C-ADN CODANT LA SUPEROXYDASE-DISMUTASE DE MANGANESE HUMAINE, SON EXPRESSION DANS LES BACTERIES ET METHODE POUR RECUPERER LA SUPEROXYDASE-DISMUTASE DE MANGANESE HUMAINE AYANT UNE ACTION ENZYMATIQUE

HUMAN MANGANESE SUPEROXIDE DISMUTASE CDNA, ITS EXPRESSION IN BACTERIA AND METHOD OF RECOVERING ENZYMATICALLY ACTIVE HUMAN MANGANESE SUPEROXIDE DISMUTASE

Abrégé français

Une molécule d’ADNc à double brin, comprenant un ADN codant le manganèse superoxyde dismutase de l’homme, a été créée. La séquence d’un brin d’une molécule d’ADN à double brin, codant le manganèse superoxyde dismutase de l’homme, a été découverte. Ces molécules peuvent être introduites dans des cellules procaryotiques, p.ex. bactériennes, ou eukaryotiques, p.ex. de la levure ou de mammifères, et les cellules résultantes sont cultivées dans des conditions appropriées pour produire du manganèse superoxyde dismutase de l’homme, ou des substances analogiques de celui-ci, qui peuvent ensuite être récupérées. Le MnSOD de l’homme, ou des produits analogiques de celui-ci peuvent être utilisés pour catalyser la réduction de radicaux de superoxydes, réduire des lésions par reperfusion, prolonger la survie d’organes isolés, ou traiter des inflammations. Cette invention porte également sur une méthode de production de manganèse superoxyde dismutase de l’homme enzymatiquement actif, ou produit analogue, dans une cellule bactérienne contenant, et capable d’exprimer, une séquence d’ADN codant le superoxyde dismutase en maintenant la cellule bactérienne dans une condition appropriée et dans un milieu de production approprié. Au milieu de production on ajoute une quantité de Mn++, de sorte que la concentration de Mn++ dans le milieu soit supérieur a environ 2 ppm. Cette invention porte également sur une méthode de récupération du manganèse superoxyde dismutase enzymatiquement actif dans des cellules bactériennes.

Abrégé anglais

A double-stranded cDNA molecule which includes DNA
encoding human manganese super oxide dismutase has been
created. The sequence of one strand of a double-
stranded DNA molecule which encodes human manganese
superoxide dismutase has been discovered. Such mole-
cules may be introduced in procaryotic, e.g., bacteri-
al, or eukaryotic, e.g. , yeast or mammalian, cells and
the resulting cells cultured or grown under suitable
conditions sa as to produce human manganese superoxide
dismutase or analogs thereof which may then be recov-
ered. Human MnSOD or analogs thereof may be used to
catalyze the reduction of superoxide radicals, reduce
reperfusion injury, prolong the survival time of iso-
lated organs, or treat inflammations.
The invention also concerns a method of producing enzy-
matically active human manganese superoxide dismutase
or an analog thereof in a bacterial cell which contains
and is capable of expressing a DNA sequence encoding
the superoxide dismutase by maintaining the bacterial
cell under suitable conditions and in a suitable pro-
duction medium. The production medium is supplemented
with an amount of Mn++ so that the concentration of
Mn++ in the medium is greater than about 2 ppm.

This invention also concerns a method of recovering
purified enzymatically active manganese super oxide
dismutase from bacterial cells.

Revendications

-43-
THE EMBODIMENTS OF THE INVENTION IN WHICH AN EXCLUSIVE
PROPERTY OR PRIVILEGE IS CLAIMED ARE DEFINED AS FOLLOWS
1. A plasmid for expression in a suitable bacterial host cell
of an enzymatically active human manganese superoxide dismutase
analog wherein the analog consists of at least two polypeptides
each comprising 199 amino acids, the sequence of each polypeptide
having methionine at its N-terminus immediately adjacent to the
lysine encoded by nucleotides 115-117 of Fig. 1 and continuing
to the lysine encoded by nucleotides 706-708 of Fig. 1 which is
the COOH terminus of the polypeptide, the plasmid comprising DNA
encoding such polypeptide and suitable regulatory elements
arranged within the plasmid so as to permit expression of the
polypeptide and formation of the human manganese superoxide
dismutase analog in the host cell.
2. A plasmid according to claim 1, designated pMSE-4, having
the restriction map shown in Fig. 2 and deposited in
Escherichia coli strain A4255 under ATCC Accession No. 52350.
3. A plasmid according to claim 1, designated pMS.DELTA.RB4, and
having the restriction map shown in Fig. 4.
4. A bacterial cell into which the plasmid of claim 1 has been
introduced.
5. A bacterial cell according to claim 4 containing the plasmid
pMSE-4 and deposited under ATCC Accession No. 53250.
6. A bacterial cell according to claim 4 containing the plasmid
pMS~RB4.
7. A method of producing a human manganese superoxide dismutase
polypeptide which comprises treating a bacterial cell of claim 4 so
that the DNA directs expression of the human manganese superoxide
dismutase polypeptide in the bacterial cell and recovering from the
bacterial cell the human manganese superoxide dismutase polypeptide
so expressed.
8. A bacterially-produced polypeptide analog of human manganese
superoxide dismutase of 199 amino acids comprising methionine
attached to the N-terminus of a portion of the amino acid sequence

-44-
of Fig. 1 the sequence of which is lysine encoded by nucleotides
115-117 of Fig. 1 and continuing to the lysine encoded by
nucleotides 706-708 of Fig. 1 which is the COOH terminus of the
polypeptide.
9. An analog of human manganese superoxide dismutase comprising
two polypeptides, each in accordance with claim 8.
10. A method of producing a human manganese superoxide dismutase
in accordance with claim 9 which comprises treating a bacterial
cell containing DNA encoding and capable of directing expression of
human manganese superoxide dismutase polypeptide so that the
bacterial cell expresses the polypeptide and forms human manganese
superoxide dismutase therefrom, and recovering from the bacterial
cell the superoxide dismutase so expressed and formed.
11. Human manganese superoxide dismutase analog resulting from the
expression in bacteria of the DNA sequence shown in Fig. 1 from
nucleotide number 115 to nucleotide number 708.
12. A veterinary composition comprising human manganese
superoxide dismutase in accordance with claim 9 and a
carrier.
13. A pharmaceutical composition comprising human manganese
superoxide dismutase in accordance with claim 9 and a
carrier.
14. A method of catalyzing the reaction
<IMG>
which comprises contacting the reactants with human manganese
superoxide dismutase in accordance with claim 9.
15. A method of reducing injury to cells caused by superoxide
radicals in vitro, which comprises catalyzing the reduction of
the superoxide radicals in accordance with claim 14.

-45-
16. A method of prolonging the survival period of excised
isolated organs which comprises adding human manganese
superoxide dismutase in accordance with claim 9 to the
perfusion medium.
17. A method of producing an enzymatically active human
manganese superoxide dismutase in a bacterial cell which contains
and is capable of expressing the superoxide dismutase having
methionine at its N-terminus immediately adjacent to the lysine
encoded by nucleotides 115-117 of Fig. 1 and continuing to the
lysine encoded by nucleotides 706-708 of Fig. 1 which comprises
maintaining the bacterial cell in a production medium
supplemented with an amount of Mn++ so that the concentration of
Mn++ in the medium is greater than about 2 ppm.
18. A method according to claim 17, wherein the bacterial
cell is an Escherichia coli cell.
19. A method according to claim 17, wherein the bacterial
cell contains a plasmid, the plasmid containing the DNA
sequence encoding the human manganese superoxide dismutase
incorporated therein.
20. A method according to claim 17, wherein the suitable
production medium is a casein hydrolysate medium.
21. A method according to claim 17, wherein the suitable
production medium is LB medium.
22. A method according to claim 17, wherein the Mn++
concentration is from 50 to 1500 ppm.
23. A method according to claim 22, wherein the Mn++
concentration is 150 ppm.
24. A method according to claim 22, wherein the Mn++
concentration is 750 ppm.

