Note : Les descriptions sont présentées dans la langue officielle dans laquelle elles ont été soumises.
- 2G~ 6:~
TECHNICAL FIELD
The invention relates to hepatitis antigens for use in
immunoassays. In particular, it concerns stabilized
hepatitis B antigens which can be readily used in standard
assays for the presence of hepatitis B anti-e antibodies.
BACKGRO_ND ART
The course of hepatitis B virus (HBV) infection in
humans can be monitored by following the appearance and
disappearance of certain components in plasma or serum of
infected subjects. There appear to be three ma~or HBV
antigenic proteins: HBs ,the envelope protein or surface
antigen; HBc, or core antigen; and HBe antigen, which
appears to be a processed product of the core. Antibodies
are formed to all three of these antigens. The core
antigen, HBc, does not appear as such in the plasma of
infected subjects, however, its processed product HBe,
along with HBs, are found in the plasma within several
months after infection, and then effectively disappear.
Antibodies reactive with core (anti-HBc) begin to appear
about two months after infection and concentrations in
plasma of antibodies reactive with HBe antigen (anti-HBe)
peak around 4 to 5 months after infection. Anti-HBs
antibody titers rise more or less concomitantly with the
diminution of titers of anti-HBe. Thus, by assessing the
levels of all five plasma~borne components, H~s, HBe, anti-
HBs, anti-HBe, and anti-HBc, the status of the infection
can be assessed. Commercially available assay ~its provide
tests for all of these markers.
Although HBc antigenic activity is not detected in
plasma of infected individuals, particles containing the
core antigen can be isolated. It has been known for over
ten years that HBe antigen is released from these core
particles by treatment with pronase, with pronase and
2(~ 7~)
2-mercaptoethanol, with sodium dodecyl sulfate ar,d 2-
mercaptoethanol, or through disruption by sonication and
treatment with chaotropic agents. Therefore, it is assumed
that HBe is some sort of processed product of HBc, and that
when HBc is produced in mammalian systems, its antigenic
characteristics are converted to those of HBe. However, it
has appeared that in order to maintain the anti-HBe
characteristics of the processed antigen, denaturing
conditions must be maintained. If the "processed" protein
is put back into isotonic solution, it reassumes the
antigenic properties of HBc.
As proteolytic cleavage appears to be involved in
con~erting HBc to HBe, it is also known that the HBe
antigen (or mixture of antigens) is a shorter molecular
weight form of HBc. The native coding sequence and the
deduced amino acid sequence for HBc have been known for
some time (see, for example, U.S. patent 4,710,463 to
Biogen).
United States patents 4,758,507 and 4,563,423, both
assigned to Biogen, describe the recombinant production of
putative HBe. Briefly, the methods involve recombinant
production of HBc in bacteria and subsequent treatment with
reagents to convert the HBc product to HBe. In
illustrative embodiments, HBc of about 1% purity is treated
either with 0.1% pronase or with 0.1% pronase and 0.1%
mercaptoethanol. Alteratively, 1% SDS and 10 mM 2-
mercaptoethanol are used. It is further suggested that the
HBe recombinant protein could be prepared by chewing back
the HBc gene to an appropriate but unspecified location to
generate HBe peptide. However, the HBe produced by these
methods, even the putatively shortened form, require the
presence of denaturing agents to maintain HBe antigenicity.
European application No. 87117370.4 (Publication No.
0,272,483) assigned to Abbott Laboratories describes
;~G~a~ q~
recombinant production of HBe from a C-terminal deleted HBc
gene and maintenance of HBe antigenic characteristics by
treatment with and storage in guanidine. Again, removal of
the chaotropic agent results in resumption of HBc rather
than HBe antigenic characteristics.
There thus exists a need for a method of maintaining
the antigenic characteristics of HBe without the use of
denaturing or chaotropic agents. The present invention
satisfies this need and provides related advantages as
well.
SUMMARY OF THE INVENTION
The invention provides stable forms of Hepatitis B
antigen useful in immunoassays for the titration of anti-
HBe in the blood of HBV-infected subjects. It has now been
found that HBe antigen suitable for immunoassays for
detection of anti-HBe can be maintained by immobilizing the
protein on a solid substrate. Such immobilization results
in maintenance of the HBe antigen characteristics.
