Note : Les descriptions sont présentées dans la langue officielle dans laquelle elles ont été soumises.
~ ~ WO 91/07508 2 ~ ~ g ~ ~ ~ PCT/US90/06613
hET~OD FOR MEASURI~G T-CELL SURFACE
ANTIGENS IN HUMANS
RELATED APPLICATION
This application is a continuation-in-part o-~ U.S.
Patent Application Serial No. 437,370, filed November 15,
1989.
FIELD OF THE INVENTION
This invention relates to a method 'or diagnosing a
pathological condition, via assaying or measuring
particular T-cell subtypes in a sample taken from a
patient suspected of having the pathological condition.
In particular, it relates to measuring cell surface
antigens of ~-cells which are characteristic of
particular T-cell subtypes.
RELATED P~TBLICATION
:
Portions of the invention described herein have been
presented in Kappler, et al., Science 244: 811-813 (May
19, 1989), the inventors' publication and the disclosure ~-
of which is incorporated by reference herein.
BACKGROUND AND PRIOR ART
In recent years, the mechanism by which mammalian
im~une systems, such as human and murine systems react to
infections, foreign antigens, and to so-called "self
antigens" in connection with autoimmune diseases has
begun to be established. See, in this regard, Grey, et
al., Scientific American 261(5): 56-64 (1989); Male, et
al., Advanced Immunology (J.P. Lippincott Company, 1987),
especially chapters 6 through 10.
WO91~07508 2 0 6 ~ PCT/US90/066
- 2 -
Well known, both to the skilled artisan and to the
general public is the role of antibodies, sometimes
referred to as "immunoglobulin" or the less correct and
older "gammaglobulin" in response to infection.
Antibodies are protein molecules which are produced by s
cells in response to infection. It is well known that
these antibodies act to "disable" or to inactivate
infectious agents in the course of combating the
infection.
In order for antibodies to be produced, however,
preceding events must occur which lead to stimulation of
the B cells which produce the antibodies. One of the key
e~ents involved in the processes leading to antibody
production is that of antigen recognition. This aspect
of the immune response requires the participation of
so-called "T-cells", and is less well known than the
antibody response commented on supra.
Briefly, and in outline form, antigen recognition
requires interaction of an "antigen presentation cell", a
"processed antigen", and a T-cell. See Grey and Male,
supra. The "processed antigen", in an infection, is a
molecule characteristic Or the pathogen which has been ~-
treated, i.e., "processed", by other cells which are a
part of-the immune system. The processed antigen
interacts with a receptor on the surface O r an antigen
presented in a manner not unlike a lock fitting into a
key hole or, perhaps more aptly, two pieces of a jigsaw
puzzle.
The configuration of the complex of processed
antigen and receptor on antigen presentation cell allows
the participation of T-cells. T-cells do not join the
complex unless and until the processed antigen has fit
into the receptor on the antigen presentation cell. This
receptor will hereafter be referred to by its scientific
name, the major histocompatibility complex (MHC), or the
human leukocyte antigen (HLA). Generally, MHC is used to
refer to murine systems, and EILA to humans.
... , . . ~.. ,.. . , ~ . . :
. . . - : . .- ,.. . . ~ ,
WO91/07508 ~ PCT/US90/06613
~ 3
These receptors fall into two classes. MHC~
molecules are lnvolved in most responses to pathogens.
In contrast, MHC-I molecules are involved when the
pathogen is a virus, or a malignant cell is involved.
When MHC-I participation is involved, there is no
antibody stimulation; rather, the interaction of MHC-I,
processed antigen and T-cell leads to lysis of cells
infected with the pathogen.
The foregoing discussion has focused on the events
involved in responding to "infection", i.e., the presence
of pathogenic foreign material in the organism. Similar
mechanisms are involved in autoimmune diseases as well.
In these conditions, the organism treats its own
molecules as foreign, or as "self-antigens". The same
type of complexing occurs as described supra, with an
antibody response being mounted against the organism
itself. Among the diseases in which this is a factor are
rheumatoid arthritis, diabetes, systemic lupus
erythromatosus, and others.
The ability of the T-cell to compleY. with the
processed antigen and MHC/HLA complex is dependent on
what is referred to as the T-cell antigen receptor,
referred to as "TCR" hereafter. The TCR is recognized as
a heterodimer, made up of alpha (oG) and beta (~
chains. Five variable elements, coded for by germline
DNA and known as "V~, J~, V~, D~, and J~" as well as
non-germline encoded amino acids contribute to the TCR. ;
See, in this regard, Marrack, et al., Immunol. Today 9:
308-315 (1988); Toyonaga, et al., Ann. Rev. Immunol 5:
30 585-620 (1987); Davis, Ann. Rev. Immunol 4: 529-591
(1985); Hendrick, et al., Cell 30: 141-152 (1982). ~ith
respect to the binding of TCR with processed antigen and
~HC, see Babbitt, et al., Nature 317: 359-361 (1985);
Buus, et al., Science 235: 1353-1358 (1987); Townsend, et
al., Cell 44: 959-968 (1986); Bjorkman, et al., Nature
329~i 506-512 (1987).
- -- , , ~ . . . . . .
:, : - : , - . -
:
WO91/07508 PCT/US90/0661
- 4 ~
Generally, both the alpha and beta subunits are
involved in recognition O r the ligand formed by processed
antigen and MHC/HLA molecule. This is not always the
case, however, and it has been found that so-called
"superantigens" stimulate T-cells with a particular V~
element, regardless of anv other element. See Kappler,
et al., Cell 49: 273-280 (1987); Kappler, et al., Cell
49: 263-271 (1987); MacDonald, et al., Nature 332: 40-45
(1988); Pullen, et al., Nature 335: 796-801 (1988);
Kappler, e, al., Nature 332: 35-40 (1988); Abe, et al.,
J. Immunol 140: 4132-4138 (1988); White, et al., Cell 56:
27-35 (1989); Janeway, et al., Smmunol. Rev. 107: 61-88
(1989); Berkoff, et al., J. Immunol 139: 3189-3194
(1988), and Kappler, et al., Science 244: 811-813 (1989).
This last reference discloses information which is also
incorporated into the subject patent application.
The "superantigens" mentioned supra, while generally
stimulating T-cells as long as they possess a V~
element, are somewhat specific in terms of the particular
form of the V~ moiety which is present on the
stimulated T cell. This feature is one aspect of the
invention, i.e., the ability to assay for particular
subtypes or subclasses of T-cells, based upon the cell
surface antigens presented by these subclasses.
Staphylococcus aureus has long been implicated in
morbidity and mortality in humans. See Bergdoll, in Feed
Bourne Infections and Intoxications (Riemann and Bryan,
ed., Acad. Press, N.Y.) pp. 443-494 (1979). The various
toxins presented by S. aureus are responsible for most
food poisoning cases, as well as severe shock, and other
life threatening pathological conditions. The mechanism
of action of the toxins associated with S. aureus is
unknown. The primary structure of the toxins, while
showing some relationship, also show some great
differences in primary structure. See Betley, et al., J.
Bacteriol 170: 34-41 (1988); Jones,- et al., J. Bacteriol
166:- 29-33 (1986); Lee, et al., J. Bacteriol 170:
. , ... . . . .. . ... .. , . ..... , ., . . . . ~ . . .
., ~ -
,
.
' ' ' , ~ . ' ~ ' .
WO9l/07508 2 Q ~ 3 ~ PCT/US90/06613
2954-2960 (1988); Blomster-Hautamaa, et al., J. Biol.
Chem. 261: 15783-15786 (1986). For the time being, it
cannot be said with any certainty whether the various S.
aureus antigens function in the same way in terms of the
immunologicai response they generate.
