Note : Les descriptions sont présentées dans la langue officielle dans laquelle elles ont été soumises.
13 41 607.
- 1 -
BACKGROUND
The present invention relates generally to the
manipulation of genetic materials and, more particularly,
to recombinant procedures making possible the production
of polypeptides possessing part or all of the primary
structural conformation and/or one or more of the biolo-
gical properties of naturally-occurring erythropoietin.
A. Manipulation Of Genetic Materials
Genetic materials may be broadly defined as
those chemical substances which program for and guide the
manufacture of constituents of cells and viruses and
direct the responses of cells and viruses. A long chain
polymeric substance known as deoxyribonucleic acid (DNA)
comprises the genetic material of all living cells and
viruses except for certain viruses which are programmed
by ribonucleic acids (RNA). The repeating units in DNA
polymers are four different nucleotides, each of which
consists of either a purine (adenine or guanine) or a
pyrimidine (thymine or cytosine) bound to a deoxyribose
sugar to which a phosphate group is attached. Attachment
of nucleotides in linear polymeric form is by means of
fusion of the 5' phosphate of one nucleotide to the 3'
hydroxyl group of another. Functional DNA occurs in the
form of stable double stranded associations of single
strands of nucleotides (known as deoxyoligonucleotides),
1 3 4 1 6 0 7..=
2 -
which associations occur by means of hydrogen bonding
between purine and pyrimidine bases [i.e.,
"complementary" associations existing either between ade-
nine (A) and thymine (T) or guanine (G) and cytosine
(C)]. By convention, nucleotides are referred to by the
names of their constituent purine or pyrimidine bases,
and the complementary associations of nucleotides in
double stranded DNA (i.e., A-T and G-C) are referred to
as "base pairs". Ribonucleic acid is a polynucleotide
comprising adenine, guanine, cytosine and uracil (U),
rather than thymine, bound to ribose and a phosphate
group.
Most briefly put, the programming function of
DNA is generally effected through a process wherein spe-
cific DNA nucleotide sequences (genes) are "transcribed"
into relatively unstable messenger RNA (mRNA) polymers.
The mRNA, in turn, serves as a template for the formation
of structural, regulatory and catalytic proteins from
amino acids. This mRNA "translation" process involves
the operations of small RNA strands (tRNA) which
transport and align individual amino acids along the mRNA
strand to allow for formation of polypeptides in proper
amino acid sequences. The mRNA "message", derived from
DNA and providing the basis for the tRNA supply and
orientation of any given one of the twenty amino acids
for polypeptide "expression", is in the form of triplet
"codons" -- sequential groupings of three nucleotide
bases. In one sense, the formation of a protein is the
ultimate form of "expression" of the programmed genetic
message provided by the nucleotide sequence of a gene.
"Promoter" DNA sequences usually "precede" a
gene in a DNA polymer and provide a site for initiation
of the transcription into mRNA. "Regulator" DNA sequen-
ces, also usually "upstream" of (i.e., preceding) a gene
in a given DNA polymer, bind proteins that determine the
frequency (or rate) of transcriptional initiation.
3 - 13 4" H ) 7
Collectively referred to as "promoter/regulator" or
"control" DNA sequence, these sequences which precede a
selected gene (or series of genes) in a functional DNA
polymer cooperate to determine whether the transcription
(and eventual expression) of a gene will occur. DNA
sequences which "follow" a gene in a DNA polymer and pro-
vide a signal for termination of the transcription into
mRNA are referred to as transcription "terminator"
sequences.
A focus of microbiological processing for the
last decade has been the attempt to manufacture
industrially and pharmaceutically significant substances
using organisms which either do not initially have gene-
tically coded information concerning the desired product
included in their DNA, or (in the case of mammalian cells
in culture) do not ordinarily express a chromosomal gene
at appreciable levels. Simply put, a gene that specifies
the structure of a desired polypeptide product is either
isolated from a "donor" organism or chemically synthe-
sized and then stably introduced into another organism
which is preferably a self-replicating unicellular orga-
nism such as bacteria, yeast or mammalian cells in
culture. Once this is done, the existing machinery for
gene expression in the "transformed" or "transfected"
microbial host cells operates to construct the desired
product, using the exogenous DNA as a template for
transcription of mRNA which is then translated into a
continuous sequence of amino acid residues.
The art is rich in patent and literature publi-
cations relating to "recombinant DNA" methodologies for
the isolation, synthesis, purification and amplification
of genetic materials for use in the transformation of
selected host organisms. U.S. Letters Patent
No. 4,237,224 to Cohen, et al., for example, relates to
transformation of unicellular host organisms with
"hybrid" viral or circular plasmid DNA which includes
1341607
- 4 -
selected exogenous DNA sequences. The procedures of the
Cohen, et al. patent first involve manufacture of a
transformation vector by enzymatically cleaving viral or
circular plasmid DNA to form linear DNA strands.
Selected foreign ("exogenous" or "heterologous") DNA
strands usually including sequences coding for desired
product are prepared in linear form through use of simi-
lar enzymes. The linear viral or plasmid DNA is incu-
bated with the foreign DNA in the presence of ligating
enzymes capable of effecting a restoration process and
"hybrid" vectors are formed which include the selected
exogenous DNA segment "spliced" into the viral or cir-
cular DNA plasmid.
Transformation of compatible unicellular host
organisms with the hybrid vector results in the formation
of multiple copies of the exogenous DNA in the host cell
population. In some instances, the desired result is
simply the amplification of the foreign DNA and the
"product" harvested is DNA. More frequently, the goal of
transformation is the expression by the host cells of the
exogenous DNA in the form of large scale synthesis of
isolatable quantities of commercially significant protein
or polypeptide fragments coded for by the foreign DNA.
See also, e.g., U.S. Letters Patent Nos. 4,264,731 (to
Shine), 4,273,875 (to Manis), 4,293,652 (to Cohen), and
European Patent Application 093,619, published November
9, 1983.
The development of specific DNA sequences for
splicing into DNA vectors is accomplished by a variety of
techniques, depending to a great deal on the degree of
"foreignness" of the "donor" to the projected host and
the size of the polypeptide to be expressed in the host.
At the risk of over-simplification, it can be stated that
three alternative principal methods can be employed: (1)
the "isolation" of double-stranded DNA sequence from the
genomic DNA of the donor; (2) the chemical manufacture of
1341607
a DNA sequence providing a code for a polypeptide of
interest; and (3) the in vitro synthesis of a double-
stranded DNA sequence by enzymatic "reverse transcrip-
tion" of mRNA isolated from donor cells. The
5 last-mentioned methods which involve formation of a DNA
"complement" of mRNA are generally referred to as "cDNA"
methods.
Manufacture of DNA sequences is frequently the
method of choice when the entire sequence of amino acid
residues of the desired polypeptide product is known.
DNA manufacturing procedures of co-owned, co-pending
U.S. Patent Application Serial No. 483,451, by Alton, et
al., (filed April 15, 1983 and corresponding to PCT
US83/00605, published November 24, 1983 as W083/04053),
for example, provide a superior means for accomplishing
such highly desirable results as: providing for the pre-
sence of alternate codons commonly found in genes which
are highly expressed in the host organism selected for
expression (e.g., providing yeast or E.coli "preference"
codons); avoiding the presence of untranslated "intron"
sequences (commonly present in mammalian genomic DNA
sequences and mRNA transcripts thereof) which are not
readily processed by procaryotic host cells; avoiding
expression of undesired "leader" polypeptide sequences
commonly coded for by genomic DNA and cDNA sequences but
frequently not readily cleaved from the polypeptide of
interest by bacterial or yeast host cells; providing for
ready insertion of the DNA in convenient expression vec-
tors in association with desired promoter/regulator and
terminator sequences; and providing for ready construc-
tion of genes coding for polypeptide fragments and ana-
logs of the desired polypeptides.
When the entire sequence of amino acid residues
of the desired polypeptide is not known, direct manufac-
ture of DNA sequences is not possible and isolation of
DNA sequences coding for the polypeptide by a cDNA method
-6- 37.;a.
becomes the method of choice despite the potential
drawbacks in ease of assembly of expression vectors
capable of providing high levels of microbial expression
referred to above. Among the standard procedures for
isolating cDNA sequences of interest is the preparation
of plasmid-borne cDNA "libraries" derived from reverse
transcription of mRNA abundant in donor cells selected as
responsible for high level expression of genes (e.g.,
libraries of cDNA derived from pituitary cells which
express relatively large quantities of growth hormone
products). Where substantial portions of the polypep-
tide's amino acid sequence are known, labelled, single-
stranded DNA probe sequences duplicating a sequence
putatively present in the "target" cDNA may be employed
in DNA/DNA hybridization procedures carried out on cloned
copies of the cDNA which have been denatured to single
stranded form. [See, generally, the disclosure and
discussions of the art provided in U.S. Patent No.
4,394,443 to Weissman, et al. and the recent demonstra-
tions of the use of long oligonucleotide hybridization
probes reported in Wallace, et al., Nuc.Acids Res., 6,
pp. 3543-3557 (1979), and Reyes, et al., P.N.A.S.
(U.S.A.), 79, pp. 3270-3274 (1982), and Jaye, et al.,
Nuc.Acids Res., 11, pp. 2325-2335 (1983). See also, U.S.
Patent No. 4,358,535 to Falkow, et al., relating to
DNA/DNA hybridization procedures in effecting diagnosis;
published European Patent Application Nos. 0070685 and
0070687 relating to light-emitting labels on single
stranded polynucleotide probes; Davis, et al., "A Manual
for Genetic Engineering, Advanced Bacterial Genetics",
Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y.
(1980) at pp. 55-58 and 174-176, relating to colony and
plaque hybridization techniques; and, New England Nuclear
(Boston, Mass.) brochures for "Gene Screen" Hybridization
Transfer Membrane materials providing instruction manuals
for the transfer and hybridization of DNA and RNA,
Catalog No. NEF-972.]
1J 41607
Among the more signficant recent advances in
hybridization procedures for the screening of recombinant
clones is the use of labelled mixed synthetic oligo-
nucleotide probes, each of which is potentially the
complete complement of a specific DNA sequence in the
hybridization sample including a heterogenous mixture of
single stranded DNAs or RNAs. These procedures are
acknowledged to be especially useful in the detection of
cDNA clones derived from sources which provide extremely
low amounts of mRNA sequences for the polypeptide of
interest. Briefly put, use of stringent hybridization
conditions directed toward avoidance of non-specific
binding can allow, e.g., for the autoradiographic
visualization of a specific cONA clone upon the event of
hybridization of the target DNA to that single probe
within the mixture which is its complete complement. See
generally, Wallace, et al., Nuc.Acids Res., 9, pp.
879-897 (1981); Suggs, et al. P.N.A.S. (U.S.A.), 78, pp.
6613-6617 (1981); Choo, et al., Nature, 299, pp. 178-180
(1982); Kurachi, et al., P.N.A.S. (U.S.A.), 79,
pp. 6461-6464 (1982); Ohkubo, et al., P.N.A.S. (U.S.A.),
80, pp. 2196-2200 (1983); and Kornblihtt, et al.
P.N.A.S. (U.S.A.), 80, pp. 3218-3222 (1983). In general,
the mixed probe procedures of Wallace, et al. (1981),
supra, have been expanded upon by various workers to the
point where reliable results have reportedly been
obtained in a cDNA clone isolation using a 32 member
mixed "pool" of 16-base-long (16-mer) oligonucleotide
probes of uniformly, varying DNA sequences together with
a single 11-mer to effect a two-site "positive" confir-
mation of the presence of cDNA of interest. See,
Singer-Sam, et al., P.N.A.S. (U.S.A.), 80, pp. 802-806
(1983).
The use of genomic DNA isolates is the least
common of the three above-noted methods for developing
-8- 1341607
specific DNA sequences for use in recombinant procedures.
This is especially true in the area of recombinant proce-
dures directed to securing microbial expression of mam-
malian polypeptides and is due, principally to the
complexity of mammalian genomic DNA. Thus, while
reliable procedures exist for developing phage-borne
libraries of genomic DNA of human and other mammalian
species origins [See, e.g., Lawn, et al. Cell, 15,
pp. 1157-1174 (1978) relating to procedures for
generating a human genomic library commonly referred to
as the "Maniatis Library"; Karn, et al., P.N.A.S.
(U.S.A.), 77, pp. 5172-5176 (1980) relating to a human
genomic library based on alternative restriction endo-
nuclease fragmentation procedure; and Blattner, et al.,
Science, 196, pp. 161-169 (1977) describing construction
of a bovine genomic library] there have been relatively
few successful attempts at use of hybridization proce-
dures in isolating genomic DNA in the absence of exten-
sive foreknowledge of amino acid or DNA sequences. As
one example, Fiddes, et al., J.Mol. and App.Genetics, 1,
pp. 3-18 (1981) report the successful isolation of a gene
coding for the alpha subunit of the human pituitary gly-
coprotein hormones from the Maniatis Library through use
of a "full length" probe including a complete 621 base
pair fragment of a previously-isolated cDNA sequence for
the alpha subunit. As another example, Das, et al.,
P.N.A.S. (U.S.A.), 80, pp. 1531-1535 (1983) report isola-
tion of human genomic clones for human HLA-DR using a 175
base pair synthetic oligonucleotide. Finally, Anderson,
et al., P.N.A.S. (U.S.A.), 80, pp. 6838-6842 (1983)
report the isolation of genomic clone for bovine
pancreatic trypsin inhibitor (BPTI) using a single probe
86 base pairs in length and constructed according to the
known amino acid sequence of BPTI. The authors note a
determination of poor prospects for isolating mRNA
suitable for synthesis of a cDNA library due to apparent
1341607
- 9 -
low levels of mRNA in initially targeted parotid gland
and lung tissue sources and then address the prospects of
success in probing a genomic library using a mixture of
labelled probes, stating: "More generally, mixed-
sequence oligodeoxynucleotide probes have been used to
isolate protein genes of unknown sequence from cDNA
libraries. Such probes are typically mixtures of 8-32
oligonucleotides, 14-17 nucleotides in length, repre-
senting every possible codon combination for a small
stretch (5-6 residues) of amino acid sequence. Under
stringent hybridization conditions that discriminate
against incorrectly base-paired probes, these mixtures
are capable of locating specific gene sequences in clone
libraries of low-to-moderate complexity. Nevertheless,
because of their short length and heterogeneity, mixed
probes often lack the specificity required for probing
sequences as complex as a mammalian genome. This makes
such a method impractical for the isolation of mammalian
protein genes when the corresponding mRNAs are
unavailable." (Citations omitted).
There thus continues to exist a need in the art
for improved methods for effecting the rapid and effi-
cient isolation of cDNA clones in instances where little
is known of the amino acid sequence of the polypeptide
coded for and where "enriched" tissue sources of mRNA are
not readily available for use in constructing cDNA
libraries. Such improved methods would be especially
useful if they were applicable to isolating mammalian
genomic clones where sparse information is available con-
cerning amino acid sequences of the polypeptide coded for
by the gene sought.
B. Erythropoietin As A Polypeptide Of Interest
Erythropoiesis, the production of red blood
cells, occurs continuously throughout the human life span
to offset cell destruction. Erythropoiesis is a very
I l
1341607
- 10 -
precisely controlled physiological mechanism enabling
sufficient numbers of red blood cells to be available in
the blood for proper tissue oxygenation, but not so many
that the cells would impede circulation. The formation
of red blood cells occurs in the bone marrow and is under
the control of the hormone, erythropoietin.
Erythropoietin, an acidic glycoprotein of
approximately 34,000 dalton molecular weight, may occur
in three forms: a, $ and asialo. The a and B forms
differ slightly in carbohydrate components, but have the
same potency, biological activity and molecular weight.
The asialo form is an a or $ form with the terminal car-
bohydrate (sialic acid) removed. Erythropoietin is pre-
sent in very low concentrations in plasma when the body
is in a healthy state wherein tissues receive sufficient
oxygenation from the existing number of erythrocytes.
This normal low concentration is enough to stimulate
replacement of red blood cells which are lost normally
through aging.
The amount of erythropoietin in the circulation
is increased under conditions of hypoxia when oxygen
transport by blood cells in the circulation is reduced.
Hypoxia may be caused by loss of large amounts of blood
through hemorrhage, destruction of red blood cells by
over-exposure to radiation, reduction in oxygen intake
due to high altitudes or prolonged unconsciousness, or
various forms of anemia. In response to tissues
undergoing hypoxic stress, erythropoietin will increase
red blood cell production by stimulating the conversion
of primitive precursor cells in the bone marrow into pro-
erythroblasts which subsequently mature, synthesize
hemoglobin and are released into the circulation as red
blood cells. When the number of red blood cells in cir-
culation is greater than needed for normal tissue oxygen
requirements, erythropoietin in circulation is decreased.
See generally, Testa, et al., Exp.Hematol.,
8(Supp. 8), 144-152 (1980); Tong, et al., J.Biol.Chem.,
1 41607...
- 11 -
256(24), 12666-12672 (1981); Goldwasser, J.Cell.Physiol.,
110(Supp. 1), 133-135 (1982); Finch, Blood, 60(6),
1241-1246 (1982); Sytowski, et al., Expt.Hematol., 8(Supp
8), 52-64 (1980: Naughton, Ann.Clin.Lab.Sci., 13(5),
432-438 (1983); Weiss, et al., Am.J.Vet.Res.,
44(10),1832-1835 (1983); Lappin, et al., Exp.Hematol.,
11(7), 661-666 (1983); Baciu, et al., Ann.N.Y.Acad.Sci.,
414, 66-72 (1983); Murphy, et al., Acta.Haematologica
Japonica, 46(7), 1380-1396 (1983); Dessypris, et al.,
Brit.J.Haematol., 56, 295-306 (1984); and, Emmanouel, at
al., Am.J.Physiol., 247 (1 Pt 2), F168-76 (1984).
Because erythropoietin is essential in the pro-
cess of red blood cell formation, the hormone has poten-
tial useful application in both the diagnosis and the
treatment of blood disorders characterized by low or
defective red blood cell production. See, generally,
Pennathur-Das, et al., Blood, 63(5), 1168-71 (1984) and
Haddy, Am.Jour.Ped.Hematol./Oncol., 4, 191-196, (1982)
relating to erythropoietin in possible therapies for
sickle cell disease, and Eschbach, at al. J.Clin.Invest.,
74(2), pp. 434-441, (1984), describing a therapeutic
regimen for uremic sheep based on in vivo response to
erythropoietin-rich plasma infusions and proposing a
dosage of 10 U EPO/kg per day for 15-40 days as correc-
tive of anemia of the type associated with chronic renal
failure. See also, Krane, Henry Ford Hosp.Med.J., 31(3),
177-181 (1983).
It has recently been estimated that the availa-
bility of erythropoietin in quantity would allow for
treatment each year of anemias of 1,600,000 persons in
the United States alone. See, e.g., Morrison,
" Bioprocessing in Space -- an Overview", pp. 557-571 in
The World Biotech Report 1984, Volume 2:USA, (Online
Publications, New York, N.Y. 1984). Recent studies have
provided a basis for projection of efficacy of erythro-
12 1341607
- -
poietin therapy in a variety of disease states, disorders
and states of hematologic irregularity: Vedovato, et
al., Acta.Haematol, 71, 211-213 (1984)
(beta-thalassemia); Vichinsky, et al., J.Pediatr.,
105(1), 15-21 (1984) (cystic fibrosis); Cotes, et al.,
Brit.J.Obstet.Gyneacol., 90(4), 304-311 (1983)
(pregnancy, menstrual disorders); Haga, et al.,
Acta.Pediatr.Scand., 72, 827-831 (1983) (early anemia of
prematurity); Claus-Walker, et al.,
Arch.Phys.Med.Rehabil., 65, 370-374 (1984) (spinal cord
injury); Dunn, et al., Eur.J.Appl.Physiol., 52, 178-182
(1984) (space flight); Miller, et al., Brit.J.Haematol.,
52, 545-590 (1982) (acute blood loss); Udupa, et al.,
J.Lab.Clin.Med., 103(4), 574-580 and 581-588 (1984); and
Lipschitz, et al., Blood, 63(3), 502-509 (1983) (aging);
and Dainiak, et al., Cancer, 51(6), 1101-1106 (1983) and
Schwartz, et al., Otolaryngol., 109, 269-272 (1983)
(various neoplastic disease states accompanied by abnor-
mal erythropoiesis).
Prior attempts to obtain erythropoietin in good
yield from plasma or urine have proven relatively unsuc-
cessful. Complicated and sophisticated laboratory tech-
niques are necessary and generally result in the
collection of very small amounts of impure and unstable
extracts containing erythropoietin.
U.S. Letters Patent No. 3,033,753 describes a
method for partially purifying erythropoietin from sheep
blood plasma which provides low yields of a crude solid
extract containing erythropoietin.
Initial attempts to isolate erythropoietin from
urine yielded unstable, biologically inactive prepara-
tions of the hormone. U.S. Letters Patent No. 3,865,801
describes a method of stabilizing the biological activity
of a crude substance containing erythropoietin recovered
from urine. The resulting crude preparation containing
erythropoietin purportedly retains 90% of erythropoietin
activity, and is stable.
