv. "Xanthil' strains 15955/1
and 15955/01. For the toxicity studies with the 15955/1
and 15955/01 tumor lines, three 50mg pieces of 4-6 week
old tissue were planted on medium in 90mm dishes. In
all cases, duplicate or triplicate dishe~ were used for
each tissue and each concentration of an analog. The
tissues were weighed after 5-7 weeks o~ growth at 25C
in the dark. Growth was expressed as a percentage of
the fresh weight increase of the same tissue on medium
that did not contain any analog or amino acid. The
experiments were repeated after initial results
delimited the range of concentrations to use for a given
analog. Experiments with the 15955/1 and 15955/01 lines
were repeated at least twice with the appropriate
concentration rangesO
Example 14: Methgd of assaying_for opine synthases
Octopine synthase was assayed using som~
modifications of previous methods tBirnberg, P. et al.
20 (1977) Phytochemistry 16 647-650; Goldmann, A. (~977)
Plant Sci. Lett. 10:49-58; Hack, E. and J. D. Xemp
(1977~ Biochem. Biophys. Res. Comms. 78:785-791;
Lejeune, B. (1967) C. R. Acad. Sci. Ser. Do
265:1753-1755; Otten, L. A. B. M. and R. A. Schilperoort
~5 ~197~) Biochim. Biophys. Acta. 527:497-500). For each
mg o~ tissue in a 1.5ml Eppendorf tube, 3~1 of a
buf~ered (0.15M potassium phosphate, pH 6.9) reaction
mixture was added. This reaction mixture contained 20
~M L-arginine, 50 mM pyruvate and 13.5 mM NADH. The
tissue was carefully macerated in the reaction mixture
with a glass rod and incubated at 25C ~or one hour.
The samples were then clarified by centrifugation and
2~1 o~ supernate wa spotted on Whatman~ 3MM paper. Up
to 30~1 of sample was used to verify a negative assay
result. The Whatman 3MM paper with the samples, as well
as l-10~g o~ octopine (or other opine) as an authentic
standard and Orange G as a migration marker, was
care~ully wetted with electrophoresis buffer (formic
acid/acetic acid/water; 3/6/91, v/v/v~ and
electrophoresed at 50-75 voltsJcm (Gibson High Voltage
Electrophoresis Apparatus, Model D) for 10-20 minutes.
The electrophor~tograms were dried in a current of hot
air and stain~d ~or octopine ~or other opines) with
either a phenanthrene quinon~ reagent (Yamada, S. and H.
A. Itano (1966) Biochim. Biophys. ActaO 130:538-540) or
with Sakaguchi -.eagent (Easley, C. W. (1965) Biochim.
Biophys. Acta. 107:386- 388). The Sakaguchi reagent is
several-fold less sensitive but was more specific for
guanidinyl compounds. When the above conditions were
used, it was also shown that tissue extraction buffers
(Hack, E. and J~ D. Kemp (1977) su~ra; Otten, L. A. B.
M. and R. A. Schilperoort (1978) supra) did not improve
assay results and, in ~act, retarded electrophoretic
migration when larger sample volumes wPre spott~d.
Electrophoretic mobilities were measured from tha origin
~0) relative to Orange G (1.0).
TABLE 1
RESTRICTION ENZYME SITES OF TH~ T DNA REGION OF pTI 15955
Enzyme Sit~s L~c~tions
Apa I 111,930
Mat II 119,471
Kba I ~18,089
Mlu I 28,93912,943
Sal I 26,77823,292
Tth I 217,04324,288
Hpa I 37,2579,442 13,800
Kpn I 3625 9,838 24,337
Pst I 39~21110,06922,456
Sa~ I 32,61014,0~918,472
Sat II 314,99618,46223,123
Xho I 36,72715,20821,476
Xma III 3411 11,983 22,663
Aat II 44,51111,76314,6S5 15,140
Bal I 44,3195,456 6,253 21,~18
BatE II 411,76811,97622,865 24,501
Eco I 412,45217,04120,160 21,516
Rru I 416,51517,14418,88~ 24,213
Sma I 4155 2,212 4,850 11,207
Stu I 44,2176,938 14,675 21,673
Xor II ~327 670 1,206 23,033
Bam RI 5 1 7,602 8,0~2 9,062 13,776
Nar I 513,53617,15819,170 20,027 24,098
Bcl I 610,05814,71114,973 15,938 21,540
24,~06
Bgl XI 61,S174,254 5,033 6,023 7,720