-46-
25. A method according to claim 18, wherein the bacterial
cell is Escherichia coli strain A4255 containing plasmid pMSE-
4 and deposited under ATCC Accession No. 53250.
26. A method according to claim 19, wherein the plasmid is
pMSE-4 having the restriction map shown in Fig. 2 and deposited
under ATCC Accession No. 53250.
27. A method according to claim 18, wherein the bacterial
cell is Escherichia coli strain A4255 containing plasmid
pMS.DELTA.RB4 having the restriction map shown in Fig. 4.
28. A method according to claim 19, wherein the plasmid is
pMS.DELTA.RB4 having the restriction map shown in Fig. 4.
29. Bacterially-produced human manganese superoxide dismutase
produced by the method of claim 17.
30. A method of recovering human manganese superoxide dismutase
from bacterial cells harboring cloning vehicles which express human
manganese superoxide dismutase having methionine at its N-
terminus immediately adjacent to the lysine encoded by
nucleotides 115-117 of Fig.1 and continuing to the lysine
encoded by nucleotides 706-708 of Fig. 1 which comprises:

-47-
(a) isolating the bacterial cells from the production
medium;
(b) suspending the isolated bacterial cells in a
buffered solution;
(c) disrupting the suspended bacterial cells;
(d) separating soluble proteins from insoluble proteins
and cell wall debris;
(e) recovering the soluble proteins;
(f) separating a fraction of the soluble proteins
containing the human manganese superoxide dismutase;
(g) recovering the fraction of soluble proteins
containing the human manganese superoxide dismutase;
and
(h) treating the fraction of soluble proteins containing
the human manganese superoxide dismutase so as to
separately recover the human manganese superoxide
dismutase.
31. A method of claim 30 wherein the buffered solution
in step (b) has a pH of 7.0 t.o 3.0;
and wherein step (d) comprises centrifuging the
disrupted bacterial cells obtained in (c) to obtain
a supernatant containing said soluble proteins;
and wherein step (e) comprises recovering the
supernatant;
and wherein step (f) comprises:

(i) heating the supernatant obtained in (e)
for a period ranging from 30 to 120
minutes at a temperature ranging from 55
to 65°C;
(ii) cooling the heated supernatant to below
10°C;
and wherein step (g) comprises:
(i) removing any precipitate from the cooled
supernatant obtained in (f); and
(ii) dialyzing the cooled supernatant;
and wherein step (h) comprises:
(i) subjecting the supernatant obtained in
step (g) to anion exchange chromatography
wherein the retentate is eluted with a
buffered solution;
(ii) collecting and pooling fractions of the
eluent containing human manganese
superoxide dismutase;
(iii) dialyzing the pooled fractions against 40
mM potassium acetate, pH 5.5;
(iv) eluting the dialyzed pooled fractions
through a cation exchange chromatography
column with a linear gradient of 40 to 200
mM potassium acetate, pH 5.5; and
(v) collecting and pooling peak fractions of
the eluent containing superoxide
dismutase.
32 . A method according to Claim 31, wherein step (f) (i)
comprises heating for 45 to 75 minutes at 58 to
62°C.
33. A method according to claim 31, wherein step (f)(i)
comprises heating for 60 minutes at 60°C.

-49-
34. A method according to claim 31, wherein step (f)(ii)
comprises cooling to 4°C.
35. A method according to claim 31, wherein in step
(g)(i) the precipitate is removed by centrifugation.
36. A method according to claim 31, wherein the
dialyzing in step (g)(ii) comprises ultra-filtration
employing a filtration membrane smaller than 30K.
37. A method according to claim 31, wherein the
dialyzing in step (g)(ii) is carried out against a 2
mM potassium phosphate buffer with a pH of about
7.8.
38. A method according to claim 31, wherein in step
(h)(i) the buffered solution is a 2 mM potassium
phosphate buffer with a pH of about 7.8.
39. A method according to claim 31, wherein the dialyzed
supernatant obtained in step (g)(ii) is concentrated
to a smaller volume.
40. A method according to claim 39, wherein the smaller
volume is 0.03 of the supernatant's original volume.
41. A method according to claim 31 wherein step (h)(v)
further comprises dialyzing the pooled peak
fractions.
42. A method according to claim 41 wherein the dialyzing
is carried out against a solution of 10mm potassium
phosphate buffer having a pH of 7.8.
43. Human manganese superoxide dismutase purified by the
method of claim 30.

-50-
44. A non-naturally-occurring molecule having human
superoxide dismutase activity comprising a human
manganese superoxide dismutase polypeptide of claim
8.
45. A polypeptide manganese complex comprising a human
manganese superoxide dismutase polypeptide of claim
8 in a complex with manganese in any of its
chemmical forms, which complex has the enzymatic
activity of naturally-occurring human manganese
superoxide dismutase.
46. A purified human manganese superoxide dismutase
analog according to claim 9, having a specific
activity greater than about 3500 units/mg.
47. Use of the human manganese superoxide dismutase
analog according to claim 9, for reducing injury to
cells caused by superoxide radicals, or for
preparing a medicament therefor.

Description

1341362
HUMAN MANGANESE SUPEROXIDE DISMUTASE cDNA,
ITS EXPRESSION IN BACTERIA AND
METHOD OF RECOVERING ENZYMATICALLY ACTIVE
HUMAN MANG$NESE SUPEROXIDE DIS~~;fTASE
Throughout this appl ication, various publ ications are
referenced by arabic numerals within parentheses. Full
citations for these references may be found at the end
of the specification immediately preceding the claims.
Superoxide dismutase (SOD) and the phenomenon of oxygen
free radicals (02-) was discovered in 1968 by McCord
and Fridovich (1). Superoxide radicals and other high-
ly reactive oxygen species are produced in every re-
spiring cell as by-products of oxidative damage to a
wide variety of macromolecules and cellular components
( for review see 2,3) . A group of metalloproteins known
as superoxide dismutases catalyze the oxidation-reduc-
tion reaction 202= + 2H+ ~ H202 + 02 and thus
provide a defense mechanism against oxygen toxicity.

~ 3413fi2
-2-
There are several known forms of SOD containing differ
ent metals and different proteins. Metals present in
SOD include iron, manganese, copper and zinc. All of
the known forms of SOD catalyze the same reaction.
These enzymes are found in several evolutionary groups.
Superoxide dismutases containing iron are found pri
marily in prokaryotic cells. Superoxide dismutases
containing copper and zinc has been found in virtually
all eukaryotic organisms (4). Superoxide dismutases
containing manganese have been found in organisms rang
lo ing from microorganisms to man.
Since every biological macromolecule can serve as a
target for the damaging action of the abundant
superoxide radical, interest has evolved in the thera-
peutic potential of SOD. The scientific literature
s ugge st s that SOD may be usef u1 in a w ide r ange of
clinical applications. These include prevention of
oncogenesis and of tumor promotion, and reduction of
the cytotoxic and cardiotoxic effects of anticancer
2o drugs (10) , protection of ischemic tissues (12) and
protection of spermatozoa (13) . In addition, there is
interest in studying the effect of SOD on the aging
process (14) .
~5 The exploration of the therapeutic potential of human
SOD has been 1 invited mainly due to its 1 invited avail-
abil ity.
Superoxide dismutase is also of interest because of its
:3o anti-inflammatory properties (11) . Bovine-derived su-
peroxide dismutase (orgotein) has been recognized to
possess anti-inflammatory properties and is currently
marketed in parts of Europe as a human pharmaceutical.
It is also sold in the United States as a veterinary

134132
-3-
product, particularly for the treatment of inflamed
tendons in horses. However, suppl ies of orgotein are
limited. Prior techniques involving recovery from
bovine or other animal cells have serious limitations
and the orgotein so obtained may produce allergic reac
Lions in humans because of its non-human origin.
Copper zinc superoxide dismutase (CuZn SOD) is the most
studied and best characterized of the various forms of
superoxide dismutase.
io
Human CuZn SOD is a dimer is metall ic-pr otein composed
of identical non-covalently linked subunits, each hav-
ing a molecular weight of 16,000 dal tons and containing
one atom of copper and one of zinc ( 5) . Each subunit
i5 is composed of 153 amino acids whose sequence has been
established (6,7) .
The cDNA encoding human CuZn superoxide dismutase has
been cloned (8) . The complete sequence of the cloned
2o DNA has also been determined (9) . Moreover, expression
vectors containing DNA encoding superoxide dismutase
for the production and recovery of superoxide
dismutase in bacteria have been described (24,25) . The
expression of a superoxide dismutase DNA and the pro-
25 duction of SOD in yeast has also been disclosed (26) .
Recently, the CuZn SOD gene locus on human chromosome
21 has been characterized (27) and recent developments
relating to CuZn superoxide dismutase have been summa
3o rized (28) .
Much less is known about manganese superoxide dismutase
(MnSOD) . The MnSOD of E. coli R-12 has recently been
cloned and mapped (22) . Barra et al. disclose a 196