The ability of S. aureus to stimulate powerful T
cell proliferative responses in the presence of mouse
cells bearing MHC-II type molecules is taught by, e.g.,
Carlson, et al. ~. Immunol 140-2848 (1988); White, et
al., Cell 56 27-35 (1989); Janeway, et al., Immunol. Rev.
107: 61-~8 (1989). White, et al., and Janeway, et al.
showed that one of these proteins is not mitogenic, in
that it selectively stimulates murine cells which bear
particular V~ elements. These papers, however, did not
extend the study to human cells. It has now been shown,
however, that certain antigens do selectively stimulate
speci.ic V~ subclasses of human T cells, making it -
possible to diagnose pathological conditions by assaying
for particular V~ subtypes.
~0 Hence, it is an object of 'he invention to describe
a method for diagnosing a pathological condition in a
human by assaying a biological sample from the subject
being tested for levels of particular V~s subtypes.
These levels are then compared to normal levels, where
difference between the two is indicative of a
pathological condition.
It is a further object o~ the invention to carr, out
the assaying using antibodies which are specific for the
particular V~. subtype. Especially preferred are
monoclonal antibodies.
It is still another object of the invention to
perform the above described assay by measuring DNA coding
for specific V~ molecules. This can be done via
utilizing, e.g., the polymerase chain reaction.
How these and other objects of the invention are
achieved are detailed in the disclosure which follows.
': . : . ~ . ., . '.
: -: ~ . : . . - . , -
W091/0~508 2 Q ~ 8 ~ ~ 3 6 PCT/US90/066 ~
BRIEF DESCRIPTION OF THE FIGURES
Figure 1 shows the results of staphylococcal toxin
stimulation of human T cells.
Figure 2 depicts studies showing V~ specific stimulation
of T cells by toxins is donor independent.
Figure 3 depicts a standard curve used to normalize
polymerase chain reaction values (PCRs) to percentages of
T cells carrying particular V~s in mixed populations.
Figure 4 shows autoradiograms of coamplified cDNA of
human TCR transcripts following stimulation with anti-CD3
antibody or a S. aureus toxin.
Figure 5 presents in bar graph form V~ specific
stimulation caused by S. aureus toxins in three
individuals.
Figure 6 shows autoradiograms of T cell receptor
transcripts amplified by polymerase chain reaction from
cells Patient 1 (P) and control individual (C).
Figure 7 shows longitudinal changes in T cell repertoire
in 2 patients studied serially after toxic shock
syndrome.
DETAILED DESCRIPTION OF PREFERRED EMBODIMENTS
Exam~le 1
This experiment used monoclonal antibodies directed
against V~5, V~6, V,~8 and V~12, as taught by Yssel, et
al., Eur. J. Immunol. 16: 1187 (1986); Borst, et al., J.
Immunol. 139: 1952 (1987); Posnett, et al., Proc. Natl.
Acad. Sci. USA 83: 7888 (1986); Carrel, et al.,
~ . . ,
- , ,
.: - - : . :, . . :
,. .
- ~ .
WO 91/07508 2 ~ ~ 8 ~3~ PCT/US90/06613
7 --
Eur. J. Immunol 16: 649 (1986), and Bigler, et al., J.
Exp. Med. 158: 1000 (1983).
T cells of a human individual were first isolated
from that individual's peripheral blood. These T cells
were then examined before and after stimulation with one
of (i) anti-CD3 antibody, (ii) SEC2; (iii) SED, or (iv)
SEE. Items (ii), (iii) an~ (iv) are known S. aureus
molecules which act as toxins.
The anti-CD3 antibodies had been rendered
stimulatory by adherence to plastic bottles. The protein
was incubated on plastic surfaces for 8 hours at 4C.
Extensive washing removed non-adherent antibody.
Following this, either adherent antibody or a S. aureus
antigen was used to stimulate peripheral blood T cells.
Stimulation took place in the presence of
irradiated, autologous, non T-cells as described by
Kotzin, et al., J. Immunol. 127: 931 (1981), the
disclosure of which is incorporated b~ reference herein.
Three days after stimulation, live cells were
~Q collected and cultured for 24 hours in recombinant human
IL-2 (25 units/ml). This allows regeneration of
potentially modified receptors. Of the surviving cells,
about 10% were true blast cells.
The blast cell ractions were then incubated with
one of (i) purified antibody to CD3 or with a monoclonal
antibody to ~ii) V~5 (mAb lC1); (iii) V~6 (mAb OT145);
(iv) V~8 (mAb MX6~, or (v) V~12 (mAb S511). Following
incubation with the mAb, the cells were stained with
fluoroscein-conjugated goat anti mouse IgG, following
Kappler, et al., Cell 49: 173 (1987). The staining
pattern was then studied on an EPICS C device, uslng a
forward angle and 90~ light scatter pattern to gate large
blast cells, which were easily distinguished from small
lymphocytes, and constituted 50~ or more of all surviving
cells in culture.
The results of the staining patterns are shown in
Figure 1. Panels A-D shows the degree of staining using
the m~bs before stimulation. Panels E-H show it after
W09t~07508 2 0 ~ PCT/US90/066
- 8 -
stimulation with anti-CD3. Finally, panels I-L show the
pattern following stimulation with SED, SEE, and SEC2.
Each anti-V~ stained a definable percentage of the
peripheral resting T cells from this donor (Fig. 1). The
percentage stained ranged from 5.2% with anti-V~6 to 1.5%
with anti V~12 (Fig. 1, A to D). Culture with anti-CD3
and interleukin-2 hardly changed the percentage stained
with each an.i-V~ (Fig. 1, E to H), indicating that this
combination of T cell stimuli affected T cells bearing
different ~ receptors similarly. Culture with the
toxins had variable effects on the percentage of T cells
stained with each anti-V~ (Fig. 1, I to L).
Staphylococcal entertoxin (SE) D, for example, greatly
increased the percentage of T cells bearing V~5 in the
blast population and nearly excluded cells bearing V~6.
In contrast, T cells blasts stimulated with SEC2 were
depleted of V~6- and V~8 bearing T cells and were greatly
enriched in V~12 bearing T cells. Finally, SEE
stimulated V~8 T cells, while excluding cells bearing
V~12. Reciprocal results for each of the tox ns were
found if the resulting T cells contaminating the blast
populations were analyzed for V~ usage. After SEE
stimulation, for example, the resting T cells were
selectively depleted of V~ 8 cells. This result
indicates that the toxins are stimulating most of the T
cells bearing the appropriate V~s, nor a minor population
of these cells.
Five different donors were used in the experiments.
These donors were HLA-typed by standard serological
techniques, and their restring peripheral T cells were
stained with anti-CD3 and the anti-V~s. Each of the
anti-V~s reacted with a low but measurable percentage of
peripheral blood T cells from each of the individuals
(Table 1). For a particular individual these percentages
were extremely reproducible from one day to another. The
percentages of T cells that bore the different V~s varied
somewhat among individuals.
- ~ .- j, , . ~ -, -. - '
-, .. . ..
- - .~: . - . . .
, . . :, ,,, - - . - . : ~ ,,- . -
g
WO9l/07508 PCTtUS90/06613
Table 1. V~ expression o~ unstimulated human peripheral T cells.
