Note : Les descriptions sont présentées dans la langue officielle dans laquelle elles ont été soumises.
1~39~7
DETECTION OF MYCOPLASMA BY DNA HYBRIDIZATION
This invention was made with Government support under Grant
No. AVAM 14096-01 with the National Institutes of Health and the
University of California. The Govemment has certain rights in this inven-
tion.
~ield of the Invention
This invention relates generally to the ~leld of Biology, and
more particularly to the fields of Biomedicine, 8iochemistry and Molecular
Biology.
Back~round and Summary of the Invention
Mycoplasmas are a group of pathogenic microor~anisms of the
Class Mollicutes characterized by having a small size and lacking a cell
wall. These microol~anisms are among the FnlAllest-known organisms
capable of a free living existence, and are important pathogens in man,
-2- 1~39547
plants and animals. For example, atypical pneumonia and non-gonococcal
urethritis are common mycoplasma infections in man. Mycoplasmas have
also been associated with rheumatoid arthritis, spontaneous abortion, infer-
tility and other genital tract diseases, and certain autoimmune disease
states. Moreover, mycoplasmas are common contaminants in cell
cultures. In biological research, mycoplasma contamination of tissue
culture is a serious problem which demands constant monitoring.
Not surprisingly, these organisms are extremely fastidious and
at present there are no cost-effective specific diagnostic procedures to
determine the presence of mycoplasma infections. The most commonly-
employed detection methods for mycoplasmas in clinical samples are
serological and cultural. The serological methods are subject to false
positives and the cultural methods are costly, time consuming and tedious.
Many of the biochemical techniques in current usage for detection of
microbial contaminants in cell cultures do not specifically detect myco-
plasmas but rather indicate the presence of any prokaryote or simple
eukaryote such as yeast and fungi, and some may even detect viruses. Such
a test is advantageous if one is interested only in the knowledge that a
microbial agent is present, but if one is searching for a suspected eti~
logical agent of an animal or human disease it is obviously necess&ry to
classify the agent as fully as possible.
Further, the above proced~l,es are hampered by special prob-
lems. ~or example, there are apparently "non-cultivable" mycopl~smas
which are not detected by conventional culture methods. In addition, in the
case of immunofluorescence tests more than one antibody might be re
-3- 1339~547
quired to identify the particular organism since more than nine different
mycoplasma species are common tissue culture cont~min~nts. Also, DNA
stains are not necessarily mycoplasma-specific.
Therefore, a simple, sensitive, specific, cost-effective, snd
rapid mycopl~sma detection system has been a desideratum in the fields of
diagnostic medicine and biological research.
The use of nucleotide sequence homology snd nucleic acid
hybridization kinetics has become a widely-employe~d technique for detect-
ing various organisms in cells and cell cultures. However, prior to this
invention reliable and specific DNA probes have not been Qvailable for
mycoplasma detection.
The present invention proceeds by the use of specific myco-
pl~sma ribosomal RNA gene fragments which are lsbeled or tsgged by a
variety of techniques, such as rsdioisotope l~beling, biotin labeling, PEI-
peroxidase conjugates, or nuorescent antibody tagging ELISA methods, for
the specific and sensitive detection of mycoplasmas in clinical specimens,
cells or cell cultures by DNA or RNA hybridization.
In one sspect of the invention, a DNA sequence from the 16S
RNA gene of mycoplasma is provided, which includes a nucleotide sequence
selected from the group consisting of AACACGTATC,
CGAATCAGCTATGTCG, GAGGTT AAC, ATCCGGATTTATT,
TCTCAGTTCGGATTGA, AGGTGGTGCATGGTTG, TCCTGGCTCAGGAT,
ATACATAGGT, AACTATGTGC, AA ~ l~ACAATG, snd
TCTCGGGTCT, which code for mycoplasma ribosomal RNA (rRNA) where
T represents thymine, G represcnt guanine, A represents adenine, C repre-
4~ 1339a~7
sents cytosine and - indicates a nucleotide deletion within the sequence
with respect to the comparable sequence in E. coli. These fragments differ
significantly from the 16S RNA gene of E. ~? and thus form the basis for
mycoplasma-specific probes which are constituted of labeled nucleotide
sequences complementary to the above.
