Note : Les descriptions sont présentées dans la langue officielle dans laquelle elles ont été soumises.
PCT/US91/06006
W O 92/06186
3 (gq ~
grk~ CATION
TITLE: Cloning Cartridges and Expre~sion
Vectors in Gram-Negative Bacteria
1NV~N 10R: ~wang-Mu Yen
W O 92/06186 PCT/Us91/06006
20~i~'741
-2-
pA~ )IJND OF T~E lh~/~h-lUI!I
An expression plasmid vector is an indispensable tool for
the study of gene expression in bacterial cells. The need to
tevelop expression vectors is particularly acute for little-
studied bacterial strains in which gene expression needs to beassessed. At least two approaches can be i ~ginPd for the
introduction of an expression vector into these bacterial strains.
A native plasmid, if it is known, can be converted into an
expression vector or a broad host range expression vector can be
introduced into these strains. The native plasmid of a poorly-
studied strain is usually not very well characterized. Genetic
elements essential for regulated gene expression have to be
introduced from other sources in order to convert it into an
expression vector. A number of broad host range vectors have
been developed for Gram-negative bacteria (see Bagdasarian et al.,
1983, Gene 26: 273-282; Mermod et al., 1986a, In: Sokatch, J.R
and Ornston, L.N., (Ets.), The Bacteria. A Treatise On Structure
and Function, Vol. 10. A~dl ic Press, Orlando, p. 325-355; and
Schmi~h~cer et al., 1988, Vectors A SurveY of Molecular
Clonin~ Vectors and Their Uses (Rodriguez & Denhardt, eds.),
Butterworth, Boston, pp. 287-332 for reviews). However, only a
few of these vectors (Bagdasarian et al., 1983, Gene 26: 273-
282; Mermod et al., 1986b, J. Bacteriol. 167: 447-454; Furste et
al., 1986, Gene 48: 119-131) allow any type of regulated gene
expression.
The regulation of naphthalene catabolic genes carried by the
NAH7 plasmid has been well studied (for review, see Yen and
Serdar, 1988, CRC Crit. Rev. Microbiol., 15: 247-268). The NAH7
plasmid is a naturally-occurring plasmid in the Pseudomonas putida
(P. putida) strain G7 (~TCC 17485). It carries catabolic genes
for the degradation of naphthalene to Krebs cycle intermediates
These ~enes are organized in two operons. The first operon
encodes enzymes for the conversion of naphthalene to salicylate
(upper pathway) and the second operon enco~es e..zy -s for the
oxidation of salicylate to acetylaldehyde and pyruvate (lower
pathway). Both operons are activated in the presence of the
-
206974~
-3-
in~Vcer salicylic acid, or some of its analogs, and the product
of the regulatory gene, nahB. The nahR gene maps upstream from
the lower pathway operon and next to the nahG gene which encodes
the enzyme salicylate hydroxylase. The two genes,
nahR and nahG, are transcribed in opposite directions and their
promoters, PR and PG. share sequences. While PG is subject to
the positive regulation of NahR protein, PR directs the synthesis
of NahR protein constitutively. The nucleotide sequences of
nahR, PR and PG have all been determined (Schell, 1986, J.
10 Bacteriol. 166: 9-14; You et al., 1988, J. Bacteriol. 170: 5409-
5415; and Schell and Sukordhaman, 1989, J. Bacteriol. 171: 1952-
1959). A bacterial DNA expression unit based on the nahR-pG
regulatory system has not been suggested or prepared for use in
the construction of expression vectors. New vectors of broad or
narrow host range that allow regulated and more efficient gene
expression and are more convenient to use still need to be
developed. Construction of a DNA restriction fragment carrying
all of the elements essential for gene cloning, selection and
expression would facilitate the development of expression vectors.
Such a cloning cartridge, if it could be constructed, could then
be inserted into a replicon of either broad or narrow host range
to convert it into an expression vector. PCT Application
PCT/GB89/00341 (Publication No. W089/09823, 10-19-89) describes a
xYlR-derived regulatory cassette from a TOL plasmid for bacterial
expression vectors. This cassette contains only the x~lR gene
with the binding site of its gene product XylR and associated
promoter (Pu)~ The gYlB~Pu cassette is not easily transferable
among replicons because there is no selective marker on the
cassette. In addition, there is: (i) no transcription
terminator, (ii) a paucity of cloning sites, and (iii) no
engineering of the promoter to allow precise insertion of a
fcreign gene for optimal expression. In particular, with respect
to (iii), there is no restriction site engineered to include the
ATG sequence encoding the initiation codon, and there appears to
be -1.5 kb of uncharacterized DNA separating the promoter region
from the cloning site (see Keil et al., J. Bacteriol. 169: 76~-
-
W O 92/06186 PC~r/US9l/06006
206974~.
.
-4-
770 (1987) and Harayama et al., J. Bacteriol. 171: 5048-5055
(1989)) which could likely reduce expression of a cloned gene
The regnl~tion of the ~Y13/PU cassette requires the use of toxic
chemical in~eers, such as toluene. Several constructs using a
~YlB/PU cassette are mentioned, but no expression data is given
to det~, 'n~ the usefulness of such constructs. There is,
therefore, a need to develop new cloning cartridges and
expression vectors that overcome the deficiencies of previously
describet expression units, including the cassette and vectors
10 described in PCT/GB89/00341.
W O 92/06186 PCT/US91/06006
2069741
SFVVA~ OF THE ~hv~h~lON
According to the prese~t invention~ a Gloning cartridge and
its derivative have been s~rcessfully constructed based on the
NahR-regulated gene expression system. The two cartridges (also
called cassettes) were tested on a derivative of the broad host
range plasmid pKT231 (Bag~ rian et al. 1981, Gene 16: 237-247)
for use in gene cloning and expression in different bacterial
hosts. Plasmid vectors ca..~ing one of the cartridges have
allowed cloning and in~urihle expression of several tested genes
in all of the Gram-negative bacteria tested to date. High-level
protein production from a cloned gene was also demonstrated. The
DNA elements assembled in the cloning cartridges provide
previously unavailable convenienre and efficiency in gene cloning
and expression in Gram-negative bacteria. In addition, cloning
cartridges according to the present invention cont~i ned on an
-3.6 kb restriction fragment allow efficient (e.g., single-step)
construction of expression vectors in a wide variety of Gram-
negative bacteria.
The present invention is directed to a cloning cartridge or
cassette which comprises five el~ ~.te essential for efficient
gene cloning and expression, based on the NahR-regulated
expression system. The five elements comprising a cloning
cartridge according to the present invention are: a gene
encoding drug-resistance, a nahR gene, a promoter PG regulated
by the D~k~ gene product, a multiple cloning site, and a
transcription terminator. A useful drug-resistance gene is the
gene encoding tetracycline-resistance (tetr) derived from the
pBR322 plasmid. In the cloning cartridge, the sequence upstream
from the Hind III site in the promoter of the tetr gene was
replaced with the nahR seq~enre. This sequence substltution
generated a new hybrid promoter for the tetr in the cartridge and
had the effect of stabilizing a plasmid carrying a cloning
cartridge according to the present invention in the absence of
selection. The nahR gene in the cloning cartridge is derived
from the NAH7 plasmid naturally occurring in P. putida. It
e~ro~es the protein, NahR, that positively regulates the promo~er
WO 92/06186 PCr/US91/06006
2069741 -
-6-
PG of the lower pathway operon for naphrhslenP degradation. The
promoter PG is activated in the presence of the NahR protein and
an j.~ ,c~ c and inexpensive in~cer, sodium salicylate at low
conrentrations (0.35 mM or lower). Uithin the promoter PG of the
cloning cartridge, a sequence of 3 nucleotides upstream of the
ATG se,~ence enroding the initiation codon was altered to create
an NdeI cloning site which was followed by a number of other
cloning sites in the order of 5' - HpaI - ClaI - ~_I - K~nI -
SscI - ~b~I - 3'. The 5' end of a characterized gene can be
converted into an NdeI site without altering the coding property
and cloned into this cartridge for regulated expression. A
transcription tDrminltor derived from plasmid pCFM1146 was placed
r~ly downstream to the multiple cloning site of PG.
A novel five-element portable cloning cartridge according
to the present invention was assembled as an -3.6 kb EcoRI -
PstI fr~ ~ t, which can be easily inserted into a variety of
tifferent replicons. Such a cloning cartridge, when inserted
into a replicon of either broad or narrow host range, converts
it into an expression vector. Thus, the present invention is
also directed to plasmid vectors of broad or narrow host range
cont~ining the cloning cartridge. A particularly preferred
embodiment is the broad host range expression vector pK~Y299,
constructed by replacing the EcoRI - PstI fragment of plasmid
pKMY286 with the -3.6 kb EcoRI - ~I cloning cartridge. In
particular, plasmid pRMY299 was precisely designed for cloning
and expression of genes that contain, or are engineered to
contain an NdeI recognition sequence (CATATG) at the 5' end of
the gene. For cloning and expression of restriction fragments
carrying genes of unknown sequences, the cloning cartridge in
pKMY299 was modified by the deletion of the sequence encoding the
start codon AUG within the multiple cloning site. This
derivative of pKMY299, designated pKMY319, thus comprises a
modified cloning cartridge. The sequence deletion prevents false
translational initiation in gene expression from the PG promoter
in pKMY319.
W O 92/06186 PC~r/US91/06006
-
zo~974~ 7
The usefulness of pKMY299 and pKMY319, as examples of
expression vectors cont~ini~ a cloning cartridge according to the
present invention, was temonstrated. Genes of various origins
whose products could be easily assayed were cloned into the
pKNY299 or pKMY319 expression vector. Regulated (e.g., inducible)
gene expression was observed in a variety of Gra~-negative host
cells. Overproduction of certain gene ~products was also
demonstrated.
W O 92J06186 PC~r/uS9l/06006
2069741
~s
-8-
8RIEF DF~TPTION OF THE DRA~INGS
Figure 1 shows a restriction map of an -1.7 kb ~indIII,~PctI
fra~ent from a region of plasmid NAH7 cont~inin~ the nahR gene
ant part of the ~h~ gene. P~ and PG are promoters of nahR and
5 nahG, respectively, with the arrows indicating direction of
transcription.
