Note : Les descriptions sont présentées dans la langue officielle dans laquelle elles ont été soumises.
1 337280
--1--
PRODUCTION OF PROTEINS IN PLANTS
Field of the Invention
The present invention relates to the modification by
genetic manipulation of plants and plant lines.
Specifically, the present invention is directed to the
creation of transgenic plants which efficiently produce
effective quantities of exogenous proteins in their
cells. This engineered protein production may be useful
for several purposes, among which is the production of
naturally selective pest control protein agents which have
the effect of imbuing the plants with inherent resistance
to insect predation.
Background of the Invention
It has now been demonstrated that tissues of many
p]ant species may be transformed by exogenous, typically
chimeric, genes which are effective to stabily transform
cells of the tissues. For several species, tissues
transformed in this fashion may be regenerated to give
rise to whole transgenic or genetically engineered
2~ plants. The engineered traits introduced into the
transgenic plants by these techniques have proven to be
stable and have also proven to be transmiss;ble through
normal ~endellian inheritance to the progeny of the
1 337280
--2--
regenerated plants. In those sp cies in which the ability
to construct transqenic plants has been established and
replicated, such as in tobacco, much research focus is
logically directed next toward the introduction of useful
traits into those plants. One such desirable trait is the
production in the plant cells of desired gene products in
vivo in the cells of the trans~enic plants.
The most common, though by no means unique, method of
transformation of plant cells used to date is based on a
unique property of the plant pathogen Agrobacterium
tumefaciens. Natural or wild-type A. tumefaciens, in its
normal pathogenic process, transmits a portion of a Ti
(for Tumor-inducin~) plasmid that it harbors to be
introduced into the genome of the infected plant host.
This portion of the Ti plasmid is referred to as the
T-DNA. The Aqrobacterium performs this pathoqenic
transformation in nature to direct the host cells of the
plant to become tumorous and to produce a class of plant
metabolites called opines on which the Agrobacterium has
the unique ability to feed. By removing the genes
responsible for tumor induction and opine production from
the Ti plasmid, and by substituting for them exo~enous
chimeric ~enes of interest, the plant genetic engineer may
then use the natural pathogenic process of the A.
tumefaciens to introduce foreign ~enes into plant
tissues. Because this transformation will generally occur
on]y on somatic plant tissues which have been wounded, its
use to date has focused on those species, such as tobacco,
which can be regenerated either from individual somatic
cells or from embryogenic somatic cell cultures. This
technique has proved effective for plant transformations
in cotton, tomato, carrot, and petunia, as well as some
other species.
Ot~er plant cell transformation techniques are
directed toward the direct insertion of DNA into the
cytoplasm of plant cells from whic~ it is taken up, by an
uncharacterized mechanism, into the genome of the plant.
_3_ 1 337280
One such technique ;s electroporation, in which electric
shock causes disruption of the cellular membranes of
individual plant cells. Plant protoplasts in aqueous
solution when subject to electroporation will uptake DNA
from the surrounding medium. Another technique involves
the physical acceleration of DNA, coated onto small inert
particles, either into regenerable plant tissues or into
plant germline celLs. These techniques widen the range of
plant species which may be genetically engineered since
they allow for the transformation of a wider variety of
tissue types such as embryonic tissues, or germline
cells.
~ aving the ability to introduce foreign D~A constructs
into the genome of plants, however, does not in and of
itself create useful traits in the modified plants or
plant lines. The ability to code for the production of
proteins in plant cells can only contribute to making a
more useful plant or plant line if the protein offers some
advantage in the field to the plant and is produced in the
plant cells in quantities effective to accomplish the
desired objective. One objective in the creation of
transgenic plants is to make plants which are less
attractive to potential plant predators or pathogens. A
candidate strategy to make lants resistant to certain
insect predators is based on a unique protein made by the
Bacillus thuringiensis, known as the delta-endotoxin or
crystal protein. This toxin is a reLatively large protein
that has a specific toxicity to Le~idopteran, Dipteran, or
Coleopteran insects. While insecticidal peptides made by
the Racillus thurin~iensis (B.t.) species have been
approved for use, and have been used, in agriculture for
many years, the relatively high cost of producing the
protein in quantity and the need for repeated applications
of the protein, because of its degradation in the
environment, have proved to be limits on the extensive use
of these materials. The creation of trans~enic plants
~hich generate this biological insecticide by themselves
1 337280
--4--
offers a practical mechanism to control susceptible
insects without the need for repeated application of other
control agents.
A primary target species for the introduction of an
effective B.t. toxin capability is the crop plant cotton
(Gossypium hirsutum L.) In the United States, cotton is
an agricultural crop with an exceptionally high pesticide
requirement, and that requirement o~ten includes
formulations of Bt. toxin produced by ~acteria. The
l~ Lepidopteran pests of cotton include the cotton boll worm
(HeLiothis virescens), the corn ear worm (Heliothis zea)
and the beet army worm (Spodoptera exigua). Because of
the long regeneration time required to regenerate whole
cotton plants from transformed tissues, however, it is
practical to use tobacco as a model species to demonstrate
and test vector and gene constructions and expression
strategies. The inventors here have previously
demonstrated the ability to adapt transformation and
expression techniques from tobacco to the successful
transformation and regeneration of cotton plants and
lines. Umbeck et al., "Genetically Transformed Cotton
(Gossypium hirsutum L.) Plants," Bio/Technology, 5, pp
263-266 (1987).
Another consideration in the genetic transformation of
plants to express useful proteins is the method of
construction of appropriate chimeric DNA sequences which
are practically effective to achieve practical
transcription and translation levels of the forei~n gene
products in plant cells. To be effective, a foreign DNA
sequence containing a coding region must be flanked by
appropriate promotion and control re~ions. Commonly used
plant cell transcription promoters include the nopaline
synthase promoter from the T-DN~ of A. tumefaciens and the
35S promoter from the cauliflower mosaic virus. These
promoters are effective in most plant cells but the level
of transcription and translation activities of protein
codin~ sequences placed down stream of these promoters is
1 337280
quite varia~le, depending on several factors such as
insertion site or sites and copy number of insertions.
Other variables, such as untranslated portions of the
transcription product and the polya~enylation sequence
also effect the level of translational activity of the
coded qene product.
~ ,pecificaLly with regard to the crystal protein of
Bacillus thuringiensis, it has been previously
demonstrated that the crystal protein itself consists of
one or more species of a large protein up to 160
kilodaltons in size. This large protein is now referred
to as a protoxin, since it has been determined that the
protoxin may be cleaved by proteolysis (and is so cleaved
in the insect qut) to produce an active peptide toxin of a
molecular weight of 55 to 75 kilodaltons that retains the
specific toxicity to the target insects. Deletion
analysis has localized the toxic portion of the protoxin
to the amino terminal end of the protoxin and have
demonstrated that both amino- and carboxy-terminal fusions
can be made to the toxin without loss of insecticidal
activity. The function of the remaining carboxyl portions
of the protoxin, beyond structural considerations in
crystal protein formation, remains unknown.
While expression of several model proteins in model
plant species has proved a regularly replicable process,
some proteins present special problems. The B.t. protoxin
molecule is very large and quite insoluble. The
expression of this protein in regenerated transgenic
plants has proven to be difficult. The coding sequence
for the protien can reliably be inserted into normally
competent plant transformation and expression vectors, but
the recovery and regeneration of expressing tissues is
difficult. Tissues in culture in which the entire
protoxin is expressed can be created, but these tissues
are typically necrotic or visibly unhealthy and cannot
routinely be regenerated into whole plants. This
observation may be due to toxic effects of the protoxin or
-6- 1 337280
perhaps simply by its insolubility.
Summary of the Invention
The present invention is summarized in that a chimeric
gene construction capable of expression in plant cells
includes, in sequence 5' to 3': a promoter sequence
effective to initiate transcription in plant cells; a
translational enhancer sequence hom~logous to the
transcribed hut untranslated sequence immediately
preceding the coding reg;on of a plant viral coat protein
gene; a coding sequence coding for a protein of less than
about 700 amino acids homologous with the amino-terminal
portion of Bacillus thuringiensis delta-endotoxin; and a
polyadenylation sequence.
The present invention is also summarized in that
transgenic plants are created which contain such a
chimeric gene construction in their genome.
It is an obiect of the present invention to facilitate
the ~reation of transgenic plants which natively produce
enhanced quantities of exogenous proteins.
It is another object of the present invention to
create transgenic plants which produce relatively high
levels of Bacillus thuringiensis delta-endotoxin in their
cells so as to have an enhanced resistance to insect
predation.
It is a feature of the present invention that cotton
~lants are created which lessen the need for commonly used
pesticides.