In one aspect, therefore, the invention is directed to
an HBe antigen in immobilized form, captured on a solid
support coated with anti-HBe. In other aspects, the
invention is directed to methods to conduct immunoassays
using the HBe antigens of the invention, and to materials,
such as derivatized solid supports, useful in these assays.
DETAILED DESCRIPTION OF THE INVENTION
An antigen is referred to in this specification as
HBeAg or HBe antigen if it is unstable and is recognized
with high specificity by antibodies to human e antigen, but
not by antibodies to human core antigen. As used herein,
specificity may be measured by following the procedure of
XG~ r~3
Example IC. An optical densi~y ratio of positive controls
to negative controls as determined in accordance with the
procedure of Example IC indicates high specificity if the
ratio is at least 5, preferably at least 10, and more
preferably at least 15. For practical reasons, the ratio
will not normally exceed 100.
The structure of human e antigen is uncertain. It is
possible that what is commonly referred to as "human e
antigen" is a mixture of antigens.
HBeAg or HBe, as used herein, cover all ~nstable
analogs of human e antigen that are recognized with high
specificity by antibodies to human e antigen. Unstable
analogs are proteins that otherwise satisfy the present
definition of HBeAg but that revert to HBcAg too rapidly or
with too high a probability to satisfactorily provide
sufficient e antigenicity to be suitable as a reagent in an
assay for anti human e antigen. This definition of HBeAg
applies, for example, to the e antigens disclosed in U.S.
Patents 4,758,507 and 4,563,423 as well as to those
disclosed in European Patent application 272,483.
This invention provides stabilized HBe antigen
2S suitable for use in immunoassays to detect the presence of
anti-HBe immunoglobulins. Such stabilized HBe retains its
HBe antigenicity during storage, without providing
extraneous and potentially deleterious stabilizing factors
such as reducing or chaotropic agents. HBe is stabilized
by being immobilized, by being bound to anti-HBe antibodies
attached to a solid substrate.
Purified HBeAg is commercially available, for example,
from Alpha Therapeutics, San Antonio, Texas.
Alternatively, recombinant HBeAg can be produced by methods
well known in the art. See for example, United States
Patent Nos. 4,758,507 and 4,563,423, and European patent
application 272,483, which are incorporated herein by
reference.
HBe can be coated directly onto a solid substrate.
However, over time, such coated HBeAg exhibits decrease in
E antigenicity, and a decrease in core immunoreactivity.
In a solid phase configuration where HBe is captured onto
a solid substrate coated with anti-HBe antibodies, the
retention of E antigenicity is improved. Preferably, the
solid phase configuration is produced as follows~ HBe
antigen in a chaotropic solution, such as guanidine-
dithiothreitol, is diluted, for example with a high protein
containing diluent, and incubated with a solid substrate,
such as microtiter wells, previously coated with anti-HBeAg
antibody. The high protein diluent may, for example, be
plasma, serum, BSA, or gelatin. The HBeAg guanidine:DTT
ratio is adjusted so that a high anti-HBeAg assay reading
is achieved (0.85-l.a.~0 O.D.) with negligible anti-core
reactivity (<0.150 O.D.). the concentration of guanidine
and DTT must be adjusted so as not to interfere in the
antibody-antigen reaction while still maintaining the
molecule in a non-conformational state. Once captured by
the anti-HBeAg antibodies on the plate, the chaotropic
agent can be removed and the wells dried for future use.
This solid phase configuration has improved stability under
normal storage conditions, compared to that of solubilized
HBe.
The solid phase captured HBeAg can be used in a one
step assay to detect the presence of anti-HBeAg antibodies
in a sample by competitive inhibition. A labeled antibody
to HBe is used for competitive binding with antibodies in
the sample to the immobilized HBeAg. The antibod~ may he
labeled with a moiety that can be detected. The label may,
for example, be a radioactive atom, a colometric group or
an enzyme. The antibody may be monoclonal or polyclonal.
The preferred antibody is polyclonal anti-HBe conjugated to
2~
horseradish peroxidase. Such an assay provides a specific,
sensitive assay to detect anti-HBeAg antibodies.
Additionally, the assay components are relatively stable at
room temperature.
As used herein "Hepatitis Be Antigen" or "HBe Antigen"
or "HBeAg~ refers to a polypeptide having the antigenicity
profile of HBe. The stabilized HBe of the present
invention refers to a polypeptide which continues to
express HBe antigenicity in solution, without the necessity
of providing stabilizing factors, such as guanidine. It is
understood, however, that limited modifications may be made
without destroying the HBe antigenicity.
