Note : Les descriptions sont présentées dans la langue officielle dans laquelle elles ont été soumises.
2 ~ 8
~2/14843 1 PCI`/US92/01383
APTA~3R. _SP~CIFI_~,~
A~D ~31'EIOD OF M~CING
Tes~nic31_Field
The preser.:: invention i9 directed to a method
for identifying oligonucleotide ~equences which
specifically bind biomolecules, including peptides,
hydrophobic molecules, and target ~eatures on cell
surfaces, in parti~ular extracellular proteins, and the
use of the~e sequences to detect and/or isolate the
target molecules and the reisulting compositions. The
instant invention is exemplified by obtaining
compositions, through the use of disclo~ed methods, that
comprise oligonucleotide sequences which bind to Factor
: X, thrombin, kinins, eico3anoids and extracellular
proteins.
The invention is also directed to improvements
:. in methods to identify specific binding sequences for
~arget substances and methods of use of such specific
binding sequences. More specifically, it concerns: (1)
the use of oligonucleotides containing modified monomer
residues to expand the repertoire of candidate oligomer
sequence~; (2) the u e of identifying and amplifying
oligonucleotides without attached flanking regior,s or
structural con~traints, but which nevertheless are
capable of specific binding to de~ired targets; and (3)
the design and use of conjugates designed to bind
~ specific target cells and induce an immune response to
.~ the target cells.
SUE3STITUTE~ SHEE~T
'.~
,
: .
. . .
; ' . ' '
210~
W092~1~3 PCT/US92/01~'
-2-
BackqrQund a~ Rela~ Art
S~eçi~ically Bindin~ Qliqonu~leotides. Con-
ventional method~ of therapeutic treatment based on
binding and inhibition of therapeutic target molecules as
well as detection and isolation of proteins and other
molecules have employed small molecules, antibodies and
the like which specifically bind ~uch substances.
Recently, however, the de novo design of specifically
binding oligonucleotides for non-oligonucleotide targets
ha~ been described. See, e.g., ~lackwell et al., Science
(1990) ~Q:1104-1110; ~31a~kwell et al., Science ~19gO)
250:1149-1151; Tuerk, C., and Gold, ~., Science (1990)
249:505-510; Ellington et al., Nature (1990) 346:B18-
822. Such oligonucleotides have been termed "aptamers"
herein. The Tuerk reference describes the use of an 1n
vitro ~ele~tion and enrichment procedure to obtain RNA
molecules that bind to an RNA binding protein. In this
méthod, a pool of RNAs that are completely randomized at
specific positions is subjected to selectlon for binding
to a desired protein. The selected RNAs are then
amplified as double-stranded DNA that is competent for
subsequent in vitro transcription. The newly transcribed
RNA is then enriched for better binding sequences and
recycled through this procedure. The amplified selected
sequences are subjected to sequence determination using
dideoxy sequencing. Tuerk and Gold applied this
procedure to determination of RNA molecules which are
bound by T4 DNA polymerase. The method utilizes the
polymerase chain reaction (PCR) technique, as described
; 30 by Saiki, R.K., et al., ~Çi~5~ (1988) 239:487-491, to
amplify the selected ~NAs.
Kinzler, K.W., et al., Nucleic Acids Res (1989)
17:3645 3653, describes the use of PCR to identify DNA
sequences that are bound by proteins that regulate gene
expression. In the reported work, total genomic DNA is
'.~,''
' :
.. ~ : : . ....
~: ' . - ~ : . .'
,: - . . .
:,' . "~'
.: :
: - ~
: .. . .~
... .:
~92/~3 2 ~ O ~ ~ 3 ~ PCT/VS9Z/Ot383
-3-
first converted to a form that is suitable for
amplification by PCR and the DNA sequences of interes~
are selected by binding to the target regulatory protein.
The recovered bound ~equences are then amplified by PCR.
S The selection and amplification process are repeated as
needed. The process as described was applied to identify
DNA sequences which bind to the Xenopus laevis trans-
cription factor 3A. The same authors (Kinzler et al.) in
a later paper, Mol Cell Biol (1990) 10:634-642, applied
this technique to identify the portion of the human
genome which is bound by the G~I gene product produced as
a recombinant fusion protein. The GLI gene is amplified
in a subset of human tumors.
Ellington, A.D., et al., Nature (1990) 346:818-
822, describe the production of a large number of random
sequence RNA molecules and identification of those which
bind specifically to selected molecules, for instance,
organic dyes such as Cibacron blue. Randomly synthesized
DNA yielding approximately 1015 individual sequences was
amplified by PCR and transcribed into RNA. It was
thought that the complexity of the pool was reduced in
the amplification/transcription steps to approximately
1013 different sequences. The pool was then applied to
an affinity column containing the dye and the bound
;~ 25 sequences subsequently eluted, treated with reverse
tran~criptase and amplified by PCR. The results showed
that about one in 101 random sequence RNA molecules
folds in such a way as to bind cpecifically to the
ligand.
Thie~en, H.-J., and Bach, C., Nucleic Acids Res
(1990) 18:3203-3208, describe what they call a target
detection assay (TDA) to determine DNA binding sites for
putative DNA binding proteins. In their approach, a
purified functionally active DNA binding protein and a
pool of genomic double-stranded oligonucleotides which
'
..'
. .
- : : . :' ' , :
: - :: - - :
: : :: : ... :........ .. .
, , . '' ,: ~'- .
.
:., , . :
' : ' :'
., ~
- ~ , .
%' 1 ~
WO92/1~3 PCT/US92/01-
-4-
contain PCR primer sites at each end were incubated with
the protein. The resulting DNA complexes with the
protein (in their case, the SPl regulatory protein) were
~eparated from the unbound oligomers in the mixture by
band-shift electrophores~ 9 and the complex oligo-
nucleotides were re~cued by PCR and cloned, and then
sequenced using double-~tranded mini prep DNA sequencing.
None of the above references, however,
describes the identification of oligonucleotide~ which
specifically bind biomolecules that are not known to
interact wi~h oligonucleotides. In particular, these
references do not describe the identification of
oligonucleotides which specifically bind peptide
molecules such as serum proteins, kinins, hydrophobic
lS molecules such as eico9anoids, or extracellular proteins.
In addition, the art has not demonstrated (i)
ln vivo therapeutic (mammalian or primate) efficacy of
selected oligonucleotides for any clinical indication,
(ii) binding of single-stranded DNA oligonucleotides to
molecules that do not ordinarily bind to nucleic acid as
;~ part of their normal function, (iii) interference with
the function of a target molecule by bound a
oligonucleotide or aptamer, (iv) target molecule binding
mediated by single-stranded DNA and (v) target-speci.ic
binding of short oligonucleotides or oligonucleotide
analogs that are derived from a larger full-length parent
oligonucleotide (aptamer) molecule.
Targets. Kinins are peptides which are formed
in biological fluids by the activation of kininogens.
Kinins have been shown to exert numerous physiolosical
and pathological actions such as exhibiting hypotensive
effects, causing pain, mediating reactive hyperaemia in
exocrine glands, playing a role in vascular and cellular
events that accompany the inflammatory processes,
controlling blood pressure, and possibly acting as
:~ .
:~
:.,
., .
, . .. . . . .. . . .. , , -
' ' , :
~ ' ' '
21~98
092/1~w~ PCT/lJS92~01~3
-5-
protectlve agents against hypertension. In pathological
states, kinins have ~een implicated in asthma,
inflammatory diseaseq such as rheumatoid arthritis and
other forms of arthritls, vascular changes occurring in
migraine, myocardial infarction, cardiova~cular failure,
carcinoid and post~astrectomy dumping syndromes,
hyperbradykininism syndrome, hemorrhagic and endotoxic
shock, as well as other pathological conditions. For a
review of kinins, see Regoli, D., and Barabe, J.,
Pharmacolo~ical_Review (1980) 32:1-46.
Eicosanoids are a family of fatty acid
derivatives which include the various prostaglandins,
thromboxanes, leukotrienes and prostacyclin. Eicosanoids
are widespread and produce a remarkably broad spectrum of
effects embracing nearly every biological function. For
example, eicosanoid~ have been shown to affect the
cardiovascular system, blood, smooth muscle, kidney and
urine formation, the central nervous system, inflammatory
and immune responses, afferent nerves and pain, as well
as several metabolic functions. For a general review of
eicosanoids and their biological significance, see
Moncada, S., et al., in The Pharmacoloqical Basis of
Thexa eutics, Gilman, A.G., et al., eds. (MacMillan
Publishing Company, New York), 7th Edition, pages 660-
671.
Many of these molecules are 80 ubiquitous that
a~tibody production in laboratory animals against the
native molecules is difficult unless they are chemically
modified to become antigenic. Labeled kinins with
sufficient ~pecific activity are not available and
'; bradykinin antibodies tend to cross-react with kininogen.
Therefore, conventional immunodiagnostic and isolation
techniques are not easily available with respect to these
;~ substances. It would therefore be desirable to develop
alternative methods for working with these agents.
.' ' ~'
.
WO9~/1~3 2 1 0 ~ 6 9 8 PCT/US92/01~-
-6-
Additionally, there are numerous difficulties
related ~o collecting biological samples while avoiding
the formation or the inactivation of kinins. Thus,
previous as~ay methods have focused on measuriny the
particular kininogens rather than the activation peptid~s
thereof. For a review of the problems associated with
the use of conventional diagnostic techniques and kinins,
see Goodfriend, T.L., and Odya, C.E., in Methods of
Hormone Radloimmuno~y~, B.N. Jaffee and H.R. Behrman,
eds. ~Academic PreYs, New York), l979, payes 909-923; and
Talamo, R.C., and Goodfriend, T.L., Handbook Exp.
Pharmacol. ~1979) 25 ~Suppl.):301-309. It would
therefore be desirable to develop alternative methods for
working with these agent~.
Particular cells,can be ~haracterized by the
presence of certain proteins on their surface. These
proteins can serve a variety of functions including
providing binding cites for other biomolecules and/or
virus receptors. It is al~o known that it i3 possible to
differentiate normal cells of a given type from abnormal
cells by the type and/or amount of characteristic protein
on the cells' surface. Since it i9 known that it is
possible to differentiate different type~ of cells by the
characteristic proteins present on their surface,
different methodologies have been developed in attempts
to characteri~e cells by the ability of certain molecules
to bind to the characteristic proteins on those cells.
The present in~entors postulated that
oligonucleotides could be used to bind to characteristic
proteins at the cell surface. Although such bindiny does
occur, it is not highly specific, i.e., a given
oligonucleotide may bind to cellular proteins on two very
different types of cell lines. Further, even if a
particular oligonucleotide is found to be specific to a
particular characteristic protein, it is difficult to
: .
.
' .: ' .:' ,
~ .. : ,
~ , . : .
2~0~9~ il
092/l~3 PCT/US9~/01383
-7-
isolate the desired oligonucleotide and produce it in
sufflcient amounts so as to allow it to be useful as a
probe to identlfy particular cell lines having particular
characteristic proteins thereon.
- 5 The invention herein provides an approach and
utilizes a binding selection method combined with PCR or
other amplification methods to develop aptamers that bind
peptide molecules such as factor X, kinins, hydrophobic
molecules such ac eicosanoids, and ext~acellular
proteins. In this method, selected and amplified
aptamers that specifically bind to these targets are
obtained starting from a pool of randomized
; oligonucleotides.
Synthetic Methods. The above references on
specifically-binding oligonucleotides do not suggest that
oligomers can be synthesized in the candidate mixture
containing analogous forms of purines and pyrimidines, as
well as modifications in the sugar moieties and the
phosphodiester linkages. This inclusion i5 significant,
since those oligomers containing modifications may have
superior binding qualities which are attributable to the
modifications per se and this inclusion thus expands the
repertoire of candidates subjected to the initial screen.
The present invention is related in part to an
improvement in the above-described methods wherein
oligomers containing modifications not found in native
; sequences can be included among the candidates for
specific binding.
;~ Furthermore, although PCR has made possible the
isolation and analysi3 of specific nucleic acid fragments
from a wide variety of sources, application of PCR to
isolate and analyze a particular nucleic acid region
heretofore has required knowledge of the nucleic acid
' sequences either flanking or within the region of
interest. The requirement of prior knowledge of the
:
:: .
' ' .
:. .
: . . . : . . . . ..
, ~ .
: .
:- : : ~ .
. ~
wos2/l~3 PCT/US92/Ot~-
-8-
flanking region i9 particularly trouble~ome when trying
to identi~y aptamers. Flanking primer ~equences impose
limi~s on aptamer structural diversity: either the
ability to bind is affected by the primer~, thereby
s eliminating from consideration a class of binding agents,
or occasionally, the primers actually participate in or
facilitate binding by conferring structure. Flanking
sequence thus may impose constraints which make aptamers
so identified suboptimal for drug development. Th~se
problem~ with the proces3es of selection for truly
optimal binding agents or aptamers have severely limited
drug development.
Clearly, it would be advantageous to devise
methods which permit the identification of optimal
aptamers. Methods such as those described by Ellington,
A.D. et al., Nature (1990) 34~:818-822, estimate that 1
in 1olO aptamers bind in that system. The novel methods
herein described and claimed may revise this ratio
downward to l in 109 or 1 in 108. With regard to drug
development, many scientists have failed to recognize the
problem that flanking primer sequence~ represent with
respect to selection for truly optimal binding agents.
Furthermore, none of the cited references
describe the identification of aptamers capable of
binding to proteins such as thrombin, nor is the use of
single stranded DNA suggested as an appropriate material
for generating aptamers. The use of DNA aptamers
according to this invention has ~everal advantages over
RNA including increased nuclea~e stability and ease of
amplification by PCR or other methods. RNA generally is
converted to DNA prior to amplification using reverse
transcriptase, a process that is not equally efficient
with all sequences, resulting in lo~s of some apt~mers
from a selected pool.
. . :
. . - .:
' : . . ~ , - . ~ - :
,
::
~9~ 3 2IQ ~ ~8 PCT/US92/Ot383
Modified BaseS in Polymerizaticn React~Qa~. A
large number of modifications which behave in a known
manner in pQlymerase react.ions is known. Otv09 , ~ ., e~
al., Nucleic Acids Re~ (1987~ 1763-1777, report the
S enzyme catalyzed incorporation of 5-(}-alkenyl)-2
deoxyuridines into DNA. As reported in thi paper,
5-vinyl-dUP behaved in the DNA polymerase I reaction
catalyzed by the Klenow fra~ment in a manner similar to
dTTP; (E)-5-(1-heptenyl) and (E)-5-(1-octenyl)-dUDPs were
poor substrates; however, all of the~e re~idues are read
as thymidine in the polymerization.
Allen, D.J., et al., }3iochemistry (1989)
28:4601-4607, report the incorporation of 5-(propylamino)
uridine into oligomers and its labeling, using the
propylamine function, with mansyl chloride. This complex
was used to study interaction with DNA polymerase I
(Klenow fragment) and was shown to interact with the
enzyme. This base residue is also recognized as
thymidine.
Langer, P.R., et al., Proc Natl Acad Sci USA
(19al) 78:6633-6637, described the synthesis of DNA and
RNA using dUTP and UTP residues labeled with biotin
through a linker at the C5 position. These labeled forms
of dUTP and UTP were utilized by a number of DNA and RNA
polymerases and are recognized by the~e enzymes when
included in the oligomer template as thymidine or
uridine.
Gebyehu, G., et al., Nucleic Acids Res (1987)
15:4513, reported biotin-labeling of dATP and dCTP
nucleotide analogs through the 6-position of adenine and
4-position of cytosine. They were incorporated into DNA
probes by standard nick translation protocols and probes
labeled with biotin derivatives of these nucleotides were
effectively hybridized to target DNA sequences. Thus,
the modified forms of dATP and dCTP, when incorporated
'
. .
. : :
2:~0~698
WV92/l~3 ` PCT/US92/01-
- 10-
into oligomers are recognized as A and C, respectively.
Similarl-y, Gillam, I.C., et al., Anal BiQhç~ (1986) 199-
207, described the incorporation of N4-(6-aminohexyl)
cytidine and deoxycytidine nucleotides into DNA
enzymatically.
Trainor, G.L~, et al., Nuçlei~ Aci~ Res ~1988)
16:11846, descri~e the ability of succinyl-fluorescein-
labeled dideoxynucleoside triphosphates as substxates for
terminal deoxynucleotidyl transferase and their use in
the preparation of 3'-fluorescence-tagged DNA.
Mizusawa, S., et al., Nuçle ~ (1986)
14, described the replacement of dGTP in polymera~e
reactions by deoxy-7-deazaguanidine triphosphate; this is
also described in the context of a PCR reaction by Innis,
M.A., in "PCR Protocols: A Guide to Methods and
Applications" ~1990) Academic Press Inc.
The in~orporation of 5-azido-dUTP appears to
substitute for dTTP in polymerase reactions as reported
by Evans, R.X., et al., BiQchemi3~ry (1987) 26:269-276;
20 Proc_Nat1 Ac~ i USA (1986) ~:5382-5386.
Oligonucleotides which contain covalently-
bound mercury at specific base residues was described by
Dale, R.M.K., et al., Pr ~ (1973)
70:2238-2242.
Finally, a terminal fluorescence residue using
purines linked to fluorescing moieties is described by
Prober, J.M., et al., Science ~:336.
Further, as set forth in the foregoing
publications, not only is the modified base specifically
recognized as such in a template sequence; nucleotide
triphosphates utilizing the modified base are also
capable of incorporation into the newly synthesized
strand by polymerase enzymes.
Immune Recc~nitiQn Mechanisms. This in~ention
is al~o related to ~he u~e of specific bindirg oligomer~
':
:: . , : -
: : : - ................................ :
, , '' : ' ' : :~ '
210 1~98
~92/~ PCT/US92/U1~3
- 11 -
in immune recognition mechani~ms. various immune
recognition mechanisms exist which permit recognition and
immune destructiQn of malignant or infected cells in an
organism. Malignant cells often express antigens that
are not found in normal cells; some of these antigens are
found at the surface of the cell. Similarly, pathogen-
infected cells often express pathogen-encoded antigen~ at
the cell surface. In both cases, the surface antigen
represent~ a potential target for a CTL (cytotoxic T-
cell) immune response.
Unfortunately, immune responses againstunwanted cells are not always effective; moreover, such
responses can, in some instances, be suppressed. A
variety of mechani~ms may play a role in the reduction or
! 15 suppression of immune responses to pathologic cells. For
example, tumors are associated with a decreased level of
the histocompatibility antigens that may play a role in
eliciting a CTL response. Viruses have also been able to
mask viral antigens at the cell surface. In the case of
HIV, heavy glycosylation of the envelope protein
(normally found at the cell surface) may play a role in
preventing an effective immune response against infected
cells. The propensity of pathologic cells to reduce or
escape effective CTL responses probably plays a role in
the progression of various infections and disorders.
While some vaccines in current use consist of
only portions of a pathogen (such as a ~iral envelope
protein in the ca~e of HBV virus), immune responses
against an intact pathogen, such as a virus or bacterium,
are often more effective that re3ponses against
individual components of the pathogen. Attenuated virus
vaccines, for example, are used in some cases in order to
expose the immune system to antigens that present
epitopes in as natural a form as possible. The
~ 35 resulting immune response appears in general to result in
.'
W092/1~3 21 0 4 b 9 8 PCT/US92/01.~`
-12-
more effective protection against the pathogen than the
corresponding respon~e to only a portion of the pathogen.
Many CTL responses appear to be based upon
specific contacts between a plurality of surface antigens
serving as signals for both self and non-self cells.
Normal immune function is believed to involve a combined
response to this plurality of surface antigens. Hence,
it is reasonable to expect that a modified immune
re~ponse would result if-one or more of these surface
features were somehow modified or masked.
In addition to the use of antibodies specific
for one or more of the subject surface features,
considerable attention has also been directed recently to
the use of oligonucleotides of similar specificity.
De novo recovery of specifically binding oligonucleotides
is pos~ible with respect to non-oligonucleotide targets,
as discussed above.
It would clearly be advantageous to devise
methods which permit the modulation of immune response to
natural antiyens in a manner such that optimum immune
protection against a pathogen or malignant cell may be
obtained, or such that an undesired component of the
response may be eliminated. In particular, it would be
desirable to take advantage of the involvement of a
plurality of epitopes in the normal immune response by
developing immunomodulatory agents which target one or
more specific epitopes involved in generating the immune
respon~e.
Disclosure~ of the Inven~ion
The invention described herein provides
~pecifically binding oligonucleotides or "aptamers" that
are stable, versatile, and highly specific for their
intended targets. Furthermore, the aptamers of the
invention may be determined as well as synthesized using
,:
.
. :. . : . .
, . . :- .:
: : .. . .
.
. `: . : - ~ ~:
210Ll~.n3
92/1~3 PCTtUS92/01~3
-13-
modified nucleotides and internucleotide linkages. In
addition, these aptamer~ may be obtained from mixtures of
candidate oligomers with completely unpredetermined
sequences, without the neces~ity for inclu~ion of PCR
primer ~equences in the candidate pool. The efficiency
~f the method to determine ~uitable aptamers is ~urther
enhanced by separation of the complex containing
successful candidate oligonucleotides bound to target
from uncomplexed oligonucleotides and elution of the
complex rom solid support.
The aptamers of the present invention f.i.nd a
variety of utilities including therapeutic and diagnostic
utilities as well as functioning as laboratory and
indu9trial reagents. The aptamers of the invention can
1~ be coupled to various auxiliary substances such as label
or solid support.
Thus, in one aspect, the invention is directed
to an aptamer containing at least one binding:region
capable of binding specifically to a target molecule
wherein the aptamer is a single-stranded DNA. Such
single-stranded DNA aptamers can be constructed to bind
specifically to a wide variety of target substances
including proteins, peptides, glycoproteins, lipids,
glycolipids, carbohydrates, and various small molecules.
Such single-stranded DNA aptamers are advantageously
stable as compared to RNA counterparts. It has been
heretofore thought that the three-dimensional structure
of double-stranded D~A limited the structural diversity
of the molecule. The inventors herein are unaware of any
prior demonstration of structural diversity for single-
or double-stranded DNA sufficient to provide the range of
conformations necessary to provide aptamers to
biomolecules. For example, known RNA structures, such as
pseudoknots, have not been described ~or single-stranded
DNA.
'
.
.'. '
wos2~ 3 '~ '3 8 PCT/US92/0l~-`
-14-
In another a9pect, the inventisn i9 directed to
aptamers that have relatively short specific binding
regions of less than 15 nucleotide residues and which
may, themselves, be relatively ~mall molecules containing
less than 16 nucleotide residues. The limited length of
these aptamers is advantageous in facilitating
administration and synthesis. Further, in still other
aspects, the invention i9 directed to aptamers with very
low dissociation constants with respect to their target
molecules (that do not normally bind oligonucleotides) of
less than 20 x lO 9; and with high specificity for their
targets of at least 5-fold differential in binding
affinity as compared to competing substances. These
enhanced specificities and binding affinities are clearly
advantageous in the applications for which the aptamers
of the invention are useful.
In another a~pect, the invention is directed to
aptamers that bind to a wide variety of target molecules,
especially those selected from the group consi~ting of
bradykinin, PGF2~, CD4, HER2, IL-l receptor, Factor X,
and thrombin. The versatility of aptamers in
specifically binding even small and hydrophobic molecules
expands the range of their utility.
In other aspects, the invention is directed to
complexes of the target molecules and the aptamers of the
invention and to methods to obtain and to use the
aptamers of the invention.
In Ctill other a~pects, the invention is
directed to improved methods to obtain aptamers in
general. These improved methods include the ability to
utilize in a candidate pool of oligonucleotides
completely undetermined sequence~; to incorporate
modified oligonucleotides in the candidate pool and to
nclude modified nucleotides in the amplifying step of
the method; to enhance the efficiency of the method by
. . .
. .
.. - ,
., . ,- . ~ , . , ~ , ~ ,
-.
: . . , :
.. ~ . . .
~.: : : - -
2 1 0 1 ~ 9 8
~92/1~3 PCT/U592/01~3
- 15 -
isolating the complex between the ~ucce~sful members of
the candidate pool and the target molecule; and to obtain
aptamers that bind cell surface factors using a
subtraction technique.
S In still another aspect of the invention,
aptamers may be used as specific binding agents in
conjugates designed to modulate the immune ~ystem.
Brief Descri~ion of the Fiqures
o Figure 1 i9 a chaxt depicting thromhin aptamer
consensus-related sequences.
Figure 2 is a plot of n vivo thrombin
inhibition obtained from primates using a 15-mer aptamer.
Modes of Carrying Out the Invention
The practice of the present invention will
employ, unless otherwise indicated, conventional
techniques of chemistry, molecular biology, biochemistry,
protein chemistry, and recombinant DN~ technology, which
are within the skill of the art. Such techniques are
explained fully in the literature. See, e.a.,
Oliaonucleotide Synthesis tM.J. Gait ed. 1984); Nucleic
Acid Hybridization (~3.D. Hames & S.J. Higgins eds. lsa4);
Sambrook, Fritsch ~ Maniatis, Molecular Cloning: A
Laboratory Manual, Second Edition (1939); and the series
Methods in Enzymology (S. Colowick and N. Kaplan eds.,
Academic Press, Inc.).
The invention is directed to a method which
penmits the recovery and deduction of aptamers which bind
specifically to desired targets including those
illustrated hereinbelow such as factor X, kinins
(including bradykinin) as well as other small peptide
hormones such as the va~oconstrictor endothelin (a 21-
mex peptide), small hydrophobic molecule~ such as
eicosanoids (including PGF2~), and extracellular
;'.,~` ~ ., .
. ~. . .. . -. : :
,
- , .
.
:' ' ' ;~
,. -:, : . ... . .
': ' ' ' -' . ' .. ' ' . '.. .' '
W092/1~3 ~ 10 ~ PCT/VS92/01~ `
-16-
proteins, ~uch as thrombin, as well as molecules that are
contained at the cell surface ~uch as IL-l receptor and
CD4. As a result of application of this method, aptamers
which contain the specifically binding sequences can be
prepared and used in oligonucleotide-ba~ed therapy, in
the detection and isolation of the target substance, s
well as in other applications.
For example, these aptamers can be used as a
separation tool for retrieving the targets to which they
specifically bind. By coupling the oligonucleotides
containing the specifically binding sequences to a solid
: support, for example, the target substances can be
recovered in useful quantities. In addition, these
oligonucleotides can be used in diagnosis by employing
15 them in specific binding assays for the target
substances. When suitably labeled using detectable
moieties such a~ radioiqotopes, the specifically binding
oligonucleotides can also be used for in vivo imaging or
histological analysis.
: 20 For application in such various uses, the
aptamers of the invention may be coupled to auxiliary
substances that enhance or complement the function of the
aptamer. Such auxiliary substances include, for example,
labels such as radioi~otopes, fluorescent labels, enzyme
labels and the like; ~pecific ~inding reagents such as
antibodies, additional aptamer sequence, cell surface
: receptor ligands, receptor~ per se and the like; toxins
such as diphtheria toxin, tetanus toxin or ricin; drugs
such as antiinflammatory, antibiotic, or metabolic
regulator pharmaceuticals, solid supports such as
chromatographic or electrophoretic supports, and the
like. Suitable techniques for coupling of aptamers to
.: desired auxiliary substances are generally known for a
::: variety of such auxiliary substances, and the specific
:~ 35 nature of the coupling procedure will depend on the
.,
' ":
; -
:; ~ `
.
`:';
..
. . ,
.
~092/1~43 2 1 ~ 8 PCr/lJSg2/01383
-17-
nature of the auxiliary substance chosen. Coupling may
be direct covalent coupling or may involve the use of
qynthetic linkers such as tho~e marketed by Pierce
Chemical Co., Rockford, IL.
Thus, the aptamers of the invention may be used
alone in therapeutic applications or may be used as
targeting agents to deliver pharmaceuticals or toxins to
desired targets. The aptamers may be uqed in diagnostic
procedures and advantageously in this application include
label. They may be u~ed as reagents to separate target
molecules from contaminant9 in s~mpleq containing the
target molecules in which application they are
advantageously coupled to solid support. A particularly
advantageous application of the aptamer~ of the invention
includes their use in an immune recruitment procedure as
targeting agents for th~ immunomodulating substance used
in this procedure, a9 further described below.