1341607
13 -
Another method of purifying human erythropoietin
from urine of patients with aplastic anemia is described
in Miyake, et al., J.Biol.Chem., Vol. 252, No. 15 (August
10, 1977), pp. 5558-5564. This seven-step procedure
includes ion exchange chromatography, ethanol precipita-
tion, gel filtration, and adsorption chromatography, and
yields a pure erythropoietin preparation with a potency
of 70,400 units/mg of protein in 21% yield.
U.S. Letters Patent No. 4,397,840 to Takezawa,
et al. describes methods for preparing "an erythropoietin
product" from healthy human urine specimens with weakly
basic ion exchangers and proposes that the low molecular
weight products obtained "have no inhibitory effects
against erythropoietin.
U.K. Patent Application No. 2,085,887 by
Sugimoto, et al., published May 6, 1982, describes a pro-
cess for the production of hybrid human lymphoblastoid
cells, reporting production levels ranging from 3 to 420
Units of erythropoietin per ml of suspension of cells
(distributed into the cultures after mammalian host propaga-
tion containing up to 107 cells per ml. At the highest pro-
duction levels asserted to have been obtained, the rate
of erythropoietin production could be calculated to be
from 40 to about 4,000 Units/106 cells/48 hours in in
vitro culture following transfer of cells from in vivo
propagation systems. (See also the equivalent U.S.
Letters Patent No. 4,377,513.) Numerous proposals have
been made for isolation of erythropoietin from tissue
sources, including neoplastic cells, but the yields have
been quite low. See, e.g., Jelkman, et al.,
Expt.Hematol., 11(7), 581-588 (1983); Tambourin, et al.,
P.N.A.S. (U.S.A.), 80, 6269-6273 (1983); Katsuoka, et
al., Gann, 74, 534-541 (1983); Hagiwara, et al., Blood,
63(4), 828-835 (1984); and Choppin, et al., Blood, 64(2),
341-347 (1984).
Other isolation techniques utilized to obtain
purified erythropoietin involve immunological procedures.
-14- 1)41617.
A polyclonal, serum-derived antibody directed against
erythropoietin is developed by injecting an animal, pre-
ferably a rat or rabbit, with human erythropoietin. The
injected human erythropoietin is recognized as a foreign
antigenic substance by the immune system of the animal
and elicits production of antibodies against the antigen.
Differing cells responding to stimulation by the antige-
nic substance produce and release into circulation anti-
bodies slightly different from those produced by other
responding cells. The antibody activity remains in the
serum of the animal when its blood is extracted. While
unpurified serum or antibody preparations purified as a
serum immunoglobulin G fraction may then be used in
assays to detect and complex with human erythropoietin,
the materials suffer from a major disadvantage. This
serum antibody, composed of all the different antibodies
produced by individual cells, is polyclonal in nature and
will complex with components in crude extracts other than
erythropoietin alone.
Of interest to the background of the present
invention are recent advances in the art of developing
continuous cultures of cells capable of producing a
single species of antibody which is specifically immuno-
logically reactive with a single antigenic determinant of
a selected antigen. See, generally, Chisholm, High
Technology, Vol. 3, No. 1, 57-63 (1983). Attempts have
been made to employ cell fusion and hybridization tech-
niques to develop "monoclonal" antibodies to erythro-
poietin and to employ these antibodies in the isolation
and quantitative detection of human erythropoietin. As
one example, a report of the successful development of
mouse-mouse hybridoma cell lines secreting monoclonal
antibodies to human erythropoietin appeared in abstract
form in Lee-Huang, Abstract No. 1463 of Fed.Proc., 41,
520 (1982). As another example, a detailed description
13 15 - 4 1 607
-
of the preparation and use of a monoclonal, anti-
erythropoietin antibody appears in Weiss, et al.,
P.N.A.S. (U.S.A.), 79, 5465-5469 (1982). See also,
Sasaki, Biomed.Biochim.Acta., 42(11/12), S202-S206
(1983); Yanagawa, et al., Blood, 64(2), 357-364 (1984);
Yanagawa, et al., J.Biol.Chem., 259(5), 2707-2710 (1984);
and U.S. Letters Patent No. 4,465,624.
Also of interest to the background of the inven-
tion are reports of the immunological activity of synthe-
tic peptides which substantially duplicate the amino acid
sequence extant in naturally-occurring proteins,
glycoproteins and nucleoproteins. More specifically,
relatively low molecular weight polypeptides have been
shown to participate in immune reactions which are simi-
lar in duration and extent to the immune reactions of
physiologically significant proteins such as viral anti-
gens, polypeptide hormones, and the like. Included among
the immune reactions of such polypeptides is the provoca-
tion of the formation of specific antibodies in
immunologically active animals. See, e.g., Lerner, et
al., Cell, 23, 309-310 (1981); Ross, et al., Nature, 294,
654-656 (1981); Walter, et al., P.N.A.S. (U.S.A.), 77,
5197-5200 (1980); Lerner, et al., P.N.A.S. (U.S.A.), 78,
3403-3407 (1981); Walter, et al., P.N.A.S. (U.S.A.), 78,
4882-4886 (1981); Wong, et al., P.N.A.S. (U.S.A.), 78,
7412-7416 (1981); Green, et al. Cell, 28, 477-487 (1982);
Nigg, et al., P.N.A.S. (U.S.A.), 79, 5322-5326 (1982);
Baron, et al., Cell, 28, 395-404 (1982); Dreesman, et
al., Nature, 295, 158-160 (1982); and Lerner, Scientific
American, 248, No. 2, 66-74 (1983). See, also, Kaiser,
et al., Science, 223, pp. 249-255 (1984) relating to
biological and immunological activities of synthetic pep-
tides which approximately share secondary structures of
peptide hormones but may not share their primary struc-
tural conformation. The above studies relate, of course,
to amino acid sequences of proteins other than erythro-
1341607
- 16 -
poietin, a substance for which no substantial amino acid
sequence information has been published. In co-owned,
co-pending U.S. Patent Application Serial No. 463,724,
filed February 4, 1983, by J. Egrie, published August 22,
1984 as European Patent Application No. 0 116 446, there
is described a mouse-mouse hybridoma cell line
(A.T.C.C. No. HB8209) which produces a highly specific
monoclonal, anti-erythropoietin antibody which is also
specifically immunoreactive with a polypeptide comprising
the following sequence of amino acids:
NH2-Ala-Pro-Pro-Arg-Leu-Ile-Cys-Asp-Ser-Arg-Val-Leu-
Glu-Arg-Tyr-Leu-Leu-Glu-Ala-Lys-COON.
The polypeptide sequence is one assigned to the first
twenty amino acid residues of mature human erythropoietin
isolated according to the method of Miyake, et al.,
J.Biol.Chem., 252, 5558-5564 (1977) and upon which amino
acid analysis was performed by the gas phase sequencer
(Applied Biosystems, Inc.) according to the procedure of
Hewick, M., et al., J.Biol.Chem., 256, 7990-7997 (1981).
See, also, Sue, et al., Proc. Nat. Acad. Sci. (USA), 80,
pp. 3651-3655 (1983) relating to development of polyclo-
nal antibodies against a synthetic 26-mer based on a dif-
fering amino acid sequence, and Sytowski, et al.,
J.Immunol. Methods, 69, pp.181-186 (1984).
While polyclonal and monoclonal antibodies as
described above provide highly useful materials for use
in immunoassays for detection and quantification of
erythropoietin and can be useful in the affinity purifi-
cation of erythropoietin, it appears unlikely that these
materials can readily provide for the large scale isola-
tion of quantities of erythropoietin from mammalian sour-
ces sufficient for further analysis, clinical testing and
potential wide-ranging therapeutic use of the substance
in treatment of, e.g., chronic kidney disease wherein
diseased tissues fail to sustain production of erythro-
poietin. It is consequently projected in the art that
_17_ 1341607
the best prospects for fully characterizing mammalian
erythropoietin and providing large quantities of it for
potential diagnostic and clinical use involve successful
application of recombinant procedures to effect large
scale microbial synthesis of the compound.
While substantial efforts appear to have been
made in attempted isolation of DNA sequences coding for
human and other mammalian species erythropoietin, none
appear to have been successful. This is due principally
to the scarcity of tissue sources, especially human
tissue sources, enriched in mRNA such as would allow for
construction of a cDNA library from which a DNA sequence
coding for erythropoietin might be isolated by conven-
tional techniques. Further, so little is known of the
continuous sequence of amino acid residues of erythro-
poietin that it is not possible to construct, e.g., long
polynucleotide probes readily capable of reliable use in
DNA/DNA hybridization screening of cDNA and especially
genomic DNA libraries. Illustratively, the twenty amino
acid sequence employed to generate the above-named
monoclonal antibody produced by A.T.C.C. No. HB8209 does
not admit to the construction of an unambiguous, 60 base
oligonucleotide probe in the manner described by
Anderson, et al., supra. It is estimated that the human
gene for erythropoietin may appear as a "single copy
gene" within the human genome and, in any event, the
genetic material coding for human erythropoietin is
likely to constitute less than 0.00005% of total human
genomic DNA which would be present in a genomic library.
To date, the most successful of known reported
attempts at recombinant-related methods to provide DNA
sequences suitable for use in microbial expression of
isolatable quantities of mammalian erythropoietin have
fallen far short of the goal. As an example, Farber, et
al. Exp.Hematol., 11. Supp. 14, Abstract 101 (1983)
report the extraction of mRNA from kidney tissues of
-18- 1341607
phenylhydrazine-treated baboons and the injection of the
mRNA into Xenopus laevis oocytes with the rather tran-
sitory result of in vitro production of a mixture of
"translation products" which included among them
displaying biological properties of erythropoietin. More
recently, Farber, et al., Blood, 62, No. 5, Supp. No. 1,
Abstract 392, at page 122a (1983) reported the in vitro
translation of human kidney mRNA by frog oocytes. The
resultant translation product mixture was estimated to
include on the order of 220 mU of a translation product
having the activity of erythropoietin per microgram of
injected mRNA. While such levels of in vitro translation
of exogenous mRNA coding for erythropoietin were
acknowledged to be quite low (compared even to the prior
reported levels of baboon mRNA translation into the
sought-for product) it was held that the results confirm
the human kidney as a site of erythropoietin expression,
allowing for the construction of an enriched human kidney
cDNA library from which the desired gene might be iso-
lated. [See also, Farber, Clin.Res., 31(4), 769A
(1983).]
BRIEF SUMMARY
The present invention provides, for the first
time, novel purified and isolated polypeptide products
1341607
19 -
having part or all of the primary structural conformation
(i.e., continuous sequence of amino acid residues) and
one or more of the biological properties (e.g., immunolo-
gical properties and in vivo and in vitro biological
activity) of naturally-occurring erythropoietin,
including allelic variants thereof. These polypeptides
are also uniquely characterized by being the product of
procaryotic or eucaryotic host expression (e.g., by bac-
terial, yeast and mammalian cells in culture) of exoge-
nous DNA sequences obtained by genomic or cDNA cloning or
by gene synthesis. Products of microbial expression in
vertebrate (e.g., mammalian and avian) cells may be
further characterized by freedom from association with
human proteins or other contaminants which may be asso-
ciated with erythropoietin in its natural mammalian
cellular environment or in extracellular fluids such as
plasma or urine. The products of typical yeast (e.g.,
Saccaromyces cerevisiae) or procaryote (e.g., E.coli)
host cells are free of association with any mammalian
proteins. Depending upon the host employed, polypeptides
of the invention may be glycosylated with mammalian or
other eucaryotic carbohydrates or may be non-
glycosylated. Polypeptides of the invention may also
include an initial methionine amino acid residue (at
position -1).
Novel glycoprotein products of the invention
include those having a primary structural conformation
sufficiently duplicative of that of a naturally-occurring
(e.g., human) erythropoietin to allow possession of one
or more of the biological properties thereof and having
an average carbohydrate composition which differs from
that of naturally-occurring (e.g., human) erythropoietin.
Vertebrate (e.g., COS-1 and CHO) cells provided
by the present invention comprise the first cells ever
available which can be propagated in vitro continuously
and which upon growth in culture are capable of producing
13 41 607
20 -
in the medium of their growth in excess of 1000
(preferably in excess of 5000 and most preferably in
excess of 1,000 to 5,000U) of erythropoietin per
106 cells in 48 hours as determined by radioimmunoassay.
Also provided by the present invention are
synthetic polypeptides wholly or partially duplicative of
continuous sequences of erythropoietin amino acid resi-
dues which are herein for the first time elucidated.
These sequences, by virtue of sharing primary, secondary
or tertiary structural and conformational characteristics
with naturally-occurring erythropoietin may possess
biological activity and/or immunological properties in
common with the naturally-occurring product such that
they may be employed as biologically active or immunolo-
gical substitutes for erythropoietin in therapeutic and
immunological processes. Correspondingly provided are
monoclonal and polyclonal antibodies generated by stan-
dard means which are immunoreactive with such polypep-
tides and, preferably, also immunoreactive with
20, naturally-occurring erythropoietin.
Illustrating the present invention are cloned
DNA sequences of monkey and human species origins and
polypeptide sequences suitably deduced therefrom which
represent, respectively, the primary structural confor-
mation of erythropoietins of monkey and human species
origins.
Also provided by the present invention are novel
biologically functional viral and circular plasmid DNA
vectors incorporating DNA sequences of the invention and
microbial (e.g., bacterial, yeast and mammalian cell)
host organisms stably transformed or transfected with
such vectors. Correspondingly provided by the invention
are novel methods for the production of useful polypep-
tides comprising cultured growth of such transformed or
transfected microbial hosts under conditions facilitative-
of large scale expression of the exogenous, vector-borne
13 `} 1 607
21 -
DNA sequences and isolation of the desired polypeptides
from the growth medium, cellular lysates or cellular
membrane fractions.
Isolation and purification of microbially
expressed polypeptides provided by the invention may be
by conventional means including, e.g., preparative chro-
matographic separations and immunological separations
involving monoclonal and/or polyclonal antibody prepara-
tions.
Having herein elucidated the sequence of amino
acid residues of erythropoietin, the present invention
provides for the total and/or partial manfucture of DNA
sequences coding for erythropoietin and including such
advantageous characteristics as incorporation of codons
"preferred" for expression by selected non-mammalian
hosts, provision of sites for cleavage by restriction
endonuclease enzymes and provision of additional initial,
terminal or intermediate DNA sequences which facilitate
construction of readily expressed vectors. Corres-
pondingly, the present invention provides for manufacture
(and development by site specific mutagenesis of cDNA and
genomic DNA) of DNA sequences coding for microbial
expression of polypeptide analogs or derivatives of
erythropoietin which differ from naturally-occurring
forms in terms of the identity or location of one or more
amino acid residues (i.e., deletion analogs containing
less than all of the residues specified for EPO and/or
substitution analogs wherein one or more residues spe-
cified are replaced by other residues and/or addition
analogs wherein one or more amino acid residues is added
to a terminal or medial portion of the polypeptide); and
which share some or all the properties of naturally-
occurring forms.
Novel DNA sequences of the invention include all
sequences useful in securing expression in procaryotic or
eucaryotic host cells of polypeptide products having at
22 1341607
- -
least a part of the primary structural conformation and
one or more of the biological properties of erythro-
poietin which are comprehended by: (a) the DNA sequences
set out in Tables V and VI herein or their complementary
strands; (b) DNA sequences which hybridize (under hybri-
dization conditions such as illustrated herein or more
stringent conditions) to DNA sequences defined in (a) or
fragments thereof; and (c) DNA sequences which, but for
the degeneracy of the genetic code, would hybridize to
DNA sequences defined in (a) and (b) above. Specifically
comprehended in part (b) are genomic DNA sequences
encoding allelic variant forms of monkey and human
erythropoietin and/or encoding other mammalian species of
erythropoietin. Specifically comprehended by part (c)
are manufactured DNA sequences encoding EPO, EPO
fragments and EPO analogs which DNA sequences may incor-
porate codons facilitating translation of messenger RNA
in non-vertebrate hosts.
Comprehended by the present invention is that
class of polypeptides coded for by portions of the DNA
complement to the top strand human genomic DNA sequence
of Table VI herein, i.e., "complementary inverted pro-
teins" as described by Tramontano, et al., Nucleic Acids
Research, 12, pp. 5049-5059 (1984).
Also comprehended by the invention are phar-
maceutical compositions comprising effective amounts of
polypeptide products of the invention together with
suitable diluents, adjuvants and/or carriers which allow
for provision of erythropoietin therapy, especially in
the treatment of anemic disease states and most espe-
cially such anemic states as attend chronic renal
failure.
Polypeptide products of the invention may be
"labelled" by covalent association with a detectable
marker substance (e.g., radiolabelled with 1251) to pro-
vide reagents useful in detection and quantification of
1341607
23 -
erythropoietin in solid tissue and fluid samples such as
blood or urine. DNA products of the invention may also
be labelled with detectable markers (such as radiolabels
and non-isotopic labels such as biotin) and employed in
DNA hybridization processes to locate the erythropoietin
gene position and/or the position of any related gene
family in the human, monkey and other mammalian species
chromosomal map. They can also be used for identifying
the erythropoietin gene disorders at the DNA level and
used as gene markers for identifying neighboring genes
and their disorders.
As hereinafter described in detail, the present
invention further provides significant improvements in
methods for detection of a specific single stranded poly-
nucleotide of unknown sequence in a heterogeneous cellu-
lar or viral sample including multiple single-stranded
polynucleotides where
(a) a mixture of labelled single-stranded poly-
nucleotide probes is prepared having uniformly varying
sequences of bases, each of said probes being potentially
specifically complementary to a sequence of bases which
is putatively unique to the polynucleotide to be
detected,
(b) the sample is fixed to a solid substrate,
(c) the substrate having the sample fixed
thereto is treated to diminish further binding of poly-
nucleotides thereto except by way of hybridization to
polynucleotides in said sample,
(d) the treated substrate having the sample
fixed thereto is transitorily contacted with said mixture
of labelled probes under conditions facilitative of
hybridization only between totally complementary poly-
nucleotides, and,
(e) the specific polynucleotide is detected by
monitoring for the presence of a hybridization reaction
between it and a totally complementary probe within said
1341607
24 -
mixture of labelled probes, as evidenced by the presence
of a higher density of labelled material on the substrate
at the locus of the specific polynucleotide in comparison
to a background density of labelled material resulting
from non-specific binding of labelled probes to the
substrate.
The procedures are especially effective in
situations dictating use of 64, 128, 256, 512, 1024 or
more mixed polynucleotide probes having a length of 17 to
20 bases in DNA/DNA or RNA/RNA or DNA/RNA hybridizations.
As described infra, the above-noted improved
procedures have illustratively allowed for the iden-
tification of cONA clones coding for erythropoietin of
monkey species origins within a library prepared from
anemic monkey kidney cell mRNA. More specifically, a
mixture of 128 uniformly varying 20-mer probes based on
amino acid sequence information derived from sequencing
fractions of human erythropoietin was employed in colony
hybridization procedures to identify seven "positive"
erythropoietin cDNA clones within a total of 200,000
colonies. Even more remarkably, practice of the improved
procedures of the invention have allowed for the rapid
isolation of three positive clones from within a
screening of 1,500,000 phage plaques constituting a human
genomic library. This was accomplished through use of
the above-noted mixture of 128 20-mer probes together
with a second set of 128 17-mer probes based on amino
acid analysis of a different continuous sequence of human
erythropoietin.
The above-noted illustrative procedures consti-
tute the first known instance of the use of multiple
mixed oligonucleotide probes in DNA/DNA hybridization
processes directed toward isolation of mammalian genomic
clones and the first known instance of the use of a mix-
ture of more than 32 oligonucleotide probes in the isola-
tion of cONA clones.
13 41 607
Numerous aspects and advantages of the invention
will be apparent to those skilled in the art upon
consideration of the following detailed description which
provides illustrations of the practice of the invention
5 in its presently preferred embodiments.
DETAILED DESCRIPTION
In the drawings, Figure 1 illustrates comparative
radioimmunoassay properties of recombinant products of
the invention. Figures 2, 3 and 4 graphically represent
10 plasmid constructions employed to secure production of
products of the invention in mammalian cells. Figures 5A
to 5E, 6 and 7 are DNA and polypeptide sequences
according to the invention. Figure 8 shows a DNA coding
sequence and polypeptide with gaps representing introns
15 of the genomic DNA. Figure 9 is a cDNA sequence of the
invention along with the polypeptide encoded by it.
According to the present invention, DNA sequences
encoding part or all of the polypeptide sequence of human
and monkey species erythropoietin (hereafter, at times,
20 "EPO") have been isolated and characterized. Further,
the monkey and human origin DNA has been made the subject
of eucaryotic and procaryotic expression providing
isolatable quantities of polypeptides displaying
biological (e.g., immunological) properties of naturally-
25 occurring EPO as well as both in vivo and in vitro
biological activities of EPO.