As used herein, "HBe antigenicity" refers to the
reactivity of HBeAg with antibodies which specifically
recognize and bind to HBe and the lack of cxoss reactivity
with antibodies which specifically recognize and bind to
HBc antigens. Kits to measure HBe antigenicity and HBc
antigenicity are presently available from Abbott
Laboratories. Antibodies which react with HBeAg are termed
anti-HBe, anti-HBeAg antibodies, or anti-HBeAg Ig.
The following examples are intended to illustrate, but
not limit, the invention.
EXAMPLE IA
Cloninq the HBV Genome in E. coli
Complete genomic HBV nucleic acid was isolated from
the serum of an infected male patient who was positive for
S antigen type ayw and e antigen by ELISA with specific
serotype reagents and Auszyme and Hbe EIA ~its,
respectively (Abbott Laboratories, Deerfield, IL).
Clarified serum was subjected to ultracentrifugation at
45,000 rpm for 3 hours at 10C to yield a virus pellet.
Z~C~ e~70
The supernatant fluid was aspirated and the pellet
resuspended in 500 ~1 at 50 mM Tris HCl pH 7.5, 50 mM NaCl.
The virus preparation was layered onto a 20% sucrose
solution in a SW41 rotor (Beckman Instruments, Brea, CA)
and pelleted at 30,000 rpm for 4 hours at 4~C. The
resulting virus pellet was resuspended in 50 mM Tris HCl pH
7.5, 10 m~ MgCl2, 5 mM 2-ME, 0.05% BSA, 10 mM NaCl, 0.5 mM
~DTA.
10Taking advantage of the endogenous virus polymerase,
- the gapped circular virus DNA was "filled in" by reaction
with 10 mM each of dATP, dTTP, dGTP, dCTP at 37C for 2
hours. This ln situ restoration of the circular structure
makes subsequent cloning of the 3.2 kbp genome practical.
Repaired particles were lysed in a buffer consisting of 10
mM Tris HCl, pH 7.5, 50 mM NaCl, 0.05% SDS, 20 ~g/ml
proteinase K. This solution was incubated at 37C for 1
hour, followed by phenol-chloroform and ether extractions
to remove protein. Viral DNA was brought to 0.3 M Na+ and
precipitated with ethanol at 0C overnight. The resultant
pellet of nucleic acid was dissolved in 10 mM Tris HCl pH
7.5, 1 mM EDTA, and the extinction at 260 nm measured. A
suitable aliquot was removed and digested with the
restriction endonuclease EcoRI. HBV nucleic acids contain
a single, unique cleavage site for this enzyme, and yield
a linear molecule upon digestion of 3.2 kbp. Linear HBV
DNA with EcoRI termini was added to similarly digested
vector pBR322 DNA in a ratio of 1 ~g HBV/0.5 ~g PBR322
plasmid. Following ethanol precipitation and drying, the
pellet was ligated with DNA ligase enzyme, and an aliquot
added to competent HB101 bacterial cells (ATCC Rockville,
MD) (Boyer, H., and Roulland-Dussiox, D., J. Molec. Biol.
41:459 (1969)). Colonies that had taken up plasmids were
scored and isolated on agar plates containing 50 mg/ml
ampicillin.
Recombinant plasmids were identified by restriction
enzyme analysis on agarose gels and by hybridization to
radio-labelled probe. The probe can be 32p-marked virus
nucleic acid or specific oligonucleotide probes labelled at
the 5' end with kinase enzyme. Hybridization is best
accomplished by colony lift techniques employing
~itrocellulose membranes, essentially as in Grunstein, M.
and Hogness, D., Proc. Natl. Acad. Sci. USA, 72:3961 (1975)
which is incorporated herein by reference. Individual
colonies that contained a 3.2 kbp EcoRI insert into the 4.4
Kbp PBR322 plasmid were isola~ed and expanded for large-
scale growth to isolate recombinant plasmids by CSCI
gradient centrifugation. Methods well known in the art
were employed to isolate plasmid recombinants free of
bacterial DNA contaminants (See for example Maniatis, et
al., (1982) Molecular Cloning: A Laboratory Manual (Cold
Spring Harbor Laboratory) Cold Spring Harbor, NY) which i
incorporated herein by reference).
