Note : Les descriptions sont présentées dans la langue officielle dans laquelle elles ont été soumises.
l3~os~s
PROCESS FOR THE BIOCHEMICAL OXIDATION OF STEROIDS AND
GENETICALLY ENGINEERED CELLS TO BE USED THEREFOR
The invention relates to a biochemical oxidation
process for the preparation of pharmaceutically useful
steroids.
BACKGROUND OF THE INVENTION
11,Q,17a,21-Trihydroxy-4-pregnene-3,20-dione (hydro-
cortisone) is an important pharmaceutical steroid, used for
its pharmacological properties as a corticosteroid and as a
starting compound for the preparation of numerous useful
steroids, particularly other corticosteroids. Hydrocortisone
is produced in the adrenal cortex of vertebrates and was
originally obtained, in small amounts only, by a laborious
extraction from adrenal cortex tissue. Only after structure
elucidation new production routes were developed,
characterised by a combination of chemical synthesis steps
1340~1s
- 2 -
and microbiological conversions. Only because the starting
compounds which are employed such as sterols, bile acids and
sapogenins are abundant and cheap, the present processes
afford a less expensive product, but these still are rather
complicate. Several possibilities were envisaged to improve
the present processes, and also biochemical approaches have
been tried.
One attempt was to have a suited starting steroid
converted in an in vitro biochemical system using the
isolated adrenal cortex proteins which are known to be
responsible for the enzymatical conversion in vivo of
steroids to hydrocortisone. However, the difficult
isolation of the proteins and the high price of the
necessary cofactors, appeared to be prohibitive for an
economically attractive large scale process.
Another approach was to keep the catalysing proteins in
their natural environment and to have the adrenal cortex
cells produce in a cell culture the desired hydrocortisone.
But due to the low productivity of the cells in practice it
appeared to be impossible to make such a biochemical process
economically attractive.
The in vivo process in the adrenal cortex of mammals
and other vertebrates constitutes a biochemical pathway,
which starts with cholesterol and via various intermediate
compounds eventually affords hydrocortisone (see figure 1).
Eight proteins are directly involved in this pathway, five
of them being enzymes, among which four cytochrome P450
enzymes, and the other three being electron transferring
proteins.
The first step is the conversion of cholesterol to 3Q-
hydroxy-5-pregnen-20-one (pregnenolone). In this conversi-
on, a mono-oxygenase reaction, three proteins are involved:
side chain cleaving enzyme (p450SCC, a heme-Fe-containing
protein), adrenodoxin (ADX, a Fe2S2 containing protein) and
I3406~ G
- 3 -
adrenodoxinreductase (ADR, a FAD-containing protein).
Besides cholesterol as a substrate the reaction further
requires molecular oxygen and NADPH.
Subsequently pregnenolone is converted by dehydrogenation/
isomerisation to 4-pregnene-3,20-dione (progesterone).
This reaction, catalysed by the protein 3(3-hydroxysteroid
dehydrogenase/isomerase (3(3-HSD), requires pregnenolone and
NAD+.
To obtain hydrocortisone progesterone subsequently is
hydroxylated at three positions which conversions are
catalysed by mono-oxygenases. In the conversion of
progesterone into 17a-hydroxyprogesterone two proteins are
involved:
steroid 17a-hydroxylase (P45017a, a heme-Fe-containing
protein) and NADPH cytochrome P450reductase (RED, a FAD-
and FMN-containing protein). The reaction consumes
progesterone, molecular oxygen and NADPH.
For the conversion of 17a-hydroxyprogesterone into 17a,21-
dihydroxy-4-pregnene-3,20-dione (cortexolone), also two
proteins are needed: steroid-21-hydroxylase (P450C21, a
heme-Fe-containing protein) and the before-mentioned
protein RED. The reaction consumes 17a-hydroxyprogesterone,
molecular oxygen and NADPH.
In the conversion of cortexolone into hydrocortisone, three
proteins are involved: steroid 11/3-hydroxylase (P45011/3), a
heme-Fe-containing protein, and the above-mentioned proteins
ADX and ADR.
As described above cytochrome P450 proteins are
enzymes which are essential for the biochemical conversion
of cholesterol to hydrocortisone. These enzymes belong to a
larger group of cytochrome P450 proteins (or shortly P450
proteins). They have been encountered in prokaryotes
(various bacteria) and eukaryotes (yeasts, moulds, plants
and animals). In mammals high levels of P450 proteins are
found in the adrenal cortex, ovary, testes and liver. Many
- 4 -
of these proteins have been purified and are well
characterized now. Their specific activity has been
determined. Recently a number of reviews on this subject
have been published, such as K. Ruckpaul and H. Rein (eds),
"Cytochrome P450" and P.R. Ortiz de Montellano (ed.)
"Cytochrome P450' structure, mechanism and biochemistry".
Cytochrome P450 proteins are characterized by their specific
absorbance maximum at 450 nm after reduction with carbon
monoxide. In prokaryotic organisms the P450 proteins are
either membrane bound or cytoplasmatic. As far as the
bacterial P450 proteins have been studied in detail (e. g.
P450meg and P450cam) it has been shown that a ferredoxin and
a ferredoxinreductase are involved in the hydroxylating
activity. For eukaryotic organisms, two types of P450
proteins, I and II have been described. Their two
differences reside in:
1. subcellular localisation, type I is localized in the
microsomal fraction and type II is localized in the inner
membrane of mitochondria:
2. the way the electrons are transferred to the P450
protein. Type I is reduced by NADPH via a P450reductase,
whereas type II is reduced by NADPH via a ferredoxinre-
ductase (e. g. adrenodoxinreductase) and a ferredoxin (e. g.
adrenodoxin).
According to EP-A-0281245*cytochrome P450 enzymes can
be prepared from Streptomyces species and used for the
hydroxylation of chemical compounds.
The enzymes are used in isolated form, which is a rather
tedious and expensive procedure.
JP-A-62236485 *(Derwent 87-331234) teaches that it is
possible to introduce into Saccharom~ces cerevisiae the
genes of liver cytochrome P450 enzymes and to express them
affording enzymes which may be used for their oxidation
activity.
However, in the above references there is no
* published on September 7, 1988
** published on October 16, 1987
1~~~G1~
- 5 -
indication to the use of cytochrome P450-enzymes for the
preparation of steroid compounds.
SUMMARY OF THE INVENTION
The invention provides a multiplicity of expression
cassettes for production of proteins necessary in the con-
struction of a multigenic system for the one-step conversion
of inexpensive steroid starting materials to more rare and
expensive end products, wherein such conversion is carried out
in native systems through a multiplicity of enzyme-catalyzed
and cofactor-mediated conversions, such as the production of
hydrocortisone from cholesterol. The expression cassettes of
the invention are useful in the ultimate production of
multigenic systems for conducting these multi-step
conversions.
Accordingly, in one aspect, the invention is directed to
an expression cassette effective in a recombinant host cell in
expressing a heterologous coding DPdA sequence, wherein said
coding sequence encodes an enzyme which is able, alone or in
cooperation with additional protein, to catalyze an oxidation
step in the biological pathway for the conversion of choles-
terol to hydrocortisone. The expression cassettes of the
invention, therefore, include those sequences capable of
producing, in a recombinant host, the following proteins:
side-chain cleaving enzyme (P450SCC); adrenodoxin (ADX);
adrenodoxin reductase (ADR); 3s-hydroxysteroid dehydro-
genase/isomerase (3s-HSD); steroid 17a-hydroxylase (P45017a);
NADPH cytochrome P450 reductase (RED); steroid-21-hydroxylase
(P450C21); and steroid lls-hydroxylase (P450118).
In other aspects, the invention is directed to recombi-
1340~1~
- 6 -
nant host cells transformed with the expression cassettes of
the invention, to methods to produce the above enzymes and to
use these enzymes for oxidation, to processes to use said
host cells for specific oxidations in a culture broth and to
pharmaceutical compositions containing compounds prepared by
said processes.
BRIEF DESCRIPTION OF THE FIGURES
Abbreviations used in all figures: R1, EcoRI; H,
HindIII; Sc, ScaI; P, PstI; K, KpnI; St. StuI; Sp, SphI; X,
XbaI; N, NdeI; S, SmaI; Ss, SstI; Rv, EcoRV; SI, SacI; B,
BamHI; SII, SacII; Sal, SalI; Xh, XhoI; Pv, PvuII; Bg, BglII;
and M, MluI.
Figure 1 shows a schematic overview of the proteins
involved in the succeeding steps in the conversion of
cholesterol in hydrocortisone as occurring in the adrenal
cortex of mammals.
Figure 2 shows the construction of plasmid pGBSCC-1.
The P450SCC-sequences are indicated in a box ().
Figure 3 shows the insertion of a synthetically derived
PstI/HindIII fragment containing the 5'-P450SCC-sequences
into the plasmid pTZl8R to obtain the plasmid pTZ synlead.
Figure 4 shows the construction of a full-length
P450SCCcDNA of synthetically (~::~') and by cDNA cloning-
( ) derived P450SCC-sequences into pTZl8R to obtain
pGBSCC-2.
Figure 5 shows the complete nucleotide sequence of
plasmid pBHA-1.
l3~osls
_ 7 _
Figure 6 is a schematic representation of the
construction of pGBSCC-3. P450SCCcDNA sequences from plasmid
pGBSCC-2 were introduced into the Bacillus/E.coli shuttle
plasmid pBHA-1. Filled in boxes are as indicated in the
legend of figure 4.
Figure 7 shows the introduction of a NdeI restriction
site in combination with an ATG startcodon before the
P450SCC-maturation site in pGBSCC-3 to obtain pGBSCC-4.
Figure 8 shows a physical map of pGBSCC-5 which is
obtained by removal of E.coli sequences from the plasmid
pGBSCC-4.
Figure 9 shows a Western-blot probed with anti-bodies
against P450SCC, demonstrating the P450SCC expression of
plasmid pGBSCC-5 introduced in B.subtilis (lane c) and
B.licheniformis (lane f). Control extracts from B.subtilis
and B.licheniformis are shown in lane a and d, resp..
For comparison also purified adrenal cortex P450SCC (30 ng)
was added to these control extracts (lane b and e, resp.).
Figure 10 is a schematic representation of the
construction of pGBSCC-17. The coding P450SCC-DNA sequences
from plasmid pGBSCC-4 were introduced into the E.coli
expression vector pTZI8RN. The P450SCC-sequences are
indicated in a box
Figure 11 shows the P450SCC expression of pGBSCC-17
in E.coli JM101.
(a) SDS/PAGE and Coomassie brilliant blue staining of the
cellular protein fractions (201) prepared from the E.coli
control strain (lane 3) and E.coli transformants SCC-301
and 302 (lanes 1 and 2, resp.). 400 ng purified bovine
134061fi
8
P450SCC (lane 4) is shown for comparison.
(b) Western-blot analysis probed with antibodies against
P450SCC of cellular protein fractions (5~,1) prepared from
the control strain E.coli JM101 (lane 2) and from the
E.coli transformants SCC-301 (lane 3) and SCC-302 (lane 4).
100 ng purified bovine P450SCC (lane 1) is shown for
comparison.
Figure 12 shows the construction of plasmid
pUCG418.
Figure 13 shows the construction of the yeast
expression vector pGB950 by insertion of the promoter and
terminator with multiple cloning sites of lactase in
pUCG418. To derive pGBSCC-6 a synthetic SalI/XhoI fragment
containing an ATG startcodon and the codons for the first 8
amino acids of P450SCC is inserted in pGB950.
Figure 14 is a schematic presentation showing the
construction of the yeast P450SCC-expression cassette
pGBSCC-7.
Figure 15 shows a Western-blot probed with
antibodies specific for the protein P450SCC.
Blot A contains extracts derived from Saccharomyces
cerevisiae 273-lOB transformed with pGBSCC-10 (lane 1);
from S.cerevisiae 273-lOB as a control (lane 2); from
Kluyverom~ces lactis CBS 2360 transformed with pGBSCC-7
(lane 3) and from K.lactis CBS 2360 as a control (lane 4).
Blot B contains extracts derived from K.lactis CBS 2360 as
a control (lane 1) and K.lactis CBS 2360 transformed with
pGBSCC-15 (lane 2), with pGBSCC-12 (lane 3) or with pGBSCC-
7 ( 1 ane 4 ) .