In another aspect of the invention, identified DNA sequences of
a 16S RNA gene are provided which include nucleotide sequences selected
from the group consisting of ACGGGTGAGT, TAATACCGCAT,
TACGGGAGGCAGCAGT, GTGGGGAGCAAA, AGGATTAGATACCCT,
CCGTAAACGAT, GAATTGACGGGG, CCCGCACAAG, GGTGGAGCATGT,
TGTTGGGTTAAGTCCCGCAACGA, GGGATGACGT, ACGTGCTACAATG,
CTAGTAATCG, TGTACACACCGCCCGTCA, AAGTCGTAACAAGGTA,
and TGGATCACCTCCTT, which code for prokaryotic rRNA. These frag-
ments represent regions within the 16S RNA gene that are identical for E.
coli and all mycoplasmas examined. Universal probes for all prokaryotes
are constituted of labeled nucleotide sequences complementary to these
fragments.
In general the invention comprises a method for determining the
presence of a prokaryotic organism which contains a nucleic acid including
a particular nucleotide sequence which is present in nucleic acids from
prokaryotic organisms but absent in nucleic acids from eukaryotic organ-
isms, which comprises contacting a medium which may contain a nucleic
acid or nucleic acid fragment from s~id prokaryotic organism including said
particular nucleotide ~quence with an oligonucleotide, including a nucleo-
tide sequence complementary to said particular nucleotide ~equence,
1339~47
whereby said oligonucleotide hybridizes with any nucleic acid or nucleic
acid fragment from said prokaryotic organism, including said particular
nucleotide sequence which may be present in said medium, and detecting
the presence of any nucleic acid or nucleic acid fragment hybridized with
said oligonucleotide.
Other aspects of the invention c~nccll. the specific biological
probes used for detecting mycoplasmss or prokaryotes in general in accord-
ance with the above described proce~ and the identification and production
of such probes.
8RIEF DESCRIPTION OF THE DRAWING
The sole figure of the drawing shows a slot blot development
illustrating the present invention.
DESCRIPTION OF THE PREFERRED EMBODIMENTS
The invention will now be described by detailing first the spe-
cific steps involved in producing and using the biological probes of the
present invention and then describing how particular nucleotide sequences
useful in this invention are determined.
SYNTHESIS OF DEOXYOLIGONUCLEOTIDES
The 16 bp deoxyoligonucleotide, GCTTAGTCGATACAGC,
which is complementary to one of the 16S mycoplasma RNA gene
sequences listed above, was synthesized using the phosphotriester solid
phase procedure described in M. H. C~ruthers et aL, Genetic Engineerin~,
-6- 1339~47
Vol. 4, p. 1-17, Plenum Publishing Co. (1982).
Any of the other deoxyoligonucleotides previously mentioned or
any other desired oligonucleotide can be similarly prepared. For example,
instead of a DNA probe it may be desired to synthesize an RNA probe such
as a recombinant SP6 vector transcript containing the sequence
CGAAUCAGCUAUGUCG.
DNA-RNA or RNA-RNA hybridization to ribosomal RNA mole-
cules amplifies the sensitivity of the detection several hundredfold above
any DNA-DNA or RNA-DNA hybridization using probes against genomic
DNA sequences, since the use of such probe which will detect multiple
copies of ribosomal RNA per mycoplasma or eubacterial cell.
TESTING OF DEOXYOLIGONUCLEOTIDES
The above described deoxyoligonucleotide was 32P-labeled at
the 5' end using the procedure in C. C. Richardson, Procedures in Nucleic
Acid Research (Cantoni, G. L. and Davies, D. R., eds.), Vol. 2, pp. 815-828,
Harper and Row, New York (1971). The resultin~ labeled
deoxyoligonucleotide was then used as a myco-
plasma-specific probe. Specificity for mycoplasma was demonstrated by
means of slot blot hyL. i~ ation as described in M. Cunningham, Anal.
Biochem. 128:41~421 l1983~.
For this purpose a 1600 bp DNA fragment of Mycoplasma pneumoniae
which hsd been cloned into pUC8 was used. The 1600 bp fragment contains
the above described 16 base deoxyoligonucleotide. A genomic digest of E.