The DNA of monkey species origins was isolated from
a cDNA library constructed with mRNA derived from kidney
tissue of a monkey in a chemically induced anemic state
and whose serum was immunologically determined to include
high levels of EPO compared to normal monkey serum. The
isolation of the desired cDNA clones containing EPO
encoding DNA was accomplished through use of DNA/DNA
colony hybridization employing a pool of 128 mixed,
radiolabelled, 20-mer oligonucleotide probes and involved
the rapid screening of 200,000 colonies. Design of the
oligonucleotide probes was based on amino acid sequence
E
1341607
25a -
information provided by enzymatic fragmentation and
sequencing a small sample of human EPO.
The DNA of human species origins was isolated from a
human genomic DNA library. The isolation of clones
containing EPO-encoding DNA was accomplished through
DNA/DNA plaque hybridization employing the above-noted
pool of 128 mixed 20-mer oligonucleotide probes and . . .
Ada
-26- 1341607
a second pool of 128 radiolabelled 17-mer probes whose
sequences were based on amino acids sequence information
obtained from a different enzymatic human EPO fragment.
Positive colonies and plaques were verified by
means of dideoxy sequencing of clonal DNA using a subset
of 16 sequences within the pool of 20-mer probes and
selected. clones were subjected to nucleotide sequence
analysis resulting in deduction of primary structural
conformation of the EPO polypeptides encoded thereby.
The deduced polypeptide sequences displayed a high degree
of homology to each other and to a partial sequence
generated by amino acid analysis of human EPO fragments.
A selected positive monkey cDNA clone and a
selected positive human genomic clone were each inserted
in a "shuttle" DNA vector which was amplified in E.coli
and employed to transfect mammalian cells in culture.
Cultured growth of transfected host cells resulted in
culture medium supernatant preparations estimated to con-
tain as much as 3000 mU of EPO per ml of culture fluid.
The following examples are presented by way of
illustration of the invention and are specifically
directed to procedures carried out prior to iden-
tification of EPO encoding monkey cDNA clones and human
genomic clones, to procedures resulting in such iden-
tification, and to the sequencing, development of
expression systems and immunological verification of EPO
expression in such systems.
More particularly, Example 1 is directed to
amino acid sequencing of human EPO fragments and con-
struction of mixtures of radiolabelled probes based on
the results of this sequencing. Example 2 is generally
directed to procedures involved in the identification of
positive monkey cDNA clones and thus provides information
concerning animal treatment and preliminary radioim-
munoassay (RIA) analysis of animal sera. Example 3 is
directed to the preparation of the cDNA library, colony
27 1341607
- -
hybridization screening and verification of positive
clones, DNA sequencing of a positive cDNA clone and the
generation of monkey EPO polypeptide primary structural
conformation (amino acid sequence) information. Example
4 is directed to procedures involved in the iden-
tification of positive human genomic clones and thus pro-
vides information concerning the source of the genomic
library, plaque hybridization procedures and verification
of positive clones. Example 5 is directed to DNA
sequencing of a positive genomic clone and the generation
of human EPO polypeptide amino acid sequence information
including a comparison thereof to the monkey EPO sequence
information. Example 6 is directed to procedures for
construction of a vector incorporating EPO-encoding DNA
derived from a positive monkey cDNA clone, the use of the
vector for transfection of COS-1 cells and cultured
growth of the transfected cells. Example 7 is directed
to procedures for construction of a vector incorporating
EPO-encoding DNA derived from a positive human genomic
clone, the use of the vector for transfection of COS-1
cells and the cultured growth of the transfected cells.
Example 8 is directed to immunoassay procedures performed
on media supernatants obtained from the cultured growth
of transfected cells according to Example 6 and 7.
Example 9 is directed to in vitro and in vivo biological
activity of microbially expressed EPO of Examples 6 and
7.
Example 10 is directed to a development of mam-
malian host expression systems for monkey species EPO
cDNA and human species genomic DNA involving Chinese
hamster ovary ("CHO") cells and to the immunological and
biological activities of products of these expression
systems as well as characterization of such products.
Example 11 is directed to the preparation of manufactured
genes encoding human species EPO and EPO analogs, which
genes include a number of preference codons for
- 28 - -13 4 1 6 0 7
expression in E.coli and yeast host cells, and to
expression systems based thereon. Example 12 relates to
the immunological and biological activity profiles of
expression products of the systems of Example 11.
EXAMPLE 1
A. Human EPO Fragment Amino Acid Sequencing
Human EPO was isolated from urine and subjected
to tryptic digestion resulting in the development and
isolation of 17 discrete fragments in quantities approxi-
mating 100-150 picomoles.
Fragments were arbitrarily assigned numbers and
were analyzed for amino acid sequence by microsequence
analysis using a gas phase sequencer (Applied Biosystems)
to provide the sequence information set out in Table I,
below, wherein single letter codes are employed and "X"
designates a residue which was not unambiguously deter-
mined.
25
35
1341607
29 -
TABLE I
Fragment No. Sequence Analysis Result
T4a A-P-P-R
T4b G-K-L-K
T9 A-L-G-A-Q-K
T13 V-L-E-R
T16 A-V-S-G-L-R
T18 L-F-R
T21 K-L-F-R
T25 Y-L-L-E-A-K
T26a L-I-C-D-S-R
T26b L-Y-T-G-E-A-C-R
T27 T-I-T-A-D-T-F-R
T28 E-A-I-S-P-P-D-A-A-M-A-A-P-L-R
T30 E-A-E-X- I-T-T-G-X-A-E-H-X-S-L-
N-E-X-I-T-V-P
T31 V-Y-S-N-F-L-R
T33 S-L-T-T-L-L-R
T35 V-N-F-Y-A-W-K
T38 G-Q-A-L-L-V-X-S-S-Q-P-W-
E-P-L-Q-L-H-V-D-K
35
1341607
30 -
B. Design and Construction of
Oligonucleotide Probe Mixtures
The amino acid sequences set out in Table I were
reviewed in the context of the degeneracy of the genetic
code for the purpose of ascertaining whether mixed probe
procedures could be applied to DNA/DNA hybridization pro-
cedures on cDNA and/or genomic DNA libraries. This ana-
lysis revealed that within Fragment No. T35 there existed
a series of 7 amino acid residues
(Val-Asn-Phe-Tyr-Ala-Trp-Lys) which could be uniquely
characterized as encoded for by one of 128 possible DNA
sequences spanning 20 base pairs. A first set of 128
20-mer oligonucleotides was therefore synthesized by
standard phosphoamidite methods (See, e.g., Beaucage, et
al., Tetrahedron Letters, 22, pp. 1859-1862 (1981) on a
solid support according to the sequence set out in Table
II, below.
TABLE II
Residue - Val - Asn Phe Tarr Ala Trp Ls
3' CAA TTG AAG ATG CGA ACC TT - 5'
T A A A T
G G
C C
Further analysis revealed that within fragment
No. T38 there existed a series of 6 amino acid residues
(Gln-Pro-Trp-Glu-Pro-Leu) on the basis of which there
could be prepared a pool of 128 mixed olignucleotide
17-mer probes as set out in Table III, below.
TABLE III
Residue - Gin Pro Trp Glu Pro Leu
3' GTT GGA ACC CTT GGA GA - 5'
C T C T A
G G
C C
1341607
-31 -
Oligonucleotide probes were labelled at the 5' end with gamma -
32P-ATP, 7500-8000 Ci/mmole (ICN) using T4 polynucleotide kinase
(NEN).
EXAMPLE 2
A. Monkey Treatment Procedures
Female Cynomolgus monkeys Macaca fascicularias (2.5-3 kg, 1.5-2
years old) were treated subcutaneously with a pH 7.0 solution of
phenylhydrazine hydrochloride at a dosage level of 12.5 mg/kg on days 1,
3 and 5. The hematocrit was monitored prior to each injection. On day 7,
or whenever the hematocrit level fell below 25% of the initial level, serum
and kidneys were harvested after administration of 25 mg/kg doses of
ketamine hydrochloride. Harvested materials were immediately frozen in
liquid nitrogen and stored at -70 C.
B. RIA for EPO
Radioimmunoassay procedures applied for quantitative detection of
EPO in samples were conducted according to the following procedures:
An erythropoietin standard or unknown sample was incubated
together with antiserum for two hours at 37 C. After the two hour
incubation, the sample tubes were cooled on ice, 1251_ labelled
erythropoietin was added, and the tubes were incubated at D.C for at
least 15 more hours. Each assay tube contained 500 pl of incubation
mixture consisting of 50 pi of diluted immune sera, 10,000 cpm of 125I-
erythropoietin, 5 pl trasylol and 0-250 pl of either EPO standard or
unknown sample, with PBS containing 0.1% BSA making up the remaining
volume. The antiserum used was the second test bleed of a rabbit
- 32 - 13 41 667
immunized with a 1% pure preparation of human urinary
erythropoietin. The final antiserum dilution on the
assay was adjusted so that the antibody-bound 125I-EPO
did not exceed 10-20% of the input total counts. In
general, this corresponded to a final antiserum dilution
of from 1:50,000 to 1:100,000.
The antibody-bound 125I-erythropoietin was pre-
cipitated by the addition of 150 Ul Staph A. After a 40
min. incubation, the samples were centrifuged and the
pellets were washed two times with 0.75 ml 10 mM Tris-HC1
pH 8.2 containing 0.15M NaCl, 2mM EDTA, and 0.05% Triton
X-100. The washed pellets were counted in a gamma
counter to determine the percent of 125I-erythropoietin
bound. Counts bound by pre-immune sera were subtracted
from all final values to correct for nonspecific precipi-
tation. The erythropoietin content of the unknown
samples was determined by comparison to the standard
curve.
The above procedure was applied to monkey serum
obtained in Part A, above, as well as to the untreated
monkey serum. Normal serum levels were assayed to con-
tain approximately 36 mU/ml while treated monkey serum
contained from 1000 to 1700 mU/ml.
EXAMPLE 3
A. Monkey cDNA Library Construction
Messenger RNA was isolated from normal and ane-
mic monkey kidneys by the guanidinium thiocyanate proce-
dure of Chirgwin, et al., Biochemistry, 18, p. 5294
(1979) and poly (A)+ mRNA was purified by two runs of
oligo(dT)-cellulose column chromatography as described at
pp. 197-198 in Maniatis, et al., "Molecular Cloning, A
Laboratory Manual" (Cold Springs Harbor Laboratory, Cold
Springs, Harbor, N.Y., 1982). The cONA library was con-
structed according to a modification of the general pro-
33 1341607
- -
cedures of Okayama, et al., Mol. and Cell.Biol., 2,
pp. 161-170 (1982). The key features of the presently
preferred procedures were as follows: (1) pUC8 was used
as the sole vector, cut with Pstl and then tailed with
oligo dT of 60-80 bases in length; (2) HincIl digestion
was used to remove the oligo dT tail from one end of the
vector; (3) first strand synthesis and oligo dG tailing
was carried out according to the published procedure; (4)
BamHI digestion was employed to remove the oligo dG tail
from one end of the vector; and (5) replacement of the
RNA strand by DNA was in the presence of two linkers
(GATCTAAAGACCGTCCCCCCCCC and ACGGTCTTTA) in a three-fold
molar excess over the oligo dG tailed vector.
B. Colony Hybridization Procedures For
Screening Monkey cDNA Library
Transformed E.coli were spread out at a density
of 9000 colonies per 10 x 10 cm plate on nutrient plates
containing 50 micrograms/ml Ampicillin. GeneScreen
filters (New England Nuclear Catalog No. NEF-972) were
pre-wet on a BHI-CAM plate (Bacto brain heart infusion 37
g/L, Casamino acids 2 g/L and agar 15 g/L, containing 500
micrograms/ml Chloramphenicol) and were used to lift the
colonies off the plate.. The colonies were grown in the
same medium for 12 hours or longer to amplify the plasmid
copy numbers. The amplified colonies (colony side up)
were treated by serially placing the filters over 2
pieces of Whatman 3 MM paper saturated with each of the
following solutions:
(1) 50 mM glucose - 25 mM Tris-HCi (pH 8.0) -
10 mM EDTA (pH 8.0) for five minutes;
(2) 0.5 M NaOH for ten minutes; and
(3) 1.0 M Tris-HC1 (pH 7.5) for three minutes.
The filters were then air dried in a vacuum over
at 80=C for two hours.
The filters were then subjected to Proteinase K
34 _ 13 41 607
digestion through treatment with a solution containing 50
micrograms/ml of the protease enzyme in Buffer K [O.1M
Tris-HC1 (pH 8.0) - 0.15M NaCl - 10 mM EDTA (pH 8.2)
-0.2% SDS]. Specifically, 5 ml of the solution was added
to each filter and the digestion was allowed to proceed
at 55=C for 30 minutes, after which the solution was
removed.
The filters were then treated with 4 ml of a
prehybridization buffer (5 x SSPE - 0.5% SDS - 100
micrograms/ml SS E.coli DNA - 5 x BFP). The prehybridi-
zation treatment was carried out at 55=C, generally for 4
hours or longer, after which the prehybridization buffer
was removed.
The hybridization process was carried out in the
following manner. To each filter was added 3 ml of
hybridization buffer (5 x SSPE - 0.5% SDS - 100
micrograms/ml yeast tRNA) containing 0.025 picomoles of
each of the 128 probe sequences of Table II (the total
mixture being designated the EPV mixture) and the filters
were maintained at 48=C for 20 hours. This temperature
was 2=C less than the lowest of the calculated disso-
ciation temperatures (Td) determined for any of the pro-
bes.
Following hybridization, the filters were washed
three times for ten minutes on a shaker with 6 x SSC
-0.1% SDS at room temperature and washed two to three
times with 6 x SSC - 1% SDS at the hybridization tem-
perature (48=C).
Autoradiography of the filters revealed seven
positive clones among the 200,000 colonies screened.
Initial sequence analysis of one of the putative
monkey cDNA clones (designated clone 83) was performed
for verification purposes by a modification of the proce-
dure of Wallace, et al., Gene, 16, pp. 21-26 (1981).
Briefly, plasmid DNA from monkey cDNA clone 83 was
linearized by digestion with EcoRI and denatured by
35 1341607
heating in a boiling water bath. The nucleotide sequence
was determined by the dideoxy method of Sanger, et al.,
P.N.A.S. (U.S.A.), 74, pp. 5463-5467 (1977). A subset of
the EPV mixture of probes consisting of 16 sequences was
used as a primer for the sequencing reactions.
C. Monkey EPO cDNA Sequencing
Nucleotide sequence analysis of clone 83 was
carried out by the procedures of Messing, Methods in
Enzymology, 101, pp. 20-78 (1983). Set out in Table IV
is a preliminary restriction map analysis of the approxi-
mately 1600 base pair EcoRI/Hindlll cloned fragment of
clone 83. Approximate locations of restriction endo-
nuclease enzyme recognition sites are provided in terms
of number of bases 3' to the EcoRI site at the 5' end of
the fragment. Nucleotide sequencing was carried out by
sequencing individual restriction fragments with the
intent of matching overlapping fragments. For example,
an overlap of sequence information provided by analysis
of nucleotides in a restriction fragment designated C113
(Sau3A at -111/Smal at -324) and the reverse order
sequencing of a fragment designated C73 (Alul at
-424/BstEII at -203).
30
13 41 607
36 -
TABLE IV
Restriction Enzyme
Recognition Site Approximate Location(s)
Ec oR I 1
Sau3A 111
SmaI 180
BstEII 203
Sma I 324
Kenl 371
RsaI 372
Alul 424
PstI 426
Alul 430
Heal 466
Alul 546
PstI 601
PvuII 604
Alul 605
Alul 782
Alul 788
RsaI 792
PstI 807
Alul 841
Alul 927
NcoI 946
Sau3A 1014
Alul 1072
Alul 1115
Alul 1223
PstI 1301
RsaI 1343
Alul 1384
HindlIl 1449
Alul 1450
HindlIl 1585
1341607
37 -
Sequencing of approximately 1342 base pairs
(within the region spanning the Sau3A site 3' to the
EcoRI site and the Hindill site) and analysis of all
possible reading frames has allowed for the development
of DNA and amino acid sequence information set out in
Table V. In the Table, the putative initial amino acid
residue of the amino terminal of mature EPO (as verified
by correlation to the previously mentioned sequence ana-
lysis of twenty amino terminal residues) is designated by
the numeral +1. The presence of a methionine-specifying
ATG codon (designated -27) "upstream" of the initial
amino terminal alanine residue as the first residue
designated for the amino acid sequence of the mature pro-
tein is indicative of the likelihood that EPO is ini-
tially expressed in the cytoplasm in a precursor form
including a 27 amino acid "leader" region which is
excised prior to entry of mature EPO into circulation.
Potential glycosylation sites within the polypeptide are
designated by asterisks. The estimated molecular weight
of the translated region was determine to be 21,117
daltons and the M.W. of the 165 residues of the polypep-
tide constituting mature monkey EPO was determined to be
18,236 daltons.