22,930
36
TABLE 1 (Continued~
Enzyme Sites Locati~ns
Nru I 614,27614,47516,42017,97321,416
2~,294
Sph I 63 ~ 24113,22013,28917,60119,295
21,562
BaaH II 7 667 9,41012,071 19,334 22,273
23,32124,069
Hind III 7 602 3,390 5,512 5,933 6,631
19,23919,953
Bgl I 8158 848 3,506 4,216 5,066
5,34212,15019,056
Eco RI 84,4945,54512,82313,026 13,362
16,20221,63124,590
Nac I 8511 5,197 6,27610,475 12,077
20,80622,35324,096
Nde I 82,1747,282 7,475 8,360 19,084
19,71521,73124,586
Aha III 9 752 2,679 2,726 2,799 3,799
9,66512,22113,68516,306
BetX I 9587 1,589 5,862 6,150 8,002
10,25913,75120,13222,741
Eco RV 92,7074,888 7,354 9,292 12,797
12,99618,02721,52233,041
Nco I 92,9215,28613,37815,421 15,562
lB,37221,08021,71024,065
Xan I 92,8065,793 6,567 6,839 6,992
10,10313,51217,67921,343
Mat I 101,4084,462 9,85511,632 15,017
15,07715,57017,60219,92820,494
BVU I 112,6105,022 6,96911,930 12,574
14,0891~,04918,47~22,31023,517
24,547
Ava I 12153 2,210 4,848 5,114 6,019
6,72711,20511,96~15,208 18,678
21,~7621,803
Cla I 121,2062,gl5 4,154 9,282 9,292
14,68615,67218,74~18,89020,128
21,43224, ~39
Pvu II122,8343,061 4,682 5,138 6,031
6,8319,975 11,83412,541 14,615
22,61624,091
Acc I 141,1612,687 6,587 6,779 6,794
11,48211,56013,99115,1161.9,942
23,29323,41723,67724,028
HgiA I14812 1,868 2,610 5,134 6,228
7,62812,48012,73414,089 14,583
18,18318,47220,86621,093
Rinc II 14 1,369 5,721 6,780 7,257 9,442
11,32~13,15613,80017,07519,393
21,47221,72722,44023,294
HgiC I17621 3,586 4,960 5,119 6,153
7,4439,834 12,01013,535 16,015
17,15719,16920,02622,70126,097
24,32~24,333
HgiD I211,3762,503 4,508 6,803 8,335
11,76012,51613,53614,66215,137
TABLE 1 (Continued)
Enzyme Sites Locations
15,23115,801 16,470 17,158 19,170
19,38919,6~8 20,027 20,24~ 24,098
24,455
BstN I 24309 377 1,423 2,538 4,210
5,023 6,976 7,056 7,583 10,151
10,86511,868 12,146 12,602 13,553
14,67216,947 19,313 19,346 19,422
19,59019,677 20,790 22,830
Hae II 28539 2,206 2,331 3,327 5,196
5,210 5,309 5,981 6,539 9,789
10,47412,269 13,539 13,845 14,335
14,70715,731 15,872 16,412 17,161
17,98018,509 19,173 1~,576 20,030
22,3522~,101 24,398
Hph I 37
Ava II 38
Fok I 39
Nci I 40
Rsa I 40
Tth I 44
Hga I 45
Hin~ I ~7
SfaN I 47
Mbs II 61
ScrF I 64
Dde I 66
Tac I 67
Sau 96 69
Ha~ III 91
Hha I 98
Alu I 99
Hpa II 102
Fnu 6~ 103
Taq I 111
Sau 116
Mnl 158
38
~E 2
A lis~ of the tissues used for h~ing ability to grow in khe pr~ of various
toxic alTuno acid analogs
strain No. a~ltivar l~ ormed ~y: M~pine P~pine
159 No. 1 Nicotiana t~cum Al~c~ium tumefaciens - -
cv. Xanthi strain 15955
1590-1 do do + +
W C58 N. tabacum Ao t~nefaciens
cv~ Wisc. 38 s~ain C589
W-B634 N. tab~cum A. t~nefaciens
cv. Wisc. 38 strain B634 + +
TABL13 3
Dry weights of transformed tissues containing
agropine/mannopine synthase genes compared to dry
w~aights of transformed tissues without agropine
5 mannopine synthase genes when grown in the presence of
various levels of the toxic amino acid analog glutamic-
y-hydrazide (GH).
Nic~tiana tabac~n cv. ~anthi(a)
~g/ml
medium Sb~Ln 159 No. l(b) S*rain 1590-1(C)
Wt. in mg. % o~ control Wt. in mg. % o~ con~rol
o 7230 1250
2 . ~ 5690 78 . 7 880 70 . 4
2900 40 . 1 1180 9~ . 4
2900 16. 6 1200 96. 0
660 9 . 1 1080 86. 4
100 1 . 4 650 ~2 . 0
a. ~ril[~ts w~e done in duplicate dis~es with 3 pieoes tissue/dish.
b. Agrapine/m~nr~ine r~tive.
c. ~mpine/ma~ine positive.
I~E 4
~y weights of trans~or~d tissues contai~ agrc~ine/~ar~ine synthas~
genes campar~ to dry weights of transfor~3d tissues withalt agrcpine/n~cpine
synthase genes ~el~ gmwn in ~e presenoe of varic~us levels of the t~ic am~no
acid analog glutami~,u-hy~razide (GH).