EXAMPLE IB
Production of Recombinant HBeAg
The plasmid recombinant isolated in Example IA was
digested with the nuclease Nla III, (New England Biolabs,
Beverly, ~A) resulting in an 0.9 kbp restriction fragment.
This fragment spans coordinates 1902-2849 of the HBV
genome, as indicated in Figure 1. The restriction fragment
was cloned into plasmid pUCl9 at the Sphl cleavage site,
resulting in recombinant plasmids with rightward (plus) and
leftward (minus) directions of the inserted fragment. The
correct (plus) orientation restriction fragment was chosen
by routine restriction enzyme analysis. This plasmid was
digested with HindIII and PstI. The resulting small
HindIII/PstI fragment was cloned into pKK233-2 (Pharmacia
Fine Chemicals, Piscataway, NJ) at the HindIII and PstI
sites, bringing the desired gene into a proper reading
3~70
frame with the trc promoter (fused tryptophan and lactose
promoters). This plasmid, which also contains the gene for
ampicillin resistance, is designated pC7.
When expressed in E. coli strain HB101 (American Type
Culture Colelction, Rockville, MD), pC7 produces a 20kD
monomer of HBVc, designated C7, which is capable of
spontaneous self-assembly to a particle size in excess of
2 X 106 daltons. The assembled particles of C7 are highly
immun~reactive with antibodies to C7. The amino and
carboxy termini of C7 are identical to those of native
HBcAg.
Using techniques of in vitro site directed mutagenesis
(Kunkel, T.A., et al. Methods in Enzymology, lS4, 367-382
(1987)), a TAA termination sequence was inserted at
position 2349. The insertion was achieved using an
oligonucleotide synthesized via solid phase chemistry,
using a Cyclone DNA Synthesizer (Biosearch, Inc.). The
oligonucleotide had the following sequence (TAA at position
2349 is underlined):
GGACCTGCCTCGTCGGGTACCCTAAACAACAGTAGTCTCC
This sequence is homologous to the sequence of pC7
flanking the position at which the mutation was desired.
The desired TAA sequence was incorporated into the
recombinant pC7, designated pCTM-18, as described by Kunkel
et al. The insertion of TAA at position 2349 results in
premature protein synthesis interruption and shortens the
resulting molecule by 5 Kd, the natural terminator of HBcAg
being at p~sition 24~0. This protein product, designated
CTM-18, has the same carboxy terminus as HBe purified from
human sera following processing of HBcAg in mammalian
cells.
~$~3~
EXAMPLE IC
Specificity of e antiaen
Six wells are coated with 10 ~g each of polyclonal
antibodies to human e antigen obtained from plasma. CTM-
18 is denatured with guanidine in accordance with Example
of European patent application EP 272,483 (Abbott).
Following denaturation, the solution containing the e
antigen is immediately diluted to less than 0.1 M guanidine
in an appropriate medium in order to prevent the guanidine
from precluding the binding of CTM-18 to the antibody. 150
ng of denatured CTM-18 in 100 ~l of the medium are added to
three of the wells and incubated at 37C for 12-18 hours.
An appropriate medium is plasma, serum, or 0.01 molar
carbonate buffer (pH 9.5). These wells contain the
positive controls. No e antigen was added to the remainder
of the wells in the negative controls. Each well is
incubated for one hour at 37C with approximately 10 ~g/100
~l of polyclonal antibodies to human e antigen conjugated
to horseradish peroxidase in a solution of 50% calf serum,
49% PBS, 1% horse serum, 0.05% detergent (Tween 20) and 1
mM potassium ferricyanide. The plates are washed, and the
optical density at 450 nM is measured.
25EXAMPLE II
Coating of Substrate with Anti-HBeAa
High titer human anti-HBe serum was obtained from the
New York Blood Center. The serum was purified as follows.
The serum was precipitated with 50% ammonium sulfate at 4C
for 4 hours. The precipitated IgG was pelleted by
centrifugation, resuspended in phosphate buffered saline
(PBS), pH 7.25 and dialyzed against phosphate-buffered
saline, pH 7.25. The dialyzed IgG was then applied to a
Baker Bond ABx HPLC column. Fractions determined to be IgG
positive by anti-human IgG ELISA were pooled and
concentrated by ultrafiltration on YM-30 membrane (Amicon,
2~ 70
Danvers, MA). The purified serum was diluted in 25 mM
Tris-HCl, pH 8.0 to a concentration of 15 ~g/200 ~L.