~ 34~ 362
- 4-
amino acid sequence for the MnSOD polypeptide isolated
from human liver cells (19) . Prior art disclosures
differ, however, concerning the structure of the MnSOD
molecule, particularly whether it has two or four iden-
tical polypeptide subunits (19,23) . It is clear, how-
ever, that the MnSOD of tide and the CuZn SOD
P YPeP
polypeptide are not homologous (19) . The amino acid
sequence homologies of MnSODs and FeSOD from various
sources have also been compared (18) .
Baret et al. disclose in a rat model that the half life
of human MnSOD is substantially longer than the half-
1 ife of human copper SOD; they also disclose that in
the rat model, human MnSOD and rat copper SOD are not
effective as anti-inflammatory agents whereas bovine
copper SOD and human copper SOD are fully active (20) .
McCord et al. disclose that naturally occurring human
manganese superoxide dismutase protects human phagocy-
tosing polymorghonuclear (PMN) leukocytes from super-
oxide free radicals better than bovine or porcine CuZn
superoxide dismutase in "in vitro" tests (21) .
The present invention concerns the preparation of a
cDNA molecule encoding the human manganese super oxide
'S dismutase polypeptide or an analog or mutant thereof.
It is also directed to inserting this cDNA into effi-
cient bacterial expression vectors, to producing human
MnSOD polypeptide, analog, mutant and enzyme in bacte-
ria, to recovering the bacterially produced human
MnSOD polypegtide, analog, mutant or enzyme. This in-
vention is also directed to the human MnSOD
golypeptides, analogs, or mutants thereof so recovered
and their uses.
:~ 5

1341362
- 5 -
This invention further provides a method for producing
enzymatically active human MnSOD in bacteria, as well as
a method for recovering and purifying such enzymatically
active human MnSOD.
The present invention also relates to using human
manganese superoxide dismutase or analogs or mutants
thereof to catalyze the reduction of superoxide radicals
to hydrogen peroxide and molecular oxygen. In
particular, the present invention concerns using
l0 bacterially produced MnSOD or analogs or mutants thereof
to reduce reperfusion injury following ischemia and
prolong the survival period of excised isolated organs.
It also concerns the use of bacterially produced MnSOD or
analogs thereof to treat inflammations.
BRIEF LIST OF DRAWINGS
Figure 1: The nucleotide sequence of DNA encoding human
MnSOD analog and corresponding amino acid sequence is
shown.
Figure 2: The construction of the ampicillin-resistant
plasmid pMSE-4 for expression of MnSOd is shown.
Figure 3: The dependence of SOD activity of MnSOD
produced by plasmid pMSE-4 on the manganese
concentration in the growth medium is shown.
Figure 4: The construction of the tetracycline-resistant
'~5 plasmid pMSGRB4, which is a high expressor of MnSOD, is
shown.

13413fi2
-6-
A DNA molecule which includes cDNA encoding the human
manganese superoxide dismutase polypeptide or analog
or mutant thereof has been isolated from a human T-cell
library. The nucleotide sequence of a double-stranded
DNA molecule which encodes human manganese superoxide
dismutase polypeptide or analog or mutant thereof has
been discovered. The sequence of one strand encoding
the polypeptide or analog thereof is shown in Fig. 1
1o fr~n nucleotide 115 downstream to nucleotide 7 08
inclusive. Other sequences encoding the analog or
mutant may be substantially similar to the strand
encoding the polypeptide. The nucleotide sequence of
one strand of a double stranded DNA molecule which
encodes a twenty-four (24) amino acid prepeptide is
also shown in Fig. 1, from nucleotides number 43
through 114, inclusive.
The double-stranded cDNA molecule or any other double
stranded DNA molecule which contains a nucleotide
strand having the sequence encoding the human manganese
superoxide dismutase polypeptide or analog or mutant
thereof may be incorporated into a cloning vehicle
such as a plasmid or virus. Either DNA molecule may
be introduced into a cell, either procaryotic, e.g. ,
bacterial, or eukaryotic, e.g.. yeast or mammalian,
using known methods, including but not 1 invited to
methods involving cloning vehicles containing either
molecule.
Preferably the cDNA or DNA encoding the human manganese
superoxide dismutase polypeptide or analog or mutant
thereof is incorporated into a plasmid, e.g. , pMSE-4 or
pMSORB4, and then introduced into a suitable host cell

1 34~ 362
_,_
where the DNA can be expressed and the human manganese
superoxide dismutase (hMnSODI polypeptide or analog or
mutant thereof produced. Preferred host cells include
Escherichia col i, in particular E. col i A4255 and
~oli A1645. The plasmid pMSE-4 in E. coli strain A4255
has been deposited with the American Type Culture
Collection under ATCC Accession No. 53250. The plasmid
pMS~RB4 may be obtained as shown in FIG. 4 and de-
scribed in the Description of the Figures.
1o Cells into which such DNA molecules have been intro-
duced may be cultured or grown in accordance with meth-
ods known to those skilled in the art under suitable
conditions permitting transcription of the DNA into
mRNA and expression of the mRNA as protein. The re-
sulting manganese superoxide dismutase protein may then
be recovered.
Veterinary and pharmaceutical compositions containing
human MnSOD or analogs or mutants thereof and suitable
2o carriers may also be prepared. This r~uman manganese
superoxide dismutase or analogs or mutants may be used
to catalyze the following reaction:
202= + 2H+ ~ H202 + 02
and thereby reduce cell injury caused by superoxide
radicals.
More particularly, these enzymes or analogs or mutants
3o thereof may be used to reduce injury caused by
reperfusion following ischemia, increase the survival
time of excised isolated organs, or treat
inflammations.
.35

~3413fi2
_8_
This invention is directed to a method of producing
enzymatically active human manganese superoxide
dismutase or an analog or mutant thereof in a bacterial
cell. The bacterial cell contains and is capable of
expressing a DNA sequence encoding the manganese
superoxide dismutase or analog or mutant thereof. The
method comprises maintaining the bacterial cell under
suitable conditions and in a suitable production
medium. The production medium is supplemented with an
amount of Mn++ so that the concentration of Mn++
1o available to the cell in the medium is greater than
about 2 ppm.
In a preferred embodiment of the invention the bacteri-
al cell is an Escherichia-,coli cell containing a plas-
mid which contains a DNA sequence encoding for the
human manganese superoxide dismutase polypeptide e. g.
pMSE-4 or pMS RB4 in E. col i strain A4255. The
concentration of Mn++ in the production medium ranges
from about 50 to about 1500 ppm, with concentrations of
150 and 750 ppm being preferred.
This invention
also concerns
a method
of recovering
manganese superoxide dismutase or analog thereof from
bacterial cells which contain the same. The cells are
first treated
to recover
a protein
fraction
containing
proteins present in the cells including human manganese
superoxide
dismutase
or analog
or mutant
thereof and
then the protein fraction is treated to recover human
manganese superoxide dismutase or analog or mutant
3o thereof. In a preferred embodiment of the invention,
the cell s are first treated to separate soluble
proteins from insoluble proteins and cell wall debris
and the soluble proteins are recovered. The soluble
proteins are then treated to separate, e.g.