30
13416 7
38 -
U ca oa :3 0 +W ca OQ
U Q H U 4) 1- 4) I- S-i u
U U a U JU f cc CL U
C7 H au
I- U H C D U -4 U &4 C.0 . -I U
U 0 I- H 4) 1- co I- .C U CO I-
U U JU >0 Q >0
U H O CO U
C 7 C7 N -I U >4 U O C)< ="I U O i-+ U
C 7 C7 I Q C7 .--I 0 r-1 FI 0 CO H Q L U
I- Q C7U QU >C7 F-Q
U I- O 1-
Q U U ku ~C7 FIU C 4)U
Z CD U IL U 4) F- CU C7 * U) Q -1 1--
O C.7 0 JU (t) QQ M1Q
O 0 U U) H-
C7 C H
I- C7 >+C7 0 I- au
O C7 U U H F4 U (n Q rI Q * U) Q
Q- U C7 a_ U Q0 0007 QQ
W U U Q
U U r-IQ 7U v)I- COU OC'
C7 Q CD C7 4) I- >, (7 -4 U '-I Q
4) U U JU UI- QC7 C7 CD
> 1 Q I- U) U
C U C7 - -I Q O FI 0 a) U 7 0 C I-
W O U C7 2 U -4 a) U r-1 1- r-I Q (n J Z I- I- I V)1- HQ 00 QQ
CO U C7 CD
Ci- U I- cc I- r-I C7 7 U O U) 0 7 C7
I- O H U > U co Q 4) I-
U C~ >C7 JU JQ JF-
O U U ~C7 OU 0)U COU FIU
=~ U U C7 0 4) I- H 0 -1 U 4) 0
+~ U I- J U Q U Q C7 V) Q
O7 C7 U I~ +-) C'
U Q N cu I- HI- OQ )C7 U)U
U) U C' 1 fQ 4)U HU Q >S CD
C 0 C7 0 V)1- a.U UC7 co UI-
Q Q Q
F+ U 0 U C7 OQ OU IaC
H Q I- C D 4) I- k u 4) 1- (L) 0
0 Q U J U IL U J H N Q
0 CO C'
U U 7U ^I CO L) 7U 7Q
U CD 0 (L) I- + -4 U 4) I- 1-1 Q
U U 0 J U Q 0 J U 0 0
U U Q
U U U >,U Ft U 0 k u
I-
U H- U 4) H I .-I CD >+ c :z (1) U
0 H 0 J U 0 CD H I- V)
U U C3
U) I-
0 Q U C). 0 0 CD 0) 0
U Q U Ft 0 F+ U H C7 >+ 0
cC O C7 U H I- CL U Q Q U I-
M U I- U
7 1- U Q 7 0 -4 U CD >, U
COQ 0 (' 4) I- CO I- r-I Q -40
N C7 U 0 J U > C) C7 0 0 0
39 13 41 607
- -
>,C7 OQ 0F- 7H- c0U a)U a)U
1-4 0 r-1 Q H U a) I - =--I U -4 I- L I-
C7 CD C7 0 CL U J U Q 0 FI Q CL F-
r-IU f-,Q CC0 U OQ $-~U CI-
c0)- a)U r-IQ ri0 r--4 CC LU (nQ
> U U) )- C0 U cl C7 CD 0 I- Q Q Q
7C7 0 :U HU 0 HI- C0 0 0)cC I-FU
.-i¾ ^ (D I- a)U 0 a)0 -q CC ~QU U)O
00 JU (I))- ri n< 0U
4--) U D0 c-II- a)U mu 7U HU
a) I - a) I- a) U r-I I- r-I U a) 1- >, Q
14 J U (n )- H Q Q 0 J O I- I-
0)0 mu CU (00 >+Q O¾ r-4U
r-. i-+ LO -4 U 1(' (I) Q -4 U r-= C7 f-+ U N F-
Q Q CC C7 Q Q Q C7 0 C7 a U > 0
a)
(n o7 D 0 c0 U u) Q 7 C7 CD I- 0)
7 >% Q a) I- r-I U >+ Q a) I- 1-I U 4-i 0
C JQ JU QC7 JQ JU Q(' QU
--4
+> 00 >,U DC7 0F- c0 C7 c0 F- a)U
C N 0 r-I 0 a) I- (n a r-I U r1 U L I-
0 I-F- 00 -1 F- CU QCD cx0 a_ I--
0 Co U C U 0 .--I 0 +J 0 0 0) 0 N 0 0 D U
V% .-1 U ri Q co c0 I- CD I- r-4 4-i 0 Q) U Q (1) F-
> QC7 0U >C7 iQ ~ QU En I- =-I -1 L)
U) 4-i F- a C7 M U (n U 7 I- c0 U (n Q
J >, Q H C7 -4 U =r-1 Q W I- r-I U >, Q
00 I-F- I-I- QU 2U JU QC7 JQ
Q
F-.- a) U r-4 U C O D O D 0 co 0 (n o
L F- c0 F- r1 a a) I- (L) I- r-I U >+ 0
CL - >0 CD L) JU JU Q0 UI-
CU D Q >+U C0 HI- aI- a)U
(1) CC r-I a r-( 0 1-1 a z (n a L I-
QQ 0c' ('C7 C0U I-Q Q(.7 CLI-
.-I I- -4 Q 0) C7 D 0 c- U 0 Q La co F
I- CO I- N C7 0 I-- C U I-I U L U
>0 >U QU JU F-Q Q- C.) I-Q
(nQ 0 (O)-- :U 0 0U ()U 0 :U aU
>% Q 'O r-{ U (L) I- ON H U r-I I- N 0) I- (n Q
Jd cz0 -1 L) CL L) F-IQ .-1 JU cr0
I-i u C 0 r=i U 7 0 H U c-r U c0 I-
L U =-I Q c0 I- - d a) G (1) U -1 U
I-Q 0U >C7 C) Lo U)Q (f) I- Qc'
aU CC7 ca F-- a)U 0)U a)U NF-
(1)Q 1-4C r4U LI- HC7 -4 I- LU
a 0 C7 U Q C) CL I- Q U r1 Q F- Q
40 1341607
- -
Q
U C.7 U U I- C7 F- I- Cs U
C) Q Q Q Q 0 U F- I- F- Q Q
N C7 Q Q Q Q U U U Q U C7
Q Q U I- C.7 0 Q U Q 1- Q Q
Q
U U 0 Q U Q 0 Q 0
C7) C7 Q 0 Q U Q I- I- Q I- C,
$40 U Q C7 U Q I- C7 C7 I-
Q Q I- U Q U Q F- F- Q U 0
U I- U 0 Q Q U 0 Q U
O U) u U U U 0 0 Q C7 Q I- U
%O >,C7 U I- C9 Cs 0 U Q C7 0 Q
=-I U I- I- U CD Q 0 0 Q I- C' Q
U CD C7 C7 Q 0 U U 0 0
co O U 0 C7 I- U Q C' Q Q Q
.--I U Q 0 Q I- 0 0 0 U C' U
~
Q 0 U Cs U U I- 0 I- Q 0
U Q I- Q Q 0 Cs I- C7 H
I- I- Q H
7 C7 Q 0 U Q Q I- 0
r-, =--I Q U U I- U U H Q I- 0 0
00 U I- Q U Q U H U 0 U F- F-1
Q U 0 0 0 I- U Q 0 I- D
>~ O Q U Q C7 Q U U U Cs I- O C
rl C7 U U C7 C7 C7 Q Q U 0 Q 0-1
Q=
=-i 0 C7 Q U I- Q Q U Q U I- 0
U u Q U U Q 0 C7 I- C7 Q
C $40 CD Q Q 0 C7 C7 Q Q I- CD U
p L U CD Q U U Q C7 CO C7 I- I- U
C) H Q C7 C' CD I- C7 Q C7 Q C7 U I-
u Q C7 C7 U I- Q C3 0 0
F+ U U U U I- Q C7 U U Q Q 0
> >, Q CD U U Q U I- Q 0 U 0 0
I- I- Q I- U C7 H Q C' 0 Q 0 0
I-
W U U I- co U co I- I- co
J 7 C7 U Q C7 Q Q I- Q co 0 CD 0
U Q Q Q I- 0 C3 U 0 U
Q J U C7 U U I- Q I- 0 H Q CD I-
U Q U U !- Q Q I- I- 0 U
N CD C7 U I- I- I- Q U U I-- Q I-
>, Q I- I- U Q I- Q Q U Q I- I -
J Q 0 U Q 0 U Q 0 U Q C7 C7
C' U U Q C' U CD I- Q C7 C.7
D 0 Q U Q C7 Q C7 0 U Q U I-
N I- U I- C7 I- U I- Q Q Q C' U
U U U C7 C7 I-
J U U U C.7 U 0
U F- I- Q U I- C7 CD 0 U
u) CD cL U Q U 0 Q Q C7 Q Q U
>%Q CL CD Q U Q Q U U co U U 0
J Q O H Q U U Q C' Q Q Q Q I-
O >,Q u1 CTQ U I- Q U CD I- U U Q U
ul -4 C7 'C H C' U 0 U I- U U I- 0 0 0
-1C70 ,4QQ 0 I- 0 I- H U U I- 0 0
U Q Q U Q U U 0 0
D) C7 CL U 0 U 0 U Q U 0 I- C' C'
H 0 () Q I- 0 Q C' U 0 0 Q I- 0
I-
Q U Q C' U Q U Q I- I- Q Q 0
U U U Q U I- Q U I- Q
U >%C7 0 U I- 0 CD I- U 0 0 0
Q) I- -I co I- 0 0 0 Q I- I- I- I- C'
J U 0 C7 U U I- Q 0 I- U I- 0 Q
-41- 1341607
The polypeptide sequence of Table V may readily be subjected to
analysis for the presence of highly hydrophilic regions and/or secondary
conformational characteristics indicative of potentially highly immunogenic
regions by, e.g., the methods of Hopp, et al., P.N.A.S (U.S.A.), 78, pp.
3824-3828 (1981) and Kyte et al., ].Mol.Biol., 157, pp. 105-132 (1982)
and/or Chou, et al., Biochem., 13, pp. 222-245 (1974) and Advances in
Enzymology 47, pp. 45-47 (1978). Computer-assisted analysis according
to the Hopp, et al. method is available by means of a program designated
PEP Reference Section 6.7 made available by Intelligenetics, Inc., 124
University Avenue, Palo Alto, California.
EXAMPLE 4
A. Human Genomic Library
A Ch4A phage-borne human fetal liver genomic library prepared
according to the procedures of Lawn, et al., Cell, Supra, was obtained and
maintained for use in a plaque hybridization assay.
B. Plaque Hybridization Procedures For
Screening Human Genomic Library
Phage particles were lysed and the DNAs were fixed on filters
(50,000 plaques per filter) according to the procedures of Woo, Methods
In Enzymology, 68, pp. 389-395 (1979) except for the use of GeneScreen
Plus filters (New England Nuclear Catalog No. NEF-972) and NZYAM plates
(NaC1, 5g; MgC12-6H20 2 g; NZ-Amine A, 10g; yeast extract, 5g;
casamino acids, 2 g; maltose; 2g; and agar, 15g per liter).
The air-dried filters were baked at 80 C for 1 hour and then
digested with Proteinase K as described in Example 3, Part B.
Prehybridization was carried out with a 1M NaCl - 1% SDS buffer for 55 C
for 4 hours or more,
41607
-42-
after which the buffer was removed. Hybridization and post-hybridization
washings were carried out as described in Example 3, Part B. Both the
mixture of 128 20-mer probes designated EPV and the mixture of 128 17-
mer probes of Table III (designated the EPQ mixture) were employed.
Hybridization was carried out at 48 C using the EPV probe mixture. EPQ
probe mixture hybridization was carried out at 46 C -- 4 degrees below
the lowest calculated Td for members of the mixture. Removal of the
hybridized probe for rehybridization was accomplished by boiling with 1 x
SSC - 0.1% SDS for two minutes. Autoradiography of the filters revealed
three positive clones (reactive with both probe mixtures) among the
1,500,000 phage plaques screened. Verification of the positive clones as
being EPO-encoding was obtained through DNA sequencing and electron
micrographic visualization of heteroduplex formation with the monkey
cDNA of Example 3. This procedure also gave evidence of multiple introns
in the genomic DNA sequence.
EXAMPLE 5
Nucleotide sequence analysis of one of the positive clones
(designated AhE1) was carried out and results obtained to date are set out
in Table VI and in Figures 5A to 5E.
43- 1341607
U U 0 C7 0 U X C7
U U C7 C7 I- 1- U X I-
U U U U U U C7 ' N U U
U Q U U C7 0 0 N =r-I Cr 0
C7 C7 U U Q U U Q 1 m u 0
U Q U U U 0 C7 U
U U U Q Q C7 U I- r-10 U
H U U 0 U U Q CO H U
U C7 U I- C7 U Q 0 > C7 U
I- U Q U U U U 0 0
0 U co H Q C7 Q C7 >+ C7 U
Q H 1- U U U 0 U -I C7 C7
C7 U 0 0 I- U U C7 0 Q
I- C7 U H U U U U I'
U U U U 0 0 I- I- N C7
I- Q U U U U U I- N CI) 1-- I-
U U U U U U C7 U I MCC C7 U U U 0 H 0
C7
Q 0 C7 Q C7 U Q 0
U Q I=- U U I- 0 0 0
0 Q U U U U U U Q C7
0 0 0 U U U U C7 U
Q Q Q U U X C7 0 C7
U U 0 C7 U Q U U Q
U U C' U Q U U U C7 0
U U C7 0 U U U Q U
Q I- U 0 U 0 C7 U 0 cc I- U Q U C7 U C7 Q
U U U U C7 0 I- Q 0
C7 U 0 U U I- U U U
cC U C7 U F- U U U U U
H U 0 C7 Q U U Q U C7 U
> F- Q Q Q U U C7 C7 I-
U U U U U 1- U 0 U I-
W Q U U H U C7 C7 I- U 0
Q U U U C7 Q C7 U U 0
m 0 C7 Q U Q 0 0 C7 U 0
C7 Q 0 0 U Q 0 0 Q U
U 0 U Q Q X U C7 0 U
C7 0 0 0 U C7 U 0 0 0
0 U U Q U Q I- 0 0
U U 0 U U C7 C7 Q U
H U U C7 C7 0 C7 U C7 co
U 1- I- U U Q U U 1- 0
Q 0 U U Q 0 U U U U
I- i- U U U Q C7 C7 C7 U
U 0 U U I- U Q C7 U U
C7 C7 U U U U C7 Q H I-
Q Q H U U 0 C7 I- C7 U
U C7 U Q U C7 U U Q C7
U C7 Q U U U U -- Q U
U 0 U I- Q U U U U 0
Q C7 U U 0 U I- U U C7
C7 Q H C7 U U U I- U C7
Q U U U 0 U U U U 1-
U U 0 U 0 Q H H 0 U
U U 0 U I- C7 C7 U U 0
I- U U U U U I- U 0 C7
I- U U C7 U U U U U C7
U U Q Q U U 0 0 0 U
0 0 Q U U U U U 0 0
C7 H U 0 Q C.7 0 U U U
C7 Q 0 Q Q U C7 U I-
I- 0 U U U U U Q Q U
U co C7 U U Q Q U 0 Q
0 I- H U Q U Q I--
U 0 U U 1- 0 0 C7 C7
U U C7 H 0 Q U 0 C7 Q
0 Q 0 0 0 0 U U C7
Q 0 Q U 1- Q 0 H U
Q Q Q Q C7 U U U U C7
13 41 607
44 -
(~ Q C7 H 7 0 U) I- a) U F- U
0 U r--~ ct U a) 1- >%O 1-4 I- a
C7 0 0 1- JU U)- 1-4 Q 0 0
I- 0 V) U U Q Q
0 0 Q Q WU a)U c H U Q
C7 CD I-1 0 0 a) U -4 I- * U) d u I-
C7 Q u C7 U) I- f'-I Q d ct U Q
C7 C7 U a U I- Q
C' 1- U Q U 7 C7 7 U O C7 U CD
0 I- I- C7 C7 (U a) 1- .-4 Q U Q
Q O U' O U JU JU C.70 I- Q
C7 I- 1- ct u U
0 U C:0 U U O U O)U caU Q cc
C' U I- cc u CU I- $40 --1 U d u
0 C' 0 C7 U J U Q U Q 0 0 Q
0 0 cc 0 U 0 cc I- U C7 C~ 7 I- 0 Q 0 0 U
Q U 1- I- U () F- I-1 U r~ Q Q U
0 U U CL U 00 U U
C' Q H U U I- U
U Q H 0 I- CIO 0 Q O (n c7 I- U
U Q 0 1- 1- c-+ 0 H ci N>. Q U U
U" Q U cc u I-I- CLU Jcc C' 0
U Q H U U C7 H
U 0 0 U O C' r-1 CU U CU U (, U
r-+ C7 U I- I- a a) I- + 1-1 U r-I U Q Q
= 0 0 0 I- U J U Q 0 Q C' ci
Q H I- U U
Q Q I- 0 0 a, 0 -4 >%U O 0 U 0
+1 U 0 0 I- Q $40 1 .-4 CD .-1 Q C7 Q
C I- C' Q C:7 U I- I- 0 0 C' 0 U 1-
0 0 0 U Q Q cc u
U H 0 O 0 U 0 CU U 7 C' O CD U C'
=~ F- 1- I- I- U N r-1 U a) I- a) I- H Q
U 1- 0 U I- I QC, JU JH U Q
r-1 Q U U 1- Q 0
> 0 I- U Q U O I- -4 U O U Q 0
U F C' U U H U cc I- a) I- C7 0
W 0 0 I- 0 I- O U > C7 J U cc J C7 cc u ct 0 U co I-
U 0 1- U 1- (n 1- 0 Q c-H U Q C,
Q U CD H 0 U >10 i-~ U >+ Q U Q
I- Q C.D 0 0 0 U I- CL U I- I- U 0
C7 U 0 Q ct I- 0
0 0 U 0 Q M O Q 7 U C7) C' 1- 1-
Q I- C7 Q CD N r-I Q a) 1- 1-a U Q 0
Q 1- H U 0 1 0 J U Q Q U 0
U U 1- U Q Q 0
¾ C7 a >, U C7 U 0
I-
0 0 cC C' r-1 O r-1 Q 0
0 0 0 cL I- CD 0 C.7 C7 C7 Q F-
0 0 Q I- cL Q U
0 O O Q 0 I- 7 C!) O C7 U C'
H U 0 cc 0 U () I- a) I- U 0
U 0 Q U 0 1- J U J U U I-
I- I- I-
0 U 0 H 0
C' U 0 Q I- 0 o l-- . 4 U 1- U
H C' C7 0 U 1- H U co I- U ¾
0 1- C' a U U dU >0 U U
0 0 I- U Q I- U 0
d u i- d 0 Q 7 U 0 CJ) Q U CD
0 a 0 U Q I- a) I- r-1 i-r C-7 ¾ I-
Q U C' 0 0 U J U Q U 0 U
Q U 0 U Q 0 Q U
U F- C' Q U 0 O N 0 1-+ U C, d
U U I- U 0 1- --1 CU U a) C7 H CT
0 U H Q C.7 U I U) I- U) Q C7 C'
0 0 H U C7 U U
1- Q 0 0 CD 0 O CD O. U \O H 0 cc
1- U d I- I- Q a) 1- U) d N L U U
Q U U I- U U JU QC7 1-Q U
45 1341607
- -
U Q a
U >,¾ U U Q ¾ U
0 00 F- F- ¾ U U U C7
Q U C7 U H co U
U O CO 1- N U 1- Q 0 0 Q
U .-1 U L I- U 0 Q Q U CD
CD ¾ 0 O 1- I- i- 0 U I-
U Q Q I- I- U U
0 U) 1- C I- Q C7 1- Q 0 U
I- >, U (n Q 0 Q U ¾ Q U
0 U Q Q C7 U Q 0 0
I- 0 Q 1- Q I- 0
U >, U -I H U U 1- Q H Q
U 0 CO 1- I- C7 c U 0
I-
U UU >C7 I- c 0
U I- U U I- U 0
Q I~ N U cn Q I- U Q )- I- Q
I- CN C U >,¾ U Q 0 H Q U
U I.- Q J Q H 0 U Q U ¾
U H 0 C7 U 0 U
U I- H I- Q ¾ ¾
LU U ¾ Cry U
I-
CD l¾ U ¾ 0 0
Q Q Q U 0 C7
O U au 1- Q Co Q U ¾
0 Q En Q I- I- U H 0 U
--
r-. ¾ U Q C7 0 U U 0
U I- F- U U I- Q U
u 1-- O¾ H ¾ C7 U U U
U I- H U I- Q I- I- I- C'
Q a- U I- Q Q Q U Q
C Q U 1- U 0 U U U
O Q C7 .-I U I- C7 ¾ U 0 U
U U I- cD H I- C7 0 U Q I-
0 C' > C7 i- U I- U Q U
¾ I- H 0 U U CD ¾
F-1 0 U O H F- I- U C7 I- C7 U
> 0 I- L U I- H 0 ¾ I- 0
H H
Q U H¾ U ¾ Q 0
W Q 0 U 0 U Q I- U
J U 0 O U 1- I- U 0 ¾ ¾
m 0 0 r-1 1- 1- Q U I- I - U
0 U Q 0 Q I- 0 Q U
H Q U co ¾ ¾ CD Q
I- U C I- C7 Q Q I- Q U
U U iE U) Q I- U I- Q U Q
Q I-- Q¾ 0 0 Q U U U
U 0 I- U U I-
Q O 0 U' 7 0 Q U Q I- Q
U LD .--1 Q 111 .--1 Q Q 1- U U CD
I- I- o u o u Q C' CD ¾ H
U I-- CD U 0 I- CD
H
U U C I- 4-) C7 H ¾ ¾ 0
U cn Q) l- ¾ U I- 0 U
I- U Q Q f¾ U I- U I- U
Q Q 0 U U 0 Q
U U 7 CD C7) U I- 0 Q C7 0
U 0 Q) 1- H 0 I- 0 ¾ I- I-
Q 0 J I- Q Q 1- Q U Q 0
Q ¾ I- U U U ¾
Q U f-+ U N U ¾ Q Q 0 U
U H N U >+ Q U U 0 I- 0
H
U 1- to Q J¾ 1- 0 Q 0
U U U U U C7 U
U U <n U au C) 0 I- I- U
U 0 >40 H CD C7 C7 I- 0 CD
U ¾ C) I- I- I- Q C' I- Q Q
I- U CD H U ¾ 0
0 u) U O CO U U U ¾ U I-
U U .,j CZ In ~ U U U U 1- I-
I- U = U ¾ U H U U U I-
1341607
46 -
ca :3 0 :3 cx ca
C7 ri U O I- O C.7 U r-I U
Q i- dC7 JU JU C7 U dC.7
U I- CD U
M-
I- U Q :3 Q O 0U :3 0 C7 U ca
U ri Q ON P U a) I- d U r-I U
Q F- CD C7 0 CL U J U Q Q 0
U C7 I- C7 0
C' U H C7 D C' H I- d U Q
U I- U CU U r-I cc L U Q C7 a) U
Q I- U U) F- C7 U H d 1- d
U U I- U U
I- C-1 U O ) C7 C3.0 N U I- CD 1b U
Q c N a)F- BCD LU U ) AU
Q U U JU I-F- F-Q 1- U Q0
U H U i- Q
I- U I- 0 Ou :3 U 1- U CO 0
F- C.7 C7 O I- 1i U a) I- U C7 .-1 U
I- d J U CL U J U U 0 Q 0
I- I- C7 U )-
I- )- d co U C 0 f-i U C' CD C1H
CT CD 0 --+ U -1 d a) 0 F- I- (n cc
U I- U d0 LDU U)d F-- U QCD
I- U U U I-
I- I- f- 7 C~ F+ U CPU C.7 H 0 Q
Q H U a) I- a) U $40 F- I - c-i U
U U d JU U))- QU U U LLU
d U C7 1- U
0 I- Q U >+ U E-+ H H 1- U O I-
Q I- I- -4 C' a) U a) I- U I- 1i U
-N Q d U C' C7 U) H J U d )- CL U
U U
C 0 U 0
0 0 CD Q C 0 C U >N U d U O f-+ U
0 1- 1- U r 1 Q * N cc r-I 0 C7 H- N CU U
. J d H I- CD U Q Q C7 C7 CD I- ri U) H
I- Q C7 U d
0 Cl C7 --1 U 0 N I- C.7 H a) U
> I- H C7 H U CO 1- O W 0 cL I-
U U I- I-- H > C7 ri U) d 0 U d
W C7 F- Q 0 U
J C7 C3 U -4 U CD ri U Q F- CO U
Cn C 7 d d CO I- a) I- 0) I- I- CD --1 U
Q d Q 0 > 0 J H > 0 CD I- Q C7
H C7 U H Q U
cc 0 7Q O O0 caU CD Q 7Q
d d 0 -4 Q co a) I- r-I U I- Q ri Q
Q U C7 CDCD JU QC7 0 C7 DC7
Q I- C7 ri Q CO U O d Il\ C 0 d (0 0
Q Q (0 F- .--1 U >+ Q .-i Q U --I >, Q
Q U U >C7 QC7 JQ -i CCU Q --1 JQ
d F- C~ I-
d I- C7 O (0 U C CD Q F- [0 U C7
CD Q Q %0 ri U =-I d 1n d -1 U Q
4 U 0 Q C' 0 U 0 Q 0 C7
Q 1- C7 co C3
Q I- Q CCD >+ U r-I C, >+ Q Q Q
d Q U --1 d r-1 0 ca H- 1-C7 Q U
Q U C' C7 U CD C7 > 0 CD C7 CD
Q H C7 U C7
C7 I- C7 C 0 OCD N I- C7 U 1-
Q Q CD -4 Q ci 0 =-'I Q a) I- F-
U d CDU QU U JU F- U
Q C7 U U
0 C7 0
I-
C7 Q U 1-40 a) I- a) )- .-1 U CD U
Q U CD 00 J U J U d 0
C7 I-
d H H C7 H
d U U \0 =-I U --1 U C CD 0 0) CD
d
Q Q C7 U -N co I- (0 1- 1-1 d -4 1-4 0 Q cx U C7 > C7 > C.7 o u -i d U 0 0
1341607
47 -
H U >,C, d U U U U CD U d
O O 11 0 U U d co cc C7 cc Q
(1) F- 0 0 d F- U F- F- d 0 0
U U F- d F- U Q
H U H d U d C7 U H U Q U
>+ Q U C~ U U d H 0 cc
F- F- F- Q F- d Q CD C7 U C7
CD C7 0 Q U F- d Q
-i U O co I- C7 0 C7 C7 I- U U
co F- H 0 ,- F- d d C7 U U d
> (~ d Q U d d U d Q d 0
C7 U I- Q 0
C7 Q F-
CD U) U I- U U C3 U F- C7 F-
H 0 >+ C7 F- U I- U F- C7 C_7 d
Q U U I- Q 1- Q CD F- F- C' F-
U 0 C7 d F- U I- U
CD U O cc c Q I- d U U 0 CD U
L I- NO -I U d u 0 F- 0 Q C7 Q
Q -4 Cr CD U U I- U U d F- Q
O U O 0 Q cc Fu- d u 0 0 FU-
O F- --i Q U U U d Q CD 0
U
J U 0 0 F- U d F- 0 I- 0
F-
U C' Q I- 0 0 U F-
O U) Q >, CD U U U F- d C7 U d
- >+ Q --I C' U CD C' U U Q Q
-4 J CT CD 0 I- Q Q C' U F- U C7
= U U 0 d C7 F- Q u u H Q U I- Q U I- U C' CD
H C7 L U cc U 0 C7 Q Q F- I -
Q U F- Q U 0 d Q C7 Q F- H
C U Q U 0 F- C7 U F-
O a) U U d u U d F- Q U I-
U L I- >+ Q U I- I- 0 F- C7 U C'
a. F- H H- U U CD Q Q CD U CT
F- F- F- U Q F- U d
f-I H F- C7 Q U U I- Q U U U
> L U N I- F- 0 d 1- d U Q U
F- d J U d 0 d Q U d CD F-
W U 0 0 U C7 0 cc C'
C1 U U) C3 C7 C7 C7 C7 I- F- d C'
m v) Q >+d CD d d Q U Q U C7
Q 4 C7 J Q CD C7 C0 Q U C9 C7 0
F- F- U Q C7 U C7 C7 F-
CC) F- C7 U F- U U d Q d
--i U Iv F- U CD U Q U U C7 U
Q 0 J U d u 0 U CD CT C7 I-
U U 0 0 C7 CD F- U
H F- U) 0 U U C7 Q U 0 F- I-
L U >+d I- U CD 0 F- 0 U U
F-Q JQ C7 d d Q U Q U CD
Q U U d U U C'
CI) U >, d 0 0 I- U U I- F- H
--I I- --I C7 I- I- U U H Q U U
H Q C7 0 CD U F- 0 U U d
0 U d co C7 U U U
H Q O CT C' Q I- U 0 d d 0 U
L U III H 0 U U d Q 0 F- 0 C,
F- Q --I Q U U cc 0 d F- U C' 0
U F- 0 U U F- F- U
Ia Q 7 U d u Q U Q Q U d
H 0 CU I- CL 0 CD Q F- 0 U U CD 0
Q U J U O F- U U U U CD U CD F-
U C' Q d U 0 0
d
O O U O U 'O CT Q U Q Q CD H C' C' I-
M N F- L F- %D H 0 U U U d U X Q
.-I J U F- -4 d d U U U Q Q Q
H 0 0 0 I- U Q U
0 Q C I- CI L) U F- C' C7 0 F- co d
k U (1) Q U) d U U co CD F- U X U
CL U Q Q Q 0 U Q Q F- U Q d
-48- 1341607
In Table VI and Figures 5A to 5E, the initial continuous DNA
sequence designates a top strand of 620 bases in what is apparently an
untranslated sequence immediately preceding a translated portion of the
human EPO gene. More specifically, the sequence appears to comprise
the 5' end of the gene which leads up to a translated DNA region coding
for the first four amino acids (-27 through -24) of a leader sequence
("presequence"). Four base pairs in the sequence prior to that encoding
the beginning of the leader have not yet been unambiguously determined
and are therefore designated by an "X" . There then follows an intron of
about 639 base pairs (439 base pairs of which have been sequenced and
the remaining 200 base pairs of which are designated "I.S.") and
immediately preceding a codon for glutamine which has been designated
as residue -23 of the translated polypeptide. The exon sequence
immediately following is seen to code for amino acid residues through an
alanine residue (designated as the +1 residue of the amino acid sequence
of mature human EPO) to the codon specifying threonine at position +26,
whereupon there follows a second intron consisting of 256 bases as
specifically designated. Following this intron is an exon sequence for
amino acid residues 27 through 55 and thereafter a third intron
comprising 612 base pairs commences. The subsequent exon codes for
residues 56 through 115 of human EPO and there then commences a
fourth intron of 134 bases as specified. Following the fourth intron is an
exon coding for residue Nos. 116 through 166 and a "stop" codon (TGA).