1340616
8a
Blot C contains extracts derived from S.cerevisiae 273-10B
as a control (lane 1), transformed with pGBSCC-16 (lane 2)
or with pGBSCC-13 (lane 3).
1340~~~
_ g -
Figure 16 is a schematic presentation of the
construction of the yeast expression vector pGBSCC-9
containing the isocytochrome CI (cyc-1) promoter from
S.cerevisiae.
Figure 17 shows a construction diagram of the
P450SCCcDNA containing expression vector pGBSCC-10 for
S.cerevisiae.
Figure 18 shows the construction of the P450SCC
expression vector pGBSCC-12 in which a synthetically derived
DNA-fragment encoding the pre-P450SCC sequence (~) is
inserted 5' for the coding sequence of mature P450SCC.
Figure 19 shows the construction of the pGBSCC-13.
This P450SCC expression cassette for S.cerevisiae contains
the pre-P450SCCcDNA sequence positioned 3' of the cyc-1
promoter of S.cerevisiae.
Figure 20 shows a schematic representation of the
construction of the plasmids pGBSCC-14 and pGBSCC-15. The
latter contains the P450SCC coding sequence in frame with
the cytochrome oxidase VI pre-sequence
Figure 21 shows the construction of the plasmid
pGBSCC-16. In this plasmid the cytochrome oxidase VI pre
sequence ~,of S.cerevisiae fused to the coding P450SCC
sequence is positioned 3' of the cyc-1 promoter.
Figure 22 shows the physical maps of the plasmids
pGBl7a-1 (A) and pGBl7a-2 (B) containing the 3' 1,4 kb
fragment and the 5' 345 by fragment ~ of P45017acDNA,
resp.. In pGBl7a-3 (C) containing the full length
P45017acDNA sequence, the position of the ATG startcodon is
1340616
- 10 -
indicated.
Figure 23 shows the mutation of pGBl7a-3 by in vitro
mutagenesis. The obtained plasmid pGBl7a-4 contains a SalI
restriction site followed by optimal yeast translation
signals just upstream the ATG initiation codon.
Figure 24 is a schematic view of the construction of
the yeast P45017a expression cassette pGBl7a-5.
Figure 25 shows the mutation of pGBl7a-3 by in vitro
mutagenesis. The obtained plasmid pGBl7a-6 contains an NdeI
restriction site at the ATG-initiation codon.
Figure 26 is a schematic representation of the
construction of pGBl7a-7. P45017acDNA sequences from plasmid
pGBl7a-6 were introduced into the Bacillus/E.coli shuttle
plasmid pBHA-1.
Figure 27 shows a physical map of pGBl7a-8 which is
obtained by removal of E.coli sequences from the plasmid
pGBl7a-7.
Figure 28 shows physical maps of pGBC21-1 and 2,
containing an 1,53 Kb 3~-P450C21cDNA and a 540 by
5~ P450C21cDNA EcoRI fragment, respectively, in the EcoRI-
site of the cloning vector pTZl8R.
Figure 29 shows the in vitro mutagenesis by the
polymerase chain reaction (PCR) of pGBC21-2 to introduce
EcoRV and NdeI restriction sites upstream the P450C21 ATG-
initiation codon, followed by molecular cloning into the
cloning vector pSP73 to derive pGBC21-3.
Figure 30 is a schematic view of the construction of
i~~as~s
- 11 -
pGBC21-4, containing the full-length P450C21cDNA sequence.
Figure 31 is a schematic representation of the
construction of pGBC21-5. The p450C21cDNA sequence from
plasmid pGBC21-4 was introduced into the Bacillus/E.coli
shuttle plasmid pBHA-1.
Figure 32 shows a physical map of pGBC21-6 which is
obtained by removal of E.coli sequences from the plasmid
pGBC21-5.
Figure 33 shows the mutation of pGBC21-2 by in vitro
mutagenesis. The obtained plasmid pGBC21-7 contains a SalI
restriction site followed by optimal yeast translation
signals just upstream the ATG initiation codon.
Figure 34 represents the construction of pGBC21-8,
containing a full-length P45oC21cDNA with modified flanking
restriction sites suitable for cloning into the yeast
expression vector.
Figure 35 is a schematic presentation showing the
construction of the yeast p450C21-expression cassette
pGBC21-9.
Figure 36 shows the in vitro mutagenesis by the
polymerase chain reaction of pGBllp-1 to introduce
appropriate flanking restriction sites and an ATG
initiation codon to the full-length P45011,QcDNA sequence,
followed by molecular cloning into the Bacillus/E.coli
shuttle vector pBHA-1 to derive the plasmid pGBllR-2.
Figure 37 shows the in vitro mutagenesis by the
polymerase chain reaction of pGBllQ-1 to introduce
appropriate flanking restriction sites and an ATG imitation
codon to the full-length P45011(3cDNA sequence, followed by
1340616
- 12 -
molecular cloning into the yeast expression vector pGB950 to
derive the plasmid pGBllQ-4.
Figure 38 is a schematic view of the molecular
cloning of the ADXcDNA sequence from a bovine adrenal cortex
polyAfRNA/cDNA mixture by the polymerase chain reaction
method. The cDNA sequence encoding the mature ADX protein
was inserted into the appropriate sites of the yeast
expression vector pGB950 to obtain the plasmid pGBADX-1.
Figure 39 shows a Western-blot probed with anti-
bodies~against ADX, demonstrating the ADX expression of
plasmid pGBADX-1 in K.lactis CBS 2360 transformants ADX-101
and 102 (lanes 4 and 5, resp.). Extract of control strain
K.lactis CBS 2360 is shown in lane 3. For comparison also
purified adrenal cortex ADX (100 ng) is supplied to the gel
in lane 1.
Figure 40 shows the in vitro mutagenesis by the
polymerase chain reaction of pGBADR-1 to introduce
appropriate flanking restriction sites and an ATG-
initation codon to the full-length ADRcDNA sequence,
followed by molecular cloning into the yeast expression
vector pGB950 to derive pGBADR-2.
DETAILS OF THE INVENTION
The invention comprises the preparation and culturing
of cells which are suited to be employed in large scale
biochemical production reactors and the use of these cells
for the oxidation of compounds and particularly for the
production of steroids, shown in figure 1. Each of the
depicted reactions can be carried out separately. Also
interchange of steps in a multi-step reaction is included in
- 13 - 1340fi16
the invention. Micro-organisms are preferred hosts but
other cells may be used as well, such as cells of plants or
animals, optionally applied in a cell culture or in the
tissue of living transgenic plants or animals.
The cells according to the invention are obtained by the
genetical transformation of suitable receptor cells,
preferably cells of suited micro-organisms, with vectors
containing DNA sequences encoding the proteins involved in
the conversion of cholesterol to hydrocortisone, comprising
side-chain cleaving enzyme (P45pSCC), adrenodoxin (ADX),
adrenodoxin reductase (ADR), 3Q-hydroxy-steroid dehydro-
genase/isomerase (3,Q-HSD), steroid-17a-hydroxylase
(P45017a), NADPH cytochrome P450 reductase (RED), steroid-
21-hydroxylase (P450C21) and steroid-11Q-hydroxylase
(P45011Q). Some host cells may already produce of their own
one or more of the necessary proteins at a sufficient level
and therefore have to be transformed with the supplementary
DNA sequences only. Such possibly own proteins are
ferredoxin, ferredoxin reductase, P450 reduetase, and 3/3-
hydroxy-steroid dehydrogenase/isomerase.
For retrieval of the sequences which encode proteins
which are involved in the conversion of cholesterol to
hydrocortisone suitable DNA sources have been selected.
An appropriate source for the retrieval of DNA encoding all
proteins involved in the conversion of cholesterol to
hydrocortisone is the adrenal cortex tissue of vertebrates
e.g. bovine adrenal cortex tissue. Also from various micro-
organisms the relevant DNA can be retrieved, e.g. from
Pseudomonas testosteroni, Streptomyces griseocarneus or
Brevibacterium sterolicum for DNA encoding the 3~3-hydroxy-
steroid dehydrogenase/isomerase and from Curvularia lunata
or Cunninghamella blakesleeana for DNA encoding proteins
involved in the 11j3-hydroxylation of cortexolone. The DNA-
sequences coding for the proteins bovine P450SCC, bovine
P45011~3 or a microbial equivalent protein, bovine adreno-
doxin, bovine adrenodoxin reductase, 3(~-hydroxy-steroid
l3~osis
- 14 -
dehydrogenase/isomerase of bovine or microbial origin,
bovine P45017a, bovine P450C21 and NADPH cytochrome P450
reductase of bovine or microbial origin, were isolated
according to the following steps:
1. Eukaryotic sequences ycDNA's1
a. Total RNA was prepared from appropriate tissue
b. PolyA+ containing RNA was transcribed into double
stranded cDNA and ligated into bacteriophage vectors
c. The obtained cDNA library was screened with 32p-
labeled oligomers specific for the desired cDNA or by
screening an isopropyl-Q-D-thiogalactopyranoside
(IPTG)-induced lambda-gtll cDNA library using a
specific (125I_labeled) antibody
d. cDNA inserts of positive plaque forming units (pfu's)
were inserted into appropriate vectors to verify:
- the entire length of the cDNA by nucleotide
sequencing
2. Prokaryotic genes
a. Genomic DNA was prepared from an appropriate micro-
organism
b. To obtain a DNA library DNA fragments were cloned
into appropriate vectors and transformed to an
appropriate E.coli host
c. The DNA library was screened with 32P-labeled
oligomers specific for the gene of interest or by
screening an IPTG-induced lambda-gtll DNA library
using a specific (1251-labeled) antibody
d. Plasmids of positive colonies were isolated and
inserted DNA fragments subcloned into appropriate
vectors to verify:
- the entire length of the gene
Note: According to an improved method the particular cDNA
- 15 -
(eukaryotic sequences) or gene (prokaryotic sequences) was
amplified using two specific oligomers by the method known
as the polymerase chain reaction (PCR) (Saiki et al,
Science, 239, 487-491, 1988). Subsequently the amplified
cDNA or DNA was inserted into the appropriate vectors.
According to one aspect of the invention suitable
expression cassettes are provided in which the heterologous
DNA isolated according to the previous procedure, is placed
between suitable control sequences for transcription and
translation, which enables the DNA to be expressed in the
cellular environment of a suitable host, affording the
desired protein or proteins. Optionally, the initiation con-
trol sequences are followed by a secretion signal sequence.
Suitable control sequences have to be introduced
together with the structural DNA by said expression
cassettes. Expression is made possible by transformation of
a suitable host cell with a vector containing control
sequences which are compatible with the relevant host and
are in operable linkage to the coding sequences of which
expression is desired.
Alternatively, suitable control sequences present in the
host genome are employed. Expression is made possible by
transformation of a suitable host cell with a vector
containing coding sequences of the desired protein flanked
by host sequences enabling homologous recombination with the
host genome in such a manner that host control sequences
properly control the expression of the introduced DNA.
As is generally understood, the term control
sequences comprises all DNA segments which are necessary
for the proper regulation of the expression of the coding
sequence to which they are operably linked, such as
1~4~516
- 16 -
operators, enhancers and, particularly, promoters and
sequences which control the translation.
The promoter which may or may not be controllable by
regulating its environment. Suitable promoters for
prokaryotes include, for example, the trp promoter (induc-
ible by tryptophan deprivation), the lac promoter (induc-
ible with the galactose analog IPTG), the ~~-lactamase
promoter, and the phage derived PL promoter (inducible by
temperature variation). Additionally, especially for
expression in Bacillus, useful promoters include those for
alpha-amylase, protease, Spo2, spac and X105 and synthetic
promoter sequences. A preferred promoter is the one depicted
in figure 5 and denoted with "HpaII". Suitable promoters for
expression in yeast include the 3-phospho-glycerate kinase
promoter and those for other glycolytic enzymes, as well as
promoters for alcohol dehydrogenase and yeast phosphatase.
Also suited are the promoters for transcription elongation
factor (TEF) and lactase. Mammalian expression systems
generally employ promoters derived from viruses such as the
adenovirus promoters and the SV40 promoter but they also
include regulatable promoters such as the metallothionein
promoter, which is controlled by heavy metals or gluco-
corticoid concentration. Presently viral-based insect cell
expression systems are also suited, as well as expression
systems based on plant cell promoters such as the nopaline
synthetase promoters.