As used in the disclosure and claim~, the
following terms are defined as follows. All references
cited are incorporated by reference.
As used herein, a "target" or "target molecule"
refers to a biomolecule that could be the focus of a
therapeutic drug strategy or diagnostic assay, including,
without limitation, proteins or portions thereof,
enzymes, peptides, enzyme inhibitors, hormones,
carbohydrates, glycoproteins, lipids, pho~pholipids,
nucleic acids, and generally, any biomolecule capable of
turning a biochemical pathway on or off or modulating it,
or which is involved in a predictable biological
- 30 response. Targets may be free in solution, like
thrombin, or associated with cells or viru~es, as in
' receptors or envelope proteins.
It should be noted that excluded from target
~ molecules are substances to which DNA sequences normally
j 35 bind such as nucleases, substrates wherein binding is
, .
., ~ , .
~1"'
!
', . . ,-: .'' ,: '" :
" : . , :
. ''
:: -: :, , ,: :
: . ::' . ,~
~: , , : ' :
, ':- - ' ,;
2 1 ~
W092~ 3 PCT/US92/0l~
effected by Watson-Crick base pairing modes of binding to
nucleic acids, specific triple helix binding to nucleic
acid sequences, and the like. Thus, excluded from target
molecules are tho3e sub~tances which natively bind the
specific form of aptamer at issue. Thus, excluded
therefore are nucleases that attack single-s~randed DNA,
restriction endonucleases that attack double-stranded DNA -
with respect to 3ingle-stranded DNA and double-stranded
DNA, respectively. Also excluded are cell surface
receptors specific for DNA or RNA.
A wide variety of materials can serve as
targets. These materials include intracellular,
extracellular, and cell surface proteins, peptides,
glycoproteins, carbohydrates, including
glycosaminoglycans, lipids, including glycolipids and
certain oligonucleotides. A representative list of
targets for which ~he aptamers of the invention may be
prepared is set forth herein in Table 1 which follows the
examples in the herein specification.
Some of the u~eful targets are peptides such as
kinins and small low molecular weight carbohydrates such
as prostaglandins. These targets have particular
features as follows:
By "kinin" is meant any of the peptide
components enzymatically released by the activation of
the variou~ kininogens (hormogens). Thus, the term
"kinin" includes the mammalian kinins such as, but not
limited ~o, bradykinin ~B~), Lys-BK, Met-~ys-~K,
leukokinins, colostrokinin, neurokinin; the vario~ls
nonmammalian kinins; and metabolite~ of the above.
Kinins are small peptides having, on the average, 9-11
amino acids. As described above, there are ~everal
inherent problems as~ociated with the u~e of conventional
` immunotechniques for working with kinins. Thus, the
; 35 present invention provides an efficient method for the
.:
: ,
... . . .
' '
.' ' ~: ' ' ' , : . `
'' . . ~ ~ ~ ' , ' . , :. :
: ' ' ' ' ~ ' ' ' '
,-
210~
W092/1~3 PCTJUS92/01383
-19-
detec~ion and isolation of these important substances.
For a review of kinins and their significance, see
Regoli, D., and ~arabe, J., Pha~m~coloqical ~evi~ws
(1980) 32:1-46, incorporated herein by reference in its
entirety.
The subject invention i9 also ~lseful for the
detection and/or isolation of low molecular weight
hydropho~ic molecules. ~y ~hydrophobic~ i5 meant a
compound having non-polar group~ such that the compound
as a whole ha~ a relatively low affinity for water and
other polar solvents. The hydrophobic molecules of the
instant invention lack large numbers of groups that may
participate in establishing noncovalent binding
interactions with aptamers. Such interactions include
base stacking via aromatic rings in the target, polar and
ionic interactions, and hydrogen bonding.
The invention i~ particularly u~eful with fatty
acid derivative~ such as eicosanoids. ~y ~'eico~anoid~ is
meant any of the several members of the family of
substances derived from 20-carbon essential fatty acids
that contain three, four or five double bonds: 8,11,14-
eicosatrienoic acid (dihomo-~-linolenic acid); 5,8,11,14-
eicosatetraenoic acid (arachidonic acid) and
5,8,11,14,17-eico~apentaenoic acid. Such substances
encompass the various prostaglandins, including but not
limited to PGA, PGB, PGC, PGD, PGE, PGE1, PGE2, PGE2~,
PGF, PGFlG~, PGF2~, PGG, PG&2, PGH, PGH2; the
thromboxanes such as bu~ not limited to TXA2 and TXB2;
prostacyclin (PGI2) and 6-keto-PGFla; leukotrienes and
: 30 precursors thereof such as LT~4 (a 5,12-dihydroxy
compound), LTC4 (a 5-hydroxy derivative that i~
conjugated with glutathione), LTA4 (a 5,6-epoxide), LTD4
(synthesized by the removal of glutamic acid from LTC4),
LTE4 (resulting from the subsequent cleavage of glycine),
LTF4 (an ~-glutamyl, cysteinyl derivative), SRS-A (a
- ~ .
.
- ~ ' ' . -" .' ` : - '-
.', ~' . '
. .
.
~1 0~ b~J8
WO92/1~W3 PCT/US92/013
-20-
mixture of LTC4 and hTD4 known as the n slow-reacting
substance of anaphylaxis"), ~PETE
(hydroperoxyeicosatetraenoic acid) and HETE
(monohydroxyeicosatetraenoic acid). Eicoqanoids are also
intended to include synthetic eicosanoid analogs such as
16-methoxy-16-methyl-PGF2~ and 15-methyl-PGF2~ (Guzzi, et
al., J. Med. ~hem. (1986) 29:1a26-1832; Cheng, et al.,
Acta Acad. Med. Shanghai (1990) 17:378 381) or in vivo
generated eicosanoid metabolites (Morrow, et al., Proc
~ O~ Da~ (1990) 87:9383-9387). ~icosanoids
are relatively low molecular weight compounds which are
generally hydrophobic in nature. These substances
normally ~ave molecular weights under 400, but some
naturally occurring variants are conjugated to one or
several amino acids and these will have higher molecular
weights. These variants are al~o encompa~sed by the
subject invention. As described above, several
eicosanoids have not heretofore been easily detectable or
isolatable using standard immunotechniques due to their
ubiquitous nature. Thus, the present invention provides
an efficient method for the detection and isolation of
these important substance8. For a review of eicosanoids
and their significance, see Moncada, S., et al., in 1
Pharmacoloaical Basis of Therapeutics, Gilman, A.G., et
al., eds. (MacMillan Publishing Company, New York), 7th
Edition, pages 660-671, incorporated herein by reference
in its entirety.
The above small molecule and hydrophobic
targets have not heretofore been considered to be
potential target molecules for aptamer ~election as
oligonucleotides are very hydrophilic and highly
hydrated. Previous methods for obtaining
oligonucleotides that bind to targets utilized protein
targets that normally bind to nucleic acids, or in the
work described by Ellington, et al., Nature ~1990)
.
.'
: -
.. ' : : ~ - , . :
. : . : . ~ . . , ... -
.: ~ . . . . :
: . :, . , ~ : : - :
~ . . . .
WO92/1~3 2 1 0 ~ ~ 3 ~ PCT/US92/013~
-21^
346:818-822, target molecules with many possible
hydrogen-bond donor and acceptor groups as well as planar
surfaces for stacking interactions. In the case of
nucleic acid binding proteins, binding to nucleic acid
oligonucleotides i9 aided by the inherent binding
properties of the proteins. In the case of molecules
used by Ellington et al., numerous chemical structures
are present that can participate in noncovalent binding
interactions including planar aromatic rings that may
lo interact with nucleic acids via base stacking
interactions. In contrast, man~f eicosanoids such as
PGF2~ have relatively little structural diversity. It is
thus unexpected that fatty acid-like molecules may serve
as binding targets for single stranded DNA. One
representative eicosanoid, PGF2~, as u3ed in the present
invention, has only 3 hydroxyl groups, two double bonds
between adjacent methylene groups, a carboxylic acid
group (which, as used herein, is present as an amide
linkage for covalent attachment to a ~olid support) and a
cyclopentyl ring. By comparison with almost all other
classes of potential biological target molecules, the
eicosanoids are extremely deficient in groups that may
participate in noncovalent binding interactions.
As used herein, "specifically binding
oligonucleotides" or "aptamers" refers to
; oligonucleotides having specific binding regions which
are capable of forming complexes with an intended target
molecule in an environment wherein other substances in
the same environment are not complexed to the
oligonucleotide. The specificity of the binding is
defined in terms of the comparative dissociation
constants (Kd) of the aptamer for target as compared to
the dis~ociation constant with respect to the apt~mer and
other materials in the environment or unrelated molecules
in general. Typically, the Kd for the aptamer with
. .
.
. .
. :
.
:
: .
~ )t3~
w09~ ~3 PCT/US92/01383
-22-
respect to the target will be 2-~old, preferably 5-fold,
more preferably lO-fold less than ~d with respect to
target and the unrelated material or accompanying
material in the environment. Even more preferably the Kd
will be 50-fold less, more preferably lO0-fold less, and
more preferably 200-fold less.
The binding affinity of the aptamers herein
with respect to targets and other molecules is defined in
terms of ~d. The value of this dissociation constant can
be determined directly by well-known methods, and can be
computed even for complex mixtures by methods such as
those, for example, set forth in Caceci, M., et al., Byte
(1984) 9:340-362. It has been observed, however, that
for some small oligonucleotides, direct determination of
Kd is difficult, and can lead to misleadingly high
results. Under these circumstances, a competitive
binding assay for the target molecule or other candidate
substance may be conducted with respect to substances
known to bind the target or candidate. The value of the
concentration at which 50~ inhibition occurs ~Ki) is,
under ideal conditions, equivalent to Kd. However, in no
event can Ki be less than Kd. Thus, determination of Ki,
in the alternative, sets a maximal value for the value of
Kd. Under those circumstances where technical
difficulties preclude accurate measurement of Kd,
measurement of Ki can conveniently be substituted to
provide an upper limit for Kd.
As specificity is defined i.n terms of Kd as set
forth above, excluded from the categories of unrelated
materials and materials accompanying the target in the
target's environment are those materials which are
sufficiently related to the target to be immunologically
crossreactive therewith, and materials which natively
bind oligonucleotides of particular sequences such as
nucleases, restriction enzymes, and the like. By
,,~
.. .
. .
,
.. . .
.. . .
~092/1~U3 21 O ~ 3 PCT/US92/01383
-23-
l~immunologically crossreactive" is meant that antibodies
raised with respect to the target crossreact under
standard assay conditions with the candidate material.
Generally, for antibodies to cro~sreac~ in standard
assays, the binding affinities of the anti~odies for
crossreactive materials as compared to targets ~hould be
in the range of 5-fold to lO0-fold, generally about lO-
fold.
Thu~, aptamers which contain specific binding
regions are specific with respect to unrelated materials
and with respect to materials which do not normally bind
such oligonucleotides such as nucleases and restriction
enzymes.
In general, a minimum of approximately 6
nucleotidesl preferably lO, and more preferably 14 or 15
nucleotides, are necessary to ef~ect ~peci~ic binding.
The only apparent limitations on the binding specificity
of the target/oligonucleotide couples of the invention
concern sufficient sequence to be distinctive in the
binding oligonucleotide and sufficient binding capacity
of the target substance to obtain ~he neces~ary
interaction. Aptamers of binding regions containing
sequences shorter than lO, e.g., 6-mers, are feasible if
the appropriate interaction can be obtained in the
context of the environment in which the target is placed.
Thus, if there are few interferences by other materials,
less specificity and less strength of binding may be
required.
As used herein, ~'aptamer1' refers in general to
either an oligonucleotide of a ~ingle defined ~equence or
a mixture of said oligonucleotides, wherein the mixture
retains the properties of binding specifically to the
target molecule. Thus, as used herein "aptamer" denotes
both singular and plural sequences of oligonucleotides,
as defined hereinabove.
.~.~ , .
WO9~ 3 ~ j 9 ~ PCT/US92/01
-24-
Structurally, the aptamers of the invention are
specifically binding oligonucleotides, wherein
l'oligonucleotide'l is as defined herein. As set forth
herein, oligonucleotides include not only those with
conventional bases, sugar residues and internucleotide
linkages, but al90 those which contain modifications of
any or all of these three moieties.
"Single-stranded" oligonucleotides, as the term
is used herein, refers to those oligonucleotides which
contain a single covalently linked series of nucleotide
residues.
"Oligomers" or "oligonucleotides" include RNA
or DNA sequences of more than one nucleotide in either
single chain or duplex form and specifically includes
short sequences such as dimers and ~rimers, in either
single chain or duplex form, which may be intenmediates
in the produc~ion of the specifically binding
oligonucleotides.
"Oligonucleotide" or "oligomer" is generic to
polydeoxyribonucleotides (containing 2'-deoxy-D-ribose or
modified forms thereof), i.e., DNA, to polyribonucleo-
tides (containing D-ribose or modified forms thereof),
i.e., RNA, and to any other type of polynucleotide which
is an N-glycoside or C-glycoside of a purine or
pyrimidine base, or modified purine or pyrimidine base or
abasic nucleotides.
.
."
.: \
.. ~ ',
:~ .
-, ~ , ,; , , ~ :
.
. . . . . .
.. .. . . . . .
~, , . . . :
.: : '
2 ~ L~; ~ r~ ~
WO 92r14f~4~ P(:'r/US92/01383
-25-
The oligomers of the invention may be formed
using conventional phosphodiester-linked nucleotides and
synthesized using standard solid phase (or solution
phase) oligonucleotide synthesis techniques, which are
now commercially available. However, the oligomers of
the invention may also contain one or more "substitute"
linkages as i9 generally understood in the art. Some of
these substitute linkages are non-polar and contribute to
the desired ability of the oligomer to diffuse across
membranes. These "substitute" linkages are defined
herein as conventional alternative linkages such as
phosphorothioate or phosphoramidate, are synthesized as
described in the generally available literature.
Alternative linking groups include, but are not limited
~5 to embodiments wherein a moiety of the formula P(O)S,
("thioate"~, P(S)S ("dithioate"), P(O)NR'2, P(O)R~,
P(O~OR~, CO, or CONR'2, wherein R' i9 H !or a salt) or
alkyl (1-12C) and R6 is alkyl (1-9C) is joined to
adjacent nucleotides through -O- or -S-. Dithioate
linkages are disclosed and claimed in commonly owned U.S.
application no. 248,517. Substitute linkages that may be
used in the oligomers disclosed herein also include
nonphosphorous-based internucleotide linkages such as the
3'-thioformacetal (-S-CH2-0-), formacetal (-0-CH2-0-) and
3'-amine (-NH-CH2-CH2-) internucleotide linkages
disclosed and claimed in commonly owned pending U.S.
patent application serial nos. 690,736 and 763,130, both
incorporated herein by reference. One or more substitute
linkages may be utilized in the oligomers in order to
further facilitate binding with complementary target
nucleic acid sequences or to increase the stability of
the oligomers toward nuclease~, as well as to confer
permeation ability. (Not all such linkages in the same
oligomer need be identical.)
; 35
.~
' ~ ~ . .; '
. .
.
., . ~.
6 9 8
WOg~/1~3 PCT/US92/013P,~
-26-
The term "nucleosidell or "nucleotide" is
similarly generic to ribonucleosides or ribonucleotides,
deoxyribonucleosides or deoxyribonucleotides, or ~o any
other nucleoside which i9 an N-glycoside or C-glycoside
of a purine or pyrimidine base, or modified purine or
pyrimidine base. Thus, the stereochemistry of the sugar
carbons may ~e other than that of D-ribose in one or more
residues. Also included are analogs where the ribose or
deoxyribose moiety is replaced by an alternate structure
such as the 6-membered morpholino ring described i.n U.S.
patent number 5,034,506 or where an acyclic structure
serves as a scaffold that positions the ba~e analogs
described herein in a manner that permits efficient
binding to target nucleic acid sequence or other
targets. Elements ordinarily found in oligomers, such as
the furanose ring or the phosphodiester linkage may be
replaced with any suitable functionally equivalent
element. As the ~ anomer binds to targets in a manner
similar to that for the ~ anomers, one or more
2G nucleotides may contain this linkage or a domain thereof.
(Praseuth, D., et al., Proc Natl Acad Sci (USA) (1988)
85:1349-1353). Modifications in the sugar moiety, for
example, wherein one or ~ore of the hydroxyl groups are
replaced with halogen, aliphatic groups, or
functionalized as ethers, amines, and the like, axe also
included.
"Nucleoside" and ~nucleotide" include those
moieties which contain not only the natively found purine
and pyrimidine bases A, T, C, G and U, but also modified
or analogous forms thereof. Modifications include
alkylated purines or pyrimidines, acylated purines or
pyrimidines, or other heterocycles. Such n analogous
purines~ and "analogous pyrimidines~ are those generally
know~l in the art, many of which are used as
chemotherapeutic agents. An exemplary but not exhaustive
.
: .
.'
s -.
.
.:
~vog2/1~3 210 ~1 .73~ 8 PCT~US92/01383
-27-
list includes pseudoisocyto~ine, N4,N4-ethanocytosine, 8-
hydroxy-N6-methyladenlne, 4-acetylcytosine, ~5
(carboxyhydroxylmethyl) uracil, S-fluorouracil,
S-bromouracil, 5-carboxymethylaminomethyl-2-thiouracil,
5-carboxymethylaminomethyl uracil, dihydrouracil,
inosine, N6-isopentenyl-adenine, 1-methyladenine,
1-methylpseudouracil, 1-methylguanine, 1-methylinosine,
2,2-dimethylguanine, 2-methyladenine, 2-methylguanine, 3-
methylcytosine, 5-methylcytosine, N6-methyladenine, 7-
methylguanine, 5-méthylaminomethyl uracil, 5-methoxy
aminomethyl-2-thiouracil, beta-D-mannosylqueosine, 5'-
methoxycarbonylmethyluracil, 5-methoxyuracil, 2-
methylthio-N6-isopentenyladenine, uracil-5-oxyacetic acid
: methyl ester, pseudouracil, 2-thiocytosine, 5-methyl-2-
thiouracil, 2-thiouracil, 4-thiouracil, 5-methyluracil,
N-uracil-5-oxyzcetic acid methylester, uracil-5-oxyacetic
acid, queosine, 2-thiocytosine, 5-propyluracil,
5-propylcytosine, 5-ethyluracil, 5-ethylcytosine,
5-butyluracil, 5-butylcytosine, 5-pentyluracil,
5-pentylcytosine, and 2,6-diaminopurine.
In addition to the modified ba~es above,
nucleotide residue9 which are devoid of a purine or a
pyrimidine base may also be included in the aptamers of
the invention and in the methods for their obtention.
The sugar residues in the oligonucleotides of
the invention may also be other than conventional ribose
and deoxyribose residues. In particular, substitution at
the 2'-position of the furanose re~idue is particularly
important.
Aptamer oligonucleotides may contain analogous
forms of ribose or deoxyribose sugars that are generally
known in the art. An exemplary, but not exhaustive list
includes 2' substituted sugars such as 2'-0-methyl-, 2'-
0-alkyl, 2'-0-allyl, 2'-S-alkyl, 2'-S-allyl, 2'-fluoro-,
2'-halo, or 2'-azido-ribose, carbocyclic sugar analogs,
.: ,
. . .
,:
.,
,~,...
" ' :
,
'.
.. ~.
,
w09~ 3 2 1 U ~ ~ ~ X - 2~- PCT/VS92/01~
~-anomeric sugars, epimeric sugars such as arabinos ,
xyloses or lyxoses, pyrano~e sugars, furanose sugars,
sedoheptuloses, acyclic analogs and abasic nucleoside
analogs such as methyl ribo~ide, ethyl riboside or propyl
riboside.
Although the conventional sugars and bases will
be used in applying tha method of the invention, substi- -
tution of analogous forms of sugars, purines and
pyrimidines can be advantageous in designing the final
product. Additional techniques, such as methods of
synthesis of 2'-modified sugars or carbocyclic sugar
analogs, are described in Sproat, B.S. et al., Nucl Acid
Res (1991) 19:733-738; Cotten, M. et al., Nuc Acid Res
(1991) 19:2629-2635; Hobbs, J. et al., 9iochemistry
(1973) 12:5138-5145; and Perbost, M. et al., Biochem
Biophys Res Comm (1989) 165:742-747 (carbocyclics).
As u~ed herein, "primer" refers to a sequence
which is capable of serving as an initiator molecule for
a DNA polymerase when bound to complementary DNA which is
usually between 3-25 nucleotides in length.
As used herein, a "type II restriction enzyme
site" refers to a site possecsed by the class of
restriction enzymes which cleaves one or both DNA strands
at internucleotide linkages that are located outside of
those associated with bases in the recognition sequence.
; This term is also meant herein to refer to a restriction
enzyme such as ~cg I tNew England Biolabs, catalog no.
545L) that makes two double stranded DNA cuts outside of
its recognition sequence.
One of the objects of the invention is to
identify aptamers useful as drugs per se or useful in
drug development. Toward this end, selection criteria
for targets and aptamers include:
1. The aptamer should selectively bind to the
desired target, thereby inhibiting a biochemical pathway
':
:.
:
,
:'
:: : . : : - .
' : .. : -. ' . . . ': ,
: :' -
.
.-: : . ~ . . :.: . : . - -
. . -:
WO92/1~3 2 ~ O ~ 6 ~ 8 PCT/US92/01383
-29-
or generating a specific re~ponse (e.g., modulating an
immune respon e or disrupting binding interact~ons
between a recep~or and its ligand)i
2. The aptamer selected for use in diagnostic
applications should have specificity for analyte (ligand)
binding in those cases where the aptamer will be
immobilized to a supporti
3. The biochemical pathway that is inhibited
or the biological re~ponse generated should be related to
a pathological disease state in such a way that
inhibition of that pathway or the biological response
generated in a patient i9 therapeutic;
4. Desirably, the aptamer i9 specific so that
it does not appreciably inhibit other pathways or
generate additional unwanted biological responses;
5. Preferred aptamers have or are capable of
belng adapted to have the pharmacokinetic characteristics
of a practical drug (i.e., they must be absorbed, must
penetrate to the site of action and must have a
reasonably predictable dose response relationship and
duration of action);
6. Desirably, the aptamer has an acceptable
toxicological profile in animals and the results of human
clinical trials mu~t demonstrate an appropriate
therapeutic use.
Methods to Prepare the Invention Aptamers
In general, the method for preparing the
a~ptamers of the invention involves incubating a desired
target molecule with a mixture of oligonucleotides under
conditions wherein some but not all of the members of the
oligonucleotide mixture form complexes with the target
molecules. The resulting complexes are then separated
from the uncomplexed members of the oligonucleotide
mixture and the complexed members which constitute an
.
.
,: . , ~ ,' ~,
:: ... . : . .: :
,,.': ' ', ' ~ ~
: - :
- - :
; , ,
WOs2/l4843 '~ ~Oi~b~ 8 Pcr/usg2/nl38~
-30-
aptamer (at this stage the apt~mer generally being a
population of a multlplicity of oligonucleotide
sequences) i5 recovered from the complex and amplified.
The resulting aptamer (mixture) may then be substituted
for the starting mixture in repeated iterations of this
series of steps. When satisfactory specificity is
obtained, the aptamer may be used as a obtained or may be
sequenced and synthetic forms of the aptamer prepared.
In this most generalized form of the method, the
oligonucleotides used as members of the starting mlxture
may be single-stranded or double-stranded DNA or ~NA, or
modified forms thereof. However, single-stranded DNA is
preferred. The use of DNA eliminates the need for
conversion of RNA aptamers to DNA by reverse
transcriptase prior to PCR amplification. Furthermore,
DNA is less susceptible to nuclease degradation than RNA.
The oligonucleotides that bind to the target
are ~eparated from the rest of the mixture and:recovered
and amplified. Amplification may be conducted before or
; 20 after separation from the target molecuie. The
oligonucleotides are conveniently amplified by PC~ to
give a pool of DNA sequences. The PCR method is well
known in the art and described in, e.g., U.S. Patent
Nos. 4,683,195 and 4,683,202 and Saiki, R.K., et al.,
25 Science (198~ 23~:487-491, and European patent
applications 86302298.4, 86302299.2 and 87300203.4, as
well as Methods in Enzymology (1987) 155:335-350. If RNA
is initially used, the amplified DNA sequences are
transcribed into RNA. The recovered DNA or RNA, in the
original single-stranded or duplex form, is then used in
another round of selection and amplification. After
three to six rounds of selection/amplification, oligomers
that bind with an affinity in the mM to ~M range can be
obtained for most targets and affinities below the ~M
.
;;
. .
':
: .
. .
2 ~ Q ~ ~ ~ 8
W092/l~3 PCT/US92/01383
-31-
range are possible for some target3. PCR may al~o be
performed in the pre~ence of target.
Other methods of amplification may be employed
including standard cloning, li~ase chain reaction, etc.
5 (See e.g., Chu, e~ al., U.S. Patent No. 4,957,858). For
example, to practice this invention using cloning, once
the ap~amer has been identified, linkers may be attached
to each side to facilitate cloning into standard ~ectors.
Aptamers, either in Ringle or double stranded form, may
be cloned and recovered thereby providing an alternative
amplification method.
Amplified sequences can be applied to
sequencing gels after any round to determine the nature
of the aptamers being selected by target molecules. The
entire process then may be repeated using the recovered
and amplified duplex if sufficient resolution is not
obtained.
Amplified ~equences can be cloned and
individual oligonucleotides then sequenced. The entire
process can then be repeated using the recovered and
amplified oligomers as needed. Once an aptamer that
binds specifically to a target has been selected, it may
be recovered as DNA or RNA in single-stranded or duplex
form using conventional techniques.
Similarly, a selected aptamer may be sequenced
and resynthesized using one or more modified bases,
sugars and linkages using conventional techniques. The
specifically binding oligonucleotides need to contain the
sequence-conferring specificity, but may be extended with
flanking regions and otherwise derivatized.
The starting mixture of oligonucleotide may be
of undetermined sequence or may preferably contain a
randomized portion, generally including from about 3 to
about 400 nucleotides, more preferably 10 to 100
nucleotides. The randomization may be complete, or there
.
. . . . - ,
W09~ M3 2 t ~ PCT/US9~/Ot3R~
may be a preponderance of certain 3equences in the
mixture, or a preponderance of certain residues at
particular position~. Although, as described
hereinbelow, it i9 not essential, the randomized sequence
is preferably 1anked by primer sequences which pexmit
the application of the polymerase chain reaction directly
to the reco~ered oligonuclestide from the complex. The
flanking sequences may also contain other convenient
features, such as restriction sites which permit the
cloning of the amplified sequence. These primer
hybridization regions generally contain 10 to 30, more
preferably 15 to 25, and most preferably 1~ to 20, bases
of known sequence.
The oligonucleotides of the starting mixture
lS may be conventional oligonucleotides, most preferably
single-stranded DN~, or may be modified forms of these
conventional oligomer~ as described hereinabove. For
oligonucleotides containing conventional phosphodiester
linkages or closely related forms thereof, standard
oligonucleotide synthesi~ techniques may be employed.
Such technique~ are well known in the art, such methods
being described, for example, in FroehlPr, B., et al.,
Nucleic Acids R@sea~_ (1986) 14:5399 5467; Nucleic Acids
Research (1988) ~:4831-4839; Nucleosides and Nucleotides
(1987) 6:2~7-291; Froehler, ~., Tet Lett (1986) 27:5575-
5578. Oligonucleotides may also be ~ynthesized using
solution pha~e methods such as triester synthesis, known
in the art. The nature of the mixture is determined by
the manner of the conduct of synthesis. Randomization
can be achieved, if desired, by ~upplying mixtures of
nucleotides for the positions at which randomization is
desired. Any proportion of nucleotides and any desired
number of Such nucleotides can be supplied at any
particular step. Thus, any degree of randomization may
be employed. Some positions may be randomized by
'''
: , .