1 ~~1~62
_g_
precipitate, a fraction of the soluble proteins
containing the hMnSOD or analog or mutant thereof and
the fraction containing the hMnSOD or analog or mutant
is recovered. The recovered fraction of soluble
proteins is then treated to separately recover the
human manganese superoxide dismutase or analog thereof.
A more preferred embodiment of the invention concerns a
method of recovering human manganese superoxide
dismutase or analog or mutant thereof frcxn bacterial
cells which contain human manganese superoxide
dismutase or analog or mutant thereof. The method
involves first isolating the bacterial cells from the
production medium and suspending them in suitable solu-
tion having a pH of about 7.0 to 8Ø The cells are
then disrupted and centrifuged and the resulting super-
natant is heated for about 30 to 120 minutes at a tem-
perature between 55 and 65°C, preferably for 45-75
minutes at 58-62°C and more preferably for 1 hour at
60°C and then cooled to below 10°C, preferably to 4°C.
Any precipitate which forms is to be removed e.g. by
centrifugation, and the cooled supernatant is dialyzed
against an appropriate buffer e.g. 2 mM potassium
phosphate buffer having a pH of about. 7.8. Pref-
erably, the dialysis is by ultrafiltration using a
filtration membrane smaller than 30R. Simultaneously
with or after dialysis the cooled supernatant optional-
ly may be concentrated to an appropriate convenient
vol ume e. g. 0 .03 of its or iginal vol ume. The
retentate is then eluted on an anion exchange chroma-
3o tography column with an appropriate buffered solution
e.g. a solution of at least 20 mM potassium phosphate
buffer having a pH of about 7.8. The fractions of
eluent containing superoxide dismutase are collected,
pooled and dialyzed against about 40 mM potassium ace

.~41 X62
-lo-
tate, pH 5.5. The dialyzed pooled fractions are then
eluted through a ration exchange chromatography column
having a linear gradient of about 40 to about 200 mM
potassium acetate and a pH of 5.5. The peak fractions
containing the superoxide dismutase are collected and
pooled. Optionally the pooled peak f ractions may then
be dialyzed against an appropriate solution e. g. water
or a buffer solution of about 10 mM potassium phosphate
buffer having a pH of about 7.8.
to
The invention also concerns purified enzymatically
active human manganese superoxide dismutase or analogs
thereof e.g. met-hMnSOD, or mutants produced by the
methods of this invention.
20
30

~ 3~~ 362
-11-
DESCRIP'~ O'L N OF THE FIGURES
FIG. 1. Tie Seguence of human ; n~, SOD_ cDNA
FIG. 1 shows the nucleotide sequence of one strand of a
double-stranded DNA molecule encoding the human manganese
superoxide dismutase as well as the 198 amino acid sequence
of human MnSOD corresponding to the DNA sequence. FIG. 1
also shows the nucleotide sequence of one strand of a double
stranded DNA molecule encoding a prepeptide to the mature
human MnSOD consisting of twenty-four amino acids and the
amino acid sequence corresponding to that DNA sequence.
Also shown are the 5' and 3' untranslated sequences.
FIG. 2. Constr,~ction of pMSE-4: Human MnSO~
ExpressioD Plasmid
Plasmid pMSB-4, containing MnSOD on an F~oRI (R~) insert,
was digested to completion with N eI and ~rI restriction
enzymes. The large fragment was isolated and ligated with
a synthetic oligomer as depicted in Fig. 2. The resulting
plasmid, pMSB-NN contains the coding region for the mature
MnSOD, preceded by an ATG initiation codon. The above
plasmid was digested with ,~oRI, ends were filled in with
Klenow fragment of Polymerase I and further cleaved with
NdeI. The small fragment harboring the MnSOD gene was
inserted into pSODal3 which was treated with ddeI and I.
pSODal3 may be obtained as described in pending co-assigned
Canadian Patent Application No. 488,832, filed August 15,
1985. This generated plasmid pMSE-4 containing the MnSOD
coding region preceded by the cII ribosomal binding site and
under the control of x P~ promoter. Plasmid pMSE-4 has been
deposited with the American Type Culture Collection under
ATGC Accession No. 53250.

~ 3~~ ~s2
-12-
FIG. 3 ~f~~~t 9f M~ + C~ntration on the
Act ivitv of SOD PrQr,~,iced in E. Coli
The chart in FIG. 3 shows the correlation between the
specific activity in units/mg of recombinant soluble
MnSOD produced by ~. coli strain A4255 containing
plasmid pMSE-4 under both non-induction (32oC) and
induction (42°C) conditions, and the concentration of
Mn++ (parts per million) in the growth medium.
io
FIG. 4 ons ~,~~,~on of pMS D RB4: Human MnSOD
Expression. Play
TetR expression vector, p~RB, was generated from
pSODSIT-11 by complete digestion with F,coRI followed by
partial cleavage with CHI restriction enzymes.
i5 pSODs 1T-11 has been deposited with the American Type
Culture Collection (ATCC) under Accession No. 5346$.
The digested plasmid was ligated with synthetic oligo-
mer
5'- AATTCCCGGGTCTAGATCT - 3'
Zo 3'- GGGCCCAGATCTAGACTAG - 5'
resulting in poRB containing the a. PL promoter.
The ~I fragment of MnSOD expression plasmid pMSE-4,
containing cII ribosomal binding site and the complete
''5 coding sequence for the mature enzyme, was inserted
into the unique SRI site of p~RB. The resulting
plasmid, pMS 4RB4, contains the MnSOD gene under con-
trol of a PL and cII RBS and confers resistance to
tetracycl ine.
:30
~5

13413fi2
-13-
A double-stranded DNA molecule which includes cDNA
encoding human manganese super oxide dismutase
polypeptide or an analog or mutant thereof has been
isolated from a human T-cell DNA library. The nucleo-
tide sequence of a double-stranded DNA molecule which
encodes human manganese superoxide dismutase
polypeptide or an analog or mutant thereof has been
discovered. The sequence of one strand of DNA mole-
1o cule encoding the human manganese superoxide dismutase
polypeptide or analog thereof is shown in Fig. 1 and
includes nucleotides numbers 115 to 708 inclusive. The
sequence of one strand encoding hMnSOD analog or mutant
is substantially similar to the stranc'l encoding the
h~SOD polypeptide. The nucleotide sequence of the
prepeptide of human manganese superoxide dismutase is
also shown in Fig. 1. Nucleotides numbers 43 through
114 inclusive code for this prepeptide.
2o The methods of preparing the cDNA and of determining
the sequence of DNA encoding the human manganese
super oxide dismutase polypeptide, analog or mutant
thereof are known to those skilled in the art and are
described more fully hereinafter. Moreover, now that
the DNA sequence which encodes the human manganese
superoxide dismutase has been discovered, known syn-
thetic methods can be employed to prepare DNA molecules
containing portions of this sequence.
3o Conventional cloning vehicles such as plasmids, e. g. ,
pBR322, viruses or bacteriophages, e. g. , a, can be
modified' or engineered using known methods so as to
produce novel cloning vehicles which contain cDNA
encoding human manganese superoxide dismutase

1 X41362
-14-
polypeptide, or analogs or mutants thereof. Similar
ly, such cloning vehicles can be modified or engineered
so that they contain DNA molecules, one strand of which
includes a segment having the sequence shown in Fig. 1
for human manganese superoxide dismutase polypeptide or
segments substantially similar thereto. The DNA mole-
cule inserted may be made by various methods including
enzymatic or chemical synthesis.
The resulting cloning vehicles are chemical entities
to
which do not occur in nature and may only be created by
the modern technology commonly described as recombinant
DNA technology. Preferably the cloning vehicle is a
plasmid, e. g. pMSE-4 or pMS RB4. These cloning vehi
cles may be introduced in cells, either procaryotic,
e.g., bacterial tEschericb~ coli, B.subtilis, etc.)
or eukaryotic, e. g. , yeast or mammal ian, using tech-
niques known to those skilled in the art, such as
transformation, transfection and the like. The cells
into which the cloning vehicles are introduced will
2o thus contain cDNA encoding human manganese super oxide
dismutase polypeptide or analog or mutant thereof if
the cDNA was present in the cloning vehicle or will
contain DNA which includes a strand, all or a portion
of which has the sequence for human MnSOD polypeptide
'5 shown in Fig. 1 or sequence substantially similar
thereto if such DNA was present in the cloning vehicle.
Escherichia ~oli are preferred host cells for the
cloning vehicles of this invention. A presently pre-
so (erred auxotrophic strain of ,~. r"~~ l is A1645 which has
been deposited with the American Type Culture Collec
tion in Rockville, Maryland, U. S. A. containing plasmid
pApoE-Ex2, under ATCC Accession No. 39787. All de
posits with the American Type Culture Collection re