Translation control sequences include a ribosome
binding site (RBS) in prokaryotic systems, whereas in
eukaryotic systems translation may be controlled by a
nucleotide sequence containing an initiation codon such as
AUG.
In addition to the necessary promoter and the
translation control sequences, a variety of other control
sequences, including those regulating termination (for
example, resulting in polyadenylation sequences in
eukaryotic systems), may be used in controlling
~34os~~
- 17 -
expression. Some systems contain enhancer elements which are
desirable but mostly not obligatory in effecting
expression.
The invention also discloses expression cassettes
containing still another heterologous coding sequence
encoding an enzyme which catalyzes, alone or in cooperation
with one or more additional proteins, another step of the
pathway of figure 1.
A group of vectors denoted with pGBSCC-n, where "n" is
any integer from 1 to 17, is especially developed for the
DNA encoding the P450SCC enzyme.
Another group of vectors denoted with pGBl7a-n, where
"n" is any integer from 1 to 5, is especially developed for
the DNA encoding the P45017a enzyme.
A further group of vectors denoted with pGBC21-n,
where "n" is any integer from 1 to 9, is especially
developed for the DNA encoding the P450C21 enzyme.
Still another group of vectors denoted with pGBl1(3-n,
where "n" is any integer from 1 to 4, is especially
developed for the DNA encoding the P45011~3 enzyme.
According to a further aspect of the invention
suitable host cells have been selected which accept the
vectors of the invention and allow the introduced DNA to be
expressed. When culturing the transformed host cells the
proteins involved in the conversion of cholesterol to
hydrocortisone appear in the cell contents. The presence of
the desired DNA can be proved by DNA hybridizing procedures,
their transcription by RNA hybridization, their expression
by immunological assays and their activity by assessing the
presence of oxidized products after incubation with the
starting compound in vitro or in vivo.
Transformed microorganisms are preferred hosts,
1340616
- 18 -
particularly bacteria (more preferably Escherichia coli and
Bacillus and Streptomyces species) and yeasts (such as
Saccharomyces and Kluyveromyces). Other suitable host
organisms are found among plants and animals, comprising
insects, of which the isolated cells are used in a cell
culture, such as COS cells, C127 cells, CHO cells, and
Spodoptera frugiperda (Sfg) cells. Alternatively a
transgenic plant or animal is used.
A particular type of recombinant host cells are the
ones in which either two or more expression cassettes
according to the invention have been introduced or which
have been transformed by an expression cassette coding for
at least two heterologous proteins, enabling the cell to
produce at least two proteins involved in the pathway of
figure 1.
A major feature of the invention is that the prepared
novel cells are not only able to produce the proteins
involved in the oxidative conversion of steroids resulting
eventually into hydrocortisone, but also to use these
proteins on the spot in the desired oxidative conversion of
the corresponding substrate compound added to the culture
liquid. Steroids are preferred substrates. The cells
transformed with the heterologous DNA are especially suited
to be cultured with the steroids mentioned in figure 1,
included other sterols such as s-sitosterol. As a result
oxidized steroids are obtained.
Depending on the presence in the host cell of a
multiplicity of heterologous DNA encoding proteins involved
in the pathway of figure 1, several biochemical conversions
result comprising the side-chain cleaving of a sterol and/or
oxidative modifications on C11, C17, C3 and C21. Therefore
the expression cassettes according to the invention are
useful in constructing a multigenic system which can effect
successive intra-cellular transformations of the multiple
steps in the sequence as depicted in figure 1. It may be
necessary to introduce into the desired host expression
i340sis
_ lg _
cassettes, which encode in their entirety the required
proteins. In some instances, one or more of the proteins
involved in the pathway may already be present in the host
as a natural protein exerting the same activity. For
example, ferredoxin, ferredoxin reductase and Pq50 reductase
may be already present in the host. Under those
circumstances, only the remaining enzymes must be provided
by recombinant transformation.
As an alternative to biochemical conversions in vivo
the proteins involved in the conversion of cholesterol to
hydrocortisone are collected, purified as far as necessary,
and used for the in vitro conversion of steroids in a cell
free system, e.g. immobilized on a column. Alternatively the
more or less purified mixture containing one or more
enzymes of the pathway is used as such for steroid
conversion. One exemplified host contains DNA encoding two
heterologous proteins viz. the. enzyme P450SCC and the
protein ADX necessary for the production of pregnenolone. In
comparison with a host with only Pq50SCC DNA the yield of
pregnenolone in a cell-free extract after adding ADR, NADPH
and cholesterol is considerably improved.
The present invention provides expression cassettes
necessary for the construction of a one-step production
process for several useful steroids. Starting from cheap
and abundantly available starting compounds, it is
especially suited for the production of hydrocortisone and
intermediate compounds. The invention renders obsolete
traditional expensive chemical reactions. Intermediate
compounds need not be isolated. Apart from the novel host
cells the processes itself used for culturing these cells
on behalf of steroid conversions are analogous to bio-
technological procedures well known in the art.
The invention is further illustrated by the following
examples which should, however, not be construed as a
limitation of the invention.
. _....~ ...._~.~.~ ~.,...~.~~,_,.m ._ . ~.....M.....wn....-A_.~ ... ~.._..w.
_.._....._ _._ ..
134016
- 20 -
Example 1
Molecular cloning of a full-length cDNA encoding the bovine
cytochrome P450 side chain cleavage enzyme (P450SCC)
General cloning techniques as well as DNA and RNA
analyses have been used as described in the handbook of T.
Maniatis et al., Molecular Cloning, Cold Spring Harbor
Laboratory, 1982. Unless described elsewhere all DNA
modifying enzymes, molecular cloning vehicles and E.coli
strains were obtained from commercial suppliers and used
according to the manufacturer's instructions. Materials and
apparatus for DNA and RNA separation and purification were
used according to instructions of the suppliers.
Bovine adrenal cortex tissue was prepared from freshly
obtained bovine kidneys, quickly frozen in liquid nitrogen
and stored at -80°C.
From frozen bovine adrenal cortex total cellular RNA
was prepared as described by Auffrey and Rougeon (Eur. J.
Biochem., 107, 303-314, 1980). Adrenal poly A+ RNA was
obtained by heating the total RNA sample at 65°C before
polyA selection on oligo(dT) chromatography.
DNA's complementary to polyA+ RNA from bovine adrenal
cortex were synthesized as follows: 10~g of polyA+ RNA,
treated with methylmercuric hydroxide was neutralized with
beta-mercaptoethanol. This mixture was adjusted to 50 mM
Tris/HC1 (pH 8.3 at 42°C), 40 mM KC1, 6 mM MgCl2, 10 mM
DTT, 3000 U RNasin/ml, 4 mM Na4P207, 50~,g actinomycine
D/ml, 0.1 mg oligo(dTl2-18)/ml, 0.5 mM dGTP, 0.5 mM dATP,
0.5 mM dTTP, 0.25 mM dCTP and 400 ~Ci alpha 32P-dCTP/ml,
all in a final volume of 100 ~1. The mixture was put on ice
for 10 minutes, heated for 2 minutes at 42°C and the
synthesis was started by addition of 150 U AMV reverse
transcriptase (Anglian Biotechnology Ltd.); incubation was
performed for 1 hr at 42°C.
- 21 -
Second strand synthesis was performed by adding DNA
polymerase and RNase H according to Gubler and Hoffman
(Gene, 25, 263-269, 1983). After treatment of the ds DNA
with T4 DNA polymerase (BRL) to obtain blund ends, decameric
EcoRI linkers (Biolabs Inc.) were ligated to the ds DNA
fragments. After digestion with EcoRI (Boehringer), double
stranded cDNA fragment were separated from the abundant
EcoRI-linkers by Biogel-'A15 m (Bio-Rad) chromatography.
Approximately 200 ng EcoRI-linker containing double
stranded cDNA was ligated with 10~,g of EcoRI digested and
calf intestine-phosphatase (Boehringer) treated with
lambda-gtll vector DNA (Promega) by T4-DNA ligase
(Boehringer) as described by Huynh et al. (In: "DNA cloning
techniques: A practical approach", pp. 49-78, Oxford IRL-
press, 1985). Phages, obtained after in vitro packaging of
the ligation mixture were used to infect the E.coli Y1090
host (Promega).
From this cDNA library approximately 106 plaque
forming units (pfu's) were screened with a 32P-end labeled
synthetic oligomer SCC-1 (5'-GGC TGA CGA AGT CCT GAG ACA
CTG GAT TCA GCA CTGG-3'), specific for bovine P450SCC DNA
sequences as described by Morohashi et al. (Proc. Natl.
Acad. Sci. USA, 81, 4647-4651, 1984). Six hybridizing pfu's
were obtained and further purified by two additional rounds
of infection, plating and hybridization. The P450SCCcDNA
EcoRI inserts were subcloned into the EcoRI site of pTZl8R
(Pharmacia). Clone pGBSCC-1 (figure 2), containing the
largest EcoRI insert (1.4 kb), derived from clone lambda-
gtll SCC-54 was further analyzed by restriction enzyme
mapping and sequencing.
The sequence data revealed that the pGBSCC-1 EcoRI
insert was identical with the nucleotide sequence of SCCcDNA
between positions 251 and 1824 on the P450SCCcDNA map as
described by Morohashi et al.
... _
1340G1~
22
The remaining 5'-P450SCCcDNA nucleotides were
synthetically derived by cloning a 177 by Pst/HindIII
fragment into the appropriate sites of pTZl8R, resulting in
the pTZ/synlead as shown in figure 3, containing besides
the nucleotides coding for the mature P450SCC protein from
position 118 to 273 as published by Morohashi et al.,
additional restrictive sites for ScaI, AvrII and StuI
without affecting the predicted amino acid sequence of the
P450SCC protein.
The full-length P450SCCcDNA was constructed by
molecular cloning in E.coli JM101 (ATCC 33876) of a
litigation mixture containing the 1372 by HindIII/KpnI
pGBSCC-1 fragment, the 177 by Pst/HindIII pTZ/synlead
fragment and pTZl9R DNA digested with PstI and KpnI.
The resulting plasmid, pGBSCC-2, containing all
nucleotide sequences encoding the mature bovine P450 side
chain cleavage protein is shown in figure 4.
Example 2
Construction, transformation and expression of P450SCC in
the bacterial host Bacillus subtilis
To derive expression of cytochrome P450SCC in a
Bacillus host, P450SCCcDNA sequences were transferred to an
E.coli/Bacillus shuttle vector pBHA-1.
Figure 5 shows the nucleotide sequence of the
shuttle plasmid pBHA-1. The plasmid consists of positions
11-105 and 121-215: bacteriophage FD terminator (double);
positions 221-307: a part of plasmid pBR322 (viz. positions
134016
22a
2069-2153); positions 313-768: bacteriophage F1, origin of
replication (viz. positions 5482-5943); positions 772-2571:
part of plasmid pBR322, viz. the origin of replication and
the (3-lactamase gene; positions 2572-2685: transposon
TN903, complete genome; positions 2719-2772: tryptophan
terminator
,.....
1340~1G
- 23 -
(double); positions 2773-3729: transposon Tn9, the
chloramphenicolacetyltransferase gene. The nucleotides at
position 3005 (A), 3038 (C), 3302 (A) and 3409 (A) differ
from the wild type cat coding sequence. These mutations
were introduced so as to eliminate the NcoI, Ball, EcoRI and
PvuII sites: positions 3730-3804: multiple cloning site;
positions 3807-7264: part of plasmid pUB110 containing the
Bacillus "HpaII" promoter, the replication function and
kanamycin resistance gene (EcoRI-PvuII fragment) (McKenzie
et al., Plasmid 15, 93-103, 1986 and McKenzie et al., Plasmid
17, 83-85, 1987); positions 7267-7331: multiple cloning
site. The fragments were put together by known cloning
techniques, e.g. filling in of sticky ends with Klenow,
adapter cloning, etc. All data were derived from GenbankR,
National Nucleic Acid Sequence Data Bank, NIH, USA.
pGBSCC-3 was derived by molecular cloning in E.coli
JM101 of the KpnI/SphI P450SCCcDNA insert of pGBSCC-2
(described in Example 1) into the appropriate sites in pBHA-1
as indicated in figure 6.
