Note : Les descriptions sont présentées dans la langue officielle dans laquelle elles ont été soumises.
13 41589
METHODS AND DEOXYRIBONUCLEIC ACID FOR THE
PREPARATION OF TISSUE FACTOR PROTEIN
Background
This invention relates to tissue factor protein. The
invention further relates to novel forms and compositions thereof,
and particularly to the means and methods for production of tissue
factor protein to homogeneity in therapeutically significant
quantities. This invention also relates to preparation of isolated
deoxyribonucleic acid (DNA) coding for the production of tissue
factor protein, to methods of obtaining DNA molecules which code
for tissue factor protein, to the expression of human tissue factor
protein utilizing such DNA, as well as to novel compounds,
including novel nucleic acids encoding tissue factor protein or
fragments thereof. This invention is also directed to tissue
factor protein derivatives, particularly derivatives lacking the
near C-terminal cytoplasmic and/or hydrophobic portion of the
protein, and their production by recombinant DNA techniques.
-2-
1341589
Bleeding is one of the most serious and significant
manifestations of disease. It may occur from a local site or may
be generalized. Primary hemostasis consists principally of two
components: vasoconstriction and platelet plug formation. Platelet
plug formation may be divided into several stages: adhesion of
platelets to subendothelial surfaces exposed by trauma; platelet
activation release reaction; platelet aggregation, which results in
the sequestration of additional platelets at the site, and the
binding of fibrinogen and the coagulation proteins to the platelet
surface which results in thrombin formation; and, fusion which is
the coalescence of fibrin and fused platelets to form a stable
haemostatic plug.
Blood coagulation performs two functions; the production of
thrombin which induces platelet aggregation and the formation of
fibrin which rfinders the platelet plug stable. A number of
discrete proenzymes and procofactors, referred to as "coagulation
factors", part'_-.ipate in the coagulation process. The process
consists of several stages and ends with fibrin formation.
Fibrinogen is converted to fibrin by the action of thrombin.
Thrombin is formed by limited proteolysis of a proenzyme,
prothrombin. This proteolysis is effected by activated factor X
(referred to as factor Xa) which binds to the surface of activated
platelets and, in the presence of factor Va and ionic calcium,
cleaves prothrombin.
Activation of factor X may occur by either of two separate
pathways, the extrinsic or the intrinsic (Figure 1). The intrinsic
cascade consists of a series of reactions wherein a protein
precursor is clEaved to form an active protease. At each step, the
newly formed protease will catalyze the activation of the precursor
protease at the subsequent step of the cascade. A deficiency of
any of the proteins in the pathway blocks the activation process at
that step, thereby preventing clot formation and typically gives
- 3 - 1 3 4 1 5 8 9
rise to a tendency to hemorrhage. Deficiencies of factor VIII or
factor IX, for example, cause the severe bleeding syndromes
haemophilia A and B, respectively. In the extrinsic pathway of
blood coagulation, tissue factor, also referred to as tissue
thromboplastin, is released from damaged cells and activates factor
X in the presence of factor VII and calcium. Although activation
of factor X was originally believed to be the only reaction
catalyzed by tissue factor and factor VII, it is now known that an
amplification loop exists between factor X, factor VII, and factor
IX (Osterud, B., and S.I. Rapaport, Proc. Natl. Acad. Sci. [USA]
74:5260-5264 [1977]; Zur, M. et ,ai1., Blood ~2: 198 [1978]). Each
of the serine proteases in this scheme is capable of converting by
proteolysis the other two into the activated form, thereby
amplifying the signal at this stage in the coagulation process
(Figure 1). It is now believed that the extrinsic pathway may in
fact be the major physiological pathway of normal blood coagulation
(Haemostasis 13:150-155 [1983]). Since tissue factor is not
normally found i: the blood, the system does not continuously clot;
the trigger for coagulation would therefore be the release of
tissue factor from damaged tissue.
Tissue factor is believed to be an integral membrane
glycoprotein which, as discussed above, can trigger blood
coagulation via the extrinsic pathway (Bach, R. et al. , J. Biol
Chem. 256[16]: 8324-8331 [1981]). Tissue factor consists of a
protein component (previously referred to as tissue factor
apoprotein-III) and a phospholipid. Osterud, B. and Rapaport, S.I.,
Proc.Natl.Acad.Sci. 74, 5260-5264 (1977). The complex has been
found on the membranes of monocytes and different cells of the
blood vessel wall (Osterud, B., Scand. J. Haematol. 32: 337-345
[1984]). Tissue factor from various organs and species has been
reported to have a relative molecular mass of 42,000 to 53,000.
Human tissue thromboplastin has been described as consisting of a
tissue factor protein inserted into a phospholipid bilayer in an
-4-
13415e~
optimal ratio of tissue factor protein:phospholipid of
approximately 1:80 (Lyberg, T. and Prydz, H., Nouv. Rev. Fr.
Hematol. 25(5): 291-293 [1983]). Purification of tissue factor
has been reported from various tissues such as,: human brain (Guha,
A. et al. Proc. Natl. Acad. Sci. 11: 299-302 [1986] and Broze,G.H.
et al., J.Biol.Chem. 260[20]: 10917-10920 [1985]); bovine brain
(Bach, R. et al., J. Biol. Chem. 256: 8324-8331 [1981]); human
placenta (Bom, V.J.J. et al., Thrombosis Res. 42:635-643 [1986];
and, Andoh, K. et gI., Thrombosis Res. 43:275-286 [1986]); ovine
brain (Carlsen. E. et al., Thromb. Haemostas. 48[3], 315-319
[1982]); and, lung (Glas, P. and Astrup, T., Am. J. Physiol. 219,
1140-1146 [1970]). It has been shown that bovine and human tissue
thromboplastin are identical in size and function (see Broze, G.H.
et al., J. Biol. Chem. 260[20], 10917-10920 [1985]). It is widely
accepted that while there are differences in structure of tissue
factor protein between species there are no functional differences
as measured by in vitro coagulation assays (Guha et 11. supra).
Furthermore, tissue factor isolated from various tissues of an
animal, e.g. dog brain, lung, arteries and vein was similar in
certain respects such as, extinction coefficient, content of
nitrogen and phosphorous and optimum phospholipid to lipid ratio
but differed slightly in molecular size, amino acid content,
reactivity with antibody and plasma half life (Gonmori, H. and
Takeda, Y., J. Physiol. 219[3], 618-626 [1975]). All of the tissue
factors from the various dog organs showed clotting activity in the
presence of lipid. Id. It is widely accepted that in order to
demonstrate biological activity, tissue factor must be associated
with phospholipids in vitro (Pitlick, F.A., and Nemerson, Y.,
Biochemistry 9: 5105-5111 [1970] and Bach,R. et al. supra. at
8324). It has been shown that the removal of the phospholipid
component of tissue factor, for example by use of a phospholipase,
results in a loss of its biological activity in vitro (Nemerson,
Y., J.C.I. 47: 72-80 [1968]). Relipidation can restore in vitro
tissue factor activity (Pitlick, F.A. and Nemerson, Y. , supra and
-5-
134158~
Freyssinet, J.M. et al., Thrombosis and Haemostasis 51: 112-118
[1986]). Amino terminal sequences of tissue factor (Bach, R. et
al., Am. Heart Assoc. [Nov., 1986], Morrissey, J.H. gt al., Am.
Heart Assoc. [Nov., 1986)) and a CNBr peptide fragment (Bach, R. et
al. supra) have been determined.
Infusion of tissue factor has long been believed to
compromise normal haemostasis. In 1834 the French physiologist de
Blainville first established that tissue factor contributed
directly to blood coagulation (de Blainville, H. Gazette Medicale
Paris, Series 2, 524 [1834]). de Blainville also observed that
intravenous infusion of a brain tissue suspension caused immediate
death which he observed was correlated with a hypercoagulative
state giving rise to extensively disseminated blood clots found on
autopsy. It is now well accepted that intravenous infusion of
tissue thromboplastin induces intravascular coagulation and may
cause death in various animals (Dogs: Lewis, J. and Szeto I.F. , J.
Lab. Clin. Med 60: 261-273 [1962]; rabbits: Fedder, G. et al.,
Thromb. Diath. Haemorrh. 27: 365-376 [1972]; rats: Giercksky, K.E.
et al., Scand. J. Haematol. 17: 305-311 [1976]; and, sheep:
Carlsen,E. et al., Thromb. Haemostas. 48: 315-319 [1982]).
Although the isolation of tissue factor has been described
in the literature as shown above, the precise structure of tissue
factor protein has not been previously established. While some
quantities of "purified" tissue factor protein have been available
as obtained from various tissues, the low concentration of tissue
factor protein in blood and tissues and the high cost, both
economic and of effort, of purifying the protein from tissues makes
this a scarce material. It is an object of the present invention
to isolate DNA encoding tissue factor protein and to produce useful
quantities of human tissue factor protein using recombinant
techniques. It is a further object to prepare novel forms of
-6-
13 41589
tissue factor protein. This and other objects of this invention
will be apparent from the specification as a whole.
Summary of the Invention
Objects of this invention can be accomplished by a method
comprising: identifying and cloning the cDNA which codes for human
tissue factor protein ; incorporating that cDNA into a recombinant
DNA vector; transforming a suitable host with the vector including
that DNA; expressing the human tissue factor protein DNA in such a
host; and reco-~Yering the human tissue factor protein that is
produced. Similarly, the present invention makes it possible to
produce human tissue factor protein and/or derivatives thereof by
recombinant techniques, as well as to provide products and methods
related to such human tissue factor protein production. The
isolation and identification and sequencing of the tissue factor
protein DNA was problematic. The mRNA was relatively rare and
heretofore no complete amino acid sequence for tissue factor
protein was known.
The present invention is directed to the compositions and
methods of producing human tissue factor protein via recombinant
DNA technology, including: 1) the isolation and identification of
the entire DNA sequence of the protein and the 5' and 3'-flanking
region thereof; 2) the construction of cloning and expression
vehicles comprising said DNA sequence, enabling the expression of
the human tissue factor protein, as well as methionine, fusion or
signal N-terminus conjugates thereof; and 3) viable cell cultures,
genetically altered by virtue of their containing such vehicles
and capable of producing human tissue factor protein. This
invention is further directed to DNA compositions and methods of
producing DNA which codes for cellular production of human tissue
factor protein. Yet another aspect of this invention are new
compounds, including DNA sequences which are utilized in obtaining
clones which encode tissue factor protein. Still another aspect of
-7-
13 41589
the present invention is tissue factor protein essentially free of
all naturally occurring substances with which it is typically found
in blood and/or tissues, i.e., the tissue factor protein produced
by recombinant means will be free of those contaminants with which
it is typically associated when isolated from its in vivo
physiological milieu. One noteworthy potential contaminant is the
causative agent for acquired immune deficiency syndrome (AIDS),
which is being found in the circulation of ever increasing numbers
of individuals. Depending upon the method of production, the
tissue factor protein hereof may contain associated glycosylation
to a greater or lesser extent compared with material obtained from
its in vivo physiological milieu, i.e: blood and/or tissue. This
invention is further directed to novel tissue factor protein
derivatives, in particular derivatives lacking the signal sequence
and the hydrophobic portion of the protein near the C-terminal end
of the protein comprising the amino acid sequence which constitutes
the tissue factor protein transmembrane or membrane binding domain.
The utility of the human tissue factor protein and
derivatives thereof of this invention is based in part on the novel
and unexpected observation that infusion into hemophilic dogs of
tissue factor protein, that is the protein portion of tissue factor
lacking the naturally occurring phospholipid, which was previously
referred to as tissue factor apoprotein III and previously believed
to be inactive, corrected the haemostatic deficiency. Tissue
factor protein was for the first time found to correct the bleeding
diathesis, i.e. a tendency toward hemorrhage, associated with
factor VIII deficiency }n vivo. Infusion of tissue factor protein
would be expected to be ineffective in light of the prior art
papers which describe tissue factor as having an absolute
requirement for phospholipid. In contrast to the work of de
Blainville and subsequent researchers over the next one hundred and
-8-
13 41589
fifty-two (152) years, tissue factor protein was also found to be
nontoxic to the dogs when infused intravenously.