200 ML of diluted serum was placed in each well of
(Dynatech Labs, Boston, MA) Immulon II 96 well polystyrene
microtiter strip wells and allowed to incubate overnight at
room temperature. The solution W2S pipetted off and 200 ~L
of 5% BSA in PBS allowed to overcoat for 30 minutes at
37C. The wells were washed five times with 300 ~L PBS.
The anti-HBeAg coated wells can either be used immediately
or stored for future use.
EXAMPLE III
Capture of HBeAg
Purified rHBeAg, prepared by the method of Example I,
was reconstituted in 8M guanidine, 75 mM dithiothreitol
(DTT; Sigma Chemical Co., St. Louis, MO) (100 ~L/16 ~g
antigen). the solution was vortexed and allowed to
incubate for three minutes. Immediately after incubation,
the solution was diluted to a final concentration of 150 mM
guanidine, 1.4 mM DTT in a diluent containing 25% normal
human serum, 10% BSA in phosphate buffered saline pH 7.2.
100 ~L of diluted antigen was then added to microtiter
wells coated the previous day with anti-HBeAg sera
according to the method of Example II, and allowed to
incubate at room temperature for 24 hours. After
incubation, wells were aspirated without washing and dried
at 37C for 30 minutes in a low humidity incubator. The
strips were sealed in laminated foil pouches with desiccant
material (Nultiform Desiccants Corp., Buffalo, NY).
The immobilized antigen was determined to exhibit HBe
antigenicity, but not HBc antigenicity. The same results
were obtained after storage for one month, indicating
stable E antigenicity.
2C~ 7C~
EXAMPLE IV
Assay for Anti-HBe
Microtiter strip wells prepared as in Example III were
removed from the storage pouch and washed three times with
PBS. the plates were inverted on a clean paper towel and
patted dry to remove any accumulation of fluid around the
wells.
Three wells were used as positive controls and to each
was added 50 ~L of plasma from patients known to be
immunoreactive for antibodies to Hepatitis B e antigen. 50
~L of plasma from individuals known to be non-reactive for
hepatitis was added to three other wells as negative
controls. 50 ~L of plasma suspected of containing anti-HBe
were added to each test well. All samples were obtained
from new York Blood Center.
HRP conjugated anti-HBeAg was prepared as follows:
High titer human serum having anti-HBeAg reactivity was
obtained from the New York Blood Center. Saturated
ammonium sulfate was added dropwise (3 mL/minute), with
stirring, to an equal volume of serum, and the solution
stirred for an additional 30 minutes after the final
addition. The solution was centrifuged at 2000 RPM for 30
minutes at 4C and the supernatant decanted. The pellet
was resuspended to the original volume in PBS, pH 7.2. As
before, saturated ammonium sulfate was added and the
solution was centrifuged. The pellet was resuspended din
one half the original volume of PBS, pH 7.2, and dialyzed
overnight at 4 D C against PBS, pH 7.2.
The solution was chromatographed in a Baker Bond ABx
HPLC Column equilibrated with 20 mM KH2PO4, pH 6.7, and
eluted with 20 mM KH2P04 and 50 mM (NH4)2S04, pH 6.7.
`- Fractions positive for Ig, as determined by their
functional use in an anti-HBeAg assay, were pooled and
XC~ 70
concentrated using an Amicon ultrafiltration cell with a
YM-30 membrane.
Horseradish peroxidase (HRP) was conjugated to the anti-HBe
antibodies according to the method of Wilson and Nakane
"Immunofluorescence and Related Techniques" (Knapp et al.,
eds.) Elsevier North Holland, Amsterdam (1978), with minor
modifications. Briefly, 4 mg HRP (Type VI RZ = 3.0, sigma
Chemical co., St. Louis, MOO was dissolved in l.O mL of 2
mM acetate buffer, pH 4.4, 0.2 mL freshly prepared 0.2 M
NaIO4 (Sigma Chemical Co.) was added to the HRP solution and
stirred for 20 minutes at room temperature. Excess NaIO4
was removed by gel filtration on a 1 X 20 cm Sephadex G-25
(Pharmacia Fine Chemicals, Piscataway, NJ) column
equilibrated with 2 mM acetate buffer pH 4.4. Oxy-HRP
fractions were pooled and concentrated to the original
volume.