Other features, objects and advantages of the present
invention will become apparent from the following
specification and examples.
Brief Description of the Drawings
Fig. 1 is a schematic diagram illustrating the steps
in the ~onstru~tion of plasmid pTV4 used in an example o~
1 337280
--7--
the present invention
Fig. 2 is a schematic diagram illustrating the steps
in the construction of vector pAMVBTS.
Fig. 3 is a schematic diagram illustrating the steps
5 in the construction of the vector pTV4AMVBTSH from the
plasmids pTV4 and pAMVBTS.
Figs. 4A and 4B are together a listinq of the believed
complete nucleotide sequence of pAMVBTS.
Detailed Description of the Invention
As will be apparent from the following examples, the
present invention arose from the effort to create
transgenic plants which express in their cells the
Bacillus thuringiensis (B.t.) delta-endotoxin in such a
fashion that the plants cells were toxic to susceptible
insect pests when ingested. The introduction of an
expressing chimeric gene coding for the expression of the
~.t. toxin into whole plants proved to be a non-routine
procedure, however. Plant tissues in which the
full-length mRNA of the introduced gene could be detected
tended to be necrotic or at least unhealthy. By making
several modifications in the gene construction, whole
intact and pathogen resistant transgenic plants were
created. These changes included (1) truncating the
protoxin coding sequence by ~eleting a large portion of
the carboxy-terminal segment of the protein, (2)
stabilizing the remaining carboxy-terminus of the protein
by the addition of two terminal proline codons, and (3)
adding to the expression cassette, between the promoter
and the start of the coding region, a translational
enhancer the sequence of which was derived from the
transcribed but untranslated leader sequence immediately
5' of the coding region of the RNA of a plant viral coat
protein gene. Constructions including these changes were
introduced into plant tissues which proved to be readily
regenerable. Plants regenerated from the transformed
1 337280
--8--
tissues exhibited high levels of mRNA activity and showed
hi~h toxicity to Lepidopteran insects in feeding trials.
The theory behind the truncation of the B.t. protoxin
gene is to cause the expression of a protein toxin in
plant cells substantially corresponding to the processed
toxin created in the insect gut after proteolysis. The
approximate location of the proteolytic site has been
previously identified. Schnepf anA l~hiteley, "Delineation
of a Toxin-encoding Segment of a Bacillus thuringiensis
Crystal Protein Gene," J. Biol. Chem., 260, pp 6273-6280
(1985). The truncation may conveniently be accomplished
3' to that site, locate~ 5' to codon 645 of the published
sequence, at any suitable restriction enzyme site.
One possible difficulty arising from the truncation of
the B.t. toxin coding sequence is that the
carboxy-terminus of the truncated expressed protein might
be unstable in vivo. To overcome the question of any
potential instability, the two codons for the amino acid
proline were added to the carboxy-terminus of the
truncated coding sequence. The expressed protein
therefore possesses two hydrophobic and protease-resistant
prolines at its terminus, which may add to the stability
of the protein in the cytosol of the plant cells. The
resulting protein did prove stable and effective in the
plants cel]s suggesting the success of this strategy.
The strategy behind the addition of the translational
enhancer is to increase the translation efficiency of mRNA
produced _ vivo from the chimeric introduced gene
construction. It has been observed that the RNA ~ from
alfalfa mosaic virus (AMV), which codes for the coat
prot~in, is efficiently translated both in vivo and in
vitro, possibly because of the characteristics of the
untranslated region of the RNA located 5' of the coat
protein coding sequence. Gehrke et al., "5'-Conformation
of Capped Alfalfa Mosaic Virus Ribonucleic Acid 4 May
Reflect Its Independance of the Cap Structure or of
Cap-hinding Protein for Efficient Translation." Biochem.,
~ 337280
g
22, pp 5157--5164 (1983). This observation is consistent
with the theory that native or indigenous gene
transcriptional and translational systems would naturally
evolve to be regulated in order for the organism to
control gene activity, while certain viral gene
transcriptional and translational systems might evolve to
be more efficient, since their success is not dependant on
the survival of the other cellular gene and systems. This
theory would suggest that viral coat protein genes would
be likely to be efficiently translated, since during a
phase of viral replication abundant quantities of the
components of the replicate viruses must be produced for
the virus to maximize its reproduction. Thus, while this
strategy is effectuated here by the use of sequence
homologous to the 5' untranslated sequence of the RNA of
the coat protein gene of AMV, it is believed that other
viral coat protein gene systems may have similarly
effective translational enhancer sequences.
As with the expression of any other gene product in
vivo, a genetic construction to cause expression in plant
cells must have appropriate transcription regulatory
sequences. The transcript;on initiation sequence is
referred to as a promoter. Several effective promoters
are known to be effective in plant cells, most commonly
the nopaline synthase promoter from A. tumefaciens and the
35S promoter from cauliflower mosaic virus (CaMV 35S), but
many other effective promoters in plant cells are known.
Transcripts of mRNA are terminated at the 3' end by
sequences of polyadenylic acid, enzymatically added
post-transcriptionally at the polyadenylation sequence,
again of which several are known, such as the
polyadenylation sequence from the nopaline synthase gene.
Any effective promoter and polyadenylation sequence is
believed usable within the present invention. The
efficiency of any such promoter is believed to vary
somewhat from promoter to promoter (for example CaMV 35S
promoter is generally stronger than the nopaline synthase
1 337280
--10--
promoter), but is also quite variable in vivo in plants
depending on several variables most notable among which is
location of gene insertion.
As may be perceived with reference to the following
example, the creation of transformed plants may be most
conveniently accomplished through the use of a vector
which can be readily adapted for the insertion of any
specific protein coding sequence. The plant expression
vector used here, pTV4AMVBTSH, includes antibiotic
resistance markers, T-DNA border fragments, an over~rive
sequence, and an expression cassette including a promoter
(CaMV 35S), the translational enhancer sequence from AMV,
the truncated B_ coding sequence, a sequence including a
pair o proline codons and a pair of termination codons,
and a transcription polyadenylation sequence, all
separated by convenient restriction sites. This vector is
thus readily adaptable for use with other proteins by the
relatively simple substitution of the new protein coding
sequence for the truncated R.t. sequence. This
substitution can either retain or delete the terminal
proline codons depending on the characteristics of the new
sequence.
EX~PLE I
I. Construction of Expression Vector
~5 The present invention has been practiced in an
exemplary fashion by the construction and use of plasmid
pTV4~VBTSH, the derivation and construction of which will
be discussed below. ~hile specimens of the plasmiA,
harbored in E. coli, have been deposited with the American
Type Culture Collection, as described below, the
derivation and construction of this plasmid will be
discussed in an exemplary fashion here in order to ensure
that the construction of this plasmid and the variations
thereof envisioned by the present invention will be
1 337280
--11--
enabled here. As can be readily seen from the following
explanation, many variations in the vector construction
are possihle while still achieving the beneficial results
and advantages intended in the present invention.
The plasmid pTV4AMVBTSH itself is an ampicillin and
sulfadia~ine resistant plant transformation and expression
vector. The actual procedure used by the applicants to
construct this vector is not described herein, since the
actual series of manipulations used in the evolution of
the plasmids which are the predecessors of this vector
were considerably more convoluted than necessary to
understand how the vector was constructed, how it may be
re-created and emulated, and how it functions. The
description below does describe, in essence, how the
vector was assembled from the various beginning parts and
the procedure described here is quite analogous to the
procedure by which the vector was actually constructed by
the applicants here. The beginning parts and the ending
results are all identical to that utilized by the
applicants and the methods and procedures are similar,
although not identical.
The plasmid pTV4~VBTSH is a co-integrate of a
sulfadiazine resistant plasmid pTV4 and an ampicillin
resistant plasmid pAMVBTS. How each of these constituent
plasmids may be constructed is what is described first
below. The plasmid pAMVBTS is a small plasmid vector,
capable of replication in E. coli, which contains a
plant-expressible gene cassette that contains as its
coding region a truncated section of the B.t. toxin coding
sequence. The plasmid pTV4 is a plant transformation
cassette vector containing left and right border sequences
useful for Agrobacterium-mediated plant transformation and
a synthetic overdrive sequence, as will be discussed
below. How each of these two vectors may be constructed
is described below, beginning with pTV4.