By molecular cloning in E.coli JM101 the methionine
initiation codon was introduced by exchanging the StuI/SphI
fragment in pGBSCC-3 by a synthetically derived SphI/StuI
fragment.
SPH 1 STU 1
CATATGATCAGTACTAAGACCCCTAGG
GTACGTATACTAGTCATGATTCTGGGGATCC
NDE T
containing an NdeI site at the ATG initiation codon.
The obtained plasmid pGBSCC-4 is shown in figure 7. The
"HpaII" Bacillus promoter was introduced upstream
P450SCCcDNA sequences by digestion pGBSCC-4 with the
restriction enzyme NdeI, separation of the E.coli part of
the shuttle plasmid by agarose gel electrophoresis and
- 24 - I340GI6
subsequent religation and transformation into Bacillus
subtilis 1A40 (BGSC 1A40) competent cells. Neomycin
resistant colonies were analysed and the plasmid pGBSCC-5
(figure 8) was obtained. Expression of bovine P450SCC was
studied by preparing a cellular protein fraction of an
overnight culture at 37°C in TSB medium (Gibco) containing
10~,g/ml neomycin. Cells of 100 ~1 culture, containing
approximately 5.106 cells, were harvested by centrifugation
and resuspended in 10 mM Tris/HC1 pH 7.5. Lysis was
performed by adding lysozym (1 mg/ml) and incubation during
minutes at 37°C. After treatment with 0.2 mg DNase/ml
during 5 minutes at 37°C the mixture was adjusted to lx SB
buffer, as described by Laemmli, Nature 227, 680-685, 1970,
in a final volume of 200 ~,1. After heating for 5 minutes at
15 100°C 15 ~,1 of the mixture was subjected to a 7.5% of
SDS/polyacrylamide gel electrophoresis. As shown in figure 9
(lane c) a 53 kDa band could be detected after
immunoblotting of the gel probed with P450SCC specific
antibodies.
Specific bovine P450SCC antibodies were obtained by
immunisation of rabbits with purified P450SCC protein
isolated from bovine adrenal cortex tissue.
Example 3
Expression of P450SCC in the bacterial host Bacillus
licheniformis
Expression of bovine P450SCC in B.licheniformis was
performed by transformation plasmid pGBSCC-5 into the
appropriate host strain B.licheniformis T5(CBS 470.83). A
cellular protein fraction prepared as described in example
2, from an overnight culture at 37°C in Trypton Soy Broth
(TSB) medium (Oxoid) containing 10~g/ml neomycin, was
analyzed by SDS/PAGE and Western-blotting. As shown in
- 25 -
-~34os1 ~
figure 9 (lane f) a 53 kDa sized protein band was
visualised after incubation of the nitrocellulose filter
with antibodies specific for bovine P45pSCC.
One transformant, SCC-201; was further analyzed for in vivo
activity of P450SCC (see example 11).
Example 4
Expression of P450SCC in the bacterial host Escherichia
coli
(a) Construction of the expression cassette
To derive a suitable expression vector in the host
E.coli for bovine P450SCC, pTZl8R was mutated by site-
directed mutagenesis as described by Zoller and Smith
(Methods in Enzymology 100, 468-500, 1983); Zoller and Smith
(Methods in Enzymology 154, 329-350, 1987) and Kramer and
Fritz (Methods in Enzymology 154, 350-367, 1987). Plasmids
and strains for in vitro mutagenesis experiments were
obtained from Pharmacia Inc.
A synthetic derived oligomer with the sequence:
5'-CAG GAA ACA CAT ATG ACC ATG ATT-3'
t i
NdeI
was used to create an NdeI restriction site at the ATG
initiation codon of the lac Z gene in pTZl8R.
The resulting plasmid pTZI8RN was digested with NdeI
and KpnI and the NdeI KpnI DNA fragment of pGBSCC-4,
containing the full-length SCCcDNA, was inserted by
molecular cloning as indicated in figure 10.
The transcription of P450SCCcDNA sequences in the
derived plasmid pGBSCC-17 will be driven by the E.coli lac-
promotor.
1~40fi16
- 26 -
(b) Expression of P450SCC in the host E.coli JM101
pGBSCC-17 was introduced into E.coli JM101 competent
cells by selecting ampicillin resistant colonies.
Expression of cytochrome P450SCC was studied by preparing a
cellular protein fraction (described in example 2) of
transformants SCC-301 and 302 from an overnight culture at
37°C in 2xTY medium (containing per liter of de-ionized
water: Bacto tryptone (Difco), 16 g; yeast extract (Difco),
10 g and NaCl, 5 g) containing 50 ~,g/ml ampicillin.
Protein fractions were analyzed by SDS/PAGE stained
with Coomassie brilliant blue (figure 11A) or by Western-
blot and probed with antibodies specific for bovine P450SCC
(figure 11B). Both analyses show a protein of the expected
length (figure 11A, lanes 1 and 2 and in figure 11B, lanes 3
and 4) for the transformants SCC-301 and SCC-302, resp.,
which is absent in the E.coli JM101 control strain (figure
11A, lane 3 and figure 11B, lane 2).
Example 5
Construction, transformation and expression of P450SCC in
the yeast Kluyveromyces lactis
(a) Introduction of the geneticin resistance marker in pUCl9
A DNA fragment comprising the Tn5 gene (Reiss et al,
EMBO J., 3, 3317-3322, 1984) conferring resistance to
geneticin under the direction of the alcohol dehydrogenase I
(ADHI) promoter from S.cerevisiae, similar to that described
by Bennetzen and Hall (J. Biol. Chem., 257, 3018-3025, 1982)
was inserted into SmaI site of pUCl9 (Yanisch-Perron et al.,
Gene, 33, 103-119, 1985). The obtained plasmid pUCG418, is
shown in figure 12.
~34~6~.6
- 27 -
E.coli containing pUCG418 was deposited at Centraal
Bureau vvor Schimmelcultures under CBS 872.87.
(b) Construction of the expression cassette
A vector was constructed, comprising pUCG418 (for
description see example 5(a)) cut with XbaI and HindIII, the
XbaI-Sa I fragment from pGB901 containing the lactase
promoter (Kluyveromyves as a host strain) and synthetic DNA
comprising part of the 3' noncoding region of the lactase
gene of K. lactis. This plasmid, pGB950, is depicted
in figure 13. pGB950 was cut with SalI and Xhol and
synthetic DNA was inserted:
SAL 1 STU 1 YNO 1
TCGACAAAAATGATCAGTACTAAGACTCCTAGGCCTATCGATTC
GTTTTTACTAGTCATGATTCTGdGGATCCGGATAGCTaAG:aGCT
resulting in plasmid pGBSCC-6 as shown in figure 13.
The StuI-EcoRI fragment from pGBSCC-2 (see example 1)
containing the P45oSCC coding region was isolated and the
sticky end was filled in, using Klenow DNA polymerase. This
fragment was inserted into pGBSCC-6 cut with StuI. The
plasmid containing the fragment in the correct orientation
was called pGBSCC-7 (see figure 14).
(c) Transformation of K.lactis
K.lactis strain CBS 2360 was grown in 100 ml of YEPD-
medium (1% yeast extract, 2% peptone, 2% glucose-
monohydrate) containing 2.5 ml of a 6.7% (w/w) yeast
nitrogen base (Difco laboratories) solution to an ~D610 of
about 7. From 10 ml of the culture the cells were collected
~.3~061 ~
- 28 -
by centrifugation, washed with TE-buffer (10 mM Tris-HC1
pH 7.5: 0.1 mM EDTA) and resuspended in 1 ml TE-buffer. An
equal volume of 0.2 M lithium acetate was added and the
mixture was incubated for 1 hr at 30°C in a shaking water-
s bath. 15~g of pGBSCC-7 was cut at the unique Sac I site in
the lactase promoter, ethanol precipitated and resuspended
in 15 ~,1 TE-buffer. This DNA preparation was added to 100 ~1
of the pre-incubated cells and the incubation was prolonged
for 30 minutes. Then an equal volume of 70% PEG4000 was
added and the mixture was incubated for 1 hr at the same
temperature, followed by a heatshock of 5 minutes at 42°C.
Then 1 ml of YEPD-medium was added and the cells were
incubated for 1.5 hrs in a shaking waterbath of 30°C.
Finally the cells were collected by centrifugation,
resuspended in 300 ~,1 YEPD and spread on agar plates
containing 15 ml of YEPD agar with 300~g/ml of geneticin and
were overlayered 1 hr before use with 15 ml YEPD-agar with-
out 6418. Colonies were grown for 3 days at 30°C.
(d) Analysis of the transformants
Transformants and the control strain CBS 2360 were
grown in YEPD medium for about 64 hrs at 30°C. The cells
were collected by centrifugation, resuspended in a
physiological salt solution at an OD610 of 300 and disrupted
by shaking with glass beads for 3 minutes on a Vortex shaker
at maximum speed. Cell debris was removed by centrifugation
for 10 minutes at 4500 rpm in a Hearaeus Christ minifuge GL.
From the supernatants 40 ~cl samples were taken for analysis
on immunoblots (see figure 15A, lane 3 and figure 15B,
lane 4 ) .
The results show that a protein of the expected length is
expressed in K.lactis cells transformed with pGBSCC-7.
The transformant was denoted as K.lactis SCC-101.
~~4oms
- 29 -
Example 6
Construction, transformation and expression of P450SCC in
the yeast Saccharomyces cerevisiae
(a) Construction of the expression cassette
In order to delete the lactase promoter, pGB950 (see
example 4(b)) was cut with XbaI and a I, the sticky ends
l0 were filled in using Klenow DNA polymerase and subsequently
ligated. In the resulting plasmid, pGBSCC-8, the XbaI-site
is destroyed, but the Sa I site is maintained.
The SalI-fragment from pGB161 (see J.A. van den Berg
et al., EP 96430) containing the isocytochrome CI (cyc 1)
promoter from S.cerevisiae was isolated and partially
digested with XhoI. The 670 by XhoI-S I fragment was
isolated and cloned into the Sa I-site of pGBSCC-8. In the
selected plasmid, pGBSCC-9, the SalI-site between the cyc 1
promoter and the 3' noncoding region of the lactase gene is
maintained (figure 16) (HindIII partially digested).
The SalI-HindIII fragment from pGBSCC-7, containing
the P450SCC coding region was inserted in pGBSCC-9 cut with
SalI and HindIII. In the resulting plasmid, pGBSCC-10, the
P450SCC coding region is downstream to the cyc 1 promoter
(figure 17).
(b) Transformation of S.cerevisiae
S.cerevisiae strain D273-lOB (ATCC 24657) was grown in
100 ml YEPD overnight at 30°C, subsequently diluted
(1:10000) in fresh medium and grown to an OD610 of 6. The
cells from 10 ml of the culture were collected by
centrifugation and suspended in 5 ml TE-buffer. Again the
cells were collected by centrifugation, suspended in 1 ml
of the TE-buffer and 1 ml 0.2 M lithium acetate was added.
,°
t, r
_ 30 _ l~4os~s
The cells were incubated for 1 hour in a shaking waterbath
at 30°C. 15 ~g pGBSCC-10 was cut at the unique MluI-site in
the cyc 1 promoter, ethanol precipitated and resuspended in
15 ~C1 TE. This DNA preparation was added to 100 ~,1 of the
pre-incubated yeast cells and incubated (shaking) for 30
minutes at 30°C. After addition of 115 ~C1 of a 70% PEG4000
solution the incubation was prolonged 60 minutes, without
shaking. Subsequently a heat shock of 5 minutes at 42°C was
given to the cells, 1 ml YEPD medium was added, followed by
a 1~ hour incubation at 30°C in a shaking waterbath. Finally
the cells were collected by centrifugation, resuspended in
300 ~1 YEPD and spread on YEPD agar plates containing
geneticin (300 ~,g/ml).
Colonies were grown for three days at 30°C.
(c) Analysis of the transformants
Transformants and the control strain were grown in
YEPL-medium (1% yeast extract, 2% bactopeptone, 3.48% K2HP04
and 2.2% of a 90% L-(+)-lactic acid solution; before
sterilization the pH was adjusted to 6.0 using a 25% ammonia
solution) for 64 hrs at 30°C. Further analysis was done as
described in example 5(d).
The immunoblot-analysis demonstrates the expression
of P450SCC in S.cerevisiae (figure 15A, lane 1).