Finally, Table VI and Figures 5A to 5E identifies a sequence of 568 base
pairs in what appears to be an untranslated 3' region of the human EPO
gene, two base pairs of which ("X") have not yet been unambiguously
sequenced.
Table VI and Figures 5A to 5E thus serves to identify the primary
structural conformation (amino acid sequence) of mature human EPO as
including 166 specified amino acid residues
-49- 1341607
(estimated M.W. = 18,399). Also revealed in the Table is the DNA
sequence coding for a 27 residue leader sequence along with 5' and 3'
DNA sequences which may be significant to promoter/operator functions
of the human gene operon. Sites for potential glycosylation of the mature
human EPO polypeptide are designated in the Table by asterisks. It is
worthy of note that the specific amino acid sequence of Table VI and
Figures 5A to 5E likely constitutes that of a naturally occurring allelic form
of human erythropoietin. Support for this position is found in the results
of continued efforts at sequencing of urinary isolates of human
erythropoietin which provided the finding that a significant number of
erythropoietin molecules therin have a methionine at residue 126 as
opposed to a serine as shown in the Table.
Table VII, below, illustrates the extent of polypeptide sequence
homology between human and monkey EPO. In the upper continuous line
of the Table, single letter designations are employed to represent the
deduced translated polypeptide sequences of human EPO commencing
with residue -27 and the lower continuous line shows the deduced
polypeptide sequence of monkey EPO commencing at assigned residue
number -27. Asterisks are employed to highlight the sequence
homologies. It should be noted that the deduced human and monkey EPO
sequences reveal an "additional" lysine (K) residue at (human) position
116. Cross-reference to Table VI indicates that this residue is at the
margin of a putative mRNA splice junction in the genomic sequence.
Presence of the lysine residue in the human polypeptide sequence was
further verified by sequencing of a cDNA human sequence clone prepared
from mRNA isolated from COS-1 cells transformed with the human
genomic DNA in Example 7, infra.
1341607
50 -
Y * Y W * W
F- * F- Y I
p p Of * C3
a a Q* Q
> * > 0 * 0
O 1- J J
H * H Q Q
Z* Z 0a CC
w * w i J J
Z * Z J * J
J * J 1- *
U * U J H
S (n V) * V)
N W * W Cr it
U) O Q U) J
MU* U C7* C.7
=~ U * C7 O (1 * V)
H f O > H
I- * F- =-4 Q Q
O H > Y * Y
Z * Z O * p
w * w > S
r-I Q Q S* S tx* !r
O W* W J* J * p
a O Y Y C3' Of C7 * 0
CVQ * Q J J H w
o w* w oa* a w* a
a J* J CT W* W U* U
W J* J 3 Lt. OQ*
>-* a* a %OW* W
* [r Of * Or .-C C' * 0
I- * I-
U) W * w V) * (n
H~ 1 J* J V)* V) >'* >
H C >* > Z* Z J* J
> O OC>!* Cr > Q Y Y
f "i V) * V) J* J J* J
W 0* 0 0 J > Y Y
'O U* U 0 Q* Q 0 * 0
m C H* H 0* C3 OW a'
Q CO J* J 0* 0 L (*% J
a * tr w (r r-1 LL- L -
C a* a J* J Z* Z
CO a * a > * > V) V)
E '-I Q* Q Q* Q >- * >-
+ 0 * 0 W * W > * >
S J a (n* V) a w
> * > 0 J * J LL LL-
4- a* a N J* J J J
O J* J Q Q o Y Y
C7* 0 J* J -7w u
C J * J 0 * 0 r1 LL * LL
O a * a C3' * 0' I- * !-
N J* J 3* 3 p* 0
=-4 0 V) * V) > * > Q
J > W * W F- *
CO I J* J > > H* H
V) * V) Q * Q F- *
E J* J 0 C3' * Of c* IY
O J* J '.0 '* Of 0J* J
U J* J 0 * 0 na* a
3* 3 >* > r-ICC * Q
J* J W* W Q* Q
3 S Z V)* V)
CVCL * a Y Y Q Q
1 U* U 3* 3 0* 0
W* W 0Q* Q CLa
S S L[1 * >- a J
> * > LL * LL 0 Cn * V)
C~ * C7 Z * Z CV H H
> * > -i Q * Q
C () C U) C U)
CO -Y CO -Y CO .Y
C E C E C
7 O 7 O 0
S S S f S S
1341607
51 -
EXAMPLE 6
The expression system selected for initial
attempts at microbial synthesis of isolatable quantities
of EPO polypeptide material coded for by the monkey cDNA
provided by the procedures of Example 3 was one involving
mammalian host cells (i.e., COS-1 cells, A.T.C.C. No.
CRL-1650). The cells were transfected with a "shuttle"
vector capable of autonomous replication in E.coli host
(by virtue of the presence of pBR322-derived DNA) and the
mammalian hosts (by virtue of the presence of SV4O virus-
derived DNA).
More specifically, an expression vector was
constructed according to the following procedures. The
plasmid clone 83 provided in Example 3 was amplified in
E.coli and the approximately 1.4kb monkey EPO-encoding
DNA was isolated by EcoRI and Hindlll digestion.
Separately isolated was an approximately 4.0 kb,
Hindlll/Sall fragment from pBR322. An approximately 30
bp, EcoRI/SalI "linker" fragment was obtained from
M13mplO RF DNA (P and L Laboratories). This linker
included, in series, an EcoRI sticky end, followed by
SstI, Smal, BamHI and XbaI recognition sites and a Sall
sticky end. The above three fragments were ligated to
provide an approximately 5.4 kb intermediate plasmid
("pERS") wherein the EPO DNA was flanked on one side by a
"bank" of useful restriction endonuclease recognition
sites. pERS was then digested with Hindlll and Sall to
yield the EPO DNA and the EcoRI to Sall (M13mplO) linker.
The 1.4 kb fragment was ligated with an approximately 4.0
kb BamHI/SalI of pBR322 and another M13mpiO HindIII/BamHI
RF fragment linker also having approximately 30 bp. The
M13 linker fragment was characterized by a Hindlll sticky
end, followed by PstI, Sall, XbaI recognition sites and a
BamHI sticky end. The ligation product was, again, a
useful intermediate plasmid ("pBR-EPO") including the EPO
DNA flanked on both sides by banks of restriction site.
1341607
52 -
The vector chosen for expression of the EPO DNA
in COS-1 cells ("pDSVLl") had previously been constructed
to allow for selection and autonomous replication in
E.coli. These characteristics are provided by the origin
of replication and Ampicillin resistance gene DNA sequen-
ces present in the region spanning nucleotides 2448
through 4362 of pBR322. This sequence was structurally
modified by the addition of a linker providing a Hindlll
recognition immediately adjacent nucleotide 2448 prior to
incorporation into the vector. Among the selected vec-
tor's other useful properties was the capacity to autono-
mously replicate in COS-1 cells and the presence of a
viral promoter sequence functional in mammalian cells.
These characteristics are provided by the origin of
replication DNA sequence and "late gene" viral promoter
DNA sequence present in the 342 bp sequence spanning
nucleotide numbers 5171 through 270 of the SV40 genome.
A unique restriction site (BamHI) was provided in the
vector and immediately adjacent the viral promoter
sequence through use of a commercially available linker
sequence (Collaborative Research). Also incorporated in
the vector was a 237 base pair sequence (derived as
nucleotide numbers 2553 through 2770 of SV40) containing
the "late gene" viral mRNA polyadenylation signal
(commonly referred to as a transcription terminator).
This fragment was positioned in the vector in the proper
orientation vis-a-vis the "late gene" viral promoter via
the unique BamHI site. Also present in the vector was
another mammalian gene at a location not material to
potential transcription of a gene inserted at the unique
BamHI site, between the viral promoter and terminator
sequences. [The mammalian gene comprised an approxima-
tely 2,500 bp mouse dihydrofolate reductase (DHFR) mini-
gene isolated from plasmid pMG-1 as in Gasser, et al.,
P.N.A.S. (U.S.A.), 79, pp. 6522-6526, (1982).] Again,
_ .... q. .....h ,,.-H .. ..
1341607
-53-
the major operative components of plasmid pDSVL1 comprise nucleotides
2448 through 4362 of pBR322 along with nucleotides 5171 through 270
(342bp) and 2553 through 2770 (237bp) of SV40 DNA.
Following procedures described, e.g., in Maniatis, et al., supra the
EPO-encoding DNA was isolated from plasmid pBR-EPO as a BamHI
fragment and ligated into plasmid pDSVL1 cut with BamHI. Restriction
enzyme analysis was employed to confirm insertion of the EPO genes in
the correct orientation in two of the resulting cloned vectors (duplicate
vectors H and Q. See Figure 2, illustrating plasmid pDSVL-MkE. Vectors
with EPO genes in the wrong orientation (vectors F, X and G) were saved
for use as negative controls in transfection experiments designed to
determine EPO expression levels in hosts transformed with vectors having
EPO DNA in the correct orientation.
Vectors H, L, F, X and G were combined with carrier DNA (mouse
liver and spleen DNA) were employed to transfect duplicate 60mm plates
by calcium phosphate microprecipitate methods. Duplicate 60 mm plates
were also transfected with carrier DNA as a "mock" transformation
negative control. After five days all culture media were tested for the
presence of polypeptides possessing the immunological properties of
naturally-occurring EPO.
EXAMPLE 7
A. Initial EPO Expression System
Involving COS-1 Cells
The system selected for initial attempts at microbial synthesis of
isolatable quantities of human EPO polypeptide material coded for by the
human genomic DNA EPO clone, also involved expression in mammalian
host cells (i.e., COS-1 cells, A.T.C.C. No. CRL-1650). The
1341607
54
human EPO gene was first sub-cloned into a "shuttle" vec-
tor which is capable of autonomous replication in both
E.coli hosts (by virtue of the presence of pBR322 derived
DNA) and in the mammalian cell line COS-1 (by virtue of
the presence of SV40 virus derived DNA). The shuttle
vector, containing the EPO gene, was then transfected
into COS-1 cells. EPO polypeptide material was produced
in the transfected cells and secreted into the cell
culture media.
More specifically, an expression vector was
constructed according to the following procedures. DNA
isolated from lambda clone AhEl, containing the human
genomic EPO gene, was digested with BamHI and Hindlll
restriction endonucleases, and a 5.6 Kb DNA fragment
known to contain the entire EPO gene was isolated. This
fragment was mixed and ligated with the bacterial plasmid
pUC8 (Bethesda Research Laboratories, Inc.) which had
been similarly digested, creating the intermediate
plasmid "pUC8-HuE", providing a convenient source of this
restriction fragment.
The vector chosen for expression of the EPO DNA
in COS-1 cells (pSV4SEt) had previously been constructed.
Plasmid pSV4SEt contained DNA sequences allowing selec-
tion and autonomous replication in E.coli. These charac-
teristics are provided by the origin of replication and
Ampicillin resistance gene DNA sequences present in the
region spanning nucleotides 2448 through 4362 of the bac-
terial plasmid pBR322. This sequence was structurally
modified by the addition of a linker providing a Hindlil
recognition site immediately adjacent to nucleotide 2448.
Plasmid pSV4SEt was also capable of autonomous replica-
tion in COS-1 cells. This characteristic was provided by
a 342 bp fragment containing the SV40 virus origin of
replication (nucleotide numbers 5171 through 270). This
fragment had been modified by the addition of a linker
providing an EcoRl recognition site adjacent to
13 41 607
55 -
nucleotide 270 and a linker providing a Sall recognition
site adjacent nucleotide 5171. A 1061 bp fragment of
SV40 was also present in this vector (nucleotide numbers
1711 through 2772 plus a linker providing a Sall recogni-
tion site next to nucleotide number 2772). Within this
fragment was an unique BamHI recognition sequence. In
summary, plasmid pSV4SEt contained unique BamHI and
Hindlll recognition sites, allowing insertion of the
human EPO gene, sequences allowing replication and selec-
tion in E.coli, and sequences allowing replication in
COS-1 cells.
In order to insert the EPO gene into pSV4SEt,
plasmid pUC8-HuE was digested with BamHl and HindIll
restriction endonucleases and the 5.6 kb EPO encoding DNA
fragment isolated. pSV4SEt was also digested with BamHl
and Hindlll and the major 2513 bp fragment isolated
(preserving all necessary functions). These fragments
were mixed and ligated, creating the final vector
I$ pSVgHuEPO', . (See, Figure 3.) This vector was propa-
gated in E.coli and vector DNA isolated. Restriction
enzyme analysis was employed to confirm insertion of the
EPO gene.
Plasmid pSVgHuEPO DNA was used to express human
EPO polypeptide material in COS-1 cells. More specifi-
cally, pSVgHuEPO DNA was combined with carrier DNA and
transfected into triplicate 60 mm plates of COS-1 cells.
As a control, carrier DNA alone was also transfected into
COS-1 cells. Cell culture media were sampled five and
seven days later and tested for the presence of polypep-
tides possessing the immunological properties of
naturally occurring human EPO.
B. Second EPO Expression System
Involving COS-1 Cells
Still another system was designed to provide
improved production of human EPO polypeptide material
- 56 - 13 41 607
coded by the human genomic DNA EPO clone in COS-1 cells
(A.T.C.C. No. CRL-1650).
In the immediately preceding system, EPO was
expressed in COS-1 cells using its own promoter which is
within the 5.6 Kb BamHI to HindIII restriction fragment.
In the following construction, the EPO gene is altered so
that it is expressed using the SV40 late promoter.
More specifically, the cloned 5.6 Kb BamHI to
Hindlll genomic human EPO restriction fragment was
modified by the following procedures. Plasmid pUC8-HuE,
as described above, was cleaved with BamHI and with
BstEII restriction endonucleases. BstEII cleaves within
the 5.6 Kb EPO gene at a position which is 44 base pairs
5' to the initiating ATG coding for the pre-peptide and
approximately 680 base pairs 3' to the Hindlll restric-
tion site. The approximately 4900 base pair fragment was
isolated. A synthetic linker DNA fragment, containing
SalI and BstEII sticky ends and an internal BamHI
recognition site was synthesized and purified. The two
fragments were mixed and ligated with plasmid pBR322
which had been cut with SalI and BamHI to produce the
intermediate plasmid pBRgHE. The genomic human EPO gene
can be isolated therefrom as a 4900 base pair BamHI
digestion fragment carrying the complete structural gene
with a single ATG 44 base pairs 3' to BamHI site adjacent
the amino terminal coding region.
This fragment was isolated and inserted as a
BamHI fragment into BamHI cleaved expression vector
plasmid pDSVL1 (described in Example 6). The resulting
plasmid, pSVLgHuEPO, as illustrated in Figure 4, was used
to express EPO polypeptide material from COS-1 cells, as
described in Examples 6 and 7A.
EXAMPLE 8
Culture media from growth of the six transfected
COS-1 cultures of Example 6 were analyzed by radioim-
13 41 607
57 -
munoassay according to the procedures set forth in
Example 2, Part B. Each sample was assayed at 250, 125,
50, and 25 microliter aliquot levels. Supernatants from
growth of cells mock transfected or transfected with vec-
tors having incorrect EPO gene orientation were unam-
biguously negative for EPO immunoreactivity. For each
sample of the two supernatants derived from growth of
COS-1 cells transfected with vectors (H and L) having the
EPO DNA in the correct orientation, the % inhibition of
1251-EPO binding to antibody ranged from 72 to 88%, which
places all values at the top of the standard curve. The
exact concentration of EPO in the culture supernatant
could not then reliably be estimated. A quite conser-
vative estimate of 300 mU/ml was made, however, from the
value calculation of the largest aliquot size (250
microliter).