1 337280
-12-
II. Construction of pTV4
The plasmid pTV4 is a derivative of pCMC92 which was
constructed to serve as a carrier plasmid in a binary
vector plant transformation system. The vector pCMC92
consists of a plasmid replicon derived from pRSFlOlO, the
left and right T-DNA border regions of Ti plasmid T37
(designated LB and RB in Fig. 1), and a chimeric
selectable marker conferring kanamycin resistance on
transformed plant cells. The chimeric selectable marker
includes the coding region for the enzyme
amino-phosphotransferase (3')-II ("APH-II") preceAed by
the promoter from the nopaline synthase gene from A.
tumefaciens (NosPr) and followed by the polyadenylation
sequence from the same gene (NospA). The plasmid pCMC92
also carries a selectable marker gene of sulfa~iazine
resistance, designated SuR in Fig. 1, located outside of
the T-DNA borders. Samples of vector pCMC92 are on
deposit and available from the American Type Culture
Collection as described below.
In order to derive pTV4 from pCMC92 a series of
alterations must be made to pCMC92. These alterations
include the deletion of restriction sites at the 3' end of
the ~PH-II gene, inside of the left T-DNA border, and
substitution for the natural sequence right T-DNA border
region on pCMC92 with a synthetic DNA fragment containing
both an artificial right T-DNA border and an overdrive
region of a Ti plasmid. These alternations will be
described in sequence below and are schematically
illustrated in Fig. 1.
II.a. pTV4 Construction - Deletion of 3' Sites
The vector pCMC92 has a polylinker region, consisting
of a series of closely adjacent restriction sites,
immediately inside the T-DNA left border region (LB).
This polylinker in pCMC92, beginning closest to the left
1 337280
-13-
border and proceeding toward the APH-II coding region, has
the restriction sites Sma I, BamH I, Xba I, and Sal I in
order. It is desired to delete the sites. To carry out
this deletion, the Sma I site may be converted to an Xho I
site by digestion, first with Sma I, to generate blunt
ends which are then ligated with commercially avai]able
Xho I linker fragments and transformed into E. coli. The
plasmids having the appropriate conversion would then have
a polylinker which consists, in order, of Xho I, ~amH I,
Xba I and Sal I. Because Xho I and Sal I leave identical
sticky ends on the DNA sequences which they cleave, this
enables a ligation of the two sites that results in the
loss of recognition of the ligated DNA region by either
enzyme. Thus this intermediate plasmid, desi~nated
pCMC92X in Fig. 1, is digested completely with both Xho I
and Sal I. The resulting linear sequence can be ligated,
to close the plasmid, and then digested with either Xho I
or Sal I to linearize any plasmids that do not ligate with
the Sal I sticky end to the Xho I sticky end. The
resulting constructs can then be transformed into E. coli
and selected for sulfadiazine resistance. The resulting
plasmid, designated pCMC92XD in Fig. 1, will have lost the
polylinker region containing the Xba I and BamH I sites,
and the Xho I and Sal I sites will have been destroyed in
the ligation. The resulting plasmid pCMC92XD will have no
restriction sites for Xho I, Sal I, or Bam HI. One
remaining Xba I site exists, between the APH-II coding
sequence and the nopaline synthase promoter, and adjacent
to it is a unique Hind III site. It is then appropriate
to delete both of these sites.
II.b. pTV4 Construction - Deletion of 5' Sites
To remove the adjacent Hind III and Xba I sites on
vector pCMC92XD, the plasmid pCMC92XD can be digested to
completion with both Hind III and Xba I. The sticky ends
35 resulting from each o~ the~e digestion~ can ~hen be
1 337280
-14-
removed by digestion with mung bean nuclease followed by
treatment with ~lenow polymerase and all four
deoxynucleotide triphosphates, to create ends that are
blunt. The blunt ends may then be ligated together using
T4-DNA ligase, which will close this plasmid, ~hich can
then be recovered by transformation in E. coli and
selection for sulfadiazine resistance. The resulting
plasmid, d signated pCMC92XD2 in Fig. 1, will have lost
both the Hind III and Xba I sites.
II.c. Construction of pTV4 - Addition of Right Border
The DNA sequence which is 5' from the APH-II coding
sequence on pCMC92XD2 consists of the nopaline synthase
promoter (NosPr) and adjacent plasmid nucleotides derived
from pTiT37 from A. tumefaciens. This adiacent DNA
encodes the right horder region of the T-DNA (RB) and an
associated sequence which has been designated as an
"overdrive" sequence. Peralta et al., "Overdrive, a T-DNA
Transmission Enhancer on the A. Tumefaciens Tumor-Inducing
Plasmid," EMBO Journal, Vol. 5, pp. 1137-1142 (1986). To
convert pCMC92XD2 to pTV4, the region of pCMC92XD2 between
a Sac II site located immediately 5' of the nopaline
synthase promoter and a unique Eco RI site located
approximately 1 kilobase outside of the right border T-DNA
seq~ence must be deleted. The deleted nucleotide sequence
is replace-l with a synthetic oligonucleotide corresponding
to the T-DNA border and a consensus overdrive sequence.
This can be conveniently accomplished in a series of three
steps.
First, a synthetic right border region can be
substituted for the region of pCMC92XD2 between the Sac II
and Eco RI sites noted above. This substitution can be
accomplished by conducting a complete digestion of
pcrsc92xD2 with Eco RI followed by a partial digestion with
Sac II and purification of linear fragments that have lost
the region of the Ti plasmid referred to above. This
1 337280
-15-
linear plasmid should be easily distinguished on agarose
gels from plasmids that are cut at the alternative Sac II
site, or plasmids that did not get cut at either Sac II
site, by size. The purified deleted DNA can then be
combined with a synthetic duplex DNA fragment,
corresponding to the Ti plasmid right border, which can be
formed by annealing two synthetic complimentary
oligonucleotides. The two synthetic nucleotides are shown
below in their form annealed to form a duplex DNA linker.
The two oligonucleotides are synthesized to include sticky
Sac II and Eco RI ends after annealing.
Sac II Cla I Hind III --TI RIGHT BORDER-- Kpn I Eco RI
5'- GGCATCGATGAAGCTTTGACAGGATATATTGGCGGGTAAACGGTACCG -3'
3'-CGCCGTAGCTACTTCGAAACTGTCCTATATAACCGCCCATTTGCCATGGCTTAA-5'
After the plasmid which results has been transformed
into E. coli and selected for sulfadiazine resistance, the
construction of this plasmid, designated pTV2, can be
confirmed by restriction digests, including a digest for
the newly introduced restriction sites for Cla I, Hind III
and Kpn I which are noted in the sequence for the
synthetic fragment illustrated above, as well as in Fig.
L. In Fig. L, the restriction sites are indicated as well
as the T-DNA border region, designated Syn. RB.
II.d. Construction of pTV4 - Conversion of Cla I to Xho I
The next operation is to provide an insertion site ~or
the cointegration of plasmids containing either a unique
Xho I site or a unique Sal I site (since these two enzymes
have compatible sticky ends). To do this, the
newly-introduced Cla I site is converted to an Xho I site
throuqh the use of commercially available Xho I linkers.
The Cla I site of the sequence shown above is not subject
-16- 1 337280
to dam methylation, a typical methylation characteristic
of E. coli. This site is the only Cla I site on pTV2 that
will digest when the DNA is dam-methylated. Therefore, if
the plasmid is digested to completion with Cla I, the
sticky ends may be filled in with I~lenow polymerase, and
the appropriate four deoxynucleotide triphosphates, and
then the appropriate commercially available synthetic
linkers may be added by blunt-end ligation. Following
appropriate digestions and ligations of the Xho I linkers,
i0 and transformation of E. coli followed by selection for
sulfadiazine resistance, plasmids can be isolated in which
the Cla I site is converted to what will now be a unique
Xho I site on the resulting plasmid, designated pTV3 in
Fig. 1.
II.e. Construction of pTV4 - Addition of Overdrive
To complete the construction of pTV4, a synthetic
overdrive consensus sequence is added to pTV3, as
illustrated in Fig. 1. This sequence is chosen to
correspond to the homologous regions of various infective
Ti plasmi~s. The selected consensus sequence is as
follows:
Kpn I overdrive Eco RI
5' - CTTTGTATGTTTGTTTGTTTGTTTG -3'
:::::::::::::::::::::::::
3' - CATGGAAACATACAAACAAACAAACAAACTTAA -5'
The two oligonucleotides synthesized to form the above
duplex sequence provide, after hybridization, for Kpn I
and Eco RI sticky ends following annealing. To insert
this duplex sequence into the plasmid, pTV3 is digested
with Kpn I and Eco RI, each of which has a unique
restriction site on the plasmid pTV3 separated by a short
oligonucleotide. The plasmid DNA is then combined for
ligation with the synthetic nucleotide sequence, provided
1 337280
in excess in order to preferentially replace any residual
oligonucleotide resulting from digestion of pTV3 with Kpn
I and EcoRI. Transformation of E. coli with the ligated
DNA, followed by repeated selection for sulfadiazine
resistance, results in the isolation of pTV4, which may be
confirmed by restriction mapping and sequencing of the
synthetic region. The completed pTV4, as illustrated in
Fig. 1, consists of an RSF1010 replicon with an authentic
T-DNA left border region from pTiT37 tLB)~ a chimeric
APH-II gene constructed with a nopaline synthase promoter
(NosPr) and a nopaline synthase polyadenylation region
(NospA), a plasmid unique Xho I site, a synthetic T-DNA
right border fragment that corresponds to the sequence
found in the pTiT37 right border (Syn.RB), and a synthetic
consensus overdrive sequence (Syn.OD). The unique Xho I
site on pTV4 can be used as an insert;on site for
co-integration with other plasmids, and the DNA inserted
in this fashion would be inside the right T-DNA border and
would be expected to be transferred into plants during
Agrobacterium-mediated transformations.