Figure 2 shows the initial steps (from plasmid pKMY256 to
pKMY292) in the construction of a cloning cartridge according to
the present invention.
Figure 3 shows the subsequent steps (from plasmid pKMY292
to pKMY297) leading to the construction of a cloning cartridge in
plasmid pKNY297.
Figure 4 shows the derivation of an expression vector
pKMY319 from the pKNY299 expression vector.
Figure 5 shows the SDS-PAGE analysis of protein products
from expression vectors pKMY299 and pKMY319, which comprise a
cloning csrtridge or modified cloning cartridge according to the
present invention, in Pseudomonas ~utida G572. Expression of
firefly luciferase under in~ced and ~minduced conditions is shown
20 in lanes 2,8 and 3,9, respectively. Expression of catechol 2,3
dioxygensse under in~ced and l~nin~u~ed conditions is shown in
lanes 4,6 and 5,7, respectively.
206974 1
DETAILED DESCRIPTION
A cloning cartridge according to the present invention
is designed to contain five elements essential for
efficient gene cloning and expression based on the NahR-
regulated expression system. These five elements, on a
conveniently portable cartridge or cassette, comprise a
drug resistance gene tetr, nahR, PGI a multiple cloning
site, and a transcription terminator. Such a cloning
cartridge can be easily inserted into a variety of vectors
for efficient and regulated gene expression. A recognition
site for the frequently-cutting restriction endonuclease
RsaI is located three base pairs upstream from the nahG
coding region (Figure 1). Initial steps in the
construction of the cloning cartridge involved converting
this RsaI site into a ScaI restriction site convenient for
inserting a multiple cloning site and placing the tetr gene
of the E. coli plasmid pBR322 (Bolivar et al., 1977, Gene
2: 95-113) next to the PR region.
Plasmid pKMY256 is an E. coli plasmid pUC19 (Yanisch-
Perron et al., 1985, Gene 33: 103-119), carrying an ~5.3
kb PstI insert which contains the nahR gene, PGI and ~200
base pairs (bp) of the nahG gene. Digestion of pKMY256 DNA
with the enzymes PstI and SalI and self-ligation led to the
cloning of a ~400 bp SalI-PstI fragment containing PR and PG
into pUC19. The resulting plasmid was designated pKMY288
(Figure 2). In pKMY288, the promoters PR and PG are located
on a ~200 bp SalI-RsaI fragment (Figure 2). The RsaI site
of this fragment can be ligated to the ScaI site of pKMY256
to regenerate the ScaI site. Replacement of the ~1.4 kb
SalI-ScaI fragment of pKMY256 with the ~200 bp SalI-RsaI
fragment of pKMY288 resulted in the deletion of the
remaining nahG sequence and the conversion of the RsaI site
in PG into a ScaI site (Figure 2). The newly formed plasmid
was designated pKMY289 (Figure 2).
W O 92/06186 P~r/US91/06006
X069741 I: '
-10-
In order to place the tetr gene next to PR . the -470 bp
E~ ScaI fragment of pKKY289 ca--~ing P~ and P~ was used to
replace a -4.4 kb ~g~ ScaI fragment in a pBR322 plasmid
ca,.~ing a copy of the LL~YOS3 Tn5 (Ss~sk~wa et al., 1982,
5 Proc. Natl. Acad. Sci. USA 79: 7450-745~; (Figure 2). The
resulting plasmid was desig~9ted pKMY291 (Figure 2). A pKMY291
derivative, designated pKMY292, was constructed by deleting the
intervening sequence between the HindIII site within nahR and the
~i~dIII site within the promoter of the tetr gene (Figure 2).
This step placed the tetr gene ~ tely downstream from PR.
In the following steps, a multiple cloning site was
inserted at the newly-created ScaI site within PG and a
transcription ter~inAtor was inserted at the end of the cloning
site. In most bacterial genes, the nucleotide sequence ATG
specifies the initiation codon. This trinucleotide and the
sey~ence prece~in~ it can be converted by site-specific
mutagenesis into the recognition site of the restriction
endon~clesce ~I (CATATG) without affecting the coding property
of the gene. In order to ~o-~ -d~te genes modified in this
manner, a ~I site can be similarly created in an expression
vector at the junction between the promoter and the 5' end of a
gene coding region. Other restriction sites can be introduced
downstream of the NdeI site for accepting the 3' end of a cloned
gene. In such an expression system, the distance between the
transcription start site and the gene coding region is unaltered,
regardless of the gene cloned. The promoter PR was modified to
contain a NdeI restriction site at the 3' end, followed by a
number of other cloning sites.
An oligonucleotide contsining the following sequence was
synthesized and ligated into the ScaI and PstI sites of pKMY292:
-11- 206974 1
RsaI HpaI XbaI
5/ ACCATATGGTTAACATCGATTCTAGAGGTACC-
3' TGGTATACCAATTGTAGCTAAGATCTCCATGG-
NdeI ClaI KpnI
SacI SacII PstI
GAGCTCCTCGAGCCGCGGACAGATCTCTGCA 3'
CTCGAGGAGCTCGGCGCCTGTCTAGAG 5'
XhoI BglII
Insertion of this sequence converted the ScaI site into the
RsaI site naturally occurring within PG~ restored the
distance between the RsaI site and the coding region,
generated a NdeI cloning site at the 3' end of the PG
sequence and placed a number of other cloning sites
immediately downstream of the NdeI site. The resulting
plasmid was designated pKMY293 (Figure 3).
The E. coli plasmid pCFM1146 carries a transcription
terminator that can be easily incorporated into other
systems. Other sources of transcription terminators are
described in co-assigned U.S. Patent No. 4,710,473.
Downstream from the transcription terminator there is a
restriction site for the enzyme BglII and immediately
upstream from the transcription terminator, there is a
multiple cloning site including an EcoRI site, a XhoI site
and a number of other restriction sites (Figure 3). The
transcription terminator in pCFM1146 was placed immediately
downstream of the multiple cloning site in pKMY293 in two
steps. The BspMII-PstI fragment of pKMY293 carrying the
tetr gene, PRI PGI and the multiple cloning site was
initially cloned into the XmaI and the PstI sites of the
plasmid pUC9 (Vieira and Messing, 1982, Gene 19: 259-268)
to place the EcoRI site of pUC9 downstream of the tetr gene
(Figure 3). The resulting plasmid was designated pKMY294
(Figure 3). In the next step the EcoRI-XhoI fragment of
pKMY294 was cloned into the EcoRI and XhoI sites of
pCFM1146 to place the transcription terminator immediately
downstream of the multiple cloning site Of PG ( Figure 3).
The resulting plasmid was designated pKMY295 (Figure 3).
-12- 236974 1
The rs ~ininE steps established a unique cloning site
downstream from the transcription terminator and restored the nahR
gene. In pKMY295, the E~lII site downstream from the
transcription terminator needed to be replaced with a restriction
site uni~ue in the cloning cartridge for the convenience of
transferring the cartridge among replicons. To achieve this end,
a pUC9 derivaeive without a HindIII s~te, designated pKMY513, WaS
initially constructed by cleaving pUC9 with the enzyme ~indIII
followed by end-filling and blunt-end ligation (Figure 3). The
~_RI-~lII fragment of pR~Y295 carrying the tet~ gene, PR~ PG~
the multiple cloning site, and the transcription terminator WaS
cloned into the ~RI and ~HI sites of pKNX513 to eliminate che
II site and incorporate a uni~ue PstI site next to the
destroyed ~lII site (Figure 3). The resulting plasmid was
designated pKMY296 (Figure 3).
In pKMY296, the part of the nahR gene downstream from the
HindIII site within nahR is still missing. To ensure correct and
convenient assembly of the nahR gene, an indicator plasmid,
designatet pKMY512, was constructed which contained the
naphthalene dioxygenase gene cluster and its NahR-regulated
promoter from the plasmid NAH7. In the presence of an inducer
sodium salicylate and the NahR protein, the naphthalene
dioxygenase genes of pK~Y512 can be turned on, which in turn
catalyzes the formation of indigo dye in ~. ÇQli (Ensley et al.,
25 1983, Science 222: 167-169). Two intermediate plasmids pN400 and
pKMY239 were involved in the construction of the indicator
plasmid pRMY512. The plasmid pN400 was constructed by cloning
the PvuII-~lII fragment of plasmid pE317 (Ensley et al., 1983,
su~ra) cont~ini~g the naphthalene dioxygenase genes into the SmaI
and BamHI sites of the plasmid pUC18 (Yanisch-Perron et al.,
1985, su~ra). ~-e plasmid pRMY239 was constructed by inserting
the -6.4 kb ~acI fragment of pN400 conr~ining the naphthalene
dioxygenase genes into the SacI site of the broad host range
plasmid pRMY223.
-13- 206974 1
Deletion of the ~ QRI fragment of pKMX239
carrying a portion of the nahR gene generated pKMY512- The ~
kb ~iadIII fragment of pKMY289 (Figure 2) carrying the portion of
nahR downstream from the ~iadIII 5ite was inserted into the
~i~dTII site of pKMY296 to complete construction of the cloning
cartritge (Figure 3). In this step the desired plasmid was
selected for its ability to render E. coli cells harboring
pKMY512 to protuce indigo in the presence of sodium salicylate.
This plasmid was designated pKMY297 (Figure 3). Thus, in
pKMY297, an -3.6 kb EcoRI-PstI fragment cont~ n~ the tetr gene,
nahR, Pc~ a multiple cloning site, and a transcription terminator
was successfully assembled as a cloning cartridge.
To test the -3.6 kb ~ç~RI~ I fragment from pKMY297 for
use as a cloning cartridge in different hosts, this fragment was
inserted into a replicon derived from the broad host range
plasmid RSF1010 (Scholz et al., 1989, Gene 75: 271-288). Plasmid
pKT231 is a derivati~e of RSF1010 (B~ rian et al., 1981,
sutra) and served as a source of the RSF1010 replicon. In
pKT231, a ~E_I site is located -200 bp from a SacI site both of
which occur in the polylinker of the cloning cartridge. These
two sites were removed from pKT231 by di~estion of the plasmid
DNA with ~I and SacI followed by treatment with the Klenow
fragment of E. coli DNA polymerase I to generate blunt ends and
self-ligation. The resulting plasmid was tesignated pKMY286.