The human tissue factor protein and derivatives thereof of
this invention are useful in the treatment of various chronic
bleeding disorders, characterized by a tendency toward hemorrhage,
both inherited and acquired. Examples of such chronic bleeding
disorders are deficiencies of factors VIII, IX, or XI. Examples of
acquired disorders include: acquired inhibitors to blood
coagulation factors e.g. factor VIII, von Willebrand factor,
factors IX, V, XI, XII and XIII; haemostatic disorder as a
consequence of liver disease which includes decreased synthesis of
coagulation factors and DIC; bleeding tendency associated with
acute and chronic renal disease which includes coagulation factor
deficiencies and DIC; haemostasis after trauma or surgery; patients
with disseminated malignancy which manifests in DIC with increases
in factors VIII, von Willebrand factor and fibrinogen; and
haemostasis during cardiopulmonary surgery and massive blood
transfusion. The human tissue factor protein and derivatives
thereof of this invention may also be used to induce coagulation
for acute bleeding problems in normal patients and in those with
chronic bleeding disorders. Other uses for tissue factor protein
will be apparent to those skilled in the art.
Brief Description of the Drawings
Fig. 1 Diagram showing activation of blood coagulation via
intrinsic pathway.
Fig. 2 Nucleotide and amino acid sequence of human tissue
factor protein. The nucleotide sequence of the human
tissue factor protein was determined from DNA sequence
analysis of one adipose clone and in part confirmed by
sequencing other clones. Predicted amino acids of the
tissue factor protein are shown below the DNA sequence
-~_
13 41589
¾r e-_ ~-_-~ur
z--m~--.-_ o ~,~ -_ v~e -_ se__--r~c- Ne_f~-- =~Mf-- ac-=_
~j =
te ~ eri
-m_-_ro-___ =v~--=t~
= =- t_i--- _=ro -._n.
z'?-- e~
-; ar f7Y n ri
= 4 ~`-:'- - --_`_- t''. ~ - -- ~ e - Y:_-
' ===-~ y t~ L- - a-i.=-- -- _
FI. - 4a ~u s `4- pa = -V~ =h ¾
~_-
-
_ e-_= =,e`f- ~ _-_;4
~s21=
. dYC- t. r f.F-- o
_ -1 o~ a` T:
J C 3 =--~~
C.. i
, _= =:i-
_-_~u~ _ _sI,t_- -_ -_- ~r-_--~ ~ - =- -
-:?At - _ - ~ ` =ti.~ 7 I.c- . _.6 r~ PS~`'
-h~
e_
7 Y' a .
:~
_ __-
--vzi' c.-: ~= t P_ L=_-
=~SC 0
= - -- ~ f1ll- = -_--
-- --s{3= _ - _. _ ' _C:~ _ =-_--___ - ~=ta-==- --- -_ I~~== =_~~~___
3.ni` -a''-` ncfi 3 Fi 3 .- -. - i F 1.
`?81: 'rJ Oi __q 9
_-__~--
_ U~ c
-lo- 13 4 1 5 S 9
having a serine substituted for a cysteine at position
245.
Figs.8a-b Figs. 8a-8b are collectively referred to herein as
Figure 8. Construction of an expression vector for
human tissue factor fusion protein.
Fig. 9 Chromogenic assay results of transient expression of
tissue factor protein in Cos cells.
Fig. 10 Construction of an expression vector for cytoplasmic
domain deleted tissue factor protein.
Detailed Description
As used herein, "tissue factor protein" refers to a protein
capable of correcting various bleeding disorders e.g. by inducing
coagulation, particularly those disorders associated with
deficiencies in coagulation factors. Tissue factor protein is
distinct from tissue factor or tissue thromboplastin of the prior
art in that it lacks the naturally occurring lipid portion of the
molecule. Tissue factor protein also includes tissue factor
protein associated with phospholipid which lipid is distinct from
the naturally occurring lipid associated with tissue thromboplastin
and displays coagulation-inducing capability without the
concomitant toxicity observed with the lipidated protein. Infusion
of tissue factor protein, as defined herein, does not result in
disseminated intravascular coagulation. The capacity of tissue
factor protein to correct various bleeding disorders is readily
determined using various in vivo bleeding models e.g. initiation of
coagulation in hemophilic dogs using cuticle bleeding time (CBT)
determination (Giles, A.R. et al., Blood 60:727-730 (1982]).
The amino acid sequence of figure 2 is that of pre-tissue
factor protein. Pre-tissue factor protein can be expressed, for
-11-
13 41589
example, in prokaryotes, which do not process and secrete mature
protein, by transforming with an expression vector comprising DNA
encoding pre-tissue factor protein. It is preferable to transform
host cells capable of accomplishing such processing so as to obtain
mature tissue factor protein in the culture medium or periplasm of
the host cell. Typically, higher eukaryotic host cells such as
mammalian cells are capable of processing pre-tissue factor protein
and secreting mature tissue factor protein upon transformation with
DNA encoding pre-tissue factor protein.
Alternatively, secreted mature tissue factor protein can be
obtained by ligating the 5' end of the DNA encoding mature tissue
factor protein to the 3' end of DNA encoding a signal sequence
recognized by the host cell. An expression vector comprising the
ligated DNA sequences is used to transform host cells. The host
cell will process the expressed fusion by proteolytically cleaving
the peptide bond between the signal sequence and the first amino
acid of tissue factor protein and secreting the mature tissue
factor protein into the host cell periplasm or into the medium,
depending upon the host cell in question. For example, in
constructing a prokaryotic expression vector the human tissue
factor protein secretory leader, i.e. amino acids -32 to -1, is
replaced by the bacterial alkaline phosphatase or heat stable
enterotoxin II leaders, and for yeast the tissue factor protein
leader is replaced by the yeast invertase, alpha factor or acid
phosphatase leaders. Gram negative organisms transformed with a
homologous signal-tissue factor protein fusion will secrete mature
tissue factor protein into the cell periplasm, whereas yeast or
bacillus sp. will secrete mature tissue factor protein into the
culture medium.
Included within the scope of the present invention are
tissue factor protein having native glycosylation and the amino
acid sequence as set forth in Figure 2, analogous tissue factor
-12-
1341589
proteins from other animal species such as bovine, porcine, ovine
and the like, deglycosylated or unglycosylated derivatives of such
tissue factor proteins, and biologically active amino acid sequence
variants of tissue factor protein, including alleles, and in vitro-
generated covalent derivatives of tissue factor proteins that
demonstrate tissue factor protein activity.
Amino acid sequence variants of tissue factor protein fall
into one or more of three classes: substitutional, insertional or
deletional variants. Insertions include amino and/or carboxyl
terminal fusions as well as intrasequence insertions of single or
multiple amino acid residues. Tissue factor fusion proteins
include, for example, hybrids of mature tissue factor protein with
polypeptides that are homologous with tissue factor protein, for
example, in the case of human tissue factor protein, secretory
leaders from other secreted human proteins. Tissue factor fusion
proteins also include hybrids of tissue factor protein with
polypeptides hor ologous to the host cell but not to tissue factor
protein, as well as, polypeptides heterologous to both the host
cell and the tissue factor protein. An example of such tissue
factor fusion protein is the herpes gD-signal sequence with the
mature tissue factor protein. Preferred fusions within the scope
of this invention are amino terminal fusions with either
prokaryotic peptides or signal peptides of prokaryotic, yeast,
viral or host cell signal sequences. It is not essential that the
signal sequence be devoid of any residual mature sequence from the
protein whose secretion it ordinarily directs but this is
preferable in order to avoid the secretion of a tissue factor
protein fusion.
Inserticns can also be introduced within the mature coding
sequence of tissue factor protein. These, however, ordinarily will
be smaller insertions than those of amino or carboxyl terminal
fusions, on the order of 1 to 4 residues. A representative example
-13- .
~J 4 1 !) 89
is [Arg135Arg136'>Arg135ProArg137) tissue factor protein, a variant
selected for its resistance to trypsin hydrolysis at the Arg135
residue. Unless otherwise stated, the specific tissue factor
protein variations described herein are variations in the mature
tissue factor protein sequence; they are not pre-tissue factor
protein variants.
Insertional amino acid sequence variants of tissue factor
proteins are those in which one or more amino acid residues are
introduced into a predetermined site in the target tissue factor
protein. Most commonly, insertional variants are fusions of
heterologous proteins or polypeptides to the amino or carboxyl
terminus of tissue factor protein. Immunogenic tissue factor
protein derivatives are made by fusing a polypeptide sufficiently
large to confer immunogenicity to the target sequence by cross-
linking in vitro or by recombinant cell culture transformed with
DNA encoding the fusion. Such immunogenic polypeptides can be
bacterial polypeptides such as trpLE, beta-galactosidase and the
like.
Deletion variants are characterized by the removal of one
or more amino acid residues from the tissue factor protein
sequence. Typically, no more than about from 2 to 6 residues are
deleted at any one site within the tissue factor protein molecule,
although deletion of residues -31 to -1 inclusive will be
undertaken to obtain met-tissue factor protein, a variant adapted
for intracellular direct expression of met-mature tissue factor
protein. Another deletion variant is of the transmembrane domain
located at about residues 220 to 242 of the tissue factor protein
molecule.
These variants ordinarily are prepared by site specific
mutagenesis of nucleotides in the DNA encoding the tissue factor
protein, thereby producing DNA encoding the variant, and thereafter
-14-
13 41589
expressing the DNA in recombinant cell culture. However, variant
tissue factor protein fragments having up to about 100-150 residues
may be conveniently prepared by jn vitro synthesis. The variants
typically exhibit the same qualitative biological activity as the
naturally-occurring analogue, although variants also are selected
in order to modify the characteristics of tissue factor protein as
will be more fully described below.
While the site for introducing an amino acid sequence
variation is predetermined, the mutation 211 e need not be
predetermined. For example, in order to optimize the performance
of a mutation at a given site, random mutagenesis may be conducted
at the target codon or region and the expressed tissue factor
protein variants screened for the optimal combination of desired
activity. Techniques for making substitution mutations at
predetermined sites in DNA having a known sequence are well known,
for example M13 primer mutagenesis.
Amino acid substitutions are typically of single residues;
insertions usually will be on the order of about from 1 to 10 amino
acid residues; and deletions will range about from 1 to 30
residues. Deletions or insertions preferably are made in adjacent
pairs, i.e. a deletion of 2 residues or insertion of 2 residues.
Substitutions, deletions, insertions or any combination thereof may
be combined to arrive at a final construct. Obviously, the
mutations that will be made in the DNA encoding the variant tissue
factor protein must not place the sequence out of reading frame and
preferably will not create complementary regions that could produce
secondary mRNA structure (EP 75,444A).
Substitutional variants are those in which at least one
residue in the Fig. 2 sequence has been removed and a different
residue inserted in its place. Such substitutions generally are
- 1 5 -
~ J 4 38~
made in accordance with the following Table 1 when it is desired to
finely modulate the characteristics of tissue factor protein.
TABLE 1
Original Residue Exemplary Substitutions
Ala ser
Arg lys
Asn gln; his
Asp glu
Cys ser
Gln asn
Glu asp
Gly pro
His asn; gln
Ile leu; val
Leu ile; val
Lys arg; gln; glu
Met leu; ile
Phe met; leu; tyr
Ser thr
Thr ser
Trp tyr
Tyr trp; phe
Val ile; leu
Substantial changes in function or immunological identity
are made by selecting substitutions that are less conservative than
those in Table 1, i.e., selecting residues that differ more
significantly in their effect on maintaining (a) the structure of
the polypeptide backbone in the area of the substitution, for
example as a sheet or helical conformation, (b) the charge or
hydrophobicity of the molecule at the target site or (c) the bulk
of the side chain. The substitutions which in general are exP<iLed
to produce the greatest changes in tissue factor protein properties
-16-
13 41589
will be those in which (a) a hydrophilic residue, e.g. seryl or
threonyl, is substituted for (or by) a hydrophobic residue, e.g.
leucyl, isoleucyl, phenylalanyl, valyl or alanyl; (b) a cysteine or
proline is substituted for (or by) any other residue; (c) a residue
having an electropositive side chain, e.g., lysyl, arginyl, or
histidyl, is substituted for (or by) an electronegative residue,
e.g., glutamyl or aspartyl; or (d) a residue having a bulky side
chain, e.g., phenylalanine, is substituted for (or by) one not
having a side chain, e.g., glycine.
A major class of substitutional or deletional variants are
those involving the transmembrane, i.e. hydrophobic or lipophilic,
region of tissue factor protein. The transmembrane region of
tissue factor protein is located at about residues 220 to 242 of
the protein encoded by the DNA from human adipose tissues. This
region is a highly hydrophobic or lipophilic domain that is the
proper size to span the lipid bilayer of the cellular membrane. It
is believed to anchor tissue factor protein in the cell membrane.