III. Construction of pAMVBTS
The vector pAMVBTS consists of an ampicillin
resistance (ApR) plasmid replicon derived from pMT21,
containing a chimeric gene construction which consists of,
in order from the 5' end, a DNA fragment corresponding to
the cauliflower mosaic virus 35S transcriptional promoter
(CaMV 35S), a DNA leader fragment corresponding to the
alfalfa mosaic virus coat protein mRNA 5' noncoding region
(AMV), a DNA fragment corresponding to the amino-terminus
of the Bacillus thuringiensis delta-endotoxin (B.t. ), and
a DNA fragment corresponding to the polyadenylation region
of nopaline synthase (NospA). Each of these component
parts is conveniently separated from the others by
vector-unique restriction sites. Two approaches are
described herein for the construction of this plasmid.
1 337280
-18-
One approach describes how the plasmid can be constructed
from previouly known or previously deposited components.
The second approach illustrates how the plasmid
pTV4AMVBTSH, aIso now deposited, can he used to derive the
vector pAMVBTS.
The construction of the vector pAMVBTS from prior
constituent parts begins with a plasmid pCMC1022, which is
an ampicillin resistant (Ap ) plasmid vector derived
from pMT21 that includes ~ plant-expressi~le gene cassette
encoding for the expression of the APH-II gene derived
from Tn5. The gene cassette containe~ in pCMC1022
consists of, from 5' to 3', a promoter, which is the CaMV
3SS promoter, the APH-II coding region of Tn5 (APH-II),
and the polyadenylation region of nopaline
synthase(NospA). This plasmid can be modified to create
pAMVBTS by a series of modifications which are intended
to: shorten the DNA sequence used as the transcriptional
promoter, add after the promoter a DNA sequence which
encodes a 5' nontranslating RNA leader from the alfalfa
mosaic virus coat protein, replacing the APH-II coding
region with a truncated B.t. toxin coding region, and
adding two proline codons to the original amino acids
located at the site of toxin truncation.
The steps in the construction of pAMVBTS are
illustrated in schematic fashion in Fig. 2.
III.a. Construction of pAMVBTS - Promoter Modification
The transcriptional CaMV 35S promoter present on
pCMC1022 is derived from approximately ~300 base pairs of
DNA nucleotides derived from the cauliflower mosaic
virus. At the 5' end of the fragment on pCMC1022 is an
Xho I site previously placed there using commercial Xho I
linkers, while at the 3' end o~ the promoter fragment,
immediately beyond the proposed start of transcription
activity in plants, is a Hind III site also resulting from
previous ligation with commercially available Hind III
1 3372~0
--19--
linkers. The total length of the promoter DNA, between
the Xho I site and the Hind III site on pCMC1022, is about
786 nucleotides. In the construction of pAMVBTS, several
hundred nucleotides of non-essential non-translated DNA
are removed from the DNA derived from the cauliflower
mosaic virus, all located 5' to the transcriptional
promoter sequence. This is accomplished by di~esting
pCMC1022 with Xho I and Hind III followed by purification
of the double-digested vector away from the 786 nucleotide
fragment containing the CaMV 35S promoter. A separate
promoter fragment, for later ligation with the
double-digested vector, is prepareA by digesting
separately pCMC1022 with Hinc II, which recognizes a
restriction site located approximately 423 nucleotides 5'
to the Hind III site, and w~ich leaves a blunt end on the
fragment. Commercially available Xho I linkers are
kinased, then ligated to the blunt end created by Hinc
II. The ligation is followed by digestion with Xho I to
expose an Xho I compatible sticky end. This DNA is then
digested with Hind III, resulting in an approximately 428
nucleotide CaMV 35S promoter fragment with Xho I and Hind
III sticky ends, which may he purified on agarose gel for
use in ligation with the above mentioned double-digested
vector. The Xho I/Hind III-digested vector is then
combined with the 428 base pair promoter fragment, and the
two fragments are ligated together. The resulting
construct;on can be transformed into E. coli and selection
carried out for ampicillin resistant transformants. The
structure of the correct plasmid, designated pCMCl022D in
Fig. 2, may he confirmed by miniprepping the colonies and
conducting appropriate restriction digests, followed by
sequencing of the region where the Xho I linkers were
added. The resulting plasmid, pCMC1022D, is identical to
pCMC1022 except for a deletion of approximately 363 base
pairs of DN~ derived from the cauliflower mosaic virus
whic~ is located 5' to the transcriptional promoter on
pCMC1022.
1 337280
-20-
II.b. Construction of pA~IVBTS - AMV Leader
Because viral coat proteins are known to be
efficiently translated both in vivo and in vitro, the 5'
noncoding region of the alfalfa mosaic virus (AMV) coat
protein mRNA was selected as the leader sequence to be
transcribed in the chimeric gene constructed for this
vector. To construct a gene encoding the AMV leader, two
complimentary oligonucleotides were synthesized. The two
oligonucleotides produced may be annealed easily by
combining equimolar quantities of the two oligonucleotides
at a concentration of approximately 10 to 50 micrograms
per milliliter total DNA, heating the mixture in low salt
(10 mM Tris-HCl, pH 8, 10 mM MgC12) to 90 degrees for 10
minutes, followed by gradual cooling to room temperature.
done in this fashion, the oligonucleotides efficiently
anneal and have a duplex structure and sequence as
follows, with a Hind III sticky end at the 5' end and an
Nco I sticky encl at the 3' end of the fragment, when
oriented as shown below.
20Hind III Nco I
5'-AGClllllATTTTTAATTTTCTTTCAAATACTTCQC -3'
:::::::::::::::::::::::::::::::::
3'- AAAATAAAAATTAAAAGAAAGTTTATGAAGGTGGTAC -5'
To prepare the DNA vector pCMC1022D for joining to the
oligonucleotide fragment, pCMC1022D is digested with Hind
III plus Nco I and the approximately 2.5 kilobase vector
is purified by electrophoresis away from the approximately
580 base pair fragment corresponding to the amino-terminal
portion of the APH-II coding region. The Nco I site is
located intermediate in the APH-II coding region, leaving
only the 3' portion of the APH-II gene, designated
3'APH-II in Fig. 2, in the vector. The approximately 2.5
kilobase vector fragment is then combined with the
annealed oligonucleotide and ligation is carried out. The
1 337280
-21-
resulting DNA is transformed into E. coli and selected for
ampicillin resistant colonies. Minipreps may be conducted
to determine that the desired plasmid, designated pAMV1022
in Fig. 2, has been obtained. DNA sequencing may be
conducted to ascertain that the AMV oligonucleotide has
the correct sequence. The plasmid pAMV1022 now includes a
promoter cassette which is bordered ~t its 5' end by an
Xho I site and at its 3' end with an Nco I site. This
promoter cassette includes approximately 400 base pairs of
the CaMV 35S promoter DNA (CaMV35S) followed by the
approximately 35 base pairs of the oligonucleotide
homologous to the AMV ~NA leader sequence (AMV).
Transcription activity in plants, based on analysis of the
CaMV promoter, is believed to initiate immediately 5' to
the Hind III site joining the CaMV sequence to the AMV
leader sequence. To prepare this promoter cassette for
additional constructions, pAMV1022 is digested with both
Xho I and Nco I, and the approximately 466 base pair
fragment is purified from the remaining plasmid using
agarose gel electrophoresis. This fragment will be used
further in the construction of pAMVBT described below.
II.c. Construction of pAMVBT~ - B.t. Toxin Gene
The entire coding region for the B.t. delta-endotoxin
has been previously characterized, published, and made
available through deposits. See U.S. patents numbered
4,448,885 and 4,467,036 and Schnepf et a]., "The Amino
Acid Sequence of a Crystal Protein from Bacillus
thuringiensis Deduced from the DNA Base Sequence," J.