The broad host range expression vector pKMY299 was constructed by
replacing the EcoRI-~I fragment in pKMY286 with the 3.6 kb
~s_RI-PstI cloning cartrid~e (Figure 4).
In pKMY299, the expected nucleotide sequences at the
junction between PG and the multiple cloning site and at the PstI
junction between the cloning cartridge-and the RSF1010 replicon
~ere completely confirmed by DNA sequence analysis. Sequences of
79 bp in PG. upstream of the ~I site and of 158 bp downstream
of this site were determined. The sequence data demonstrated
that, as expected, the 5' end of the synthetic polylinker was
ligated at the RsaI site close to the 3' end of PG and that the
polylinker sequence downstream of the ~h~I site was replaced by
W O 92/06186 PC~r/Us91/06006
20~i9~
pCF~1146 sequences (Figure 3). Downstream from PG. seven unique
restriction sites including a NdeI site followed by H~aI, ClaI,
~ I, K~nI, SacI, and ~QI sites, can be used for precise
insertion of genes with the 5' end lying within a NdeI
recognition sequence. A sequence of 337 bp including 54 bp of
the cloning cartridge upstream of the PstI recognition sequence
- and 277 bp of the RSF1010 replicon downstream of this sequence,
was dete_ ~Dd. This sequence indicated that the PstI end of the
cloning cartritge was ligated, as expected, at the corresponding
10 PstI site in RSF1010 DNA starting at nucleotide 7768 (Scholz et
al., 1989, su~a).
Similar sequence analysis of 303 bp of the RSF1010 replicon
upstream of ~he ~çQRI recognition sequence and 36 base pairs of
the cloning cartridge downstream of this sequence, also
demonstrated, as expected, that the ~_RI end of the cloning
cartridge was ligated at the corresponding ~QRI site in RSF1010
DNA starting at nucleotide 8676 (Scholz et al., 1989, su~ra).
However, the same analysis revealed that the sequence from
nucleotides 1 to 1653 in RSF1010 DNA (Scholz et al., 1989, su~ra)
was completely deleted in pKMY299. The deleted region contains
the entire strA gene and most of the strB gene deter~ini~g
streptomycin resistance (Scholz et al., 1989, .supra). Restriction
patterns of pKMY286 and pKT231 DNA suggested that this deletion
occurred in the plasmid pKT231 used, as described herein.
25 Further analysis of pK~Y286 and pKMY299 DNA with various
restriction e~ ^s did not detect other aberrations in pKMY299.
Plasmid pKMY299 can be considered, therefore, as an RSF1010
plasmid with nucleotides 1 to 1653 deleted and nucleotides 7768
to 8676 replaced with a 3.6 kb cloning cartridge.
Plasmid pKNY299 was designed for precise cloning and
regulated expression of genes that contain, or are engineered to
contain, an ~deI recognition sequence at the 5' end. For cloning
and expression of restriction fragments carrying genes of unknown
sequences, the cloning cartridge in pKMY299 was modified. The
sequence ATG within the ~I recognition sequence in pKMY299 was
removed to prevent false translational initiation in gene
W O 92/06186 P ~ /Us91/06006
Z~69~41
-15-
expression from PG. This was achieved by digestion of pKMY299
DNA with ~1 and ~E_I followed by treatment with Mung Bean
nuclease to reDove the overhang, and self-ligation of the
~ -inin~ plasDid DNA. The resulting plasmid was designated
S pKMY319 (Figure 4). Sequence analysis confirmed the expected
location of the five ,. -ining cloning sites in pKMY319 in the
order of ClaI, ~ I, and ~hQI sites. The same
analysis revealed that in addition to removal of the AT overhang
generated by ~I digestion as expected, the Mung Bean nuclease
~ Yrectedly reDoved anotber eight bp. The expected sequence and
the actually observet sequence around the ligation site in pK~Yl9
are shown as follows:
* * * * *
expected T C A C G A G T A C C A A A C A T C G A T
ClaI
* * * *
observed T C A C G A C A T C G A T
ClaI
The asterisks mark bases comple - ~Ary to the 3' end of the
Pse~d~ -,as aerU~in~c~ 16S RNA and define a coding region for the
putative ribosoDe-binding site (Shine and Delgarno, 1975, Nature
~54: 34-38). One of the important bases encoding ribosome-
binding site was removed in pKMY319. A disruption of this
ribosome binding site might prove ad~antageous in the use of
pKMY319 for the expression of cloned frAg - -c contAinin~ genes
of unknown ~e~e.lce. A Shine-Delgarno sequence, which is
normally located only a few bp upstream from a gene, is usually
cloned on a fragment along with the gene. A second ribosome
binding site enroded by the expression vector might act to reduce
expression (Schauder and McCarthy, 1989, Gene 78: 59-72).
To evaluate the use of pK~Y299 and pKMY319 as expression
vectors, genes of ~arious origins whose products could be easily
assayed were cloned into the plasmids and their expression
tested. An intronless luciferase gene constructed from Photinus
~Yralis (firefly) cDNA and genomic clones (de Uet et al., 1987,
Mol. Cell. Biol. 7: 725-737), was reconstructed to contain 8 NdeI
site at the 5' end. The reconstructed luciferase gene was cloned
-16- 206974 1
into pKMY299 at the NdeI and Asp718 (KpnI) sites and the
resulting plasmid, pKMY520, was introduced into E. coli and
P. putida host cells. Expression of the luciferase gene
was analyzed in the presence or absence of sodium
salicylate as an inducer in both recombinant host cells.
Luciferase activity was determined by measuring the light
produced in a reaction catalyzed by this enzyme.
Production of luciferase protein in P. putida was also
analyzed by SDS polyacrylamide gel electrophoresis (SDS-
PAGE) of a crude extract. Luciferase production in
uninduced recombinant P. putida cells carrying pKMY520 was
barely visible on an SDS gel (Figure 5). However, the high
sensitivity of the luciferase assay (de Wet et al., 1987,
supra) allowed detection of relatively high enzyme activity
from uninduced recombinant P. putida or E. coli host cells
carrying pKMY520 (Table II). The same assay detected a ~90
fold induction of the luciferase activity in recombinant
P. putida host cells (Table II) and an ~80 fold induction
of the same activity in recombinant E. coli host cells.
The amount of luciferase produced in induced P. putida
cells carrying pKMY520 represented ~3.7~ of the total
soluble proteins (Figure 5). These results demonstrated
regulated expression of a eukaryotic gene from pKMY299 in
two different Gram-negative hosts.
To test the use of pKMY319 as an expression vector,
restriction fragments carrying the toluene monooxygenase
(TMO) gene cluster tmoABCDEF from Pseudomonas mendocina KR1
or the catechol 2,3-dioxygenase gene from the plasmid NAH7
(see Yen and Serdar, 1988 supra, for review) were
individually cloned into pKMY319 to generate plasmids
pKMY342 and pKMY517, respectively. Recombinant plasmid
pKMY342 carrying the TMO gene cluster was introduced into
a number of Gram-negative bacterial species and plasmid
pKMY517 carrying the catechol 2,3-dioxygenase gene was
introduced into P. putida. Expression of these genes was
measured under induced and uninduced conditions.
W O 92/06186 PCT/uS9l/06006
2~i9~41
Significantly higher specific activities of both toluene
monooxygenase and csrechol 2,3-dioxygenase were observed from
inAll~e~ cultures than from l~in~ced cultures of all bacterial
strains testet (Tables I ant III). These results demonstraeed
5 the wide we of pKMY319 as an expression vector in obt~ining
regulated gene expression in Gram-negaeive bacteria. Comparing
to the level of catechol 2,3-dioxygenase produced from NAH7, a
25-fold overproduction of this enzyme from pKNY517 was observed
under the experi -ll conditions (Table I). Production of
catechol 2,3-dioxygenase protein in P. ~utida harboring the
plasmid pKMY517 was analyzed by SDS-PAGE of a crude cell extract.
The amount of catechol 2,3-dioxygenase produced represented -10%
of the total soluble proteins, as detected by densitometer
analysis of the gel (Figure 5). These results demonstrated the
usefulness of pK~Y319 in the overproduction of gene product(s).
The stability of the cloning cartridges was tested in view
of reports that a plasmid carrying the tetr gene, used as an
element of the cloning cartridges described herein, was not
stably inherited in P. putida or E. coli in the absence of
selection (8agdasarian et al., 1982, supra; Kolot et al., 1989,
Gene 75: 335-339). It has been suggested that a short sequence
within the promoter of the tetr gene forms a ~hot spot" for
recombination (James and Kolotner, 1983, in Mechanisms of DNA
ReDlication and Reco~bination, Cozzarelli, (ed.), pp. 761-772,
Liss, New York), and might be responsible for destabilization of
this plasmid carrying the tetr gene (Kolot et al., 1989, su~ra).
This sequence contains a ~indIII site and tisruption of the
HindIII recognition sequence or the sequence in its vicinity
stabilized the plasmid carrying the tetr gene (Kolot et al.,
1989, su~ra). In the construction of a cloning cartridge
according to the present invention, the sequence upstream from
the HindIII site in the promoter of the tetr gene was replaced
with the nahR sequence (Figure 3). This sequence substitution
generated a new hybrid promoter for the tetr gene and stabilized
the plasmid carrying either of the cloning cartridges according
to the present invention.
-18- 206974 1
The hybrid promoter in the cloning cartridges
described herein, allowed the use of the tetr gene as a
selection marker in all of the bacterial strains tested
(Tables 2, 3 and 4). To test the stability of a plasmid
carrying a cloning cartridge according to the present
invention, P. putida KT2440 and P. putida G572 host cells
(Table l) harboring pKMY299 or pKMY319 were grown in L-
broth in the absence of tetracycline for over 50
generations. Each of the cultures was streaked on L-agar
plates for single colony formation and 100 colonies from
each culture were tested on L-agar plates supplemented with
tetracycline (50 mg/ml) for tetracycline resistance. All
of the colonies tested were tetracycline resistant. This
result suggested that use of the tetr gene in the form
carried by the cloning cartridges according to the present
invention did not lead to the elimination of either
cartridge or elimination of a plasmid carrying either of
the cartridges, in the absence of selection.