.
W~92/1~3 2 1 0 ~ ~ 9 8 PCT/US92/01383
-33-
mixtures of only two or three bases rather than the
con~entional four. Randomized posltions may alternate
with those which have been specified. It may be helpful
if some portions of the candidate randomized sequence are
in fact known.
In one embodiment of the method of the
invention, the starting mixture of oligonucleotides
subjected to the invention method will have a binding
affinity for the target characterized by a Kd of l ~M or
greater. Binding affinities of the original mixture for
target may range from about lO0 ~M to lO ~M to 1 ~M, but,
of course, the smaller the value of the dissociation
constant, the more initial affinity there is in the
starting material for the target. This may or may not be
advantageous as specificity may be sacrificed by starting
the procedure with materials with high binding affinity.
~ y application of the method of the invention
as described herein, improvements in the bindipg affinity
over one or several iterations of the above steps of at
least a factor of 50, preferably of a factor of lO0, and
more preferably of a factor of 200 may be achieved. As
defined herein, a ratio of binding affinity reflects the
ratio of Kds of the comparative complexes. Even more
preferred in the conduct of the method of the invention
is the achievement of an enhancement of an affinity of a
factor of 500 or more.
Thus, the method of the invention can be
conducted to obtain the invention aptamers wherein the
aptamers are characterized by consicting of single-
stranded DNA, or by having a binding affinity to a targetthat does not normally bind oligonucleotides represented
by a Kd of 20 x lO 9 or lecs, or by having a specificity
representing by a factor of at least 2, preferably 5, and
more preferably lO with respect to unrelated mclecules,
or by having a binding region of less than 15 nucleotide
,~.
~, :
., ~ ~ . . . .
,
2 1 0 ~
Wos2/1~w3 PCT/US92/013
-34-
residues or a total size cf le8g than ~6 nucleotide
residues, or ~y binding to particular target mol~cules.
The inve~tion proce~ses are al~o characterized by
accommodating sta~ti~g mix~es of ol.i~o~cleotides
ha~1ng a ~lr~d:Lrlg af filllty for ta~get c~a~ac:teri2ed ~y a
Kd Of 1 ~ or more ~y an enhanceme~t o~ h~ndlng a1nlty
of 50 or more, and by belng conducted under physio10g~cal
conditiong.
As u~ed herein, phy~iological conditions mean~
the salt concentration and ionic ~trength in an aqueous
~olution which characterize fluids found in human
metabolism commonly referred to as phy8iological buffer
or physiological saline. In general, these are
represented by an intracellular pH of 7.1 and ~alt
5 concentrations (in mM) o~ Na+: 3-15; R+: 140; Mg+2: 6.3;
Ca+2: 10 4; Cl : 3-15, and an extracellular pH o~ 7.4 and
salt con~entrations (in mM) of Na+: 145; X+: ~; Mg+2: 1-
2; ~a+2: 1-2; and Cl : llo.
The use of physiological conditions in the
aptamer selection method i5 extremely important,
particularly with re~pect to those aptamers that may be
intended for therapeutic uge. As i9 under~tood in the
` art, the conce~tration of various ions, in particular,
the ionic strength, and the pH value impact on the value
of the dissociation constant o~ the target/aptamer
: complex.
:
Use of Modified~ eotides_and Oligonucleotides
In one embodiment of the invention method, the
initial mixture of candidate oligonucleotides will
include oligomers which contain at least one modiied
nucleotide residue or linking group.
If certain specific modifications are included
in the amplification procass as well, advantage can be
taken of additional properties of any modified
~ .
. :
. - .
':~ '. :
2 1 0 ~
W~92/1~W3 PCT/US92/0~3
-35-
nucleotides, such as the presence of speciflc affinity
agents in the purification of the desired materials.
In order for the modified oligomer to yield
useful results, the modification must result in a residue
which is "read" in a known way by the polymerizing enzyme
used in the amplification procedure. It is not necessary
that the modified residue be incorporated into the
oligomers in the amplification process, as long it is
possible to discern from the nucleotide incorporated at
the corresponding position the nature of the modification
contained in the candidate, and provided only one round
of complexation/amplification is needed. However, many
of the modified residues of the invention are also
susceptible to enzymatic incorporation into
oligonucleotides by the commonly used polymerase enzymes
and the resulting oligomers will then directly read on
the nature of the candidate actually contained in the
initial complex. It should be noted that if ~ore than
one round of complexation is needed, the amplified
sequence must include the modified residue, unless the
entire pool is sequenced and re~ynthesized to include the
modified residue.
Certain modifications can be made to the base
residues in a oligonucleotide sequence without impairing
the function of polymerizing enzymes to recognize the
modified base in the template or to incorporate the
modified residue. These modifications include alkylation
of the 5-position of uridine, deoxyuridine, cytidine and
deoxycytidine; the N4-position of cytidine and
deoxycytidine; the N -position of adenine and
deoxyadenine; the 7-po ition of 7-deazaguanine, 7-deaza-
deoxyguanine, 7-deazaadenine and 7-deazadeoxyadenine. As
long as the nature of the recognition is known, th~
modified base may be included in the oligomeric mixtures
useful in the method of the invention.
: :
:,
.
.j :
~: :
wVs2/1~w3 2 1 il ~ t~ 9 8 PCT~US92/0138~
-3~-
The nature of the sugar moiety may also be
modified without affecting the capacity of the sequence
to be usable as a specific template in the synthesis of
new DNA or RNA.
The efficacy of the process of selection and
amplification depends on the ability of the PCR reaction
faithfully to reproduce the sequence actually complexed
~o the target substance. ~hus, if the target substance
contains modified form~ of cytosine tC~), the PCR
reaction must recognize this as a modified cytosine and
yield an oligomer in the cloned and sequenced product
which reflect this characterization. If the modified
form of cytosine (C~) is included in the PCR reaction as
dC*TP, the resulting mixture will contain C* at positions
represented by this re~idue in the original member of the
candidate mixture. (It is seen that the PCR reaction
cannot distinguish between various locations of C* in the
original candidate; all C residue locations will appear
as C*.) Conversely, dCTP could be used in the PCR
reaction and it would be understood that one or more of
the positions now occupied by C was occupied in the
original candidate mixture by C , provided only one round
of complexation/amplification is needed. If the
amplified mixture i9 used in a second round, this new
mixture must contain the modification.
Of course, if the selected aptamer is sequenced
and resynthesized, modified oligonucleotides and linking
groups m2y arbitrarily by used in the synthesized form of
the aptamer.
Inclusion of modified oligonucleotides in the
method~ and aptamers of the invention provides a tool for
expansion of the repertoire of candidates to include
large numbers of additional oligonucleotide sequences.
Such expansion of the candidate pool may be especially
important as the demonstration of binding to proteins,
.
,,~.. , . ::
.
2 ~
WO92/1~W3 PCT/US92J01383
-37-
for example, in the prlor art is limited to those
proteins known to have the capability to bind DNA.
Modifications of the oligonucleotide may be neces~ary to
include all desired substances among those ~argets for
which specific binding can be achieved.
Thus, one preferred method comprises incubating
the target with a mixture of oligonucleotides, wherein
these oligonucleotides contain at least one modified
nucleotide residue or linkage, under conditions wherein
complexation occurs with some but not all members of the
mixture; separating the complexed from uncomplexed
oligonucleotides, recovering and amplifying the complexed
oligonucleotides and optionally determining the sequence
of the recovered nucleotides. In an additional preferred
lS embodiment, amplification is also conducted in the
presence of modified nucleotides.
Use of Starting Oliqonucleotide Mixtures of
Unpredetermined Se~uence
In another embodiment, a method for making
aptamers is provided, based on the discovery that the
presence of flanking sequences (usually primer binding
sequences) on the oligonucleotides of the candidate
mixture may limit aptamer structural diversity and/or
inhibit binding, thereby resulting in less than the full
range of structural variation that is possible in a given
pool of aptamers. This embodiment may use mixtures of
unbiased oligonucleotide pools, and provides the ability
to then engineer appropriate means for amplifying the
desired oligonucleotides (putative aptamers).
Once single ~tranded aptamers are generated,
linkers may be added to both ends as described herein
(much in the same manner as a sticky end ligation).
- Preferably the linkers are partially double stranded and
have some overhang to and at both ends to facilitate
:., , . ~ . ~ .
~. 7 -
:.
' . -: . . .. :... ,. ~ ,.. :
9 ~
Wos2/1~W3 PCT/US92/01
-3~-
cloning into a standard cloning ~ector. One of the
overhangs should be a random sequence to provide comple-
mentarity to permit binding to the aptamer. The other
overhang may pro~ide necessary bases for sticky end
ligation.
In one embodiment the method comprises:
(a) providing a mixture of oligonucleotides of
unknown, non-predetermined or substantially non-
predetermined, said mixture comprising a quantity of
oligonucleotide3 sufficiently reflective of the
structural complexity of said target as to statistically
ensure the presence of at least one oligonucleotide
capable of binding said target;
(b) incubating said mixture of oligonucleotides
with aid target under conditions wherein complexation
occurs between some oligonucleotides and said target,
said complexed oligonucleotides defining an aptamer
population;
(c) recovering said aptamers in substantially
single stranded form;
(d) at~aching a known nucleotide sequence to at
least one end of said aptamers;
(e) amplifying said aptamers; and
(f) removing said known nucleotide sequence
from said aptamers.
In the first step, the oligonucleotides
comprising the mixture may be of completely unknown
~` sequence. The oligonucleotides comprising the pool also
may be o~ partially known sequence, but without flanking
primer regions. The invention is not limited to first
generation aptamers, but may be practiced to identify
second and third generation aptamers as well.
Oligonucleotides comprising the pool from which second
and thi-d generation aptamers may be identified, may
, . ,
. . .,. . ~ .
Wo92~ 3 2 1 0 ~ ~ .9 ~ PCT/~J~92/01383
-39-
have, for example, 40~-70~ of their ~equences known or
predetermined.
One skilled in the art will recognize that the
diversity of the oligonucleotide pool from which aptamers
are identified may be reduced, either by using known
sequences, or through the processes of retention and
selection by which theae aptamers are made. ~s pool si~e
and pool diversity is reduced, more aptamers capable of
more specific binding are recovered. Stated in another
way, the quantity of oligonucleotides in the pool and the
diversity and/or complexity of the pool are inversely
related.
These aspects of the invention are elucidated
in the following embodiment which adds additional steps
to steps (a)-(f) listed above:
(g) repeating step~ a-f using ~aid first
aptamers of st~p (f), or a portion thereof, to comprise a
second pool of oligonucleotides for use in step (a),
thereby generating a second aptamer population which may
be used to repeat ~teps (a)-(f), and optionally
(h) repeating ~teps (z)-(f) using said second
aptamers of step (g), or a portion thereof, a sufficient
number of times so as to identify an optimal aptamer
population from which at lea~t one consensus region may
identified in at least two of the aptamers from said
optimal aptamer population, the presence of which may be
correlated with aptamer ~o target binding or to aptamer
structure.
This method include~ methods for selectively
attaching and removing flanking regions to aptamers,
thereby permitting aptamer reco~ery in high yield. One
such method comprises,
after separating oligonucleotides in the method
above in substantially single stranded form from the pool
capable of binding target;
., .
:
.
... .
: . - ' , . .:
., , .....
, ~ . ; ;,
:' '
. . ~- . . .
WO92/1~ PCT/US92/013
~ 9~ -40-
attachlng a 5' linker of known sequence to a
first (the 5') end of the oligonucleotides, the 5~ linker
ha~ing a first type II restriction enzyme recognition
site at its 3' end, attaching a 3' linker of known
sequence to a second (the 3') end of the
oligonucleotides, the 3' linker having a second type II
restriction enzyme recognition site different from the
site at the 5' end;
amplifying the oligonucleotides, thereby
generating a duplex compri~ing a first (upper) strand,
having a 5' linker complement portion, an oligonucleotide
complement portion and a 3' linker complement portion,
and a second (lower) strand, comprising a 5' linker
portion, an oligonucleotide portion and a 3' linker
portion;
removing the 5' and the 3' linker portions from
the oligonucleotideY; and
recovering the oligonucleotides in
substantially single stranded form.
Another method of effecting amplification
comprises,
after recovering oligonucleotides from the
above bound pool in substantially single stranded form;
attaching a double stranded DNA linker of known
sequence having at least 2-4 bases of random sequence
present as a 3' overhang, said 2-4 bases capable of
hybridizing to the 3/ end of said oligonucleotides, the
: linker having a first type II restriction enzyme
recognition ~ite;
- 30 attaching a double stranded DNA linker of known
sequence having at least 2-4 bases of random sequence
present as a 3' ov~rhang, the 2-4 bases capable of
hybridizing to the 5' end of the oligonucleotides, said
linker having a second type II restriction enzyme
recognition site;
, . . .
.: .
:~: . :
. ~
,:~ : . . . :
, .
21~ n~
wos2/1~3 PCT/US92/01383
-41-
amplifying said oligonucleotides, thereby
generating duplexes comprising a first (upper) strand,
having a S' linker complement portion, an oligonucleotide
complement portion and a 3' linker complement portion,
and a second (lower) strand, comprising a 5~ linker
portion, an oligonucleotide portion and a 3' linker
portion;
removing the 3' linker portion from the
oligonucleotide by attaching the product of Ytep 4 above
to a ~olid ~upport, removing the 3~ linker by digesting
with a type II restriction enzyme capable of recognizing
said first type II restriction enzyme binding site,
removing the 5~ lin~er complement and the oligonucleotide
complement by heat denaturation, annealing a 5' linker
complement to the upper strand, and removing the 5'
linker portion by digesting with a type II reRtriction
enzyme capable of recognizing the second type II
: restriction enzyme site; and
recovering the oligonucleotides in
subsLantially single stranded form.
In another approach, the method includes
atta hing a single RNA residue to the 5' linker portion
and removing it after amplification by cleaving the RNA
linkage.
A Subtraction Method fQr Antamer Prep~ration
It i9 often advantageous in enhancing the
specificity of the aptamer obtained to remove members of
the starting oligonucleotide mixture which bind to a
second substance from which the target molecule is to be
distinguished. This method is particularly useful in
obtaining aptamers which bind to targets that reside on
cell surfaces since a large number of contaminating
materials will surround the desired target. In such
subtraction methods, at least two rounds of selection and
... . .
. .
.
. .
......
.: ' ` ,.
: . - - '" .: ' ', ~ . '
.. . . . ..
: : - ' . : ~
' . ,, ,, ,. ., , . "
WO92/1~3 PC~/US92/013
-~2-
amplification w ll be conducted. In a positive/negative
selection approach, the target will be incubated with the
starting mixture of oligonucleotides and, as usual, the
complexes formed are separated from uncomplexed
oligonucleotides. The complexed oligonucleotides, which
are now an aptamer, are recovered and amplified from the
complex. The recovered aptamer i9 then mixed with the
second, undesired, ~ubstance from which the target is to
be distinguished under conditions wherein members of the
aptamer population which bind to said second substance
can be complexed. This complex i9 then separated from
the remaining oligonucleotides of the aptamer. The
resulting unbound second aptamer population is then
recovered and amplified. The ~econd aptamer population
is highly specific for the target as compared to the
second substance.
In an alternative approach, the negative
selection step may be conducted fir t, thus mixing the
original oligonucleotide mixture with the undesired
substance to complex away the members of the
oligonucleotide mixture which bind to the second
substance; the uncomplexed oligonucleotides are then
recovered and amplified and incubated with the target
under conditions wherein those members of the
oligonucleotide mixture which bind targets are complexed.
The resulting complexes then removed from the uncomplexed
oligonucleotides and the bound aptamer population is
recovered and amplified as usual.
When applied to the preparation cf aptamers
which bind specifically targets residing on cell
surfaces, the positive round is conducted preferably with
the target expressed at the surface of a cell, said
expression typically occurring through recombinant
transformation or by virtue of the native properties of
the cell. The negative round of selection is conducted
;'
..
~: `
- ~ ,
.:~
. ':
`
'.''
21043j~
W092/1~ PCT/US92/01383
-43-
with similar cells which have similar surface materials
associated with them, but which do not expre~Y the
desired target.
The methods and aptamers of the present
invention can al90 be directed to cell surface proteins.
To prepare these aptamers, a pool of oligonucleotides is
brought into contact with a first known cell line which
is known to expres~ a particular cell surface protein
which is uniquely identified with that cell line and
sufficient time i9 allowed for the oligonucleotides to
bind to the protein on the cell surfaces. The cells are
isolated with oligonucleotides bound thereto and the
oligonucleotides are removed. This procedure is referred
to herein as "positive screening". Thereafter, the
removed oligonucleotides are brought into contact with a
second cell line which is identical to the fir3t cell
line, except that the second cell line does not express
the particular identifying cell surface protein; binding
is allowed to occur and any oligonucleotides which bind
to the second cell line are isolated and discarded. This
procedure is referred to as "negative screening". The
"positive" and "negative" screening steps can be repeated
a multiplicity of timeq in order to obtain
oligonucleotides which are highly specific for the cell
surface proteins being expressed on the first cell line.
The highly specific oligonucleotides may then be
amplified and sequenced.
A preferred variation for 3election of aptamers
that bind to surface antigens involves a procedure
wherein negative selection is firs~ carried out ~ollowed
by a positive selection. In accordance with this
procedure, a pool of random oligonucleotides is combined
~ with a tissue culture medium. The oligonucleotides are
- allowed to remain in contact with the cell cultures for a
sufficient period of time to allow binding between
`~:
.~ .
~ ,,
.
, ,: .
.:
: ~ , : ~ ..
W092/1~3 2 1 ~ 4 ~ 9 ~ PCT/US92/013~
-44-
oligonucleo~ides and cell surfaces which lack the target
molecule. When this binding occurs, a negative selection
process has been carried out, i.e., oligonucleotides
which are not the desired aptam~rs can ~e eliminated by
their binding to nontarget surfaces. Following this
negative selection, a positive selection step i9 carried
out. Thi3 i9 done by combining the oligonucleotides
which did not bind to the surfaces lacking target
molecules thereon wi~h a cell culture containing ~he
0 target molecule on their surface. Such a negative-
positive selection protocol can be carried out in a
medium containing human or bovine serum in order to
select aptamers under simulated physiological conditions.
It is desirable to replicate physiological conditions as
closely as possible when carrying out the selection
processes in that one endeavors to find oligonucleotides
(aptamers) which bind to the target molecules under
physiological conditions 90 that such aptamers can later
be used ~ vivo.
In more detail, the oligonucleotide mixture is
brought into contact with a fir~t known cell line which
is known to express a particular cell surface protein
which is uniquely identified with that cell line. After
allowing sufficient time for the oligonucleotides to bind
to the protein on the cell surfaces, procedures are
; carried out to isolate the cells with oligonucleotides
bound thereto and the oligonucleotides are removed. This
procedure is referred to herein as "positive screening".
After treatments with the candidate
; 30 oligonucleotide mixtures, the cells containing the
targeted surface protein may be extensively washed in
buffered saline or in tissue culture medium to remove low
~ affinity aptamers and uncomplexed cligonucleotides.
0 Following washing, the cells are treated with one or more
35 of a number of agents that permit recovery of bound
: `
. '
.
,, .s .,. ,., .... . - . -. . : :-: .. -
.... . ... : : . .. ~ . -:: : :.. - .. .... .
, :. .. .: :, , . :
. . . - . . ~ . . - . ~ ,
.-:, . , ~ . ,: :: , - .
~ , : .-. - , : :
: . . .: . : - . , ~ ,
-. . - ~: .. . . :
W092/l~W3 2 1 Q ~ PCTIUS92/01383
-45-
aptamer~. The cell~ may be treated enzymatically with
tr~psin or other proteases to cleave the targets a~ the
cell surface, thus releasing the bound aptamer~.
Alternatively, the cells containing bound aptamers may be
washed in a detergent or high ionic strength solution in
order to disrupt binding between the cells and aptamers.
The aptamers recovered at this point consist of a pool of
different sequences that bind to different cell surface
targets, including the target of interest.
Aptamers from the first tissue culture cells
may be recovered from solution by precipitation or may be
used directly if reagents used to remove aptamers do not
significantly affect cells in the second tissue culture.
The aptamer mixture is then incubated with the
second (null) cell culture under similar conditions. The
mixture brought into contact with a second cell line
which is identical to the first cell line, except that
the second cell line does not express the particular
identifying cell surface pxotein. 9inding is allowed to
occur and any oligonucleotides which bind to the second
cell line are isolated and discarded. This procedure is
referred to as "negative screening". The "positive" and
"negative" screerling steps can be repeated a multiplicity
of times in order to obtain oligonucleotides which are
highly specific for the cell ~urface proteins bein~
expressed on the fir~t cell line. When the highly
specific oligonucleotides have been determined and
isolated, they are subjected to PCR technology for
amplification as above. The resulting "aptamers" can be
labeled and thereafter effectively used to identify the
presence of the first cell line expressing the par~icular
cell surface protein.
This method identifies target features on cell
surfaces such as proteins, especially hetero- or
homodimers or multimers. Selecting high-affinity ligands
,
:; '' . :, ,
.
:
- , , ~ :
W092~ 3 ~ 1 0 ~ ~ 9 8 PCT/US92/013~
-4~-
specific for such transmembrane proteins outside ~he
natural cellular con~ext has heretofore been exceedingly
difflcult, if not impossible. Many transmembrane
proteins cannot be isolated from cells without loss of
their native structure and function. This is due, in
part, to a requirement for detergents to disrupt cellular
membranes that anchor transmembrane proteins (Helenius,
A., et al., Biochim. Bio~hys. Acta (1975) 41~:27-79).
Detergents that solubilize membranes also tend to
denature proteins, leading to loss of function and
alteration of native structure.
A preferred variation of this method involves a
procedure wherein negative ~election is first carried out
followed by a positive selection. In accordance with
this procedure, a pool of random oligonucleotides is
combined with a tis~ue culture medium. The
oligonucleotides are allowed to remain in contact with
the cell cultures for a sufficient period of time to
allow binding between oligonucleotides and cell surfaces
which lack the target molecule. When this binding
occurs, a negative selection process has been carried
out, i.e., oligonucleotides which are not the desired
aptamers can be eliminated by their binding to nontarget
surfaces. Following this negati~e selection, a positive
selection step is carried out. This i8 done by combining
the oligonucleotides which did not bind to the surfaces
;~ with no target molecules thereon with a cell culture
containing the target molecule on their surface. Such a
negative-positive selection protocol can be carried out
in a medium containing human or bovine serum in order to
select aptamers under simulated physiological conditions.
It is desirable to replicate physiological conditions as
closely as possible when carrying out the selection
processes in that one endeavors to find oligonucleotides
(aptamers) which bind to the target molecules under
.- .
.
.
.
; . :
~092/1~3 21 0 ~ ~ ~ 8 PCT/US92/01383
-47-
physiological condition~ so that such aptamers can later
be used n v vo.
Aptamers which are selected in the presence of
serum may be rendered nuclease-stable by the use of PCR
primers with modified internucleotide linkages that are
nuclease-stable as described in commonly assigned
copending Application Publication No. W090/15065
(incorporated herein by reference).
An alternative variation of the use of serum
for aptamer selection is also possible. In accordance
with this alternative protocol, candidate aptamers are
added to a tissue culture medium lacking ~erum. The
serum-free medium is incubated with cells which lack the
target molecules on their surfaces. Following the
incubation, a cell culture which contains the target
molecules on their surfaces is combined with any
oligonucleotides which did not bind to the first cell
culture which did not have the target molecule thereon.
This step in the protocol provides for positive
selection. After continuing the incubation for the
positive selection for 20-40 minutes, serum is added in
order to provide a final concentration in the range of
about 5~ to lO~ of serum. At this point, any
oligonucleotides which are not tightly complexed with the
target molecule begin to degrade due to the nucleases
present in the added serum. However, the
oligonucleotides which are tightly bound to the target
; molecules on the cells are nuclease resistant as they are
inaccessihle to the nucleases due to their physical
association with the target molecules. After exposure to
the nucleases for 10-30 minutes, the medium (i.e.S the
serum containing the nucleases) is removed and the cells
are washed and caused to release the oligonucleotides or
aptamers bound thereto by treatment of the cells with
proteases and/or detergents. Any oligomers which are
.
: .
,'';'
.: , ~ . . ~ ., -
: . . ,
W09~ 3 2 ~ 8 PCT/US92/013
-48-
sub~tantially degraded by ~he nucleases wlll not be
ampllfied during amplirication processing.
In more detail, the present inventors have
found that the nuclease activity present within the serum
is primariiy a 3' exonuclease activity. The presence of
3' exonuclease activity during target binding may be used
with a candidate aptamer pool that has a ~hor~ primer a~
the 3' end as a nuclease target. Accordingly, if the 3'
end, which lncludes the primer, is degraded by the
nuclease, the oligonucleotides attached to the degraded
primers will not be amplified during amplification
processing and will thereby be eliminated. A similar
short primer sequence (6-lO bases) at the 5' end could
also be utilized in the same manner if 5' exonucleases
are added to the medium during the eelection protocol.
At various stages of the screening process,
advantage may be taken of 2CR techniques for
amplification of selected aptamer pools. While the
material recovered after a single cycle of positive and
negative selection may in some instances be suitable
after amp].ification for sequencing directly, it is often
advantageous to repeat the cycle until a lower
dissociation constant (Kd) is obtained for binding of the
single-stranded oligonucleotide species to the
transfectant cells (the first tissue culture cells)
relative to the parental cells (the second tissue culture
cells). Usually, multiple rounds of selection and
aptamer amplification will be neces~ary in order to
provide multiple opportunities to enrich for aptamers
that specifically bind to the target structure. In
addition, it is clearly within the scope of the present
invention to amplify the selected pools of aptamer after
each screening (po3itive or negative).
If an agoni t or other substance already known
to bind the desired target is available, competitive
.
:
~ .
.
.~ .
2 1 ~
~092/1~3 PCT/US92/01383
-49-
binding analyses can be performed using the selected
oligonucleo~ide species and radiolabeled substanGe.
Depending upon the results of such competitive analyses,
it can be determined whether it would be desirable to
proceed with additional po~itive/negative screening
cycles.
One could al~o determine whether the selected
oligonucleotide species can inhibit the target protein in
a functional a~say. For example, oligonucleotides
selected for binding to CD4, the human lymphocyte
transmembrane protein, may be tested for their ability to
inhibit HIV-1 infection of human lymphocytes in culture.
Modified Method Wherein T~rget/Aptamer Com~lexes are
Separated ~rom Solid_Support
As set forth hereinabove, the original
~ oligonucleotide mixture can be synthesized according to
; the desired contents of the mixture and can be separated
by adding the oligonucleotide mixture to a column
containing co~alently attached target molecules (see,
Ellington, A.D., et al., Nature (1990) 346:818-822) or to
the target agents in solution (see Blackwell et al.,
Science (1990) 250:1104-lllOi Blac~well et al., Science
(1990) 250:1149-1151; or to the target agent bound to a
filter (see Tuerk, C., and Gold, L., ~iQa~Q (1990)
24~:505-510). Complexes between the aptamer and targeted
agent are separated from uncomplexed aptamers using any
suitable technique, depending on the method used for
complexation. For example, if columns are used, non-
binding species are simply washed from the column using
; an appropriate buffer. Specifically bound material can
then be eluted.
If binding occurs in ~olution, the complexescan be separated from the uncomplexed oligonucleotides
using, for example, the mobility shift in electrophoresis
:' ' :
' ~
wos2/1~w3 2 1 ~ 9 8 PCT/US92/013X~
- 50 -
techni~ue (EMSA), de~ribed in D~vis, R.L-, et al ., Ç~ll
(1990) ~0:733. In this method, aptamer-targe~ molecule
complexes are run on a gel and aptamers removed from the
region of the gel where ~he target molecule runs.