Deletion or substitution of the transmembrane domains will
facilitate recovery and provide a soluble form of recombinant
tissue factor protein by reducing its cellular or membrane lipid
affinity and improving its water solubility so that detergents will
not be required to maintain tissue factor protein in aqueous
solution. Preferably, the transmembrane domain is deleted, rather
than substituted in order to avoid the introduction of potentially
immunogenic epitopes. One advantage of the transmembrane deleted
tissue factor protein is that it is more easily secreted into the
culture medium. This variant is water soluble and does not have an
appreciable affinity for cell membrane lipids, thus considerably
simplifying its recovery from recombinant cell culture.
Substitutional or deletional mutagenesis can be employed to
eliminate N- or 0-linked glycosylation sites (e.g. by deletion or
-17-
13 41 589
substitution of asparaginyl residues in Asn-X-Thr glycosylation
sites), improve expression of tissue factor protein or alter the
half life of the protein. Alternatively, unglycosylated tissue
factor protein can be produced in recombinant prokaryotic cell
culture. Deletions or substitutions of cysteine or other labile
residues also may be desirable, for example in increasing the
oxidative stability or selecting the preferred disulfide bond
arrangement of the tissue factor protein. One such example of a
cysteine substitution is the substitution of a serine for the
cysteine at position 245. Deletions or substitutions of potential
proteolysis sites, e.g. Arg Arg, is accomplished for example by
deleting one of the basic residues or substituting one by
glutaminyl or histidyl residues.
A DNA isolate is understood to mean chemically synthesized
DNA, cDNA or genomic DNA with or without the 3' and/or 5' flanking
regions. DNA encoding tissue factor protein is obtained from other
sources than human by a) obtaining a cDNA library from the
placenta, adipose or other tissues containing tissue factor protein
mRNA, such as brain, of the particular animal, b) conducting
hybridization analysis with labelled DNA encoding human tissue
factor protein or fragments thereof (usually, greater than 100bp)
in order to detect clones in the cDNA library containing homologous
sequences, and c) analyzing the clones by restriction enzyme
analysis and nucleic acid sequencing to identify full-length
clones. If full length clones are not present in the library, then
appropriate fragments may be recovered from the various clones
using nucleic acid sequence disclosed for the first time in the
present invention and ligated at restriction sites common to the
clones to assemble a full-length clone encoding tissue factor
protein.
Tissue factor protein derivatives that are not coagulation-
inducing which fall within the scope of this invention include
-18-
134~589
polypeptides that may or may not be substantially homologous with
tissue factor protein. These tissue factor protein derivatives are
produced by the recombinant or organic synthetic preparation of
tissue factor protein fragments or by introducing amino acid
sequence variations into intact tissue factor protein so that it no
longer demonstrates coagulation-inducing activity as defined above.
Tissue factor protein derivatives that are not coagulation-
inducing as described above are useful as immunogens for raising
antibodies to coagulation-inducing tissue factor protein. Such
tissue factor protein derivatives, referred to as "tissue factor
protein antagonists" may be used to neutralize tissue factor
protein coagulation-inducing activity. Such a tissue factor
protein antagonist may bind to factor VII or VIIa or inhibit the
proteolysis of factors IX or X when in complex with factor VII or
VIIa. Tissue factor protein antagonists are useful in the therapy
of various coagulation disorders e.g. disseminated intravascular
coagulation (DIC) occurring during severe infections and
septicemias, after surgery or trauma, instead of or in combination
with other anticoagulants such as heparin.
Covalent modifications of the tissue factor protein
molecule are included within the scope of the invention. Such
modifications are made by reacting targeted amino acid residues of
the recovered protein with an organic derivatizing agent that is
capable of reacting with selected side chains or terminal residues.
Alternately, post-translational modification in selected
recombinant host cells may be used to modify the protein. The
resulting covalent derivatives are useful as immunogens or to
identify residues important for biological activity as well as for
altering pharmacological characteristics of the molecule, such as
half life, binding affinity and the like, as would be known to the
ordinarily skilled artisan.
-19-
13 41589
Certain post-translational derivatizations are the result
of the action of recombinant host cells on the expressed
polypeptide. Glutaminyl and asparaginyl residues are frequently
post-translationally deamidated to the corresponding glutamyl and
aspartyl residues. Alternatively, these residues are deamidated
under mildly acidic conditions. Either form of these residues
falls within the scope of this invention.
Other post-translational modifications include
hydroxylation of proline and lysine, phosphorylation of hydroxyl
groups of seryl or threonyl residues, methylation of the a-amino
groups of lysine, arginine, and histidine side chains (T.E.
Creighton, Proteins: Structure and Molecular Properties, W.H.
Freeman & Co., San Francisco pp 79-86 [1983]), acetylation of the
N-terminal amine and, in some instances, amidation of the C-
terminal carboxyl.
"Essentially free from" or "essentially pure" when used to
describe the state of tissue factor protein produced by the
invention means free of protein or other materials normally
associated with tissue factor protein in its in vivo physiological
milieu as for example when tissue factor protein is obtained from
blood and/or tissues by extraction and purification. Other
materials include infectious organisms such as, for example, the
causative agent of acquired deficiency syndrome (AIDS). Tissue
factor protein produced by the method of the instant invention is
greater than or equal to 95% purity.
In general, prokaryotes are used for cloning of DNA
sequences in constructing the vectors useful in the invention. For
example, E. coli K12 strain 294 (ATCC No. 31446) is particularly
useful. Other microbial strains which may be used include E. coli
B and E. coli X1776 (ATCC No. 31537). These examples are
illustrative rather than limiting.
-20-
y341589
Prokaryotes also can be used for expression. The
aforementioned strains, as well as E. coli W3110 (F-, a-,
prototrophic, ATTC No. 27325), bacilli such as Bacillus subtilus,
and other enterobacteriaceae such as Salmonella typhimurium or
Serratia marcescans, and various pseudomonas species can be used.
In general, plasmid vectors containing promoters and
control sequences which are derived from species compatible with
the host cell are used with these hosts. The vector ordinarily
carries a replication site as well as one or more marker sequences
which are capable of providing phenotypic selection in transformed
cells. For example, E. coli is typically transformed using a
derivative of pBR322 which is a plasmid derived from an E. coli
species (Bolivar, et al., Gene 2: 95 [1977]). pBR322 contains
genes for ampicillin and tetracycline resistance and thus provides
easy means for identifying transformed cells. The pBR322 plasmid,
or other microbial plasmid must also contain or be modified to
contain promoters and other control elements commonly used in
recombinant DNA construction.
Promoters suitable for use with prokaryotic hosts
illustratively include the P-lactamase and lactose promoter systems
(Chang et al., "Nature", 275: 615 [1978]; and Goeddel et al.,
"Nature" 281: 544 [1979]), alkaline phosphatase, the tryptophan
(trp) promoter Lystem (Goeddel "Nucleic Acids Res." 8: 4057 [1980]
and EPO Appln. Publ. No. 36,776) and hybrid promoters such as the
tac promoter (H. de Boer gt al., "Proc. Natl. Acad. Sci. USA" 80:
21-25 [1983]). However, other functional bacterial promoters are
suitable. Their nucleotide sequences are generally known, thereby
enabling a skilled worker operably to ligate them to DNA encoding
tissue factor protein using linkers or adaptors to supply any
required restriction sites (Siebenlist et al., "Cell" 20: 269
[1980]). Promoters for use in bacterial systems also will contain
-21- 13 4 1 5 8 9.
a Shine-Dalgarno (S.D.) sequence operably linked to the DNA
encoding tissue factor protein.
In addition to prokaryotes, eukaryotic microbes such as
yeast cultures may also be used. Saccharomyces cerevisiae, or
common baker's yeast is the most commonly used eukaryotic
microorganism, although a number of other strains are commonly
available. For expression in Saccharomyces, the plasmid YRp7, for
example, (Stinchcomb, et al., Nature 282: 39 [1979]; Kingsman et
al, Gene 7: 141 [1979]; Tschemper et al., Gene 10: 157 [1980]) is
commonly used. This plasmid already contains the trpl gene which
provides a selection marker for a mutant strain of yeast lacking
the ability to grow in tryptophan, for example ATCC no. 44076 or
PEP4-1 (Jones, Genetics $5: 12 [1977]). The presence of the trpl
lesion as a characteristic of the yeast host cell genome then
provides an effective means of selection by growth in the absence
of tryptophan.
Suitable promoting sequences for use with yeast hosts
include the promoters for 3-phosphoglycerate kinase (Hitzeman et
al., "J. Biol. Chem." 55: 2073 [1980]) or other glycolytic enzymes
(Hess et al., "J. Adv. Enzyme Reg." 7: 149 [1968]; and Holland,
"Biochemistry" 17: 4900 [1978]), such as enolase, glyceraldehyde-3-
phosphate dehydrogenase, hexokinase, pyruvate decarboxylase,
phosphofructokinase, glucose-6-phosphate isomerase, 3-
phosphoglycerate mutase, pyruvate kinase, triosephosphate
isomerase, phosphoglucose isomerase, and glucokinase.
Other yeast promoters, which are inducible promoters having
the additional advantage of transcription controlled by growth
conditions, are the promoter regions for alcohol dehydrogenase 2,
isocytochrome C, acid phosphatase, degradative enzymes associated
with nitrogen metabolism, metallothionein, glyceraldehyde-3-
phosphate dehyd=ogenase, and enzymes responsible for maltose and
-22- ; 3 4 1 5 8 9 -
galactose utilization. Suitable vectors and promoters for use in
yeast expression are further described in R. Hitzeman et al.,
European Patent Publication No. 73,657A. Yeast enhancers also are
advantageously used with yeast promoters.
Preferred promoters controlling transcription from vectors
in mammalian host cells may be obtained from various sources, for
example, the genomes of viruses such as: polyoma, Simian Virus 40
(SV40), adenovirus, retroviruses, hepatitis-B virus and most
preferably cytomegalovirus, or from heterologous mammalian
promoters, e.g. beta actin promoter. The early and late promoters
of the SV40 virus are conveniently obtained as an SV40 restriction
fragment which also contains the SV40 viral origin of replication.
Fiers et al., Nature, 273: 113 (1978). The immediate early
promoter of the human cytomegalovirus is conveniently obtained as a
HindIII E restriction fragment. Greenaway, P.J. et al., Gene 18:
355-360 (1982). Of course, promoters from the host cell or related
species also are useful herein.
Transcription of a DNA encoding tissue factor protein by
higher eukaryotes is increased by inserting an enhancer sequence
into the vector. Enhancers are cis-acting elements of DNA, usually
from about 10 to 300bp, that act on a promoter to increase its
transcription initiation capability. Enhancers are relatively
orientation and position independent having been found 5' (Laimins,
L. et al., Proc.Natl.Acad.Sci. 78: 993 [1981]) and 3' (Lusky, M.L.,
gt al., Mol. Cell Bio. 3: 1108 [1983]) to the transcription unit,
within an intron (Banerji, J.L. gt gl., Cell 33: 729 [1983)) as
well as within the coding sequence itself (Osborne, T.F., et al.,
Mol. Cell Bio. 4: 1293 [1984]). Many enhancer sequences are now
known from mammalian genes (globin, elastase, albumin, a-
fetoprotein and insulin). Typically, however, one will use an
enhancer from a eukaryotic cell virus. Examples include the SV40
enhancer on the late side of the replication origin (bp 100-270),
-23-
13 41589
the cytomegalovirus early promoter enhancer, the polyoma enhancer
on the late side of the replication origin, and adenovirus
enhancers.
Expression vectors used in eukaryotic host cells (yeast,
fungi, insect, plant, animal, human or nucleated cells) may also
contain sequences necessary for the termination of transcription
which may affect mRNA expression. These regions are transcribed as
polyadenylated segments in the untranslated portion of the mRNA
encoding tissue factor protein. The 3' untranslated regions also
include transcription termination sites.