The invention is now illustrated by the following
Examples, with reference to the accompanying drawings.
EXAMPLE 1
Construction of Intermediate Plasmid pKMY289
A. Preparation of Plasmid pKMY256
The starting material for the construction of pKMY256
was plasmid pKY217 described by Yen and Gunsalus, 1985, J.
Bacteriol. 162: 1008-13. Plasmid pKMY256 was constructed
according to the following series of steps. In the first
step, an ~4.3 kb HindIII fragment from plasmid pKMY217
containing the nahR and nahG genes was cloned into the
HindIII site of the pKT240 plasmid described by Bagdasarian
et al., 1983, Gene 26: 273-82. The resulting plasmid
from this first step was designated pKMY219. In the
second step, an ~7 kb BamHI - SacI fragment from pKMY219
containing the nahR and nahG genes was cloned into the
BamHI and SacI sites of the pKT231 plasmid
W O 92/06186 Z~69741 P~/USg1/06006
-19-
described by ~g~n~ian et al., 1981, Gene 1: 237-47. The
resulting plasmid was designated pY~Y223. In the next step, an
-6 kb PstI fr~ e from FVMY?~3 contAining the ahR gene, -200
base pairs of the nah gene and the gene conferring ~An ~in
resistance, was cloned into the ~I site of the pUCl9 plasmid
described by Yanisch-Perron et al., 1985, supra. The resulting
-8.0 kb plasmid was designated pKMY256. (Figure 2). The
orientation of the -6 kb PstI fragment in pKMY256 placed the
multi-cloning site of pUC19 from the SalI to the EcoRI site
i -~iAt~ly downstream of the PstI site in the nahG gene.
Plasmid pKMY256 was then used to construct intermediate plasmid
pKMY289 as follows.
B. Preparation of Plasmid pKMY288
Plasmid pKMY256 DNA was digested with PstI and SalI,
resulting in 4 PstI-~lI frA~ -q of -4.9 kb, -2.7 kb, -420 bp,
and -10 bp. The digestion mixture was self-ligated and used to
transform ~. ~Qli JM109 cells. The transformed cells were plated
on L-agar with ampicillin (250 ~g/ml), IPTG (isopropyl-B-D-
thiogalact~.~.oside) as inducer and X-gal (5-bromo-4-chloro-3-
indolyl-~-D-galactoside)as substrate for the lacZ gene product.
The desired construct was screened by picking colorless colonies
followed by miniprep analysis. It contained the -420 bp PstI-
I fragment carrying P~ and PG. The resulting -3.1 kb plasmid
was designated pKMY288 (Figure 3), and comprises pUCl9 (-2.7 kb),
-60 bp of the pahR gene, PR . PG and -200 bp of the nahG gene
(originally derived from pKY217 as described above). Plasmid
pKMY288 is thus the equivalent of subcloning the -420 bp PstI-
SalI fragment of pKMY256 into plasmid pUCl9.
C. Preparation of Plasmid pKMY289
Plasmid pKNY288 DNA (Section B above) was digested with
I and RsaI. Plasmid pKMY256 DNA (Section A above) was
digested with ~31I, ScaI (compatible with RsaI) and ~_I (to
prevent reformation of original plasmid pKMY256 during subsequent
ligation). The digested pKMY288 and pKMY256 DNAs were mixed,
ligated, and used to transform E. coli JM109. Transformants
were selected by plating on L-agar with ~nl ~cin (50 ~g/ml).
W O 92/06186 P ~ /~S91/06006
Z069741.
-20-
The resulting -6.8 kb plasmid was designated pKMY289 (Figure 2),
and comprises the -6.6 kb ~alI-ScaI fragment of pKMY256 and the
-200 bp SalI-RsaI (after ligation, RsaI is converted to ScaI)
fragment of pKMY288. This -200 bp fragment comprises -60 bp of
the D~h~ gene, PR. PG (minus the 5 bp sequence ACAGC before the
ATG of the Dah~ gene). None of the Dah~ gene re ninC. In the
construction of pKMY289, the 3s~I site i -~iQtely upstream of
the nahG gene has been converted to a ScaI site, which allows
certain manipulations in the following construction steps.
ESAXPLE 2
Construction of Intermediate Plasmid ~K~Y293
A. Preparation of Plasmid pKMY291
Plasmid pKKY289 DNA (Example 1) was digested with ~glII,
~_I and PstI (to prevent reformation of original plasmid pKMY289
during subseq~ent ligation). Plasmid pBR322::Tn5 (S~-c~wa et
al., 1982, Proc. Natl. Acad. Sci. USA 79: 7450-7454) DNA was
digested with ~lII and ~aI- The digested pKMY289 and
pBR322::Tn5 DNAs were mixed, ligated and used to transform ~.
coli JM109 cells. Transfo rc were selected by plating on L-
agar with tetracycline (10 ~g/ml). The resulting -6.1 kb plasmid
was designated pKKX291 (Figure 2) and comprises the -5.6 kb
EglII-ScaI fragment of pBR322::Tn5 cont~inine DNA regions
essential for replication and the -470 bp ~glII-ScaI fragment of
pKMY289 cont~inine -330 bp of the nahR gene, PR and PG (minus the
bp sequence ACAGC before the ATG of the nahG gene). In
addition to positionine the nahR region with respect to the tetr
gene for further manipultion, this step placed a desirable
restriction site (PstI) downstream of the ScaI si~e for
unidirec~ional insertion of a polylinker at the ScaI site.
B. Preparation of Plasmid pKMY292
Plasmid pK~Y291 ~NA (Section A above) was digested with
HindIII and ~k~I. The digestion mixture was ligated, digested
again with XhoI (to prevent the reformation of pKMY291), then
used to transfor~ E. coli JM109 cells. Transformants were
selected by plating on L-agar with tetracycline (10 ~g/ml). The
W O 92/06186 PC~r/US91/06006
Z069741.
tesired -4.2 kb plasmid was designated pKMY292 (Figure 2).
Plasmit pKMY292 resulted from the teletion of an -1.9 k~ Hin~ITI
frag~ent, including the tesiret deletion of the PstI site. In
attition, the deletion eli n~red the nucleotide sequences
upstream of the tetr promoter ant brought the tet~ gene of
pBR322::Tn5 as close as possible to the nahR gene sequence, and
in a tesired orientation.
C. Preparation of Plasmid pKMY293
Plasmid pKMY292 DNA (Section B above) was digested with
ScaI and PstI. An -240 bp ScaI-PstI fragment of pKMY292 was
deleted and replaced with a polylinker of the following sequence:
5~-AcrATATGGTT M CATCGATTCTAGAGGTA~C~A~lC~lCGAGCCGCG~ACA~ATCTCTGCA
3'-TGGTATACrAATTGTAGCTAAGATCTCCA~GG~C~Arr-Ar-~lCGGCGCCl~l~lAGAG
This double-stranded polylinker cort~inc multiple restriction
sites in the order of 5'-B~aI-~I-H~aI-ClaI-~ 2~I-SacI-XhoI-
SacII-~glII-PstI-3'.
The single-stranded DNA fr~ ~ ~s used in the construction
of the polylinker of the above-tescribet sequence were chemically
synthesized by using an ABS 380B DNA synthesizer (Applied
Biosystems, Inc., 850 Lincoln Centre Drive, Foster City, CA
94404). Many DNA synthesizing insL~ c are known in the art
and can be used to make the frag~ents. In addition, the
fragments can also be conventionally prepared in substantial
accordance with the procedures of Itakura et al., 1977, Science
198: 1056 and Crea et al., 1978, Proc. Natl. Acad. Sci. US 75:
5765. The synthesized single strands were annealed to form the
double-strantet polylinker as follows. Four single strands were
synthesized for Ann~l ing and tesignated 140-27 (31 mer), 140-
28 (35 mer), 140-29 (32 mer) and 140-30 (24 mer), having the
following sequences, respectively:
140-27 5'-ACC ATA TGG TTA ACA TCG ATT CTA GAG GTA C-3'
140-28 5'-CTC GGT ACC TCT AGA ATC GAT GTT M C CAT ATG GT-3'
140-29 5'-CGA GCT CCT CGA GCC GCG GAC AGA TCT CTG CA-3'
140-30 5'-GAG ATC TGT CCG CGG CTC GAG GAG-3'
The 5' ends of strants 140-28 and 140-29 were kinased (marked
witb an asterisk below) prior to Ann~l ing according to
W O 92/06186 PCT/US91/06006
2069741-
-22-
c~ ..tional methods, for example, Yansura, et al., 1977, Biochem.
~:1772-1780. The scheme for AnnsAling was:
5' 140-27 3' 5'. 140-29 3'
3' 140-28 .5' 3' 140-30 5'
The ScaI and E~I digested pKMY292 DNA was ligated with
the above-described 5'-RsaI-PstI-3' polylinker, and the ligation
mixture was used to transform ~. coli B 101 cells. Transformants
were selected on L-agar plates with tetracycline (10 ~g/ml). The
desired -4.1 kb plasmid, designated pKMY293 (Figure 3), was
identified by miniprep analysis of ~h~I and As~718 digested DNA.
The pKMY292 DNA L. -ine uncut by ~h~I and As~718 digestion.
Plasmid pKMY293 comprises the synthetic polylinker, PG ~ PR ~
-270 bp of the D~_R gene, and the tet~ gene i ~~iAtely
downstream. The synthetic polylinker replaced the deleted 5 bp
sequence ACAGC at the ScaI site of plasmid pRNY292 with the
sequence ACCAT to generate the ~I site in the polylinker.
Thus, the insertion of the synthetic polylinker as described:
(i) converted the ScaI site into the Rsal site naturally
occurring within PG; (ii) restored the distance between the RsaI
site and the coding region; (iii) generated an NdeI cloning site
at the 3' end of the PG sequence; and (iv) placed a number of
other cloning sites i -~iAtely downstream of the NdeI site.