13413fi2
-15-
ferred to in this application were made pursuant to the
Budapest Treaty on the International Recognition of the
Deposit of Microorganisms.
A1645 was obtained from A1637 by selection for Gal+
(ability to ferment galactose) as well as loss of tet-
racycl ine resistance. It still contains elements of
phage ~, . Its phenotype is C600 r m+ gals thr leu
lacZ b1 (a cI857 p Hl p BamHl N+) .
to A1637 was obtained from C600 by inserting transposon
containing tetracycl ine resistance gene into the galac
tose operon as well as elements of phage a including
those elements responsible for cI repressor synthesis.
C600 is available from the American Type Culture CoI
i5 -lection, as ATCC Accession No. 23724.
Prototrophic strains of Escherichi~ c~,,i which enable
high level polypeptide expression even when grown in a
minimal media are even- more preferred as hosts for
zo expression of genes encoding manganese super oxide
dismutase. One presently preferred prototrophic strain
is A4255. Strain A4255 containing the plasmid pMSE-4
has been deposited with the American Type Culture Col-
lection under ATCC Accession No. 53250.
The resulting cells into which DNA encoding human man-
ganese superoxide dismutase polypeptide or analog or
mutant thereof has been introduced may be treated, e. g.
grown or cultured as appropriate under suitable condi-
-;o tions known to those skilled in the art, so that the
DNA directs expression of the genetic information
encoded by the DNA, e. g. directs expression of the
hMnSOD polypeptide or analog or mutant thereof, and the
cell expresses the hMnSOD polypeptide or analog or
mutant thereof which may then be recovered.

13413fi2
-16-
As used throughout this specification, the term
"superoxide dismutase" (SOD) means an enzyme or a
polypeptide acting upon superoxide or oxygen-free rad
icals as receptors, or which catalyze the following
dismutation reaction
202= + 2H+ ---~ 02 + H202
The term "manganese superoxide dismutase" (MnSOD) as
1o used herein means any superoxide dismutase molecule
containing the element manganese, in any of its chemi-
cal forms.
The term "human manganese superoxide dismutase
polypeptide" as used herein means a polypeptide of 198
amino acids a portion of the amino acid sequence of
which is shown in Fig. 1; the N-terminus of the se
quence is the lysine encoded by nucleotides 115-117 of
Fig. 1 and the COON terminus of the sequence is the
zo
lysine encoded by nucleotides 706-708 of Fig. 1.
The term "polypeptide manganese complex" as used herein
means a molecule which includes a human manganese
superoxide dismutase polypeptide in a complex with
S manganese in any of its chemical forms and which has
the enzymatic activity of naturally-occurring human
manganese superoxide dismutase.
The term "human manganese superoxide dismutase" as used
herein means a molecule which includes at least two
human manganese superoxide dismutase polypeptides in a
complex with manganese in any of its chemical forms and
which has the enzymatic activity of naturally-occurring
human manganese super oxide dismutase.

3341~fi2
-17-
The term "human manganese superoxide dismutase
polypeptide analog" as used herein means a polypeptide
which includes a human manganese super oxide dismutase
polypeptide to either or both ends of which one or more
additional amino acids are attached.
The term "polypeptide manganese complex analog" as used
herein means a molecule which includes a polypeptide
manganese complex, the polypeptide por tion of which
includes one or more additional amino acids attached to
it at either or both ends.
The term "human manganese superoxide dismutase analog"
as used herein means a molecule that includes at least
two polypeptides at least one of which is human manga-
nese superoxide dismutase polypeptide analog, in a
complex with manganese in any of its chemical forms,
and which has the enzymatic activity of naturally-oc-
curring human manganese superexide dismutase.
The term "human manganese superoxide dismutase
polypeptide mutant" as used herein means a polypeptide
having an amino acid sequence substantially identical
to that of the human manganese superoxide dismutase
polypeptide but differing from it by one or more amino
acids.
The term "polypeptide manganese complex mutant" means a
molecule which includes a human manganese superoxide
3o dismutase polypeptide mutant in a complex with manga-
nese in any of its chemical forms and which has the
enzymatic activity of manganese super oxide dismutase.

~ ~~~ ~sz
-18-
The term "human manganese superoxide dismutase mutant"
as used herein means a molecule which includes at least
two polypeptides at least one of which polypeptides is
a human manganese superoxide dismutase polypeptide
mutant in a complex with manganese in any of its chemi-
cal forms and which has the enzymatic activity of
naturally-occurring human manganese superoxide
dismutase.
The mutants of hMnSOD polypeptide and hMnSOD which are
1o included as a part of this invention may be prepared by
mutating the DNA sequence shown in Fig. 1, the N-ter-
minus of which sequence is the lysine encoded by
nucleotides 115-117 and the COON terminus of which
sequence is encoded by nucleotides 706-708.
The DNA may be mutated by methods known to those of
ordinary skill in the art, e. g. Bauer et al. , Gene
?3-81 (1985) . The mutated sequence may be inserted
into suitable expression vectors as described herein,
2o which are introduced into cells which are then treated
so that the mutated DNA directs expression of the
hMnSOD polypeptide mutants and the hMnSOD mutants.
The enzymatically active form of human manganese
~~5 superoxide dismutase is believed to be a protein having
at least two, and possibly four, identical subunits,
each of which has approximately 198 amino acids in the
sequence shown in Fig. 1 for human manganese
superoxide dismutase, the N-terminus of the sequence
being the lysine encoded by nucleotides 1.15-117 of Fig.
1 and the COON terminus of the sequence being the
lysine encoded by nucleotides 706-708 of Fig. 1.

1 341362
-19-
Human MnSOD or analogs or mutants thereof may be
prepared from cells into which DNA or cDNA encoding
human manganese superoxide dismutase, or its analogs
or mutants have been introduced. This human MnSOD or
analogs or mutants may be used to catalyze the
dismutation or univalent reduction of the superoxide
anion in the presence of protons to form hydrogen per-
oxide as shown in the following equation"
human MnSOD
io 2 p 2 ~ + 2 H+ ~ H2 02 + 02
Veterinary and pharmaceutical compositions may also be
prepared which contain effective amounts of hMnSOD or
one or more hMnSOD analogs or mutant and a suitable
i5 carrier. Such carriers are well-known to those skilled
in the art. The hMnSOD or analog or mutant thereof may
be administered directly or in the form of a
composition to the animal or human subject, e.9., to
treat a subject afflicted by inflammations or to
2o reduce injury to the subject by oxygen-free radicals on
reperfusion following ischemia or organ
transplantation. The hMnSOD or analog or mutant may
also be added directly or in the form of a composition
to the perfusion medium of an isolated organ, to reduce
25 injury to an isolated organ by oxygen-free radicals on
perfusion after excision, thus prolonging the survival
period of the organ. Additionally. the hMnSOD or ana
log or mutant thereof may be used to reduce
neurological injury on reperfusion following ischemia
3o and to treat bronchial pulmonary dysplasia.
A method of producing enzymatically active human manga-
nese superoxide dismutase or an analog or mutant there-
of in a bacterial cell has also been discovered. The

31362
-20-
bacterial cell contains and is capable of expressing a
DNA sequence encoding the human manganese super oxide
dismutase or analog or mutant thereof. The method
involves maintaining the bacterial cell under suitable
conditions and in a suitable production medium. The
production medium is supplemented with an amount of
Mn++ so that the concentration of Mn++ in the medium is
greater than about 2 ppm.
The bacterial cell can be any bacterium in which a DNA
sequence encoding human manganese superoxide dismutase
has been introduced by recombinant DNA techniques. The
bacterium must be capable of expressing the DNA se-
quence and producing the protein product. The suitable
conditions and production medium will vary according to
the species and strain of bacterium.
The bacterial cell may contain the DNA sequence encod-
ing the super oxide dismutase or analog in the body of a
vector DNA molecule such as a plasmid. The vector or
'o plasmid is constructed by recombinant DNA techniques to
have the sequence encoding the SOD incorporated at a
suitable position in the molecule.
In a preferred embodiment of the invention the bacteri-
''S al cell is an Escherichia coli cell. A preferred auxo-
trophic strain of ~,. coli is A1645. A preferred proto
trophic strain of E. col i is A4255 The E, col i cell of
this invention contains a plasmid which encodes for
human manganese superoxide dismutase or an analog or
3~ mutant thereof.
In a preferred embodiment of this invention, the
bacterial cell contains the plasmid pMSE-4. A method
of constructing this plasmid is described in the De-