Cell HLA type Percentage of T cells bearing
donor
A s C DR DQ v~5 v~6 V~8 V~12
BR 26 14 1.4 wl 3.9 3.3 3.2 1.3
28 38 ws3 w3
cw 24 7 3 4.6 w3 2.7 2.0 4.0 1.5
31 60 7 w52,w53
LS 2 8 w7 3.6 wl 2.6 5.2 3.6 1.5
62 w52
RC 1 35 w4 1.7 wl 3.2 6.1 6.5 1.2
11 37 w53 w2
SL 1 8 w7 3.6 wl 3.1 4.4 3.7 1.8
63 w52 w2 -
Exam~le 2
Cells from the different donors were stimulated with
anti-CD3 or the staphylococcal toxins and analyzed for
CD3 and Vp expression (Fig. 2). For each individual,
results were calculated as the percentage of T cell
blasts bearing a particular V~ after stimulation divided
by the percentage of T cells bearing that V~ before
stimulation. This calculation was designed to correct
for variations in VA expression from one person to
another. As before, anti-CD3 stimulated T cells bearins
the different V~ s uniformly; the ratio of T cells
bearing a particular V~ before and after CD3 stimulation
was close to 1. In contrast, it was clear that the
staphylococcal toxins varied markedly in their ability to
stimulate T cells bearing different V~ s. For example, T
cells bearing V~ 5 and V~ 12 were ~uite rich in blasts
produced by challenge with SEC3, whereas T cells bearing
V~ 8 were specifically excluded from the SEC3 blasts.
One or more of the toxins was a stimulus for T cells
positive for each of the V~ families (albeit weakly for
V~ 6), indicating that a toxin superantigen had been
identified for each of the V~ families. Conversely,
:
- . ~ . - ~ , . . . - ~,
,: : . .. - . ,.: , .:: . ~ , . ,: . :
wo 91/07508 2 0 ~ 8 ~ ~ ~ PCT~US90/066
- 10 -
toxins could be identified which specifically failed to
stimulate T cells bearin~ each of the V~ s.
It is remarkable that a characteristic stimulation
pattern could be identified for almost each toxin. SEC2,
for example, stimulated T cells bearing V~ 12 and
excluded cells bearing V~ s from the other three
families. This pattern was not seen with any of the
other toxins. SED stimulated T cells bearing V~5 and V~
12, had marginal effects on T cells bearing V~ 8, and
excluded cells bearing V~ 6. Again, this pattern was
unique to this toxin.
In some cases, stimulation with a given enterotoxin
yielded blasts that were neither enriched nor depleted
for expression of a given V~ by comparison ~-ith the
starting population. Starting and ending percentages of
V~ 5-bearing cells were similar, for example, in
responses to toxic shock toxin (TSST). Such a result
might indicate that only some Vp 5-bearing T cells were
stimulated by TSST. Perhaps the other variable
components of the receptor, VcG, JoG, or J~ , could quite
often prevent interaction of this toxin with V~ 5, a
phenomenon that has been noticed before for superantigen
reaction with mouse T cell receptor V~ s. Alternatively,
TSST may react with only one member of the V ~5 family.
Thus, in responses to TSST, the increase in blasts
bearing this member may be offset by a disappearance of T
cells bearing other members of the family, but also
reactive with lCl. Discrimination by superantigens among
different members of V~ families has been seen in mice,
where the self superantigen Mls-1 stimulates T cells
positive for V~ 8.1 but not those bearing Vp 8.2 or
V~ 8.3 (Kappler, et al. Nature 332: 35 (1988), and SEC1
stimulates T cells bearing V~ 8.2 but not those bearing
V~ 8.1 or V~ 8.3.
In some experiments, the percentages of T cells that
stained with anti~CD4 or anti CD9 were checked before and
after stimulation. The starting percentages were
.. ~ ,.. , .. .... . ., ..... ., :
.:. .~ ,' ~' ' ., ' : ' ' : ' .: . '' .
. ` WO 91/07S08 ~ 3 ~ PCT/US90/06613
; ~,., -- 1 1 --
vlrtually unchanged by toxin stimulation. T cells from
one donor, for example, were initially 78~ CD4+ and 23%
CD8 . After stimulation with the nine different toxins
the percentages in the blast of CD4 cells ranged from
74~ to 79~, and of CD8 cells from 20g to 25%, suggesting
that all these stimuli affected CD4 and CD8 cells
equally. It might have been expected that the toxins,
which are dependent on class lI MHC for presentation
would have preferentially stimulated CD4 cells, but such
is not the case.
One of the most striking features o the data in
Fig. 2 is the consistency of the results from one
individual to another. Thus, although the five people
tested had dirferent HLA types and different starting
pexcentages of T cells bearing the various V~ s (Table
l), the proportional changes n V~ expression in blasts -~
stimulated by each toxin were almost the same from one
individual to another. Although the superantigens - -
require class II MHC for presentation, the allele of
class II has much less impact on superantigen
presentation than it does on recognition of conventional -~
antigens plus MHC by T cells.
These results show that the staphylococcal toxins
are not indiscriminate mitogens for human T cells, but
are, in fact, V~ -specific. This result accounts for the
previously noted clonal specificity for such toxins.
Although each toxin is able to stimulate only a
subpopulation of all T cells in humans, they are still
powerful T cell stimulants, active at low concentrations.
Some or all of the toxic effects of these proteins in
humans may be mediated by their ability to stimulate
large numbers of human T cells. For example, the ability
of these toxins to induce secretion of large quantities
of lymphokines is probably secondary to their ability to
stimulate, in a V~ - specific way, a sizable percentage
of T cells. It is also possible that the ability of
these and other microbial-derived superantigens to
WO~1/07508 2 ~ PCT/US90/066
stimulate populations of T cells bearing particular V~ s
may be related to the dirferential resistance of
different individuals to the effects of these toxins and
also to the ability of microbial attac~ to induce immune
consequences, such as autoimmunity, in certain
individuals.
Example 3 -
The foregoing examples demonstrated a method for
quantifying T cell subsets having particular cell surface
phenotypes, using antibodies. This methodology calls for
interaction between the antibody and its binding
partners, i.e., the cell surface antigen, which is the V~
molecule.
Enhanced presence of the V~ molecules means that
there has been enhanced expression o the DNA coding for
the particular molecule. Thus, the following experiments
deal with the measurement of the aforementioned T-cell
subsets via analysis of the DNA expressing a particular V~
subtype.
Among the methods available to the skilled artisan
for analyzing DNA is the so-called polymerase chain
reaction, or "PCR" as used hereafter. PCR methodology is
well known to the art, as may be seen in, e.e.g, U.S.
Patent Nos. 4,683,195, 4,683,202 and 4,800,159, Saiki, et
al., Science 239: 487-491 (1988), and Chelly, et al.,
Nature 333: 858-860 (1988). Given that the PCR
methodology is known to the art, only the modifications
to the technology used are elaborated upon.
Total RNA was prepared from anti-CD3 stimulated
peripheral T cells as described supra. Two ~g of total
RNA was used for the synthesis of first strand cDNA using
reverse transcriptase (Amersham) and random
hexanucleotides~ The reaction was stopped by heating for
5 minutes at 95C before polymerase chain reaction.
One twentieth of each cDNA samples was co-amplified
using a V ~-specific primer with a C~ primer and two C~
primers as set forth at Table 2 with final concentration
, ...... . ,, .. ,,, . ................. .- - ., . .. . . -
: ........ : . - .. , . . . : : :- . . -, . ~ . . : .
. ., .. .: . ., , . . , . : :
~ WO91/07508 - l3 - PCT/US90/06613
,,. ~
of 0.3 ~M in each reaction. The amplification was
performed with 2.5 U o Taq polymerase (Per~in-Elmer) and
a Cetus Perkin Elmer thermocycler under the following
conditions; 95C melting, 55C annealing, and 72C
extension for l minute each. For quantification of
amplified products, coamplification was performed with 5'
P-labelled reverse primers (about 5x105 cpm each). The
amplified products were separated on 2~ agarose gels,
dried and exposed to X-ray film. The autoradiograms were
used to identify and cut out the V~ -C~ and C~ bands.