Unbound oligomers migrate outside these regions and are
separated away. Finally, if cQmplexes are ~ormed on
filters, unbound aptamers are eluted u ing standard
techniques and the desired aptamer recovered from the
filters.
In a preferred method, separation of the
complexes involves detachment of target-aptamer complexes
from column matrices aR follows.
A column or other support matrix having
covalently or noncovalently coupled target molecules is
synthesized. Any standard coupling reagent or procedure
may be utilized, depending on the nature of the support
and the target molecule. For example, covalent binding
may include the formation of disulfide, ether, ester or
amide linkages. The length of the linkers used may be
varied by conventional means. Noncovalent linkages
include antibody-antigen interactions, protein-sugar
interactions, as between, for example, a lectin column
and a naturally-occurring oligosaccharide unit on a
peptide.
Lectins are proteins or glycoproteins that can
bind to complex carbohydrates or oligosaccharide units on
glycoproteins, and are well-described in The_Lectins
(I.E. Liener et al., eds., Academic Press 1986). Lectins
are isolated from a wide variety of natural sources,
including peas, beans, lentils, pokeweed and snails.
Concanavalin A is a particularly useful lectin.
Other linking chemistries are also available.
For example, disulfide-derivatized biotin (Pierce) may be
linked to a target moiecule by coupling through an amine
or other functional group. The re~ulting target-S-S-
.
.
WO92/1~W3 2 1 0 ~ ~ ~ PCT/US92/01383
-51-
blotln complex c3uld then be u~ed in comblna~ion ~ith
avidin-derivatized support. Oligonucleotide-target
complexes could then be recovered by disulfide bond
cleavage. Alternatively, target may be coupled via ~
cis-diol linker, and oligonucleotide-target complexes may
be recovered by mild oxidation of the vicinal diol bond
using NaIO~ or other appropriate reagents. Linking
chemistries will be selected on the basis of (i)
conditions or reagent~ nece~ary for maintaining the
structure or activity of the target molecule, and/or (ii)
chemical groups or moieties on the target molecule
available for linking to the ~upport.
The oligomer mixture is added to and incubated
with the support to permit oligonucleotlde-target
complexation. Complexes between the oligonucleotides and
target molecule are separated from uncomplexed
oligonucleotides by removing unbound oligomers from the
support environment. For example, if columns are used,
nonbinding species are simply washed from the column
using an appropriate buffer.
Following removal of unbound oligomers, the
target molecules are uncoupled from the support. The
uncoupling procedure depends on the nature of the
coupling, as described above. Targets bound through
disulfide linkages, for example, may be removed by adding
a sulfhydryl reagent such as dithiothreitol or ~-
mercaptoethanol. Targets bound to lectin supports may be
removed by adding a complementary monosaccharide (e.g.,
~-methyl-mannoside, N-acetylglucosamine, glucose, N-
acetylgalactosamine, galactose or other saccharides forconcanavalin A). Oligonucleotides specifically bound to
the target can then be recovered by ~tandard denaturation
techniques such as phenol extraction.
The method of elution of target-oligonucleotide
complex from a ~upport has superior unexpected properties
,:
:
: . . . . :.
.: : :
.. . . . .
' .: . , ~ . .
': : ~ ' . -
.
W092/1~3 ~ l ~3 ~ ~. 9 8 PCT/US~2/013P~
-52-
~hen compared with standard oligonucleo~ide elution
techniques. This invention is not dependent on the
mechanism by which these superior properties occur.
However, without wishing to be limited by any one
mechanism, the following explanation is offered as to
how more efficient elution i5 obtained. Certain support
effects result from the binding of oligonucleotides to
the ~upport, or the support in conjunction with
oligonucleotide or targe~. Removing oligonucleotide-
target complexes enables the recovery of oligonucleotidesspecific to target only, while eliminatiny oligo-
nucleotides binding to the support, or the support in
conjunction with oligonucleotide or target. At each
cycle of selection, this method may give up to 1,000-
fold enrichment for specifically binding species.Selection with target~ remaining bound to support gives
less enrichment per cycle, making it necessary to go
through many more cycles in order ~o get a good aptamer
population.
Aptamer Pools of Varying L~n~th
Aptamers can also be selected in the above
methods using a pool of oligonucleotides that vary in
length as the starting material. Thus, several pools of
oligonucleotides having random sequences are synthesized
that vary in length from e.g. 50 to 60 bases for each
pool and containing the same flanking primer-binding
sequences. Equal molar amounts of each pool are mixed
and the variable-length pool is then used ~o select for
aptamers that bind to the desired target substance, as
described above. This protocol selects for the optimal
species for target binding from the starting pool and
does not limit aptamers to those of a given length.
Alternatively, several pools of mixed length
aptamers can be used in parallel in separate selections
:' .
:.
., .
': , ,
':
- ~, : :
. : .
,
2 ~
~092J1~3 PCT/US92/01~83
-53-
and then combined and further ~elected to obtain the
optimal binders from the size range initially used. For
example, ~hree pools, A, ~ and C, can be used. Pool A
can consist of oligonucleotides having random sequences
that vary in length from e.g. 30 to 40 bases; pool B can
have sequences varying in length from e.g. 40 to S0
bases; and pool C can have sequences varying in length
from 50 to 60 bases. It is to be unders~ood that the
lengths described above are for illustrative purposes
only. After selection to obtain binders from A, ~, and
C, all aptamers are mixed together. A number of rounds
of selection are done as described above to obtain the
best binders from the initial species selected in the 30-
to 60-base range. Note that with this technique, not all
possible species in some of the pools are used for
selection. If the number of sites available for binding
are increa~ed, i.e., if a column is u~ed and the size of
the column increased, more species can be included for
selection. Furthermore, this method allows for the
selection of oligomers from the initial starting pool
that are of optimal length for binding the targeted
agent.
. ,
Derivatization
Aptamers containing the specific binding
sequences discerned through the method of the invention
can also be derivatized in various ways. For example, if
the aptamer is to be u5ed for separation of the target
substance, conventionally the oligonucleotide will be
derivatized to a solid support to permit chromatographic
separation. If the oligonucleotide is to be used to
; label cellular components or otherwise for attaching a
detectable moiety to target, the oligonucleotide will be
derivatized to include a radionuclide, a fluorescent
' 35 molecule, a chromophore or the like. If the oligonucleo-
:'
i
. 1
.
: ~ . . , . - . :
,, . . ;
- - '~ : ': ..
:, - .: .: , ,
.:''~, " ' ; : -
w092/1~3 ~ 8 PCT/U~92/013
-54-
tide is to be used in specific binding a~says, coupling
to solid support or detectable label, and the like are
also desirable. If it i9 to be u~ed in therapy, the
oligonucleotide may be derivatized to include ligands
which permit easier transit of cellular barriers, toxic
moieties which aid in the therapeutic effect, or
enzymatic activities which perform desired functi~ns at
the targeted site. The aptamer may also be inclu~ed in a
suitable expres~ion sy~tem to pro~ide for in situ
generation of the desired sequence.
Consensus Sequences
When a number of individual, distinct aptamer
sequences for a single target molecule have been obtained
and sequenced as described above, the sequences may be
examined for "consensus sequences." As used herein,
"consensus sequence" refers to a nucleotide sequence or
region (which may or may not be made up of contiguous
nucleotides), which i~ found in one or more regions of at
least two aptamers, the presence of which may be
correlated with aptamer-to-target-binding or with aptamer
structure.
A consensus sequence may be as short as three
nucleotides long. It also may be made up of one or more
noncontiguous sequences with nucleotide sequences or
polymers of hundreds of bases long interspersed between
the consensus sequences. Consensus sequences may be
identified by sequence comparisons between individual
aptamer species, which comparisons may be aided by
computer programs and other tools for modeling secondary
and tertiary structure from sequence information.
Generally, the consensus sequence will contain at least
about 3 to 20 nucleotides, more commonly from 6 to lO
nucleotides.
',
.
,. , . . ~ :
: - .:: . . .
:,' ,'' ~ ~' , .
.. .. .. ......
210~
~092/1~3 PCT/US92/01383
-55-
As used herein n consensus sequence" means that
certain positions, not necessarily contiguous, of an
oligonucleotide are specified. By ~pecified i9 meant
that ~he composition of the position is other than
completely random. Not all oligonucleotides in a mixture
may have the same nucleotide at ~uch position; for
example, the consensus sequence may contain a known ratio
of particular nucleotides. For example, a consensus
sequence might consist of a 3eries of four positions
wherein the first position in all members of the mixture
is A, the second position is 25~ A, 35~ T and 40~ C, the
third position is T in all oligonucleotides, and the
fourth position i5 G in 50~ of the oligonucleotides and C
in 50~ of the oligonucleotides.
When a consensus sequence is identified,
oligonucleotides that contain that sequence may be made
by conventional synthetic or recombinant means. These
aptamers, termed "secondary aptamers, n may also ~unction
as target-specific aptamers of this invention. A
secondary aptamer may conserve the entire nucleotide
sequence of an isolated aptamer, or may contain one or
more additions, deletions or substitutions in the
; nucleotide sequence, as long as a consensus sequence is
conserve~. A mixture of secondary aptamers may also
function as target-specific aptamers, wherein the mixture
;~ i9 a set of aptamers with a portion or portions of their
nucleotide sequence being random or varying, and a
conserved region which contains the consensus sequence.
Additionally, secondary aptamer~ may be synthesized using
one or more of the modified bases, sugars and linkages
described herein using conventional techniques and those
! described herein.
. .
:
;'''
. .
. . .
- . ..... . . .:
.. . . -
,
: . . :
. ~
w~92/1~3 ~ 8 P~T/US92/013
-56-
I~mune ~ecru-i~me-nt
The pre~ent invention also provides a method
whereby immune response i9 elicited in a desired manner
through the use of agents which are directed to specific
targets on cells involved in a pathological condition of
interest. The aptamers prepared herein are useful as
targeting agents in this method. In a particular
embodiment of the invention, the known ability of various
materials to elicit strong immune re~ponse3 is exploited
so as, in turn, to stimulate the immune response ~o
~arget pathologic cells, which may themselves otherwise
have the ability to reduce or escape effective CTL
responses.
Pursuant to this method of the invention, in a
first step a targeting agent is identified that
specifically binds to a surface feature of the pathologic
cells of interest. Once such a selective targeting agent
has been identified, in a second step a conjugate is
formed with a moiety known to act itself as an immunogen,
for example a~ an antigen for eliciting a strong CTL
response in the organism. By virtue of the ~elective
binding of the targeting agent component of the conjugate
to cells containing the target, these cells are in effect
modified 90 as to exhibit the immunologic character of
the associated immunogenic component of the conjugate.
Thus, when the associated moiety is an antigen which
elicits a strong CTL response, the cells are effectively
marked for destruction by the antigen component of the
conjugate.
In accordance with one preferred embodiment of
the invention, the targeting agent is an oligonucleotide
which binds to a specific target on a cell surface, and
the immunomodulatory component of the conjugate is a
polypeptide which elicits a strong CTL response.
W092J1~3 2 ~ O ~ S ~ ~ PCT/US92/Ot383
Uti1ity Qf the ~ ers
The aptamers of the invention are ~lseful in
diagnostic, research and therapeutic contexti~. For
diagnostic applications, aptamers are particularly well
5 suited for binding to biomolecules that ar~ identical or ¦ -
~imilar between different qpecies. Classes of molecules
such as kinins and eicosanoids generally do not serve as
good antigens because they are not easily recognized as
foreign by the immune systems of animalis that can be used
to generate antibodies. Antibodies are generally used to
bind analytes that are detected or quantitated in various
diagnostic a~says. Aptamers represent a class of
molecules that may be used in place of antibodie~ for
diagnostic and purification purposes.
The aptamers of the invention are therefore
particularly useful as diagnostic reagents to detec~ the
presence or absence of the target substances to which
they specifically bind. Such diagnostic tests are
conducted by contacting a sample with the specifically
binding oligonucleotide to obtain a complex which is then
detected by conventional means. For example, the
aptamers may be labeled using radioactive, fluorescent,
or chromogenic labels and the presence of label bound to
solid support to which the target substance has been
bound through a specific or nonspecific binding means
detected. Alternatively, the specifically binding
aptamers may be used to effect initial complexation to
the support. Means for conducting assays using such
oligomers as specific binding partners are generally
known to track tho~e for standard specific binding
partner based assays.
Thi~ invention also permits the recovery and
deduction of oligomeric sequences which bind specifically
~c cell surface proteins and specific portions thereof.
Therefore, these oligonucleotides can be used as a
i
~` ~
'. . .
.
wos2/1~3 ~ PCT/US92/013E~
-5~
separation tool for retrieving the substances to which
they specifically bind. By coupling the oligonucleo-
tides containing the specifically binding seouences to a
solid support, for example, proteins or oth~r cellular
component~ to which they bind can be recovered in useful
quantities. In addition, these oligonucleo~ides can be
used in diagnosis by employing them in specific binding
assays for the target sub~tances. When ~uitably labeled
using detectable moieties such as radioisotopes, the
specifically binding oligonucleotides can also be used
for in ViVQ imaging or histological analysis.
It may be commented that the mechanism by which
the specifically binding oligomers of the invention
interfere with or inhibit the activity of a target
substance is not always establi~hed, and is not a part of
the invention. The oligomers of the invention are
characterized by their ability to target specific
substances regardless of the mechanisms of targeting or
the mechani~m of the effect thereof.
For use in research, the specifically binding
oligonucleotides of the invention are especially helpful
in effecting the i~olation and purification of substances
to which they bind. For this application, typically, the
oligonucleotide containing the specific binding ~equences
is conjugated to a solid support and used as an affinity
ligand in chromatographic separation of the target
substance. The affinity ligand can also be used to
recover previously unknown ~ubstances from sources which
do not contain the target substance by virtue of binding
similarity between the intended target and the unknown
substanceq. Furthermore, as data accumulate with respect
to the nature of the nonoligonucleotide/oligonucleotide-
specific binding, insight may be gained as to the
mechanisms for control of gene expression.
. . . ~ . . ,
::
; ~
' : :
21~ ~698
W092/l~3 PCT/US9Z/01383
-59-
In therapeutic applications, the aptamers of
the invention can be formulated for a variPty of modes of
administration, including systemic and topical or
localized administration. Techniques and formulations
generally may be found in Remington's ~harmaceutical
Sciences, Mack Publi~hing Co., Ea~ton, PA, latest
edition.
For systemic administration, injection i9
preferred, including intramuscular, intravenous,
intraperitoneal, and subcutaneous. For injection, the
aptamers of the invention are formulated in liquid solu-
; tions, pre~erably in phy3iologically compa~ible buffers
such as Hank' 5 solution or Ringer' 9 solution. In addi-
tion, the aptamers may be formulated in ~olid form and
redis~olved or su~pended immediately prior to use.
Lyophilized forms are al~o included.
Systemic admini tration can also be by
transmucosal or transdermal means, or the oligomers can
be administered orally. For tran mucosal or transdermal
administration, penetrants appropriate to the barrier to
be permeated are used in the formulation. Such
penetrants are generally known in the art, and include,
for example, for transmucosal administration bile salts
and fusidic acid derivatives. In addition, detergents
may be used to facilitate permeation. Transmucosal
~ administration may be through nasal sprays, for example,
; or using suppositorie~. For oral administration, the
; oligomers are formulated into convPntional oral
administration forms such as capsules, tablets, and
tonics.
For topical administration, the oligomers of
the invention are formulated into ointments, salves,
gels, or cxeams, as is generally known in the art
The oligonucleotides may al~o be employed in
expression systems, which are administered according to
,~
, . . . .
: . ~
.
: ~ ,
.
2 1 ~
WO92/1~3 PCT/US92/01
-60-
techniques applicable, for instance, in applying gene
therapy.
I~mune Res~Qnse MQd~lati~n
The present invention is also directed to a
method whereby immune response is elicited in a desired
manner throu~h the use of agents which are direc~ed to
specific targets on cells involved in a pathological
condition of intere~t.
Tar~eting Agents
For use as targeting agents, any of a number of
different materials which bind to cell surface antigens
may be employed. When available, antibodie~ to target
cell surface antigens will generally exhibit the
necessary specificity for the target. Similarly, ligands
for any receptors on the surface of the pathologic cells
of interest may suitably be employed as targeting agent.
Yet another class of potentially valuable targeting
agents is oligonucleotides of the requisite binding
selectivity.
Typically, for reaction with antigenic
determinants on proteins, antibodies raised against these
; proteins, either polyclonal or monoclonal, may be used.
Polyclonal anti-sera are prepared in conventional ways,
for example by injecting a suitable mammal with antigen
to which antibody is desired, assaying the antibody level
in serum against the antigen, and preparing anti-sera
; when the titers are high. Monoclonal antibody
preparations may also be prepared conventionally, such as
by the method of Koehler and Milstein using, e.g.,
peripheral blood lymphocytes or spleen cells from
immunized animals and immortalizing these cells either by
viral infection, by fusion with myelomas, or by o~her
~ . . .. .
~092~1484~ 2 10 ~ 6 ~ ~ Pcr/lJsg2/01383
-61-
conven~ional procedures and screening for the production
of the desired antibodies by isolated colonies.
In addition to antibodies, ~uitable
immunoreactive fragments may also be employed, such as
the Fab, Fab', or F~ab')2 fragments Many antibodies
suitable for use in forming the targeting mechanism are
already available in the art. For example, the use of
immunologically reactive fragments as substitutes for
whole antibodies i9 described by Spiegelberg, H.L., in
"Immunoassays in the Clinical Laboratory" (1978) 3:1-23.
One known curface antigen to which antibodies
can be raised, for example, is the extracellular domain
of the HE~2/nu associated with breast tumors. As set
forth by Fendly, B.M. et al. ~ Biol Res~ Mod (l990)
9:449-455, antibodies to HER/nu can be raised in
alternate hosts (~ince the antigen i~ not foreign to the
host-bearing tumor) and can be used in immunoconjugates
to bind specifically to the tumor. A~ applied in the
method of the invention, the antibody or fragment thereof
would be coupled not to a toxin, but to an
immunomodulatory agent which would mount a CTL response.
In addition to immunoreactivity, targeting can
be effected by utilizing receptor ligands which target
receptors at the target cell surface, for example on the
basis of complementarity of contours or charge patterns
between the receptor and ligand. As used herein, the
term "receptor ligand" refers to any substance, natural
or synthetic, which binds ~pecifically to a cell surface
receptor, protein or glycoprotein found at the surface of
the desired target cell population. These receptor
ligands include lymphokine factors, for example, IL2 or
viral or tumor antigens.
Oligonucleotides identified a binding to one
or more surface antigen of the pa~hologic cells may also
~5 be used to form conjugates in a known manner, and are
'
2 1 0 ~ b ~ ~
WOs2Jl~W3 PCT/US92~01~3
-62-
particularly preferred for use as targeting agents in
- accordance with the pre~ent invention.
Immunom~ulatory Ag~a~9
S An rlimmunological response" as di~cusqed herein
generally refers to the development in a mammal of either
a cell- or antibody-mediated immune response to an agent
of interest. Typically, ~uch a response consists of the
mammal producing antibodie~ and/or cytotoxic T-cells
directed specifically to a particular agent. In the
context of the presenc invention, however, an
"immunological re~pon~e different from that elicited by
the pathologic cell itself in the absense of the
conjugate" may con~titute, e.g., the failure to produce
antibodies or cytotoxic T-cells under circumstances (for
example, in the presence of a particular antigen) which
would normally result in the induction of a specific
response.
Examples of moieties known to act as antigens
for eliciting a strong CTh response include a wide range
of biologically active materials. Particularly suitable
for use in this regard are short peptide sequences, such
as those which may correspond to the antigenic
determinant3 of known immunogenic proteins. For example,
sequences derived from viral or bacterial pathogens may
be useful in stimulating a strong CTL response in the
infected host organism.
Other immunomodulatory agents useful in the
invention include fragments of the HLA Class I
- 30 slycoproteins. The ability of such HhA Class I
glycoprotetns or fragments thereof to stimulate a CTL
response has been documented by Symington, F.W. et al., J
Invest D_rmatol (1990) 95:224-228. Also known to elicit
CTL responses are short regions of viral antigens such as
., .
tho~e of the influenza virus nucleoprotein (Rothbard,
~ .
.
; : ~
: . .;
: - . -:. ~ -
., : ,. .
., ~ - .
2 ~ 0 ~ 8
~0 92 /1 ~W3 Pcr~uss2~0 1383
- 63 -
3.~. et al " ~MBO ~ ~19~) a:2321-2328) and sections of
the murine minor histocompatibility antigens such as H-
25.3 cell sur~ace antigen (Lai, P.K., Transplanta~1~
(1985) 39:G38-643). Other known agents whlch expand CTL
S as opposed to helper T- cells include interleukin-6 and
cyclosporin A.
TechniquPs for Couplin~LTarqetin~ A~ents and
Immunomodulatory Agents
Coupling of the targeting agents with ~he
immunomodulatory agents may be carried out u~ing any of a
variety of dif f erent techniques which are well known per
se to those working in the field. The particular choice
of coupling method depend4 on the chemical nature of the
specific targeting and immunomodulatory agents.
Selection of the most appropriate method of coupling from
among the variety of available alternatives for any given
types of targeting and immunomodulatory agents may in
some instances require routine screening to determine
empirically which conjugates provide the optimum
combination of targeting 8pecif icity and desired
immunomodulatory effect.
When at least one of the agents which
constitute the conjugate is a polypeptide, well-known
chemical methods for ~ormation of chemical bonds with,
e.g., functional group~ on amino acid ~ide-chains or
- preferably N-terminal amino or C-terminal carboxyl
groups, may be employed. One common approach is the use
of linkers which may be homobifunctional or
heterobifunctional, and typically involve highly reactive
functional groups on the linker. Another approach is the
use of dehydrating agents, such as carbodiimides, to
effect the formation of new bonds by reaction of a
carboxyl moiety on one member of the conjugate with a
free ami~o group on the other. Particularly suitable
.
.. ~ .
W092/1~3 ~ l~k~ 8 -64- PCT/US92/Ot~
methods involving the use of conjugation reagents (i.e.,
reagents which result in elimination of water to form a
new covalent bond) are discussed in, e.g., U.S. Patent
4,843,147 to Levy et al., which i9 hereby incorporated by
reference. Additional techniques for formation of
conjugates between polypeptides and various types of
biologically active molecules have been described in the
art with respect to the formation of cytotoxic
conjugates; for example, a variety of different
conjugate-forming reactions are described in U.S. Patent
4,507,234 to Kato et al., which is also hereby
incorporated by reference.
Similarly, methods are known for attaching a
variety of different species to oligonucleotides. For
example, Asseline, U. et al. (Proc Natl Acad Sci 81,
3297-3301 (1984)) describes the covalent linking of an
intercalating agent via a polymethylene linker through a
3'-phosphate group. Mori, K. et al. tFEBS Letters
249:213-218 (1989)) describes the covalent attachment of
groups via a methylene linker at the 5'-terminus of
oligonucleotides. PCT application W089/05853 published
June 29, 1989, the entire disclosure of which is hereby
incorporated by reference, describes a variety of methods
for formation of conjugates between nucleotide sequences
and chelating agents; the chelating agent is joined to
the nucleotides sequence by either a covalent bond or a
linking unit derived from a polyvalent functional group.
Other methods will of course be readily apparent to those
working in the field.
Identification of Suitable Targets for the Conlugates
Suitable targets for binding a targeting agent
include cell surface antigens which are specific t:o the
pathologic cells which it is desired to treat. For
example, most tumor antigens (such as the
.,
.,
,. .
~: ' 7 . ..
.: .
:. . . ' ~ .:
. . : :
:' ' .,.'
:
"
Wo92/1~W3 2 1 ~ PCT/US92/01383
-65-
carclnoembryonic antigen associated with several types of
cancer) do not generally elicit an effective CTL
response. The presence of the antigens on the surface of
tumor cells enables the use of appropriately tailored
S targeting agents to deliver conjugate specifically to
thoqe cells.
In addition to eliciting CTL type reqponses,
other ~ypes of immunomodulatory effects may be achieved
through the use of the inventive conjugates. For
example, the conjugate of the invention may be useful in
preventing the progression or the cure of autoimmune
disease.
Diseases with an autoimmune component, such as
diabetes or arthritis, appear to involve response to
specific self antigens. By using conjugates of the
invention to elicit an immune response against those
immune cells which mediate the attack on self tissues, a
positive effect on the course of the disease may be
achieved. In principle, a group of antigenically related
immune cells that mediate the systemically inappropriate
response could be targeted using a single conjugate
specific for that antigen. Destruction of this marked
population by the immune system should lead to an
amelioration of the disease condition.
Alternatively, the binding of appropriate
conjugates to target antigens on cells could be employed
as a means to mask recognition of those antigens or of
the cell bearing the antigens. Thi~ could prevent the
de~truction of the cell carrying the antigens, and thus
result in stasis of autoimmune di~ease progression.
Further, an immune response stimulated by the
immunomodulatory portion of the conjugate may re~ult in
other desirable immunologic responses in the organism.
In particular, by ~irtue of the cell death process
initiated in responYe to the conjugate, a highly
'`' : ~
.,
.
,: . . :. : .
w092/l~w3 PCT/US92/0~3X~
2:f Q ~ ~nj~ -66-
desirable response to other unmarked cells of the same
~ype may result. Thus, by identifying a particular class
of cells for recognition by various componen~s of ehe
immune system ~ia the immunomodulatory portion of the
conjugate, it may be po~sible to induce a particular
category of responce (e.g., CTL-mediated destruction) to
that category of cells as a whole, regardless of whether
or not the cells are marked by conjugate.
Target molecules that are not conventionally
considered to be biomolecule~l are also appropriate for
the methods described herein. Example of "non-
biomolecule" targets include intermediates or end-
products generated by chemical synthesis of compounds
used in therapeutic, manufacturing or cosmetic
applications, including polymer surfaces, especially
tho~e useful in medical applications. Aptamer
oligonucleotides may be uYed to specifically bind to most
organic compounds and are suitably u~ed for isolation or
detection of such compounds.
The following examples are meant to illustrate,
but not to limit the invention.
:
Example 1
Selection of A~tamers that ~ind to 9radykinin
A. Preparation of Bradykinin CQlumn
~radykinin derivatized Toyopearl~ (Toso Haas, Inc.,
Woburn, MA) support was used for all ~elections
described. Bradykinin was coupled to the Toyopearl
support through its amino termini according to the
manufacturer's instructions. ~radykinin (NH2-arg-pro-
pro-gly-phe-ser-pro-phe-arg-COOH, acetate salt) was
obtained from ~achem Feinchemikalien AG (Cat. No. H-
1970). Toyopearl AF-carboxyl 650 M was converted to the
NHS-ester by treatment with N-hydroxy succinimide (NHS)
, . .
. '
~, .
,
~: .
210~3~
wos2/1~3 PCT/US92/01383
-~7-
and diisopropyl carbodiimide in dioxane/DMF (1:1) for 24
hours. The support was washed with DMF, H20, 200 mM
NaHCO3 and treated with a solution of bradykinin (20 mg
of bradykinin/ml support~ in 200 mM NaHC03 for 3 days.
The support was then washed and the coupling yield was
determined by HCl digestion of the support (80C for 8
hours) and a ninhydrin as~ay using free bradykinin as a
standard. The yield wa3 found to be 16 mg/ml support ~16
~mole/ml support). The coupled support was then capped
by treatment with acetic acid (NHS-e~ter) in dioxane/200
mM NaHCO3 buffer (1:1).
An underivatized capped support to be used as a
control was made by treating Toyopearl AF-carboxyl 650M
with acetic acid (NHS-ester) in dioxane/200 mM NaHC03
buffer (1:1), followed by washing.