Examgle 7
Construction, transformation and expression of pre-P450SCC
encoding DNA in the yeast Klu~eromyces lactis
(a) Construction of the expression cassette
Plasmid pGB950 (see example 5(b)) was cut with SalI
and XhoI and synthetic DNA was inserted:
~~4os~~
- 31 - -
SAL I
TCGACAAAAA_TGTTGGCTCGAGGTTTGCCATTGAGATCCGCTTTGGTTAAGGCTTGTCC
GTTTTTACAACCGAGCTCCAAACGGTAACTCTAGGCGAAACG:~aTTCCGAACAGG
ACCAATCTTGTCCACTGTTGGTGAAGGTTGGGGTCACCACAGAGTTGGTACTGGTGAAGG
TGGTTAGAACAGGTGACAACCACTTCCAACCCCAGTGGTGTCTCAACCATGACCACTTCC
STU 1 ~H~
TGCTGGTATCAGTACTAAGACTCCTAGGCCTATCGATTC
ACGACCATAGTCATGATTCTGAGGATCCGGATAGCTAAGAGCT
resulting in plasmid pGBSCC-11 (figure 18). Analogous as
described in example 5(b), the P450SCC coding region of
pGBSCC-2 was inserted into pGBSCC-11 cut with StuI. The
plasmid containing the fragment in the correct orientation
was called pGBSCC-12 (figure 18).
(b) Transformation of K.lactis and analysis of the
transformants
Transformation of K.lactis with pGBSCC-12 was
performed as described in example 5(c). The transformants
were analysed as described in example 5(d). The analysis
demonstrates the production of P450SCC by K.lactis (figure
15B, lane 3).
Example 8
Construction. transformation and expression of pre-P450SCC
encoding DNA in the yeast Saccharomyces cerevisiae
(a) Construction of the expression cassette
The SalI-HindIII (HindIII partially digested) fragment
from pGBSCC-12, containing the pre-P450SCC coding region was
inserted in pGBSCC-9 cut with SalI and HindIII. The
resulting plasmid was called pGBSCC-13 (figure 19).
1340616
- 32 -
(b) Transformation of S.cerevisiae and analysis of the
transformants
S.cerevisiae strain D273-lOB was transformed with
pGBSCC-13 as described in example 6(b). The transformants
were analysed as described in example 5(c). The result,
shown in figure 15C (lane 3), demonstrates the expression of
P450SCC by S.cerevisiae. One transformant, SCC-105, was
further analyzed for in vitro activity of P450SCC (see
example 12).
Example 9
Construction, transformation and expression in Kluyveromvces
lactis of P450SCC sequences fused to the pre-region of
cytochrome oxidase VI from Saccharomyces cerevisiae
(a) Construction of the expression cassette
Plasmid pGB950 (see example 6(b)) was cut with SalI
and XhoI and synthetic DNA was inserted:
SAL I
TCGACAAAAATGTTGTCTCGAGCTATCTTCAGAAACCCAGTTATCAACAGAACTTTGTT
GTTTTTACAACAGAGCTCGATAGAAGTCTTTGGGTCAATAGTTGTCTTGAAACAA
GAGAGCTAGACCAGGTGCTTACCACGCTACTAGATTGrICTAAGAAC~.CTTTCATCCAATC
CTCTCGATCTCGTCCACGAATGGTGCGATGATCTAACTGATTCTTGTGAAAGTAGGTTAG
STU 1 XHO 1
CAGAAAGTACATCAGTAC'!'AAGACTCCTAGGCGTATCGATTC
GTCTTTCATGTAGTCATGATTCTGAGGATCCGGATAGCTAAGAGCT
resulting in plasmid pGBSCC-14.
The amino acid sequence from the cytochrome oxidase VI
(COX VI) pre-sequence was taken from the article of Wright
et al. (J. Biol. Chem., 259, 15401-15407, 1984). The
synthetic DNA was designed, using preferred yeast codons.
The P450SCC coding region of pGBSCC-2 was inserted into
pGBSCC-14 cut with StuI, similarly as described in example
l3~osls
- 33 -
5(b). The plasmid containing the P450SCC coding sequence in
frame with the COX VI pre-sequence was called pGBSCC-15
(figure 20).
(b) Transformation of K.lactis and analysis of the
transformants
Transformation of K.lactis with pGBSCC-15 was
performed as described in example 5(c). The transformants
were analysed as described in example 5(d). The result
(figure 15B, lane 2) shows that P450SCC is expressed.
Example 10
Construction, transformation and expression in Saccharomyes
cerevisiae of p450SCC sequences fused to the pre-region of
cytochrome oxidase VI from Saccharomyces cerevisiae
(a) Construction of the expression cassette
The SalI-HindIII (HindIII partially digested) fragment
from pGBSCC-15, containing the coding region for p450SCC
fused to the COX VI pre-sequence, was inserted in pGBSCC-9
cut with SalI and HindIII. The resulting plasmid was called
pGBSCC-16 (figure 21).
(b) Transformation of S.cerevisiae and analysis of the
transformants
S.cerevisiae strain D273-lOB was transformed with
pGBSCC-16 as described in example 6(b). The transformants
were analysed as described in example 6(c). The result,
shown infigure 15C (lane 2), demonstrates the expression of
P450SCC in S.cerevisiae.
i34afi1fi
- 34 -
Example 11
In vivo activity of P450SCC in Bacillus licheniformis SCC-
201
B.licheniformis SCC-201 was obtained as described in
example 3. The organism was inoculated in 100 ml of medium
A. Medium A consisted of:
Calcium chloride-hexahydrate 1 g
Ammonium sulfate 5 g
Magnesium chloride-hexahydrate 2.25 g
Manganese sulfate-tetrahydrate 20 mg
Cobalt chloride-hexahydrate 1 mg
Citric acid-monohydrate 1.65 g
Distilled water 600 ml
Trace elements stock solution 1 ml
Antifoam (SAG 5693) 0.5 mg
Trace elements stock solution contained per 1 of distilled
water:
CuS04.5H20 0.75 g
H3B03 0.60 g
KI 0.30 g
FeS04(NH4)2S04.2H20 27 g
ZnS04.7H20 5 g
Citric acid.H20 15 g
MnS04.H20 0.45 g
Na2Mo04.H20 0.60 g
H2S04 (96%) 3 ml
After sterilisation and cooling to 30°C in order to
complete the medium, 60 g of maltose-monohydrate dissolved
in 200 ml of distilled water (sterilized 20 minutes, 120°C),
200 ml 1M of potassium phosphate buffer (pH 6.8; sterilized
20 minutes, 120°C), 1.7 g of Yeast Nitrogen base (Difco)
- 35 - ~ 134016
dissolved in 100 ml of distilled water (sterilized by
membrane filtration) were added to the medium.
The culture was grown for 64 hours at 37°C and
subsequently 2 ml of this culture was added as inoculum to
100 ml of medium A containing 10 mg of cholesterol.
Cholesterol was added as a solution containing cholesterol
mg: TergitolTM/ethanol (1:1, v/v), 0.75 ml and Tween
80TM, 20 ~,1. The culture was grown for 48 hours at 37°C,
whereupon the culture was extracted with 100 ml of
10 dichloromethane. The mixture was separated by centrifugation
and the organic solvent layer was collected. The extraction
procedure was repeated twice and the 3 x 100 ml of
dichloromethane fractions were pooled. The dichloromethane
was evaporated by vacuum distillation and the dried extract
(approximately 450 mg) was analysed for pregnenolone using a
gaschromatograph-mass spectrometer combination.
GC-MS analysis.
From the dried extract a defined amount was taken and
silylated by adding a mixture of pyridine bis-(trimethyl-
silyl)-trifluoroacetamide and trimethylchlorosilane. The
silylated sample was analysed by a GL-MS-DS combination
(Carlo Erba MEGA 5160-Finnigan MAT 311A-Kratos DS 90) in the
selected ion mode. Gaschromatography was performed under the
following conditions: injection moving needle at 300°C;
column M.cpsi129 0.25 inner diameter df 0.2 ~,m operated at
300°C isotherm; direct introduction into MS-source.
Samples were analysed by monitoring ions m/z 298 from
pregnenolone at a resolution of 800. From the measurements
it is clear that in case of the host strain B.licheniformis
T5 no pregnenolone could be detected (detection limit
1 picogram), whereas in case of B.licheniformis SCC-201
production of pregnenolone easily could be monitored.
i3~~ms
- 36 -
Example 12
In vitro activity of P450SCC obtained from Saccharomyces
cerevisiae SCC-105
S.cerevisiae SCC-105 obtained as described in
example 8 was inoculated in 100 ml medium B. Medium B
contained per 1 of distilled water:
Yeast extract 10 g
Bacto Peptone (Oxoid) 20 g
Lactic acid (90%) 20 g
Dipotassium phosphate 35 g
pH = 5.5 (adjusted with ammonia, 25% w/w)
This culture was grown for 48 hours at 30°C and sub-
sequently this culture was used as inoculum for a fermentor
containing medium C. Medium C consisted of:
Yeast extract 100 g
Bacto Peptone (Oxoid) 200 g
Lactic acid (90%) 220 ml
Dipotassium hydrogen phosphate 35 g
Distilled water 7800 ml
pH was adjusted at pH = 6.0 with ammonia (25%) and the
fermentor including the medium was sterilized (1 hour,
120°C) .
After cooling, 2.4 g of geneticin dissolved in 25 ml
of distilled water was sterilized by membrane filtration and
added to the medium. The inoculated mixture was grown in the
stirred reactor (800 rpm) at 30°C, while sterile air was
passed through the broth at a rate of 300 1/h and the pH was
automatically kept at 6.0 with 4N H2S04 and 5% NH40H (5%
NH40H in distilled water; sterilized by membrane
filtration). After 48 hours a feed of lactic acid (90%,
sterilized by membrane filtration) was started at a rate of
20 g/h. The fermentation is then resumed for 40 hours,
- 37 - ~340G1~
whereupon the cells were collected by centrifugation
(4000xg, 15 minutes).
The pellet was washed with 0.9% (w/w) NaCl, followed by
centrifugation (4000xg, 15 minutes); the pellet washed with
phosphate buffer (50 mM, pH = 7.0) and cells were collected
by centrifugation (400oxg, 15 minutes). The pellet was taken
up in phosphate buffer (50 mM, pH = 7.0) resulting in a
suspension containing 0.5 g wet weight/ml. This suspension
was treated in a DynoR-mill (Willy A. Bachofen Maschinen-
fabrik, Basel, Schweiz). Unbroken cells were removed by
centrifugation (4000xg, 15 minutes). The cell-free extract
(2250 ml, 15-20 mg protein/ml) was stored at -20'C.
P450SCC was roughly purified by the following
procedure. From 50 ml of thawed cell-free extract, a rough
membrane fraction was pelleted by ultracentrifugation
(125000xg, 30 minutes) and resuspended in 50 ml of a 75 mM
potassium phosphate solution (pH 7.0), containing 1% of
sodium cholate. This dispersion was gently stirred for
1 hour at 0°C, and subsequently centrifugated (125000xg,
60 minutes). To the thus obtained supernatant, containing
solubilized membrane proteins, (NH4)2SO4 was added (30%
w/v), while the pH was kept at 7.0 by adding small amounts
of a NH40H solution (6N). The suspension was stirred for
20 minutes at 0°C, after which the fraction of precipitated
proteins was collected by centrifugation (15000xg, 10 min).
The pellet was resuspended to 2.5 ml with 100 mM potassium
phosphate buffer (pH 7.0), containing 0.1 mM dithio-threitol
and 0.1 mM EDTA. This suspension was eluted over a
gelfiltration column (PD1~ Pharmacia), yielding 3.5 ml of a
desalted protein fraction (6 mg/ml), which was assayed for
P450SCC activity.
Bi
38
P450SCC activity was determined by an assay, which
is essentially based on a method of Doering (Methods
Enzymology, 15, 591-596, 1969). The assay mixture consisted
of the following solutions:
Solution A (natural P450SCC electron donating
system): a 10 mM potassium phosphate buffer (pH 7.0),
containing 3 mM of EDTA, 3 mM of phenylmethylsulfonyl
fluoride (PMSF) , 20 ACM of adrenodoxin and 1 ~.M of
adrenodoxin reductase (electron carriers; both purified
from bovine adrenal cortex),
1 mM of NADPH (electron donor) and
mM glucose-6-phosphate and
8 units/ml glucose-6-phosphate-dehydrogenase (NADPH regene-
rating system) .