Eg~XPLE 3
Construction of Intermediate Plasmid DKMY295
25 A. Preparation of Plasmid pKMY294
Plasmid pKMY293 DNA (Example 2) was digested with PstI and
~s~MII. In addition, plasmid pUC9 DNA (Vieira and Messing, 1982,
Gene 19: 259-268) was digested with pstI and maI. The digested
pK~Y293 and pUC9 DNAs were mixed, ligated and used to transform
E. coli JM109 cells. Transformants were selected by plating on
L-agar with tetracycline (10 ~g~ml) and ampicillin (500 ~g/ml).
The desired -4.8 kb plasmid, designated pKMY294 (Figure 3), was
identified by miniprep analysis of ~hQI and EcoRI digested DNA.
Plasmid pKNY294 comprises the -2.0 kb PstI-~pMII fragment of
-23- 206q74l
pKMY293 inserted by ligation into the PstI and XmaI sites
of pUC9. The ligation eliminated the XmaI and BspMII sites
and placed an EcoRI site downstream of the tetr gene.
B. Preparation of Plasmid pKMY295
Plasmid pKMY294 DNA (Section A above) was digested
with XhoI and EcoRI. In addition, plasmid pCFM1146 DNA was
similarly digested with XhoI and EcoRI. The XhoI-EcoRI-
digested pKMY294 and pCFM1146 DNAs were mixed, ligated and
used to transform E. coli FM5 cells. E. coli FM5 cells
were derived from a strain of E. coli K-12 and contained an
integrated A phage repression gene, CI857 (Burnette et al.,
1988, Bio/Technology 6: 699-706). Transformants were
selected by plating on L-agar with tetracycline (10 ~g/ml)
and kanamycin (50 ~g/ml). The resulting ~6.8 kb plasmid
was designated pKMY295 (Figure 3). Miniprep analysis of
XhoI-EcoRI digested pKMY295 confirmed that an ~2.0 kb
fragment of pKMY294 had been successfully inserted in
pCFM1146 with the concomitant deletion of a small segment
of the pCFM1146 cloning site comprising the EcoRI-HpaI-
KpnI-NcoI-HindIII-XhoI sites. In pKMY295, the
transcription terminator in pCFM1146 is located immediately
downstream of the multiple cloning sites of PG.
EXAMPLE 4
Construction of Intermediate Plasmid pKMY297
A. Preparation of Plasmid pKMY296
The starting materials for the construction of plasmid
pKMY297 were plasmid pKMY296 DNA (Example 3) and plasmid
pKMY513 DNA. Plasmid pKMY513 is essentially the pUC9
plasmid (Vieira and Messing, 1982, supra) in which the
HindIII site has been deleted as follows. HindIII-digested
pUC9 DNA was treated with the Klenow fragment of DNA
polymerase I to fill in the sticky ends created by the
HindIII digestion. The Klenow-treated DNA was ligated,
treated with Hind III, and used to transform E. coli JM109
cells. Transformants were selected on L-agar plates with
W O 92/06186 P(~r/US91/06006
20697~
-24-
a~picillin (250 ~g/ml). Miniprep analysis of selected
transformants confi ~ that the DNA was resistant to HindII~
digestion. The ~ III resistant plasmit DNA was designated
pKMY513.
The pKKY513 DNA thus obtained was digested with EcoRI and
E~HI. Plasmid pRMY295 DNA (Example 3) was digested with EcoRI
and EglII. The digested DNAs were mixed, ligated, and the
ligation mixture used to transform ~. coli JM109 cells.
Transformants were selected on L-agar plates contAinin~
tetracycline (10 ~g/ml) and ampicillin (500 ~g/ml). The desired
-5.1 kb plasmid, designated pKMY296 (Figure 10), contained the
-2.4 kb EcoRI-BElII fragment of pKMY295 ligated with the -2.7 k~
EcoRI-~HI fragment of pKMY513. The ligation eliminated the
EglII and ~HI sites ant placed a unique ~ I site downstream
of the transcription te nAtor.
B. Preparation of Plasmid pKMY297
Plasmid pKMY296 DNA (Section A abo~e) was digested with
Hin~TI~. Similarly, plasmid pKKY289 DNA (Example 1) was digested
with ~ TI~. The digested pKMY296 and pKMY289 DNAs were mixed,
ligated and used to transform ~. coli HBlOl cells conrAining
plasmid pKMY512. Plasmid pKMY512 was used, in order to
specifically select only those transfo ~nr~ that contained a
plasmid ha~ing the -1.1 kb ~i_dIII fragment of pKMY289 inserted
into the unique ~indIII site of pKMY296 to recreate a complete
nahR gene. The construction of pKMY512 and its use in the
selection of the desired transformant are described as follows.
The starting material for the construction of pKMY512 was
plasmid pN400 DNA. Plasmid pN400 was itself constructed by
cloning the -7.5 kb PvuII-B lII fragment of plasmid pE317 (Ensley
et al., 1983, Science 222: 167-169), which contains the
naphthalene dioxygenase genes from plasmid NAH7, into the SmaI
and BamHI sites of plasmid pUC18 (Yanisch-Perron et al., 1985,
su~ra). Plasmid pN400 DNA was digested with SacI and an -6.4 kb
SacI fragment conrAininp the naphthalene dioxygenase genes was
inserted by ligation in the same orientation as the nahG gene
into SacI-digested pKKY223 DNA to yield intermediate plasmid
W O 92/06186 PCT/uS91/06006
Z0~97~
pKMY239. The desired plasmit pKMY512 was obtained by deletion of
an -6.1 kb ~g~ EcoRI fragment from pKMY239 to delete a portion
of the nahR gene and its activity. Plasmid pK~Y512 thus contains
all the structural naphthalene dioxygenase genes, but no
functional nahR gene. The nahR gene product positively controls
the expression of the naphthalene dioxygenase structural genes,
and these structural gene products are able to catalyze the
production of indigo in E. coli as shown by Ensley et al., 1983,
suDra. Without the nahR gene product, no expression of
naphthalene dioxygenase activity and no indigo production is
possible in transformants with pRMY512 alone. Uhen a
transformant contains plasmid pKMY512, and a derivative of plasmid
pKMY296 in which the -1.1 kb HindIII fragment of pKMY289 has been
inserted in the correct orientation so as to yield a functional
nahR gene, such a transformant contains two comple - ting plasmids
and will be able to p od~ce indigo in the presence of an inducer
of the naphth~enD dioxygenase genes.
Using this complementation system, transformants were
initially selected on L-agar plates with 500 ~g/ml ampicillin
(pRMY296 selection marker), 50 ~g/ml ~n- ~cin (pKMY512 selection
marker), and 1.0 mM sodium salicylate as inducer of the
naphthalene dioxygenase genes. Blue colonies, due to indigo
production, were selected for further analysis. Miniprep DNA
from the blue colonies was used to transform E. coli H~101 cells,
and these secondary transfor~ants were selected on L-agar plates
with 500 l~g/ml ampicillin only. Miniprep analysis of HindIII
digested DNA from these secondary transformants confirmed that the
-1.1 kb ~indIII fragment of pK~Y289 had been successfully cloned
into the HindIII site of pK~Y296, thus generating the desired
-6.2 kb plasmid designated pKMY297 (Figure 3).
Uith the successful construction of plasmid pKMY297, the
-3.6 kb EcoRI-PstI cloning cartridge (or cloning cassette)
conr~ining the 5 desired elements was completed. The cartridge
contains a regulatory gene, a promoter regulated by the
regulatory gene, a multiple cloning site (polylinker), a
W O 92/06186 PC~r/US91/06006
Z069741.
transcription te n~tor, and 8 gene en~o~ing antibiotic
resistance.
EaA~PLE 5
Con~truction of Plasmid oKMY299
To test the -3.6 kb EcoR I-Pst I fragment from pKMY297 for
use as a cloning cartridge or cassette in different hosts, this
fragment was inserted into a replicon derived from a broad host
range plasmid RSF1010 (Scholz et al., 1989, supra). The broad
host range expression vector pKMY299 was constructed as follows.
A. Preparation of Inre~ te Plasmid pKMY286
Plasmid pKT231 DNA (Example 1) was digested with SacI and
HoaI. The HoaI site is between the EcoRI and SacI sites of
pKT231, -200 bp from the SacI site. The SacI- and HoaI-digested
pKMY231 DNA was treated with the Klenow fragment of DNA
polymerase I to create blunt ends. The Klenow-treated DNA was
then ligated and used to transform ~. coli B 101 cells.
Transfo_ ~ne~ were selected on L-agar plates with 50 ~g/ml
~n ~cin. The resulting -10.3 kb plasmid was designated
pKMY286. In pR~Y286, the HoaI and SacI sites from pKT231 were
deleted, so that these two sites within the polylinker would be
available as cloning sites.
B. Preparation of Plasmid pKMY299
Plasmid pKMY286 DNA (Section A above) was digested with
p~RI and ~I. Plasmid pKMY297 DNA (Example 4) was also
digested with EcoRI and PstI, and, in addition, with ScaI (to
prevent regeneration of plasmid pKMY297). The digested pKMY286
and pKMY297 DNAs were mixed, ligated and used to transform E.
coli HB101 cells. Transformants were selected by plating on L-
agar with tetracycline (10 ~g/ml). Tetracycline-resistant
colonies were picked and tested on L-agar with tetracycline
(10 ~g/ml) and ampicillin (500 ~g~ml). Tetracycline-resistant and
ampicillin-sensitive colonies were picked and ~Ya~ined by miniprep
analysis for the ligation of the -3.6 kb EcoRI-PstI cassette of
plasmid pKMY297 with the -6.1 kb EcoRI-PstI fragment of plasmid
35 pKMY286. The desired -9.7 kb plasmid containin~ this cassette
W O 92/06186 PC~r/US91/06006
2069741~
-27-
was desigr~ted pKMY299 (Figure 4). Pl~smit pKMY299 in E. coli
~B101 cells has been depositet with the American Type Gulture
Collection as strain EcY5103 on September 25, l9gO and given
accession number A.T.C.C. 68427.