BioL. Chem., 260, ~p. 6264-6272 (1985). A modification of
the amino-terminal coding region of the DNA fragment which
encodes the toxin has been made to establish a Hind III
site by mutagenesis immediately preceeding the initiator
"ATG" of the toxin coding region. An available deposited
plasmid containing the B_ delta-endotoxin coding region
with this mutagenic modification is plasmid pCMC122,
1 337280
- -22-
deposited with the ATCC Accession Number 39639. The
following discussion illustrating the construction of a
toxin coding region as it is used in pAMVBTS begins with
the plasmid pCMC122. Alternatively, an almost identical
process can be utilized beginning with the vector pSYC823,
also deposited with the American Type Culture Collection
Accession Number 39657.
III.d. Construction of p~lVBTS -
Clone B~t. into pCMC1022
The vector pCMC122 is a plant transformation vector
containing within it an expression cassette which consists
of a B.t. protoxin coding region (B.t.) bracketed by a
nopaline synthase promoter (NosPr) and a nopaline synthase
polyadenylation region (NospA) located between T-DNA
border regions (LB and RB). In order to utilize this DNA
construct, the amino acid coding region of the protoxin
and the associated nopaline synthase polyadenylation
region are excised from pCMC122 and inserted into
pCMC1022. First, pCMC122 is partially digested with Hind
III. There are several ~ind III sites on the plasmid, but
the only site that is useful is the site immediately
adjacent to the "ATG" initiation codon of the B.t. coding
region. The other three additional Hind III sites are
located within the coding sequence itself for the B.t.
protoxin gene. A partial digest intended to segregate the
appropriately cut vector is conveniently accomplished by
digesting 100 micrograms of pCMC122 with 10 units of Hind
III ~s recommended by the supplier, but terminating 20~ of
the reaction at 5 minute intervals by removing aliquots
an~ combining with phenol beginning 5 minutes after
initiation of the reaction. The 5 aliquots are then
separated from the phenol, pooled, ethanol precipitated,
and washed with 70% ethanol, after wh;ch they are
resuspended for a complete digestion ~ith Sal I. This
reaction mixture is then subjected to preparative agarose
1 337280
-23-
gel electrophoresis and the approximately 4.0 kilobase
fragment corresponding to the entire B.t. protoxin coding
region plus the nopaline synthase polyadenylation region
may be excised from the gel and recovered. This fragment
~ill have a Hind III site at the 5' end of the coding
region and a Sal I site at the 3' end of the fragment. To
prepare an appropriate vector to receive this coding
region construction, pCMC1022 is cleaved in a complete
digestion with Hind III and Sal I and the approximately
2660 base pair vector fragment is gel purified. This
process is again illustrated in Fig. 2. The digested
pCMC1022 vector is then combined in equimolar amounts with
the purified B.t. protoxin coding region from pCMC122 and
ligation is carried out. Following transformation into ~.
coli and selection for ampicillin resistance, the correct
plasmid structure of the resulting plasmid, designated
pCaMVBT in Fig. 2, can be confirmed by minipreps. The
resulting vector pCaMVBT represents an expression plasmid
containing, in sequence, an 800 base pair CaMV 35S
promoter fragment (CaMV35S), the complete B.t. protoxin
coding region (B.t.), and a nopaline synthase
polyadenylation region (NospA).
III.e. Construction of pAMVBTS -
Modification of Amino Terminus of Toxin Gene
In order to improve the utility of the vector
containing the ~.t. protoxin coding sequence for use in
pAMVBTS, the DNA sequence immediately upstream to the
"ATG" initiation codon was altered to include a
restriction site for the endonuclease Nco I. This
sequence is CCATGG, wherein the internal "ATG" represents
the initiation methionine codon of the toxin protein
coding sequence. This may be done by chemically
synthesizing two oligonucleotide primers with regions of
homology to the amino terminus of the toxin coding region
and amplifying a DNA fragment corresponding to a modified
1 337280
-24-
amino-terminal coding region utilizing the polymerase
chain reaction (PCR). Nucleotides 5 to 25 of the first
nucleotide, designated KB15 and i]lustrated below, were
homologous to nucleotides 1 to 21 of the toxin coding
region, beginning the numbering of the nucleotides of the
coding region with the "A" of the initiation codon. This
represents nucleotides 527 to 547 of the published toxin
sequence as puhlished by Schnepf et al. above. The third
through eighth nucleotides of KB15 include the recognition
sequence for the endonuclease Nco I, with the first two
nucleotides of KB15 serving a stabilizing role in both the
polymerase chain reaction amplification sequence and
during subsequent cleavage of the amplified DNA fragment
with the endonuclease Nco I. The second oligonucleotide,
designated KB16 and also shown below, is homologous to the
opposite or "antisense" strand of the toxin coding region
at nucleotides 722 to 701 of the published sequence.
These two oligonucleotides were used in conjunction with
the DNA encoding the B.t. protoxin that is found on
pCaMVBT, described above, in a polymerase chain reaction
essentially as described in the published description of
the polymerase chain reaction protocol. Saiki et al.
"Enzymatic Amplification of Gamma-Globin Genomic Sequences
and Restrictions Site Analysis for Diagnosis of Sickle
Cell Anemia," Science, Vol. 230, pp. 1350-1354 (1985).
Details of this reaction are also provided below.
KB15 25mer 5'- CGCCATGGATAACAATCCGAACATC -3'
KB16 22mer 5'- CCCATATTATATCAACTAGTCC -3'
To amplify the modified amino-terminal fragment of the
B.t. protoxin encoding gene from pCAMVBT, a hundred
microliter reaction is prepared containing lOmM Tris-HCl
(pH 7.5), 50 mM NaCl, lOmM MgC12, 1.5 mM of each of the
four d~TP's, 0.01 microgram of pCaMVRT and 2 micrograms
each of KB15 and KB16 described above. This reaction is
1 337280
- -25-
heated to 100 degrees C for 2 minutes, microfuged at room
temperature for 30 seconds, and then 1 microliter of
Klenow fragment DNA polymerase (U.S. Biochemicals, 5 units
per microliter) is added and mixed into the reaction. The
first cycle of the polymerase chain reaction is conducted
by incubating this mixture for 2 minutes at 37 degrees,
then 2 minutes at 100 degrees, followed by 30 second
microcentrifugation. An additional microliter of Klenow
poLymerase is then addeA to initiate the second cycle of
the polymerase chain reaction and a subsequent series of
cycles of 37 degrees, 100 degrees, centrifugation, and
polymerase addition are continued until 20 synthesis steps
at 37 degrees have been conducted. After the twentieth
cycle of synthesis at 37 degrees, the reaction is heated
only to 65 degrees for 10 minutes to inactivate the Klenow
polymerase. The reaction products are then returned to 37
degrees, brought to 100 mM NaCl, and 50 units each of Nco
I and Spe I are added. Incubation is then conducted at 37
degrees for 1 hour, and the reaction mixture is subject to
electrophoresis on 3~ Nusieve agarose.
The amplified 178 nucleotide fragment with exposed Nco
I and Spe I sticky ends, which corresponds to nucleotides
481 to 657 of the pAMVBTS plasmid, is purified by
electroelution from the agarose after excision of the
ethidium bromide-stained band from the gel. This
amplified fragment is cloned into a plasmid vector
prepared from pCaMVBT. For this reaction, pCaMVBT was
digested with Nco I and Spe I and the larger of the two
resulting fragments gel-purified. Spe I cuts the vector
pCaMVBT only near the amino terminus of the B.t. protoxin
coding region. Nco I also cuts pCaMVBT at a unique site,
at nucleotide number 272 within the CaMV DNA fragment.
Thus the combination of these two enzymes results in
deletion of a functional portion of the CaMV 35S promoter
fragment, so that the resulting plasmid following cloning
of the polymerase chain reaction-amplified toxin
amino-terminus is not capable of expression in plant
-26- 1 337280
cells, due to lack of a promoter. The amplified DNA
fragment and the Nco I and Spe I double-digested vector
are combined and ligated, and transformed into E. coli
which is then subjected to selection for ampicillin
resistance. The resulting plasmid, designated pBT/NCOI in
Fig. 2, consists of a fragment of the CaMV DNA terminating
at the unique Nco I site, the B.t. protoxin coding region
with a modified amino-terminus consisting of the Nco I
restriction site, and a nopaline synthase polyadenylation
region. The amplified region between Nco I and Spe I are
sequenced to confirm that the correct DNA has been
amplified.