Expression vectors may contain a selection gene, also
termed a selectable marker. Examples of suitable selectable
markers for mammalian cells are dihydrofolate reductase (DHFR),
thymidine kinase or neomycin. When such selectable markers are
successfully transferred into a mammalian host cell, the
transformed mammalian host cell can survive if placed under
selective pressure. There are two widely used distinct categories
of selective regimes. The first category is based on a cell's
metabolism and the use of a mutant cell line which lacks the
ability to grow independent of a supplemented media. Two examples
are: CHO DHFR- cells and mouse LTK- cells. These cells lack the
ability to grow without the addition of such nutrients as thymidine
or hypoxanthine. Because these cells lack certain genes necessary
for a complete nucleotide synthesis pathway, they cannot survive
unless the missin& nucleotides are provided in a supplemented
media. An alternative to supplementing the media is to introduce
an intact DHFR or TK gene into cells lacking the respective genes,
thus altering their growth requirements. Individual cells which
were not transformed with the DHFR or TK gene will not be capable
of survival in non supplemented media.
-24-
4 1 5 89
The second category is dominant selection which refers to a
selection scheme used in any cell type and does not require the use
of a mutant cell line. These schemes typically use a drug to
arrest growth of a host cell. Those cells which have a novel gene
would express a protein conveying drug resistance and would survive
the selection. Examples of such dominant selection use the drugs
neomycin, Southern P. and Berg, P., J. Molec. Appl. Genet. .1: 327
(1982), mycophenolic acid, Mulligan, R.C. and Berg, P. Science 209:
1422 (1980) or hygromycin, Sugden, B. gt al., Mol. Cell. Biol. ~:
410-413 (1985). The three examples given above employ bacterial
genes under eukaryotic control to convey resistance to the
appropriate drug G418 or neomycin (geneticin), xgpt (mycophenolic
acid) or hygromycin, respectively.
"Amplification" refers to the increase or replication of
an isolated region within a cell's chromosomal DNA. Amplification
is achieved using a selection agent e.g. methotrexate (MTX) which
inactivates DHFR. Amplification or the making of successive copies
of the DHFR gene results in greater amounts of DHFR being produced
in the face of greater amounts of MTX. Amplification pressure is
applied notwithstanding the presence of endogenous DHFR, by adding
ever greater amounts of MTX to the media. Amplification of a
desired gene can be achieved by cotransfecting a mammalian host
cell with a plasmid having a DNA encoding a desired protein and the
DHFR or amplification gene permitting cointegration. One ensures
that the cell requires more DHFR, which requirement is met by
replication of the selection gene, by selecting only for cells that
can grow in the presence of ever-greater MTX concentration. So
long as the gene encoding a desired heterologous protein has
cointegrated with the selection gene replication of this gene gives
rise to replication of the gene encoding the desired protein. The
result is that increased copies of the gene, i.e. an amplified
gene, encoding the desired heterologous protein express more of the
desired heterologous protein.
-25-
;3 4 1 589
Preferred suitable host cells for expressing the vectors of
this invention encoding tissue factor protein in higher eukaryotes
include: monkey kidney CV1 line transformed by SV40 (COS-7, ATCC
CRL 1651); human embryonic kidney line (293, Graham, F.L. &I gI. J.
Gen Virol. 36: 59 [1977]); baby hamster kidney cells (BHK, ATCC CCL
10); chinese hamster ovary-cells-DHFR (CHO, Urlaub and Chasin,
Proc.Natl.Acad.Sci. (USA) Z: 4216, [1980]); mouse sertoli cells
(TM4, Mather, J.P., Biol. Reprod. 2.3: 243-251 [1980J); monkey
kidney cells (Cl'1 ATCC CCL 70) ; african green monkey kidney cells
(VERO-76, ATCC CRL-1587); human cervical carcinoma cells (HELA,
ATCC CCL 2); canine kidney cells (MDCIf, ATCC CCL 34); buffalo rat
liver cells (BRL 3A, ATCC CRL 1442); human lung cells (W138, ATCC
CCL 75); human liver cells (Hep G2, HB 8065); mouse mammary tumor
(MMT 060562, ATCC CCL51); and, TRI cells (Mather, J.P. et al.,
Annals N.Y. Acad. Sci. 383: 44-68 [1982]).
"Transformation" means introducing DNA into an organism so
that the DNA is replicable, either as an extrachromosomal element
or by chromosomal integration. Unless indicated otherwise, the
method used herein for transformation of the host cells is the
method of Graham, F. and van der Eb, A., Virology 52: 456-457
(1973). However, other methods for introducing DNA into cells such
as by nuclear injection or by protoplast fusion may also be used.
If prokaryotic cells or cells which contain substantial cell wall
constructions are used, the preferred method of transfection is
calcium treatment using calcium chloride as described by Cohen,
F.N. et al., Proc. Natl. Acad. Sci. (USA), 69: 2110 (1972).
Construction of suitable vectors containing the desired
coding and control sequences employ standard ligation techniques.
Isolated plasmids or DNA fragments are cleaved, tailored, and
religated in the form desired to form the plasmids required.
-26-
13 41589 _
For analysis to confirm correct sequences in plasmids
constructed, the ligation mixtures are used to transform E. coli
K12 strain 294 (ATCC 31446) and successful transformants selected
by ampicillin or tetracycline resistance where appropriate.
Plasmids from the transformants are prepared, analyzed by
restriction and/or sequenced by the method of Messing et al.,
Nucleic Acids Res. 9: 309 (1981) or by the method of Maxam et al.,
Methods in Enzyrnology 65: 499 (1980).
Host cells can be transformed with the expression vectors
of this invention and cultured in conventional nutrient media
modified as is appropriate for inducing promoters, selecting
transformants or amplifying genes. The culture conditions, such as
temperature, pH and the like, are those previously used with the
host cell selected for expression, and will be apparent to the
ordinarily skilled artisan.
"Transfcction" refers to the taking up of an expression
vector by a host cell whether or not any coding sequences are in
fact expressed. Numerous methods of transfection are known to the
ordinarily skilled artisan, for example, CaP04 and electroporation.
Successful transfection is generally recognized when any indication
of the operation of this vector occurs within the host cell.
In order to facilitate understanding of the following
examples certain frequently occurring methods and/or terms will be
described.
"Plasmids" are designated by a lower case p preceded and/or
followed by capital letters and/or numbers. The starting plasmids
herein are either commercially available, publicly available on an
unrestricted basis, or can be constructed from available plasmids
in accord with published procedures. In addition, equivalent
-27- ~341569
plasmids to those described are known in the art and will be
apparent to the ordinarily skilled artisan.
"Digestion" of DNA refers to catalytic cleavage of the DNA
with a restriction enzyme that acts only at certain sequences in
the DNA. The various restriction enzymes used herein are
commercially available and their reaction conditions, cofactors and
other requirements were used as would be known to the ordinarily
skilled artisan. For analytical purposes, typically 1 g of
plasmid or DNA fragment is used with about 2 units of enzyme in
about 20 l of buffer solution. For the purpose of isolating DNA
fragments for plasmid construction, typically 5 to 50 g of DNA are
digested with 20 to 250 units of enzyme in a larger volume.
Appropriate buffers and substrate amounts for particular
restriction enzymes are specified by the manufacturer. Incubation
times of about 1 hour at 37 C are ordinarily used, but may vary in
accordance with the supplier's instructions. After digestion the
reaction is electrophoresed directly on a polyacrylamide gel to
isolate the desired fragment.
"Recovery" or "isolation" of a given fragment of DNA from a
restriction digest means separation of the digest on polyacrylamide
or agarose gel by electrophoresis, identification of the fragment
of interest by comparison of its mobility versus that of marker DNA
fragments of known molecular weight, removal of the gel section
containing the desired fragment, and separation of the gel from
DNA. This procedure is known generally (Lawn, R. 11 g1., Nucleic
Acids Res. 9: 6103-6114 [1981], and Goeddel, D. et al., Nucleic
Acids Res. 8: 4057 [1980]).
"Dephosphorylation" refers to the removal of the terminal
5' phosphates by treatment with bacterial alkaline phosphatase
(BAP). This procedure prevents the two restriction cleaved ends of
a DNA fragment from "circularizing" or forming a closed loop that
-28-
134i589.
would impede insertion of another DNA fragment at the restriction
site. Procedures and reagents for dephosphorylation are
conventional (Maniatis, T. et A_1., Molecular Cloning, 133-134 Cold
Spring Harbor, [1982]). Reactions using BAP are carried out in
50mM Tris at 68 C to suppress the activity of any exonucleases
which may be present in the enzyme preparations. Reactions were
run for 1 hour. Following the reaction the DNA fragment is gel
purified.
"Ligation" refers to the process of forming phosphodiester
bonds between two double stranded nucleic acid fragments (Maniatis,
T. et al., Id. at 146). Unless otherwise provided, ligation may be
accomplished using known buffers and conditions with 10 units of T4
DNA ligase ("ligase") per 0.5 pg of approximately equimolar amounts
of the DNA fragments to be ligated.
"Filling" or "blunting" refers to the procedures by which
the single stranded end in the cohesive terminus of a restriction
enzyme-cleaved nucleic acid is converted to a double strand. This
eliminates the cohesive terminus and forms a blunt end. This
process is a versatile tool for converting a restriction cut end
that may be cohesive with the ends created by only one or a few
other restriction enzymes into a terminus compatible with any
blunt-cutting restriction endonuclease or other filled cohesive
terminus. Typically, blunting is accomplished by incubating 2-
15 g of the target DNA in 10mM MgC12, 1mM dithiothreitol, 50mM
NaCl, 10mM Tris (pH 7.5) buffer at about 37 C in the presence of 8
units of the Klenow fragment of DNA polymerase I and 250 M of each
of the four deoxynucleoside triphosphates. The incubation
generally is terminated after 30 min. phenol and chloroform
extraction and ethanol precipitation.
Human tissue factor protein and its recombinant expression
product is obtained according to the following protocol:
-29- 41589
1. Oligonucleotide probes representing a single codon choice
for each amino acid corresponding to the amino terminal
portion of tissue factor protein, and the CNBr peptide
fragment were chemically synthesized.
2. Two deoxyoligonucleotides complementary to codons for amino
acid sequences of tissue factor protein, described below,
were synthesized and radiolabelled with 732 P-ATP.
a) 5' CTG ACC TGG AAG TCC ACC AAC TTC AAG ACC ATC CTG-
GAG TGG GAG CCC AAG CCT GTG AAC -3'; and
b) 5' ATG GGC CAG GAG AAG GGC GAG TTC CGG GAG ATC TTC-
TAC ATC ATT GGC GCT GTG GTC TTT GTG GTG ATC ATC-
CTG GTG ATC -3'.
3. Oligo (dT) primed cDNA libraries were constructed in agt10.
4. A human placental cDNA library was screened using the
chemically synthesized oligonucleotide probes. No positive
plaques were obtained using the 60 mer probe (a). Twenty-
two (22) positive plaques were obtained using the 81 mer
probe (b), half of which were very weakly positive. The
eleven (11) best were chosen to rescreen for plaque
purification. Five positive plaques were obtained on the
second screen. DNA was prepared from each of these.
5. Clones having a total cDNA of approximately 2800 bp of
insert DNA were isolated. Sequencing and characterization
of the placental clones were undertaken. Since the mRNA
size on a Northern blot was approximately 2.35 Kb these
clones may have contained unexcised introns. Hence a human
adipose library was screened.
-30-
13 41589
6. An oligo (dT) primed human adipose library was screened
using a 1400 bp coRI fragment from one of the placental
clones.
7. Clones having a total cDNA of approximately 2350 bp
(including 150 to 200 bp for the polyA tail) and 1800 bp of
insert DNA were isolated. Those clones containing 2350 bp
and presumed to contain all the tissue factor mRNA were
sequenced.
8. The full length cDNA encoding human tissue factor protein
is constructed in a plasmid. It should be appreciated that
knowledge of the complete DNA sequence in Fig. 2 enables
one to prepare extremely long probes having perfect
homology with human tissue- factor protein cDNA, thereby
considerably simplifying and increasing the efficiency of
probing cDNA or genomic libraries from other species, and
making it possible to dispense with tissue factor protein
purification, sequencing, and the preparation of probe
pools.
9. The cDNA encoding human tissue factor protein is then
constructed into an expression vehicle which is used to
transform an appropriate host cell, which is then grown in
a culture to produce the desired tissue factor protein.
10. Biologically active tissue factor protein is produced
according to the foregoing procedure has 263 amino acids.
The following examples merely illustrate the best mode now
contemplated for practicing the invention, but should not be
construed to limit the invention.
.~>~.