Each band was counted by liquid scintilation counter. In
control experiments, the relative amplification
ef.iciency was calculated essent~ally as described by
Chelly et al., supra. -
Table 2. Sequences of primers used for PCR
,
.,
~r~ ~egu-nc~ ~e~Dbes-a
5~ ~
~P~ GcAc~cAGTTcccTGACrTGcAc l.l~ 1.2
~CATCAACCATGCAAGCCTGACC~ 2.l~ 2.2~ 2.3
CTCTCTAGAGAGAAG~GGAGCGC 3.l~ ~.2
~CA~ATGAGAGTGGAT~GTCAT,T 4.1, ~ .S
~5-~ ~TACTTCAGTGAGACACAGAGAA~C 5.l
Y~5.2/3 ~TCCCTAACTATAGC~C~CAGCIG 5.2~ ~.3
Y~6 aGGCCTGA5GCATCCGTC~C 6.~ 6.2~ 6.3
~7 CCI~AAIGACCCAACAGC~CTC~ ~ 7.~
~8 A m ~C~r~AACAACAACG~CCG ~ 8.2~ t.j~ ~.4
~9 . CCTAAATC2CC~GACAAAGCTCAC 9.1
V~10 CTCCAAAAAC~CATCCTGTACC5T lO.l~ lO.2
V~li ~CAACAGTCTCCAGAA~AAGGACG l~.l, 1l.2
~12 AAAcGAGAAGTcTcAe~ 12.l 12-2
V~13.l CAAGeAGAAGTCCCCAAT 13~ lb
~13.2 CGTGAGGGTAC~CTCCC l~.2C
V~l~ GTC~C~CGAAAAGAGAAGAGGA~ l~-lC
~15 ~C~GTC~C~CGACAGGCACAGGC~ . lS.l,
Y~16 ~A~GACTCI~A~C~GG~TGAGTCC 16.l
V~l7 cAGArAe~AA~GAc~s~cAG 17.l
CAT¢AGTCACGA~TGCCAAAGGAA 18.l
~9 CAA~GCCCCAAGAAC6CACCGC l9-1
~2Q ~CC~C5GAGGTGCCCCAGA~CTC Z0.
~C~ 5~CTCATGCCTC~AA~A~
~C~ GA~CCC~CACCCTGCCGTGT~CC
~C~ A~CA~AAATTCGGCTAGGA~CC
~_l . ~ . ' '
- ~
,: . . , ;
, . : ' : ' , ~ , . . . , . . : ~ . , .
': ' , ` ' ~ ' , - : ~ . -
o~ ~
W09t/07508 PCT/US90/0661
- 14 -
Notes To Table 2
The size of amplified products (V~ bands! b~ V~
and 3'C~ primers ranged from about 170 to 220 bp. The
size of the amplified cDNA IC~ band) by 5'C~ and 3'C~
primers was about 600 bp. The 3'C~ primer used in this
study matches exactly both C~ 1 and C~ 2 DNA. The
sequences of V~ , C~ , and C~ are from previously
published reports.
aMembers of each V~ family which have identical
seque~ces as the correspondin~ primer are listed.
V~ 13.1, CV~ 13.2, and V~ 14.1 have also been
called V~ 12.3, 12.4, and 3.3, by Toyonaga, et al., Ann.
Rev. Immunol. 5: 585-620 (1987), Kimura, et al., Eur. J.
Immunol. _ : 375-383 (1987).
Among the at least 20 different families of human V~
genes, at least 46 different members of these families
have been cloned and sequenced, as reported by Toyonaga,
et al., supra; Concannon, et al., Proc. Natl. Acad. Sci.
USA 83: 6598-6602 (1986); Lai, et al., Nature 331:
543-546 (1988). To analyze human T cell V~ usage, 22
different V~ -specific oligonucleotides for use as 5'
sense primers for PCR were synthesized. Their sequences,
and the V~ 's which they would be expected to amplify,
are shown in Table 2. All the V~ 's indicated as
amplified have sequences matching their corresponding
primers exactly. There may have been other V~ genes
amplified with these primers. For example, the V~ 6
primer matches V~ 6.4 except for one nucleotide, and
further experiments will be needed to find out if V~ 6.4
is amplified using this primer. Altogether, all these
primers would be expected to cover at least 39 of the 46 ~-
sequenced human genes. Each V~ specific oligomer was
picked to have roughly the same G+C content and to be
located at relatively the same position in V~ .
:. . . - -: .... - , ~ - , . . . . ..
~ -. . , . .. . ~ ~, , .. . . . - . . - -
.. , :. :~ . - - - :: . :. : : .:
- . . . - , : :... . ,- , -, . - - . . .
.. .. ~. , . , : . , ..... .- :: . :: : .
. - .. , ... .. : : ,: . ...
., ... ., . . . '. - : ~
- ' ' ~ - ': . : . . -
- WO9l/07508 ~ PCT~US90/06613
- 15 -
Exa~le 4
.
Total RNA was prepared from human peripheral T cells
stimulated by anti-CD3 antibody or one of 5 different
S. aureus toxins (SEB, SEC2, SEE, exfoliatins toxin
(ExT), and toxic shock syndrome toxin 1 (TSST), as
described in the previous e~amples. At the time of
analysis these populations contained 50-90% T cell blasts
as judged by flow cytometric analysis. A single strand -~
complementary DNA was prepared for mRNA phenotyping,
following Buus, et al., Science 35: 1353-1358 (1987);
Townsend, et al., Cell 44: 959-968 (1986), and aliquots
of cDNA from each sample were amplified with each of the
22 5' V~ specific sense primers and the 3' C~ specific
antisense primer. As an internal control, TCR~ chain
mRNA was co-amplified in the same tube. Amplification
was performed with 25 cycles, a limited number use~ to
ensure that the amount of product synthesized was -
proportional to the amount of ~ mRNA in the original
preparation. The specificity Or each V~ specific primer
~0 was determined by the size of its amplified product and
hybridization to the amplified products of specific
probes (not shown). The amplification efficiencies of
four of the primer sets (5'C~ -3'~, V/~s , 3, and 8-3'C~) -
were determined as described by Chelly, et al., ~E~.
The average -_ficiency ranged about 46-48%. For each
sample the number of counts in the V~ band were
normalized to those found in the C~ band.
It was necessary to ~ind out whether or not the
relative incorporation in this PCR reaction was
proportional to the number of cells in the responding
population expressing a particular V~ element. However,
two possible sources of error had to be considered. The -
first of these was contribution from unstimulated T
cells. It was reasoned that, since mRNA levels are
extremely low in unstimulated T cells compared to T cell
blasts, the contribution from unstimulated cells would
only become a problem when the proportion of blasts
.
,,. ~ . - - - - . - . . . . . . . . . . .
, . .: - ' ' " ': ' .
'. .: ': ' ' ' ' : ' ~ ' ... . . ... .
W O 91t07508 2 ~ 8 P ~ /US90/066
- 16 -
expressing a particular Vp was very low compared to the
unstimulated cells. Secondly, since all T cells have the
potential to rearrange the ~-locus on both chromosomes,
transcription of V~ mRNA from a non-productively
rearranged chromosome in at least some T cells might
confuse the analysis. Since non-functional mRNA could be
expected to be at a low level due to its instability, it
was reasoned that this mRNA may only present a problem in
cases where a particular V~ element was poorly expressed
in the blast population.
In order to test these assumptions, the actual
percentage of T cell blasts expressing V~ 5.2/3, V~ 8 and
V ~12 in the various samples using flow cytometry and
anti- V~ monoclonal antibodies was determined prior to
preparing mRNA. When the normalized PCR incorporations
for V ~ 's 5.2/3, 8 and 12 for these samples were plotted
in a log/log plot against the percentage of T cell blasts
staining with these anti-V~ s monoclonal antibodies, a ~-
linear relationship was obtained (Figure 3) with the data
from three different experiments indistinguishable. This
relationship was most evident for values above 1%. Below
about 1~ V~, expression or a normalized PCR incorporation
- of about 30 the correlation was lost. It was concluded,
therefore that contributions from unstimulated T cells
and non-productively rearranged ~-genes were
ir.significant when Vfi expression in the blasts was
greater than 1~. Therefore, the data plotted in Figure 4
was used as a standard curve to analyze expression of -
V ~'s for which antibody was not used, estimating the
percent V~ expression from the normalized PCR
incorporation.