III.f. Construction of p~5VBTS -
Combining pAMV1022 with pBT/NCOI
In order to insert a transcriptional promoter onto
pBT/NCOI, and to combine with the upstream AMV leader
sequence, the coding region from pBT/NCOI must be combined
with pA~5V1022. The vector pBT/NCOI is dige.sted with Nco I
and Xho I, and the larger component containing the vector
may be purified by agarose gel electrophoresis, followed
by electroelution. The plasmid pAMV1022 is digested with
Xho I and Nco I followed by purification to obtain the 466
base pair promoter fragment from the remaining portion of
the vector. The two purified DNA fragments are then
combined, ligated, and transformed into E. coli which is
then selected for ampicillin resistance. The resulting
plasmid, designated pA~5VBT in Fig. 2, is confirmed by
plasmid minipreps. T~e expression cassette in the plasmid
p~5VBT consists of a functional CaMV 35S promoter of
approximately 430 base pairs (CaMV3~S), a 35 nucleotide
DNA fragment encoding the ~5V coat protein noncoding
region (AMV), a complete coding sequence for the B.t.
protoxin (B.t.) and followed by the polyadenylation region
from nopaline synthase (NospA).
1 337280
-27-
III.g. Construction of pAMVBTS -
Truncation of Toxin Region
It has previously been demonstrated that only the
amino-terminal portion of the B.t. protoxin is required
for toxicity. Schnepf and Whiteley, "Delineation of a
Toxin-Encoding Segment of a Bacillus thuringiensis Crystal
Protein Gene," J. Biol. Chem., 260, pp. 6273-6280 (1985).
Deletion of the carboxyl-terminal portion of the toxin
sequence beyond a recognition site for the endonuclease
Bcl I (a sequence of TGATCA, nucleotides 2413-2418 of the
vector pAMVBTS, Fig. 4, and nucleotides 2458-2463 of the
published toxin sequence), located in amino acid codon 644
of the protoxin sequence, removes a significant portion of
the protoxin but does not eliminate toxicity. Deletion of
the coaing sequence beyond the Bcl I site and codon 644
does remove at least 1594 nucleotides from the expected
mRNA (depending on how the deletion is accomplished) and
eliminates 45% of the total amino acids found on the
protoxin. While it is possible that stabili~ing
structures may be located on the carboxy-terminal portion
of the protoxin codinq sequence, or at the 3' terminus of
the bacterial transcribed mRNA, there is no apparent
requirement for the retention of the carboxy-termina]
portion of the protoxin when expressed in plants. In
fact, to the contrary, an increase in efficiency of
expression in plants might be expected by removal of some
of the sequences from the chimeric genes since then both
the transcribed mRNA and the translated protein would be
proportionately smalLer and less complex. Furthermore,
any functions of either the carboxy-terminal portion of
the protoxin or the 3' terminus of the mRNA that are
deleterious to plant cell growth or activity would be
eliminated by removal of these terminal sequences.
Because the carboxy-terminus of the protoxin is believed
to be involved in the formation of the crystal structure
when the protoxin is expressed in B. thuringiensis, and
1 337280
-28-
may serve a similar function in the cells of plants
expressing the protoxin, removal of this portion of the
protoxin may additionally eliminate deleterious effects on
plant cell growth or activity caused by the insolubility
of the protoxin crystal structure.
The plasmid pAMVBT has two Bcl I restriction sites
located within the coding region of the protoxin. The
site which is most 5', corresponding to nucleotide 2413 of
pA,~IVBTS, Fig. 4, is the site mentioned above as being just
outside the necessary coding sequence for toxicity. The
second site, which is not the desired one, is located
further along the protoxin coding sequence. The vector
pAMVBT also has unique Pst I site, located in the
polylinker region between the nopaline synthase
pol~denylation region and the termination of the protoxin
sequence. This site is located at nucleotide 2432 of the
pAMVBTS sequence illustrated in Fig. 4. To truncate the
protoxin region, to eliminate the portion not required for
toxicity, the coding region of the protoxin in pAMVBT is
truncated by deletion of all the DNA between the most S'
Bcl I site and the Pst I site. Into the location of this
deleted DNA a synthetic DNA duplex linker is inserted as
illustrated below.
Bcl I Pst I
5' - GAT CAA CCA CCT TAA TAG CTG CA -3' KBl9
.. ... ... ... ...
.. ... ... ... ...
3' - TT GGT GGA ATT ATC G -5' KB20
asp gln pro pro ter ter
(pro=proline codon; ter=termination codon)
As can be seen, the duplex linker is formed by
annealing two oligonucleotides, designated KBl9 and KB20.
These nucleotides are designed to restore both the Bcl I
site of the original B.t. toxin coding sequence and the
Pst I site joining the toxin coding region to the
1 337280
-29-
polyadenylation region when cloned into the above
descrihed Bcl I/Pst I deletion plasmid. Because the Bcl I
site is located within the coding region for the protoxin,
the linker formed from oligonucleotides KBl9 and KB20 was
further designed to terminate the protein coding region
with the addition of two new adjacent termination codons,
those being the TAA and TAG sequences in the above
synthetic linker. These terminations codons are
appropriate because of the ]ack of termination codons
located at this posit;on in the truncated gene coding
sequence. In addition, to stabilize the carboxy-terminus
of the truncated toxin protein, upstream of the two
termination codons, two additional codons for the amino
acid proline, CCA and CCT, were included in the linker as
carboxy-terminal co~ons before the termination codons.
Construction of the truncated toxin expression
cassette was carried out by first digesting the plasmid
pAMVBT with Bcl I and Pst I to delete the carboxy-terminus
of the B.t. protoxin coding region. The DNA for this
reaction was prepared from an E. coli strain free of dam
methylase, which methylates the "A" in the sequence
"GATC," since methylation at this site inhibits cleavage
by the endonuclease Bcl I. The remaining approximately
4564 base pair fragment is then purified by agarose gel
electrophoresis. The oligonucleotides KBl9 and KB20 are
chemically synthesized in the sequence shown above,
annealed, and then are combined with the digested vector.
It is unnecessary to phosphorylate the synthetic linkers
with polynucleotide kinase, since ligation of the plasmid
vector with the 3' ends of the unphosphorylated linkers
occurs with sufficient efficiency and repair of the
unligated 5' end occurs following transformation in E.
coli. However, it is acceptable to phosphorylate the
linkers if care is then used to avoid polymerization of
the linkers without ligation to the vector. After
transformation of this ~igation into E. coli and selection
for ampicillin resistant colonies, plasmid minipreps can
1 337280
-30-
then be done to confirm that the correct plasmid has been
obtained, pAMVBTS. Sequencing of the synthetic DNA
sequence should be carried out to confirm the correct
coding sequence has been cloned. The coding cassette of
tl-e resulting plasmid pAMVBTS consists, in 5' to 3'
sequence of: the CaMV 35S promoter (CaMV35S), free of
unnecesssary 3' DMA, DNA encoding an mRNA leader
homologous to the ~V coat protein mRNA 5' nontranslating
region (AMV), DNA encoding a truncated B.t. toxin (B.t.)
with an Nco I site at the "ATG" initiator and 2 proline
codons immediately preceding two new termination codons
(Pro & Term) and terminated by a Pst I site, and the
polyadenyLation region of nopaline synthase (NospA).
The believed complete nucleotide sequence of the
vector pAMVBTS is illustrated in Figs. 4A and 4B. The
references above to the sequence position on that vector
match the reference locat;ons indicated in Fig. 4. The
sequence of Figs. 4A and 4B is believed correct, and was
determined partially from published sequence of the
beginning vectors and partially from sequencing data and
thus consequently may have mirror base pair errors not
affecting its successful function or use.
In the sequence of Figs 4A and 4B, nucleotide 1 begins
at an ~coRI side just 5' to the unique Xho I site. The
Xho I site shown in Figs. 2 and 3 may be found at
nucleotides 16 to 21 of the sequence in Figs. 4A and 4B.
IV. Construction of pTV4AMVBTSH
The plant expressible B.t. expression vector
pTV4AMVBTSH results from cointegration of plasmids pTV4
and pAMVBTS described above, as illustrated in Fig. 3.
The two progenitor plasmids pTV4 and pAMVBTS are first
each digested with endonuclease Xho I which cleaves each
of the plasmids at a unique site. The linearized plasmids
are then cleaned by phenol extraction and ethanol
3~ precipation, combined for ligation using T4 DNA ligase,
1 337280
-31-
and transformed into E. coli host MM294. Selection was
then applied to the transformed E. coli, for both
ampicillin resistance and sulfadiazine resistance, and
plasmid cointegrates were analyzed by minipreps. The
resulting plasmids are of two different types, depending
on the relative orientation of the two cointegrated
vector.s. Where the vectors integrate in the orientation
shown ~or pTV4~1VBTSH illustrated in Fig. 3, in which the
direct;on of transcription of the ampicillin resistance
gene (Ap ) from pAMVBTS is the same as the direction of
transcription of the sulfadiazine resistance gene (Su )
from pTV4, there are no directly repeated DNA sequences
that can generate homologous deletions in E. coli,
Agrobacterium, or in plant cells. In plasmids having the
opposite orientation of the cointegration, the nopaline
synthase polyadenylation regions (NospA) would be in
direct repetition and would therefore be capable of
deleting the APH-II gene in vivo by homologous
recombination. In addition, the enhancer region at the 5'
end of the CaMV 35S promoter is situated directly adjacent
to the nopaline synthase gene from pTV4 and would
therefore be likely to stimulate that gene as well as the
B.t. toxin gene in the selected orientation for
pTV4AMVBTSH.