-31-
4 1589
EXAMPLE 1
cDNA Clonine
DNA encoding tissue factor protein may be obtained by
chemical synthesis when the complete DNA sequence is known, by
screening reverse transcripts of mRNA from various tissues, or by
screening genomic libraries from any cell. Since neither the
complete amino acid nor DNA sequence of tissue factor protein were
known at the time of this invention, the chemical synthesis of the
complete DNA sequence encoding tissue factor protein was not
possible. A human placental cDNA library was prepared as previously
described (Ullrich, A. et &I., Nature 309:418-425 [1984)).
Double-stranded cDNA was prepared from human adipose RNA using
reverse transcriptase in known fashion and, after E. coli RNase H
treatment DNA polymerase I was used to synthesize the second strand
and then ligated to synthetic oligonucleotides containing
restriction sites for SalI, SstI, ~hoI and an EcoRI overhanging
end, as described previously (Gubler, U. and Hoffman, B.J., Gene
25: 263 [1983)). This DNA was inserted into the coRI site of
AgtlO (Huynh, T. et al., DNA Cloning Techniques [ed. Grover,
D.][1984]).
Two oligonucleotide probes representing one possible codon
choice for each amino acid of the N-terminal amino acid sequence
(60 nucleotides) and the internal amino acid sequence near the C-
terminal (81 nucleotides) were designed and synthesized based on
the following amino acid sequences presented at an American Heart
Association meeting as cited above:
-32- 1341589
Amino terminal
5' CTG ACC TGG AAG TCC ACC AAC TTC AAG ACC ATC CTG GAG-
Leu Thr Trp Lys Ser Thr Asn Phe Lys Thr Ile Leu Glu-
TGG GAG CCC AAG CCT GTG AAC -3'
Trp Glu Pro Lys Pro Val Asn
Near C-terminal
5' ATG GGC CAG GAG AAG GGC GAG TTC CGG GAG ATC TTC TAC-
Met Gly Gln Glu Lys Gly Glu Phe Arg Glu Ile Phe Tyr-
ATC ATT GGC GCT GTG GTC TTT CTG GTG ATC ATC CTG GTG ATC-3'
Ile Ile Gly Ala Val Val Phe Val Val Ile Ile Leu Val Ile-
cDNA clones of human tissue factor protein were obtained using the
DNA probes first to screen a human placental cDNA library. A 1400
bp coRI fragment from a placental clone was used to screen a human
adipose cDNA library.
About 1 million phage from the oligo(dT) primed human
placenta cDNA library in Agt10 were grown on twenty-five (25) 15-cm
petri plates from which triplicate nitrocellulose filters were
lifted. The filters were hybridized with each of the 32P-end
labelled oligonucleotide probes in 0.75M NaCl, 75mM trisodium
citrate, 50 mM sodium phosphate (pH 6.8), 5X Denhardt's solution,
20 percent formamide, 10 percent dextran sulfate and 0.2 g/l
boiled, sonicated salmon sperm DNA at 42 C overnight and washed for
2 hrs in 0.30M NaC1, 30mM trisodium citrate, 0.1 percent NaDodSO4
at 42 C. Twenty-two (22) hybridizing duplicate positives were
observed with filters hybridized with the tissue factor protein
near C-terminal probe. The eleven (11) best were chosen for plaque
purification. Tissue factor protein amino terminal probe failed to
hybridize. Five clones were positive upon plaque purification.
DNA was prepared from each of these and then analyzed by digestion
with coRI. One clone was shorter and appeared to be a partial
clone. Four clones which were identical based on an coRl digest
-33-
13 4 1 5 89
were the best candidates for full-length cDNA clones. EcoRI
fragments from three of the clones, the partial clone and two of
the putative full length clones, were subcloned into M13 phage
vectors for DNA sequencing by dideoxy chain termination (Messing,
J. et al., Nucleic Acids Res. 9:309-321 [1981]).
A 1400 bp coRI fragment from a placental cDNA clone was
hybridized to a Northern blot to which was bound mRNA. The size of
the tissue factor protein mRNA was determined to be about 2.35 kb
in the placental samples which tested positively. The placental
cDNA clones were approximately 2800 bp in length including the
nucleotides corresponding to the polyA tail on the mRNA. These
clones were approximately 450 bp longer than the observed length of
the mRNA on the Northern blot. Stop codons and methionine codons
in all three reading frames were observed immediately upstream of
the DNA encoding the amino terminus of the protein, suggesting the
absence of a signal sequence. The lack of a signal sequence
immediately 5' of the sequence representing the NH2 terminus of the
mature protein in the placental clones was confirmed by comparison
to the adipose clones described below. It was also determined by
comparison of the placental and adipose sequences that the
placental clones contained an intervening sequence or intron not
present in the adipose clone. The presence of the intron in the
placental clone suggests a poor splicing mechanism in the placenta
making the isolation and cloning of the pre-tissue factor protein
DNA a most difficult task.
Because of the discrepancy in length between the isolated
placental clones and the mRNA as determined in Northern blotting
tissue factor protein cDNA was also isolated from an adipose
library. An adipose cDNA library constructed in agt10 was chosen
because adipose tissue has amounts of tissue factor mRNA comparable
to placental tissue. The library was screened using a 1400 bp
EcoRI fragment from a placental clone radiolabelled with 732-P-ATP
-34- ;3 41589
under conditions more stringent than those used to screen the
placental library. (The above conditions were modified to use 50%
formamide in the hybridization; and the wash in 0.03M NaC1, 3mM
trisodium citrate, 0.1 percent NaDodSO4, at 60 C.) Fourteen double
positives of varying intensities were obtained. Twelve were chosen
for plaque purification. Upon rescreening for plaque purification,
8 strong double positives were obtained. DNA was prepared from
each of these positives. Four of these, which were identical upon
digestion with f&2RI, were the best candidates for full length cDNA
clones. One of these was chosen for analysis by DNA sequencing and
labeled aTF14. The size of these clones was approximately 2350 bp,
including the length of the polyA tail. This was the same size as
observed on Northern blot as described above. A fifth clone was
shorter than the 2350 bp clones described above.
Two of the adipose cDNA clones were shorter than the full
length mRNA (approximately 1800 bp) and had fSoRI digestion
patterns which were distinctly different from the putative full
length clones. Analysis of these clones indicates that they are
partial clones in that they include DNA corresponding to a portion
of the tissue factor protein mRNA. The eighth clone was only about
850 bp and was not chosen for further analysis.
EXAMPLE 2
DNA Seauence of Tissue Factor Protein cDNA
The nucleotide sequence of tissue factor protein cDNA is
shown in Fig. 2. Of the four adipose clones having an identical
EcoRI digestion pattern, one was fully sequenced and corresponded
to the sequence shown in Figure 2. Clone ATF14 contains about 2217
bp of insert, which includes approximately 90 nucleotides of the
poly(A) tail (which is not shown in Fig 2). The cDNA sequence
contains 99 bp of 5' untranslated sequence. The LroRI digestion
pattern of the putative full length clone comprised three fragm,!,==
-35- 13 4 1 5 8 9
of about 900, 750 and 650 bp. A fifth clone appeared to differ in
the EcoRI digestion pattern in the fragment at the 5' end. Two of
the adipose clones had an coRI digestion pattern indicating they
were shorter than the full length clones but yet contained an coRl
fragment longer than any fragment in the full length clones. This
may be due to an coRI polymorphism or to the presence of an
intron. The longest clone was sequenced to completion.
Completeness of the coding sequence was assessed from the presence
of a long open reading frame beginning with a start codon, ATG.
Following the ATG initiator codon are codons for a hydrophobic
leader or signal sequence.
The 5' end of the cDNA contains an ATG start codon, for the
amino acid methionine, followed by a continuous open reading frame
that codes for a 295 amino acid polypeptide. The first 32 amino
acid residues are mostly hydrophobic amino acids and probably
represent an amino-terminal signal peptide. The amino-terminal
sequence that follows corresponds to that sequence of tissue factor
protein as purified from tissue. The cDNA sequence predicts that
the mature tissue factor protein contains 263 amino acids with a
calculated molecular weight of about 29,500. Tissue factor protein
is known to be a membrane glycoprotein with a relative molecular
mass of 42,000 to 53,000 on SDS polyacrylamide gels. The
translated DNA sequence predicts four (4) asparagine linked
glycosylation sites. A hydropathy profile of the protein (Fig. 5)
reveals that the first three of these sites are located in
hydrophilic regions, increasing the likelihood that they are on the
surface of the protein and indeed glycosylated. Likewise, a
cluster of 7 out of 13 residues (amino acids 160-172) that are
either serine or threonine, indicating possible sites of 0-linked
glycosylation, also lies in a predicted region of hydrophilicity.
The hydropathy profile also reveals a striking cluster of
hydrophobic residues near the carboxy terminus (Fig. 5). This
region, encompassing amino acids 220-243, probablv comprises the
-36- 1341589
membrane anchoring domain of tissue factor. A search of the
sequence data bases revealed no significant homology of tissue
factor to available protein sequences. Notably, there was no
marked homology to factor VIII, a protein cofactor of the
coagulation protease factor IX. This is unexpected because both
the factor VIII-factor IX, and the tissue factor-factor VII
complexes catalyze the activation of factor X, and the proteases of
each complex (factor IX and VII) are highly homologous (F.S. Hagen
et al.. Proc. Natl. Acad. Sci. USA 83:2412 [1986] and S. Yoshitake
et al., Biochemistry 24:3736 [1985]). It can now be seen that
these interactions are not reflected in a similarity of primary
protein sequence of the two cofactors.
The cDNA sequence implies that mature tissue factor is
released by signal peptidase cleavage of a prepeptide without
additional propeptide processing. The 32 amino acids from the
initial methionine to the mature amino terminus commence with a
charged region followed by a hydrophobic "core" sequence of 14
residues. The prepeptide ends in ala-gly-ala; ala-X-ala is the
most frequent sequence preceding signal peptidase cleavage (0.
Perlman et al., Mol. Biol. 167:391 [1983]).
The methionine codon at nucleotide 100-102 (Figure 2) is
presumed to initiate translation of pre-tissue factor protein. The
five nucleotides preceding and the one following this ATG are
common choices for nucleotides surrounding translation initiation
sites in eukaryotic mRNA, although they are not in complete
identity with the concensus described by Kozak, M., Nucl. Acids
Res. 12:857 [1984]. The characterized cDNA clones appear to
contain virtually the entire 5' untranslated region of the message.
The cDNA contains a 1139 nucleotide 3' untranslated region
in which the common polyadenylation signal AATAAA precedes the
poly(A) tail by 23 nucleotides. A noteworthy feature of the
-37-
1J" 41~89
untranslated region is the presence of a 300 bp Alu family repeat
sequence. There are about 300,000 copies of the Alu repeat in the
human genome, and numerous examples of their presence in the
introns of genes, where they are removed by splicing during the
maturation of mRNA (C.W. Schmid et al., Science 216:1065 [1982] and
P.A. Sharp, Nature 301:471 [1983]). Although cytoplasmic poly(A)+
mRNA also contains Alu sequences, there have only been two previous
specific reports of Alu-like sequences in the 3' untranslated
sequence of mRNAs: in the class 1 histocompatibility antigens of
mouse and rat, and in the human low density lipoprotein receptor
(L. Hood et al., Ann. Rev. Immunol. 1:529 [1983]; B. Majello et
al., Nature 314:457 [1985] and T. Yamamoto et al., Cell 39:27
[1984]). Alu sequences are often flanked by short direct repeats,
as a likely consequence of their insertion into the genome at
staggered double-strand nicks. The Alu sequence in the 3' region
of tissue factor cDNA is flanked by a direct repeat of 11
nucleotides, as indicated by arrows in Fig. 2.
EXAMPLE 3
Expression of Human Tissue Factor Protein
Eukaryote Host
The full length human tissue factor protein cDNA was
contained within the cDNA clone ATF14. The full length cDNA was
inserted into an expression plasmid comprising the cytomegalovirus
enhancer and promoter, the cytomegalovirus splice donor site and
intron, the Ig variable region intron and splice acceptor site, the
SV40 polyadenylation and transcription termination site.
Construction of the expression vector, shown in Figure 4, was
undertaken as follows.
The basic vector referred to as pCIS2.8c26D used here has
been described in Canadian Application No. 546,646.
, __
-37a-
13 41589
As shown in Figure 4a, a single nucleotide preceding the
2"I site in pF8CIS was changed from guanosine to thymidine so that
a dam- strain of F. r,~ would not be required for cutting of the
_QUI site.