C. Selected Sequence Analysis of Plas~id pKMY299 DNA
In pKMY299 the expected nucleotide sequences at the junction
between PG and the multiple clo~ing site snd at the PstI junctlon
between the cloning cartridge and the RSF1010 replicon were
completely confi -~ by DNA sequence analysis. Sequences of 79
base pairs in PG~ upstream of the NdeI site and of 158 base
pairs downstream of this site were determined. The sequence data
demonstrated that, as expected, the 5' end of the synthetic
polylinker was ligated at the ~_I site close to the 3' end of
PG and that the polylinker ~eiuence downstream of the XhoI site
was replaced by pCFM1146 sequences (Figure 3). Downstream from
PG~ seven unique restriction sites including a ~deI site followed
by ~E_I, ClaI, ~ 2~I, SacI, and ~hQI sites can be used for
precise insertion of genes with the 5' end lying within a NdeI
recognition sequence. A oeq~e..ce of 337 bp, including 54 bp of
the cloning cartridge upstream of the PstI recognition sequence
and 277 bp of the RSF1010 replicon downstream of this sequence,
was determined. This sequence indicated that the PstI end of the
cloning cartridge was ligated, as expected, at the corresponding
PstI site in RSF1010 DNA starting at nucleotide 7768 (Scholz et
al., 1989, supra).
Similar sequence analysis of 303 bp of the RSF1010 replicon
upstream of the EcoRI recognition sequence and 36 bp of the
cloning cartridge downstream of this sequence, also demonstrated,
as expected, that the EcoRI end of the cloning cartridge was
ligated at the corresponding EcoRI site in RSF1010 DNA starting
at nucleotide 8676 (Scholz et al., 1989, su~ra). However, the
same analysis revealed that the sequence from nucleotides 1 to
1653 in RSF1010 DNA (Scholz et al., 1989, supra) was completely
deleted in pKKY299. The deleted region contains the entire strA
gene and most of the strB gene dete ining streptomycin
resistance (Scholz et al., 1989, supra). Restriction patterns of
W 0 92/06186 P ~ /US91/06006
20~974~
pKNY286 and pKT231 DNA suggested that this deletion occurred in
the plasmid pKT231 used, as described herein. Further _r~lysis
of pKMY286 and pKMY299 DNA with various restriction enzymes did
not detect other aberrations in pKMY299. Plasmid pKMY299 can be
S considered, therefore, as an RSF1010 plasmid with nucleotides 1
to 1653 deleted and nucleotides 7768 eo 8676 replaced with a 3.6
kb cloning cartridge.
sr~YPLE 6
Construction of Plasmid DKMY319
Plasmid pKMY299 conr~ining the -3.6 kb EcoRI-PstI cloning
cartridge, described in Example 5 above, was designed for the
cloning and expression of genes conr~inine the NdeI recognition
sequence at the 5' end. For the cloning and expression of
restriction fragments ca.-~ing genes of unknown sequences, the
cloning cartridge in pKHY299 was modified to remove the sequence
ATG within the NdeI recognltion sequence in pKMY299 to prevent
false translational initiation in gene expression from PG.
Specifically, the ATG equence within the NdeI recognition
sequence of the polylinker from plasmid pKMY299 was removed as
follows. Plasmid pKMY299 DNA (Example 5) was digested with NdeI
and ~_I, then treated with Mung Bean nuclease (New F.ngl ~n~
Biolabs, 32 Tozer Road, Beverly, MA 01915) according to the
ontlf~rturer's instructions, to remove the overhang. The
nuclease-treated DNA was then ligated and used to transform .
coli B 101 cells. Transformants were selected on L-agar plates
with tetracycline tlO ~g/ml). The desired plasmid, in which the
NdeI and HDaI sites were effectively deleted was designated
pKMY319 (Figure 4). Plasmid pK~Y319 in . coli HB101 cells has
been deposited with the American Type Culture Collection as
strain EcY5110 on September 25, 1990 and given accession number
A.T.C.C. 68426. When the sequence around the ligation site in
pK~Y319 (i.e., ligation after NdeI, HDaI and Mung Bean nuclease
treatment of pKMY299 DNA) was analyzed, it was found that in
addition to removing the single-stranded AT overhang created by
NdeI, ~ung Bean nuclease had L_ ~ed 8 bp of sequence, including
W O 92/06186 PCT/US91/06006
Z069~41
-
-29-
at least one of the nucleotides thought to be important for
enro~ing the r~hoss -1 binding site 5' to the AUG translation
start codon. (The seq~ence of this ribosomal binding site is
reviewed in Yen and Serdar, 1988, CRC Crit. Rev. Microbiol. 15:
247-267 (see Figure 4 at p. 255). The expected sequence and the
actually observed sequence around the ligation site in pK~Y319 is
shown as follows:
* * * * *
expected T C A C G A G T A C C A A A C A T C G A T
ClaI
* * * *
observed T C A C G A C A T C G A T
ClaI
A disruption of this ribosomal binding site may prove
advantageous in the use of pKNY319 for the expression of cloned
fragments cont~ining genes of ~ sequences. Such a fragment
often contains sequence(s) enroAing the rihos~ ~1 binding site(s)
for the gene(s) it carries. In such cases, a second ribosome
binding site might act to effectively reduce expression (Schauder
and McCarthy, 1989, Gene 78: 59-72).
EXA~PLE 7
Construction of a pKMY319-derived Expression System
for the Catechol 2.3-Dioxvgenase Gene of Plasmid NAH7
A. Preparation of Inte ~~iAte Plasmid pKKY514
Plasmid pKY67 is the NAH7 plasmid cont~in;ng a Tn5
insertion in the nahG gene (Yen and G~lnc~lac, 1982, Proc. Natl.
Acad. Sci. 79: 874-878). Plasmid pKY67 DNA and plasmid pUC19 DNA
(Yanisch-Perron et al., 1985, su~a) were digested with XmaI.
The digested pKY67 and pUCl9 DNAs were mixed, ligated and used
to transform E. coli B101 cells. Transformants were selected by
plating on L-agar with k~n~ ~cin (50 ~g/ml) and ampicillin
(500 ~g/ml). The desired -5.4 kb plasmid, designated pKMY514,
was pUC19 carrying an -2.7 kb ~_I insert Conr~ i n; ng the Tn5 gene
e~o~;ne k~n: ~cin resistance and the NAH7 gene nahH encoding
catechol 2,3-dioxygenase.
W O 92J06186 PC~r/uS91/06006
~* l - / .
Z069741
-30-
B. Preparation of ~nte ~ te Plasmid pKMYS15
Plasmid pKMY514 DNA (Section A above) was digested with
~s~I and ~h~l. A ~coI site and an ~h~I site have been mapped
upstream and downstream of the nahH gene respectively (Ghosal et
S al., 1987, Gene 33: 19-28). Plasmid pCFM1146 DNA (Example 3) was
also treated with NcoI and ~kQI. The digested pKMY514 and
pCFK1146 DNAs were mixed, ligated and used to transform E. coli
FM5 cells. Transformants were selected by plating on L-agar with
~n ~cin (50 ~g/ml) at 28C. At 28C, the temperature inducible
~ promoter derived from pCFM1146 is off and transcription of the
nahH gene is not inAvred. This master plate is kept under
conditions whereby the nahH gene is not induced. Replica plates
were made from the master plate. The replica plates were then
incubated at 42C, so as to turn on the temperature inducible
promoter ant induce the production of the nahH gene product,
catechol 2,3-dioxygenase. To detect those colonies producing
catechol 2,3-dioxygenase, the replica plates were sprayed with
0.5 M catechol. The o~eo~l is converted to a yellow-colored
product, 2-~ LO~ ronic sr Al~ehyde, to yield yellow colonies.
The colonies on the master plate corresponding to the yellow
colonies on the replica plate were picked, and grown at 28C.
The desired -6.2 kb plasmid designated pKMY515 was thereby
obtained, comprising an -1.5 kb ~çQI-~h~I fragment from p~MY514.
This fragment contains the ~ahH gene inserted into the NcoI and
25 XhoI sites of the -4.7 kb pCFM1146. The ~_I site in pKMY514
which was derived from pCFM1146 is thus available for cloning the
nahH gene in pKMY319 in the last step in the construction of the
plasmid pKMY517 as described in Section C below.
C. Construction of pKMY517 for the Expression of NAH7 Catechol
2,3-Dioxygenase Gene
Plasmid pKMY515 DNA (Section B above) was digested with
~I and Xhol. Similarly, plasmid pK~Y319 DNA (Example 6) was
digested with Xbal and Xhol. The digested pKMY515 and pK~Y319
DNAs were mixed, ligated, and used to transform E. coli HB101
cells. Transformants were selected on L-agar plates cont~j ni ng
tetracycline (10 ~g/ml). Io detect those colonies producing
catechol 2,3-dioxygenase, the plates were sprayed with catechol,
W O 92/06186 PC~r/US91/06006
- zo~9741. ~
as described in Section B above, and yellow colonies were
selected. The tesired -11.2 kb plasmid for the expression of the
NAH7 catechol 2,3-dioxygenase 8ene was obtained and designated
pKMY517. It comprised an -1.5 kb ~ L I-~hQI fragment from pKHY515
co~rRininE the nah~ gene inserted into the XbaI and ~QI sites
of pKMY319. These results suggested that inducible promoter in
pKMY517 that was derived from pKMY319 was slightly leaky so that
when a very sensitive assay with catechol was used, even small
ts of rPtechol 2,3-dioxygenase were easily tetected in the
pKMY517-transformed cells in the absence of induction. When the
cells are inA~lred, large rc of catechol 2,3-dioxygenase may
be produced, as described in Example 9 below.
E~AXPLE 8
Construction of a pKMY299-derived Expression System
15 for the Luciferase Gene of FireflY Photin-.~ Dyralis
A. Preparation of pLu2
A double-stranded synthetic oligonucleotide was prepared
with the following seq~ence:
NdeI
5~ .AAr.AcGC~AAAAA~ATAAA~AAA~GCCCGGCGCCATTCTATCCT-3'
3'-ACCTTCTGCG~ lAl~ CCGGGCCGCGGTAA~ATA~GATC-5'
XbaI
Each strand was synthesized using an Applied Biosystems Model
380B nucleic acid synthesizer. The two strands were annealed by
conventional methots, for example, Yansura et al., 1977, supra.