1341362
-21-
scription of the Figures and the plasmid itself is
described in Example 2. This plasmid has been deposit-
ed with the ATCC under Accession No. 432 50.
In another preferred embodiment of this invention, the
bacterial cell contains the plasmid pMS 4RB4. A method
of constructing this plasmid is described in the De
scription of the Figures and the plasmid itself is
described in Example 5. This plasmid may be construct
ed from pSOD ~T-11 which has been deposited with the
American Type Culture Collection under Accession No.
53468.
In specific embodiments of the invention, an enzymati-
cally active human manganese superoxide dismutase ana-
log is produced by E. coli strain A4255 cell contain-
ing the plasmid pMSE-4 and by E,, coli strain A4255 cell
containing the plasmid pMS pRB4.
The suitable production medium for the bacterial cell
2o can be any type of acceptable growth medium such as
casein hydrolysate or LB (Luria Broth) medium, the
latter being preferred. Suitable growth conditions
will vary with the strain of E. coli and the plasmid it
contains, for example ~.~ cc,~j, A4255 containing plasmid
p~E-4 is induced at 42oC and maintained at that tem-
perature from about 1 to about 5 hours. The suitable
conditions of temperature, time, agitation and aeration
f or gr ow ing the inocul um and f or gr ow ing the cul tur a to
a desired density before the production phase as well
3o as for maintaining the culture in the production period
may vary and are knaan to those of ordinary skill in
the art.

1 341 362
-22-
The concentration of Mn++ ion in the medium that is
nece ssary to pr oduce enzymatical 1y act ive MnSOD w i1 l
vary with the type of medium used.
In LB-type growth media Mn+~ concentrations of 150 ppm
to 750 ppm have been found effective. It is preferred
that in all complex types of grawth mediums the concen-
tration of Mn++ in the medium is from about 50 to about
1500 ppm.
The specific ingredients of the suitable stock, cul-
ture, inoculating and production mediums may vary and
are known to those of ordinary skill in the art.
This invention also concerns a method of recovering
h~an manganese superoxide dismutase or analog or
mutant thereof from bacterial cells which contain the
same. The cells are first treated to recover a protein
fraction containing proteins present in the cells
including human manganese superoxide dismutase or
2o analog or mutant thereof and then the protein fraction
is treated to recover human manganese superoxide
dismutase or analog or mutant thereof.
In a preferred embodiment of the invention, the cells
are first treated to separate soluble proteins from
insoluble proteins and cell wall debris and the
soluble proteins are then recovered. The soluble
proteins so recovered are then treated to separate,
e.g. precipitate, a fraction of the soluble proteins
:3o containing the human manganese superoxide dismutase or
analog or mutant thereof and the fraction is recovered.
The fraction is then treated to separately recover the
human manganese superoxide dismutase or analog or
mutant thereof .

1 341 362
-23-
The following is a description of a more preferred
embodiment of the invention. First, the bacterial
cells are isolated from the production medium and
suspended in a suitable solution having a pH of about
7 .0 or 8 .0 . The cell s ar a then di sr upted and
centrifuged. The resulting supernatant is heated for a
period of about 30 to 120 minutes at a temperature
between approximately 55 to 65°C, preferably for 45-75
minutes at 58 to 62°C and more preferably one hour at
60°C, and then cooled to below 10°C, preferably to
about 4°C. Any precipitate which may form during cool-
ing is removed, e.g. by centrifugation and then the
cooled supernatant is dialyzed against an appropriate
buffer. Preferably the cooled supernatant is dialyzed
by ultrafiltration employing a filtration membrane
smaller than 30R, most preferably 10R. Appropriate
buffers include 2 mM potassium phosphate buffer having
a pH of about 7.8. After or simultaneously with this
dialysis the cooled supernatant may optionally be
2o concentrated to an appropriate volume, e.g. 0.03 of
the supernatant's original volume has been found to be
convenient. The retentate is then eluted on an anion
exchange chromatography column with an appropriate
buffered solution, e.g., a solution at least 20 mM
potassium phosphate buffer having a pH of about 7.8.
The fractions of eluent containing superoxide dismutase
are collected, pooled and dialyzed against about 40 mM
potassium acetate, pH 5.5. The dialyzed pooled f rac-
tions are then eluted through a ration exchange chrana-
3o tography column having a 1 inear gradient of about 40 to
about 200 mM potassium acetate (BOAC) and a pH of 5.5.
The peak' fractions containing the superoxide dismutase
are collected and pooled. Optionally the pooled peak
fractions may then be dialyzed against an appropriate
~s

~ X41362
-2 4-
solution, e.g. water or a buffer solution of about 10
mM potassium phosphate hav ing a pH of about 7.8 .
The invention also concerns purified, i.e.
substantial 1y free of other substance s of human or igin,
human manganese superoxide dismutase or analogs or
mutants thereof produced by the methods of this
invention. In particular, it concerns a human
manganese superoxide dismutase analog having at least
two polypeptides, at least one of which polypeptides
1o has the amino acid sequence shown in Fig. 1, the N-
terminus of which sequence is the lysine encoded by
nucleotides 115-117 of Fig. 1 and the COOH terminus of
which sequence is the lysine encoded by nucleotides
706-708 of Fig. 1 plus an additional methnione residue
at the N-terminus (Met-hMnSOD) . A preferred embodiment
of this invention concerns pur if ied Met-hMnSOD hav ing a
specific activity of 3500 units/mg.
25
35

1 ~41~fi2
- 2 5-
The Examples which follow are set forth to aid in un-
derstanding the invention but are not intended to, and
should not be construed to, limit its scope in any way.
The Examples do not include detailed descriptions for
conventional methods employed in the construction of
vectors, the insertion of genes encoding polypeptides
into such vectors or the introduction of the resulting
plasmids into hosts. The Examples also do not include
to detailed description for conventional methods employed
for assaying the polypeptides produced by such host
vector systems or determining the identity of such
polypeptides by activity staining of isoelectric focus-
ing (IEF) gels. Such methods are well-known to those
.or ordinary skill in the art and are described in nu-
merous publications including by way of example the
following:
T. Maniatis, E. F. Fritsch and J. Sombrook, Molecular
Cloning,: ~ysbo~at~~~y Manual, Cold Spring Harbor Labo-
ratory, New York (1982) .
J. M. McCord and I . Fr idov ich, J. BiQ~ 'hem. 2 44: 6049-
55 (1969) .
C. Beauchamp and I . Fr idov ich, ~,al . Biochem. 44 : 276-87
(1971) .
:30
:35

~ X41 X62
-26-
In order to identify MnSOD cDNA clones, mixed of igomer
probes were synthesized according to the published
amino acid sequence (18,19) .
5'-,robe - 30 mer sequence from AA15 AA24 (18,19)
5' 3'
TTG CATAATTTG TG CCTT AATG TG TGGTT C
T G T G
G G
3'-probe - 32 mer sequence from AA179-AA189 (18)
5, 3'
TCTGTTACGTTTTCCCAGTTTATTACGTTCCA
G G G G
The 5'-probe consisting of 30 nucleotides corresponds
to amino acids 15 to 24 of mature MnSOD. The 3'-probe
consisting of 32 nucleotides corresponds to amino acids
179 to 189 of mature MnSOD. The 5'-probe is a mixed
probe consisting of 36 different sequences, as shown
above. The 3'-probe is a mixed probe consisting of 16
different sequences as shown above. (When more than
one nucleotide is shown at a given position, the DNA
strand was synthesized with equimolar amounts of each
of the shown nucleotides thus resulting in the mixed
pr obe ) .
The 5'-probe was employed to screen 300,000 plaques of
a T-cell cDNA library cloned into the ~ gt-10 vector.
Hybridization to phage plaque replicas immobilized on
nitrocellulose filters was performed according to