A three part ligation comprising the following fragments
was carried out: a) the 12617bp Qal- stIl fragment of pFBCIS
(isolated from a dam- strain and BAp treated); the 216bp 5kiII-. stY
fragment of pFBCIS; and, c) a short LLtI-glaI synthetic
oligonucleotide that was kinased (see Figure 4a, an asterisk
indicates the changed nucleotide). This three part ligation
generates the expression vector pCIS2.8c24D which is identical to
the pCIS2.8c26D and, pCIS2,8c28D in the portions used to express
tissue factor.
This vector was modified to
-38-
remove
the factor VIII coding sequence by aaaI-II digest. The
region was replaced by a polylinker to allow for additional cloning
sites. The sequence of the polylinker used is given below.
5' CGATTCTAGACTCGAGGTCCGCGGCCGCGTT 3'
3'TAAGATCTGAGCTCCAGGCGCCGGCGCAA 5'
The C 1aI and I aI sites of the original vector are regenerated and
sites,, for enzymes XbaI, t~oI, NotI were added. This vector is
called pCIS2.CXXNH. The coding region for tissue factor was
subcloned from aTF14 by using the SalI site present at the 5'
junction of the A vector and the cDNA and a coI site located 3' of
the coding region in the noncoding portion of the cDNA. A blunt 3'
end was first created by digesting with Ncol followed by a fill-in
reaction containing the Klenow fragment DNA polymerase and 4
dNTP's. When the aTF14 DNA was subsequently cut with SalI an
approximately 1232 bp fragment with the sequence TCGA overhanging
at the 5' end and a blunt 3' end containing the tissue factor
coding region was created. This was ligated into the pCIS2.CXXNH
vector which had been cut with XhoI (yielding a TCGA overhang) and
HDaI (blunt). The new vector was labelled pCIS.TF or alternatively
referred to as pCISTF1.
Human embryonic kidney cells (293 cells) and monkey kidney
cells (Cos cells) were transfected with the expression vector
pCIS.TF containing the tissue factor protein cDNA. 48 hours after
transfection the cells were harvested and tested for tissue factor
protein activity by the chromogenic assay described below. Cells
were removed from the 100 mm plates by suspension in 1 ml of 0.01 M
sodium phosphate buffer, pH 7.0, containing 0.15 M NaC1. The
absorbance at 550 nM was adjusted to 0.750 in order to adjust for
differential cell density on the plates. The cells were sonicated
for 1 min and Triton X-100 *was added to a final concentration of
0.1 percent. The samples were rotated at room temperature for 90
min and cellular debris removed by centrifugation at 10,000 x g.
*Trade-mark
-39- i S 4 1 :3 8 9
Detergent solubilized extracts were relipidated by diluting 2 l of
the sample into 0.8 ml 0.05 M Tris-HC1, pH 7.5, containing 0.1 M
NaCl, 0.1 percent bovine serum albumin (TBS buffer). Fifty l of
a 5 mg/mi solution of phosphotidylcholine (lecithin) in 0.25
percent deoxycholic acid and 25 1 of CdC12 were added and the
solution incubated for 30 min at 37 C.
Recombinant tissue factor protein was tested for its
ability to function in a specific chromogenic assay. The results
are shown in Fig. 9. As expected, various concentrations of rabbit
brain thromboplastin (crude tissue factor) were found to react in
the assay. Control COS-7 cells (containing the parent expression
vector without tissue factor cDNA) had an activity only slightly
above the assay blank (with the addition of relipidation mixture
alone) (Fig. 9). The cells transfected with the tissue factor
expression plasmid, in contrast, showed a strong positive reaction
in the assay, thereby demonstrating that the cDNA encodes tissue
factor.
EXAMPLE 4
Expression of Human Tissue Factor Protein
Prokaryote Host
The plasmid pTF2A12 was designed to express mature tissue
factor protein in E. coli using the alkaline phosphatase promoter
and the STII leader sequence (U.S. Patent 4,680,262). This plasmid
was constructed as shown in Figure 6, by the ligation of four DNA
fragments, the first of which was the synthetic DNA duplex:
5' TCAGGCACTACAAATACTGTGGCAGCATATAATT
ACGTAGTCCGTGATGTTTATGACACCGTCGTATATTAAATTG-5'
The above fragment codes for the first 12 amino acids of mature
tissue factor protein. The second was a 624 base pair BbvI-EcoRI
restriction fragment from pCISTF, described above, coding for amino
-40- 13 415 89
acids 13 to 216. The third was a 518 base pair E.QoRI-EamHI
fragment from pCISTF which encodes the last 47 amino acids of
tissue factor protein. Plasmid pAPSTII HGH-1 (U.S. Patent
4,680,262) was digested with 930 bp Ts'I EamHI to produce a
fragment.
The four fragments were ligated together to form plasmid
pTF2A12, as shown in Figure 6, and used to transform E. coli K12
strain 294 cells. Transformants were selected by ampicillin
resistance and plasmid pTF2A12 was selected by restriction analysis
and dideoxy sequencing.
E. coli K12 strain 294 cells containing expression vectors
were grown overnight at 29 C in low phosphate media containing 50
g/ml carbenicillin. Cell pellets from 1 ml of culture with an
absorbance of 1 at 600 nM were resuspended in 200 l 50 mM Tris-HC1
pH 7.5, 150 mM NaCl, 1% Triton X-100, 1 mg/ml lysozyme. The
suspensions were pulse sonicated for 1 minute followed by
centrifugation at 10,000 x g to remove cell debris. Detergent
solubilized extracts were relipidated by diluting 10 1 of the
sample into .8 ml of .05 M Tris-HC1 pH 7.5 containing 0.1 M NaCl,
0.1% bovine serum albumin (TBS buffer). Fifty 1 of a 5 mg/ml
solution of phosphotidyl choline in 0.25% deoxycholic acid and 25
1 of CdC12 were added and the solution incubated for 30 minutes at
37 C.
Tissue factor activity was detected by chromogenic assay as
described below.
EXAMPLE 5
Expression of Human Tissue Factor Protein Mutant
The plasmid pTFIII is designed to express a mature mutant
form of tissue factor protein in E. coli. This mutation converts
-41- ~341589
cysteine at position 245 of mature tissue factor protein to serine.
The controlling elements for expression, the alkaline phosphatase
promoter and STII leader sequence are identical to that used in
constructing plasmid pTF2A12.
Plasmid TFIII was made in three steps, the first two of
which reconstruct the carboxyl end of the gene. The plasmids
pTF100-1 and pTR80-3 are the results of the first two steps.
Plasmid pTF100-1 was constructed from three DNA fragments
(see Fig. 7a). The first is the cloning vector pTrp14 (U.S. Patent
No. 4,663,283) in which a non essential LqQRI-XbaI fragment is
removed (Figure 7). The second was a 32 base pair coRI-LokI
fragment encoding amino acids 217 to 228 of mature tissue factor
protein. The third fragment encoding amino acids 229-245 was a
chemically synthesized DNA duplex wherein the codon at position 245
was changed to TCT (underlined) from TGT:
5'-TA TTT GTG GTC ATC ATC CTT GTC ATC ATC CTG
A CAC CAG TAG TAG GAA CAG TAG TAG GAC
GCT ATA TCT CTA CAC AAG T
CGA TAT AGA GAT GTG TTC AGA TC-5'
The three fragments were ligated together forming plasmid pTF100-1
and transformed into B. coli K12 strain 294. Transformants were
selected by ampicillin resistance and plasmid pTF100-1 was selected
by restriction analysis and dideoxy sequencing.
Plasmid pTF80-3 was constructed from two DNA fragments
(Figure 7b). The first was plasmid vector pHGH2O7 (U.S. Patent No.
4,663,283) in which the 930 base pair ~baI-BAMHI fragment had been
removed. The second was the chemically synthesized 68 mer DNA
duplex:
~341589
_- A(;~
_= --
-.- -: :: . r- = - - - - - - - = -- - - - --- --- -
_-_--==-iLi -F =- '----_
i
-4_--,-
&LA6&_ _>-
---__-_ -_ _- - __ _-- ---- - - _-`- - _ -_=_Fti_--
- - - =.F r - _ -
-_ i - ~ __ _ a _ _.- e ny..
_ _ - _-_ ~:- v _ _~_- _- f-_- ~. ~./-~=_ - _- . r= ._
- = = ~- - ~ t -
_--_--_ --i- - _ _ -_ --'-__ ---- ~~-_ - - --- ----=-.,---_ -
= ~ 28 - 1 3 4 1 5 8 9
_Cv3 sKgV;::Lj-=n of =--Z5 -- _ 2RKs
z==_ sCa~=-rig pas_:rid -s_ p C =".8c 28
bas~ _ _z~b e-E=s nn _ __--3r~~ == I thi=QZgh 6 --fe. r -- gM-Ac2t
ba =r =re -_~ ~Y:e T == the 12L~RI u=YU
- a-_-_ote- , The =~- ~omÃ~--' Lvir-- ~arX4 _ _omo ar an id th,
-_ t~r'-_ anc =- -~'A -`a' gla== _a 3t~-r-:
cvt~_=~$~~=:`-_S -r:
ClC-_-
~r~~~e^= __=-_.. ~'_~_=.$e=vv (~`~'--==-'"1= - o t = _pFt_ __tp sa pUCi -=
,- f 1 - 8 ty = 1 Y n U. L _-_ = A ~ic. G
''~i_' -0 ~ TC r ~ ---- .~i
i s h -
~ 4=_ =l j. a~- -_ =-= z: ~--
~` -'-rt1 --- s c *f t~ the ==n tp- us0a 1 r -}__Ch _--7-le _ _3nde-
--ft m_ m ` for _
- _s,.
-ft fia?:e = p---8 0--=1 = a 1=.-- = ~_-_-_e r:c =f rn~
-- ' 201 -- -' ---`--- - --- - ' _ = _ -_~ -
:~ _~ =I s-== r at
T-_= -aS =~ p~
e ai1d~ j u~NA =--=- ti ,a~. fr ar --~tiv E- in =- - -ur to
1ni z=ti.at 6 =-r=?: A;:=_, ~`a__ ~,:6-i-_9::~ 31 N te a
- - -
L: ;ite- --_ia ct e== _f_-~t as. _ syn-_~-_ic =s:e _- = _==Yh -_--_a ir:e
__=- aP6 _me. te - ;-,E!e t~.~ s - ~ -
~~~--_ I:
== =e ne=-~jrn to ~f ro~r_= _se ~~ =
= 1 ~-
i`Glir- -ta=- -`_ -ia6lTS!_:'=_- ia l-- -M1'EpT
S- nce.- ene_ t- wa- -One rd __-_nt:iE;==-_ 4r_u
==~e sI e --_i n~ - -abel- - 110 -~} a-_- -ow ---__tger y . 5~--
-=---.-ntir =.10rr wertf -cke-- and S--~en~_~-: W& _
4A ~ rif4= - aYiu ---U1l$- _'E --'S.
LS
~~it~ -u-' -_:-:Tk F= -._d s 4o = = iYc
L' - - ~~ -'-
~ _ -__.~]$; ~P~= ~.=. ~t~==-`'3raE_ _nd c - :i * >.~ ` Ri ' =_ _f t}=T
a- proprt-Siz_:
S ??i3 '~--'~?te'r -~3 I12ad_ =C? ~.?P =';Sei-~ ~a
3'-=- to 4e T)Uin tw~- _ a:_
'g,p 4z_ ~-- _ i~~.g=-= ?_ ==ie -_=-~R_
~
p ~
_ __ ~7 ~d LL_ _~G = _
_~F #~_
-4 IIb =
13 41589
sRquar.~eU in both a_d c=:=r;-3 ~r~.a laDea1=d 'P-P6-T. a=3
p"a(
-.:ir s~-=~=_ _iT= :~a,t J1 =.c"
~=~
and "n sI ;ifl C=3~_ . A i~ ~I`= 4Et36~
.... .
_ - ,
~~~}~~~
^' ^ r}=~} - _ - _ - =~8_.