The pH of the HRP solution was raised to 9.5 by the
addition of 20 ~L 0.2 M sodium bicarbonate buffer, pH 9.5.
9 mG of purified IgG in 1 mL 0.02 M sodium bicarbonate
buffer, pH 9.5 and stirred for 2 hours at room temperature.
0.1 mL of freshly prepared sodium borohydride solution (4
mg/mL in H2O) and left overnight.
The solution was applied to a Baker Bond ABx HPLC
column equilibrated with 20 mM 4-morpholine ethane sulfonic
acid (MES), pH 5.6, and eluted with 500 mM (NH4)2SO4, pH 7Ø
Fractions were screened for activity at O.D. 280 and O.D. 403
and those fractions having the highest ratio of
30 O.D.~03/O.D.280 were pooled. BSA (10 mg/mL) and glycerol were
added (to ~inal concentration of 40%). The conjugate was
titered, divided into 1 ml aliquots, and stored at -20~C.
The following conjugate diluent was used: 40% Newborn
Bovine Serum (heat-inactivated), 10% Normal Human Serum
(heat-inactivated), 1% horse serum (heat-inactivated),
XC~ 70
0.05% aggregated immunoglobulin (human), 0.07% TWEEN-20, 1
mM potassium ferricyanide, amphotericin B (2.5 mg/mL),
gentamicin sulfate (50 mg/mL), in 0.05 M Tris and 0.15 M
NaCl, pH 7.4.
150 ~L conjugate was added to each control or test
well. The wells were covered and the plate agitated
briefly and incubated at 37C for 120 minutes. The cover
seal was removed and the wells washed 5 times with 1.5 ml
PBS containing 0.05~ TWEEN 20 (Sigma Chemical Co., St.
Louis, M0). The plate was inverted on a clean paper towel
and patted dry.
150 ~L substrate solution containing freshly mixed
tetramethylbenzidene and hydrogen peroxide solutions
(Kirkegaard & Perry Labs, Gaithersburg, MD) was added to
each well and incubated in the dark at room temperature.
50 ~L stop solution containing 4N sulfuric acid was added
to each well and the plate agitated gently.
The plates were read in a Molecular Devices VMAX
Reader at 450 nm.
EXAMPLE V
Stability of Solid Phase Captured HBeAg
an accelerated stability study was conducted on solid
phase captured HBeAg to determine the persistence of the E
antigenicity of the antigen. Strip wells were maintained
at 37C in a low humidity chamber 21 days. E antigenicity
was measured by O.D. units at 450 nm using the assay
described in Example IV. The results are presented in
Table I.
14
3~70
TABLE I
Day Reactivity
0 1.284
1 1.263
2 1.27~
3 1.235
4 1.204
1.210
6 1.153
7 1.136
8 1.203
9 1.159
1.116
15 11 1.146
12 1.093
13 1.075
14 1.106
1.095
20 16 1.061
17 1.025
18 0.963
19 1 . 010
0.985
25 21 0.972
As indicated, reactivity of captured antigen decreased
11.6% after 1 week at 37C, 14.0% after 2 weeks at 37~C and
24.3% after 3 weeks at 37C. From these results it is
predicted that captured antigen will retain acceptable
stability for over 9 months at 37C.
EXAMPLE VI
Specificity and Sensitivity of Anti-HBeAa Immllnoassay
Clinical specificity and sensitivity were demonstrated
by assaying 123 known negative and positive patient samples
and correlating to the Abbott HBe (rDNA) EIA Diagnostic Kit
(Abbott Laboratories, Deerfield, IL). 94 samples testes
positive (O.D. Ø5) and 29 samples tested negative tO.D.
40 ,005) using duplicate assays according to the method of
Example IV. There was a 100% correlation with the Abbott
~IA. The following formula is used for the cutoff (09.5)
x positive control + (0.5) x negative control = cutoff. An
3'~7~
assay is considered valid when the P-N (PCx-NCx) value is
greater than -0.5. Summary of the data are shown in Table
II.
'
TABLE II
ABBOTT EIA IMCLONE EIA
Pos. Mean .064 0.89
Neg. Mean1.430 1.023
Range.715-2.145 .512-1.533
P-N -1.367 -0.934
Cutoff .747 0.5~6
Although the invention has been described with
reference to the presently-preferred embodiment, it should
be understood that various modifications can be made
without departing from the spirit of the invention.
Accordingly, the invention is limited only by the following
claims.