341 ~fi2
-27-
standard procedures (Maniatis et al. ) except
that the hybridization was performed at 50°C in 8xSSC
for 16 hrs. The filters were then washed at 50°C with
5xSSC and 0.1$ SDS. Three positive plaques were iso-
lated and named Phi MS8, Phi MS1 and Phi. MS1J.
EcoRI digests of DNA from Phi MS8 and Phi MS1 showed
that they both have cDNA inserts approximately 800 by
long, which hybridize to both the 5' and 3' ofigonu
cleotide probes. Phi MS1J carried only 450 bg cDNA
1o insert which hybridized only to the 5' end probe.
The SRI inserts of the three phage clones were sub-
cloned into the ,SRI site of pBR322 thus yielding
pMSB-4, pMSl-4 and pMSlJ, respectively. Restriction
analysis and hybridization to the 5' and 3' oligonu-
cleotide probes revealed similar patterns for both
pMSB-4 and pMSl-4. The following restriction map
showing the 5' ---~ 3' orientation has been deduced
for both plasmids.
25
35

~~3~~~~2
-2 8-
S~
100 200 300 400 500 600 700 800
The sequence of the cDNA insert pMSB-4 is shown
of in
Fig. 1. The predicted amino differs from
acid sequence
io the publ fished amino acid sequence (19) in that Glu
appears instead of Gln in three (3) locations
(AA
42,
88, 108) and an additional two amino acids. Gly and Trp
appear between AA123-124 Sequence analys is of pMSl-4
and pMSlJ revealed that the three MnSOD clones were
independently derived and confirmed these differences
fran the published amino acid
sequence.
The sequence upstream of the N-terminal Lysine of ma
ture MnSOD predicts a pre-peptide sequence of 24 amino
2o acids.
30
:35

1341362
-29-
C s ruc R ss
The starting point for the construction of pMSE-4 is the
plasmid pMSB-4 which was obtained as described in Example 1.
Plasmid pMSB-4, containing human MnSOD cDNA on an ~gRI
insert, was digested to completion with ~I and T~,~I
restriction enzymes. The large fragment was isolated and
ligated with a synthetic oligomer as depicted in Fig. 2.
The resulting plasmid, pMSB-NN contains the coding region
for the mature MnSOD, preceded by an ATG initiation codon.
The above plasmid was digested with SRI, ends were filled
in with Klenow fragment of Polymerise I and further cleaved
with 1 eI. The small fragment containing the MnSOD gene was
inserted into pSODal3 which was treated with T~gI and S,~I.
pSODal3 may be obtained as described in pending, co-assigned
Canadian Patent Application No. 488,832, filed August 15,
1985. This generated plasmid pMSE-4 containing the MnSOD
coding region preceded by the cII ribosomal binding site and
under the control of ~1 P~ promoter. Plasmid pMSE-4 has been
deposited with the American Type Culture Collection under
ATCC Accession No. 53250. All methods utilized in the above
processes are essentially the same as those described in
Maniatis, supra.

1;41362
- 3 0-
Plasmid pMSE-4 was introduced into ;Escherichia col i
strain A4255 using known methods. Then the E. coli
strain 4255, containing pMSE-4, were grown at 32°C in
Lucia Broth (LB) medium containing 100 g/ml) of ampi-
cill in unt i1 the Opti cal Densi ty (OD) at 6 00 nm was
0.7. Induction was performed at 42°C. Samples taken
1o at various time intervals were electrophoresed sepa-
rated on sodium dodecyl sulfate - polyacrylamide gels
electrophoresis (SDS-PAGE) . The gels showed increases
in human MnSOD levels up to 120 minutes post-induc-
tion, at which stage the recombinant MnSOD protein
c~prised 27% of total cellular groteins as determined
by scanning of Coomassie-blue stained gel. Sonication
of samples for 90 sec. in a W-375* sonicator and parti-
tioning of pr oteins to sol uble (s ) and non-sol uble (p)
fractions by centrifugation at 10,000 g for 5 min.
2o revealed that most of the recombinant MnSOD produced
was non-soluble. The induced soluble protein fraction
contained only slightly more SOD activity than the
uninduoed counterpart, as assayed by standard methods.
See McCord et al., . Apparently a portion of the
~gOD found in the soluble fraction is inactive. This
suggested that most of the human MnSOD produced under
the conditions described in this Example is, in ef-
fect, inactive.
* trade mark.

~ 341 362
-31-
++
Activity
The addition of Mn++ in increasing concentrations up to
450 ppm to the growth media of E. coli A4255, contain-
ing pMSE-4, prior to a 2 hr. induction at 42°C had no
adverse effect on the overall yield of human MnSOD.
Analysis of sonicated protein fractions soluble (s) and
to non-soluble (p) on sodium dodecyl sulfate - polyacryl-
amide gel electrophoresis (SDS-PAGE) , showed increased
solubil ization of the recombinant protein with in-
creased Mn++ concentrations (Table 1) . An assay of SOD
activity (see McCord et al. , ) suggests a corre-
i5 lation between increased Mn++ concentrations in the
growth media and increased solubility of the MnSOD with
an apparent optimum at 150 ppm Mn++ concentration in
the media (Fig. 3) . Furthermore increased Mn++ concen-
trations activated previously inactive soluble enzyme.
2o Soluble protein fractions of induced cultures grown at
these Mn++ levels show up to 60-fold increase in SOD
activity over soluble protein fractions of non-induced
cultures grown at these Mn++ levels. Activity stain-
ing of isoelectric focusing (IEF) gels (see Beauchamp
25 et al , . ) r eveal ed that mul ti f orms of the r ecom-
binant MnSOD were identical to those of native human
liver MnSOD.
Results for human MnSOD production by E. coli A1645
:3o Containing pMSE-4 were similar to those described
above.
,3 S

~ ~413fi2
-32-
Mn++ Percent Percent Specific
(ppm) Soluble Soluble Activity
human Mn human Mn units/mg
SOD of SOD of Sol ub1 a
Total human Soluble Bac- Proteins
MnSOD terial Proteins
Induced
io
0 30 .6 7 .2 30
50 72.7 15.4 241
100 78.0 16.9 356
150 82 .9 18 . 8 6 06
200 82.0 20.8 338
250 79.2 20.4 380
300 80.8 20.3 381
450 89.2 22.4 323
:z 0
:30
~5

~ 341362
-33-
R
TetR expression vector, ppRB, was generated from
pSODs 1T-11 by complete digestion with SRI followed by
partial cleavage with CHI restriction enzymes.
pSOD ~T-11 has been deposited with the American Type
Culture Collection under Accession No. 53468. The
1o digested plasmid was ligated with synthetic oligomer
5'- AATTCCOGGGTCTAGATCT - 3'
3'- GGGCCCAGATCTAGACTAG - 5'
1s resulting in p~R.B containing the a PL promoter.
The EcoRI fragment of MnSOD expression plasmid pMSE-4,
containing cII ribosomal binding site and the complete
coding sequence for the mature enzyme, was inserted
2o into the unique SRI site of poRB. The resulting
plasmid, pMSdRB4, contains the MnSOD gene under con-
trol of ~ PL and cII RBS and confers resistance to
tetracycline (Fig. 4) .
2s
;; S

~ 341362
-3 4-
Plasmid pMS~RB4 was introduced into Escherichia coli
strain A4255, using known methods. Cultures were grown
at 32°C in Luria Broth (LB) containing various concen-
trations of Mn++. until the Optical Density (OD) at 600
nm reached 6.7. Induction was performed at 42°C.
Samples taken at various time intervals were
electrophoresed on SDS-PAGE, hMnSOD level increased
with induction time up to 120 minutes, at which ,stage
it comprised about 15% of total cellular proteins as
determined by scanning of Coomassie Blue stained gel.
The induced MnSOD was soluble, regardless of Mn++ con-
centration in growth media. This is in contrast with
observations for the AmpR plasmid pMSE-4. ( See Example
4.) However, maximum SOD activity and expression level
were dependent on Mn++ supplementation (Table 2) .
25
35

1341362
- 3 5-
TABLE 2
~jaSOD Egpression in E. Col i A4255 Ij~MS aRB4)
ppm Mn+~ Percent Soluble Specific Activity
hMnSOD Units/mg Sol ubl a
of Soluble Proteins
Bacter ial Pr oteins
to 420 320 420
0 10.9 8.0 23
50 19 .8 8 .0 227
100 16.0 8.0 241
200 17.0 10.0 278
300 16.0 9.3 238
Z5
35