' ~~A3 - CZ -t~ _?-3 I
G{='-~Epp6-~ li= 1 =o ~ -3s S=~e:tj-!A e -4 --3
190~ated _Y: - T1a3t~-: d p-rH-r :f ---a s.~..R AaR.~ .
i'h- -=I4-__-i,r e__-A -po' vA 7i--:fa- zas i.,ort-tr_d
~.4 a-m t Om r== I-_, ~F~~~ and
1 t
E_4`-==d 1'Cr Q th_'- t * L-ple,- f_ts~ ~ yU=-1
f3VTRr
~- ~-= Tt-i - 3{-e ~t ~ 16 w z-S, -em-=v--.3 -y p a=~=~? _,-'
.
v-c`: I arI -i=I i-_~ ir wat czlC,-0~
ti='=t M -j -'~'r -,~i= t-g--1 -~-=$ -Tl we_~ -C_3~-ar as~d
t- e =c`E r== :e c=c) r_ = 3s i_-O1-tu~
Ia .~ s_~~.I ~-.
.f- tt1=~ ~ p-
zG d -~vt`-- 'L~- 5!Ta- GiP~~ -~~=~C~
L[:
'_ L . -_ r y~
~L=eC}-.
~._ ~ .l.u.jai =~-I~ _6~-6' r_-n t E z
O'_A:AU =I -WaS iYo_tt-~ an_- I-=-s?=-rt_d Ii `? - 'u= p ..Ãi-T-:a--
-'= = V ; _
~ `~~ 4 3tr=~~T~ t .
2~
à `j
~`~J=~F ~ T = S r-~=-! w-3 -~t with b :ut-_te~ -z~ stl~-l-g, a~. A e.=ot-_=
wi__.e-jt ari wR_
~:--d rteWned pE=Y ,
- 7. p=;'L ~ a= c=-t wi-In _tn-= and DaM . ~ ,i= = t = ~-
F-_
w an= ~--~a3aved_ L_1-~ ~s -~e-~ t-l~
=ia.zf~~ ~R_'-a?t`=- ~u~.
13 41589
8. ihe 1U.L; TI I 3i t= wL- c; Ye *_`s'ti to a HLm_g I -=te =_is-=_~ -
c r_--n
ecp
oz D:v_- uF -~ ~ on~
rc~r_~rrr. A T on--= rt-_ i.=- a 4
> s T g
Mes-ric'--on a-_ _he_ : n
-t1e e.-= 1 y _
im-T.tBr = C0 a = 3 - _~~ l_-` en- ar-_ at
te~~~ni _-on _it"- ~c~= ~_.1 A =-=si--ve a s de--if- ~i -~_~ -_-~^~-
pRF--~~arr---ma; I- l.
3. ~~.~-==sm- v ma_ --as =ut t- ?s=T ~__ _ N-Z --a411 _
RI==-Ii -iT-i -==t and ` =_ke_ weta ii=_= e-= tn; M-==irs =or _aC
~fr ~r -_t e -o1 =. 'vy, -ur, It -1s= de _ m u a -ar:=
Of ""iE~ --_--" _-- ---_"~----Y`b -~ OTI ` _ ss tE-- ~-a --
= Tt? = _ ~ I: ~ J ~ - - 3 t -
~-_,
c_ mo_~
,
a F` -11 _lr-_ . 3;Fe-t--~1~-_ ? '_(~ra _
-- i-=~ 4-== ~t'- _ui'~ J~- ~lI`Z=-
~_ _ , .. _ . ..
B8'~
~ ~ e_~ C __- õ--=
Zt
=~ ~1RT -1 ~ - ~:
3 =-~i
3~!z`ec= and sG===Z=_~tt-: ==si__~=e-_ were i===:t4--a~. 7I-
slc,ne w- . r = ms4 =P-K-. . : [~ R= c.~z- e ctt A.4- t~-
~nc t~
~G
ih4. -C_li t-_ns F-lb~ CHiF io-3n-ar ta_S_
~pat~.a =--r ,- _ t - Iw'= in -on. _nd -~1=-- ~ =-=e pY_r , :he
~_ ~
-43- 1341589
promoter, the SV40 poly A signal and SV40 origin of replication; it
has no DHFR gene. Construction of the tissue factor protein
expression vector was undertaken as follows: the tissue factor
protein cDNA from ATF14 was cloned into the S,&JI site of pSP64 and
labelled pSP64TF (Promega Corporation, 1987). pSP64 containing the
tissue factor cDNA was cut with coI. An 18 mer converter which
was not kinased was ligated to the NroI end to change the coI site
to an baI site. The sequence of the linkers used were:
NcoI - XbaI Linker
18 mer
NcoI Xbal _
5'CATGGAGTCGTAACTGAT 3'
3' CTCAGCATTGACTAGATC 5'
pSP64 was then digested with BbvI and a 1030 bp fragment was gel
isolated. A PvuII-$bvI approximately 100 bp DNA duplex which was
not kinased, contained the sequences for the first thrombin
activation site in factor VIII and the first 12 amino acids of
mature human tissue factor protein. The sequences of the
approximately 100 bp was as follows:
Tissue Factor/Thrombin Fusion
5' CTG GAG GAC AGT TAT GAA GAT ATT TCA GCA TAC TTG CTG AGT AAA
GAC CTC CTG TCA ATA CTT CTA TAA AGT CGT ATG AAC GAC TCA TTT
AAC AAT GCC ATT GAA CCA AGA TCA GGC ACT ACA AAT ACT GTG GCA
TTG TTA CGG TAA CTT GGT TCT AGT CCG TGA TGT TTA TGA CAC CGT
GCA TAT AAT T 3'
CGT ATA TTA AAT TG
The PvuII-BbvI fragment was ligated to the approximately 1030 bp
fragment. A fragment of approximately 1130 bp was gel isolated.
This PvuII-XbaI fragment was then ligated into a pSP64 vector
labelled pSP64ThTF. A clone was obtained which was sequenced over
the area comprising the synthetic 100 mer. This plasmid was
-44- 15 41589
digested with PvuII and XhAI in an attempt to isolate a large
amount of the insert. However, the MaaI site was not digested.
Therefore, the insert was gel isolated by cutting with ~vuIl and
"a I. The $alI site is in the remaining part of the pSP64
polylinker and located next to the 102AI site. The second fragment
containing the herpes-gD signal sequence plus some 5' untranslated
region comprised a 275 bp fragment obtained from the pgD-DHFR (EP
Publication 0139417, published May 2, 1985), which is digested with
stI-SacII and a 103 bp SyacII-PvuII synthetic fragment having the
following sequence:
SacII-PvuII Synthetic Fragment (HSVgD Leader)
5'-GC AAA TAT GCC TTG GCG GAT GCC TCT CTC AAG ATG GCC GAC
3'-GCG CCG TTT ATA CGG AAC CGC CTA CGG AGA GAG TTC TAC CGG CTG
CCC AAT CGA TTT CCC GGC AAA GAC CTT CCG CTC CTG GAC CAG-3'
GGG TTA GCT AAA GCG CCG TTT CTG GAA GGC CAG GAC CTG GTC-5'
The third segment was obtained by digesting pRK7 with stI-SalI and
gel isolating an approximately 4700 bp fragment. The final three
part ligation used: a) PwII-S.alI fragment containing the first
thrombin activation site 5' to the cDNA encoding tissue factor
protein; b) stI-PvuII fragment containing the herpes-gD signal
sequence; and c) the pRK fragment containing the control elements.
The 3 pieces described above and clones were obtained and
determined to be correct by restriction enzyme digestion and
sequencing.
Human embryonic kidney cells (293S) were transfected with
the expression vector containing the tissue factor-herpes-gD fusion
protein. Human 293 cells are harvested 15 hours after transient
transfection. The culture media is removed and 2 mis of extraction
buffer (5 mM Tris HC1); 150 mM NaC1:pH 7.5 [TBS] containing 0.1%
Triton X-100) are added per 100 mm tissue culture plate. The cells
are suspended and rotated (end over end) for 45-60 min. at 4 C.
The extract is centrifuged at 8000 X g for 20 min. and then loaded
-45-
directly
onto the monoclonal antibody column (3.5 mg 5B6/ml of CNBr
*
activated Sepharose) at a flow rate of 0.8 ml/min. Preparation of
an antibody to herpes-gD is described in EP Publication No.
1,139,416, published May 2, 1985. The antibody column is washed
with 10 mis of extraction buffer to return the Absorbance (280 nm)
to baseline. The column is then washed with 50 mM Tris HC1; 1M
NaCl; 0.1% Triton X-100, pH 7.5 and eluted with 0.1 M glycine; 150
mM NaC1; 0.1% Triton X-100, pH 2. The pH is adjusted to neutral
with 1 M Tris HC1, pH 8.5.
The gD portion of the gD-tissue factor fusion protein was
cleaved from the fusion protein using thrombin. 1110 units of
thrombin (0.33 mg protein) was covalently attached to 0.5 ml CNBr-
activated Sepharose according to manufacturer's instructions. 5000
units of gDTF fusion protein is incubated with approximately 150 l
of thrombin Sepharose for 90 min at 37 C (rotated end over end).
The thrombin-Sepharose is then removed by centrifugation.
Tissue factor activity was detected by chromogenic assay as
described below.
EXAMPLE 7
Expression of Cvtoplasmic Domain Deleted
Tissue Factor Protein
The vector pRKTFL244 was constructed, as shown in Figure
10, to express tissue factor protein lacking the cytoplasmic
domain, amino acids 244 through 263. The vector was constructed by
a three part ligation. The first part was an 859 bp fragment
obtained by digesting pCISTF1 with EcoRI and C1aI. The 859 bp was
gel isolated. The second portion was gel isolated following Clal-
BamHI digestion of pRK5 as described above. The third part was a
EcoRI-BamHI chemically synthesized 87 mer having the following sequence:
*Trade-mark
~,
-46- 1341589
87 mer
217
Phe Arg Glu Ile Phe Tyr Ile Ile Gly Ala Val Val Phe Val Val
5'-AA TTC AGA GAA ATA TTC TAC ATC ATT GGA GCT GTG GTA TTT GTG GTC
3'-G TCT TTC TAT GAA GTA GAT AAT TCC AGC CAC TAC AAA CAC GAC
243
Ile Ile Leu Val Ile Ile Leu Ala Ile Ser Leu His End
ATC ATC CTT GTC ATC ATC CTG GCT ATA TCT CTA CAC TAA G-3'
GAT GAT AAG GAC GAT GAT CAG AGC TAT AGA TAG GTG TTA TCC GA-5'
The three part ligation used: a) the 859 bp fragment
encoding amino acids 1-216; b) the 4700 bp fragment from pRK5; and,
c) the 87 mer encoding amino acids 217-243. This new vector was
labeled pRKTF,6244 (see Figure 10).
Human embryonic kidney cells (293) were transfected with
the expression vector pRKTFA244. After three days, cytoplasmic
domain deleted tissue factor protein were purified as previously
described and assayed in the chromogenic assay described below.
The cytoplasmic-domain deleted tissue factor showed a strong
positive reaction in the assay demonstrating that the cytoplasmic
domain deleted tissue factor protein was effective in this jn vitro
coagulation assay.
EXAMPLE 8
Purification of Tissue Factor Protein
Tissue factor protein was purified using immunoaffinity
purification using an IgG monoclonal antibody that binds human
tissue factor protein.
Human tissue factor protein was synthesized in recombinant
culture as described above. The following immunogens were injected
into a BALB/c mouse (29.1.C) according to the schedule described
below: recombinant human tissue factor protein (rTF) (.07 mg/ml
having a specific activity 17040 U/mg); recombinant tissue factor
-47- 13 4 1 5 89
protein obtained from a tissue factor-gD fusion cleaved by thrombin
to remove the herpes-gD sequences from the amino terminal end
(rTF:gDThr) (0.72 mg/ml having a specific activity 4687 U/mg) and
recombinant tissue factor-herpes-gD fusion (rTF-gD) (approximately
150,000 U/mg) on the following immunization schedule:
Day Administration Route Ingunogen
1. subcutaneous (sc) 0.25 ml of r-TF in Freund's
complete adjuvant
14. half sc and half 0.25 ml r-TF:gD in incomplete
intraperitoneal (ip) Freund's adjuvant
28. I.P. 0.25 ml of r-TF:gD in PBS
42. I.P. 0.25 ml of r-TF:gD in PBS
62. I.P. 0.25 ml of r-TF:gD in PBS
75. I.P. 0.25 ml of r-TF:gD in PBS
85. Intra-Splenic 0.1 ml of r-TF:gDThr in PBS
** 10-40 g/ml
The anti-TF titer assayed by radio-immunoprecipitation (RIP) and
ELISA increased gradually throughout the immunizations to day 85.