The two termini of the annealed oligonucleotide are compatible
with termini generated by cleavage with ~I and ~_I. This
touble-strandet oligonucleotide was mixed with pUCl9 DNA (Yanisch-
Perron et al., su~ra) that had been digested with NdeI and XbaI,
then ligated and used to transform E. coli JM83 cells (Vieira and
Messing, 1982, Gene 19: 259-268). Transformants were selected by
plating on L-agar with ampicillin (100 ~g/ml), IPTG (1 mM) and
~-gal (2 mg/ml~. The desired transformants, in which the -230 bp
~deI- aI fragment of pUCl9 conrRininE the lacZ gene was replaced
by the synthetic oligonucleotide during the ligation, were
ampicillin resistant and colorless. Miniprep analysis of the DNA
WO 92/06186 ~ PCI /1 IS91/06006
206~7~-
from such transforoant colonies conf~ -c the presence of an
-2.5 kb plasmid with expected ~I and 3p_I sites. One such
isolate was designated pAD6. Plasmid pAD6 thus contains a coding
s~qu~nce for the 5' end of the firefly luciferase gene begi~ning
5 with the seiuellce ATG enro~;ng the start codon (within the
synthetically derived ~I site) and ending with the XbaI site at
codon 16 (nucleotide 100) (see Figure 1 of de~et et al., 1987,
Mol. Cell. Biol. 7:725-737).
In order to construct an intact firefly luciferase gene,
plasmit pAD6 DNA was digested with NdeI and XbaI, releasing the
synthetic oligonucleotide insert. The small insert fragment was
isolated from a 10% polyacrylamide gel according to conventional
methods. Plasmid pJD201 (deWet et al., l9B7, suDra) comprises a
full-length, intronless Photinus Dyralis (firefly) luciferase gene
constructed by a genomic DNA-cDNA fusion cloned into plasmid
pUCl9. Plasmid pJD201 DNA was digested with XbaI and KDnI. The
-1.7 kb frag~ent cont~;nin~ the majority of the fire n y
luciferase gene coting sequence (i.e. from the ~_I cleavage site
at codon 16 (nucleotide 101) to the ~I site in the polylinker
of pUCl9) was isolated from a 0.7% agarose gel according to
cu~ r.~ional methods. The ewo purified fragments (NdeI~ I and
XbaI-KDnI ) enro~i n~ the complete firefly luciferase gene were
mixed with plasmid pCFM1156 DNA that had been digested with NdeI
(at the ATG of pCF~1156) and ~I. Plasmid pCFM1156 is identical
25 to plasmid pCFM4722 described by Burnette et al., 1988,
Bio~Technology 6: 699-796, and contains an inducible PL promoter,
a rihos~ - binding site, a cloning cluster, . coli origin of
replication, a transcription te_ n~tor, genes regulating plasmid
copy number, and a ~n ~cin-resistance gene. The 3-fragment
mixture was ligated and used to transform E. coli FM5 cells.
Transformants were selected on L-agar plates cont~i~ing 50 ~g/ml
~n ~in. The desired -6.4 kb plasmid was designated pLu2.
Miniprep analysis of restriction endonuclease digested pLu2 DNA
con~i d that an -1.7 kb ~ XbaI-K~nI insert had been
successfully cloned into pCFM1156. The NdeI-H~aI-MluI-EcoRI-
NcoI-KDnI linker was thus deleted from pCFM1156. Since there was
W O 92/06186 ~069741.~ P ~ /US91/06006
a possibility that multiple copies of the small fragmen~ purified
from pAD6 for the ligation could have been insertet, plasmid pLu2
DNA was subjected to DNA sequence analysis. The sequence
analysis showed that a single copy of the small fragment of pAD6
had been inserted and confirmed the desired coding sequence of
luciferase.
B. Preparation of Plasmid pKMY520
Plasmid pLu2 DNA (Section A above) was digested with NdeI
and ~p718 (Boehringer Cat. No. 814253). Asp718 recognizes the
same 6 bp sequence as ~E~I, but cuts at a different site, as
follows:
G'GTACC
CCATG~G
Similarly, plasmid pKMY299 DNA (Example 5) was digested with NdeI
and As~718. The designated pLu2 and pKMY299 DNAs were mixed,
ligated and used to transform ~. ~1i B 101 cells. Transfo -n~5
were selected on L-agar plates with tetracycline (10 ~g/ml).
Colonies were picked, screened for luciferase activity, and tested
by miniprep analysis as follows. Each colony picked was grown
-15 hours in 5 ml of L-broth with 10 ~g/ml tetracycline.
Luciferase activity of each was assayed in accordance with the
procedure of Example 10. Those with detectable luciferase
activity were chPrk~d by miniprep analysis, using HindIII and
Asp718 to digest the miniprep DNA. The desired plasmid contained
three fragments: an -1.1 kb ~ndIII fragment, an -2.2 kb HindIII-
As~718 fragment and an -8.1 kb (vector) HindIII-As~718 fragment.
It had a size of -11.4 kb and was designated pKMY520. Plasmid
pKMY520 thus contains an -1.7 kb NdeI-As~718 fragment derived
from pLu2 comprising the firefly luciferase gene inserted into
the NdeI and K~nI sites of pKMY299.
F~MPLE 9
Ca~echol 2.3-Dioxvgenase Assav
Cells were grown in 50 ml of PAS medium (Chakrabarty, et
al., 1973, Proc. Natl. Acad. Sci. USA ~Q: 1137-1140) cont~;ning
0.4% glutamate or 50 ml of L-broth in the presence or absence of
W O 92/06186 P ~ /US91/06006
.~ .. ..
Z06974~ -34-
O.35 mM sodium salicylate (as in~..rer) for ^13-14 hrs. at 30~C.
The cells were harvested by centrifugation, the pellet wsshed
with 20 ml of 100 ~M sodium phosphate buffer at pH 8.3. T~e
cells were resua~el~ded in 5 ml of the same buffer with 10% (v/v)
acetone for enzyme stabilization. The resuspended cells were
sonicated using a cell disrupter ~f~tured by ~eat Systems -
Ultrasonics, Inc. (Plainview, New York; available as model No.
U-375) and giving 5 pulses of 10 seconds/pulse with 1 minute
between each pulse. After sonication, the suspension was
centrifuged for 30 in~tes at 15,000 rpm in a Beckman
Instruments, Inc. (Somerset, NJ 08875) J2-21 centrifuge with a
JA20 rotor to yield a crude extract for assay and for SDS-PAGE
analysis. The pellet was discarded and the supernatant (crude
extract) was used in the assay for catechol 2,3-dioxygenase
activity essentiAlly according to Sala-Trepat and Evans, 1971,
Eur. J. Biochem. 20: 400-413, as follows. The total volume for
the assay was 1 ml. One to 10 ~1 of crude extract (or an
appropriate dilute of extract) was mixed with 100 ~1 of 3.3 mM
catechol (substrate) and then ~lute~ up to 1 ml with assay
buffer (100 mM sodium phosphate, pH 8.3 with 10% (v/v) acetone).
Formation of the yellow product, 2-1-ydrO~ conic semialdehyde
(extinction coefficient ~ - 33.4 mM~~ cm~1) was measured at O.D.375
using a ~ec~ ~n DU-70 spectrophotometer. An aliquot of the crude
extract was also used for the determination of protein
concentration by the method of Bradford, 1976, Anal. Biochem. 72:
248 using the Bio-Rad Protein Assay Kit obtained from Bio-Rad
Laboratories, Richmond, CA 94B04. The calculated specific
activity (~mole/min/mg) is reported in Table I below. Strain
PpG1901 (Yen and GtlnC~l AC, 1982, Proc. Natl. Acad. Sci. 79: 874-
878; Yen and G~mc~l~c, 1985, J. Bacteriol. 162: 1008-1013) is
Pseudomonas utida G1343 contAinin~ the wildtype NAH7 plasmid.
Strain PpY1006 is Pseudomas ~utida G572 (Shaham et al., 1973, J.
Bacteriol. 116: 944-949) con~inine plasmid pKMY517 (Example 7).
Table I shows that when cells from these 2 strains were grown in
the presence of an inducer of the PG promoter (e.g., 0.35 mM
sodium salicylate), significant amounts of enzymatically active
W O 92/06186 PCTtUS91/06006
Z06!~741
-35-
catechol 2,3-dioxygenase were expressed. The plasmid pKMY517
cO~esin~ the cstechol 2,3-dioxygenase gene derived from the NAH7
plasmid. Even ~ninA-~eed pKNY517-co~t~ining cells exhibit
detectable levels of catechol 2,3-dioxygenase activity, indicating
that the inA,~cihle promoter is somewhat ~leaky~ (i.e,, a small
amount of enzyme is made even without an inducer of the D~
gene), Nonetheless, the results shown in Table I clearly
demonstrate that when cells cont-~inin~ pKMY517 were grown in the
presence of inA~cer, the highest levels of catechol 2,3-
dioxygenase activity were observed,
TABTF I
Expression of the Catechol 2,3-dioxygenase
Gene of the Plasmit NAH7 from NAH7 ant the Plasmid
Vector pKMY319 in Pse~ 95 putida
Specific Activity of catechol
2,3-dioxygenase
Plasmid Host Cell (~mole min~lm~
NAH7 l~ninA~ed P, Putida G1343 0.02
NAH7 inAuced P. Dutida G1343 0.8
pKMY517 l~ninA~ced P. utida G572 1.7
pKMY517 inA,l~ced P. D~t~da G572 20.0
These results demonstrated the usefulness of pKMY319 as an
expression vector in obr~inin~ regulated gene expression.
Comparing the level of catechol 2,3-dioxygenese produced from NAH7
with that from pKMY517, a 25-fold overproduction was observed
under the experimental conditions (Table I). Production of
caeechol 2,3-dioxygenase relative to other proteins produced in
P. ~utida harboring plasmid pKMY517 was analyzed on SDS-
polyacrylamide gels (Figure 5). SDS-PAGE was performed
essentially according to T r- 81i 1970, Nature 227: 680-685.