B. Synthesis o~ Oliqonu~leotide Pool
DNA oligonucleotides containing a r~ndomized
sequence region were synthesized using standard solid
phase techniques and phosphoramidite chemistry
(Oligonucleotide Synthesi~, Gait, M.J., ed. (IRL Press),
1984; Cocuzza, A., Tetrahedron ~etters, (1989) 30:6287-
6291.) A 1 ~M small-scale synthesis yielded 60 nmole of
HP~C-purified single-stranded randomized DNA. Each
strand consisted of specific la-mer sequences at both the
5' and 3' ends of the strand and a random 60-mer sequence
in the center of the oligomer to generate a pool of 96-
mers with the following sequence (N = G, A, T or C):
5~ HO-CGTACGGTCGACGCTAGCN60CACGTGGAGCTCGGATCC-OH 3~
DNA 18-mers with the following sequences were used as
primers for PCR amplification of oligonucleotide
sequences recovered from bradykinin columns. The 5~
primer sequence was 5' HO-CGTACGGTCGACGCTAGC-OH 3' and
:,
b
. .
' , . : ':
. ~
'
: ' ~, ' :. .
: , '' ' ' ' ' '~.' ' "" ": '.' . :' ' :'.. -
Wo92~1~3 ~ 1 0~ ~ 9 8 6a - PCT/US92tO13
the 3' primer sequence was 5' biotin-O-
GGATCCGAGCTCCACGTG-OH 3'. The biotin residue was linked
to the 5' end of the 3' primer using commercially
available biotin phosphoramidite (New England Nuclear,
Cat. No. NEF-707). The biotin phosphoramidite i9
incorporated into the strand during solid phase DNA
synthesis using standard synthesis conditions.
C. Selection for Aptamers That Bind tQ an Immobilized
Bradykinin Column
400 ~l bradykinin-derivatized Toyopearl support
was loaded on a l.5 ml column housing. The column was
washed with 3 ml of 20mM Tris-acetate buffer (pH 7.4)
containing lmM MgC12, 1 mM CaCl2, 5mM KCl and 140mM NaCl
(the "selection buffern). An identical column was
prepared using the underivatized Toyopearl control
support described in Example l-A.
An initial oligonucleotide pool (0.5 nmole, 3 x
lOl4 unique sequences) of synthetic 96-mers prepared in
Example 2 was amplified approximately 30-fold by large-
scale PCR using known technigues. As~uming 10-20~
readthrough of synthetic DNA and possible preferential
amplification by the Taq polymerase, the estimated actual
complexity was reduced to about l x lOl3 unique
sequences.
This amplified oligonucleotide pool (O.l
nmoles, about 6 copies of 1 x 1013 unique sequences),
doped with 5'-32P-labeled ~pecie~, was used in the first
selection round. The pool was heated to 94C for 3
minutes in selection buffer, allowed to cool to room
temperature, applied to the control column in a volume of
100 ~1, and allowed to equilibrate for approximately lO
minutes. The column was then eluted with selection
buffer and the eluent collected in 200 ~l fractions. The
bulk of the counts (approximately 95~) with little
'~
''
:: ~:
,. , ~ . .
:
: . , . ~.
~92/1~3 210 ~ 6 3 ~ PCT/US92/0;383
-69-
affinity for the matrix eluted in the flrst 2 or 3
fractions after the void volume. These fractions were
combined, applied to the bradykinin-linked suppo~-t (400
~1 support, approximately 5 ~mole, wa~hed with 3 ml of
selection buffer), and eluted with selection buffer. The
column was then eluted with selection buffer and the
eluent collected in 200 ~l fractions. Fractions were
collected until the eluted counts in a fraction plateaued
at less than about .05~ total loaded counts. The column
was then eluted with elution buffer (500 mM Tris HCl (pH
8.3), 20 mM EDTA) at room temperature. Aptamers were
eluted in the first 2 or 3 fractions after the void
volume. These fractions were combined and precipitated
using ethanol and glycogen as the carrier. The aptamer
pellet was resuspend~d in 200 ~l of ddH20 (deionized
distilled water) and divided into two 0.5 ml siliconized
Eppendorf tubes for PCR. All remaining counts on the
column were removed by treatment with O.lN NaOH (0.5 ml),
although these species were not used in subsequent
amplification and selections.
:
D. Amplification of Selected A~tamers
Two groups of selected aptamers were amplified
by PCR using standard techniques and the following
protocol.
A 200 ~1 PCR reaction consisted of the
following: 100 ~1 template aptamer (approximately 2
pmoles); 20 ~1 buffer tlOO mM Tris Cl (pH 8.3), 500 mM
KCl, 20 mM MgCl2); 32 ~l NTP's (5 mM conc total, 1.25 mM
each ATP, CTP, GTP, and TTP), 20 ~l primer 1
(biotinylated 18-mer, 50 ~M); 20 ~1 primer 2 (18-mer, 50
~M); 2 ~l hot NTP's (approximately 2 mCi); 6 ~l ddH20;
and 2 ~1 Taq I Polymerase (10 units). The react'ion was
seale~ with 2 drops NUJOh mineral oil. A control
reaction was also performed without template aptamer.
.
;,i
~ .. . .
. : :
,-: :.: . ~ :
.:: : - :: .:
:
:, :
:: . . : .
.
: :
W092/1~3 ~ t O ~ b' 9 8 PCT/US92/013~
-70-
Initial denaturation was at 94C for 3 minutes,
but subsequent denaturation after each elonga~ion
reaction lasted l minute. Primer annealing occurred at
60C for l minute, and elongation of primed DNA strands
using the Taq polymerase ran at 72C for 2 minutes. The
final elongation reaction to completely fill in all
strands ran for l0 minutes at 72C, and the reaction was
then held at 4C.
Fifteen rounds of Taq polymerase elongation
were carried out in order to amplify the selected aptamer
DNA. After the reactions were completed, the ~JJOL oil
was remo~ed by chloroform extraction. The two reactions
were combined and chloroform extracted again. A 2 ~l
sample was removed from each of the aptamer and control
reaction for counting and an analytical gel. The rest of
the amplified aptamer was run over four Nick columns (G-
50 Sephadex, washed with 3 ml TE buffer (l0 mM Tris HCl
(pH 7.6), 0.l mM EDTA)) to remove unincorporated NTP's,
primers, and salt. l00 ~l of the amplified aptamer pool
(400 ~l total) was applied to each Nick column. 400 ~l
of TE buf f er was then added to each column and the
columns were eluted with an additional 400 ~l using l0 mM
Tris-HCl, pH 7.6, 0.l m~ EDTA (1600 ~l total). A 8 ~l
sample was removed from the combined eluents for counting
and an analytical gel. The remaining eluent was loaded
; on an avidin agarose column (Vector Laboratories, Cat.
No. A-2010) (600 ~l settled support, washed with 3 x 800
~1 TE buffer). Approximately 90~ of the loaded counts
remained on the column. The column was washed with TE
buffer (3 x aoo ~1) and then the nonbiotinylated strand
was eluted with 0.15 N NaOH (400 ~l fractions) More than
45~ of the counts on the column were eluted in the first
two fractions. These two fractions (800 ~l) were
combined and neutralized with approximately 4 ~l of
glacial acetic acid. The neutralized fractions were
., .
'~ .
..
.... , :
.:
: . ., : , .~,
.
-
.
~vo 92!1~ 2 ~ O ~ ~ 9 PCT/US~2/0t383
reduced to 200 yl by speed vacuum or butanol extractionand then precipitated with EtOH. The resultant pellet
was dissolved in 102 ~l selection buffer, heated at 94C
for 3 min, and cooled to room temperature. A 2 ~l sample
was removed for counting and an analytical gel.
E. Aptamer Recovery_PrQfiles From the First Two Rounds
of ~election
Aptamers eluted from the first round of
bradykinin-linked column selection were obtained in two
100 ~l fractions that contained 0.07~ of the total counts
loaded. Recovery of three 100 ~l fractions from the
second round selection yielded 0.26% of the total counts
loaded therein, indica~ing that an increa~ed proportion
of the aptamers loaded onto the column had bound to
bradykinin.
F. Further Rounds of_Aptamer Selection on Bradykinin
Columns
Additional rounds of selection and
amplification were carried out in order to obtain a
population of aptamers that consisted of species that
bound to bradykinin. The cycle of Examples 1-C and 1-D
was repeated 6 timeq until a significant portion of the
oligonucleotide pool (as mea~ured by cpm) remained on the
column after washing with selection buffer. Under the
selection and amplification conditions used, about 15~ of
~- input counts (0.5 nmole DNA, about 19 ~g) bound to the
bradykinin column in rounds 5 and 6. About 6~ of the
counts bound to the control column. However, the
proportion of counts that bound to the bradykinin column
was higher, 40~ of input cpm, when the initial a~ount of
input DNA was reduced from 0.5 nmole to 0.1 nmole. Under
these conditions (0.1 nmole input DNA, about 3.5 ~g) 19
of the counts bound to the capped control column. The
- '
~' ~
WO92/1~3 2 1 ~ ~. fi ~ 8 -72- PCTt~S92/013~
relatively high proportion of counts bound to the control
column was due to overloading of the control colun~
during the prebinding proce~s prior to adding aptamer to
bradykinin columns at each round of ~election. This high
S level of bindlng to the control column in the later round
pools (rounds 5 and 6) can be reduced by reducing the
molar ratio of input DNA to column during the selection
process. This protocol i9 described in Example 1-G
below. This high affinity aptamer pool wa~ eluted,
amplified by PCR, cloned, and sequenced (about 20 ~o 40
clones). From these clones, several homologous batches
of aptamers and/or individual clones are prepared by
solid phase DNA synthesis and tested for bradykinin
binding affinity and specificity.
G. Aptamer Selection Using a Reduced Molar Ratio of
Aptamer to Column
An initial oligonucleotide pool (0.5 nmole, 3 x
1014 unique sequences) of synthetic 96-mer prepared as ln
Example 1-B is amplified approximately 30-fold by large-
scale PCR using known techniques. Assuming 10-20~
readthrough of synthetic DN~ and possible preferential
amplification by the Taq polymerase, the estimated actual
complexity is reduced to about 1 x 1013 unique sequences.
This amplified oligonucleotide pool (0.5
nmoles, about 30 copies of 1 x 1013 unique sequences)
; doped with 5, 32p labeled ~pecies, is used in the first
selection round. A bradykinin-linked column and control
support column are prepared as in Example 1-B.
The pool is heated to 94C for 3 minutes in
selection buffer, cooled to room temperature, then
applied to 1 ml of control support washed with 3 ml of
selection buffer, and allowed to equilibrate for about 10
minutes. The column is then eluted with Qelection buffer
and the eluent collected in 200 ~1 fractions. The bulk
: ., - . . ; . -
, . ~, .-.. ~ , . .
:- . ' . . ~ , . , , : ',
- ., ' "' ~ ' ' : ,
~092/l~3 2 10'i~ 9 3 PCTJUS92/01383
-73-
of the count3 (approximately 90~), with little af~inity
for the matrlx is eluted in the fir3t 2 or 3 fractions
after the void ~olume. These fractions are combined,
applied to the bradykinin-llnked support (1 ml,
approximately 10 to 15 ~mole, wa~hed with 3 ml of
selection buffer), eluted with selection buffer, and the
eluent collected in 200 ~l fractions. Fractions are
collected until the eluted counts in a fraction plateau
at less than 0.05~ of the total counts loaded on ~he
column (approximately 12 fraction~). The column is then
eluted with elution buffer (.15 N NaOH, 50 mM EDTA). The
aptamers are eluted in the first 2 or 3 fractions after
the void volume. These fractions are combined and
precipitated using ethanol and glycogen as the carrier.
15 The aptamer pellet is taken up in 100 ~1 of dd H2O and
transferred to a 0.5 ml siliconized eppendorf tube for
PCR. One aptamer PCR reaction and one control (without
template) reaction are then run as described in
Example 1-D.
The above procedure is then repeated, with the
exception that the oligonucleotide pool u~ed in
subsequènt selection cycles is reduced to 0.1 nmole and
the control and bradykinin support volumes are reduced to
about 330 ~l (about 3 to 5 ~moles bradykinin). The
procedure is repeated ( 5-6 times) until a significant
portion of oligonucleotide remains on the column after
washing with selection buffer. This high-affinity
aptamer pool is eluted, converted to double stranded DNA
by PCR, and cloned. About 20 clones are sequenced. From
these clone~, several homologous batches of aptamers are
prepared and tested for binding affinity and target
specificity. High affinity aptamers are mutagenized
. .,
using the techniques described in ~llington et al.,
Nature (1990) 346:818-822 to yield a 15% mutatlon rate a~
:....
': .
.
: :
,
. .
W09~J1~3 PCT/US92/013'`~
2~ ~fi~ -74-
each position and reselected to determine ~hose bases
whlch are involved in binding.
Example 2
S Selection of Ap~mers ~hat Bind to PGF2~
A. Prepara~iQn of PGF2~ Linked to a Solid SuppQr
PGF2~ derivatized Toyopearl~ AF-amino 650M
(Toso Haas, Inc., Woburn, MA) support (charged wi.th 10
~moles PGF2~/ml ma~rix~ was used for all selections
described. The support was coupled through the free
carboxyl group of PGF2~ according to the manufacturer's
instructions. PGF2~ was purchased from Sigma Chemical
Co. (Cat. No. P 3023) and tritiated PGF2~ was purchased
from New England Nuclear.
10 mg of PGF2a (Tris salt) was dissolved in
1 ml H20/methanol and converted to the sodium salt by
passage over an ion exchange column. The column eluent
was then evaporated, dissolved in dioxane and converted
~0 to the N-hydroxy-~uccinimide (NHS) ester by treatment
with NHS and diisopropyl carbodiimide for 24 hrs. This
mixture was then added to 1 ml of the settled support
Toyopearl washed previoucly with 200 mM NaHC03. The
mixture was shaken for 24 hrs., and washed with a NaHCO3
solution. To determine the amou~t of coupling, the above
described procedure was repeated except that a small
amount of tritiated PGF2~ was added. The coupling yield
was determined by the amount of tritium as~ociated with
the support. The support was then capped by treatment
with acetic acid (NHS-estPr) in dioxane/200 mM NaHC03
buffer (1:1).
An underivatized capped support was mad~ by
treating Toyopearl AF-amino 650M with acetic acid (NHS-
ester) in dioxane/200 mM NaHC03 buffer (1:1) to be used
as a control.
. ' ,
.,
,
' . ' , ~ .
210~8
`~092/1~3 PCT/US92/01383
-75-
B. Selec~ion for Aptamers That Bind to an Immobilized
PGF2~ Column
200 ~l derivatized Toyopearl support containing
2 ~mole of PGF2~ ligand wa~ loaded on a l.S ml column
housing. The column was washed with 3 ml of 20mM Tris-
acetate buffer (pH 7.4) containing lmM MgCl2, 1 mM CaC12,
5mM KCl and 140mM NaCl (the "Qelection buffer~). An
identical column was prepared using the underivatized
Toyopearl control support described in Example 2-A.
0.5 nmoles of the oligonucleotide pool prepared
in Example l-B (doped with tracer amounts of 5'-32P-end-
labeled species) was resuspended in 400 ~l of selection
buffer and heat denatured for ~ min at 95C. The
denatured DNA was immediately transferred to wet ice for
lO min. This ~aterial was applied to the control support
(underivatized Toyopearl), flow initiated, and eluent
collected. Flow-through was reapplied three times. At
the end of the third application, the column was rinsed
with 200 ~l selection buffer (l bed volume). The flow-
through was pooled and applied for a fourth time. A
column profile was established using 32p quantification
via Cerenkov counting. Flow-through material was then
pooled for application to the PGF2~ support.
Application of the flow-through pool to PGF2~-
derivatized Toyopearl was performed as described above.
After the third application, the column was washed with
200 ~l of selection buffer and the material reapplied to
establish a column profile. The support was washed with
additional selection buffer until the eluting 32p
material decreased to low levels, le~s than 0.2~ of
initial input cpm. The support was then washed with lml
of selection buffer containing lM NaCl. ~ound
oligonucleotides were eluted with 20mM EDTA/60~
acetonitrile. The solvent was removed under vacuum and
WO 92/14~ i rl X I~ U592/0138
~ 76 ~
the materlal chromatographed on a Nick c~lumn (Pharmacia,
G-5C Sephadex column9) as per the manufacturer' 5
lnstructions ~sing 10mM Tris (pH 7.5)/0.1mM EDTA/250mM
NaCl. The 32p containing fraction was then precipitated
with 20~g of carrier glycogen and absolute ethanol (2.5
vol) on dry ice for 15 minutes. The DNA was pelleted for
15 minutes at 4~C, washed with 70~ ethanol, and dried
under vacuum.
C~ Amplification of Apt~mer~Obtained After Sele~tion on
` a PFG2a Column
The DNA selected in Example 2-B abo~e was
amplified via PCR using known techniques under the
following conditions: 1 nmole of 5' and 3' primer
(biotinylated), 250 ~M dNTP9 (containing 20 ~Ci each of
dCTP, dGTP and dATP) in 200 ~1 of 10 mM Tris ~pH 8.3)
containing 50 mM KCl and 1.5 mM MgC12. The reaction
vessel was ~ealed with mineral oil, and subjected to 25
cycles of amplification. The mineral oil was then
removed, and 100 ~1 CHC13 was added. The solution was
then vortexed and separated via centrifugation. The
aqueous layer was removed, concentrated via n-butanol
extraction and brought to a final volume of 100 ~1. The
32p labeled DNA was then passed over a Nick column
equilibrated in 100 mM Tris (pH 7.5)/100 mM NaCl to
remove unincorporated primer and dNTP9. The column
eluent wa~ then applied to 400 ~1 of avidin-agarose
matrix (two applications resulted in more than 90~
retention of the input). The matrix was extensively
washed to remo~e contaminants and single-stranded aptamer
eluted with 600 ~1 washes of 0.15N NaOH (2X), yielding
40-48~ recovery of input 3~P DNA. The aptamer solution
was brought to pH 6 with acetic acid and concentrated via
n-butanol extraction to 40% of the initial volum.e. The
material was precipitated with absolute ethanol (3 vols)
:.
.,~ .
~ . . . .
.
: ` ': ~ - , . . :
.
2~0~8
W092/l~3 PCT~U592tO1383
-77-
on dry ice for 15 minutes. The DNA was pelleted, washed
with 70~ ethanol and dried under vacuum. The material
was resuspended in selection bu~fer as described above.
Subsequent rounds of ~election were carried out u~ing the
same protocol: removal of aptamer by binding to the
control support column; followed by binding to the PGF2a
column. Each round of selection resulted in a pool
enriched in the aptamer that specifically bound to the
PGF2~ immobilized on the column. Amplified material was
always obtained from the PGF2~ column by elution in 20 mM
EDTA/60~ acetonitrile.
D. Ouantitation of Aptamer Recovery From PGF2~ Columns
,- After 6 Rounds of Selection
The total radioactivity (32p) a~sociated with
each oligonucleotide pool used for PGF2a selection was
determined prior to addition to underivatized Toyopearl
columns. DNA from underivatized and PGF2a-derivatized
columns was recovered and total radioactivity determined
and expressed as ~ recovery. Data for 32p recovered (in
cpm) after column washes are shown in Table 2 for
selection rounds 1 through 6.
.,
:,~
:,
:;
}
;~
: . ' '
., ~
.'
:. : :
WO92/1~3 ~ 9 8 PCT/US92/013
-78-
Table 2
~ To~al cpm Eluted
EçYn~Ls~ eçtiQn 3CN/EDTA Wash
1 0.37
2 2.31
3 7.98
4 16.97
5* 17.34
6 17
total cpm recovered after 2 column washes with
C~3CH/EDTA.
E. Characterization of Aptamers Eluted From the
Round 6 Column
(a) The recovery of specifically-binding
oligonucleotides in each amplified pool from round 4, 5
and 6 selections remained constant at about 17~ of total
input cpm. Aptamers obtained from the round 6 column
washes prior to addition of CH3CN/EDTA were recovered by
ethanol precipitation, pooled, and subjected to selection
on a new PGF2~ column. The total cpm recovered from
CH3CN/EDTA elution was about 17~.
This demonstrate3 that the aptamers elu~ed by
CH3CN/EDTA in round 6 specifically bind to the PGF2~
: ligand. The 17~ recovery was due only to the limited
. binding capacity of the PGF~ column. This means that 1
to lO~ of linked PGF2~ is available for aptamer binding,
giving a ligand:oligonucleotide loading ratio of about 40
to 400. Higher recovery values for round 4 through 6
selections have been reported but result from a hlgher
: ligand:oligonucleotide ratio of about 10-30,000
~:............... (Ellington and Szostak, Nature (1990) 346:818-822).
.: Thus, the aptamers obtained after 6 rounds of PGF2~
selection (~he "round 6 pool") were a pool of molecules
,"'
... .... . - - : -
- - ,
. .. . . . .
,
- :
:: .:
::. ~ . - -
.
.
210~8
~92/1~3 PCT/US92/01~3
79-
that resulted from competition among aptamer ~pecies for
a limited number of PGF2~ binding sites.
(b) The round 6 pool wa~ further characterized
by adding 1 ml of a 2.4 mg/ml solution (5 ~mole) of PGF2
in selection buffer to an PGF2a column (containing 2
~mole of matrix-bound PGF2~). This result shows ligand-
specific elution of the pool -- a claqsic property of
affinity-selected ligands. See Schott, H., Affinity
Chromatoqraphy, (Marcel Dekker, Inc., New York), 1984.
(c) The round 6 pool was additionally
characterized for PGF2~-binding specificity by monitoring
hydroxypropionic acid ~HP)-mediated elution (HP is
chemically similar to PGF2~). 0.4 ml of selection buffer
containing l.0 mM HP was added to a PGF2~ column
saturated with radiolabelled round 6 pool. The elution
profile showed that less than l~ of applied radiolabeled
aptamer DNA was eluted by HP. This step was followed by
application of 0.4 ml of selection buffer containing l.0
mM PGF2~ using the same column, and resulted in the
elution of over 95~ of radiolabelled aptamer DNA from the
column. This result demonstrated that the round 6 pool
was binding specifically to PGF2~ and did not bind to a
chemically similar molecule such as HP.
(d) To further characterize the round 6 pool,
the pool was incubated with 5 ~mole of PGF2~ in selection
buffer for 30 minutes ~t room temperature and then added
to a PGF2~ column as described above. Less than 2~ of
the total cpm a~sociated with the pool bound to the
column. A PGF2~ column loaded with the round 6 pool in
selection buffer adsorbs 75~ of the input oligo-
nucleotides (here 75~ of the counts bound to the column
because only 0.05 nmole of aptamer was added to the
column).
(e) Analysis of the selection and elution
buffers was carried out by incubating the round 6 pool
. . .
W092/1~3 2 ~ PCTIUS92/Ot
-8~-
wi~h a PGF2~ column by ~uspending the pool in ~election
buffer containing 20 mM ~DTA to remove Mg++ ions by
chelation. Less than 2~ of the total cpm associated with
the pool bound to the column, while a control column
5 loaded with the round 6 pool in selection buffer bound as
described above (75~ of the counts bound to the column
because only O.05 nmole of oligonucleo~ides was added to
the column, resulting in a 10-fold incxease in the
PGF2~:oligonucleotide molar ratio compared to the binding
ratio used to generate ~he PGF2~ aptamer pool). Thi~
indicated that specific binding of oligonucleotides
involve~ structural features that required the presence
of Mg++ ion. The u~e of EDTA in the elution buffer
efficiently removes Mg++ ion from solution and thus
prohibits specific binding of oligonucleotidec to the
PGF2~ matrix.
(f) The following additional characterization
method is proposed: :
The round 6 pool is characterized by
determining the elution profile ob~ained after washing a
PGF2~ column (200 ~1 support volume) saturated with the
round 6 pool. The washes are carried out using 0.4 ml of
selection buffer containing 1.0 mM solutions of a series
of compounds that res~mble PGF2~ more closely than HP
does. In each case, the elution with a molecule similar
to PGF2~ will be followed by elution with 0.4 ml of
selection buffer containing 1.0 mM PGF2~ to determine the
efficiency of PGF2~ elution. The compounds that are
tested include hydroxydecanoic acid, arachidonic acid,
prostaglandin A, prostaglandin B, and other eicosanoids.
Washes using chemically similar molecules are
; utilized for isolation of aptamers that bind to specific
compounds. Elution of a PGF2~ column saturated with the
round 6 pool using 1.0 mM 8-iso-PGF2~ (Cayman Chemical
35 Company, catalog No. 16350, an isomer of PGF2~), followed
.~ ,
, ~
.,,j .
:"
: . : . . , . , ~
, "
., : :, .:
,, - . , ~ .
.~ : .. : .
: - ~
2~0 ~
~vog2/1~3 ` PCT/US92/01~3
-81-
by elution with selection buffer con~aini~g l.0 ~M PGF2~
results in isola~ion of aptamer~ that pref erentially bind
to either PGF2~ or the 8-iso-PGF20~ isomer.
Alternatively, columns made u~ing equimolar amoun~s of
5 PGF2~ and 8- i90- PGF2~ are used to generate a pool of
aptamers containing species that bind to one or the other
isomer or both. Some of these aptamers presumably bind
to regions of the PGF2~ structure that are unaffected by
the isomerization. Chemically modified kicosanoids are
used in a similar manner.
Example 3
Selection of Aptamers From Non-Predetermined Pools
A. Prçparation of PGF2a _inked to a Solid Sup~ort
PGF2~ derivatized Toyopearl~ (Toyo Haas, Inc.,
Woburn, MA) 3upport (charged with lO ~moles PGF2~/mL
matrix) was used for all selections described.
Selections were carried out according to the
manufacturer's instructions. PGF2~ was purchased from
Sigma Chemical Co. (Cat. No. P 3023) and 3H-PGF2a was
purchased from New England Nuclear.
PGF2~ (salt) (lO mg) is dissolved in H2O/
methanol (l ml) and converted to the sodium salt by
passage over an ion exchange column. The eluent is
evaporated, dissolved in dioxane and converted to the
NHS-ester by treatment with N-hydroxy-succinimide (NHS)
and diisopropyl carbodiimide for 24 hrs. This mixture is
then added to a toyopearl AF-amino 650M (Toyo Haas, Inc.)
support (1 ml of settled support) which has been washed
previously with 200 mM NaHCO3). The mixture is shaken
for 24 hours and the support i9 washed with 200 mM NaHC03
solution. To determine the amount of loading the above-
described coupling procedure is repeated except that a
small amount of tritiated PGF2~ is added and the coupling
:.
" ~:
- -- : , . . .
- ' ' ' . ' . ,. .. ~
, ' '~ ':,,
~,
:
W092/1~3 2 i 0 ~ ~ ~ 8 PCT/US92/013~
-82-
yield i~ determined from the amoun~ of 3H-label
associated with the support.
After completed PGF2~ coupling, the support is
capped by treatment with acetic acid NHS-ester in
dioxane/buffer 1:1. (The buffer is 200 mM NaHC03). The
all-capped ~upport is made by treatment of toyopearl
AF-amino 650M with acetic acid NHS-ester in the same
manner as described above.
10 B. Selection of Aptamers of Sub3tantially Non-
Predetermined Sequence That ~ind to PGF2~ Linked
to Solid Support
A pool of aptamers consisting of 60 bases of
completely random sequence i9 synthesized by standard
solid phase techniques using phosphoramidite chemistry
(Gait M.J., Oliqonucleotide ~y~thesis, IRL Press, 1984;
Cocuzza, A., Tetrahedron Lett. (1989) 30:6287-6291).
1.3 x 1036 different aptamer sequences are possible in a
random 60-mer pool. A standard 1 ~M scale synthesis
~ 20 followed by HPLC purification yields 60 nmoles of single
,l stranded DNA. Assuming that each base residue has an
average molecular weight of 350, the synthesis yields
1.26 mg of purified DNA. The aptamers are synthesized
with a phosphate group at the 5' end. The biotin residue
is linked to primer using a commercially available biotin
phosphoramidite conjugate (New England Nuclear, Catalog
No. NEF-707) that i8 incorporated into the strand after
solid phase DNA ~ynthesis using standard synthesis
conditions. The biotin label is incorporated into DNA
according to manufacturer's recommendation~.