Nics:~tiana tabac~n cv. Wisc~nsin 38(a)
~g/ml
medium Strain W{ 58(b) Strain W-B634(C)
Wt. in mg.% of control ~t. in mg.~ of oontrol
0 1100 - 1670 ~
2.5 610 55.5 920 55.1
200 18.2 1300 77.8
Dead 920 55.1
Dead 620 37.1
Dead 430 25.7
Dead 580 34.7
a. EXperiments were done Ln duplicate dishes with 3 pieces tissue/dish.
b Agrcpine~manncpine negative.
c A~ropLne/mannopine poeitive.
~5~
I~LE 5
~y weights OI transformed tissues contai~ agm~ine/marn~ine synthase gen~s
c~ar~d to dry wei~h~s of trans~onn~d ti~sues wi~:h~ a~r~p~ne/mar~op~ne
synthase gen~s ~n grc~n in ~e pres~nce o~ ; of the toxic am~no
acid analog S car~l-lrcyst~ne (aC).
Nicotiana tabac~n cv. ~nthi(~)
l~g/ml
m~li~n Stram 159 No. l(b) Stxain 1590-1~C)
Wt. in m~.~6 of con~rol Wt. in mg. % of cont~ol
0 7230 -- 1250 ~
6 7800 107 . 9 1180 9d~ . 4
12 6720 92 . 9 1640 131 . 2
500 ~ . 9 1160 92 . 8
500 6. 9 1400 112 ~ 0
100 400 5.5 1710 136.8
. . _ .
a. Experimellts w~re done in duplicate di~hes with 3 pieces tissue/dish.
b A~r~e/mar~ine ne~ative.
C. ~ine/manr~ir~ p~;itive.
41
I~E 6
Dry wei~ts of trarE;fonned tissu~ contai~ agm~i~e/mann~ne ~yn~ase genes
cc~mparsd t~ dry wei~h~s of trar sform~d tissues with~ agra~ine/mannop~ne
synth~æ gene~; when grown in the pres~oe of various levels o~ ~he tox~c am~no
acid analcg S carb~[yl~I,cysteine (CC~.
Nicatiana ~bac~n cv. Wisconsin 38(a)
~g/ml
medi~n St~ain ~ C58(b) Strain W-B634(C)
Wt. in ~g.% of cont;rolWt. in m~.% of control
0 1100 -- 1670 ~
6 270 24 . 5 1890 113 . 2
12 1040 94 . 5 1440 86 . 2
220 20. 0 1720 103 . 0
50 Dead -- 2000 119 . 8
100 80 7 . 3 2580 154 ~ 5
aO Expe~nen~s ~re done ~ :~uplicate di~hes wit;h 3 piec~; tissu~3/dish.
b. Agr~pine/ma~ine ru~a~ive.
c. A~pine/mar~cpine positive~
42
I~E 7
~y wei~hts of t~ansfonned tissues cont~ agr~pine/mar~ins synkhase genes
synthasa gene~ ~en gr~ in the p~ of vari~ le~,7els of the toxic aTino
acid analog 6~iaz~5 ox~I~norleucine (DCN).
Nic~tiana 'cabacmn cv. Xanthi(a)
~g/ml
r~di~n Strain 159 No. l(b) Stra.~n 1590-1(C)
Wt. in mg. % of controlWt. in mg. % of control
0 7230 ~ 1250
0.015 5260 72.8 1230 g8.4
0.03 2470 34.2 1330 106.4
0.06 2880 39.8 1180 94.4
0.12 90 1.2 600 48.0
0.25 60 0.8 30~ 2~ .0
O . 50 Dead - 140 11.2
1. O Dead ~ 100 8.0
2.0 Dead 300 24.0
.... _ _
a. EXperiments ~re done in duplicate dishe~ with 3 pieces tissue/dish.
b Agropine/mannopine negative.
c. Agropine/nannopine positive.
43
I~LE 8
Dry wei~hts of transformed tissues conta~ agrc~ineJmar~Lne ~r~ genes
campa~ to dry weights of trans~orm~ tissu~ wi~t agr~pine/ma~}opine
syn~hase g~nes w~en gra~ in ~e presence of various le~els of th~ t~xic ~nino
acid anal~g 6~iaz~5-oxo-~rnorleu~ne (D~
Nicotiana tabac~m cvO Wiscons~n 38(a)
medi~n Strain W{~58(b) Strain W-B634(c~
Wt. in m~.% of controlWt. in mg.% of cont~ol
0 1100 ~ 1670
0 . 015 ~50 22 . 7 ~70 28 . 1
0 . 03540 49 . 1 270 16 . 2
0 . 06120 10. 9 360 21. 6
0. 12Dea~ -- 200 12 . 0
0. 25 ~ad -- 120 7 . 2
a. Experim~ts were done in duplica~e di~hes with 3 pieces tissue/dish.
bo Ag~p~e/maT~ine r~a~ive~
c. A3r~ine/ma~ine positi~e.