Protein samples (crude extracts prepared as described above) were
heated at 65C for 15 min~tes in a loading buffer cont~inlng 2%
SDS, 5% 2-mercaptoethanol, 10% glycerol, 0.02% bromophenol blue
and 62.5 mM Tris-Cl (pH 6.8) before they were loaded on the gel.
W O 92/06186 PCT/US91/06006
206974~
The gel was stained with C~ ~csie blue and sc~nn~d with a laser
densitometer (Ultrascsn XL, Pharmacia LKB Biotechnology, Inc.,
Picc~e~sy~ NJ 08854) to dete~ in~ relative protein productions.
As shown in Figure 5: lanes 1 and 10 are molecular weight
5 standards (hen egg white l~soz~ ~, 14,400; soybean trypsin
inhibitor, 21,500; bovine carbonic anhydrase, 31,000; hen egg
white ov~ll n, 42,699; bovine serum albumin, 66,200; and rabbit
muscle phosphorylsse b, 97,400): lanes 4 and 5 are PpY1006 in
PAS, jn~red and ~in~ ed, respectively: and lanes 8 and 9 are
PpY1006 in L-broth, in~uced and l~ninA~ced, respectively. Similar
percentages of catechol 2,3-dioxygenase were produced whether the
cultures were grown in PAS medium or L-broth. The amount of
catechol 2,3-dioxygenase produced represented -10% of the total
soluble cell proteins (Figure 5, lanes 4 and 8). These results
demonstrated the usefulness of the pKMY319 expression vector for
the oveL~Iu~ction of gene product(s).
E 10
T~ iferase AssaY
Strain Ppn 009 cells were grown in 5.0 ml of L-broth with
20 10 ~g/ml tetracycline at 30C to a density of O.D.~50 - 4.5 in
the presence or sbsen~e of 0.35 mM sodium salicylate as an
inducer. Strain Ppn 009 is Pseudomas putida G572 (Shaham et al.,
su~ra) cont~inin~ plasmid pKMY520. An aliquot of cell suspension
(3-10 ~1) was mixed with water and 30 ~1 of assay buffer (0.2 M
25 HEPES, pH 7.7, 50 mM MgS0~) in a total volume of 100 ~1 in a
cuvette. The cuvette was placed in a 1~ ter, for example,
a LVMAC BIOCuu-~l~K M 2500 (LUMAC B.V., P. 0. Box 31101, 6370 AC
Landgraaf, The Netherlands). The light-emitting reaction was
initiated by injection of 100 ~1 of 1 mM luciferin (Sigma
30 Chemical, St. L~uis, M0 63178) in 5 mM citrate buffer, pH 5.5,
and 100 ~1 of 100 mM rATP in water. [The BIOCOuNl~K M 2500, a
very sensitive photon counter controlled by a microprocessor, was
operated for these analyses in the "A2 mode n ] . The light
produced was displayed in relative light units (RLU) by the
35 1~ ter. [According to the Biocounter manufacturer's
W O 92/06186 2069741 PC~r/US9l/06006
instructions, the photomultiplier is calibrated such that 200 pg
ATP in 100 ~1 LDMIT-P~ gives 7,200 RLU]. The tata are reported
as specific activity of luciferase (RLU/~g protein). Protein
concentration was measured as describet in Example 9, using the
methot of Bradfort, 1976, suDra ant the Bio-Rat Protein Assay
Kit. Cells were resuspended in 0.1 N NaOH and incubated in a
boiling water bath for 20 n~)tes before protein determination.
~r~RT.F II
Expression of the Luciferase Gene of the Firefly
Photinus ~ralis from the Expression Vector pKMY299
in Pseudo~onas ~utida and Escher~chia çoli
Specific activity
of luciferase'
Plasmit~ Host Cell~ (~TTI Der ~F ~rotein~
pKMY520 lminAllced ~. ~utida G572 4.5 x 10~
pKHY520 in~red P. ~utida G572 4.1 x 106
pKMY520 ~in~ced ~. coli JM103 1.9 x 103
pKMY520 in~lc~d _. coli JM103 1.5 x 105
'Plasmit pKMY520 is pKMY299 csrrying an insert co~inine firefly
luciferase gene.
~Cells grown in L-broth as describet in this Exa~ple 10.
CCells not carrying the luciferase gene gave a background value
of less than 30 RLU per ~g protein.
Production of luciferase protein in P. ~utida was also analyzed
by SDS-PAGE, according to the methot described in Exa~ple 9 for
the analysis of catechol 2,3-dioxygenase. Luciferase production
in unin~t~ced P. ~utida cells harboring pKMY520 was barely visible
on SDS gels when the cells were grown in PAS medium (Figure 5,
lane 3) or in L-broth (Figure 5, lane 7). However, the high
sensitivity of the luciferase assay allowed detection of
relatively high enzyme activity from ~nin~ced P. ~utida or E.
s~l~ cells harboring pKMY520, as shown in Table II above. This
assay also allowed detection of an -90-folt induction of activity
in P. ~utida and an -80-folt intuction in E.coli (Table II).
_ -38- 206974 1
The SDS-PAGE analysis revealed that the amount of
luciferase produced in induced P. putida harboring pKMY520
represented ~3.7~ of the total soluble proteins whether the
cells were grown in PAS medium (Figure 5, lane 2) or in L-
broth (Figure 5, lane 6). These results demonstratedregulated expression of a eukaryotic gene from pKMY299 in
two different Gram-negative host cells.
EXAMPLE 11
Construction of and Assay for pKMY319-Derived
Expression System for Toluene Monooxygenase (TMO) Genes
The tmoABCDEF gene cluster from Pseudomonas mendocina
KR-1 has been cloned and sequenced. To further test the
use of pKMY319 as a regulated expression vector in Gram-
negative bacteria, restriction fragments carrying the TM0
gene cluster from P. mendocina KR1 were cloned into
pKMY319. Specifically, pKMY342 was constructed by cloning
the ~4.7 kb XbaI-SacI fragment of pKMY341 carrying the TM0
gene cluster into pKMY319. Plasmid pKMY341 was constructed
by cloning the ~4.7 kb XbaI-BamHI fragment of pKMY336
carrying the TM0 gene cluster into the E. coli vector
pT7-5. The construction of pKMY336 has been described in
detail in the above-referenced co-pending and co-assigned
application. Analysis of pKMY342 DNA with restriction
enzymes demonstrated that two copies of the XbaI-SacI
fragment joined by a SacI-KpnI-XbaI linker derived from the
multiple cloning site in pKMY319 had been cloned into
pKMY319. The pKMY342 recombinant plasmid carrying the TM0
gene cluster was then introduced into a number of Gram-
negative bacterial species as shown in Table III below.
Expression of the TM0 genes was measured under induced and
uninduced conditions. As shown in Table III, significantly
higher specific activities of toluene monooxygenase were
observed from induced cultures as compared with
W O 92/06186 PCT/US91/06006
21~69~4~
-
-39-
inAl-red cultures of all bacterial strains tested. These
results demonstrated the wide use of pKMY319 as an expression
vector in obtsin;n~ regulated gene expression in Gram-negative
bacteria.
TART ~ III
Expression of the Toluene Monooxygenase Gene Cluster
ABCDEF of Pseudomonas mendocina KRl
from the Plasmid Vector pKMY319 in Gram-Negative Bacteria
Specific Acti~ity of
Toluene Monooxygenaseb
Bacterial Strain- (nmole min~lmg~
Aeromonas hydro~hila Y21, Iminduoed 0.3
Aeromonas hvdro~hila Y21, inAllre~ 17.0
15 Enterobacter cloacae Y81, min~-lced 0 9
Enterobacter cloacae Y81, indllred 23.0
Escherichia coli Y5250, min~l~ced 0.9
Escheri~hia Qli Y5250, in~l~ced 19.0
Kl ebsiella pl,e: niae Y61, min~lred 1.3
Klebsiella Dneumoniae Y61, ind~ced 15.0
Pseudomonas ~utida Y2511, l~nind~ced 0.8
Pseudomonas ~utida Y2511, 1n~ced 27.0
Pseudomonas mendocina Y4075, ~nin~uced 1.2
Pseudomonas mendocina Y4075, ;n~vred 19.0
'All bacterial strains contain the recombinant plasmid pKMY342,
which is pKMY319 carrying an insert contAining the toluene
monooxygenase gene cluster from P. mendocina KR1. The parent
strains into which pKMY342 was introduced are all natural
isolates.
bThe specific activities in toluene-inAvced and llnin~lced P.
mendocina KRl cells were 30 and 0.5 nmole min ~mg 1, respectively.
W O 92/06186 ~ PCT/US91/06006
2069741
-40-
EgA~PLE 12
Tailoring 5' End of Known Genes for Inser~ion into
Plasmid D~MY299 EYnression Svstem
Since the ~I recognition site ends with the sequence ATG,
altering the 5' end of anv gene beg; nni ne with the sequence ATG
to generate an NdeI site does not lead to a change in the coding
property of the gene. This is an ideal manner of generating a
suitable 5' end restriction site for precise cloning of a gene
for expression and requires the alteration of no more than 3
nucleotides. The 3 nucleotides that are 5' to the sequence ATG
~n~o~ing the start codon of a gene may be specifically converted
by site-directed mutagenesis to CAT, thus creating an NdeI
recognition site for cloning into the pKMY299 broad host range
expression system.
Site-directed mutagenesis is either accomplished according to
conventional methods (for example, see Chapter 15 of Sambrook et
al., 1989, Molecular Clonin~ - A Laboratory Manual (Second
Edition), Cold Spring Harbor Laboratory Press, N.Y.; Chapter 8 of
Current Protocols in Molecular BioloYY, Ausubel et al., eds.,
1989, Greene Publiching A~soci~tes and Wiley-Interscience) or
accomplished with the following steps: (i) locate a restriction
site just inside the coding region; and ~ii) attach a synthetic
oligonucleotide linker at this restriction site that restores the
reading frame of this gene and contains an NdeI site at the 5'
end. Examples of generating an NdeI site at the 5' end of a
gene using the latter method can be found in Burnette et al.,
1988, supra, or in Example 8 above. Such modified genes are
useful for cloning into the pKMY299 broad host range expression
system according to the present invention.