PGF2~ derivatized support (charged with
10 ~moles PGF2a/mL resin) is used for all selections
described. 200 ~l (2 ~mole of PGF2~ ligand) support is
' poured into a 1.5 mL column housing. The support is
:' 35 washed with 3 mL of 20 mM Tris-Ac pH 7.4 containing 1 mM
':
:,
,~
. .
: .
. . . . ~ , . :.
. . : : , . -. ~ :-. .
' ~
. . .
``
WO92/1~W3 2 1 0 ~ ~ 9 8 PCT/US92/013~3
-83-
MgC12, 1 mM CaC12, 5 mM KCl and 140 mM NaCl (the
"selection buffer"). Selection buffer mimics the ion and
pH conditions found in the human circulatory system. A
control column containing identical support is prepared
in the same manner. This support is the parent matrix
for attachment of selection ligand but has been capped as
the acetamide to mimic the linkage used for attachment to
PGF2a.
1 nmole of aptamer (doped with tracer amounts
10 of 32P-labeled 3pecies) is resuspended in 400 ~1 of
selection buffer and heat denatured for 2 minutes at
95C. The denatured DNA i9 immediately transferred to
wet ice for 10 minutes. This material i9 applied to the
control support. Flow is initiated and eluent collected.
Flow-through is reapplied up to three times. At the end
of the third application the column is rinsed with
selection buffer. A colum~ profile i9 established using
32p quantitation via Cerenkov counting. Flow through
material (2 to 4 column volumes) is pooled for applica-
tion to the PGF2~ support.
Application to PGF2~ matrix is identical tothat described above. After application to the column,
the matrix is washed with 200 ~L of selection buffer and
the material reapplied to establish a column profile.
The support is washed with additional selection buffer
until the eluting 32p material reaches a con3tant low
level (le~s than about 0.2~ of input DNA per 200 ~L of
flow through). The support then is washed with 1 mh of
selection buffer containing increased NaCl (lM) until
counts per 200 ~L of wash are less than abou~ 0.2~ of
input totals. Desired aptamer i9 eluted with a solution
of 20 mM EDTA/60~ acetonitrile (elution buffer).
Specifically bound aptamers are recovered from the first
~ 2 to 4 column ~olumes that are obtained after adding
- 35 elution buffer. The solvent is removed ln vacuo and the
.,
:~
J,:. . .
. '' ' ,'. '~. ' : ' ' ';
" ~' . ' ~ ~ `'
.
: ' ' ~
. ~ ' , .
WO92~1~W3 2 1 ~ 8 PCT/US92/013&~
-84-
material ls chromatographed on a G50 Sepha~ex Nick column
(Pharmacia, catalog no. 17-0855-02) as per the manufac-
turer's instruction~ using 10 mM Tri.s p~ 7.5/0.1 mM
EDTA/250 mM NaCl. The 32p frac~ion i~ then precipitated
S with 20 ~g of carrier glycogen (Boehringer Mannheim) and
2.5 volume absolute ethanol (dry ice 15 minute~). The
DNA is pelleted at 14R, 15 minutes ~ 4C, washed with 70%
ethanol and dried 'n vacuo.
C. Covalent linkage of ~ rs ~Q~ptamers with
completely random 9e~uenÇ~
Linkers of known sequence that serve a~ primers
for amplification of the aptamer by PCR or other methods
are covalently attached to the DNA in the aptamer pool as
follows. 1.0 pmole of aptamer obtained as described in
Section 1 (about 21 ng of which correspond3 to about 6.0
x 1ol4 molecules) is added to a solution containing
1 nmole of linker 1 which contains 40 nucleotide residues
(about 14 ~g) and 1 nmole of linker 2 (about 14 ~g).
hinker 1, which will be ligated to the 5' end of the
aptamer and consists of a pool of 256 different species,
has the structure shown below. Four random sequence
residues at the 5' end of strand A of linker 1 gives rise
to the 256 different species. Four random sequence
residues at the 3' end of strand C of linker 2 result in
a pool of 256 linker 2 species.
linker 1:
3' HO-ACGCCGCGGTACTTACGC-N-N-N-N-OH 5'
strand A
5' biotin-TGCG&CGCCATGAATGCG-OH 3'
strand B
~'' . . ::,
'
2 ~
~0 92~14843 PC~/VS9~/0138
-85-
Llnker 2 has the following structure.
linker 2:
5~ HO-AGCGGCCGCTCTTCTAGA-N-N-N-N-OH 3
strand C
3~ HO-TCGCCGGCGAGAAGATCT-OPO3 5
s t rand D
The linker 1 sequence: 5~ G~ATGC
3' CTTACG
is the recognition sequence for cutting by the
restriction enzyme ~sm I, which cuts as follows 5x
denotes the cut site in each strand):
5' GAATGCNx
3I CTTACxGN
Positioning of the 9spMI site as shown in linker 1
permits subse~uent precise removal of the at~ached linker
from the aptamer after amplification. The linker 2
sequence:
5~ CTCTTC 3~
3~ GAGAAG 5'
is the recognition sequence for cutting by the
restriction enzyme Ear I, which cuts as follows (x
denotes the cut site in each strand):
5~ CTCTTCNx
3~ GAGAAGNNNNx
Positioning of the Ear I site as shown in linker 2
permits su~sequent precise removal of the attached linker
from the aptamer after amplification.
Nucleotide residues labeled N are random A, T,
G or C residues and serve to anneal with the terminal
four bases at the 5' end, linker 1, and 3' end, linker 2,
of each aptamer. Perfect matches between the ra~dom
linker bases and the terminal four random bases of the
aptamer permit annealing and ligation of the linkers to
the aptamer. The ligation reaction is carried out in a
300 ~1 volume using 1,000 units of T4 DNA ligase (New
.. .
: - : . : -
:. .
. : :
W092/1~3 ~ L~ 6 ~ ~ PCT/US92/01
-~6-
England ~iolabs, Catalog No. 202C~ in standard reaction
buf~er ~50 mM tris-HCl, pH 7.8 AT 20C, 10 mM magnesium
chloride, 20 mM dithiothreitol, 1 mM ATP, 50 ~g/rnl ~ovine
serum albumin~ at 12C for 12 to 18 hours. The molar
ratios of linker to matched aptamer end i~ approximately
1000:1, which drives the ligation reaction toward
ligation of all aptamers in the pool. This ratio arises
from input aptamer, 1 pmole, that has 0.0039 pmole of any
given 4 base sequence at either end. 0.0039 nmole of
either linker with a given 4 base overhang is present
resulting in the 1000:1 ratio. For aptamers ~hat have an
end which participates in aptamer ~tructure and/or
binding, later rounds of ~election and amplification will
be enriched in species that have a nonrandom ~equence at
one or both end~. In this ca~e, the ratio of
specifically matched linker and aptamer will decrease by
as much as 100 fold or more. Subsequent rounds of
selection and amplification may then be carried out using
linkers that reflect predominant aptamer end sequences to
20 restore the ratio to a value near 1:1000. The condi-
tions described generate aptamers with linkers covalently
linked to each end. The ligation reaction generates two
products. The first product is linker 1 ligated to the
5' end of the aptamer with linker 2 ligated to the 3' end
of the aptamer. The second product is linker 2 ligated
to itself to give a dimer. The dimer~ are removed by
adding solid agarose-avidin support (Vector Labs, Inc.
Catalog No. A2010), 2 mg of avidin per ml support with
avidin linked to the support to the ligation reaction.
Biotin attached to linker 1 strand A binds to the avidin
solid support, permitting separation of dimers from apta-
mers with linkers covalently attached. The support is
pelleted and washed three times in buffer (10 mM NaCl, 10
mM Tris-HCl, pH 7.5, 1 mM EDTA) to remove dimers and
unligated linkers synthesized using linker strand C as a
., .
,
. ~ . .
-, . , . ,:
,: ~ - ' '
~09~ M~ 2 ~ 0 ~ ~3~ PCT/US92tO1383
-87-
primer. The column is heated to 95C to melt off the
aptamer complement.
The following method to separate linker dimers
from the aptamer pool alternatively may b~ utilized. For
example, E. coli polymerase I (New England Biolabs,
Catalog Nos. 209L or 210L) is us~d to synthesize aptamer
and strand ~ complement, using strand C as the primer.
The resulting duplex aptamer-linker and complemen~ is
then separated from li~cer dimers using an avidin column
by washing at room temperature. The complement
containlng flanking linker is eluted by heating to 94C
and washing.
Pxotocols for adding linkers to only one end of
an aptamer and amplifying it follow. For example, in a
preferred embodiment, a pool of a very long linkers
(several hundred nucleotides of known double stranded
sequence having one 3' overhang (4 bases long) of random
sequence at the 3' end of aptamer) is generated. This
pool of linkers may be used to drive 3' ligation to the
aptamer pool. Chain extension from the 3' overhang
generates the aptamer complement. Standard blunt end
ligation may then be used to circularize the double
stranded structure. The structure then is cut using a
restriction site in the linker, preferably one with an 8
base recognition sequence (to reduce the percentage of
aptamers cut). Aptamers are then amplified using PCR or
other known methods. In this method, the primers obvi-
ously may be placed anywhere within the large linker
regisn, permitting amplification of only desired lengths
of linker. Obviously, the long linker described above
could be a replicon and directly used to generate an
aptamer clone bank by transforming a desired host. For
related protocols see PCR TechnQlogy Principles and
A~plications for DNA Amplification, Chapter lO, p~ 105-
lll (Henry A. Erlich, ed. 1989) Stockton Press. For
,
-
~ .
w092/l~3 ~ 3 -88- PC~/US92iol38
another variatiQn which may be adapted see Eun H-M, and
Yoon, J-W., Biotechniq~s (1989) 7:992-997. A less
preferred (because yields are low~r) embodiment ~or
attaching a linker to a single stranded aptamer would be
ligation of single stranded linker to ~ingle stranded
aptamer.
D. PCR Amplification of Aptamer~ With Flankinq Pr1mer
S~ nCe~
The selected DNA is amplified via PCR using the
following conditions: 1 nmole of each primer, 250 ~M
dNTPs (containing 20 ~Ci of dCTP, dGTP and dATP-total 60
~Ci) in 200 ~ of 10 mM Tris pH 8.3 containing 50 mM KC1
and 1.5 mM MgC12. The reaction is sealed with mineral
oil. This reaction i5 put through 15 cycles of
amplification. One cycle of PCR amplification i9 carried
out by bringing the temperature to 94C for 1 minute.
This time is extended to 2 minutes for the initial
denaturation step. The denaturation step i9 60C for 1
minute. The hybridization ~tep i9 72C for 1 minute and
then back to 94. After 15 cycles, the temperature is
left at 72C for 2 minutes to completely fill in all
primed single stranded regions. Upon completion, the
; mineral oil is removed by extraction with CHCl3. The
solution i9 then vortexed and separated via
centrifugation. The aqueous layer is removed and
concentrated via n-butanol extraction-final volume
100 ~L. The 32p labeled DNA is then passed over a
Sephadex G50 Nick column (Pharmacia) equilibrated in
100 mM TriR pH 7.5/100 mM NaCl to remove unincorporated
primer and dNTP's. The eluent is then applied to a
400 ~L avidin-agarose matrix (two applications results in
~90% retention of the input). The matrix is extensively
washed to remove contaminants and the single strand
aptamers are eluted with 2 600 ~L washes of 0.15N NaOH.
.:
.:
.
- ~ .
'
:
2 1 0 ~
wos2/l~3 PCT/IJS92/01383
-89-
The aptamer 901ution i9 neutralized with acetic acid to
pH 6 and concentrated via n-butanol extraction to 40~ of
the initial volume. The material i5 precipitated with 1
~1 of a 20 mg/ml glycogen solution tBoehringer Mannheim)
followed by adding 3 volumes of absolute ethanol and
cooling on dry ice for 15 minutes. The DNA is pelleted,
washed with 70~ ethanol and dried i vacuo. The material
is resuspended in selection buffer as described above.
The procedure is repeated with aptamer pools from
subsequent rounds of selection on PGF2~ columns.
E. Removal of Primers From the Am~lified A~tamer Pool
Linker 2 is removed by digestion with Ear I
(New England Biolabs, Catalog No. 528L) under recommended
conditions using excess enzyme to insure complete cutting
by the enzyme. Following Ear I digestion, the column i9
heated to q5C for 3 minutes to denature the apsamer
complement-strand molecule followed by washing in TE
buffer (10 mM Tris-Hcl, pH 7.5, 1 mM EDTA) to remove all
unbound strands.
The aptamer i9 removed from linker 1 strand A,
which is bound to the agarose-avidin support, by
suspending the support in 1 ml of BsmI restriction buffer
(50 mM sodium chloride, 20 mM Tris-HCl, pH 7.4 at 20C,
10 mM magnesium chloride, 10 mM 2-mercaptoethanol,
10 ~gjml bovine serum albumin) and then annealing linker
1 strand A, followed by digestion with 300 units of BsmI
enzyme at 65C for 1 hour. ~mI digestion releases the
aptamer from linker 1 strand B which remains bound to the
support by biotin-avidin binding. The resulting pool of
sequences is referred to as round l aptamers because the
pool has been selected once for aptamers that bind to the
PGF2~ molecule. The aptamer pool i~ then radiolabeled by
incorporation of 32p as described in Example 3-B.
Alternatively, aptamers are labeled using radiolabeled
.
: : - , ., ,. .. - . . ;
W092/1~3 ~ ~ PCT/US92/01~
-90 -
nucleotide triphosphates during PCR amplification. The
DNA i~ precipitated with ethanol as de~cribed in
Example 3-D.
F. Chemica~ Linkage. of Linker~_to Aptamçrs with
completely ~andom seg~ences
Linkers are covalPntly coupled to the 5' end of
aptamers obtained from column selection as described in
Examples 3-A and 3-B. Aptamer DNA i9 synthesized with a
free amine group at the 5' end. Amine pho~phorami.dite
monomers are used to generate the 5' terminal amine-
nucleoside residue (using equal amounts of A, T, G and C
monomer at the final coupling step).
After selection and elution of DNA, the aptamer
DNP. is coupled to primer ~equences as follow~. Linker is
coupled to the 3' end using linker 2 described in
Example 3-C. Linker (carrying biotin at the 5~ end) is
- attached to the aptamer free 5' amine group by chemical
coupling between primer oligomer DNA with a free 3'
phosphate group. The reaction is carried out for 4 hours
at room temperature in 0.1 M methylimidazole, pH 7.0 and
O.1 M 1-(3-dimethylaminopropyl)-3-ethylcarbodiimide
hydrochloride. The latter reagent acts a~ a water
soluble condensing agent. The resulting aptamer con-
tains the linkage, 5' X-O-P-02-NH-CH2-Z 3', at the
aptamer-linker junction; X iQ the 3' terminal re~idue of
the linker and Z is the S' terminal aptamer residue.
; Once linkers are attached at both ends of the aptamer, as
described in the Example~ above, PCR amplification is
carried out and the DNA is attached to an avidin column.
Free aptamer carrying a amino group at the 5' end is
obtained by (i~ digest~on in excess Ear I enzyme, (ii)
heat denaturing at 94C, (iii) washing the column with
TE, (iv) relea~e of free aptamer after incubation Gf the
column in 80% acetic acid for 4 hours at room
'
.~:
... .
: . - - '
. . , ~ ..
.:
.
2 1 0 _L ~S ~ ~
WOg~ 3 PCT/US92/01383
-91 -
temperature. The aptamers are then recovered by
neutralizlng with base and ethanol precipitatlon.
G. Link~rs CQnt~i~inq a RN~Re~idue ~ he ~_Aptamer-
Primer Junc~iQn
DNA oligomers containing even a single RNA
nucleotid~ residue are sensitive to RNAses such as RNAse
Tl or Ul. Tl and Ul enzymes cleave specifically at
guanine residues to yield two oligomers. One oligomer
contains the RNA residue at the 3' end the pho~phate
group linked at the 3' position and the other oligomer
contains a hydroxyl group at the 5' end. Cleavage of
such an oligomer at the RNA residue is also possible by
incubation of the oligomer in 0.l M NaOH for 30 minutes
lS and yields essentially the same products as the Tl or U
enzymes. RNA e ~ensitivity of DNA-RNA oligomers may be
applied to selection and amplification of aptamers.
Incorporation of an RNA residue (G*) at the 3' terminal
position of linker l strand B (5' biotin-
TGCGGCGCCATGAATGCG*-OH 3') will generate aptamer with a
ribo-guanosine residue a~ the 5' end of the aptamer
(i.e., at the primer 3' to 5' aptamer junction) when this
oligomer i9 used to prime synthesis of aptamer using the
complementary strand template. DNA polymerases have the
capacity to initiate DNA Rynthesis from a free 3'
hydroxyl group on either DNA or RNA oligomers. RNA-
containing oligomer i~ synthesized using support bound
protected G* monomer (Milligen/Biosearch, Catalog No. GEN
067570) that is used directly in a l ~mole scale DNA
~ynthesis using phosphoramidite chemistry according to
manufacturer's instructions.
Aptamer strands have the following struccure.
G* denotes the position of the guanine RN~ residue.
5' biotin-TGCG&CGCCATGAATGCG~N60TCTAGAAGAGCGGCCGCT-OH 3'
'
:. , '
W092t1~3 ~ f~ 8 PCT~US92~013
-92-
Aptamer selection for PGF2~ target would be
carried out as described in Examples 3-A through 3-D.
DNA primers (strands B and C as described in Example 3-C)
are attached to aptamer ~NA eluted from the column and
amplification using s~rand ~ of linker l with a ribosyl G
residue at the 3' end i9 used as primer for synthesis of
the aptamer strand containing an RN~ residue in
amplification. Removal of the linkers and recovery of
aptamer would be accomplished by the following series of
steps. The RNA containing strand ha~ 5' biotin attached.
1. Ear I digestion to remove primer sequences
ae the 3' end of the aptamer,
2. heating to 94C for 2-3 minutes to
denature the complementary strand,
3. washing the column to remove species
released in steps l and 2,
4. aptamer release from the avidin column by
Tl RNAse digestion, and
5. recovery of aptamer from the column by
washing and ethanol precipitation.
The aptamer thus obtained i9 then used in a
subsequent round of selection on a PGF2~ column. After
recovery of aptamer from the column, DNA obtained in
elution buffer washes is precipitated, and resuspended in
buffer for kinase reaction and then ligated to flanking
primer seguences as described. The kinase reaction prior
to ligation of linkers i~ necessary to replace the 5'
terminal phosphate group that is lost from the aptamer
when Tl digestion (or NaOH treatment) is carried out.
.~.....
.
-:
.:
;. ~ - ~ ,
2 1 ~ 8
~0~2/1~3 PCTtUS92/01~3
-93-
H. Selection of ~ptamer~ Wi~h a 3' End That Doe~ Not
Participat~ in Tarqe~ Molecule ~3inding or in Main~aininq
Ap~mer Stru~$E~
Aptamers are ob~ained as described in the
Examples above, except that a~ter two rounds o~ seleGtion
and amplification using aptamer~ without flanking primer
seguences, alternate rounds of selection and
amplification are carried out with linker left on the 3'
end during a subsequent round of selection. The popula-
tion of aptamers thus obtained bind to the PGF2~ targetregardless of the presence of linker at the 3' end. This
population is a subset of all aptamers that bind to
PGF2~.
I. Selection of A~tamers With Several Bases of Known
ase Seguence at Qne or Both Ends
Aptamer DNA is synthesized as described in
~xample 3-B except that the 5' terminal four bases have a
known sequence to generate a pool of aptamers with the
following sequence 5~ P03-AATTCN55 3'. A linker similar
to linker l with the following structure is ligated to
the 5~ end of the aptamer,
' 3~ HO^X17CTTAAG-OH 5
5~ biotin^X17G^OH 3~
and linker 2 of Example 3^C i9 ligated to the 3~ end of
the aptamer pool after elution from target molecules.
Ligation of this linker to the aptamer creates a EcoRI
site and cuttiny of the aptamer with EcoRI releases
aptamer without addition or deletion of any residues.
The use of restriction enzymes such as EcoRI are
preferred in the 5~ linker because cutting occurs on
short double stranded regions that carry the recognition
: site (such as the double stranded region that occurs when
aptamer is removed from the avidin column by restriction
enzyme cutting after removal of the 3' linker and
:`:
.'
.
,
.
.. . ; ,,
wos2i1~3 '~ i~t' J ~ PCT/US92/01
-94-
complementary 9trand). Other restriction ~ites such as
that for Hind III, or Xba I which leave a ~our base 5'
overhang may be created and used at the 5~ end to leave 5
bases of known sequence. Creation of a site for enzymes
that leave either 2 (Cla I) or 0 (P~u II) base 5'
overhangs, respectively, will generate aptamers with 4 or
3 bases of known sequence at the 5' end of the aptamer.
Sites created and used in this manner at the 3' end
- require the use of enzymes that leave a 0 (Sma I), 2 (Pvu
I) or 4 (Apa I) base 3' overhang after cutting to
generate aptamers with 3, 4 or 5 bases re~pectively at
the 3' end with known ~equence. If ~oth ends of the
aptamers have known ~equences that constitute part of a
restriction enzyme site, then the 3ites at the ends mu~t
differ from each other 80 that the linkerq can be removed
separately after amplification.
J. Selection of Aptamers Startinq From a Pool of
Aptamers That Vary in Lenqth
Eleven pools of aptamers of random sequence are
synthesized which vary in length from 50 to 60 bases for
each pool. Equal molar amount~ of each pool is mixed and
the variable length'pool i9 then used to select for
apt~mers that bind to PGF2~ as described in Examples 3-B
through 3-E or 3-I above.
Example 4
Preparation o~ Aptamers Spe ific for
Cell Surface Prp~çins
A. CD4
The human lung fibrobla~t-like cell line, CCD-
18LU (American Type Culture Collection No. CCL205), is
transfected with the human CD4 gene cloned into an
expression vector. Cells stably expressing human CD4
-
.
,
. . .
21~4~ J8
Wo92J1~3 PCT/US92/01~3
g5
protein are obtained by ~tandard methodis for transfectingcells and obtaining clones (see MQlecular Clo~inq; A
~a~oratory Manual, Cold Springs Harbor, 1989). In this
case, the bacterial neomycin phosphotranisferaise is
coexpressed from the CD4 vector, permitting selection for
cells carrying the vector in the antibiotic G4l8 (Gibco).
The resulting cell line expressing CD4 i9 called CD4+. A
pool of aptamers consisting of 60 bases of random
sequences flanked by 18 base primer sequences i9 obtained
by standard solid phase synthesis techniques
("Oligonucleotide Synthesis - A Practical Approach", ed.
M.J. Gait, IRL Press l984). Next, O.l to l nmoles of
aptamer are added to 6 ml of ti~isue culture medium
[minimum E~sential medium (Eagle)] without fetal bovine
serum.o Two confluent lO cm tissue culture plates of CCD-
18LU cel~is are washed twice in 5 ml medium lacking serum
followed by addition of 3 ml of medium containing the
aptamer pool. The plates are left at 37C for 30
minutes. Medium from the two CCD-18LU plates is then
recovered and pooled.
The recovered aptamer in medium is added to
2 confluent plates of CD4~ cells previously washed twice
in 5 ml per wash of medium lacking serum. The plates are
left at 37C for 30 min. After incubation, the plates
are washed two times in medium and one time in saline
using 5 ml per wa~h. The CD4+ cells are then treated
with trypsin (l.5 ml trypsin O.Ol~ solution in lO mM
EDTA~ for 30 minutes at 37C. The medium containing
cells i9 briefly 9pun to pellet out the cells. The
aptamers are recovered by ethanol precipitation and
amplified. The procedure i9 repeated 3 to 6 times to
enrich for aptamers that specifically bind to the CD4
cell surface protein. Binding to CD4 is monitored by
measuring the amount of radiolabeled aptamer that is
retained after binding to CD4+ cells. Radiolabeled
'. ',
.:
;.'
~- ; , ...
.
: .. ~. :
~ : .
: .: , ' . ,
WO92/1~W3 ~ 6 ~ 96- PCT/US92/Ol~
aptamers are obtained by a standard kinase reaction using
~-32P-ATP ~o label the 5' end of aptamer after
amplification. Alternatively, radiolabeled nucleoside
triphosphates can be obtained by using PCR amplification
to label the aptamer pool. The binding as~ay (positive
selection) u es 0.1 nmole of labeled aptamer
(approximately 3.4 ~g) binding to one confluent plate of
CD4+ cells for 30 min at 37C, followed by two washes in
medium and one saline wash. The retained radioactivity 1,
is determined by scintillation counting of cells :lysed in
1 ml of 1% sodium dodecyl sulfate, 10 mM Txis pH 7.2, 10
mM EDTA. 0.05 ml of lysate is counted in a scintillation
counter using standard methods and reagents (Aquasolve,
New England Nucl~ar~. Selection and amplification is
continued until at least three round~ have been
completed. After the third round and subsequent
amplification rounds, 30-50 individual aptamers from the
amplified pool are cloned and sequenced using a
convenient vector such as p~luescript (Promega Biotech)
and double-stranded dideoxy sequencing. Alternatively,
pools of 10-20 individual clone sequences may be
sequenced. When DNA sequencing reveals regions of
conserved sequences, individual clones are synthesized
and examined for their binding characteristics. The
aptamers may be tested for their capacity to block the
binding of HIV to T-cell lines ~uch as SupTI or HUT-78
(Evans, L.A., et al., J. Immunol. (1987) 138:3415-3418)
that are susceptible to infection.
Individual aptamer isolates or small pools
consisting of 10 to 50 individual aptamer species that
reduce HIV infectivity are used to identify optimal
species for blocking HIV infectivity by interfering with
the binding interaction between gp120 and CD4.
Disruption of this interaction has been previously shown
to reduce HIV infectivity (Clapham et al., Nature (1989)
:
- ::
.. '': :
.
. ~ ,, :
:
.:
2~ t~8
W092/1~3 PC~/US92/01383
-37-
337:36a-37o)~ After identification of optimal CD4
aptamer species, further modification~ such as inclusion
of covalent cros~linking base analogs ~such as
aziridinylcytosine) or other substituents to enhance the
efficacy of the aptamer are then te3ted in order to
further improve the aptamer for therapeutic or diagnostic
useR. Lead aptamer 3pecie~ identified on the basis of
blocking HIV infectivity are also then modified by
inclusion of terminal internucleotide linkage
modifications that rPnder the oligonucleotlde
substantially nuclease resistant. Methods to stabilize
oligonucleotides are disclosed in publication number
WO9 0 / 1 5 0 6 5, incorporated herein by reference.
15 B. HER2
HeLa cells stably transfected and expressin~
the gene for the HER2 oncogene referred to herein as the
HER2 cell line are grown to confluency and washed two
times with phosphate-buffered saline. Single-stranded
oligonucleotide i3 generated by the random incorporation
of 60 nucleotides between two primer binding sites using
standard solid-phase synthesis techniques essentially as
described in "Oligonucleotide Synthesis--a Practical
Approach" (IRL Press 1984, ed. M.J. Gait). Approximately
25 5 x lo6 to l x 107 cells are then incubated with 2 to 5
ml of tissue culture medium containing O.l to 1 nmoles of
oligonucleotide at 37C at a pH in the range of 7.0 to
7.4 containing between l-5mM of divalent cations, such as
magnesium or calcium. After 1-2 hours of incubation,
oligonucleotides which have binding specificity for any
cell surface proteins, and structure including the target
HER2 glycoproteins, are then released from the cell by
cleavage with trypsin (or other protease which is capable
- of cleaving, and thereby dissociating from cells, the
protein target of interest) in buffered saline. (Evans
.' .
.
.
,
. . . : . . . :
WO92tl~W3 2 i ~ ~ 5 ~ 8 -9B- PC~/US92/013~
et al., ~ mm~Q~ (1987) 138:3415-3418; Hoxie e~ al.,
Sci~nc~ (1986) 234:1123-1127).