Solution B (substrate): a micellar solution of
37.5 ~,M cholesterol (doubly radiolabeled with [26,27-14C]
cholesterol (40 Ci/mol) and [7 alpha-3H] cholesterol (400
Ci/mol)) in 10°s (v/v) TergitolTM NP40/ethanol (1:1, v/v).
The assay was started by mixing 75 ~,1 of solution
A with 50 ~l of solution B and 125 ~,1 of the roughly
purified P450SCC fraction (or buffer as reference). The
mixture was stirred gently at 30°C. Samples (50 ~.1) were
drawn after 0, 30 and 180 minutes and diluted with 100 ~,1
of water. Methanol (100 ~,1) and chloroform (150~C1) were
added to the diluted sample. After extraction and
centrifugation (5000xg, 2 minutes) the chloroform layer was
collected and dried. The dry residue was dissolved in 50 ~,1
of acetone, containing 0.5 mg of a steroid mixture
(cholesterol, pregnenolone and progesterone (1:1:1, w/w/w))
and subsequently 110 ul of concentrated formic acid was
I34061~
38a
added. The suspension was heated for 15 minutes at 120°C.
Hereafter the 14C/3H ratio was determined by double label
liquid scintillation counting. This ratio is a direct
measure for
x
- 39 -
the sidechain cleavage reaction, because the 14C-labeled
sidechain is evaporated from the mixture as isocaprylic acid
during the heating procedure.
Using this assay it was found that the P450SCC
fraction, roughly purified from S.cerevisiae SCC-105,
showed side chain cleavage acitivity. During 3 hours of
incubation 45% of the cholesterol had been converted. By
means of thin layer chromatography the reaction product was
identified as pregnenolone.
Example 13
Molecular cloning of a full-length cDNA encoding the bovine
cytochrome P450 steroid 17a-hydroxylase (P45017a).
Approximately 106 pfu's of the bovine adrenal cortex
cDNA library described in example 1 was selected for
P45017acDNA sequences by screening with two 32P-end labeled
synthetic oligomers specific for P45017acDNA. Oligomer 17a-
1 (5'-AGT GGC CAC TTT GGG ACG CCC AGA GAA TTC-3') and
oligomer 17a-2 (5'-GAG GCT CCT GGG GTA CTT GGC ACC AGA GTG
CTT GGT-3') are complementary to the bovine P45017acDNA
sequence as described by Zuber et al. (J. Biol. Chem., 261,
2475-2482, 1986) from position 349 to 320 and 139 to 104,
respectively.
Selection with oligomer 17a-1 revealed ~ 1500
hybridizing pfu's. Several hybridizing pfu's were selected,
purified and scaled up for preparative phage DNA isolation.
The EcoRI inserts of the recombinant lambda-gtll DNA's were
subcloned in the EcoRI site of pTZl8R. One clone, pGBl7a-1,
was further characterized by restriction endonuclease
mapping and DNA-sequencing. Plasmid pGBl7a-1 contains an 1.4
kb EcoRI insert complementary to the 3' part of P45017a from
the EcoRI site at position 320 to the polyadenylation site
at position 1721 as described by Zuber et al.
- 40 - 134~fi16
A map of pGBl7a-1 is shown in figure 22A.
Eight hybridizing pfu's were obtained by selecting the
cDNA library with oligomer 17a-2. After purification,
upscaling of recombinant phages and isolation of rec lambda-
gtll DNA's, EcoRI inserts were subcloned in the EcoRI site
of pTZlBR. EcoRI inserts varied in length from 270 by to 1.5
kbp. Only one clone, pGBl7a-2 containing a 345 by EcoRI-
fragment was further investigated by nucleotide suquencing
and compared with the published P45017acDNA sequence data by
Zuber et al. As shown in figure 22B the P45017acDNA sequence
in pGBl7a-2 starts 72 by upstream the predicted AUG start
codon at position 47 and shows complete homology with the
5' part of P45017acDNA till the EcoRI site at position 320
as described by Zuber et al.
A full-length bovine P45017acDNA was constructed by
molecular cloning in E.coli JM101 of a ligation mixture
containing a partial EcoRI digest of pGBl7a-1 and the 345
by EcoRI fragment of pGBl7a-2. The obtained clone pGBl7a-3
contains a full-length bovine P45017acDNA and is shown in
figure 22C.
Example 14
Construction and transformation of a full-length P45017ac-
DNA clone into the yeast Kluyveromyces lactis
(a) Construction of the expression vector
To derive a suitable expression vector in yeast hosts
for bovine P45017a, pGBl7a-3 was mutated by site-directed
mutagenesis as described by Zoller and Smith, (Methods in
Enzymol., 100, 468-500, 1983): Zoller and Smith, (Methods in
Enzymol., 154, 329-350, 1987) and Kramer and Fritz, (Methods
in Enzymol., 154, 350-367, 1987). Plasmids and strains for
~~~os~s
- 41 -
in vitro mutagenesis experiments were obtained from
Pharmacia Inc..
As indicated in figure 23, 9 by just upstream the ATG
initiation codon were changed to obtain a SalI restriction
site and optimal yeast translation signals using the
synthetic oligomer 17a-3
SAL 1
5'-TCTTTGTCCTGACTGCTGCCAGTCGAGAAAAATGTGGCTGCTC-3'
The resulting plasmid pGBl7a-4 was digested with SalI
and SmaI; the DNA-fragment containing the full length
P45017acDNA was separated by gelectrophoresis, isolated and
transferred by molecular cloning in E.coli JM101 into the
pGB950 vector (see example 5) which was first digested with
XhoI, sticky ends filled in with Klenow DNA polymerase and
subsequently digested with SalI, resulting in the plasmid
pGBl7a-5 as depicted in figure 24.
(b) Transformation of K.lactis
15 ug of pGbl7a-5, cut at the unique SacII site in the
lactase promoter, was used to transform K.lactis strain CBS
2360 as indicated in example 5. Transformants were analyzed
for the presence of integrated pGBl7a-5 sequences in the
host genome by southern analysis. One transformant 17a-101,
containing at least three copies of pGBl7a-5 in the genomic
host DNA, was further analyzed for in vivo activity of
P45017a (see example 16).
l~4osls
- 42 -
Example 15
Construction and transformation of P45017a in the bacterial
hosts Bacillus subtilis and Bacillus licheniformis
(a) Construction of the expression vector
To derive a suitable expression vector in Bacillus
hosts for bovine P45017a, pGBl7a-3 was mutated by site-
directed mutagenesis as described in example 14.
As indicated in figure 25 an NdeI restriction site was
introduced at the ATG imitation codon using the synthetic
oligomer 17a-4:
5'-GCT GCC ACC CAG AC,C ATA TG~T GGC TGC TCC T-3'
NdeI
The resulting plasmid pGB 17a-6 was partial digested
with EcoRI: the DNA fragment containing the full-length
P45017acDNA was separated by gelelectrophoresis, isolated
and ligated to EcoRI digested pBHA-1 DNA as shown in
figure 26. The ligate was molecular cloned by transferring
the ligation mixture into E.coli JM101 to obtain pGBl7a-7.
(b) Transformation of B.subtilis and B.licheniformis
The "HpaII" Bacillus promoter was introduced upstream
the P45017acDNA sequences by digestion pGBl7a-6 with the
restriction enzyme NdeI, separation of the E.coli part of
the shuttle plasmid by agarose gel electrophoresis and
subsequent religation and transformation of B.subtilis 1A40
(BGSC 1A40) competent cells. Neomycin resistant colonies
were analysed and the plasmid pGBl7a-8 (figure 27) was
obtained.
Transformation of the host B.licheniformis T5 (CBS
470.83) was also performed with pGBl7a-8. The plasmid
13~Q~~ s
- 43 -
remains stable in the appropriate Bacillus hosts as
revealed by restriction analysis of pGBl7a-8 even after
many generations.
Example 16
In vivo activity of P45017a in Kluvveromyces lactis 17a-
101
K.lactis 17a-101 was obtained as described in
example 14. The organism was inoculated in 100 ml of medium
D. Medium D contained per litre of distilled water:
Yeast Extract (Difco) 10 g
Bacto Peptone (Oxoid) 20 g
Dextrose 20 g
After sterilization and cooling to 30°C, 2.68 g of Yeast
Nitrogen Base (Difco) dissolved in 40 ml of distilled water
(sterilized by membrane filtration) and 50 mg of neomycine
dissolved in 1 ml of distilled water (sterilized by membrane
filtration) was added to the medium. Subsequently 50 mg of
progesterone dissolved in 1.5 ml dimethylformamide was added
to 100 ml of medium. The culture was grown for 120 hours at
30°C and subsequently 50 ml of culture broth was extracted
with 50 ml of dichloromethane. The mixture was centrifugated
and the organic solvent layer was separated. Dichloromethane
was evaporated by vacuum distillation and the dried extract
(about 200 mg) was taken up in 0.5 ml of chloroform. This
extract contained 17a-hydroxyprogesterone as shown by thin
layer chromatography. The structure of the compound was
confirmed by H-NMR and 13C-NMR. NMR analysis also showed
that the ratio 17a-hydroxyprogesterone/progesterone in the
extract was approximately 0.3.
- 44 - 1340046
Example 17
Molecular cloning of a full-length cDNA encoding the bovine
cytochrome P450 steroid 21-hydroxylase (P450C21)
Approximately 106 Pfu's of the bovine adrenal cortex
cDNA library, prepared as described in example 1, were
hybridized with a 32P-end labeled oligo C21-1. This oligo,
containing the sequence 5'- GAT GAT GCT GCA GGT AAG CAG AGA
GAA TTC-3' is a specific probe for the bovine P450C21 gene
located downstream the EcoRI site in the P450C21 cDNA
sequence as described by Yoshioka et al. (J. Biol. Chem.,
261, 4106-4109, 1986). From the screening one hybridizing
pfu was obtained. The EcoRI insert of this recombinant
lambda-gtll DNA was subcloned in the EcoRI site of pTZl8R
resulting in a construct called pGBC21-1. As shown in
figure 28 this plasmid contains a 1.53 kb EcoRI insert
complementary to the P450C21cDNA sequences from the EcoRI
site at position 489 to the polyadenylation site as
described by Yoshioka et al., as revealed by nucleotide
sequencing.
To isolate the remaining 5' part (490 bp) of the
P450C21cDNA, a new bovine adrenal cortex cDNA Library was
prepared according the procedure as described in example 1
with only one modification. As primer for the first cDNA
strand synthesis an additional oligomer C21-2 was added.
Oligomer C21-2 with the nucleotide sequence 5'- AAG CAG
AGA GAA TTC-3' is positioned downstream the EcoRI-site of
P450C21cDNA from position 504 to 490.
Screening of this cDNA library with a 32P-end labeled
oligomer C21-3, containing the P450C21 specific sequence
5'-CTT CCA CCG GCC CGA TAG CAG GTG AGC GCC ACT
GAG-3' (positions 72 to 37) revealed approximately 100
hybridizing pfu's. The EcoRI-insert of only one recombinant
l~~os~s
- 45 -
lambda-gtll DNA was subcloned in the EcoRI-site of pTZl8R
resulting in a construct called pGBC21-2.
This plasmid (figure 28) contains an insert of 540 by
complementary to the P450C21cDNA sequences from position
-50 to the EcoRI-site at position 489 as revealed by
nucleotide sequencing.
Example 18
Construction of a P450C21cDNA Bacillus expression vector
and transformation to the bacterial hosts Bacillus subtilis
and Bacillus licheniformis
(a) Construction of the expression vector
To construct a full-length P450C21cDNA with flanking
sequences specific for the Bacillus expression vector pBHA-
1, the 5' part of the P450C21 gene was first modified by the
Polymerase Chain Reaction (PCR) method with pGBC21-2 as
template and two specific P450C21-oligomers as primers.
Oligomer C21-4 (5'-CTG ACT GAT ATC CAT ATG GTC CTC
GCA GGG CTG CTG-3') contains 21 nucleotides complementary
to C21-sequences from positions 1 to 21 and 18 additional
bases to create an EcoRV restriction site and an NdeI
restriction site at the ATG initiation codon.
Oligomer C21-5 (5'-AGC TCA GAA TTC CTT CTG GAT
GGT CAC-3') is 21 bases complementary to the minus strand
upstream the EcoRI-site at position 489.