V. Construction of pTV4 and pAMVBTS from pTV4AMVBTS
Plasmid pTV4AMVBTSH has been deposited with the
American Type Culture Collection, Accession No. 53636.
Since this plasmid is a cointegrate of the two pro~enitor
plasmids pTV4 and pAMVBTSH which were opened at unique
sites for the restriction endonuclease Xho I, it may
readily be used to regenerate both of those two progenitor
plasmids. This is the second, and much easier method now,
for creating pAMVBTS or derivatives thereof. If DNA of
pTV4AMVBTSH is digested with Xho I to completion, then
3~ phenol extracted and ethanol precipitated to clean it, the
1 337280
-32-
DNA may then be resuspende~ as recommended for ligation by
suppliers of T4-DNA ligase, but by maintaining the DNA at
a ~ilute concentration, about 10 micrograms per mililiter,
ring closure is favored over cointegration. The resulting
structures can be transformed into E. coli MM294 or any
other suitable strain. By appropriate selection among the
transformation progeny the colonies which were only
ampicillin resistant will be found to contain pAMVBTS,
while the colonies only sulfadiazine resistant will
contain pTV4. Thu.s, as illustrated in Fig. 3, the vector
pTV4~VBTSH can be readily resolved into its progenitor
vectors which can be readily recombined to create the
plant expressible vector.
While these vectors are particularly suitable for the
expression of the B.t. toxin protein in plant cells, they
may also be utilized for the expression of other gene
products in plant cells. Note that the B.t. coding re~ion
in pAMVBTS (or pTV4AMVBTS) is neatly contained between a
unique Nco I site and a downstream unique Pst I site.
Thus the coding region can readily be excised from pAMVBTS
and any other appropriate coding region can be inserted
therefor. The insertion of any alternate coding sequence
in this region would take full advantage of the upstream
~V leader sequence for the enhanced transcriptional
activity obtained thereby. In addition, if the inserted
coding region in itself codes for a truncated protein
product, instead of deleting just the B.t. coding region
from pAMVBTS between the Nco I site and the Pst I site,
the deletion can be from the Nco I site to the Bcl I site,
which is before the proline codons and the terminator
codons, so that those can be retained with the expression
plasmid for the new sequence. In any event, it should be
clear that these plasmids are suitable for the insertion
and expression of other coding sequences besides that
illustrated herein.
1 337280
-33-
EXAMPLE 2
Transformation and Regeneration of
Transgenic Tobacco Plants
The plasmid pTV4AMVBTS was conjugated into A.
tumefaciens strain EHA101 in a manner similar to that
described in Barton et al. "Regeneration of Intact Tobacco
Plants Containing Full Length Copies of Genetically
Engineered T-DNA, and Transmission of T-D~A to R-l
Progeny," Cell, 32, p. 1033-1043 (1983). Seeds of tobacco
(Nicotiana tabacum, var. Havana 425) were surface
sterilized, and germinated on Murashige and Skoog (MS)
medium. Aseptically grown immature stems and leaves were
then inoculated with overnight cultures of A. tumefaciens
harboring the plasmid pTV4AMVBTS. Following 48 to 72
hours of incubation at room temperatures on a regeneration
medium (MS medium containing 1 milligram per milliliter of
kinetin), cefotaxime (at 100 micrograms per milliliter)
and vancomycin (at 250 micrograms per milliliter) were
applied to kill the agrobacteria, and kanamycin (at 100
micrograms per milliliter) was applied to select for
transformant plant tissue. After approximately 6 weeks,
with media changes performed at 2 week intervals, shoots
appeared. The shoots were excised and placed in rooting
medium containing 25 milligrams per milliliter kanamycin
until roots were formed, which occurred in 1 to 3 weeks.
After roots were formed, the plants were transferred to
commercial potting soil mixture (Metro-mix 360, W. R.
Grace & Co.). Approximately 2 weeks after potting, insect
toxicity tests were initiated on leaves of the resulting
plants.
Insect Toxicity Assays
Insect eggs of tobacco hornworm (Manduca sexta),
cotton boll worm (Heliothis virescens), corn earworm
1 337280
-34-
(Heliothis zea) and beet armyworm (Spodoptera exi~ua) were
hatched on mature wild-type tobacco plants. Larvae of the
various insects were allowed to graze for 1 to 3 days on
wild-type plants prior to transfer to test plants. Since
mature tobacco plants contained higher levels of secondary
metabolites than freshly regenerated plants, the feeding
of the larvae on older plants made the larvae less
sensitive to toxins than neonatal larvae. This reduced
sensitivity in the larvae proved useful in distinguishing
between variation~ in the level of toxin production in
various transgenic plants. Tobacco hornworms were placed
directly on the leaves of young wild-type and recombinant
plants, usually 2 to 4 larvae per plant per test, with up
to 6 successive tests conducted per plant. Only test
plants showing 100~ toxicity to the larvae in all tests
were considered to be resistant. Alternatively, tests
were conducted using excised leaf tissue in petri dishes
with 5 to 10 hornworms or a single larvae of the other
species per dish. In the assays conducted in dishes,
weights of the larvae were recorded at initiation and
termination of the tests. Feeding trials were generally
conducted for 2 to 4 days in duration, with daily
monitoring of the reduction in feeding and larval deaths.
Table I below illustrates the toxicity of ten
resulting transgenic plants as measured by these insect
assays. Relative levels of toxicity between plants
providing complete larvae mortality are subjective
(indicated by scale of + to ++++), and are based on the
extent of damage to the plant before mortality. In all
cases of mortality, some feeding was observed. In Table
1, the number of gene inserts is listed as measured by
restriction mapping and the level of toxin-related RNA was
measured and is valued in picograms per 20 microgram in
each plant. The toxicity ratio is number of larvae killed
versus number tested. H425 is the wild-type (control)
plant. "nd" indicated not detectable.
1 337280
-35-
TABLE 1
TOXICITY IN REGENERATED AMVBTS TOBACCO PLANTS
PLANT # GENES RNA TOXICITY
H425 0 nd- (0/50)
857 3 47++++ (12/12)
858 nd 1.2- (1/6)
859 2 1.1+++ (10/10)
860 1 0.8+++ (8/8)
861 2 1.4++ (8/8j
862 5 7++++ (8/8)
863 1 0.5+ (6/6)
870 3 2.5+++ (10/10)
~72 3 1.3++ (8/8)
884 nd 2.8- (2/6)
Further analysis of over 100 independent
transformations has shown that within approximately 25% of
the plants feeding on the leaves by larvae is lethal to
all larvae within 4 days, with the most resistant plants
allowing only minimal feeding during the early hours of
the test. Many of the plants which were judged nontoxic
by the methods described for Table I resulted in few
larvae being kilLed but did reduce larval feeding levels
and growth rates in comparison to control tissues.
Blot Analysis
Southern Blot analyses were conducted on 10 of the
regenerated transgenic plants of Table I above. Digestion
of the DNA from the plants with Pst I and Xho I fragments
would be expected to release from the transgenic plants
the toxin chimera as a 2.42 k;lobase internal DNA fragment
which includes both the CaMV promoter and the entire toxin
coding region from pTV4AMVBTSH. Eight of the 10 plants
1 337280
-36-
analyzed by Southern Blot appeared to have one or more
intact toxin genes while two of the plants showed only
broken inserts of variable size less than a single copy in
intensity. Additional digests to analyze the border
fragments of the recombinant plant DNA indicated that each
of the transformants witl intact genes contained between 1
and 3 different inserts, each of which hybridized at a
single-copy intensity. The relative proportion of intact
inserts, copy numbers, and the overall frequency of
regeneration in these and other transgenic plants compares
favorably with the experience with other genes in plants
and supports the concept that the truncated B.t. toxin
encoded by pAMVBTS and its progeny does not have the
deleterious effects on plant cells that are observed when
the full length protoxin coding region is inserted into
plant cells.
Northern Slot-Blot analysis was conducted on 10
transformants. The range of expression in horn
worm-resistance transformants varied over a 50-fold
range. The two plants which showed only broken inserts
stilL showed evidence of toxin related mRNAs.