Aptamers and cell proteins released by protease
cleavage are then digested for an additional 30 mlnutes
at 37C with protease to extensively degrade all cellular
proteins. Thi~ process may be aided by a brief heat step
(80C for 3 minutes~ followed by readdition of fresh
protease such a pronase (Sigma Chemical Company, catalog
no. P4914). Alternatively, a protease from the thermo-
philic bacterium (Sigma Chemical Company, catalog no.P1512) may be used to aid recovery of aptamers from cell
proteins. After digesting with enzymes, the aptamers
recovered from binding to HER2 cells are recovered by
precipitation with ethanol using glycogen as a carrier.
The aptamers are then resuspended in medium (3 ml) and
incubated with 5 x 106 HeLa cells for about 60 minutes.
Cellular supernatants are recovered, and the oligonu-
cleotides precipitated from the serum-free culture medium
after adding 200 to 8~0 ~g glycogen (Boehringer Mannheim)
followed by the addition of two volumes of ethanol.
The thus-recovered oligonucleotides, which form
a reduced pool with cell surface protein binding
specificity, are amplified using PCR techniques. The
cycle is repeated 4-7 times followed by cloning of
individual aptamer species. The sequences of individual
clones are determined by standard methods. Individual
aptamers are then synthesized and tested for binding by
the method described in Example 4-C.
C. IL-l
The human HeLa cell line is transfected with
two different genes to generate two lines that express
the inserted gene. The first gene is the human IL-1
receptor (Sims et al., Proc. Natl. Acad. Sci. (1989)
86:8946-8950), giving rise to the IL-lR cell line and the
.:
~ ' . '' '
.
:
~092/1~3 2 1 0 ~ PCT/US92/01383
99
second gene is the Il,-l receptor that has been
genetically engineered by standard technique9 to expre~s
I~- lR that has been mutated in the extracellular domain,
giving rise to the IL-lRm cell line. Transfected clones
S expressing each receptor are identified by immuno-
precipitation using polyclonal antibodies against the
Ih-lR protein.
~ ptamers that specifically bind to the IL-lRm
molecule at the cell surface are obtain~d by selection
using the IL-lRm cell line. The procedure starts with a
pool of aptamers containing 60 random bases flanked by 18
base primer sequences as described above. Two confluent
plates containing about 8,000,000 IL-lR cells are
incubated with a total of O.l nmole of aptamer in a total
of 4 ml of tis~ue culture medium lacking serum. O.l
nmole of aptamer pool i~ e~timated to contain
approximately 6 x lOl3 different aptamer species, having
a mass of approximately 3.4 ~g. The estimates of
molecule number~ is based on the estimated molecular
weight of 33,600 for a 96-mer. Each base residue in the
aptamer has an average molecular weight near 350 da.
The aptamer pool size may be reduced by as much as lO-
; fold if the initial DNA synthesis does not provide fully
~; random sequences due to uncharacterized biases in the
synthesi~ and purification steps.
The cells are washed three times in medium
lacking serum prior to adding the aptamer pool. The IL-
lR cells are incubated for 30 minutes at 37C followed by
recovery of the medium containing aptamer~ from the
cells. The aptamers in solution are then added tO washed
IL-lRm cells and incubated for 30 minutes at 37C,
followed by three washes in medium lacking serum followed
by three washes in buffered saline. The cells are then
trypsinized for 30 minutes at 37C and intact cells are
pelleted by a brief spin. Aptamers are recovered from
: ,., . . , . , : -;
- ~ .
. . . . .
.. , .,. : , : -
W0~2/l~3 2 ~ 8 loo - PCT/US92/01~
the supernatant after enzyme digestion or heating by
precipitation and amplified by standard PCR methods. The
process is repeated using 0.1 nmole of amplified aptamer
pools at the start of each round of selection.
Enrichment for aptamers that specifically bind
to the IL-lRm protein is monitored by measuring the
binding of selected aptamer pools to IL-lRm cells by the
following method. Aptamers obtained after 6 rounds of
selection and amplification are modified according to
methods disclosed herein. Biotin is covalently attached
at the 5' end via linkage to N-ethyl-diethanolami~e
linked to the 5' nucleotide of each aptamer in the
amplified pool. Alternatively, aptamers labeled for
chemilumineqcent detection may be synthesized and used
for 1n situ detection of bound aptamers (~ronstein et
al., Clin. Chem. (1989) 35:1856; ~ronstein et al., Anal.
Biochem. (1989) 180:95). Aptamers attached to target IL-
lRm molecules on IL-lRm cells are then assayed by
standard protocols using avidin and biotinylated enzymes
~uch as alkaline or acid phosphatases. Methods for
detection of nucleic acids by enzymatic methods are
generally described in numerou~ publications (Urdea et
al., Nucleic A~lds Re~. (1988) 16:4937-4956; Gillam,
Tibtech (1987) 5:332-334). Pools containing a
; 25 significant proportion of aptamers that ~pecifically bind
to the IL-lRm target are detected by incubating a washed,
confluent IL-lRm tissue culture plate containing about 5
x 10 6 cell~ with 0.01 nmole of labeled aptamer from the
selected pool mixed with 0.1 nmole of unlabeled aptamer
from the initial random pool for 30 minutes at 23C.
After incubation, the plate i~ washed three times in
buffered saline and bound labeled IL-lRm aptamer is
detected enzymatically. The presence of nitroblue
tetrazolium dye (Gillam, Tibtech (1987) 5:332-334)
indicates the presence of bound aptamer. Specific
'
.~ - . .
. .
W~92/1~3 ~ PCT/~JS92/~1~3
-101-
binding of ~elected aptamer iY verified by coincubation
of 0.01 nmole of labeled selected aptamer with 0.1 nmole
of unlabeled selected aptamer for 30 minutes a~ 37C.
The unlabeled aptamer will compete with labeled aptamer
and will reduce the enzyme generat~d dye production by
about 70 to 95~. A control plate of IL-lR cells
incubated with labeled selected aptamer alone and in
mixture with the initial pool of unselected aptamer is
included to demonstrate that binding i8 specific for the
IL-lRm molecule. Little or no binding of ~elected
aptamer is observed on control IL-lR cells.
After a pool of aptamers that efficiently binds
to the IL-lRm molecule is identified, individual clones
are obtained and se~uenced by 9tandard protocols (Chen et
al., DNA (19a5) 4:165-170). Individual aptamers are then
synthesized and tested for their capacity to bind to the
IL-lRm molecule.
Aptamer~ that bind Ih-lRm efficiently but that
do not bind to IL-lR are binding to structures in IL-lRm
; 20 ~hat are present due to ~he mutation engineered into the
jparent IL-lR molecule. This type of selection procedure
can be adapted to naturally occurring mutations, such as
translocations that are correlated with pathological
conditions. Protein structures uniquely associated with
a mutation may be u~ed to generate aptamers that
specifically bind to tho~e structures. Such aptamers
would be useful for both diagnostic and therapeutic
application8.
D. Serum-Enhanced I~-1 Selection
Aptamers which bind to IL-lR can be obtained by
following a protocol as described in Example 15 above
except that HeLa is used as the control cell line and the
target is the T~_ lR molecule on the I~-lR cell line.
'
.~ .
.: ~ . , .
-: ~ . ' ~ . . - . :
. .
.
W092/l~3 2 ~ PCT/US92/01~U
-102-
Nonradioactive methods can be used to detect bound
aptamers.
In a variation of thi~ protocol, aptamer
recovered from the HeLa control cells i9 incubated with
IL-lR cells in serum-free medium for 15 minutes at 37C,
then prewarmed calf serum i9 added to give a final
concentration of 10~ and incubate an additional
15 minutes. The serum contains enzymes that degrade
aptamers that are not tightly bound to target molecules.
The serum will enhance selection for aptamers that are
not nuclease sensitive due to their tight as~ociation
with IL-~R. After incubation, the cells are washed twice
in medium without serum and once in saline, and aptamers
are reco~ered and amplified.
Example S
Sele~tiQn of Apt~mers that Bind to Factor X
A. Synthesis of Oligonucle~ide Pool
DNA oligonucleotides containing a randomized
sequence region were synthesized using standard solid
phase techniques and phosphoramidite chemistry
~ (Oli~onucle~id~ Synthesis, Gait, M.J., ed. (IRL Press),
; 1984; Cocuzza, A., Te~rahedron Let~ç~s, (1989) 30:6287-
6291). A 1 ~M small-scale synthesis yielded 60 nmole of
HPLC-purified ~ingle-stranded randomized DNA. Each
strand consisted of specific l9-mer sequences at both the
5' and 3' ends of the str~nd and a random 30-mer sequence
in the center of the oligomer to generate a pool of
68-mers with the following sequence (N = G, A, T or C):
S' TCTCCGGATCCAAGCTTATN30CGAATTCCTCGAGTCTAGA 3'
DNA 19-mers with the following sequences were used as
3' primers for PC~ amplification of oligonucleotide
,.
~ : .
.
!
''`` ~ , ,
WO~2/1~3 21 O ~ ~ ~ 8 PCT/US92/01383
-103-
~equenc~s recovered from selection columns. The 5~
primer sequence was 5' TCTCCGGATCCAAGCTTAT 3' and the 3'
primer sequence was 5' biotin-O-TCTAGACTCGAGÇAATTCG 3'.
The biotin residue was linked to the 5' end of the 3'
primer using commercially aYailable biotin
phosphoramidite (New England Nuclear, Cat. No. NEF-707).
The biotin phosphoramidite is incorporated into the
strand during solid phase DNA synthesis using standard
synthesis conditions.
B. Isolation of Factor X Aptamers Using Factor X
Immobilized on a Lectin Column
A pool of aptamer DNA 68 bases in length was
synthesized as described in Example 5-A, and then PCR-
amplified to construct the initial pool. An aliquot o~the enzymatically-synthesized DNA was further amplified
in the presence of ~-32P-dNTPs to generate labeled
aptamer to permit quantitation from column fractions.
A Factor X column was prepared by washing 1 mL
(58 nmole) agarose-bound concanavalin A ("Con-A") (Vector
Laboratories, cat. no. AL-1003) with 20 mM Tris-acetate
buffer (pH 7.4) containing 1 mM MgC12, 1 mM CaC12, 5 mM
KCl and 140 mM NaCl (the "selection buffern) (4 x 10 me).
1 m~ of settled support was then incubated overnight at
4C in 10 mL selection buffer containing 368 ~g (6.24
nmole) Factor X (Haematologic Technologies Inc, Cat No.
HCXA-0060). After shaking o~ernight ~o permit Fac~or X
binding to the Con-A beads, the mixture was briefly
centrifuged and the supernatant remo~ed. The beads were
resuspended in fresh selection buffer and transferred to
a column which was then washed with selection buffer (5 x
1 mL). A column containing 1 mL of settled beads had a
void volume of approximately 300 ~L. A control Con-A
column was prepared by adding 1 mL of settled support to
~ `
:' ` ,.
;;
~ - . - . ; .
.
: :.
W092/l~W3 PCT/U~92/013~
2 i Q ~ ~ ~ 8 - 104-
a column followed by 5 washes of 1 mL of selection
buffer.
Prior to application of ~he aptamer DNA pool to
Con-A columns, the DNA was heated in selection buffer at
95C for 3 minutes and then oooled to room temperature
for 10 minutes. The pool, consistiny of 100 pmole DNA in
O.5 mL selection buffer, was then pre-run on the control
Con-A column at room temperature to remove species that
bound to the control support. Three additional 0.5 mL
aliquots o~ selection buffer were added and column
fractions 2, 3 and 4 (0.5 mh each) were pooled and then
reapplied to the column twice. The DNA in 1.5 mL
selection buffer was then recovered. Approximately 16
of total input cpm were retained on the column.
The recovered DNA was then applied to a Con-A-
Factor X column as a 0.5 mL aliquot followed by a 1.0 mL
aliquot. Flow-through was retained and reapplied to the
column twlce. DNA added to the column on the final
application was left on the column for 1 hour at room
temperature. The column was then eluted with 0.5 mL
aliquots of selection buffer. 0.5 mL fractions were
collected and radioacti~ity was determined in each
fraction. Radioactivity in eluted fractions 7 through 12
were low and relatively constant. After recovery of
fraction 12, the column was washed with 0.5 mL aliquots
of 0.1 M ~-methyl-mannoside (Sigma Cat. no. M-6882) in
selection buffer to elute the bound Factor X along with
Factor X-bound aptamers. Fractions 14 and 15 showed a
significant peak of Factor X protein level, as determined
spectrophotometrically by Bradford protein stain (Pio-
Rad, Cat No. 500-0006). 0.085~ of the input DNA eluted
in these two fractions.
Aptamer DNA (Round 1 DNA) was recovered from
the Factor X by phenol extraction (2 x 0.5 mL). The
aqueous phase volume was reduced to about 250 ~L by n-
.
.
210~
W09~ W3 PCT/US92/01383
-105-
~utanol extraction. Apt~mer DNA was precipitated on dry
ice using 3 volumes of ethanol and 20 ~g of glycogen as a
carrier. The DNA was pelleted, wa~hed once in 70
ethanol and then dried.
C. Am~lification o~ Factor X Selected Aptamer9
Round 1 DNA from Example 5-~ was resuapended in
100 ~L of H20 and amplified by PCR. A 200 ~L PCR
reaction con~is~ed of the following: 100 ~L template 96-
mer DNA ~approximately 0.01 pmoles); 20 ~L 10X buffer
(100 mM Tris Cl (pH 8.3), 500 mM KCl, 20 mM MgCl2); 32 ~L
dNTP's ~5 mM conc total, 1.25 mM each dATP, dCTP, dGTP,
and dTTP); 20 ~L primer 1 (biotinylated 18-mer, 50 ~M);
20 ~L primer 2 ~18-mer, 50 ~M); 6 ~L ~-32P-dNTP's
(approximately 60 ~Ci); and 4 ~L Taq I Polymerase (20
units). The reaction was covered with 2 drops NUJOL
mineral oil. A control reaction was also performed
- without template aptamer.
Initial denaturation was at 94C for 3 minutes,
but subsequent denaturation after each elongation
; reaction lasted 1 minute. Primer annealing occurred at
56C for 1 minute, and elongation of primed DNA strands
using the Taq polymerase ran at 72C for 2 minutes, with
5-second extenaions added at each additional cycle. The
final elongation reaction to completely fill in all
strands ran for 10 minutes at 72C, and the reaction was
then held at 4C.
18 rounds of Taq polymerase elonyation were
carried out in order to amplify the selected aptamer DNA.
3.0 After the reactions were completed, the aqueous layer was
retrieved and any residual NUJOL oil was removed by n-
butanol extraction, reducing the volume to 100 ~L. A
: sample may be removed from each of the ap~amer and
control reaction for quantitation and analytical PAGE.
The amplified aptamer pool ~100 ~L) was fractionated over
.
. .
" ~,
,: '
.
., . . ,. : - ,
:: . ~ . :
:- . - .
.: . - ,
: - . - ,
:. : ,
:,
':
W0~2/1~W3 h~ 3 8 PCT/~S92/013
-106-
a Nick column (&-50 Sephadex, equilibrated with 3 mL TE
buffer (10 mM Tris HCl (pH 7.6~, 0.1 mM EDTA)) to remove
unincorporated NTP'~, primers, and ~alt. 400 ~L of TE
buffer was then added to the column and the DNA pool was
eluted from the column with an additional 400 ~L using TE
buffer. (A sample may be removed from the eluent for
quantitation and analytical PAGE.) The eluent (400 ~L)
was loaded on an avidin agarose column (Vector
Laborator-ies, Cat. No. A-2010) (500 ~L settled support,
washed with 3 x 1 mL TristNaCl buffer (0.1 ~ Tris, 0.1 M
NaCl, pH 7.5)). Approximately 90~ of the loaded
radioactivity remained on the column. The column was
washed with Tris/NaCl buffer (4 x 400 ~L) and then the
nonbiotinylated strand was eluted with 0.15 N NaOH (3 x
300 ~L fractions),. More than 45~ of the radioactivity on
the column eluted in these three fractions. These
fractions (900 ~L) were combined and neutralized with
approximately 5.5 ~L of glacial acetic acid. The
neutralized fractions were reduced to 250 ~L by speed
vacuum or butanol extraction and the nucleic acids were
~ precipitated with EtOH. The resultant pellet was
-~ dissolved in 102 ~L selection buffer. A 2 ~L sample was
removed for quantitation and analytical PAGE. The
resulting amplified Round 1 Pool was applied to a new
Con-A-Factor X column as in Example 5-B to obtain Round 2
aptamers.
D. Character~zation of Round 1 T_rouy~_Round 11 Factor X
Aptamers Obtained frQ~_~election on Lectin Coll~ns
Eleven rounds of Factor X aptamer selection and
amplification were carried out using Con-A-Factor X
columns as in Examples 5-B and 5-C. A8 shown in Table 3,
the ~-methyl-mannoside eluate in fractions 14 and 15
contained a maximum of about 18~ of input DNA at
selection round 11 using the described conditions.
. . .
. ~ "
W092/1~W3 2 1 ~ ~ 6 9 ~ PCT/US92tO1383
-107-
Table 3
~ DNA eluted by * ~ DNA bound to
; 5 Round ~-methyl-mannoqidecontrol support
.. _ _ _ . . . .. .. . _
0.0~5 14.0
2 1.400 37.0
3 14.000** 27.0
4 1.800 21~0
1.100 18 . o
6 1.500 10.5
7 .620 4.8
: a l . loo lo . 6
9 1.500 12.1
5.700 2.8
11 17. sno 19 . o
, .................................. _
O.1 M ~-methyl-mannoside in ~election buffer was
; added beginning at fraction 13 in each elution, and
. 20 ~ractions 14 and 15 were retained and the DNA amplified.
Fraction 16 was also included in rounds 7-11. Due to
slow leeching o~ Factor X from the column, DNA bound to
~;I Factor X could al~o be Reen in earlier ~ractions in
., rounds 10 and 11.
~ A h~gh proportlon o DNA waq bound ln round 3 due to
a low inpu~ ratio of DNA to Factor X.
After amplification, approximately 5 pi~omoles
of radiolabeled round 11 aptamer DNA was analyzed for
specificity in a filter binding assay. In this assay,
nitrocellulo3e ~ilters ~1 cm diameter~ pre -soaked in
`, selection bu~er overnight at 4C and DNA in 100 ~L o~
selection bu~er was incubated at room temperature ror 10
minutes with: (1) An unselected 68-mer oligonucleotide
,
., '~ .
:
, ., -
. ~.
'' ~
.. :' - ;, ., . ., , :.: . : , .
.. : , . . . . .
:,: .:
WO92/1~3 PCT/US92/013
~ $ -108-
DNA pool, (2) unselected DNA with Factor x (1 ~M!, (3)
Round 11 aptamer DNA and Factor X (1 ~M), and (4) Round
11 aptamer DNA alone. The filters were then washed 3
times with 3.0 mL of selection buffer at 37 and
radioactivity was counted to determine ~he amount of DNA
that was retained as a Factor X complex. The results are
shown in Table 4.
Table 4
DNA ~ DNA Bound to Filter
Unselected 68-mer1.2
Unselected 68-mer + Factor X 1.3
IRound 11 aptamer + Factor X 24.6
Round 11 aptamero.9
Unselected DNA did not show significant binding
to the Factor X while selected aptamer DNA bound to
Factor X. Binding results show specific Factor X
binding. Based on the filter binding results in Table
10, a KD of approximately 2 ~M can be estimated for the
round 11 pool.
Example 6
Selection of Aptamers that Bind to Thrombin
~'. I
A. Synthesis of Oligonucleotide Pool
DNA oligonucleotides containing a randomized
sequence region were synthesized using standard solid
phaqe techni~ues and phosphoramidite chemistry
(Oligonucleotide Synthesis, Gait, M.J., ed. (IRL Press~,
1984; Cocuzza, A., Tetrahedron Letters, (1989) 30:6287-
6291). A 1 ~M small-scale synthesis yielded 60 nmole of
.,, ~
,': ~. ;
:` ' ' '
: . ~ : - : -
:: - ~:
W092~14B43 2 ~ O ~ PCr/UC92/~1383
- 109 -
HPLC-purified single-~tranded randomized DNA. Each
strand consisted of specific 18-mer sequences at both the
5~ and 3' ends of the strand and a random 60-mer ~equence
in the center of the oligomer to generate a pool of
96-mers with the following sequence (N = G, A, T or C):
5' HO-CGTACGGTCGACGCTAGCN60CACGTGGAGCTCGGATCC-OH 3~
DNA 1~-mer~ with the following ~equences were used as
primers for PCR amplification of oligonucleotide
sequences recovered from selection columns. The S'
primer sequence was 5' HO-CGTACGGTCGACGCTAGC-OH 3' and
the 3' primer ~equence was 5' biotin-O-
GGATCCGAGCTCCACGTG-OH 3'. The biotin residue was linked
to the 5' end of the 3' primer using commercially
available biotin phosphoramidite (New England Nuclear,
Cat. No. NEF-707). The biotin phosphoramidite is
incorporated into the strand during solid ?hase DNA
synthesis using standard synthesis conditions.
'~ 20 In another, similar experiment, a pool of
~ 98-mers with the following sequence was synthesized:
~''i .
5' HO-AGAATACTCAAGCTTGCCG-N60-ACCTGAATTCGCCCTATAG-OH 3'.
DNA 19-mers with the following sequences can also be used
as primers for PCR amplification of oligonucleotides
recovered from selection columns. The 3' primer sequence
1 is
.i
5' biotin-O-CTATAGGGCGAATTCAGGT-OH 3'
. .
and the 5' primer sequence is
5~ HO-AGAATACTCAAGCTTGCCG-OH 3'.
',';~
.
:
'' ~ ' '
. .
WO92/1~3 ~ 9 ~ PCT/US92/013~
- 110-
It will be noted that in all ca~es, the duplex
form of the primer binding sites contain restriction
enzyme sites.
B. Isolation of Thro~bin Aptamers Usinq Thrombin
Immobilized on a Lectin Column
A pool of aptamer DNA 96 ba~es in lengt~ was
synthesized as described in Example 6-A, and then PCR-
amplified to construct the i~itial pool. A 9mall amount
of the enzymatically-synthesized DNA wa~ further
amplified in the presence of ~-32P-dNTPs to generate
labeled aptamer to permit quantitation from coLumn
fractions.
A thrombin column was prepared by washing 1 m~
(58 nmole) agarose-bound concanavalin A ("Con-A") (Vector
Laboratories, cat. no. AL-1003) with 20 mM Tris-acetate
buffer (pH 7.4) containing 1 mM MgC12, 1 mM CaC12, 5 mM
KCl and 140 mM NaCl (the "selection buffer") (4 x 10 me).
1 me of settled support wac then incubated overnight at
4C in 10 me selection buffer containing 225 ~g (6.25
nmole) thrombin (Sigma, Cat. no. T-6759). After shaking
overnight to permit thrombin binding to the Con-A beads,
the mixture was briefly centrifuged and the supernatant
removed. The beads were resuspended in fresh selection
buffer and transferred to a column which was then washed
with selection buffer (5 x 1 me). A column containing 1
me of settled beads had a void volume of approximately
300 ~L. A control Con-A column was prepared by adding 1
me of settled support to a column followed by 5 washes of
1 m~ of selection buffer.
Prior to application of the aptamer DNA pool to
Con-A columns, the DNA was heated in selection buffer at
95C for 3 minutes and then cooled on ice for 10 minutes.
The pool, consisting of 100 pmole DNA in 0.5 me selection
buffer, was then pre-run on the control Con-A column at
.
,
,; . . . .
: '' :
210~6i3~
"'092/1~3 PCT/US92/01383
- 111-
room temperature to remove species that bound to the
control support. Three additional 0.5 mQ aliquots of
selection buffer were added and column fractions 2, 3 and
4 (0.5 mt each) were pooled and then reapplied to ~he
column twice. The DNA in 1.5 me selection buffer was
then recovered. Approximately 1~ of total input cpm were
retained on the column.
The recovered DNA was then applied to a Con-A-
thrombin column as a 0.5 me ali~uot followed by a 1.0 me
aliquot. Flow-through was retained and reapplied to the
column twice. DNA added to the column on the final
application was left on the column for 1 hour at room
temperature. The column was then eluted with 0.5 me
aliquots of selection buffer. 0.5 me fractions were
collected and radioactivity was determined in each
fraction. Radioactivity in eluted fractions 7 through 12
were low and relatively constant. After recovery of
fraction 12, the column was washed with 0.5 me aliquots
of 0.1 M a-methyl-mannoside (Sigma Cat. no. M-6882) in
selection buffer to elute the bound thrombin along with
thr-~bin-bound aptamers. Fractions 14 and 15 showed a
significant peak of thrombin enzyme activity, as
determined spectrophotometrically by conversion of a
chromogenic substrate (Kabi Diagnostica, Cat. no.
S-2238). 0.01% of the input DNA eluted in these two
fractions.
Aptamer DNA (Round 1 DNA) was recovered from
the thrombin by phenol extraction (2 x O.5 me). The
aqueous phase volume was reduced to about 250 ~l by n-
butanol extraction. Aptamer DNA was precipitated on dry
ice using 3 volumes of ethanol and 20 ~g of glycogen as a
carrier. The DNA was pelleted, washed once in 70%
ethanol and then dried.
.
'~`
:
,~ , ;~ , , ~ , , - ' .
- .
. . :: . -
. , . . :
W092tl~3 2 ~ O ~ 6 9 ~ PCT/US92/01~
-112-
C. ~ fic~iQn Qf S~ ted Throm~in A~ame~
Round 1 DNA from Example 6-B wa~ resuspended in
100 ~1 of H20 and amplified ~y PCR. A 200 ~l PCF.
reaction consisted of the following: 100 ~l template 96-
mer DNA (approximately 0.01 pmoles3; 20 ~l lOX buffer
~100 mM Tris Cl (pH 8.3), 500 mM ~Cl, 20 mM MgCl~); 32 ~l
dNTP's (5 mM conc totalt 1.25 mM each dATP, dCTP, dGTP,
and dTTP); 20 ~l primer 1 (biotinylated 18-mer, 50 ~M);
20 ~l primer 2 (18-mer, 50 ~M); 6~1 ~ 32p dNTP~s
(approximately 60 ~Ci); and 2 ~l Taq I Polymera3e (10
unit~). The reaction was covered with 2 drops NUJOL
mineral oil. A control reaction was also performed
without template aptamer.
Initial denaturation was at 94C for 3 minutes,
but subsequent denaturation after each elongation
reaction lasted 1 minute. Primer annealing occurred at
60C for 1 minute, and elongation of primed DNA strands
using the Taq polymerase ran at 72C for 2 minutes, with
S-second extensions added at each additional cycle. The
final elongation reaction to completely fill in all
strands ran for 10 minutes at 72C, and the reaction was
then held at 4C.
18 round~ of Taq polymera~e elongation were
carried out in order to amplify the selected aptamer DNA.
After the reactions were completed, the aqueous l~yer was
retrieved and any residual NU~OL oil was removed by n-
butanol extraction, reducing the volume to 100 ~L. A
sample may be removed from each of the aptamex and
control reaction for quantitation and analytical PAGE.
The amplified aptamer pool (100 ~) was run over a Nick
column (G-50 Sephadex, waQhed with 3 mL TE buffer (10 mM
Tris-HCl (pH 7.6), 0.1 mM EDTA)) to remove unincorporated
NTP's, primers, and salt. 400 ~L of TE buffer was then
added to the column and the DNA pool was eluted from the
column with an additional 400 ~L using TE buffer. (A
.
:: :
. :
~vog~/1~W3 210 ~ ~ ~ 8 PCT/US92/01~3
-113-
sample may be removed from the eluent for quantitation
and analytical PAGE.) The eluent (400 ~L) was loaded on
an avidin agarose column (Vector Laboratories, Cat. No.
A-2010) (500 ~L settled support, washed with 3 x 1 mL
Tris/NaCl buffer (0.1 M Tris, 0.1 M NaCl, pH 7.5)).