Example 5
The PCR methodology was used to analyze the
expression of V~ 5.2/3, V~ 8, V ~12 and 19 other V ~s or
V~ families in normal peripheral T cells stimulated with
the various toxins. T cells stimulated with anti-CD3
.
, . , - ~- -, -: - :,-: : : . .. . . . .
~-i` wo 9l/07s08 2 ~ PCT/US90/06613
- 17 -
were used as a control, because Examples 1 and 2 show
that stimulation with anti-CD3 did not significantly
change the percentages of T cells bearing particular
V ~ 's from that seen in the starting population. Results
are shown in Figure 4. The results of a complete
analysis of the response of T cells from a single
individual to five different S. aureus toxins are
summarized in Table 3.
': -
,~ .. .. ~ . : . . . . . : .
WO 91/07508 ~ 0 ~ 8 ~ ~ 1 8 - PCl/US90/06~
_ ., ~_
~ ~ _ ~ .
>~ ~ ~''S~ " `S ~ "'
.. ~ n~ &~
@ ~E ~ a~o;~ lag;8"P~S
__ ~ ~ . _ .'
.~ ~ ~ ~ ~ r ooo~ _
3 ~ ~ , rJ~n j~ ~
Y~ C~5~ 2' ~ _
1 ~ ` ~ o
s~ # ¦ ~ ~ 33~~ 3~ ~ ~ -
~r; ~ ~ n~
0 1~ 3 : 3 _ ~
~ I i 1~) 3 ~ ~ n n ~ _
_ 'Ç~ ~ Xn~ ~ ~ X~
o 1 ~ ~ ~ _
L~ ~ ~ ~ d ~ 33 ~ o
x _ ~ ~n~ ~
n I q 3~ ~ ~ ~
8 )~ ~ ~ O ~ ~ N ~ O~ ~ O O ~ ~ N ~ ~ ~ q ~ ~
3~ ~ Y ~o ~ n ' V ~ ~ ~ ~ ;i;
,, ~ ~ ~3~ 8 _
E~ ~ ~--~ '~ ~
_ _ ~ _
!` ~e~ 2
. . : . ` .
~ WQ 91/07508 2 ~ ? ~ PCT/US90/06613
Some V~ families were used more abundantly than
others by normal peripheral T cells. Members of the V~
2, 3, 6, 7 and 8 farnilies and V~ 13.1 were expressed by
more than 50~ o. total T cells. Such a finding was
perhaps not unexpected for V ~6 and V~ 8 which are part
of large families of V ~'s (although the V~ 6
oligonucleotide probably primes for only 3 of the 9
members of the Vl36 family), but is more surprising for
V ~13.1, which appears to be the product O r a single
gene. The uneven expression of V~'s by human peri-
pheral cells did not appear to be idiosyncratic for
this individual or determined by MHC, since similar
frequencies were seen for 2 other unrelated human donors
tested (see discussion, infra, and Figure 5).
Complete analysis of the expression of mRNA for all
20 families of human T cell receptor V~ genes showed
clearly that all the toxins preferentially stimulated T
cells expressing particular V~ 's, moreover the pattern
of stimulation was different for each toxin. A number of
20 striking new associations were found. Most dramatically -
V~ 2-bearing cells were highly-enriched by stimulation
with TSST. About 50~ of the T cells in TSST stimulated T
cell blasts had V~ 2. As was shown, supra SEB stimulated
T cells bearing V~ 12, but this analysis also revealed
stimulation of T cells bearing V~ 3, V ~14, V ~15, V ~17
and perhaps V~ 20 by SEB. The related toxin, SEC2, also
stimulated T cells expressing V ~ 12, V~ 14, V ~15, V~ 17
and V ~20, but not those expressing V~ 3. SEE stimulated
T cells bearing members of the V~ 8 family, as we have
previously shown, but also increased the proportion of
V~ 5.1 , V~ 6.1-3 , and V~ 18 cells.
Using this method, it was possible to estimate
roughly the percentage of all the T cells in a given
human cell population that could be accounted or by
summing those bearing the different V ~ s measured. As
shown in Table 3, this percentage was about 90~ for T
cells stimulated with anti-CD3, suggesting that the
.: . . . . ~
.: . . . .
, . ' .~ '
. .
W O 91/07508 ~ ~ P ~ /US90/066
- 20 -
estimate that the V~ oligonucleotides would prime for
expansion of mRNA's encoded by 39 of the 46 human V~.
genes is not exaggerated, certainly not by an order of
magnitude. This suggests that the 46 known V~ sequences
probably cover most of the human genes. The quantitative
PCR's accounted for a lower percentage Oc blasts
stimulated by some of the toxins, in particular, ExF. It
is possible that this toxin predominantly stimulates T
cells bearing V ~'s not covered by the listed primers.
Some of the most dramatic associations in Table 3
were tested in two additional human individuals to see
how general the phenomena were (Figure 5). The
stimulation experiments, and calculations, were identical
to those used suPra. In their responses to these toxins
the 3 individuals behaved almost identically. For
example, V~ 2 T cells were enriched by TSST to almost
the same level of 45% in every case. Similarly, in all
three individuals, SEB stimulated T cells bearing V~ 3
and SEE stimulated T cells bearing V ~ 8.
Example 6
The similarities between mice and humans in the T
cell response to these toxins in striking. In both cases
T cells bearing particular V~ 's dominate the response to
each toxin. In both cases the discriminatory powers of
the toxins can be particularly dramatic. For example, in
humans V~ 5.1 T cells responded to SEE, whereas cells
bearing V ~5.2/3 did not. Similarly, it has been
observed by the inventors that, in the mouse, several
toxins can distinguish among the members of the V~ 8
family. This member-specific response to superantigens
has also been seen in mice for the endogeneous
superantigen, Mls-l , which stimulates T cells bearing
V ~8.1 but not those expressing V p8.2 or V~ 8.3. See
- Kappler, et al., Nature 332: 35-40 (1988).
Extensive sequence analysis of vr~ genes rom mouse
and man shows that there are some homologues, both by
. -. - ~ ~ . - , . . , . ~ :
- ~ . .: .. . : . .~. - . . .. , . .; .. : ~ :
., . .. : ~ . -:
: : . . :- . : . . ,: .. -
: - : .. , .: . . . . : : .
,, . .. , ,.. - . . . . : :
WO91/07508 ~ J ~ PCT/VS90/06613
- 21 -
primary sequence, and bv their relative location in the V~
gene complex. See Toyonaga, et al., Ann. Rev. Immunol.
5: 585-620 (1987); Concannon, et al., Proc. Natl. Acad.
Sci. USA 83: 6598-6602 (1986); Lal, et al., Nature 331:
543-546 (1988). The stimulation patterns by the
different toxins O r these homologues by using data for
mice V~ stimulation by toxins was compared, followins
White, et al., Cell 56: 2/-35 (1989). As indicated in
Table 4, in some cases T cells bearing homologous V~ 's
show a similar pattern of response to the toxins. ExT
and especially TSST, for example, stimulated T cells
bearing human V ~ 2 and mouse T cells bearing the most -~
analogous V ~15. Human T cells expressing members of the
V ~ 12, 14, 15 and 17 families all showed a tendency to
respond to SEB and SEC2, but not ExT or TSST. This ~
property was shared by their closest murine relatives, -
mouse V ~ 's 8.1, 8.2 and 8.3. However, similar response
patterns by T cells bearing homologous V ~'s was not
always seen. For example, T cells bearing murine V ~3
responded to most of these toxins, however, those bearing
the closest human analog, V ~10, did not. Even with all
this information in hand, a close examination of the
primary amino acid sequences of the human and mouse V~
elements has not yet revealed the essential residues
responsible for toxin specificity. Thus, while tempting,
complete generalization from mouse to human systems (MHC
to HLA) is not indicated.