134132
-36-
s E. coli strain A4255 harboring plasmid pMSQR84 was
fermented in LB supplemented with 750 ppm Mn~+, at 32°C
to an A600 of 17Ø Induction of human MnSOD expres-
sion was effected by a temperature shift to 42°C for 2
hour s at which stage the cul tur a r eached A600 of 43 .0 .
1o Cells were harvested by centrifugation and resuspended
in 0.2 original volume in 50 mM potassium phosphate
buffer, pH 7.8 containing 250 mM NaCl. Bact* ria were
disrupted by a double passage through Dynomill, cen-
trifuged and cell debris were discarded. The superna-
is Cant was heated for 1 hour at 60°C, cooled to 4°C and
the cleared supernatant was concentrated to 0.03 origi-
nal volume and dialyzed against 2 mM potassium phos-
phate buffer, pH 7.8, on a Pelicon ultra filtration
unit equipped with a lOR membrane: The crude enzyme
preparation was loaded onto a DE52*column, washed thor-
oughly with 2 mM potassium phosphate buffer, pH 7.8 and
eluted with 20 mM potassium phosphate buffer, pH 7.8.
Pooled fractions containing the enzyme were dialyzed
against 40 mM potassium acetate, pH 5.5, loaded onto a
CM52 column and eluted with a linear gradient of 40 -
200 mM potassium acetate, pH 5.5. Peak fractions con-
taining human MnSOD were pooled, dialyzed against H20,
adjusted to 10 mM potassium phosphate buffer, pH 7.8
and frozen at -20°C.
Recombinant human MnSOD obtained was more than 99%
pure, with a specific activity of about 3500 units/mg.
The overall yield of the purification procedure was
about 30% (Table 3) .
:35 *Trade Marks
v

1341362
-37-
Sequencing of the purified enzyme shows the presence
of an additional methionine at the N--terminal amino
acid as compared with the known human MnSOD (19) .
Analysis for metal content by atomic absorption re-
vealed about 0.77 atoms Mn per enzyme subunit. This is
in accordance with publ fished data (23) .
15
25
35

13413x2
_~~ _
i
..,
a
i
U E
' r r~ o N o
U .-. ow n r-~ o
c' .-i r, r u~
.:
.,.i.,N r1 .-~ N M
W C
U
n.
cryI
,,
I
O ~ O O
O 4D M GD 1n
O 10 1D C
E.
dP '-i
~I
'
G ,?i
i
rY7c Ii Ci
O N 111 h N
.-I U7 , . .
..-i ao r u~ ~a .,
EE ,~ Q' ~' +'
O
U .u
v G
v
i
o~ c v
.., W
c~ v a
0
.1J Li O O O ~"1 N
~ 1
O eT O t' eT
.U.i .1 O N N
w~ ro N
... w
, w
E
'I
I 27
Gr v
w
a
" a
c v
w v E
C y
C ~0 c
s~ ro .u
v .u c v
C L N N
N i.~ N +: .u O
~ ~ a
a
n.
r, a c
.., v, o m v
n E U
O U ~i N N
c O -i u~ u', ~0
a, O v W
,.., vu 0.~ Ca U

~ ~~~ X62
-39-
1. McCord, J.M. and Fridovich, I., J-Biol. (:hem.
244:6049-55 (1969) .
2. Fridovich, I. in A~yances ~n Inorganic Biochem-
istry, eds. Eichhorn, G.L. and Marzilli, L.G.
(Elsevier/North Holland, New York) , pp. 67-90
(1979) .
l0 3 . Fr eeman, B. A. and Cr apo, J. D. , I~arQr atory In-
ve~tion 47:412-26 (1982) .
4. Steinman, H. M. in S~,ineroxic~ Dismutase, ed.
Oberley, L.W. (CRC Press, Florida) , pp. 11-68
(1982) .
5. Hartz, J.W. and Deutsch, H. F. , J. yiol. Ch em.
247:7043-50 (1972) .
6 . Jabusch, J. R. , Farb, D. L. , Kerschensteiner,
D. A. and Deutsch, H. F. , Biochemistry 19:2310-16
(1980) .
7 . Barra, D. , Martini, F. , Bannister, J. V. , Schin
ina, M.W., Rotilio, W.H., Bannister, W.H. and
Bossa, F. , FEB,~Letters 120: 53-56 (I980) .
8 . Lieman-Hurwitz, J. , Dafni, N. , Lavie, V. and
Groner, Y. , g,Loc. Natl. Acad. ~ci. USA 79:2808
11 (1982) .
9. Sherman, L. , Dafni, N. , Lieman-Hurwitz, J. and
Groner, Y., Proc. Natl. Acad. yR~i. USA 80:5465-
69 (1983).

1 341 362
-40-
10. Oberley, L.W. and Buettner, G. R., cancer Re-
se~rch 39:1141-49 (1979).
11. Huber, W. and Menander-Huber, R. B. , C1 inics i,~
Rheum. Dis. 6:465-98 (1980) .
12. McCord, J. M. and Roy, R. S. , Can. J. Physiol .
Pharma. 60:1346-52 (1982).
l0 13. Alvarez, J.G. and Storey, B.T., Biol. Re rp od.
28:1129-36 (1983).
14. Tal masof f, J. M. , Ono, T. and Cutl er , R. G. ,
roc. Natl. Acad. Sci. U iA 77:2777-81 (1980) .
15. Lowry, 0. H. , Rosebrough, N. J. , Farr, A. L. and
Randall, R.J., J. Biol,~ Chem. 193:265-75
(1951) .
2o 16. Weser, U, and Hartmann, H.J., FEBS Letters
17:78-80 (1971) .
17 . Jewett, S. L0. , Latrenta, G. S. and Beck, C. M. ,
Arc. Biochem. Bioghys. 215:116-128 (1982) .
18. Harris, J.I. an d Steinman, H.M., Superoxide an d
yur_zeroxide Dismutase, Michelson, A. M., McCord,
J. M. and Fridovich, I. eds. , Academic Press,
London, pp. 225-230 (1977).
19. Barra, D., Schinina, M.E., Simmaco, M., Bannis-
ter, J.V., Bannister, W.H., Rotilio, G. and
Bossa, F. , J. B~.ol. Chem. 259:12595-601 (Octo-
ber 25, 1984) .

1341362
-41-
20. Baret, A. , Jadot, G. , and Michelson, A. M. ,
R~ochem~ca~ Phar acoloav 33:2755-60 (September
1, 1984) .
21. McCord, J. M, and Sal in, M. L. , Movement, Metabo-
~ ism aHd Bactericidal Mechanisms of Pha9~yjtes,
Ross, A. , Patriar ca, P. L. , Rome a, D. (eds ) pp.
257-264 (1977) .
22. Touati, D. , Journal of acte;,yoloav 155: 1078-87
(1983) .
23 . McCord, J. M. , Boyle, J. A. , Day, Jr. , E. D. ,
Rizzolo, L.J. and Salin, M.L., Superoxi a and
~u~roxide Dismutase, Michaelson, A. M. , Mc-
Cord, J. M., and Fridovich, I. (eds) Academic
Press, London pp. 129-138 (1977).
24. European Patent Publication No. 0131843 Ai,
2o publ fished January 23, 1985, carresponding to
European Patent' Application No. 84107717.5,
filed July 3, 1984, which claims priority of
U. S. Serial No: 514,188, filed July 15, 1983.
25. Hallewell, et al . , N'~l_.P,~ic Aci~,~ Res. 5,
(1985) .
26. European Patent Publication 0138111 Al, pub-
lished Agril 24, 1985, corresponding to Europe-
3o an Patent Application No. 84111416.8, filed
September 25, 1984, which claims priority of
U. S. Serial No. 538,607, filed October 3, 1983,
and U. S. Serial No. 609,412, filed May 11,
1984.

~ 341362
-42-
27. E1~0 Journal, Vol. 4, No. 1, pp. 77-84 (January
1985 .
28. Abstracts of the Fourth International Confer-
ence on Superoxide and Superoxide Dismutase,
Rome, Italy, September 1-6, 1985.
1o
20
30