The RIP assay used 0.005 ml of sera from immunized and non-
immunized mice diluted with 0.495 ml of PBSTA (PBS containing 0.5%
bovine serum albumin [BSA] and 0.1% Triton X-100). 50,000 cpm of
1251-rTF was added and the mixture was incubated for 2 hr at room
temperature. 125I-rTF complexed with antibody was precipitated by
incubating for 1 hr at room temperature with 0.05 ml of SPA beads.
The SPA beads consisted of staphylococcal protein A bound to
sepharose CL-4B beads that had been pre-incubated with rabbit anti-
mouse IgG and stored in 50 mM Tris pH 8, 10 mM MgC12, 0.1% BSA and
0.02% NaN3. The beads were pelleted, washed three times with PBSTA
and counted in a gamma counter.
-48- 3 4
1~589
opl
The ELISA consisted of 0.1 ml of rTF (0.5 g/ml) in
carbonate buffer p1H 9.6 adsorbed to microtiter wells for 2 hr at
37 C. Further non-specific adsorption to the wells was blocked for
1 hr at 37 C with PBSA (PBS containing 5% BSA). The wells were
washed 3 times with PBST (PBS containing 0.1% Tween 80) and the
serum samples diluted in PBS was added and incubated overnight at
4 C. The wells were washed 3 times with PBST. 0.1 ml of goat
anti-mouse immunoglobulin conjugated to horseradish peroxidase was
added to each well and incubated for 1 hr at room temperature. The
wells were washed again and 0-phenylene diamine was added as
substrate and incubated for 25 minutes at room temperature. The
reaction was stopped with 2.5 M H2SO4 and the absorbance of each
well was read at 492 min.
On day 89 the spleen from mouse 29.1.C was harvested,
disrupted and the spleen cells fused with P3 X63-Ag8.653 (ATCC CRL
1580) ~non-secreting mouse myeloma cells using the PEG fusion
procedure of S. Fazakas de St. Groth et al., J. Immun. Meth., 35:1-
21 (1980). The fused culture was seeded into 4 plates each
containing 96 microtiter wells and cultured in HAT (hypoxanthine,
aminopterin and thymidine) media by conventional techniques
(Mishell and Shiigi, Selected Methods in Cellular Immunoloev, W.H.
Freeman & Co., San Francisco, pp. 357-363 [1980]). The anti-TF
activity of culture supernatants was determined by ELISA and RIP.
Twenty positives were found to have anti-TF activity. Of these, 12
stable fusions which secreted anti-TF were expanded and cloned by
limiting dilution using published procedures (Oi, V.J.T. &
Herzenberg, L.A., "Immunoglobulin Producing Hybrid Cell Lines" in
Selected Methods in Cellular Immunoloey, p. 351-372, Mishell, B.B.
and Shiigi, S.M. [eds.], W.H. Freeman & Co. [1980]).. Selection of
clones was based on: macroscopic observation of single clones,
ELISA and RIP. The antibody was isotyped using a Zymed isotyping
kit according to the accompanying protocol. (Zymed Corp.) Large
quantities of specific monoclonal antibodies were produced by
*Trade-mark
-49-
1341589
injection of cloned hybridoma cells in pristane primed mice to
produce ascitic tumors. Ascites were then collected and purified
over a protein-A Sepharose column.
Approximately 5 ml of ascites fluid was centrifuged at 3000
rpm in a Sorvall*6000 at 4 C for 10 min. The clear layer of
pristane and the layer of lipid was removed with a pasteur pipet.
The ascites fluid was transferred to a 50 ml centrifuge tube. The
ascites fluid was sterile filtered through a 0.45 M filter. 1.11
gram of KC1 was added to the ascites to yield a final concentration
of 3M KC1.
The ascites was loaded onto a 10 ml column containing SPA
Sepharose (Fermentech). The column was washed with 3M KC1. The
mouse IgG was eluted with 3 to 4 column volumes of 0.1 M acetic
acid in 0.15 M NaC1 pH 2.8.
The antibody D3 was coupled to CNBr Sepharose according to
the manufacturer's instructions at 3 mg IgG per ml of Sepharose.
(See Pharmacia Co. instruction manual). Transfected 293S cells
were grown in a 1:1 mixture of Ham's F-12 (w/o glycine,
hypoxanthine and thymidine) and DMEM (w/o glycine). Additions to
the basal medium include: 10% dialysed or diafiltered fetal calf
serum, 50 nM methotrexate, 2.0 mM L-glutamine and 10 mM HEPES
buffer.
A frozen vial of 293S (63/2S CISTF) is thawed in a tissue
culture flask containing the described medium. When the culture
reaches confluency it is trypsinized with trypsin-EDTA mixture and
a small portion of the cell population was used to inoculate larger
flasks. Cultures were monitored daily by phase microscopy to
determine growth (percent confluency), morphology and general
health. When rollerbottle cultures were confluent (usually within
5-7 days), the cells were trypsinized and counted. Cells were
*Trade-mark
-50- 1341589
enumerated and their viabilities determined by the trypan blue
exclusion technique. Typical cell numbers from a confluent 850 cm2
rollerbottle were between 1 to 4 x 108 cells. Cells were suspended
in 0.01 M sodium phosphate, 0.15 M NaC1. Cells were collected by
centrifugation at 5000 rpm. Cells were resuspended in 50 mis TBS
containing 1% Triton X per flask. Cultures were incubated one hour
at room temperature and then centrifuged 8000 x g for 20 min.
Supernatant was loaded onto the D3-Sepharose column described
above. The column was washed and eluted with .1 M acetic acid, 150
mM NaCl and .05% Tween 80.
EXAMPLE 9
Assay for Tissue Factor Protein
1. Chromogenic tissue factor assay.
All samples extracted from the culture medium were
relipidated prior to assay. As discussed above tissue factor has
an absolute requirement for phospholipid to exhibit activity in in
vitro assay systems (Pitlick and Nemerson, Supra). Lecithin
granules were homogenized in Tris 0.05 M, 0.1 M NaC1 pH7.4 (TBS)
containing 0.25% sodium deoxycholate to a concentration of 1 mg/ml.
This solution (PC/DOC) was used to relipidate tissue factor as
follows. Tissue factor protein was diluted into TBS containing
0.1% bovine serum albumin (TBSA). Fifty microliters were placed in
a 12x75mm polystyrene test tube and 50 l PC/DOC solution was
added. Three hundred and fifty (350) microliters TBSA were then
added along with 25 l 100 mM CdC12. This relipidation mixture was
allowed to incubate at 37 C for 30 min.
For the chromogenic assay, relipidated tissue factor
protein samples were diluted in TBSA. Ten microliters were placed
in a test tube with 50 l of the factor IXa/factor X reagent and 2
l of a solution of purified factor VII, 30 units/ml. The tubes
were warmed to 37 C and 100 l 25mM CaC12 were added. Samples were
-51-
`i =~ =r i ~ u :v
incubated
for 5 min. at 37 C prior to the addition of 50 l
chromogenic substrate specific for factor Xa, S2222, also
containing the synthetic thrombin inhibitor 12581. The reaction
was allowed to proceed for 10 min. and was stopped by the addition
of 100 l 50% glacial acetic acid solution. Absorbance was
detected at 405 nM. A standard curve was constructed using rabbit
brain thromboplastin (commercially available from Sigma, St. Louis,
MO. catalogue #T0263) arbitrarily assigning this reagent as having
100 tissue factor units/ml. Dilutions were made from 1:10 to
1:1000. Absorbance was plotted on the abscissa on semilog graph
paper with dilution of standard plotted on the ordinate.
2. One stage assay for tissue factor activity.
100 l haemophilic plasma were added to 10 l of
relipidated or lipid free tissue factor protein or TBSA as control
in a siliconized glass tube to prevent non-specific activation
through the contact phase of coagulation. The reactants were
warmed to 37 C and 100 l 25 mM CaC12 were added and clot formation
timed (Hvatum, Y. and Prydz, H., Thromb. Diath. Haemorrh. 21, 217-
222 [1969]).
EXAMPLE 10
Efficacy and Lack of Toxicity of
Tissue Factor Protein in a Canine Hemophilia Model
Tissue factor protein was infused into hemophilic dogs
using the procedure of Giles, A.R. et al., Blood 60, 727-730
(1982).
Lack of tissue factor protein toxicity was first determined
in a normal dog on bolus injection of about 50 tissue factor
protein U/kg and 100 tissue factor protein U/kg doses. A cuticle
bleeding time (CBT) was performed (Giles supra) prior to infusion
and 30 min after each injection. Blood was withdrawn and
- 5 2- T 3 4` 5 8 ~
anticoagulated for coagulation assays at various time points during
the experiment. In order to demonstrate in vivo factor VIII
bypassing activity of tissue factor protein, experiments were
conducted using hemophilic dogs. Fasting animals were anesthetized
and a CBT performed prior to any infusion. Tissue factor protein
was then administered by bolus injection and CBTs performed at
various time points up to 90 min after the infusion. Several doses
of tissue factor protein were administered. Blood samples were
withdrawn throughout the duration of each experiment and assayed
for factor V, prothrombin and partial thromboplastin times. CBTs
of greater than 12 min were regarded as grossly abnormal. Those
nails were cauterized to prevent excessive blood loss.
An anesthetized normal dog was administered doses of tissue
factor protein representing 100 U/kg of tissue factor protein on
relipidation in the chromogenic assay. The CBT in this animal was
approximately 3 min prior to any infusion. There was some
reduction in WBCT at 5 minutes while it returned to normal at 15
minutes. Factor V levels were normal 30 min after each infusion.
The prothrombin and partial thromboplastin times were unchanged at
the end of the experiment and the CBTs were also within the normal
range. Thus the infusion of tissue factor protein was well
tolerated in normal dogs and no evidence of disseminated
intravascular coagulation was found.
A hemophilic dog with a prolonged CBT characteristic of
hemophilia A was administered 100 U/kg of tissue factor protein.
The CBT was normalized at 5 minutes and 20 minutes after this
infusion. A second experiment using 100 U/kg of tissue factor
protein gave normal CGR at 20 minutes and some shortening of CBT at
90 minutes. The procoagulant effect was not maintained 90 min
after the infusion as the CBT effect was again prolonged at this
time point.
-53-
1341589
Pharmaceutical Compositions
The compounds of the present invention can be formulated
according to known methods to prepare pharmaceutically useful
compositions, whereby the tissue factor protein product hereof is
combined in admixture with a pharmaceutically acceptable carrier
vehicle. Suitable vehicles and their formulation, inclusive of
other human proteins, e.g. human serum albumin, are described for
example in Remington's Pharmaceutical Sciences by E.W. Martin.
Such compositions will
contain an effective amount of the protein hereof together with a
suitable amount of vehicle in order to prepare pharmaceutically
acceptable compositions suitable for effective administration to
the 1~ost. Such compositions should be stable for appropriate
periods of time, must be acceptable for administration to humans,
and must be readily manufacturable. An example of such a
composition would be a solution designed for parenteral
administration. Although pharmaceutical solution formulations are
provided in liquid form appropriate for immediate use, such
parenteral formulations may also be provided in frozen or in
lyophilized form. In the former case, the composition must be
thawed prior to use. The latter form is often used to enhance the
stability of the medicinal agent contained in the composition under
a wide variety of storage conditions. Such lyophilized
preparations are reconstituted prior to use by the addition of
suitable pharmaceutically acceptable diluent(s), such as sterile
water or sterile physiological saline solution. The tissue factor
protein of this invention is administered to provide a coagulation
inducing therapeutic composition for various chronic bleeding
disorders, characterized by a tendency toward hemorrhage, both
inherited and acquired. Examples of such chronic bleeding
disorders are deficiencies of factors VIII, IX, or XI. Examples of
acquired disorders include: acquired inhibitors to blood
coagulation factors e.g. factor VIII, von Willebrand factor,
factors IX, V, XI, XII and XIII; haemostatic disorder as a
~-- ~
- 54 - 13 4 1 5 8 9
consequence of liver disease which includes decreased synthesis of
coagulation factors and DIC; bleeding tendency associated with
acute and chronic renal disease which includes coagulation factor
deficiencies and DIC; haemostasis after trauma or surgery; patients
with disseminated malignancy which manifests in DIC with increases
in factors VIII, von Willebrand factor and fibrinogen; and
haemostasis during cardiopulmonary surgery and massive blood
transfusion.