A representative culture fluid according to
Example 6 and five and seven day culture fluids obtained
according to Example 7A were tested in the RIA in order
to compare activity of recombinant monkey and human EPO
materials to a naturally-occurring human EPO standard and
the results are set out in graphic form in Figure 1.
Briefly, the results expectedly revealed that the recom-
binant monkey EPO significantly competed for anti-human
EPO antibody although it was not able to completely inhi-
bit binding under the test conditions. The maximum per-
cent inhibition values for recombinant human EPO,
however, closely approximated those of the human EPO
standard. The parallel nature of the dose response
curves suggests immunological identity of the sequences
(epitopes) in common. Prior estimates of monkey EPO in
culture fluids were re-evaluated at these higher dilution
levels and were found to range from 2.91 to 3.12 U/ml.
Estimated human EPO production levels were correspon-
dingly set at 392 mU/ml for the five-day growth sample
1341607
- 58 -
and 567 mU/ml for the seven day growth sample. Estimated
monkey EPO production levels in the Example 78 expression
system were on the same order or better.
EXAMPLE 9
Culture fluids prepared according to Examples 6
and 7 were subjected to an in vitro assay for EPO acti-
vity according to the procedure of Goldwasser, et al.,
Endocrinology, 97, 2, pp. 315-323 (1975). Estimated
monkey EPO values for culture fluids tested ranged from
3.2 to 4.3 U/ml. Human EPO culture fluids were also
active in this in vitro assay and, further, this activity
could be neutralized by anti-EPO antibody. The recom-
binant monkey EPO culture fluids according to Example 6
were also subjected to an assay for in vivo biological
activity according to the general procedures of Cotes, et
al., Nature, 191, pp. 1065-1067 (1961) and Hammond, et
al., Ann.N.Y.Acad.Sci., 149, pp. 516-527 (1968) and acti-
vity levels ranged from 0.94 to 1.24 U/ml.
EXAMPLE 10
In the previous examples, recombinant monkey or
human EPO material was produced from vectors used to
transfect COS-1 cells. These vectors replicate in COS-1
cells due to the presence of SV40 T antigen within the
cell and an SV40 origin of replication on the vectors.
Though these vectors produce useful quantities of EPO in
COS-1 cells, expression is only transient (7 to 14 days)
due to the eventual loss of the vector. Additionally,
only a small percentage of COS-1 became productively
transfected with the vectors. The present example
describes expression systems employing Chinese hamster
ovary (CHO) DHFR- cells and the selectable marker, DHFR.
[For discussion of related expression systems, see
1341 607
59 -
U.S. Letters Patent No. 4,399,216 and European Patent
Applications 117058, 117059 and 117060, all published
August 29, 1984.
CHO DHFR- cells (DuX-Bll) CHO Kl cells, Urlaub,
et al., Proc. Nat. Acad. Sci. (U.S.A.), Vol. 77, 4461
(1980) lack the enzyme dihydrofolate reductase (DHFR) due
to mutations in the structural genes and therefore
require the presence of glycine, hypoxanthine, and thymi-
dine in the culture media. Plasmids pDSVL-MkE (Example
6) or pDSVL-gHuEPO (Example 7B) were transfected along
with carrier DNA into CHO DHFR- cells growing in media
containing hypoxanthine, thymidine, and glycine in 60 mm
culture plates. Plasmid pSVgHuEPO (Example 7A) was mixed
with the plasmid pMG2 containing a mouse dihydrofolate
reductase gene cloned into the bacterial plasmid vector
pBR322 (per Gasser, et al., supra.) The plasmid mixture
and carrier DNA was transfected into CHO DHFR- cells.
(Cells which acquire one plasmid will generally also
acquire a second plasmid). After three days, the cells
were dispersed by trypsinization into several 100 mm
culture plates in media lacking hypoxanthine and thymi-
dine. Only those cells which have been stably trans-
formed with the DHFR gene, and thereby the EPO gene,
survive in this media. After 7-21 days, colonies of sur-
viving cells became apparent. These transformant colo-
nies, after dispersion by trypsinization can be
continuously propagated in media lacking hypoxanthine and
thymidine, creating new cell strains (e.g., CHO
pDSVL-MkEPO, CHO pSVgHuEPO, CHO-pDSVL-gHuEPO).
Culture fluids from the above cell strains were
tested in the RIA for the presence of recombinant monkey
or human EPO. Media for strain CHO pDSVL-MkEPO contained
EPO with immunological properties like that obtained from
COS-1 cells transfected with plasmid pDSVL-MkEPO. A
representative 65 hour culture fluid contained monkey EPO
at 0.60 U/ml.
13 41 607
60 -
Culture fluids from CHO pSVgHuEPO and CHO
pDSVL-gHuEPO contained recombinant human EPO with immuno-
logical properties like that obtained with COS-1 cells
transfected with plasmid pSVgHuEPO or pDSVL-gHuEPO. A
representative 3 day culture fluid from CHO pSVgHuEPO
contained 2.99 U/ml of human EPO and a 5.5 day sample
from CHO pDSVL-gHuEPO had 18.2 U/ml of human EPO as
measured by the RIA.
The quantity of EPO produced by the cell strains
described above can be increased by gene amplification
giving new cell strains of greater productivity. The
enzyme dihydrofolate reductase (DHFR) which is the pro-
duct coded for by the DHFR gene can be inhibited by the
drug methotrexate (MTX). More specifically, cells propa-
gated in media lacking hypoxanthine and thymidine are
inhibited or killed by MTX. Under the appropriate con-
ditions, (e.g., minimal concentrations of MTX) cells
resistant to and able to grow in MTX can be obtained.
These cells are found to be resistent to MTX due to an
amplification of the number of their DHFR genes, result-
ing in increased production of DHFR enzyme. The sur-
viving cells can, in turn, be treated with increasing
concentrations of MTX, resulting in cell strains con-
taining greater numbers of DHFR genes. "Passenger genes"
(e.g., EPO) carried on the expression vector along with
the DHFR gene or transformed with the DHFR gene are fre-
quently found also to be increased in their gene copy
number.
As examples of practice of this amplification
system, cell strain CHO pDSVL-MkE was subjected to
increasing MTX concentrations (0 nM, 30 nM and 100 nM).
Representative 65-hour culture media samples from each
amplification step were assayed by RIA and determined to
contain 0.60, 2.45 and 6.10 U/ml, respectively. Cell
strain CHO pDSVL-gHuEPO was subjected to a series of
increasing MTX concentrations of 30 nM, 50 nM, 100 nM,
- 61 13 41 607
-
200 nM, 1 tM, and 5 pM MTX. A representative 3-day
culture media sample from the 100 nM MTX step contained
human EPO at 3089 129 u/ml as judged by RIA.
Representative 48 hour cultural medium samples from the
100 nM and 1 UM MTX steps contained, respectively, human
EPO at 466 and 1352 U/mi as judged by RIA (average of
triplicate assays). In these procedures, 1 x 106 cells
were plated in 5 ml of media in 60 mm culture dishes.
Twenty-four hours later the media were removed and
replaced with 5 ml of serum-free media (high glucose DMEM
supplemented with 0.1 mM non-essential amino acids and
L-glutamine). EPO was allowed to accumulate for 48 hours
in the serum-free media. The media was collected for RIA
assay and the cells were trypsinized and counted. The
average RIA values of 467 U/ml and 1352 U/mi for cells
grown at 100 nM and 1 UM MTX, respectively, provided
actual yields of 2335 U/plate and 6750 U/plate. The
average cell numbers per plate were 1.94 x 106 and
3.12 x 106 cells, respectively. The effective production
rates for these culture conditions were thus 1264 and
2167 U/106 cells/48 hours.
The cells in the cultures described immediately
above are a genetically heterogeneous population.
Standard screening procedures are being employed in an
attempt to isolate genetically hemogeneous clones with
the highest production capacity. See, Section A, Part 2,
of "Points to Consider in the Characterization of Cell
Lines Used to Produce Biologics", June 1, 1984, Office of
Biologics Research Review, Center for Drugs and
Biologics, U.S. Food and Drug Administration.
The productivity of the EPO producing CHO cell
lines described above can be improved by appropriate cell
culture techniques. The propagation of mammalian cells
in culture generally requires the presence of serum in
the growth media. A method for production of erythro-
poietin from CHO cells in media that does not contain
1341607
- 62 -
serum greatly facilitates the purification of erythro-
poietin from the culture medium. The method described
below is capable of economically producing erythropoietin
in serum-free media in large quantities sufficient for
production.
Strain CHO pOSVL-gHuEPO cells, grown in standard
cell culture conditions, are used to seed spinner cell
culture flasks. The cells are propagated as a suspension
cell line in the spinner cell culture flask in media con-
sisting of a 50-50 mixture of high glucose DMEM and Ham's
F12 supplemented with 5% fetal calf serum, L-gluta-
mine, Penicillin and Streptomycin, 0.05 mM non-essential
amino acids and the appropriate concentration of metho-
trexate. Suspension cell culture allows the EPO-produc-
ing CHO cells to be expanded easily to large volumes.
CHO cells, grown in suspension, are used to seed roller
bottles at an initial seeding density of 1.5 x 107 viable
cells per 850 cm2 roller bottle in 200 ml of media. The
cells are allowed to grow to confluency as an adherent
cell line over a three-day period. The media used for
this phase of the growth is the same as used for growth
in suspension. At the end of the three-day growth
period, the serum containing media is removed and
replaced with 100 ml of serum-free media; 50-50 mixture
of high glucose DMEM and Ham's F12 supplemented with 0.05
mM non-essential amino acids and L-glutamine. The
roller bottles are returned to the roller bottle incuba-
tor for a period of 1-3 hours and the media again is
removed and replaced with 100 ml of fresh serum-free
media. The 1-3 hour incubation of the serum-free media
reduces the concentration of contaminating serum pro-
teins. The roller bottles are returned to the incubator
for seven days during which erythropoietin accumulates in
the serum-free culture media. At the end of the seven-
day production phase, the conditioned media is removed
and replaced with fresh serum-free medium for a second
13 4 1 6 0 7
- 63 -
production cycle. As an example of the practice of this
production system, a representative seven-day, serum-free
media sample contained human erythropoietin at 3892 409
U/ml as judged by the RIA. Based on an estimated cell
density of 0.9 to 1.8 x 105 cells/cm2, each 850
cm2 roller bottle contained from 0.75 to 1.5 x 108 cells
and thus the rate of production of EPO in the 7-day, 100
ml culture was 750 to 1470 U/106 cells/48 hours.
Culture fluids from cell strain CHO pDSVL-MkEPO
carried in 10 nM MTX were subjected to RIA in vitro and
in vivo EPO activity assays. The conditioned media
sample contained 41.2 t 1.4 U/ml of MkEPO as measured by
the RIA, 41.2 0.064 U/mi as measured by the in vitro
biological activity assay and 42.5 5 U/ml as measured
by the in vivo biological activity assay. Amino acid
sequencing of polypeptide products revealed the presence
of EPO products, a principle species having 3 residues of
the "leader" sequence adjacent the putative amino ter-
minal alanine. Whether this is the result of incorrect
membranc processing of the polypeptide in CHO cells or
reflects a difference in structure of the amino terminus
of monkey EPO vis-a-vis human EPO, is presently unknown.
Culture fluids from cell strain CHO pDSVL-gHuEPO
were subjected to the three assays. A 5.5 day sample
contained recombinant human EPO in the media at a level
of 18.2 U/ml by RIA assay, 15.8 4.6 U/ml by in vitro
assay and 16.8 3.0 U/ml by in vivo assay.
Culture fluid from CHO pDSVL-gHuEPO cells pre-
pared amplified by stepwise 100 nM MTX were subjected to
the three assays. A 3.0 day sample contained recombinant
human EPO at a level of 3089 129 U/ml by RIA, 2589
71.5 U/mi by in vitro assay, and 2040 160 U/ml by in
vivo assay. Amino acid sequencing of this product
reveals an amino terminal corresponding to that
designated in Table VI.
Cell conditioned media from CHO cells trans-
fected with piasmid pDSVL-MkE in 10 nM MTX were pooled,
13 4 1607
- 64 -
and the MTX dialyzed out over several days, resulting in
media with an EPO activity of 221 + 5.1 U/ml (EPO-CCM).
To determine the in vivo effect of the EPO-CCM upon hema-
tocrit levels in normal Balb/C mice, the following
experiment was conducted. Cell conditioned media from
untransfected CHO cells (CCM) and EPO-CCM were adjusted
with PBS. CCM was used for the control group (3 mice)
and two dose levels of EPO-CCM -- 4 units per injection
and 44 units per injection -- were employed for the
experimental groups (2 mice/group). Over the course of 5
weeks, the seven mice were injected intraperitoneally, 3
times per week. After the eighth injection, average
hematocrit values for the control group were determined
to be 50.4%; for the 4U group, 55.1%; and, for the 44U
group, 67.9%.
Mammalian cell expression products may be
readily recovered in substantially purified form from
culture media using HPLC (C4) employing an ethanol gra-
dient, preferably at pH7.
A preliminary attempt was made to characterize
recombinant glycoprotein products from conditioned medium of
COS-1 and CHO cell expression of the human EPO gene in
comparison to human urinary EPO isolates using both
Western blot analysis and SDS-PAGE. These studies indi-
cated that the CHO-produced EPO material had a somewhat
higher molecular weight than the COS-1 expression product
which, in turn, was slightly larger than the pooled
source human urinary extract. All products were somewhat
heterogeneous. Neuraminidase enzyme treatment to remove
sialic acid resulted in COS-1 and CHO recombinent pro-
ducts of approximately equal molecular weight which were
both nonetheless larger than the resulting asialo human
urinary extract. Endoglycosidase F enzyme (EC 3.2.1)
treatment of the recombinant CHO product and the urinary
extract product (to totally remove carbohydrate from
1341607
65 -
both) resulted in substantially homogeneous products
having essentially identical molecular weight charac-
teristics.
Purified human urinary EPO and a recombinant,
CHO cell-produced, EPO according to the invention were
subjected to carbohydrate analysis according to the pro-
cedure of Ledeen, et al. Methods in Enzymology,
83(Part D), 139-191 (1982) as modified through use of the
hydrolysis procedures of Nesser, et al., Anal.Biochem.,
142, 58-67 (1984). Experimentally determined car-
bohydrate constitution values (expressed as molar ratios
of carbohydrate in the product) for the urinary isolate
were as follows: Hexoses, 1.73; N-acetylglucosamine, 1;
N-acetylneuraminic acid, 0.93; Fucose, 0; and N-acetyl-
galactosamine, 0. Corresponding values for the recom-
binant product (derived from CHO pDSVL-gHuEPO 3-day
culture media at 100 nM MTX) were as follows: Hexoses,
15.09; N-acetylglucosamine, 1; N-acetylneuraminic acid,
0.998; Fucose, 0; and N-acetylgalactosamine, 0. These
findings are consistent with the Western blot and
SDS-PAGE analysis described above.
Glycoprotein products provided by the present
invention are thus comprehensive of products having a
primary structural conformation sufficiently duplicative
of that of a naturally-occurring erythropoietin to allow
possession of one or more of the biological properties
thereof and having an average carbohydrate composition
which differs from that of naturally-occurring erythro-
poietin.
EXAMPLE 11
The present example relates to the total manu-
facture by assembly of nucleotide bases of two structural
genes encoding the human species EPO sequence of Table VI
and incorporating, respectively "preferred" codons for
expression in E.coli and yeast (S.cerevisiae) cells.
-66- 1341607
Also described is the construction of genes encoding analogs of human
EPO. Briefly stated, the protocol employed was generally as set out in the
previously noted disclosure of Alton, et al. (WO 83/04053). The genes
were designed for initial assembly of component oligonucleotides into
multiple duplexes which, in turn, were assembled into three discrete
sections. These sections were designed for ready amplification and, upon
removal from the amplification system, could be assembled sequentially
or through a multiple fragment ligation in a suitable expression vector.
Tables VIII through XIV below and Figure 6 illustrate the design and
assembly of a manufactured gene encoding a human EPO translation
product lacking any leader or presequence but including an initial
methionine residue at position -1. Moreoever, the gene incorporated in
substantial part E.coli preference codons and the construction was
therefore referred to as the ""ECEPO" gene.