Immunoblot analysis of toxin-related polypeptides in
the plants was also conducted. Specific immunoreactive
polypeptides were discovered of approximately 72
kilodaltons. Control plant tissues did not contain the 72
kilodalton polypeptide.
Transmissibility of Transgenic Genes
Transmission of the resistance to insect predation to
the progeny of transgenic plants was tested by allowing
transgenic plants to flower, and then recovering the seed
generated by self-pollination of the transgenic plants.
The progeny of 1 plant, number 857 identified in Table I
above, having a particularly high level of RNA activity,
were analyzed in detail. It was determined that plant
number 857 had 3 independent insertions of this chimeric
1 337280
sequence containing the toxin gene. Among the progeny,
restriction mapping including border digests revealed that
various combinations of the 3 inserts were found in the
progeny from plant number 857. The levels of toxin
S related RNA activity in the progeny also appeared to
vary. It was ascertained that the three inserts did not
express at identical levels, since only marginal toxicity
and little toxin-related RNA activity was apparent when
the toxin insert characterized by the 1.5 kilobase border
fragment was the only insert present. Table II summarizes
the data on insect bioassays and nucleic acid analysis for
the progeny of plant number 857. In Table 2, the inserts
are labelled "a", "b", and "c". Additional analyses of
progeny from other transgenic have indicated that the
AMVBTS gene routinely continues to express in the progeny,
at a level depending on the copy number and activity of
the particular insertion.
1 337280
-38-
TABLE II
TOXICITY IN PROGENY OF AMVBTS PLANT #857
PLANT ~ GENES RNA TOXICITY
H425 0 nd- (0/26)
1262 c nd- (3/6)
1263 c nd- (0/6)
1264 nd nd- (0/6)
1265 a,b,c 6++++ (6/6)
1266 a,b,c 6++++ (6/6)
1267 a,b,c 5++++ (6/6)
1268 a,b,c 12++++ (6/6)
1269 c nd- (2/6)
1270 c nd- (4/6)
1271 c nd- (0/6)
1272 a,b,c 8++++ (6/6)
1273 c nd- (2/6)
1274 a,b,c 24++++ (6/6)
1275 c nd- (4/6)
1276 a,b,c 15++++ (6/6)
Verification of toxicity
While the tobacco hornworm larvae were used as
convenient assays for toxicity, because of the sensitivity
of tobacco hornworms to B.t. toxin, the effect of the
toxin on other Lepidopteran insects was also verified.
The resistance of the toxin producing plants to predation
by cotton bollworms, corn earworms, and beet armyworms was
also tested. In successive tests using either the parent
plant 857, or its progeny with all three insertions
represented (for example plant number 1265), reductions in
feeding and increased mortality of each species of larvae
were observed relative to larvae fed on control
non-transgenic tobacco tissues.
9 1 337280
EX~MPLE III
Transgenic Cotton
It has been previously demonstrated ~enerally that
plant transformation vectors and techniques suitable for
the Agrobacterium-mediated transformation of tobacco
plants can be utilized in tissues of cotton (Gossypium
hirsutum L.) plants. A description of the technique for
doing this transformation, and the subsequent regeneration
process necessary to recover full plants has been
published. Umbeck et al., "Genetically Transformed Cotton
(Gossypium hirsutum L.) Plants," Bio/Technology, 5, pp.
263-266 (1987). Since Lepidopteran insects are
significant predators to cultivated cotton, the creation
of transgenic cotton plants expressing the B.t. toxin
specific to Lepidopteran pests was an appropriate
objective.
Seeds of cultivated cotton of variety Coker 312, were
surface sterilized with 3% sodium hypochlorite for 20
minutes. The seeds were then rinsed three times with
steri]e distilled water plus cefotaxime (500 mg/l). The
seeds were then allowed to germinate in SH medium
containing the fungicide benomyl (50 mg/l). Four to six
days after germination, hypocotyl plants were removed, cut
into 0.5 cm pieces and placed on a support medium
containing agar (0.8%) and water.
The hypocotyl pieces in culture were then inoculated
with the diluted (1:10) overnight culture of a
nontumorigenic or "helper" A. tùmefaciens strain EHA101
harboring the vector pTV4AMVBTSH. The suspension culture
of A. tumefaciens contained approximately 10 bacteria
per milliliter.
As in the previous experiment, the A. tumefaciens
strain harbored a binary Ti plasmid system containing a Ti
plasmid carrying the so-called virulence region and also
the plasmid pTV4AMVBTSH. The infection of the A.
1 337280
-40-
tumefaciens on the immature tissues was allowed to proceed
for 3 days of incubation at room temperature. Light was
also allowed to the culture during this incubation
period. After that, the tissues were transferred to MS
salts with B5 vitamins plus antibiotics, the phytohormones
2,4-D (0.1 mg/l) and either 6-furfurylaminopurine (0.1
mg/l) or zeatin (0.001 mg/l), and the gelling agent
Gelrite (1.6 g/l), plus magnesium chloride (750 mg/l),
plus 30g/1 glucose. Antibiotics were then added to the
13 medium to kill the remaining Agrobacterium including
cefotaxime (50-100 mg/l) and carbenicillin (400-500
mg/l). Kanamycin sulfate (5-50 mg/l) was also included in
the medium as a selection agent for transformed tissues.
Subcultures of the tissues were made every 3 to 6 weeks to
replenish depleted nutrients and antibiotics. After 3 to
4 months, individually derived cell lines were labeled and
maintained on the selection medium for tissue
amplification. The tissues were incubated at 30 degrees C
for a 16 hour photo period (50-100 umol/m2/S).
After amplification, the antibiotics were discontinued
and the transformed tissues were maintained on the same
mediums without the plant hormones.
Embryogenic calli and embryos have been obtained from
the transformed and selected tissues using the method
~5 described in Umbeck et al., supra. When sufficient callus
tissue was generated, Southern Blot analysis of the
tissues was conducted in a manner identical to that
conducted with the tobacco tissues above. Embryogenic
calli which were assayed showed the presence of one or
more copies of the insert from pAMVBTS. In accordance
with the published procedure, embryos reaching a selected
size, i.e. about 4 mm or more in length, and which appear
to have good embryo development, with cotyledon and
radicle present, have been transferred to a rooting
medium. This has been done by soaking the embryos in a
rooting medium (MS salts, glucose, and B5 vitamin) until a
root is germinated after which they are transferred to SH
1 337280
-41-
medium in an agar formulation until leaves are formed.
The rooting SH medium sometimes includes the phytohormone
gibberellic acid, at 0.1 mg/l. The embryos are now
being incubated at 30 degrees C for a 16 hour photo
period. The embryos will germinate, and at the 2 to 3
leaf stage will be transferred to pots filled with
vermiculite or soil, and watered and fertilized as
needed. The plants will be enclosed in a beaker for
hardening-off the leaves and then will ultimately be
planted in the greenhouse. Adapted plants will be
repotted in a commercial soil mixture such as Metro-Mix
360 and maintained until mature.
The resultant transgenic cotton plants will
constitutively express in their tissues the truncated
toxin portion of the B.t. delta-endotoxin crystal
protein. Suitable insect toxicity assays performed ;n the
same fashion as indicated above with respect to the
tobacco tissues will confirm the presence of and
expression of the chimeric B.t. gene construction
transferred from pTV4AMVBTSH into the genome of the cotton
plants. The trait will be inheritable by normal Mendelian
inheritance.
In order to enable others of ordinary skill in the art
to practice the present invention, certain deposits have
been made, all hosted in E. coli, with the American Type
Culture Collection, 12301 Park Lawn Drive, Rockville, MD
U.S.A. on the dates listed below and with the following
ATCC accession numbers. Similar deposits have also been
made with the Cetus Master Culture Collection maintained
by Cetus Corporation, Emeryville, California, and the CMCC
Accession number of these cultures is also given below.
PLASMID CMCC # ATCC # ATCC DEPOSIT DATE
pCMC92 2306 53093 April 10, 1985
pCMC122 1991 39639 March 23, 1984
pCMC1022 2902 67269 November 14, 1986
pAMVBTS 3137 53637 June 24, 1987
pTV4AMVBTSH 3136 53636 June 24, 1987
1 337280
-42-
The present invention is not to be limiteA in scope by
the microorganisms or plasmids deposited herein, since the
deposited embodiment is intended as a single illustration
of one aspect of the invention and to enable a single
illustration of practice of the invention, and any
microorganisms or plasmids which are functionally
equivalent are within the scope of this invention.
Indeed, various modifications of the invention in addition
to those shown and described herein will become apparent
to those skilled in the art from the foregoing description
and fall within the scope of the appended c]aims.