- - : ; . . .. .
-. ,. . .-~ :
- : . . .
- ~ . , - ., . - :. . . ..
-, - , ..... ... , , . 1 .
'- : . , .:
2 ~
WO91~07508 - 22 - PCT/US90/066
Table 4. Correlations Between Mouse and Human V
Usage in Response to S. Aureus Toxlns.
.. _ . _~
Enriohe~ ~n ~es~onsQ to
.. _ . _
S~B ~E~2 SEE Ex~ ~sS~
. , . . _ .
~OUS~ ~ IJ 8.
8.2
~-~
.
Ru~ 1~ ~ 6'7) t t -- -
i~o~olcgg ~2 (62)
~% Eos~o) 1~ (60) -_ * _ _
1~ ~s8a ~ , .
1 ( ~5 ) _ _ _ _ _
7 t~2) ~
- .
~OUs~ ~ t~ ~
~U~ 8 t71~ _ _ ~ _ _
~o~olo~ 3 ~ 6 0 ) _ _ * ~ ~:
t~ ~os:~o) ~t ~5~ _ _ + ~;
__ .
~Sou ~ ~ t
~n 2 ~6S~ ~
~o~olog .
~% ~o~) .
. . ,. - . .
~OU~ ~ 3 ~ +
~u~sa~ 67) _ _ _ _ _
Xorso~og~ 50 tS6) ~ .
- . .
.:: - , ,
.,
., ''~
WO91/07508 - 23 ~ $~ ~ PCT/US90/06613
In comparing mouse and man, the most striking
difference to emerge thus far in our studies is the
apparent lack of mechanisms limiting V~ expression in
humans. In the mouse, despite the potential for
expression of over 20 vfi elements in the species as a
whole, various mechanisms limit V~ expression in
individual mice. In some strains large genetic deletions
have eliminated about half of the V~ gene elements.
See, e.g., Behlke, et al., Proc. Natl. Acad. Sci. USA 83:
10 767-771 (1986). Other V~ gene elements are often
inactivated by point mutations. See Wade, et al., J.
Immunol. 141: 2165-2167 (1988). Most ingeniously, in
many strains of mice, self-superantigens, expressed
during T cell development lead to the deletion of T cells
bearing particular V~ elements during the establishment
of self tolerance. See in this regard Kappler, et al.,
Cell 49: 273-280 (1987); Kappler, et all, Cell 49:
263-271 (1987); macDonald, et al., Nature 332: 40-45
(1988); Pullen, et al., Nature 335: 79~-801 (1988);
20 Kappler, et al., Nature 332: 35-40 (1988); Abe, et al.,
-
J. Immunol 140: 4132-4138 (1988). It i~ proposed that
these mechanisms which lead to limited V~ expression in
individual m ce may be a protective evolutionary response
to the pressure exerted by bacter al toxins, so that in a
population of mice some individuals will be relatively
resistant to the effects of any particular toxin
superantigen. No evidence for widespread similar
mechanisms in humans has emerged thus far from the
limited number of individuals examined. Thus large
genetic deletions have not been found nor have
self-superantigens which cause elimination of T cells
bearing particular V~ been observed. A closer
examination both of individual members of the V~
families and of larger human populations, especially
those with a much more widespread exposure at an early
age to these types of toxins, may be required to observe
some of these mechanisms at work in humans.
,
- . . . :, ~ - - : . . - - - :.. .
. .' ' ' : ' . . '.' '~ ' . :
'''' ` ' ' ' ~' ~ ' ' " . ~ ' '
,
'
wo 9l,07508 2 ~ 24 - PCT/US90/066~
Example 7
Patients (9 in total) were all diagnosed as having
toxic shock syndrome by their private physicians. They
were then screened to determine if they met the
definition for severe toxic syndrome as jointly created
by the Centers for Disease Control and several
investigators. See Todd, Clin. Microbiol. Rev. 1:
432-466 (1988); Reingold, et al., Ann. Intern. Med. 96:
875-80 (1982); Wisenthal, et al., Ann. J. Epidemol. 122:
10 847-56 (1985). Major criterial (all required) for the
diagnosis include fever (>39.8C), rash (diffuse
erythematous rash evolving to desquamation), and
hypotension (systolic blood pressure C90 mmHg for adults --
and/or orthostatic syncope or dizziness). Minor criteria
(3 required) for the definition include diarrhea and/or
vomiting, muscular involvement, mucous membrane
hyperemia, decreased renal function or pyuria, elevated
liver enzymes, platelet count ~100,000/mm3, and
disorientation or altered state of consciousness. All ~
20 patients studied also had at least one probable focus of ~ -
S. aureus infection. As a control, in addition to normal
.
individuals, one patient with severe toxic shock syndrome
associated w_th group A Streptoccocus pyogenes (Stevens,
et al., New Eng. J. Med. 321: 1-7 (1989) was also
studied.
Disease in four patients appeared to be related to
menstruation and tampon use. S. aureus was cultured from
2 of these patients, and the vagina was presumed to be
the site of S. aureus infection in the remainder. The
development of toxic shock syndrome in Patient 6 appeared
to be related to an S. aureus vaginal infection four
weeks after cesarian section. Disease in Patient 4 was
associated with sinusitis from which S. aureus was
cultured. Eposides in two children (Patients 7 and 8)
were associated with subcutaneous abcess of the buttocks
and peritonsillar cellulitis, respectively. S. aureus
was cultured from both foci, and these isolates produced ~ -
WO91/07508 2 ~ ~ g ~ PCT/US90/06613
- 25 -
TSST-l as well as entertoxins A and C in vitro. Patient
3 had previously experienced more than 10 episodes of
toxic shock syndrome thought to be related to upper
respiratory and sinus infection with S aureus. Despite
being prophylactically treated with dicloxacillin, she
required hospitalization for the clinical episode of
toxic shock syndrome studied here. At the time of
hospitalization, a culture of the nasopharynx was
negative for S. aureus. Thus, with the possible
exception of this latter patient, toxic shock syndrome in
the nine patients studied appeared to be related to focus
of S. aureus infection. The time from acute onset of
symptoms and from initiatlon of treatment (including
antibiotics) to the tlme samples were obtained for
analysis of T cell subset changes is also listed in Table
S. At the beginning of the study, it was unclear as to
how long abnormalities in T cell subsets would persist
after the toxic shock syndrome, and no restriction was
placed on this variable.
.
.. ~ . . . ;-
., .
- ,
. . . : , ' . . . : , ' ' . : , . ' . . . :
WO 91/07508 2 ~ 2 6 - P~/US90/066
T~blc 5
Clinic~l Cll~r~ctcristics ot B:llicll(s S~u(li~
Sourcc of S,~urcu~ Major Minor Cullurc of Days ~ronl o nscl of
nl ~ 5c~ infection Critcri~t*~s~2+' Sourc~/Enlcroto.<in syml)toll~s/trc;llmcllt
- production++ lo ririt blo- d s;~ plc
32/E va~ina, allA,B,C,D, ND 14/10
mcnstluation~ ed E,F,C
218/F va~in~, allA,B,C.D, ND,~ gn
menstn~ion-relatcd E
321/I: none~ 311A,B,C Nc~ 6/5
426/F sinus allA.B,C,D, S. ~urclls, 152/150
E,G not tesled
513/F va~im, allB,C,E S. ~urc~, 13/11
menstruation-relatcd not tested
623/F va~in~, allC,D,G S. ~ureu~. 8n
post-surgical not tcstcd
716/M buttocks allA,B,C,D, S. itureus, 4/3
abscess E TSST-I, A,C
S- 8/1: pcritonsil~r ~11A,B,C,D S. aurct~ /3
ccllulitis TSST-I, A,C
9I~/F v~gina, ~11A,C,D ~ ;turcll!;, 1/3
mctlstru~tion-rcl:Ltcd TSST-I, C
~ .