-67- 1341607
TABLE VIII
ECEPO SECTION 1 OLIGONUCLEOTIDES
1. AATTCTAGAAACCATGAGGGTAATAAAATA
2. CCATTATTTTATTACCCTCATGGTTTCTAG
3. ATGGCTCCGCCGCGTCTGATCTGCGAC
4. CTCGAGTCGCAGATCAGACGCGGCGGAG
5. TCGAGAGTTCTGGAACGTTACCTGCTG
6. CTTCCAGCAGGTAACGTTCCAGAACT
7. GAAGCTAAAGAAGCTGAAAACATC
8. GTGGTGATGTTTTCAGCTTCTTTAG
9. ACCACTGGTTGTGCTGAACACTGTTC
10. CAAAGAACAGTGTTCAGCACAACCA
11. TTTGAACGAAAACATTACGGTACCG
12. GATCCGGTACCGTAATGTTTTCGTT
TABLE IX
ECEPO SECTION 1
XbaI
EcoRI 1 3
AATTCTAG AAACCATGAG GGTAATAAAA TA TGGCTCC GCCGCGTCTG
GATC TTTGGTACTC CCATTATTTT ATTAC GAGG CGGCGCAGAC
2 4
5
ATCTGCGAC CGAGAGTTCT GGAACGTTAC CTGCTG AAG CTAAAGAAGC
TAGACGCTGA GCTC CAAGA CCTTGCAATG GACGACCTT GATTTCTTCG
6
7 9 11
TGAAAACATC CCACTGGTT GTGCTGAACA CTGTTC TTG AACGAAAACA
ACTTTTGTAG GGTG CCAA CACGACTTGT GACAAGAAAC TTGCTTTTGT
8 10
KpnI BamHI
TTACGGTACC G
AATGCCATGG CCTAG
12
1 I i
13 41 607
- 68 -
TABLE X
ECEPO SECTION 2 OLIGONUCLEOTIDES
1. AATTCGGTACCAGACACCAAGGT
2. GTTAACCTTGGTGTCTGGTACCG
3. TAACTTCTACGCTTGGAAACGTAT
4. TTCCATACGTTTCCAAGCGTAGAA
5. GGAAGTTGGTCAACAAGCAGTTGAAGT
6. CCAAACTTCAACTGCTTGTTGACCAAC
7. TTGGCAGGGTCTGGCACTGCTGAGCG
8. GCCTCGCTCAGCAGTGCCAGACCCTG
9. AGGCTGTACTGCGTGGCCAGGCA
10. GCAGTGCCTGGCCACGCAGTACA
11. CTGCTGGTAAACTCCTCTCAGCCGT
12. TTCCCACGGCTGAGAGGAGTTTACCA
13. GGGAACCGCTGCAGCTGCATGTTGAC
14. GCTTTGTCAACATGCAGCTGCAGCGG
15. AAAGCAGTATCTGGCCTGAGATCTG
16. GATCCAGATCTCAGGCCAGATACT
-69- 1341607
E
ca
fuo m U
C7U 40
C~ U U
I--Q OC7 F I C7U
Q F- 0 O H ¾ F1 F- Q
F-Q QH 0u Au C7
C7O C7O OU I-Q
UC7 I-Q UC7 ¾I-
QF- UC7 0U C.7U
CDO ¾F- ¾F-
QI- cc u0 0u
Q F-
C7O OC7 ¾ I-Q
DU QF- UDI O W OW
MIF-¾~I 0U u0 CDU1%0I
O C7 0 O U 0 u1IC7 U '-I
0U F-Q f-Q IF-Q
N Q F- H Q Q F- .-I I- Q
C7O '-1Q Q
O U C7 ^ IC7 U Q I- F- Q
' I II F-¾ 0U I-¾ C0U
X H F- Q H 0 O
C7 U f- C7 U
U Ii U C7 U U C7
C7 U U C7 Q F-
F- Q C7 U Q F-
Q F- ¾ F-
F- Q U U C7
C7 U Q F- ¾ F--
Q F- U C7 C7 U
¾F- 0U F-Q
U U U U F- Q
U 0 F- Q I- C7 U
r-4IU0NI CIU U0 Q¾
QF- QF- 000OI UC7
C0U UC7 000--4 (DO
Q F- 0 O O\IF- Q F- Q
¾F- CDO UC7
O C7 ¾ F- 00
C7 U
Ccr OW DU ¾F--I
L) C3
F- ¾ F- F- ¾ MU Ca ~--I
Y C7 U N I¾ F- \O I U C7 '-1 ~C7 U
C7U OC7 Q I- F-Q
OU I-¾ F- <C u0
H F- 0 U 0 U 0 O
F- 0U F- OW
OQ I-¾ OW U
U I- Q C7 O Q
W Q C7O C7U C:r
- 70 13 41 607
-
TABLE XII
ECEPO SECTION 3
1. GATCCAGATCTCTGACTACTCTGC
2. ACGCAGCAGAGTAGTCAGAGATCTG
3. TGCGTGCTCTGGGTGCACAGAAAGAGG
4. GATAGCCTCTTTCTGTGCACCCAGAGC
5. CTATCTCTCCGCCGGATGCTGCATCT
6. CAGCAGATGCAGCATCCGGCGGAGA
7. GCTGCACCGCTGCGTACCATCACTG
8. ATCAGCAGTGATGGTACGCAGCGGTG
9. CTGATACCTTCCGCAAACTGTTTCG
10. ATACACGAAACAGTTTGCGGAAGGT
11. TGTATACTCTAACTTCCTGCGTGGTA
12. CAGTTTACCACGCAGGAAGTTAGAGT
13. AACTGAAACTGTATACTGGCGAAGC
14. GGCATGCTTCGCCAGTATACAGTTT
15. ATGCCGTACTGGTGACCGCTAATAG
16. TCGACTATTAGCGGTCACCAGTAC
- 71 1341607
-
TABLE XIII
ECEPO SECTION 3
BamHI BglII
GA TCCAGATCTCTG
GTCTAGAGAC
1 3 5
ACTACTCTGC GCGTGCTCT GGGTGCACAG AAAGAGG TA TCTCTCCGCC
TGATGAGACG CGC GAGA CCCACGTGTC TTTCTCCGAT A GAGGCGG
2 4
7 9
GGATGCTGCA TCT CTGCAC CGCTGCGTAC CATCACTG T GATACCTTCC
CCTACGACGT AGA GAC TG GCGACGCATG GTAGTGACGA CT TGGAAGG
6 8
11 13
GCAAACTGTT TCG GTATAC TCTATCTTCC TGCGTGGTA ACTGAAACTG
CGTTTGACAA AGCACATA G AGATTGAAGG ACGCACCAT TGA TTGAC
10 12
Sall
TATACTGGCG AAGC TGCCG TACTGGTGAC CGCTAATAG
ATATGACCGC TTCG CG ATGACCACTG GCGATTATC AGCT
15 14 16
13 41 607
- 72 -
TABLE XIV
ECEPO GENE
-1 1
XbaI MetAla
CTAG AAACCATGAG GGTAATAAAA TAATGGCTCC GCCGCGTCTG
TTTGGTACTC CCATTATTTT ATTACCGAGG CGGCGCAGAC
ATCTGCGACT CGAGAGTTCT GGAACGTTAC CTGCTGGAAG CTAAAGAAGC
TAGACGCTGA GCTCTCAAGA CCTTGCAATG GACGACCTTC GATTTCTTCG
TGAAAACATC ACCACTGGTT GTGCTGAACA CTGTTCTTTG AACGAAAACA
ACTTTTGTAG TGGTGACCAA CACGACTTGT GACAAGAAAC TTGCTTTTGT
TTACGGTACC AGACACCAAG GTTAACTTCT ACGCTTGGAA ACGTATGGAA
AATGCCATGG TCTGTGGTTC CAATTGAAGA TGCGAACCTT TGCATACCTT
GTTGGTCAAC AAGCAGTTGA AGTTTGGCAG GGTCTGGCAC TGCTGAGCGA
CAACCAGTTG TTCGTCAACT TCAAACCGTC CCAGACCGTG ACGACTCGCT
GGCTGTACTG CGTGGCCAGG CACTGCTGGT AAACTCCTCT CAGCCGTGGG
CCGACATGAC GCACCGGTCC GTGACGACCA TTTGAGGAGA GTCGGCACCC
AACCGCTGCA GCTGCATGTT GACAAAGCAG TATCTGGCCT GAGATCTCTG
TTGGCGACGT CGACGTACAA CTGTTTCGTC ATAGACCGGA CTCTAGAGAC
ACTACTCTGC TGCGTGCTCT GGGTGCACAG AAAGAGGCTA TCTCTCCGCC
TGATGAGACG ACGCACGAGA CCCACGTGTC TTTCTCCGAT AGAGAGGCGG
GGATGCTGCA TCTGCTGCAC CGCTGCGTAC CATCACTGCT GATACCTTCC
CCTACGACGT AGACGACGTG GCGACGCATG GTAGTGACGA CTATGGAAGG
GCAAACTGTT TCGTGTATAC TCTAACTTCC TGCGTGGTAA ACTGAAACTG
CGTTTGACAA AGCACATATG AGATTGAAGG ACGCACCATT TGACTTTGAC
Sall
TATACTGGCG AAGCATGCCG TACTGGTGAC CGCTAATAG
ATATGACCGC TTCGTACGGC ATGACCACTG GCGATTATCA GCT
1341607
-73-
More particularly, Table VIII illustrates oligo-nucleotides employed
to generate the Section 1 of the ECEPO gene encoding amino terminal
residues of the human species polypeptide. Oligonucleotides were
assembled into duplexes (1 and 2, 3 and 4, etc.) and the duplexes were
then ligated to provide ECEPO Section 1 as in Table IX. Note that the
assembled section includes respective terminal EcoRI and BamHI sticky
ends, that "downstream" of the EcoRI sticky end is a XbaI restriction
enzyme recognition site; and that `upstream" of the BamHI sticky end is a
KpnnI recognition site. Section 1 could readily be amplified using the M13
phage vector employed for verification of sequence of the section. Some
difficulties were encountered in isolating the section as an XbaI/KpnI
fragment from RF DNA generated in E.coli, likely due to methylation of the
KanI recognition site bases within the host. Single-stranded phage DNA
was therefore isolated and rendered into double-stranded form in vitro by
primer extension and the desired double stranded fragment was
thereafter readily isolated.
ECEPO gene Sections 2 and 3 (Tables XI and XIII) were constructed
in a similar manner from the oligo-nucleotides of Tables X and XII,
respectively. Each section was amplified in the M13 vector employed for
sequence verification and was isolated from phage DNA. As is apparent
from Table XI, ECEPO Section 2 was constructed with EcoRI and BamHI
sticky ends and could be isolated as a Kpnl/Ba1II fragment. Similarly,
ECEPO Section 3 was prepared with BamHI and SaII sticky ends and could
be isolated from phage RF DNA as a 5a1II/SalI fragment. The three
sections thus prepared can readily be assembled into a continuous DNA
sequence (Table XIV and Figure 6) encoding the entire human species
EPO polypeptide with an amino terminal methionine codon (ATG) for E.coli
translation initiation. Note also that "upstream" of the initial ATG is a
series of base pairs substantially
13 4 16 07
-74-
duplicating the ribosome binding site sequence of the highly expressed
OMP-f gene of E.coli.
Any suitable expression vector may be employed to carry the
ECEPO. The particular vector chosen for expression of the ECEPO gene as
the "temperature sensitive" plasmid pCFM536 -- a derivative of plasmid
pCFM414 (A.T.C.C. 40076) - as described in European patent application
No. 136,490, inventor Charles F. Morris published April 10, 1985. More
specifically, pCFMS36 was digested with XbaI and Hindlll; the large
fragment was isolated and employed in a two-part ligation with the ECEPO
gene. Sections 1 (XbaI/KpnI), 2 (KanI/Bg II) and 3 (Bg1II/SalI) had
previously been assembled in the correct order in M13 and the EPO gene
was isolated therefrom as a single XbaI/HindIII fragment. This fragment
included a portion of the polylinker from M13 mp9 phage spanning the
Sall to Hindlll sites therein. Control of expression in the resulting
expression plasmid, p536, was by means of a lambda PL promoter, which
itself may be under control of the C1857 repressor gene (such as provided
in E.coli strain K12AHtrp).
The manufactured ECEPO gene above may be variously modified to
encode erythropoietin analogs such as [Asn2,des-Pro 2 through IIe6 hEPO
and [His7]hEPO, as described.
A. [Asn2, des-Pro2 through Ile6]hePO
Plasmid 536 carrying the ECEPO manufactured gene of Table XIV
and Figure 6 as a Xbal to Hindlll insert was digested with Hindlll and
Xhol. The latter endonuclease cuts the ECEPO gene at a unique, 6 base
pair recognition site spanning the last base of the codon encoding Asp8
through the second base of the Arg10 codon. A XbaI/XhoI "linker"
sequence was manufactured having the following sequence:
13 41 607
-75-
XbaI +1 2 7 8 9
Met Ala Asn Cys Asp XhoI
5'-CTAG ATGGCT AAT TGC GAC-3'
3'-TAC CGA TTA ACG CTG AGCT-5'
The XbaI/XhoI linker and the XhoI/HindIII ECEPO gene sequence
fragment were inserted into the large fragment resulting from XbaI and
Hindlll digestion of plasmid pCFM526 -- a derivative of plasmid pCFM414
(A.T.C.C. 40076) -- as described in the above-mentioned European patent
application No. 136,460 published April 10, 1985, inventor, Charles F.
Morris, to generate a plasmid-borne DNA sequence encoding E.coli
expression of the Met-1 form of the desired analog.
B. (His7]hEPO
Plasmid 536 was digested with Hindlll and XhoI as in part A above.
A XbaI/XhoI linker was manufactured having the following sequence:
XbaI +1 2 3 4 5 6 7 8 9 XhoI
Met Ala Pro Pro Arg Leu Ile His Asp
5' -CTAG ATG GCT CCG CCA CGT CTG ATC CAT GAC-3'
3'-TAC CGA GGC GGT GCA GAC TAG GTA CTG AGCT-5'
The linker and the XhoI/HindIII ECEPO sequence fragment were then
inserted into pCFM526 to generate a plasmid-borne DNA sequence
encoding E.coli expression of the Met-1 form of the desired analog.
Construction of a manufactured gene ("SCEPO") incorporating yeast
preference codons is as described in the following Tables XV through XXI
and Figure 7. As was the case with the ECEPO gene, the entire
construction involved formation of three sets of oligonucleotides (Tables
XV, XVII and XIX) which were formed into duplexes and assembled into
sections (Tables XVI, XVIII and XX). Note that synthesis was facilitated in
part by use of some sub-optimal codons in both the SCEPO and ECEPO
construc-
76 1341607
- -
tions, i.e., oligonucleotides 7-12 of Section 1 of both
genes were identical, as were oligonucleotides 1-6 of
Section 2 in each gene.
10
20
30
1341607
77 _
TABLE XV
SCEPO SECTION 1 OLIGONUCLEOTIDES
1. AATTCAAGCTTGGATAAAAGAGCT
2. GTGGAGCTCTTTTATCCAAGCTTG
3. CCACCAAGATTGATCTGTGACTC
4. TCTCGAGTCACAGATCAATCTTG
5. GAGAGTTTTGGAAAGATACTTGTTG
6. CTTCCAACAAGTATCTTTCCAAAAC
7. GAAGCTAAAGAAGCTGAAAACATC
8. GTGGTGATGTTTTCAGCTTCTTTAG
9. ACCACTGGTTGTGCTGAACACTGTTC
10. CAAAGAACAGTGTTCAGCACAACCA
11. TTTGAACGAAAACATTACGGTACCG
12. GATCCGGTACCGTAATGTTTTCGTT
TABLE XVI
SCEPO SECTION 1
EcoRI HindIll 1
AATTCA AGCTTGGATA
GT TCGAACCTAT
2
3
AAAGAGCT C ACCAAGATTG ATCTGTGACT CAGAGTTTT
TTTCTCGA G TG TTCTAAC TAGACACTGA GCTC AAAA
4
5 7
GGAAAGATAC TTGTTG AAG CTAAAGAAGC TGAAAACATC CCACTGGTT
CCTTTCTATG AACAAC TTC GATTTCTTCG ACTTTTGTAG GG CCAA
6 8
9 11 Kin I BamHI
GTGCTGAACA CTGTTC TTG AACGAAAACA TTACGGTACC G
CACGACTTGT GACAAGAAAC TTGCTTTTGT AATGCCATGG CCTAG
12
I I
1341607
78 -
TABLE XVII
SCEPO SECTION 2 OLIGONUCLEOTIDES
1. AATTCGGTACCAGACACCAAGGT
2. GTTAACCTTGGTGTCTGGTACCG
3. TAACTTCTACGCTTGGAAACGTAT
4. TTCCATACGTTTCCAAGCGTAGAA
5. GGAAGTTGGTCAACAAGCAGTTGAAGT
6. CCAAACTTCAACTGCTTGTTGACCAAC
7. TTGGCAAGGTTTGGCCTTGTTATCTG
8. GCTTCAGATAACAAGGCCAAACCTTG
9. AAGCTGTTTTGAGAGGTCAAGCCT
10. AACAAGGCTTGACCTCTCAAAACA
11. TGTTGGTTAACTCTTCTCAACCATGGG
12. TGGTTCCCATGGTTGAGAAGAGTTAACC
13. AACCATTGCAATTGCACGTCGAT
14. CTTTATCGACGTGCAATTGCAA
15. AAAGCCGTCTCTGGTTTGAGATCTG
16. GATCCAGATCTCAAACCAGAGACGG
79 1341607
TABLE XVIII
SCEPO SECTION 2
KpnI
Ec~oRI 1
T
hi riTTCGGTACC AGACACCAAG
GCCATGG TCTGTGGTTC
2
3 5
GT AACTTCT ACGCTTGGAA ACGTAT GAA GTTGGTCAAC AAGCTGTTGA
Cl TTG AGA TGCGAACCTT TGCATA CT CAACCAGTTG TTCGACAACT
4 6
7 9
AGT TGGCAA GGTTTGGCCT TGTTATCTG AGCTGTTTTG AGAGGTCAAG
TCAAACC TT CCAAACCGGA ACAATAGAC TCG CAAAAC TCTCCAGTTC
8 10
11 13
CCT GTTGGT TAACTCTTCT CAACCATGGG ACCATTGCA ATTGCACGTC
GGA C CA ATTGAGAAGA GTTGGTACCC TG T ACGT TAACGTGCAG
12 14
BglII BamHI
GAT AAGCCG TCTCTGGTTT GAGATCTG
15 CTA TTC GC AGAGACCAAA CTCTAGACCTA G
16
1 I
80 1341607
- -
TABLE XIX
SCEPO SECTION 3 OLIGONUCLEOTIDES
1. GATCCAGATCTTTGACTACTTTGTT
2. TCTCAACAAAGTAGTCAAAGATCTG
3. GAGAGCTTTGGGTGCTCAAAAGGAAG
4. ATGGCTTCCTTTTGAGCACCCAAAGC
5. CCATTTCCCCACCAGACGCTGCTT
6. GCAGAAGCAGCGTCTGGTGGGGAA
7. CTGCCGCTCCATTGAGAACCATC
8. CAGTGATGGTTCTCAATGGAGCG
9. ACTGCTGATACCTTCAGAAAGTT
10. GAATAACTTTCTGAAGGTATCAG
11. ATTCAGAGTTTACTCCAACTTCT
12. CTCAAGAAGTTGGAGTAAACTCT
13. TGAGAGGTAAATTGAAGTTGTACAC
14. ACCGGTGTACAACTTCAATTTACCT
15. CGGTGAAGCCTGTAGAACTGGT
16. CTGTCACCAGTTCTACAGGCTTC
17. GACAGATAAGCCCGACTGATAA
18. GTTGTTATCAGTCGGGCTTAT
19. CAACAGTGTAGATGTAACAAAG
20. TCGACTTTGTTACATCTACACT
_81_ 1341607
TABLE XX
SCEPO SECTION 3
BamHI Bg1II 1
GATC CAGATCTTTG ACTACTTTGT T AGAGCTTT
GTCTAGAAAC TGATGAAACA A T T GAAA
2
3 5
GGGTGCTCAA AAGGAAG CA TTTCCCCACC AGACGCTGCT TCTGCCGCTC
CCCACGAGTT TTCCTTCGG AGGGGTGG TCTGCGACGA AGACGGCGAG
4 6
7 9 11
CATTGAGAAC CATC CTGCT GATACCTTCA GAAAGTT TT CAGAGTTTAC
GTAACTCTTG GTAGTGAC A CTATGGAAGT CTTTCAA AA G CTCAAATG
8 10 12
13 15
TCCAACTTCT GAGAGGTAA ATTGAAGTTG TACAC GGTG AAGCCTGTAG
AGGTTGAAGA ACT CCATT TAACTTCAAC ATGTG-GCCPf- TTCGGACATC
14 16
17 19
AACTGGT AC AGATAAGCCC GACTGATAA AACAGTGTAG
TTGACCA G ATTCGGG CTGACTATTG TT CACATC
18
Sall
ATGTAACAAA G
TACATTGTTT CAGCT
25
82 1341607
- -
TABLE XXI
SCEPO GENE
-1 +1
Hindlll ArgAla
AGCTTGGATA AAAGAGCTCC ACCAAGATTG ATCTGTGACT CGAGAGTTTT
ACCTAT TTTCTCGAGG TGGTTCTAAC TAGACACTGA GCTCTCAAAA
GGAAAGATAC TTGTTGGAAG CTAAAGAAGC TGAAAACATC ACCACTGGTT
CCTTTCTATG AACAACCTTC GATTTCTTCG ACTTTTGTAG TGGTGACCAA
GTGCTGAACA CTGTTCTTTG AACGAAAACA TTACGGTACC AGACACCAAG
CACGACTTGT GACAAGAAAC TTGCTTTTGT AATGCCATGG TCTGTGGTTC
GTTAACTTCT ACGCTTGGAA ACGTATGGAA GTTGGTCAAC AAGCTGTTGA
CAATTGAAGA TGCGAACCTT TGCATACCTT CAACCAGTTG TTCGACAACT
AGTTTGGCAA GGTTTGGCCT TGTTATCTGA AGCTGTTTTG AGAGGTCAAG
TCAAACCGTT CCAAACCGGA ACAATAGACT TCGACAAAAC TCTCCAGTTC
CCTTGTTGGT TAACTCTTCT CAACCATGGG AACCATTGCA ATTGCACGTC
GGAACAACCA ATTGAGAAGA GTTGGTACCC TTGGTAACGT TAACGTGCAG
GATAAAGCCG TCTCTGGTTT GAGATCTTTG ACTACTTTGT TGAGAGCTTT
CTATTTCGGC AGAGACCAAA CTCTAGAAAC TGATGAAACA ACTCTCGAAA
GGGTGCTCAA AAGGAAGCCA TTTCCCCACC AGACGCTGCT TCTGCCGCTC
CCCACGAGTT TTCCTTCGGT AAAGGGGTGG TCTGCGACGA AGACGGCGAG
CATTGAGAAC CATCACTGCT GATACCTTCA GAAAGTTATT CAGAGTTTAC
GTAACTCTTG GTAGTGACGA CTATGGAAGT CTTTCAATAA GTCTCAAATG
TCCAACTTCT TGAGAGGTAA ATTGAAGTTG TACACCGGTG AAGCCTGTAG
AGGTTGAAGA ACTCTCCATT TAACTTCAAC ATGTGGCCAC TTCGGACATC
AACTGGTGAC AGATAAGCCC GACTGATAAC AACAGTGTAG
TTGACCACTG TCTATTCGGG CTGACTATTG TTGTCACATC
Sall
ATGTAACAAA G
TACATTGTTT CAGCT
-83- 1341607
The assembled SCEPO sections were sequenced in M13 and Sections
1, 2 and 3 were isolatable from the phage as HindIII/KpnI, Kpnl/5g1II,
and Bg1II/Sa1I fragments.
The presently preferred expression system for SCEPO gene products
is a secretion system based on S.cerevisiae a-factor secretion, as
described in co-pending U.S. Patent Application Serial No. 487,753, filed
April 22, 1983, by Grant A. Bitter, published October 31, 1984 as
European Patent Application 0 123,294. Briefly put, the system involves
constructions wherein DNA encoding the leader sequence of the yeast a-
factor gene product is positioned immediately 5' to the coding region of
the exogenous gene to be expressed. As a result, the gene product
translated includes a leader or signal sequence which is "processed off" by
an endogenous yeast enzyme in the course of secretion of the remainder
of the product. Because the construction makes use of the a-factor
translation initiation (ATG) codon, there was no need to provide such a
codon at the -1 position of the SCEPO gene. As may be noted from Table
XXI and Figure 7, the alanine (+1) encoding sequence is preceded by a
linker sequence allowing for direct insertion into a plasmid including the
DNA for the first 80 residues of the a-factor leader following the a-factor
promoter. The specific preferred construction for SCEPO gene expression
involved a four-part ligation including the above-noted SCEPO section
fragments and the large fragment of HindIII/Sa1I digestion of plasmid
paC3. From the resulting plasmid paC3/SCEPO, the a-factor promoter
and leader sequence and SCEPO gene were isolated by digestion with
BamHI and ligated into BamHI digested plasmid pYE to form expression
plasmid pYE/SCEPO.
EXAMPLE 12
The present example relates to expression of
1341607
- 84 -
recombinant products of the manufactured ECEPO and SCEPO
genes within the expression systems of Example 11.
In use of the expression system designed for use
of E.coli host cells, plasmid p536 of Example 11 was
transformed into AM7 E.coli cells previously transformed
with a suitable plasmid, pMW1, harboring a C1857 gene.
Cultures of cells in LB broth (Ampicillin 50 ug/ml and
kanamycin 5 ug/ml, preferably with 10 mM MgSO4) were
maintained at 28=C and upon growth of cells in culture to
O.D.600 - 0.1, EPO expression was induced by raising the
culture temperature to 42=C. Cells grown to about 40
O.D. provided EPO production (as estimated by gel) of
about 5 mg/OD liter.