~, a representative prokasyotic eubacterium, was also produced by
-7- 133~47
digestion with the enzyme Hindm. The digested E. coli DNA ~nd the
1600 bp M. pneumoniae DNA fragment were trsnsferred onto nitrocellulose
filters according to the procedure in the J. J. Leary et sl., Proc. Natl.
Acad. Sci. U.S.A. 80:4045-4049 (19831
The nitroc~ filters containing the DNA fr~mPnt~ were
baked for 2 hours at 80~C under reduced pressure and hybridized to the
32P-labeled deoxyoligonucleotide. Development of the resulting slot blots,
shown in the drawing, revealed blots of increasing intensity for the M.
pneumoni~e DNA segment at 0.00034 ng, 0.0034 ng, 0.034 ng, 0.34 ng, and
3.4 ng (calculated for 16 bp) and no blots for the E. coli DNA segment at
0.00015 llg, 0.0015 ~Ig, 0.015 llg, 0.15 llg,and 1.5 llg indicating the sp~
cificity of the deoxyoligonucleotide probe for mycoplasma. The deoxy-
oligonucleotide having the sequence GCTTAGTCGATACAGC thus is useful
as a mycoplasma-specific probe which hybridizes with mycoplasmal DNA
but does not hybridize with DNA of other prokaryotic organisms. On the
other hand, a deoxyoligonucleotide having the sequence TGCCCACTCA,
for example, which is complementary to one of the prokaryotic coding gene
sequences, is useful as a prokaryote-specific probe which hybridizes with
prokaryotes but not with eukaryotes.
For the detection of mycoplasmas in infected cells the follow-
ing procedure h~ ~een found ef~ective. The cells are trypsinized using 1-
_ T75 tissue culture flasks with Trypsin EDTA (0.05% trypsin, 0.04~ EDTA
in PBS) for 2 minutes at 3~C. The trypsinized cells are resuspended in 1-
2 ml of growth medium and spotted in a quantity of 50-100 Ill (1 x 105 -
1 x 106 cells) onto a nitrocellulose filter wetted with 10 x SSC (1 x SSC:
~ -8- 1339~47
15 mM Na citrate, 150 mM NaCl, pH 7.4) using a Minifold I[ slot blot hybri-
dization apparatus available from Schleicher and Schuell, Inc., Keene,
N. H. The DNA samples applied to the slot blots are denatured with alkali
(0.5 M NaOH, 1.5 M NaCl) for 5-lOminutes at room temperature and neu-
tralized for 5-10 minutes at room temperature using 0.5 M Tris, pH 7.2 and
3.0 M NaCl. The filter is then washed with 2 x SSC for five minutes at
room temperature and baked in a vacuum oven for 2 hours at 80~C. The
filter is prehybridized for 2 hours at 65~C using a prehybridization buffer
consisting of 0.5 mM EDTA, 5 mM Tris, pH 7.5, 5 x Denhardt, and
100 ~g/ml heat denatured her,in~ sperm DNA. Hybridization, using the
probes of this invention in a concentration measured as 1-2 x 106 cpm of
32P-labeled deoxyoligonucleotide, specific sctivity >108 cpm/~l g in hybridi-
zation buffer consisting of 10 mM Tris, pH 7.5,1 mM EDTA, 0.75 M NaCl,
1 x Denhardt, 0.5% SDS, 10% dextran sulfate and 100 llg/ml heat dena-
tured herring sperm DNA, is carried out at 65~C for 16 hours. Following
hybridization the filter is washed 2-4 hours at 65~C with 2 x SET, 0.2% SDS
(1 x SET:30 mM Tris, pH 8.0, 150 mM NaCl) and 1-2 hours at room tem-
perature with 4 mM Tris base. The Blter is then dried and exposed on X-
ray film using 1 or 2 Dupont Cronex intensifying scree1ls.
DETERMINATION OF PARTICULAR NVCLEOTIDE SEQUENCES
While the foregoing description of the present invention teaches
how particular nucleotide seguences can be prepared and used, the broader
scope of this invention may be re~li7ed by ~y~minirlg the technigues used
for determining particular nucleotide sequences which are useful as myc~
1~39~54 7
g
plasma-specific probes, probes specific for prokaryotes in general, probes
specific for individual mycoplasma, ureaplasma, acholeplasma, and spir~
plasma species or probes specific for individual eubacterial species.