The PCR was performed as described by Saiki et al
(Science 239, 487-491, 1988) with minor modifications.
The PCR was performed in a volume of 100 ~,1 containing: 50
mM KCL, lOmM Tris-HCL pH 8.3, 1.5 mM MgCl2, 0.01 % (w/v)
gelatin, 200 ~M each dNTP, 1 ~M each C21-primer and 10 ng
pGBC21-2 template. After denaturation (7' at 100°C) and
1340fi15
- 46 -
addition of 2 U Taq-polymerase (fetus), the reaction
mixture was performed to 25 amplification cycles (each: 2'
at 55°C, 3' at 72°C, 1' at 94°C) in a DNA-amplifier
apparatus (Perkin-Elmer).
In the last cycle the denaturation step was omitted. A
schematic view of this P450C21cDNA amplification is shown
in figure 29.
The amplified fragment was digested with EcoRV and
EcoRI and inserted by molecular cloning into the
appropriate sites of pSP73 (Promega). The obtained plasmid
is called pGBC21-3. As shown in figure 30 the 3' P450C21-
EcoRI fragment of pGBC21-1 was inserted in the right
orientation into the EcoRI-site of pGBC21-3. The obtained
vector pGBC21-4 was digested with EcoRV and KpnI (KpnI is
situated in the multiple cloning site of pSP73) and the
fragment containing the full-length P450C21cDNA was isolated
by gel electrophoresis and inserted into the appropriate
sites of pBHA-1 by molecular cloning. The derived plasmid
pGBC21-5 is illustrated in figure 31.
(b) Transformation of Bacillus
The "HpaII" Bacillus promoter was introduced upstream
the P450C21cDNA gene by digestion pGBC21-5 with the
restriction enzyme NdeI, separation of the E.coli part of
the shuttle plasmid by agarose gel electrophoresis and sub-
sequent religation and transformation of B.subtilis 1 A40
(BGSC 1 A40) competent cells. Neomycin resistant colonies
were analysed to obtain pGBC21-6 (figure 32).
Transformation of the host B.licheniformis T5 (CBS
470.83) was also performed with pGBC21-6. The plasmid
remains stable in both Bacillus hosts as revealed by
restriction analysis.
1340~1fi
- 47 -
Example 19
Construction of a P450C21cDNA yeast expression vector and
transformation to the yeast host Kluyveromyces lactis
(a) Construction of the expression vector
To derive a suitable expression vector in yeast hosts
for bovine P450C21, pGBC21-2 was mutated by site directed
mutagenesis as described in example 14. For the mutation
oligomer C21-6 (5'-CCT CTG CCT GGG TCG ACA AAA ATG
GTC CTC GCA GGG-3') was used to create a SalI
restriction site and optimal yeast translation signals
upstream the ATG initiation codon as indicated in figure 33.
The SalI EcoRl DNA fragment of derived plasmid
pGBC21-7 was ligated to the 3' P450C21-EcoRI-fragment of
pGBC21-1 and inserted by molecular cloning into the
appropriate sites of pSP73 as indicated in figure 34.
Derived pGBC21-8 was cut with SalI and EcoRV (EcoRV site is
situated in the multiple cloning site of pSP73) and the DNA
fragment containing the full-length P450C21cDNA was
inserted into the yeast expression vector pGB950. Derived
pGBC21-9 is depicted in figure 35.
1340616
- 48 -
(b) Transformation of K.lactis
15 ~tg of pGBC21-9 was digested with SacII and
transformation of K.lactis CBS 2360 was performed as
described in example 5(c).
Examgl a 2 0
Molecular cloning of a full-length cDNA encoding the bovine
cytochrome P450 steroid 113-hydroxylase (P45011Q)
A bovine adrenal cortex cDNA library was prepared as
described in example 1 with one modification. An additional
P45011~-specific primer (oligomer 11(3-1) with the nucleotide
sequence 5'-GGC AGT GTG CTG ACA CGA-3' was added to the
reaction mixture of the first strand cDNA synthesis.
Oligomer 11(3-1 is positioned just downstream the
translation stopcodon from position 1530 to 1513. Nucleotide
sequences and map positions of mentioned P45011p-oligomers
are all derived from the P45011,OcDNA sequence data described
by Morohashi et al. (J. Biochem. 102 (3), 559-568, 1987).
The cDNA library was screened with a 32P-labeled oligomer
11Q-2 (5'-CCG CAC CCT GGC CTT TGC CCA CAG TGC CAT-
3') and is located at the 5' end of the P45011QcDNA from
position 36 to 1.
Screening with oligomer 11J3-2 revealed 6 hybridizing
pfu's. These were further purified and analyzed with
oligomer 11Q-3 (5'-CAG CTC AAA GAG AGT CAT CAG CAA
GGG GAA GGC TGT-3', positions 990 to 955). Two out of six
showed a positive hybridizing signal with 32P-labeled
oligomer 11Q-3.
The EcoRI inserts of both llp-lambda-gtll
recombinants were subcloned into the EcoRI-site of pTZl8R.
One clone with an EcoRI insert of 2.2 kb (pGBllQ-1) was
-- 130616
49
further analyzed by restriction enzyme mapping and is shown
in figure 36. pGB11J3-1 contains all coding P45011~3cDNA
sequences as determined by Morohashi et al.
Example 21
Construction of a P45011~cDNA Bacillus expression vector and
transformation to the bacterial hosts Bacillus subtilis and
Bacillus ~icheniformis
(a) Construction of the expression vector
A full-length P45011pcDNA with modified flanking
sequences to the Bacillus expression vector pBHA-1, was
obtained by the PCR method (described in example 18) with
pGBllp-1 as template and two specific P45011~-oligomers as
primers.
Oligomer llp-4 (5'-TTT GAT ATC GAA TTC CAT ATG
GGC ACA AGA GGT GCT GCA GCC-3') contains 21 bases
complementary to the mature P45011pcDNA sequence from
position 72 to 93 and 21 bases to create EcoRV, EcoRI and
Nde restriction-sites and ATG initiation codon.
Oligomer 11Q-5 (5'-TAA CGA TAT CCT CGA GGG TAC
CTA CTG GAT GGC CCG GAA GGT-3) contains 21 bases
complementary to the minus P45011,OcDNA strand upstream the
translation stopcodon at position 1511 and 21 bases to
create restriction-sites for EcoRV, XhoI and KpnI.
After PCR amplification with above mentioned template
and P45011A-primers, the amplified fragment (1.45 kb), was
digested with EcoR and KpnI and inserted by molecular
cloning into the Bacillus expression vector pBHA-1 cut with
EcoRI and K n to obtain the vector pGBll(3-2 (see
figure 36).
~d
x.340616
- 50 -
(b) Transformation of Bacillus
The "HpaII" Bacillus promoter was introduced upstream
the P45011QcDNA sequences by digestion pGBll/3-2 with NdeI,
separation of the E.coli part of the shuttle plasmid by
agarose gel electrophoresis and subsequent relegation (as
described in example 18) and transformation of B.subtilis
1A40 (BGSC 1A40) competent cells. Neomycin resistant
colonies were analysed and the plasmid pGBllQ-3 was
obtained. The derived plasmid pGB11~3-3 was also transmitted
to the B.licheniformis host strain T5 (CBS 470.83).
Example 22
Construction of a P45011j~cDNA yeast expression vector and
transformation to the yeast host Kluyveromyces lactis
(a) Construction of the expression cassette
A full-length P45011QcDNA with modified flanking
sequences to the yeast expression vector pGB950 was obtained
by the PCR method (described in example 18) with pGB11J3-1 as
template and two specific P45011Q-oligomers as primers.
Oligomer 113-6 (5'-CTT CAG TCG ACA AAA ATG GGC
ACA AGA GGT GCT GCA GCC-3') contains 21 bases
complementary to the mature P45011QcDNA sequence from
position 72 to 93 and 18 additional bases to create a SalI
restriction site, an optimal yeast translation signal and an
ATG initiation codon.
Oligomer 11Q-5 is described in example 21(a).
After PCR amplification with above mentioned template and
P45011Q primers, the amplified fragment (1.45 kb), was
digested with SalI and XhoI and inserted by molecular
cloning into the yeast expression vector pGB950 cut with
SalI to obtain the vector pGBllQ-4 (figure 37).
y ~~4os~s
- 51 -
(b) Transformation of K.lactis
15 ~g of pGBllQ-4 was cut at the unique SacII site in
the lactase promoter and transformation of K.lactis CBS
2360 was performed as described in example 5(c).
Example 23
Molecular cloning and construction of a full-length cDNA
encoding the bovine adrenodoxin (ADX), and subsequent
transformation and expression of ADXcDNA in the yeast
Kluyveromyces lactis
(a) Molecular cloning of ADX
A full-length ADXcDNA, with 5' and 3' flanking
sequences modified to the yeast expression vector pGB950,
was directly obtained from a bovine adrenal cortex mRNA/cDNA
pool (for detailed description see example 1) by amplifica-
tion using the PCR method (see example 18).
For the ADXcDNA amplification two synthetic oligomer
primers were synthesized.
Oligomer ADX-1 (5'-CTT CAG TCG ACA AAA ATG AGC
AGC TCA GAA GAT AAA ATA-3') containing 21 bases
complementary to the 5' end of the mature ADXcDNA sequence
as described by Okamura et al (Proc. Natl. Acad. Sci. USA,
82, 5705-5709, 1985) from positions 173 to 194. The oligomer
ADX-1 contains at the 5' end 18 additional nucleotides to
create a SalI restriction site, an optimal yeast translation
signal and an ATG initiation codon.
The oligomer ADX-2 (5'-TGT AAG GTA CCC GGG ATC
CTT ATT CTA TCT TTG AGG AGT T-3') is complementary to
the 3'end of the minus strand of ADXcDNA from position 561
~34a6~~
- 52 -
to 540 and contains additional nucleotides for creating
restriction sites for BamHI, SmaI and KpnI.
The PCR was performed as described in example 18 with
1~M of each ADX-primers and 10 ~1 mRNA/cDNA mixture (as
described in example 1) as template.
A schematic view of this ADXcDNA amplification is
shown in figure 38.
The amplified fragment contains a full-length ADXcDNA
sequence with modified flankings, which was characterized by
restriction-site analysis and nucleotide sequencing.
(b) Construction of the expression vector
The amplified ADXcDNA fragment was digested with SalI
and SmaI and inserted by molecular cloning into the yeast
expression vector pGB950 cut with SalI and EcoRV. The
derived plasmid pGBADX-1 is depicted in figure 38.
(c) Transformation of K.lactis
15 ug of pGBADX-1 was cut at the unique SacII-site in
the lactase promoter and transformation of K.lactis CBS
2360 was performed as described in example 5(c).
(d) Analysis of the transformants
Two transformants, ADX-101 and ADX-102 and the
control strain CBS 2360 were selected for further analysis.
The strains were grown in YEPD-medium for about 64 hrs at
30°C. Total cellular protein was isolated as described in
example 5(d). From the supernatants 8 ~C1 samples were taken
for analysis on immunoblots (see figure 39, lane 3, 4 and
5) .
The results show that a protein of the expected
- 53 -
~3~QSls
length (14 kDa) is expressed in K.lactis cells transformed
with pGBADX-1.
The i~r vitro ADX-activity of transformant ADX-102 is
described in example 24.
Example 24
In vitro activity of adrenodoxin obtained from Kluyveromyces
lactis ADX-102
K.lactis ADX-102, obtained as described in example 23,
and control strain K.lactis CBS 2360 were grown in 100 ml
YEPD medium (1% yeast extract, 2% peptone, 2% glucose
monohydrate) containing 2.5 ml of a 6.7% (w/w) yeast
nitrogen base (Difco laboratories) solution and 100 mg 1 1
of geneticin (G418 sulphate: Gibco Ltd.), for 56 hours at
30°C. The cells were collected by centrifugation (4000xg,
15 minutes), resuspended in a physiological salt solution
and washed with a phosphate buffer (pH 7.0, 50 mM). After
centrifugation (4000xg, 15 minutes) the pellet was
resuspended in a phosphate buffer (pH 7.0, 50 mM) resulting
in a suspension containing 0.5 g cell wet weight/ml. The
cells were disrupted using a Braun MSINHomogenizer (6 x 15
seconds, 0.45 - 0.50 mm glass beads). Unbroken cells were
removed by centrifugation (4000xg, 15 minutes). The cell
free extracts (40 mg protein/ml) were stored at -20°C.