Cells were harvested, lysed, broken with French
Press (10,000 psi) and treated with lysozyme and NP-40
detergent. The pellet resulting from 24,000 xg centrifu-
gation was solubilized with guanidine HC1 and subjected
to further purification in a single step by means of
C4 (Vydac) Reverse Phase HPLC (EtOH, 0-80%, 50 mM NH4Ac,
pH 4.5). Protein sequencing revealed the product to be
greater than 95% pure and the products obtained revealed
two different amino terminals, A-P-P-R... and P-P-R... in
a relative quantitative ratio of about 3 to 1. This
latter observation of hEPO and [des Ala1]hEPO products
indicates that amino terminal "processing" within the
host cells serves to remove the terminal methionine and
in some instances the initial alanine. Radioimmunoassay
activity for the isolates was at a level of 150,000 to
160,000 U/mg; in vitro assay activity was at a level of
30,000 to 62,000 U/mg; and in vivo assay activity ranged
from about 120 to 720 U/mg. (Cf., human urinary isolate
standard of 70,000 U/mg in each assay.) The dose response
curve for the recombinant product in the in vivo assay
differed markedly from that of the human urinary EPO
standard.
85 1341607
- -
The EPO analog plasmids formed in parts A and B
of Example 11 were each transformed into pMW1-transformed
AM7 E.coli cells and the cells were cultured as above.
Purified isolates were tested in both RIA and in vitro
assays. RIA and in vitro assay values for [Asn2,
des-Prot through Ile6]hEPO expression products were
approximately 11,000 U/mg and 6,000 U/mg protein, respec-
tively, while the assay values for [His7]hEPO were about
41,000 U/mg and 14,000 U/mg protein, respectively, indi-
cating that the analog products were from one-fourth to
one-tenth as "active" as the "parent" expression product
in the assays.
In the expression system designed for use of
S.cerevisiae host cells, plasmid pYE/SCEPO was trans-
formed into two different strains, YSDP4 (genotype a
pep4-3 trpl) and RK81 (genotype as pep4-3 trpl).
Transformed YSDP4 hosts were grown in SD medium (Methods
in Yeast Genetics, Cold Spring Harbor Laboratory, Cold
Spring Harbor, N.Y., p. 62 (1983) supplemented with casa-
mino acids at 0.5%, pH 6.5 at 30=C. Media harvested when
the cells had been grown to 36 O.D. contained EPO pro-
ducts at levels of about 244 U/ml (97 pg/OD liter by
RIA). Transformed RK81 cells grown to either 6.5 O.D. or
60 O.D. provided media with EPO concentrations of about
80-90 U/ml (34 pg/OD liter by RIA). Preliminary analyses
reveal significant heterogeneity in products produced by
the expression system, likely to be due to variations in
glycosylation of proteins expressed, and relatively high
mannose content of the associated carbohydrate.
Plasmids PaC3 and pYE in HB101 E.coli cells were
deposited in accordance with the Rules of Practice of the
U.S. Patent Office on September 27, 1984, with the
American Type Culture Collection, 12301 Parklawn Drive,
Rockville, Maryland, under deposit numbers A.T.C.C. 39881
and A.T.C.C. 39882, respectively. Plasmids pCFM526 in
AM7 cells, pCFM536 in JM103 cells, and pMWl in JM103
- 86 - 13 41 607
cells were likewise deposited on November 21, 1984
as A.T.C.C. 39932, 39934, and 39933, respectively.
Saccharomyces cerevisiae strains YSPD4 and RK81 were
deposited on November 21, 1984 as A.T.C.C. 20734 and
20733, respectively.
It should be readily apparent from
consideration of the above illustrative examples that
numerous exceptionally valuable products and processes
are provided by the present invention in its many aspects.
Polypeptides provided by the invention are
conspicuously useful materials, whether they are
microbially expressed products or synthetic products,
the primary, secondary or tertiary structural
conformation of which was first made known by the present
invention.
As previously indicated,
recombinant-produced and synthetic products of the
invention share, to varying degrees, the in vitro
biological activity of EPO isolates from natural
sources and consequently are projected to have utility
as substitutes for EPO isolates in culture media employed
for growth of erythropoietic cells in culture.
Similarly, to the extent that polypeptide products of
the invention share the in vivo activity of natural EPO
isolates they are conspicuously suitable for use in
erythropoietin therapy procedures practiced on mammals,
including humans, to develop any or all of the effects
herefore attributed in vivo to EPO, e.g., stimulation
of reticulocyte response, development of ferrokinetic
effects (such as plasma iron turnover effects and marrow
transit time effects), erythrocyte mass changes,
stimulation of hemoglobin C synthesis (see, Eschbach,
et al., supra) and, as indicated in Example 10, increasing
hematocrit levels in mammals. Included within the class
of humans treatable with products of the invention are
patients generally requiring blood transfusions and
including trauma victims, surgical patients, renal
disease patients including dialysis patients, and
87 -
patients with a variety of blood composition affecting
disorders, such as hemophilia, sickle cell disease, phy-
siologic anemias, and the like. The minimization of the
need for transfusion therapy through use of EPO therapy
can be expected to result in reduced transmission of
infectious agents. Products of the invention, by virtue
of their production by recombinant methods, are expected
to be free of pyrogens, natural inhibitory substances,
and the like, and are thus likely to provide enhanced
overall effectiveness in therapeutic processes vis-a-vis
naturally derived products. Erythropoietin therapy with
products of the present invention is also expected to be
useful in the enhancement of oxygen carrying capacity of
individuals encountering hypoxic environmental conditions
and possibly in providing beneficial cardiovascular
effects.
A preferred method for administration of poly-
peptide products of the invention is by parenteral (e.g.,
IV, IM, SC, or IP) routes and the compositions admi-
nistered would ordinarily include therapeutically
effective amounts of product in combination with accep-
table diluents, carriers and/or adjuvants. Preliminary
pharmacokinetic studies indicate a longer half-life in
vivo for monkey EPO products when administered IM rather
than IV. Effective dosages are expected to vary substan-
tially depending upon the condition treated but thera-
peutic doses are presently expected to be in the range of
0.1 (-'7U) to 100 (-7000U) ug/kg body weight of the active
material. Standard diluents such as human serum albumin
are contemplated for pharmaceutical compositions of the
invention, as are standard carriers such as saline.
Adjuvant materials suitable for use in com-
positions of the invention include compounds indepen-
dently noted for erythropoietic stimulatory effects, such
as testosterones, progenitor cell stimulators,
insulin-like growth factor, prostaglandins, serotonin,
88 13 41 607
- -
cyclic AMP, prolactin and triiodothyronine, as well as
agents generally employed in treatment of aplastic ane-
mia, such as methenolene, stanozolol and nandrolone [see,
e.g., Resegotti, at al., Panminerva Medica, 23,, 243-248
(1981); McGonigle, et al., Kidney Int., 25(2), 437-444
(1984); Pavlovic-Kantera, et al., Expt.Hematol., 8(Supp.
8), 283-291 (1980); and Kurtz, FEBS Letters, 14a(1),
105-108 (1982)]. Also contemplated as adjuvants are
substances reported to enhance the effects of, or
synergize, erythropoietin or asialo-EPO, such as the
adrenergic agonists, thyroid hormones, androgens and BPA
[see, Dunn, "Current Concepts in Erythropoiesis", John
Wiley and Sons (Chichester, England, 1983); Weiland, et
al., Blut, 44(3), 173-175 (1982); Kalmanti, Kidney Int.,
22, 383-391 (1982); Shahidi, New.Eng.J.Med., 289, 72-80
(1973); Fisher, et al., Steroids, 30(6), 833-845 (1977);
Urabe, et al., J.Exp.Med., 149, 1314-1325 (1979); and
Billat, et al., Expt.Hematol., 10(1), 133-140 (1982)] as
well as the classes of compounds designated "hepatic
erythropoietic factors" [see, Naughton, et al.,
Acta.Haemat., 69, 171-179 (1983)] and "erythrotropins"
[as described by Congote, et al. in Abstract 364,
Proceedings 7th International Congress of Endocrinology
(Quebec City, Quebec, July 1-7, 1984); Congote,
Biochem.Biophys.Res.Comm., 115(2), 447-483 (1983) and
Congote, Anal.Biochem., 140, 428-433 (1984)] and
"erythrogenins" [as described in Rothman, et al.,
J.Surg.Oncol., 20, 105-108 (1982)]. Preliminary
screenings designed to measure erythropoietic responses
of ex-hypoxic polycythemic mice pre-treated with either
5-a-dihydrotestosterone or nandrolone and then given
erythropoietin of the present invention have generated
equivocal results.
Diagnostic uses of polypeptides of the invention
are similarly extensive and include use in labelled and
unlablled forms in a variety of immunoassay techniques
-89- 13 4 1 6 0 7
including RIA's, ELISA's and the like, as well as a variety of in vitro and in
vivo activity assays. See, e.g., Dunn, et al., Expt.Hematol., 11(7)590-600
(1983); Gibson, et al., Pathology 16, 155-156 (1984); Krystal,
Expt.Heratol., 11(7) 649-660 (1983); Saito, et al., Jap.J~Med., 23(l) 16-
21 (1984); Nathan, et at., New Eng.J.Med., 308(9) 520-522 (1983); and
various references pertaining to assays referred to therein. Polypeptides
of the invention, including synthetic peptides comprising sequences of
residues of EPO first revealed herein, also provide highly useful pure
materials for generating polyclonal antibodies and "banks" of monoclonal
antibodies specific for differing continuous and discontinuous epitopes of
EPO. As one example, preliminary analysis of the amino acid sequences
of Table VI in the context of hydropathicity according to Hopp, et al.,
P.N.A.S (U.S.A.), 78, pp. 3824-3828 (1981) and of secondary structures
according to Chou, et al., Ann.Rev.Biochem. 47, p. 251 (1978) revealed
that synthetic peptides duplicative of continuous sequences of residues
spanning positions 41-57 inclusive, 116-128 inclusive and 144-166
inclusive are likely to produce a highly antigenic response and generate
useful monoclonal and polyclonal antibodies immunoreactive with both the
synthetic peptide and the entire protein. Such antibodies are expected to
be useful in the detection and affinity purification of EPO and EPO-related
products.
Illustratively, the following three synthetic peptides were prepared:
(1) hEPO 41-57, V-P-D-T-K-V-N-F-Y-A-W-K-R-M-E-V-G;
(2) hEPO 116-128, K-E-A-I-S-P-P-D-A-A-S-A-A;
(3) hEPO 144-166, V-Y-S-N-F-L-R-G-K-L-K-L-Y-T-G-E-A-C-R-
T-G-D-R.
-9o- 1341607
Preliminary immunization studies employing the above-
noted polypeptides have revealed a relatively weak posi-
tive response to hEPO 41-57, no appreciable response to
hEPO 116-128, and a strong positive resopnse to hEPO
144-166, as measured by capacity of rabbit serum antibo-
dies to immunoprecipitate 125I-labelled human urinary EPO
isolates. Preliminary in vivo activity studies on the
three peptides revealed no significant activity either
alone or in combination.
While the deduced sequences of amino acid resi-
dues of mammalian EPO provided by the illustrative
examples essentially define the primary structural con-
formation of mature EPO, it will be understood that the.
specific sequence of 165 amino acid residues of monkey
species EPO in Table V and the 166 residues of human spe-
cies EPO in Table VI do not limit the scope of useful
polypeptides provided by the invention. Comprehended by
the present invention are those various naturally-
occurring allelic forms of EPO which past research into
biologically active mammalian polypeptides.such as human
y interferon indicates are likely to exist. (Compare,
e.g., the human immune interferon species reported to
have an arginine residue at position No. 140 in EPO
published application 0 077 670 and the species reported
to have glutamine at position No. 140 in Gray, et al.,
Nature, 295, pp. 503-508 (1982). Both species are
characterized as constituting "mature" human y interferon
sequences.) Allelic forms of mature EPO polypeptides may
vary from each other and from the sequences of Tables V
and VI in terms of length of sequence and/or in terms of
deletions, substitutions, insertions or additions of
amino acids in the sequence, with consequent potential
variations in the capacity for glycosylation. As noted
previously, one putative allelic form of human species
EPO is believed to include a methionine residue at posi-
tion 126. Expectedly, naturally-occurring allelic forms
1341607
91 -
of EPO-encoding DNA genomic and cONA sequences are also
likely to occur which code for the above-noted types of
allelic polypeptides or simply employ differing codons
for designation of the same polypeptides as specified.
In addition to naturally-occurring allelic forms
of mature EPO, the present invention also embraces other
"EPO products" such as polypeptide analogs of EPO and
fragments of "mature" EPO. Following the procedures of
the above-noted published application by Alton, et al.
(W0/83/04053) one may readily design and manufacture
genes coding for microbial expression of polypeptides
having primary conformations which differ from that
herein specified for mature EPO in terms of the identity
or location of one or more residues (e.g., substitutions,
terminal and intermediate additions and deletions).
Alternately, modifications of cDNA and genomic EPO genes
may be readily accomplished by well-known site-directed
mutagenesis techniques and employed to generate analogs
and derivatives of EPO. Such EPO products would share at
least one of the biological properties of EPO but may
differ in others. As examples, projected EPO products of
the invention include those which are foreshortened by
e.g., deletions [Asn2, des-Prot through Ile6]hEPO,
[des-Thr163 through Arg166]hEPO and "627-55hEP0", the
latter having the residues coded for by an entire exon
deleted; or which are more stable to hydrolysis (and,
therefore, may have more pronounced or longer lasting
effects than naturally-occurring EPO); or which have been
altered to delete one or more a potential sites for gly-
cosylation (which may result in higher activities for
yeast-produced products); or which have one or more
cystein residues deleted or replaced by, e.g., histidine
or serine residues (such as the analog [His7]hEPO) and
are potentially more easily isolated in active form from
microbial systems; or which have one or more tyrosine
residues replaced by phenylalanine (such as the analogs
13 41 607
92 -
[Phe15] hEPO, [Phe49] hEPO, and [Phe145] hEPO) and may bind
more or less readily to EPO receptors on target cells.
Also comprehended are polypeptide fragments duplicating
only a part of the continuous amino acid sequence or
secondary conformations within mature EPO, which
fragments may possess one activity of EPO (e.g., receptor
binding) and not others (e.g., erythropoietic activity).
Especially significant in this regard are those potential
fragments of EPO which are elucidated upon consideration
of the human genomic DNA sequence of Table VI, i.e.,
"fragments" of the total continuous EPO sequence which
are delineated by intron sequences and which may consti-
tute distinct "domains" of biological activity. It is
noteworthy that the absence of in vivo activity for any
one or more of the "EPO products" of the invention is not
wholly preclusive of therapeutic utility (see, Weiland,
et al., supra) or of utility in other contexts, such as
in EPO assays or EPO antagonism. Antagonists of erythro-
poietin may be quite useful in treatment of polycythemias
or cases of overproduction of EPO [see, e.g., Adamson,
Hosp.Practice, 18(12), 49-57 (1983), and Hellmann, et
al., Clin.Lab.Haemat., 5, 335-342 (1983).
According to another aspect of the present
invention, the cloned DNA sequences described herein
which encode human and monkey EPO polypeptides are
conspicuously valuable for the information which they
provide concerning the amino acid sequence of mammalian
erythropoietin which has heretofore been unavailable
despite decades of analytical processing of isolates of
naturally-occurring products. The DNA sequences are also
conspicuously valuable as products useful in effecting
the large scale microbial synthesis of erthropoietin by a
variety of recombinant techniques. Put another way, DNA
sequences provided by the invention are useful in
generating new and useful viral and circular plasmid DNA
vectors, new and useful transformed and transfected
93 1341607
microbial procaryotic and eucaryotic host cells
(including bacterial and yeast cells and mammalian cells
grown in culture), and new and useful methods for
cultured growth of such microbial host cells capable of
expression of EPO and EPO products. DNA sequences of the
invention are also conspicuously suitable materials for
use as labelled probes in isolating EPO and related pro-
tein encoding cDNA and genomic DNA sequences of mammalian
species other than human and monkey species herein speci-
fically illustrated. The extent to which DNA sequences
of the invention will have use in various alternative
methods of protein synthesis (e.g., in insect cells) or
in genetic therapy in humans and other mammals cannot yet
be calculated. DNA sequences of the invention are
expected to be useful in developing transgenic mammalian
species which may serve as eucaryotic "hosts" for produc-
tion of erythropoietin and erythropoietin products in
quantity. See, generally, Palmiter, et al., Science,
222(4625), 809-814 (1983).
Viewed in this light, therefore, the specific
disclosures of the illustrative examples are clearly not
intended to be limiting upon the scope of the present
invention and numerous modifications and variations are
expected to occur to those skilled in the art. As one
example, while DNA sequences provided by the illustrative
examples include cDNA and genomic DNA sequences, because
this application provides amino acid sequence information
essential to manufacture of DNA sequence, the invention
also comprehends such manufactured DNA sequences as may
be constructed based on knowledge of EPO amino acid
sequences. These may code for EPO (as in Example 12) as
well as for EPO fragments and EPO polypeptide analogs
(i.e., "EPO Products") which may share one or more biolo-
gical properties of naturally-occurring EPO but not share
others (or possess others to different degrees).
DNA sequences provided by the present invention
are thus seen to comprehend all DNA sequences suitable
1341607
94 -
for use in securing expression in a procaryotic or
eucaryotic host cell of a polypeptide product having at
least a part of the primary structural conformation and
one or more of the biological properties of erythro-
poietin, and selected from among: (a) the DNA sequences
set out in Tables V and VI; (b) DNA sequences which
hybridize to the DNA sequences defined in (a) or
fragments thereof; and (c) DNA sequences which, but for
the degeneracy of the genetic code, would hybridize to
the DNA sequences defined in (a) and (b). It is
noteworthly in this regard, for example, that existing
allelic monkey and human EPO gene sequences and other
mammalian species gene sequences are expected to hybri-
dize to the sequences of Tables V and VI or to fragments
thereof. Further, but for the degeneracy of the genetic
code, the SCEPO and ECEPO genes and the manufactured or
mutagenized cDNA or genomic DNA sequences encoding
various EPO fragments and analogs would also hybridize to
the above-mentioned DNA sequences. Such hybridizations
could readily be carried out under the hybridization con-
ditions described herein with respect to the initial iso-
lation of the monkey and human EPO-encoding DNA or more
stringent conditions, if desired to reduce background
hybridization.
In a like manner, while the above examples
illustrate the invention of microbial expression of EPO
products in the context of mammalian cell expression of
DNA inserted in a hybrid vector of bacterial plasmid and
viral genomic origins, a wide variety of expression
systems are within the contemplation of the invention.
Conspicuously comprehended are expression systems
involving vectors of homogeneous origins applied to a
variety of bacterial, yeast and mammlain cells in culture
as well as to expression systems not involving vectors
(such as calcium phosphate transfection of cells). In
95 13 41 607
- -
this regard, it will be understood that expression of,
e.g., monkey origin DNA in monkey host cells in culture
and human host cells in culture, actually constitute
instances of "exogenous" DNA expression inasmuch as the
EPO DNA whose high level expression is sought would not
have its origins in the genome of the host. Expression
systems of the invention further contemplate these prac-
tices resulting in cytoplasmic formation of EPO products
and accumulation of glycosylated and non-glycosylated EPO
products in host cell cytoplasm or membrances (e.g.,
accumulation in bacterial periplasmic spaces) or in
culture medium supernatants as above illustrated, or in
rather uncommon systems such as P.aeruginosa expression
systems (described in Gray, et al., Biotechnology, 2, pp.
161-165 (1984)).
Improved hybridization methodologies of the
invention, while illustratively applied above to DNA/DNA
hybridization screenings are equally applicable to
RNA/RNA and RNA/DNA screening. Mixed probe techniques as
herein illustrated generally constitute a number of
improvements in hybridization processes allowing for more
rapid and reliable polynucleotide isolations. These many
individual processing improvements include: improved
colony transfer and maintenance procedures; use of nylon-
based filters such as GeneScreen and GeneScreen Plus to
allow reprobing with same filters and repeated use of the
filter, application of novel protease treatments
[compared, e.g., to Taub, et al. Anal.Biochem., 126, pp.
222-230 (1982); use of very low individual con-
centrations (on the order of 0.025 picomole) of a large
number of mixed probes (e.g., numbers in excess of 32);
and, performing hybridization and post-hybridization
steps under stringent temperatures closely approaching
(i.e., within 4-C and preferably within 2-C away from)
the lowest calculated dissocation temperature of any of
the mixed probes employed. These improvements combine to
;341607
- 96 -
provide results which could not be expected to attend
their use. This is amply illustrated by the fact that
mixed probe procedures involving 4 times the number of
probes ever before reported to have been successfully
used in even cDNA screens on messenger RNA species of
relatively low abundancy were successfully applied to the
isolation of a unique sequence gene in a genomic library
screening of 1,500,000 phage plaques. This feat was
accomplished essentially concurrently with the publica-
"tion of the considered opinion of Anderson, et al.,
supra, that mixed probe screening methods were
"...impractical for isolation of mammalian protein genes
when corresponding RNA's are unavailable.
20
30