. . , - - . - - . - . - -: - .: . - . - -- -
WO91/07508 ~ PCT/US90/06613
- 27 -
. .
Major criteria include fever C>102F), a characteristic
erythematous rash that subsequently i5 followed by
desquamation, and hypotension.
Minor criteria include A, gastrointestinal symptoms
tvomiting or diarrhea); B, muscle involvement (cleaved
CPK or sever myalgias); C, hyperenia of the mucous
membranes; D, renal functional impairment or pyuria; E,
laboratory evidence of hepatic dysfunction; F,
thrombocytopenia (platelet count ~100,00/mm ); and G,
lQ disorientation or altered state of consciousness.
Patient 3 had at least 10 prior episodes of toxic shock
syndrome. Several of these had been associated with
sinusitis, and previous evaluations had included positive
cultures of S. aureus from the nasopharynx and sinus. The
patient was being treated prophylactically with antibiotics,
and at the time of this hospitallzation, all cultures were
negative for S. aureus.
In some of the later cases studied, the source of
infection was cultured and S. aureus isolates were tested
for in vitro production of enterotoxins, A,B,C1,C2,C3,D
and E, and TSST-l. . . -
Not done.
. - i .- , ... . - . ~ : ~ : - : :
: , .
. . . ..
WO91/07508 ~ PCT/US90/06613
- 28 -
Peripheral blood mononuclear cells taken from the
patients were isolated from heparinized blood following
Ficoll hypaque gradient centrifugation. Stimulation of T
cells were accomplished as described supra in plastic
flasks coated with purified anti-CD3 antibody. Cells
were cultured at lxlO~ cells per ml in media containing
P~P~II 1640 supplemented with 2 mM glutamine, lO mM hepes
buffer, lO0 u/ml penicillin, lO0 ug/ml streptomycin, and
lO~ fetal calf serum. After three days of culture, live
cells were harvested and cultured for an additional 24
hours in 25 u/ml recombinant human IL- to expand cells
expressing the receptor for IL-2 while allowing
regeneration of potentially modulated T cell receptors.
The cells were then harvested, washed and used for either
indirect immuno~luorescence staining or quickly frozen in
liquid nitrogen for subsequent RNA extraction.
Indirect immunofluorescence was performed bv ~ -
incubating cells with saturating amounts of monoclonal
antibody, and then staining with a fluorescein-conjugated
goat anti-mouse Ig(Tago, Inc., Burlingame, CA) was
described supra. Control samples included cells stained ~-
with the second-step reagent alone, and background values
were subtracted. Forward angle and 90C light scatter -
patterns were used to gate on the large lymphoblasts,
which were easily distinguished _rom small lymphocytes
and which comprised the great majority of all viable
cells. Fluorescence intensity was determined using an
Epics C cell sorter. Monoclonal antibodies used as
staining reagents were directed to CD4 and CD8, and to
epitopes on T cell receptors bearing V~ 5, V ~6, V ~8,
and V ~12, again as described supra.
Total RNA was prepared from anti-CD3 stimulated
cells as described and total RNA was used for the
synthesis of first strand cDNA using reverse
transcriptase, also as indicated suPra. Similarly, cDNA
was amplified using the polymerase chaln reaction as
described in Example 3.
,~
'; ' , : , :,, . ::, , , . - . - . , ,
.. ~ . , , . - : .. - ~
, . , . ., . , , ., . ~ ~-
.
WO9l/07508 2 a ~ PCT/US90/06613
- 29 -
In a fashion similar to Examples 1-6, peripheral
blood mononuclear cells were isolated from patients and
controls, and T celis were stimulated in culture with
anti-CD3 antibody and IL-2. Using cDNA made from total
RNA isolated from the T cell blasts and a quantitative
polymerase chain reaction, T cell receptor gene segments
encoding V ~2, V~5 (5.2 and 5.3), V~ 8 (8.1 and 8.2), -
and V ~12 were amplified and quantitated. To control for
the amount of T cell receptor ~RNA and variation in
reaction rate, a C~ gene segment was also amplified in
each reaction. Figure 6 shows results with T cells from
Patien, 1 and a concomitantly-studied normal individual.
A striking increase in amplified V~ 2 DNA is apparent in
the patient compared with control, whereas little
difference is observed in the C ~ products. There is
also little difference between patient and control in the
amount of V~ 5, V~ 8, or V ~12 product especially when
normalized to the relative amount of C ~ amplified in
each reaction.
The data in Table 6 are expressed as a ratio of Vp
DNA to C~ DNA amplified in the same reaction. Although
all Oc the controls (studied concomitantly with patients)
had V ~ 2/C~ ratios less than or equal to 0.10, initial
samples from 5 of the 9 patients had ratios greater than
0.17 (p=0.03 by Fisher's exact test) with one, for
Patient 1, as high as 0.78. Abnormal V~ 2~C~ ratios
were demonstrated in 3 of the 4 patients with
menstruation-related disease and in 2 of the 5
nonmenstrual cases. In contrast to V~ 2, none of the
other V~ /C ~ ratios were increased more than 2 SD above
control values, indicating the selective nature of
V~ 2 expansion in toxic shock syndrome. Tt shoul~ be
noted that among the patients not demonstrating increased
V ~2/C ~ ratios (Patie`nts 4,6,8,9), one (Patient 4~ was
studied a relatively long period after the acute disease
such that an increased level could have been missed.
.
.
. .
. - . . :. . . ... : . , . . . . , ~
.: . . :........ :. . . . . : . . , . . :
. ~ ... . . : : .
. :: . . - , -
2 ~ 5 ~ 3 () -
WO 91/07508 PCI/US90/066
T;lblc 6
Vp Expression in l'eripller~l 131Oo(l T Cells l;r(lm l'~tiellls
~villl l`oxie Sllock Syn~lrome
V13/C Ratio~
P;ltien~ #V~2 VB5t V~8# V,B 12
Q78 0.07 0.03 0.0~
2 0.25 0.02 0.01 0-03
3 0.18 0.~3 0.03 0.03
4 0.07 0.02 0.03 0 03
0.18 0.04 0.03 0.01
6 0.11 0.04 0.04 0.01
7 0.46 0.04 0.03 0.01
8 0.08 0.04 0.04 0.0 1
9 0.05 0.04 0.04 ().01
Cont~ols (N=7)
(me~n + S.E) 0.0~+0.01 0.05+0.01 0.025+0.01 0.03+0.5)1
~ D~t~ ~re presenled for the initi31 s~nple obt~ined frorn e~ch p~tient (see T~l~le I ).
+ A prin~er specific for ~ sequencc eornmon to V,BS.2 ~nd V~B5.3 f~mily memocrs w;ls us~
~Apr.itnerspecificfor~sequencecommontoV~8.1~ndV~8.2f;mlilymemb~rsu~;lsuse~1. -
. . - ,, ; - .: :
. ..
WO91/07508 2 ~ PCT/US90/06613
- 31 -
T cells isolated from patients and controls were
also analyzed for subset alterations by indirect
immunofluoresce and cytofluorographic analysis. No
consistent alteration in the percentage of CD4 and CD8
T cells were noted even in patients with markedly
elevated V~ 2 levels. The ranges of CD4 and CD8 T cel'
percentages were 30-84~ and 14-60%, respectively, in
patients compared with means (+ SE) values of 64 + 5.1%
and 29 + 4.6~ for control ndividuals. Cells from 7 of
the patients were also stained for the expression of V~
5, V ~6, V ~8, and V ~,12. Consistent with the above
analysis by the quantitative polymerase chain reaction
technique, values outside the normal range were not
observed for these non-Vf~12 T cell subsets. Mean + SE
values or patients vs. controls ~N=12) were: V~ 5,
~.4+0.25 vs. 3.1+0.30; V p8, 4.3+0.63 vs. 3.7+0.50; V~ 6,
3.0+0.46 vs. 3.4+0.41; and V ~,12, 1.6+0.14 vs. 1.5+0.09.