ADX activity, i.e. electrontransfer capacity from
adrenodoxin reductase to cytochrome P450SCC, in the cell-
free extracts was determined by a P450SCC activity assay.
The assay mixture consisted of the following solutions:
Solution A (natural P450SCC electron donating system
with the exception of ADX): a 50 mM potassium phosphate
buffer (pH 7.0), containing 3 mM of EDTA, 2 ~M of
adrenodoxin reductase (purified from bovine adrenal cortex),
- 54 - 6
1 mM NADPH (electron donor), 15 mM glucose-6-phosphate and
16 units/ml glucose-6-phosphate-dehydrogenase (NADPH
regenerating system).
Solution B (substrate and enzyme): a micellar solution
of 75 uM of cholesterol (doubly radiolabeled with
[26,27-14C] cholesterol (40 Ci/mol) and [7a-3H] cholesterol
(400 Ci/mol) ) and 1.5 uM of P450SCC (purified from bovine
adrenal cortex) in 10% (v/v) Tergitol~ NP 40/ethanol (1:1,
v/v) .
The assay was started by mixing 75 ~1 of solution A
with 50 ~1 of solution B and 125 ~l of cell-free extract or
125 ~cl of a potassium phosphate buffer (50 mM, pH 7.0)
containing 10 ~,M ADX (purified from bovine adrenal cortex).
The mixture was stirred gently at 30'C. Samples were drawn
after 15 minutes of incubation and diluted with 100 ul of
water. From a sample substrate and products) were extracted
with 100 ~1 of methanol and 150 ~,1 of chloroform.
After centrifugation (5000xg, 2 minutes) the chloroform
layer was collected and dried. The dry residue was dissolv a
in 50 ~cl of acetone, containing 0.5 mg of a steroid mixture
(cholesterol, pregnenolone and progesterone (1:1:1, w/w/w))
and subsequently..110 ~1 of concentrated formic acid was
added. The suspension was heated for 15 minutes at 120°C.
Hereafter the 14C/3H ratio was determined by double label
liquid scintillation counting. The ratio is a direct measure
for the side chain cleavage reaction, because the 14C-
labeled side chain is evaporated from the mixture as iso-
caprylic acid during the heating procedure.
Using this assay ADX electron carrier activity could
easily be demonstrated in the cell-free extract of K.lactis
ADX102. In the assays with cell-free extract of K.lactis
ADX-102 or with purified ADX, the side chain of the
cholesterol was cleaved within 15 minutes in a yield of 50a
whereas in the assay with cell-free extract of the control
l3~osi6
- 55 -
strain K.lactis CBS 2360 no side chain cleavage could be
detected.
Example 25
Molecular cloning and construction of a full-length cDNA
encoding the bovine adrenodoxin oxidoreductase (ADR), and
subsequent transformation of ADRcDNA in the yeast Kluyver-
omyces lactis
(a) Molecular cloning of adrenodoxin oxidoreductase
A bovine adrenal cortex cDNA library was prepared as
described in example 1 with one modification. An additional
ADR-specific primer (oligomer ADR-1) with the nucleotide
sequence 5'-GGC TGG GAT CTA GGC-3' was added to the
reaction mixture of the first strand cDNA synthesis.
Oligomer ADR-1 is located just downstream the translation
stopcodon from position 1494 to 1480. Nucleotide sequences
and map positions of mentioned ADR-oligomers are all derived
from the ADRcDNA sequence data described by Nonaka et al,
Biochem. Biophys. Res. Comm. 145(3), 1239-1247, 1987.
Obtained cDNA library was screened with a 32P-labeled
oligomer ADR-2 (5'-CAC CAC ACA GAT CTG GGG GGT CTG
CTC CTG TGG GGA-3').
4 hybridizing pfu's were identified and subsequently
purified. However only 1 pfu showed also a positive signal
with oligomer ADR-3 (5'-TTC CAT CAG CCG CTT CCT CGG
GCG AGC GGC CTC CCT-3'), which is located in the middle
of the ADRcCDNA (position 840 to 805). The ADRcDNA insert
(approx. 2 kb) was molecular cloned into the EcoRI-site of
pTZl8R.
The obtained plasmid pGBADR-Y contains a full-length
ADRcDNA as revealed by restriction enzyme mapping and
- 56 -
nucleotide sequencing. The physical map of pGBADR-1 is
illustrated in figure 40.
(b) Construction of the expression cassette
A full-length ADRcDNA with modified flanking sequences
to the yeast expression vector pG8950 was obtained by the
PCR method (see example 18) with pGBADR-1 as template and
two specific ADR-oligomers as primers.
Oligomer ADR-4 (5'-CGA GTG TCG ACA AAA ATG TCC
ACA CAG GAG CAG ACC-3') contains 18 bases complementary
to the mature ADRcDNA sequences from position 96 to 114 and
18 bases to introduce a SalI restriction site, an optimal
yeast translation signal, and an ATG initiation codon.
Oligomer ADR-5 (5'-CGT GCT CGA GGT ACC TCA GTG
CCC CAG CAG CCG CAG-3') contains 18 bases complementary
to the minus strand of ADRcDNA upstream the translation
stopcodon at position 1479 and 15 bases to create KpnI and
XhoI restriction sites for molecular cloning in various
expression vectors.
After amplification with above mentioned template and
ADR primers, the amplified fragment (1.4 kb) was digested
with SalI and XhoI and inserted by molecular cloning into
the yeast expression vector pGB950 cut with SalI and XhoI.
The derived plasmid pGBADR-2 is illustrated in
figure 40.
(c) Transformation of K.lactis
15 ~,g of pGBADR-2 was cut at the unique SacII-site in
the lactase promoter and transformation of K.lactis CBS 2360
was performed as described in example 5(c).
~34061~
- 57 -
Example 26
Molecular cloning of a full-length cDNA encoding bovine
NADPH-cytochrome P450 reductase (RED)
The bovine adrenal cortex cDNA library described in
example 1 was screened with a 32P-labeled synthetic oligomer
5'-TGC CAG TTC GTA GAG CAC ATT GGT GCG TGG CGG GTT AGT GAT
GTC CAG GT-3', specific for a conserved amino acid region
within rat-, porcine- and rabbit RED as described by Katagari
et al. (J. Biochem., 100, 945-954, 1986) and Murakami et al.
(DNA, 5, 1-10, 1986).
Five hybridizing pfu's were obtained and further char-
acterized by restriction enzyme mapping and nucleotide se-
quencing. A full-length REDcDNA was inserted into expres-
sion vectors and transformed to appropriate hosts as men-
tinned in examples 2, 3 and 6.
Example 27
Construction, transformation and expression of an expression
cassette encoding the proteins P450SCC and ADX in the yeast
Kluyveromyces lactis
(a) Construction of the expression cassette
The expression cassette pGBADX-1 (see example 23) was
digested with SacII and HindIII (partially) and sticky ends
were filled in using Klenow DNA polymerase. The DNA fragment
comprising a part of the lactase promoter (but still func-
tional), the coding ADX sequence and the lactase terminator
was separated and isolated by agarose-gel electrophoresis and
subsequently inserted into pGBSCC-7, which was first linear-
ized by XbaI digestion (see example 5(b)) and sticky ends
filled in using Klenow DNA-polymerase. The construction was
set up in such a manner that a unique restriction site
(SacII) is obtained which is necessary to transfer the
plasmid to K.lactis.
This unique SacII restriction site is located in the lactase
58 - 1~~0616
promoter sequence flanking the SCC sequence, as the SacII
restriction site in the lactase promoter flanking the ADX
sequence is destroyed by the fill-in reaction.
The obtained expression cassette pGBSCC/ADX-1 contains the
coding sequence for SCC as well as for ADX, each driven by
the lactase promoter.
(b) Transformation of K.lactis
Transformation of K.lactis CBS 2360 was performed as
described in example 5(c) with 15 ~g pGBSCC/ADX-1,
linearized at the unique SacII restriction site. One
transformant (SCC/ADX-101) was selected for SCC and ADX
expression studies.
(c) Analysis of the transformant K.lactis SCC/ADX-101
Cellular protein fractions were prepared from cultures
of the SCC/ADX-101 and the control strain CBS 2360 as
described in example 5(d) and analyzed by SDS/PAGE and
Western-blotting. The blot was probed with antibodies
specific for SCC and ADX, respectively.
Compared to the control strain, the cellular protein
fraction of transformant SCC/ADX-101 shows two additional
bands of expected length (53 and 14 kDa, respectively)
showing the expression of both proteins SCC and ADX.
Expression levels of both proteins in transformant
SCC/ADX-101 are comparable with levels observed in
transformants expressing only one protein (for SCC see
figure 15A, lane 3, and for ADX figure 39, lane 5).
The in vitro SCC and ADX activity of transformant
SCC/ADX-101 is described in example 28.
1340616
59
Example 28
In vitro activity of P45pSCC and adrenodoxin obtained from
Kluyveromyces lactis SCC/ADX-101
K.lactis SCC/ADX-101 obtained as described in
example 27 and control strain K.lactis SCC-101 as described
in example 5 (d) were grown in 1 1 of YEPD medium (1% yeast
extract, 2% peptone, 2% glucose monohydrate) containing 100
mg 1-1 of geneticin (G418 sulphate; Gibco Ltd.), for 72
hours at 30°C. The cells were collected by centrifugation
(4000xg, 15 minutes), resuspended in a physiological salt
solution and washed with a phosphate buffer (pH 7.5, 75
mM). After centrifugation (4000xg, 15 minutes) the pellet
was resuspended in a phosphate buffer (pH 7.5, 75 mM)
resulting in a suspension containing 0.5 g cell wet
weight/ml. The cells were disrupted using a Braun MSK
Homogenizer (6 x 15 seconds, 0.45 - 0.50 mm glass beads).
Unbroken cells were removed by centrifugation (4000xg, 15
minutes).
In the cell-free extracts the activity of the
protein complex P450SCC/ADX was assayed, by determining the
cholesterol side chain cleaving reaction in the presence of
NADPH and ADR. The assay mixture consisted of the following
solutions:
Solution A (natural P450SCC electron donating
system with the exception of ADX): a 50 mM potassium
phosphate buffer (pH 7.0), containing 3 mM of EDTA, 2 uM of
adrenodoxin reductase (purified from bovine adrenal
cortex), 1 mM NADPH (electron donor), 15 mM glucose-6-
,",~ .
1340616
59a
phosphate and 16 units/ml glucose-6-phosphate-dehydrogenase
(NADPH regenerating system).
Solution B (substrate): a micellar solution of
37,5 ~.M of cholesterol (doubly radiolabeled with
[26,27-14C] cholesterol (40 Ci/mol) and [7a-3H) cholesterol
(400 Ci/mol) )
- 1340616
in 10% (v/v) TergitolTM NP 40/ethanol (1:1, v/v).
The assay was started by mixing 75 ~1 of solution A
with 50 ~cl of solution B and 125 ~1 of cell-free extract.
The mixture was stirred gently at 30°C. Samples were drawn
after 60 minutes of incubation and diluted with 100 ~,1 of
water. From a sample substrate and products) were extracted
with 100 ~1 of methanol and 150 ~1 of chloroform.
After centrifugation (5000xg, 2 minutes) the chloroform
layer was collected and dried). The dry residu was dissolved
in 50 ~,1 of acetone, containing 0.5 mg of a steroid mixture
(cholesterol, pregnenolone and progesterone (1:1:1, w/w/w))
and subsequently 110 ~,1 of concentrated formic acid was
added.
The suspension was heated for 15 minutes at 120°C. Hereafter
the 14C/3H ratio was determined by double label liquid
scintillation counting. The ratio is a direct measure for
the side chain cleaving reaction, because the 14C-labeled
side chain is evaporated from the mixture as isocaprylic
acid during the heating procedure.
Using this assay cholesterol side chain cleaving activity
was demonstrated in the cell-free extract of K.lactis
SCC/ADX-101, whereas in the cell-free extract of K.lactis
SCC-101 no activity was detectable.
By means of HPLC-analysis, the reaction product produced by
a cell-free extract of K.lactis SCC/ADX-101 was identified
as pregnenolone.