Such determination involves the following steps:
1. cloning the entire genome of ribosomal RNA of a particul~r
species of mycoplasma into a bacteriophage or plasmid vector;
2. probing the resulting ribosomal RNA gene fragments with a
non-mycoplasm~ prokaryotic ribosomal RNA operon;
3. characterizing the fragments which hybridize with said non-
mycoplasma prokaryotic ribosomal RNA operon;
4. identifying mycoplasma~pecific fragments by differential
hybridization as described in Gobel, U. and Stanbridge, E. J., Science, VoL
226, pp. 1211-12~3 (1984).
5. subcloning mycoplasma-specific fragments into a sequencing
plasmid;
6. sequencing the resulting subcloned mycoplasma-specific
fragments;
7. repeating steps 1-6 for other species of mycoplasma and for
non-mycopl~smal prokaryotes; and
- 8. comparing sequences obtained in steps 6 and 7; whereby a
sequence common to all the species of mycoplasma but differing from the
corresponding sequence in non-mycopl~rnsl prokaryotes is useful as a
mycoplasma specific pro~e ~ 8 sequence comm~n to all the species of
mycoplasm&, ~ ell ~s the non-mycoplasmal ptokaryotes, is useful as a
probe specific for prokaryotes in general, and a sequence specific for either
~,
1339~47
--1 o
a specific mycoplasms, acholeplasma, ureaplssma, or spiropl~sma species
and sequences specific for any given eubacterial species, are useful 8S
probes specific for individual mycoplasma, acholeplasma, ureaplasma,
spiroplasma, or eubacterial species, respectively.
Cloning of the ribosomal RNA genome of M. pneumoniae was
accomplished by Hindm digestion of total M. pneumoniae DNA and ligation
of the Hindm fragments to the Hindm digested vector pUC8. The resulting
ribosomal RNA gene fragments were probed with E. coli ribosomal RNA
operon in the pKK 3535 plasmid according to the procedure in Gobel et al.,
Science, 226:1211-1213 (1984) to identify cloned fragments
which contained ribosomal sequences. A
1600 bp fragment was chosen on the basis of hybridization to mycoplasma
species and not to E. coli or mammalian DNA under stringent hybridization
conditions. This 1600 bp fragment was removed from the pUC8 vector by
means of HindI~ digestion and ligated to M13Mp8 DNA bacterial virus for
sequencing using the Sanger dideoxy method described in Sanger et al.,
Proc. Natl. Acad. Sci. U.S.A., 74:5463-5467 (1977).
Comparison of the sequences of the mycoplasma species M.
pneumoniae, M. capricolum, snd Mycoplasma spe~ies PG50 with E. coli
indicated that cert~in sequen~es were common to all these species of
mycoplasrn~ b~t di~~erent from E. coli. These sequences could be synthe-
sized and labeled and used as mycoplasma-specific probes. For example,
GCTTAGTCGATACAGC constitued a mycoplasma-specific probe. Other
sequences were common to these species of mycoplasma as well as E.
1339547
coli. These latter sequences could be synthesized, labeled, and used as
probes specific for all prokaryotic species. Still other sequences were
unique to a single mycoplasma species and could be synthesized, labeled,
and used as mycoplasma species-specific probes.
The present invention thus provides a specific, sensitive, and
rapid method for the detection of mycoplasmas in contaminated cell cul-
tures or other biological environments. Alternatively, the present inven-
tion can be used to provide a ribosomal DNA probe derived from a domain
conserved in all prokaryotes. Such a probe would be ex-tremely useful in
the rapid and sensitive diagnosis of a bacteremiH or septicemia in man or
QnimQl~. The present invention may also be used to provide ribosomal DNA
probes that are specific for individual mycoplasma, acholeplasma, ures-
plasma, spiroplasma, and eubacterial species, respectively. These probes
will be of particular use for those organisms where little or no information
exists on their genetic make-up.
Although the present invention has been described in detail by
reference to certain specific examples of deoxyoligonucleotides and myco-
plasma species, it should be apparent to one skilled in the art that various
modifications are possible. It is intended that this invention include such
modifications and that the invention be limited only in accordance with the
claims appended hereto.