Examples 1-6 show that the efficiency of V~ 2
ampli,ication is similar to that .or V f, 5 and V ~8,
supporting the validity of estimating the percentage of
circulating T cells expressing V f~ 2 by the polymerase
chain reaction method. The results suggest that V~,2 T
cells in normal individuals are approximately 10% of the
peripheral blood T cell population. In contrast, peak
values for patients l and 2 may be as great as 70% and
30~, respectively, emphasizing the striking stimulation
of V~, 2 T cells occurring in some patients.
One patient with severe toxic shock syndrome
associated with group A streptococcus was also studied.
All ma]or and minor criteria for the definition of toxic
shock syndrome were present, and the patient died
approxlmately too weeks after hospitalization. The
patient was studied within one week of the onset of
symptoms, and the V~j2/C d~ ratio was 0.08, clearly
within the normal range.
- .- : . , - . . . ~ ::
.- . . : . - . ..
- - ~ - :, . . :
- - : - . .
: . . . . . .
- . , - . ' : . ~ : , , :: '
WO91/07508 2 3 ~ PCT/US90/066
- 32 -
Example 8
Serial samples were obtained from two patients to
examine longitudinal changes in T cells expressing V~ ?
after the acute disease. V~ 2 T cell percentages in
Patient 1 decreased by half within 2 weeks after the
initial determination and were almost normal by 60 days
after the onset of the acute disease (Figure 7 - top
panel). Patient 2 demonstrated near-normalization of V~2
levels within ~5 days of the acute episode (Figure 7 -
bottom panel). These serial studies also emphasize the
relative lack of fluctuation over time in T cell subsets -
expressing other V~ segments, an observation also made
in studies of normal individuals some of which are
discussed su~ra.
The foregoing examples show that a pathological
condition, such as an infection, can be diagnosed by
assaying a sample from a patient to determine levels of ~-
particular V~. molecules in the sample. Increased levels
of specific subtypes have been found to be linked to
particular antigens, as the results show.
The term "pathological condition" as used herein is
not limited to an infection; rather, it refers to any
condition where an abnormal immune response has occurred.
This includes, e.g., autoimmune diseases where, as has
been shown supra, specific V~ type molecules are present
where they should not be, or are present in quantities
above those found in normal individuals.
Increases in V~, quantities are not the only way to
diagnose pathological conditions in accordance with this
invention. The art is familiar with various diseases and
pathological states, such as HIV infection, where T cell
levels are below those normally encountered. Correlation
of particular V~ types to conditions characterized by T
cell depletion are also embraced herein.
Examples 7 and 8 shows that a selective increase in
circulating T cells expressing V ~2 is frequently
assoc~ated with toxic shock syndrome. Other T cell
-
; . : . . . , . : . .: . :
~ ~ ., . - .................. ,. . . : . .
- - ~: -, . ,
WO91/07508 ~ ~Vu~ PCT/US90/06613
33 -
subsets studied including those expressing Vf35, Vl,8,
and V ~12 were not increased above normal levels and did
not ~luctuate over time. Thus, measurement of the
proportion of T cells expressing V~ 2 in peripheral blood
could be used as a diagnostic test for this disease.
Diseases that result in nonspecific T cell activation
should not lead to a selective increase in Vf~2 T cells.
It should also be emphasized in TSST-l and other S.
aureus enterotoxins stimulate cells bearing particular
V~ segments almost regardless of the composition of the
rest of the T cell receptor on these cells. Other
variable elements (D~ ,, V ~ , J ~) do not appear to
contribute much to the recognition of these V~ - specific
superantigens as they do for conventional antigens.
Thus, although it is possible that some conventional
antigens may also stimulate a subset of T cells expressing
V~ 2, the magnitude of this response with the frequency
of responding T cells being much less than l in l00 would
be only a small frac.ion of that resulting from
stimulation of TSST-l. It seems unlikely that such a
response could change circulating levels o r V~ 2 T
cells.
It is apparent that not all of the patients with
toxic shock syndrome in this study demonstrated elevated
V~ levels. One patient was studied nearly five months
after the acute illness, and elevated levels could have
been missed. This possibility is corroborated by the
serial changes in two patients, in which a return to
near-normal levels occurred within one to two months ~ -
after presentation. Examples 1-6 indicated that S.
aureus toxins other than TSST-l do not stimulate V~ 2 T
cells but do stimulate other sets of T cells in a V~-
specific fashion. Thus the experiments set forth in
Examples 7 and 8, which focused on T cells expressing
V~2, are likely to detect abnormalities only in TSST-l
mediated disease. Future studies that include the
measurement of T cell subsets likely to be expanded by
~. ; . -
WO91/07508 ~ 34 PCT/US9~/06
these other toxins may increase the frequency of positive
tests. As predicted, the patient with fatal shock
syndrome associated with group A streptococcus did not
have elevated levels of circulating V~ 2 T cells.
The data presented here indicate that during to~ic
shock syndrome T cell stimulation occurs on a scale not
observed in response to conventional antigens, and it is
proposed that this massive T cell activation is a critical
event in the development of disease. These activated T
cells are likely to be releasing IL-2, interferon-gamma,
lymphotoxin (TNF-~), and a variety of other less
well~characterized lymphokines. See ~.icusan, et al.,
Immunology 58: 203-8 (1986). IL-2 infusions have been
associated with a high frequency of induced hypotension
as taught by Belldegrun, et al., Ann. Int. Med. 106:
817-22 (1987); Ann. Int. Med. 109: 953-8 (1988). The T
cell activation process and/or release of IL-2 could also
greatly enhance or be required for the release of IL-l
and TNF by macrophases. Nedwin, et al., J. Immunol. 135:
2492-7 (1985). If T cell activation is required for
expression of toxic shock syndrome, T cell depletion or
functional inactivation should interrupt the cascade of -
events in S. aureus toxin mediated disease. This may be ,
partially supported by studies suggesting that
administration of corticosteroids early in the disease
course mav produce beneficial effects in some patients.
See Todd, et al., JAMA 252: 3399-3402 (1984).
In this initial study, patients were not studied at
the time of initial presentation. Kinetic studies where
therefore limited to following changes in T cell
repertoire after the initial increase in percentage of
V~2 T cells. The return of this subset to relatively
normal levels was surprisingly rapid in the-two patients
that were serially followed. The fact that levels do
return to normal indicates that the increase in V~ T
cells occurs after the onset of toxic shock syndrome and
is not a factor influencing susceptibility. The
- ~ ., ' .' ' ' . : ,. '
~: . ,' ' ~ . ,
W091/07508 PCT/US90/06613
35 -
' ~L.
mechanisms responsible for the decrease in circulaLing
V~2 T cells with time are unclear. Studies in rodents
after immunization have indicated that after activation
and expansion in numbers, antigen-specific T cells
emigrate from lymphoia tissues (the site of antigen
activation) into the recirculating pool (i.e. thoracic
duct lymph). See Sprent, et al., Cell Immunol. 2: 171-81
(1971); Wilson, et al., J. Immunol. 116: 1030-40 (1976).
These cells gradually decrease over time, perhaps
reflecting their return to lymphoid tissues and/or the
continuous entry of other antigen-activated cells into
the recirculating pool.
The terms and expressions which have been employed
are used as terms of description and not of limitation,
and there is no intention in the use of such terms and
expressions of excluding any equivalents of the features
shown and described or portions thereof, it being
recognized that various modifications are possible within
the scope of the invention.
.
- . . - ,. - ~ , : . - .
; - ' ~' ~ . :. . ' `