Approximately g0~ of the loaded radioactivity remained on
the column. The column was washed with Tri~/NaCl buffer
(4 x 400 ~l) and then the nonbiotinylated strand was
eluted with 0.15 N NaOH (3 x 300 ~L fractions). More
than 45~ of the radioactivity on the column eluted in
theqe three fractions. These fractions (900 ~l) were
combined and neutralized with approximately 3.5 ~l of
glacial acetic acid. The neutralized fractions were
reduced to 250 ~l by speed vacuum or butanol extraction
and the nucleic acids were precipitated with EtOH.~ The
resultant pellet was di~solved in 102 ~l selection
buffer. A 2 ~l sample was removed for quantitation and
analytical PAGE. The resulting amplified Ro~nd 1 Pool
was applied to a new Con-A-thrombin column as in Example
22 to obtain Round 2 aptamers.
. .,
D. Characterization of Round 1 Through Round 5 Thrombin
A~tamer~ Obtained from Sel~ction on Lectin Col~mna
Five rounds of thrombin aptamer selection and
amplification were carried out using Con-A-thrombin
columns as in Examples 6-B and 6-C. As shown in Table 5,
the combined fractions 14 and 15 contained a maximum of
- about 10~ of input DNA using the de3cribed conditions.
. . .
~.
' . .
:
~; '
.
.~ .
.. . . . .. ..
, . .
- - . ~ . . .
~ ' '
W092/l~3 ~ 3~ PCT/US92/01
-114-
~a~l~ 5
~ DNA eluted by ~ ~ DNA bound to
Round ~-methyl-mannoside control support
_ _ ___
1 0.01 0.7
2 0.055 1.9
3 5.~0 2.3
4 10.25 1.1
9.70 1.0
-- __
0.1 M ~-methyl-mannoside in selection buffer was
- added as fraction 13 in each elution, and fractions 14
and 15 were retained and the DNA amplified. Due to slow
leeching of thrombin from the column, DNA bound to
thrombin could also be seen in earlier fractions in
rounds 3-5.
After amplification, round 5 aptamer DNA was
analyzed for specificity in a filter binding assay. In
this assay, nitrocellulose filters (1 cm diameter)
prebound with salmon sperm DNA were used to bind either:
(1) An unselected 96-mer oligonucleotide DNA pool, (2)
unselected DNA with thrombin (60 pmole), (3) Round S
aptamer DNA and thrombin (60 pmole), (4) Round 5 aptamer
DNA alone, or (5) Round 5 aptamer DNA and ovalbumin (60
; pmole). In each ca~e 3.5 pmole of DNA was used and the
incubation was in 200 ~L selection buffer at room
temperature for 1 hour. The filters were then washed 3
times with 3.0 mQ of selection buffer and radioactivity
was counted to determine the amount of DNA that was
retained as a thrombin complex. The results are shown in
Table 6.
;. ~ ' ' ,. ~ . ,
: . .: , . . .:
, .. ..
210~1b~8
'~'092/t~ PCT/US92/01383
-115-
~Q~
DNA ~ DNA ~ound to Filter
Unselected 96-mer 0.08
Unselected 96-mer + thrombin 0.06
Round 5 apt~mer + thrombin 20.42
Round 5 aptamer 0.07
Round 5 aptamer + ovalbumin 0.05
1 0 -- ~
Unselected DNA did not show significant binding
to the thrombin while selected aptamer DNA bound to
thrombin. Binding re~ults show specific thrombin binding
with no detectable ovalbumin binding.
Round 5 aptamer DNA was then amplified using
the following 3~ primer sequence:
5' HO-TAATACGACTCÆCTATAGGGATCCGAGCTCCACGTG~OH 3'
and the 5' 18-mer primer sequence shown in Example 21.
The 36-mer primer was used to generate internal BamHl
restriction sites to aid in cloning. The amplified Round
5 aptamer DNA was then cloned into pGEM 3Z (Prome~a). 32
of the resulting clones were then amplified directly
using the following 5' primer sequence:
5~ HO-CTGCAGGTCGACGCTAGC-OH 3~
and the 3' biotinylated 18-mer primer sequence shown in
Example 21, and then sequenced.
Filter binding assays using aptamer DNA from 14
of the clones were u~ed to determine the di~sociation
constants ~KDj for thrombin as follows: Thrombin
concentrations between 10 ~M and 1 nM were incubated at
' ' ~: ' .
.
.
WO92/1~3 ~ 9 8 -116- PCT/US92/01~
room temperature in selection buffer for 5 minutes in the
pre~ence of 0.08 pmole of radiolabeled 96-mer derived
from cloned Round 5 aptamer DNA. After incubation, the
thrombin and aptamer mixture was applied to
nitrocellulose filters (0.2 micron, 2.4 cm diameter) that
were pretreated with ~almon sperm DNA ( 1 mg/me DNA in
selection buffer) and washed twice with 1 m~ selectlon
buffer. After application of thrombin mixture, the
filters were washed three times with 1 me selection
buffer The radioactivity retained on the filters was
then determined. KD values for the individual clones
ranged from 50 to >2000 nM.
The DNA sequence of the 60-nucleotide randomly-
generated region from 32 clones was determined in order
to examine both the heterogeneity of the selected
population and to identify homologous sequences.
Sequence analysis showed each of the 32 clones to be
distinct. However, triking sequence con~ervation was
found. The hexamer 5' GGTTGG 3' was found at a variable
location within the random Yequence in 31 of 32 clones,
and five of the six nucleotides are strictly conserved in
all 32. Additionally, in 28 of the 32 clones a second
hexamer S' GGNTGG 3', where N i9 usually T and never C,
is observed within 2-5 nucleotides from the first
hexamer. Thu~, 28 clones contain the consensus sequence
5' GGNTG&(N)zGGNTG5 3' where z i9 an integer from 2 to 5.
The remaining 4 clones contain a "close variant sequence"
(a sequence differing by only a single base). A
compilation of the homologous sequences are shown in
Figure 1. It ~hould be noted that DNA sequencing of
several clones from the unselected DNA population or from
a population of aptamers selected for binding to a
different target revealed no homology to the thrombin-
selected aptamers. From these data we conclude that this
consensus se~uence contains a sequence which is
.~ . : ' -
- 1
.
.- . . : : . :
2~ o~ ~9~ -
'092~1~W3 PCT/US92/01383
-117-
re~ponsible either wholly or in part, for conferring
thrombin affinity to the aptamers.
Clotting time for the thrombin-catalyzed
conversion of fibrinogen (2.0 mg/mL in selection buffer)
to fibrin at 37C was measured using a precision
coagulation timer apparatus ~Becton-Dickinson, Cat. nos.
64015, 64019, 64020). Thrombin (10 nM) incubated with
fibrinogen alone clotted in 40 sec, thrombin incubated
with fibrinogen and P1 nuclease (i3Oehringer-Mannheim,
Indianapolis, IN) clotted in 39 sec, thrombin incubated
with fibrinogen and aptamer clone #5 (200 nM) clotted in
115 sec, and thrombin incubated with fibrinogen, clone #5
(200 nM) and P1 nuclease clotted in 40 sec. All
incubations were carried out at 37C using reagents
1~ prewarmed t~ 37~. Aptamer DNA or, when present, Pl
nuclease, wa~ added to the fibrinogen solution prior to
addition of thrombin. The~e re~ults demonstrated that
~i) thrombin ac~ivity was inhibited specifically by
intact aptamer DNA and (ii) that inhibitory activity by
aptamer did not require a period of prebinding with
thrombin prior to mixing with the fibrinogen substrate.
Inhibition of thrombin actility was studied
using a consensus-related sequence 7-mer, 5' GGTTGGG 3~,
or a control 7-mer with the ~ame base composition but
different sequence (5' G&GGGTT 3'). Clotting times were
mea8ured using the timer apparatus as above. The
. thrombin clotting time in thiC experiment was 24 sec
u~ing thrombin alone (10 nM), 26 sec with thrombin and
the control ~equence at 20 ~M and 38 ~ec with thro~in
plus the ~on9ensu8 sequence at 20 ~M, indicating
specificity for thrombin inhibition at the level of the
7-mer.
The inhibitory aptamers were active at
physiological temperature under physiologic ion
conditions and were able to bind to thrombin in the
,, .
wo 92/14X43 PCr/US92/013,~.
2 1 ~ l8 -
presence of the fibrinogen substrate, a key requirement
for therapeutic efficacy.
MQdi~ie~ Thrombin ~E~mer@
Modified forms of the single-stranded, thrombin
consen~us ~equence-containing deoxynucleotide 15-mer
described in Example 7, 5' GGTTGGTGTGGTTGG 3~, and a
closely related 17-mer, were 3ynthesized using
convent.ional techniques. These aptamers for the most
part contain the identical nucleotide sequences, bases,
sugars and phosphodiester linkages as conventional
nucleic acids, but substitute one or more modified
linking groups (thioate or MEA), or modified bases
(ur~cil or 5-(1-pentynyl-2'-deoxy)uracil). The aptamers
containing 5-(l-pentynyl)-2'-deoxyuridine were generated
by replacing thymidine in the parent aptamers. Thrombin
aptamers containing 5-(1-pentynyl)-2'-deoxyuridine were
also obtained by selection a~ described in Examples 13
and 14 below.
Independent verification of the K1 for the
nonmodified 15-mer was made by determining the extent of
thrombin inhibition with varying DNA concentration. The
data revealed 50~ inhibition of thrombin activity at
2S approximately the same concentration as the derived K1,
strongly suggesting that each bound thrombin was largely,
if not completely, inhibited, and that binding occurred
with a 1:1 stoichiometry.
35
. . ~ . : ; : . :. :
: . -
- . .
, ~ : :, . . .,, : . . -
. : . . . , ~ .
. ~ , .
- : - .- :
.: --
w~g2/l~3 2 1 0 ~ 6 9 8 PCT/US92tO13~3
- 119 -
Table 7
Compound K~ (nM)
GGTTGGTGTGGTTGG 20
GGTTGGTGTGGTTGG#G#T 3s
GGTTG&TGTGGTT G G 40
G G T T G G T G T G G T T G G 280
GGTTGG(dU)G(dU)G&TTG& 15
GG(dU)TGGTGTGG(dU)TGG 80
GGTTGGTGTGGTU'GG 20
.. ..... . .. . _ _
indicates a thioate (i.e., P(O)S) linkage
# indicates a MEA linkage
U' indicates 5-(1-pentynyl)uracil
Example a
Inçorporation of 5-(~-~entynyl)-2,'-deoxyuridine
Into Aptam,e~r~C~ndidate DNA
5-(1-pentynyl)-2l-deoxyuridine was synthesized
and converted to the triphosphate as described in Otvos,
L., et al., Nucleic Acids Res,, (1987) 1763-1777. The
pentynyl compound was obtained by reacting 5-iodo-2'-
deoxyuridine with l-pentyne in the presence of palladi~m
catalyst. 5-(1-pentynyl)-2'-deoxyuridine triphosphate
was then used as a replacement for thymidine triphosphate
in the standard PCR reaction.
A pool of 96-mer single-stranded DNA was
synthesized, each strand consisting of specific 18-mer
PCR primer sequences at both the 5' and 3' ends and a
random 60-mer sequence in the center of the oligomer.
Details of synthesis of the pool of single-stranded DNA
is disclosed in Examples 1-6 above. PCR conditions were
the same as those described abo~e, with the following
changes. dATP, dGTP and dCTP were all used at a
.: - . , ,
. - . . ,-
-, . . . .
, - . ~: , , ,- . :
,
WO92/l~3 ~ 8 PCT/US92iO13
-120-
concentration of 200 ~M. The optimal concentration for
synthesis of full-length 96-~er DNA via PCR USing 5-(1-
pentynyl)-2~-deoxyuridine was 800 ~M. Generation of PCR-
amplified fragments demonstrated that the Taq polymerase
both read and incorporated the ba-~e as a thymidine
analog. Thus, the analog acted as both substrate and
template for the polymerase. Amplification wa~ detected
by ~he presence of a 96-mer band on an Et~r-s~ained
polyacrylamide gel.
Example_~
Incor~Qr~t~Qn of Other ~ase Analo~s
Into ~andldate~iLæm~r DNA
Ethyl, propyl and butyl derivatives at the
5-position of uridine, deoxyuridine, and at the
N4-position of cytidine and deoxycytidine are synthesized
using methods described above. Each compound is
converted to the triphosphate form and tested in the PCR
assay described in Exampie 1 using an appropriate mixture
of three normal deoxytriphosphates or ribotriphosphates
along with a single modified base analog.
This procedure may also be performed wi~h
N6-position alkylated analogs of adenine and
deoxyadenine, and the 7-position alkylated analogs of
deazaguanine, deazadeoxyguanine, deazaadenine and
deazadeoxyadenine, synthesized using methods described in
the specification.
Example 10
Thrombin Aptamer Containing Substitute
Int~Ea~cleotide L~nkag~
Modified fonms of the 15-mer thrombin aptamer,
5' GGTTGGTGTGGTTGG 3' containing one or two formacetal
internucleotide linkages (O-CH2-O) in place of the
phosphodiester linkage (O-PO(O )-0) were synthesized and
: ~
-
W092/~4843 2 iL ~ Pcr/usg2/al383
-121-
as~ayed for thrombin inhibition as descrihed above. The
H-phosphonate dimer synthon was synthesized as described
in Matteuccl, M.D., Tet. Lett. (1990) 31:2385-2387. The
formacetal dimer, 5' T-O-CH2-O-T 3', ~as then used in
S solid pha~e synthesis of aptamer DNA. Control unmodified
aptamer DNA was used as a po~itive control.
The results that were obtained are shown in Table 8.
Table 8
10 Compound clot time (sec)
100 nM 20 nM 0 nM
GGT~TGGTGTGGTTGG 105 51 --
GGTTGGTGTGGT-TGG 117 48 --
15 GGT-TGGTGTGGT~TGG 84 60 --
GGTTGGTGTGGTTGG 125 49 --
NO DNA CONTROL -- -- 25
indicates a formacetal linkage
Example 11
Thrombin Aptamer_Containing Abasic
~uc~eotide Residue~
Modified form~ of the 15-mer thrombin aptamer,
5' GGTTGGTGTGGTTGG 3' containing one abasic residue at
each position in the aptamer were synthesized and assayed
for thrombin inhibition as described above. The abasic
residue, 1,4-anhydro-2-deoxy-D-ribitol was prepared as
described in Eritja, R., et al, Nus~e~Q~ides and
Nucl~o~ides (1987) 6:803-814. The N,N-diisopropylamino
cyanoethylphosphoramidite synthon was prepared by
standard methods as described in Caruthers, M.H. Accounts
Chem._Res. (1991) 24:278-284, and the derivatized CGP
support was prepared by the procedures described in
Dahma, M.J., et al, Nucleic Acids Re$. (1990) 18:3813.
. . . .
:
w092~ 3 2~ G.'3~ 122 PCT/US92/013~
The abasic residue w~s singly substituted into each of
the 15 positions of the 15-mer. Control unmodified
aptamer DNA was used as a positive control. The results
that were ob~ained are shown in Table 9.
Ta~le 9
Compound clot time (sec)
100 nM O nM
GGTTGGTGTGGTTGX 27
GGTTGGTGTGGTTXG 27
GGTTGGTGTGGTXGG 27
GGTTGGTGTGGXTGG 56
GGTTGGTGTGXTTGG 27
G~TTGGTGTXGTTGG 29
GGTTGGTGXGGTTGG 43
GGTTGGTXTGGTTGG 51
GGTTGGXGTGGTTGG 161 - :
GGTTGXTGTGG~TGG 27
GGTTXGTGTGGTTGG 27
GGTXGGTGTGGTTGG 27
GGXTGGTGTGGTTGG 62
GXTTGGTGTGGTTGG 27
XGTTGGTGTG~TTGG 28
GGTTGGTGTGGTTGG 136
NO DNA CONTROL - 26
X - indicates an abasic residue
Exam,ple 12
ThrQmbin A~tamers ~ontainin~ 5-
(1-Propynyl)-2'-deoxy~ridine Nu~leot,ide R~sidu,es
Modification of the lS-mer thrombin aptamer, 5'
GGTTGGTGTGGTTGG 3' to contain 5-(1-propynyl)-2~-
deoxyuridine nucleotide analogs at the indicated
.:
. ~ ; .; . ', '; :,
.- : , ,:
`~092/l~3 2 1 0 ~ fi ~ 8 PCT/US92/013~3
-123-
positions in the aptamer was effected by the ~ynthesis of
these aptamers. They were assayed for throm~in
inhibition as descri~ed above. The aptamer and the
H-phosphonate were prepared aQ de~cribed in DeClercq, E.,
et al, J Med ~hem. (19~33 26:661-666; Froehler, B.C., et
al, Nucleoside~_and Nucleotides ~1987) 6:2~7-291; and
Froehler, B.C., et al, Tet. Lett. (1986) 27:~69. This
analog residue was substituted at the indicated positions
and the aptamer assayed for inhibition of thro~bin. The
results that were obtained are shown in Table 10.
Table 10
Compound clot time (~ec)
100 nM O nM
GGTTGGTGTGGTZ~G 147
GGTTGGTGTGGZTGG 129
GGTTGGTGZGGTTGG 120
GGTTGGZGTGGTTGG 118
20 GGTZGGTGTGGTTGG 187
GGZTGGTGTGGTTGG 138
GGTTGGTGTGGTTGG 125
NO DNA CONTROL - 23
Z - indicates a 5-propynyl-2'-deoxyuridine residue
Example 13
Incorporation ~f ~ ~ 2'-deoxyuridine
Into A~tamer Candld_~e DNA
5-~1-pentynyl)-2'-deoxyuridine was synthesized
and converted to the triphosphate as described in Otvos,
L., et al., Nucleic Acids Res (1987) 1763-1777. The
pentynyl compound was obtained by reacting 5-iodo-2'-
deoxyuridine with 1-pentyne in ~he pre~ence of a
palladium catalyst. 5-(1-pentynyl)-2'-deoxyuridine
::
:,
, '
., . ~ .
WO92/1~3 PCT/US92/01
~ 124-
triphosphate was then used as a replacement for thymidine
triphosphate in the standard PCR reaction.
A pool of 60-mer single-stranded DNA was
synthesi2ed, each strand consisting of specific 18-mer
PCR primer sequences at both the 5' and 3' ends and a
random 20-mer sequence in the center of the oligomer.
Details of synthe3is of the pool of single-stranded DNA
is disclosed in Example 1.
~3ecause of the poor substrate activity of
pentynyl dUTP when used with TAQ polymerase, VENT~
thermostable polymerase, (New England Biolabs, Cat. No.
254) was employed. Amplification was performed as per
the manufacturers instructions. Pentynyl dUTP was
included in the reaction as a substitute for dTTP. The
~ingle-stranded 60-mer was isolated by a modification of
standard procedures. The 200 ~L PC~ amplification
reaction was divided into two samples which were applied
to two NICK~ columns equilibrated (5 mL) as described.
The eluent was collected, pooled and applied to avidin-
agarose as described. This column was washed with bufferfollowed by elution of single-stranded 60-mer DNA with
0.15 N NaOH, pooled and neutralized with glacial acetic
acid. Single-stranded 60-mer DNA was desalted on a NAP5
column equilibrated in 20 mM Tris OAc (p~ 7.4). 10X
selection buffer salts were added to the sample, heated
to 95C for 3 minutes, and transferred to wet ice for 10
minutes.
E~ample 14
Isolation of ThrQ~ L~i~amers Using
DNA_Co~a~ining 5-(1-Pentynyl)-2'-deo~yuridine
The pool of aptamer DNA 60 bases in length was
used essentially as deqcribed in Example 13. The aptamer
pool sequence was
,
tj(~
` ~/O 92/14843 PC~/US~2/01383
-125-
5 ' TAGAATACTCAAGCl~CGACG - N2 o - AGTTTGGATCCCCGGGI'AC 3 ',
while the 5 ' primer sequence was
5 ' TAGAATACTCAAGC'rTCGACG 3 '
and the 3 ' biotin-linked primer was
5 5 ' GTACCC(:GGGATCCAAACT 3 ' .
Thrombin immobilized on a Con-A lectin column ~erved as
the target as described.
After five rounds of selection, aptamer DNA was
recovered and amplified using thymidine triphosphate
(dTTP) in place of 5~ pentynyl)-2'-deoxyuridine in
order to facilitate subsequent cloning and replication of
aptamer DNA in E. coli. At thi~ stage, the presence of
a thymidine nucleotide at a given location in an aptamer
corresponded to the location of a 5-(1-pentynyl)-2'-
deoxyuridine nucleotide in each original round fiveaptamer. Thus, dTTP served to mark the location of 5-
(1-pentynyl)-2'-deoxyuridine residues in the original
selected DNA pools.
The round five amplified DNA containing dTTP
was digested with BamHI and HindIII and cloned into the
corre ponding sites of pGEM 3Z ~Promega ~iotech) and
transformed into E. coli. DNA from 21 clones was
analyzed by dideoxy sequencing. Three of the clones
contained aptamer sequences that were identical. Only
o~e of the 21 clones contained a sequence that closely
resembled the original 5' GGTTGG 3' binding motif
obtained using thymine in the selection protocol.
One of these two clones (#17) and the original
unselected pool was analyzed for thrombin binding by
ni~rocellulose filter assay described above using DNA
labeled with 32p to permit analysis of thrombin binding
characteristics. The labeled DNA was synthesized by PCR
and contained 5-(1-pentynyl)-2'-deoxyuridine in order to
retain the original selected DNA structures. The DNA was
incubated with thrombin at various concentrations between
.
, .
.
.' .. ':
- :
WO92/1~3 2 ~ ~ 1 ;3~ -126- PCT/U~92/Ol~
10 nM and 10 ~M to obtain the ~D values for thrombin
binding. The KD of the unselected pool was ~10 ~M while
the ~D of clone 17 was 300 nM.
Radiolabeled clone 17 DNA was synthesized using
thymidine in place of 5-(1-pentynyl)-2'-deoxyuridine and
the resulting DNA had a KD f ~10 ~M, demonstrating that
the 5-(1-pentynyl)-2'-deoxyuracil heterocycle could not
be replaced by thymine in the selected aptamer without
109s of binding affinity.
Representative sequences that were obtained are
as follows.
5~ TAGTATGTATTATGTGTAG 3
5l ATAGAGTATATATGCTGTCT 3
5' GTATAT~GTATAGTATTGGC 3
5' AGGATATATGATATGATTCGG 3
5' TACTATCATGTATATTACCC 3'
5~ CATTAAACGCGAGC~TTTTG 3'
5' CTCCCATAATGCCCTAGCCG 3'
5' GACGCACCGTACCCCGT 3'
5' CACCAAACGCATTGCATTCC 3'
5' GTACATTCAGGCTGCCTGCC 3'
5' TACCATCCCGTGGACGTAAC 3'
5' GACTAAACGCATTGTGCCCC 3'
5' AACGAAGGGCACGCCGGCTG 3
5' ACGGATGGTCTGGCTGGACA 3
Example 15
Isola ~ amers Us~g~
DNA Containin~ 5-Methyl-2'-deoxycytidine
5-methyl-2'-deoxycytidine triphoDphate was
obtained commercially (Pharmacia, Cat. No. 27-4225-01)
and used to synthesize DNA containing random sequences 60
bases in length flanked by primers 19 bases in length.
The pool of aptamer DNA g8 bases in length was used
: ~ - :. , , . . : .
. , : . ,: - . .. . ~ .
"092/1~3 2 1 0 4 6 ~ ~ PCT/VS92J01383
-127-
essentially as described in Example 6. Thrombin
immobilized on a Con-A lectin column ~erved a~ the target
as described.
~riefly, a ~00 ~L PCR reaction was set up
using: 10 mM Tris-HCl, pH 8.3 at 25O C, 1.5 mM MgCl2, 50
mM NaCl and 200 ~M of each of dATP, dGTP, dTTP and 5-
methyl-2'-deoxycytidine eriphosphate~ 20 ~Ci each of ~-
32P-dATP and dGTP were added to label the DNA. 1 nmole
of 5~ and 3~ primer were added followed by addition of
0.2 pmole of 98-mer template pool DNA. Amplification was
initiated by addition of 2 ~L (10 U) of Taq polymerase
followed ~Jy sealing of the reaction with a mineral oil
overlay. About 16 cycles of amplification were performed
followed by a 10 minute final extension to complete all
duplex synthesis.
Amplified DNA was recovered (100 ~L aqueous
phase), n-butanol extracted (650 ~L) and applied to a
Nick column prewashed with 5 mL of buffer containing 100
mM Tris-HCl pH 7.5 and 100 mM NaCl. Eluted DNA was
applied to a 0.5 mL avidin-agarose column prewashed in
the same buffer and washed until DNA loss from the column
was ~ 1000 cpm. Single stranded DNA was eluted from the
avidin column by washing with 0.15 N NaCl and the eluate
was neutralized to pH 7.0 using glacial acetic acid. The
98-mer DNA was exchanged into selection buff~r on a
second Nick column and, after heat denaturation for 3 min
at 95O C followed by cooling on ice for 10 min, used in
aptamer selection on thrombin lectin columns. 1 mL
thrombin columns were equilibrated in selection buffer
prior to addition of single-stranded DNA. The single-
stranded DNA was recirculated for three complete passes.
Upon completion of the third pass the peak radioactive
element was then applied to a 1 mL ConA/thrombin column
(charged with 3 nmoles of thrombin). Radioactive single-
stranded 93-mer was applied three times to this matrix.
.
.
W092/l~3 ~1 a 1 6 ~9 ~ -12~- PCT/US92/013~
At the ~hird application, the column was stoppered and
allowed to stand for 1 hr. The column was then washed
with selection buffer and O.s mL aliquot fractions
~ollected. A total wash volume of 6 mL was employed. At
this time, 0.1 M ~-methyl-mannoside in selection buffer
was then added, followed by a 4 mL total volume wash.
Thrombin enzymatic activity was detected via chromogenic
substrate monitored by absorbance at 405 nm. Peak
thrombin fractions were pooled, extracted with phenol,
and the volume reduced by nBuOH extraction. 20 ~g
glycogen was added, the single-stranded 9a-mer
precipitated via ethanol addition and pelleted via
centrifugation. The pelleted DNA was resuspended in
water and used as a template for PCR amplification. This
protocol was repeated to obtain a pool of DNA that
resulted from 5 rounds of selection on thrombin columns.
Double-stranded DNA was digested with EcoRI and
HinDIII and cloned into pGEMBZ. Aptamers were then
transformed into E. coli and analyzed by dideoxy
seguencing. Round five aptamer pool DNA bound to
thrombin with a KD f approximately 300 ~M.
~xdmple ~6
DemonstratiQn of A~amer ~ecificity for Binding
to a~d I~Lhi~ition o~ Throm~in
The specificity of aptamer binding was
demonstrated using 32p radiolabeled DNA and a series of
proteins. To determine the binding specificity of the
thrombin aptamer, 96-mer clone #29, having the partial
30 sequence 5'CGGGGAGA6C~99~3~95lGGCAATGGCTAGAGTAGTGAC
GTTTTCGCGGTGAGGTCC 3' was used. The consensus sequence
is shown underlined. In addition, a 21-mer aptamer,
5' GGTTGGGCTGGTTGGGTTGGG ~' was tested for inhibition of
another fibrinogen-cleaving enzyme ancrod, which was
obtained commercially (Sigma, Cat. No. A-5042). The
, . , , . ~ . .
:. .
,
. . . .
. .
~092/l~3 210 ~ ~ ~ 8 PCT~US92/0138~ j
-129-
21-mer had a of KI for thrombin of about 100 nM and its
KD was about 350 nM. Clone #29 had a KD of about 200 nM
for thrombin.
The aptamer was shown to specifically bind to
thrombin by a filter binding assay. Briefly,
radiolabeled aptamer DNA at about a concentration of
about 1 nM was incubated with the indicated protein for
several minutes at room temperature, followed by
filtration of the aptamer-protein mixture through a
nitrocellulose filter. The filter was washed with 3 mL
of selection buffer and then radioactivity bound to the
filters was determined as a ~ of input radioactivity.
Results obtained are shown in Table 11. Binding data is
shown for both unselected 96-mer DNA and for two separate
experiment~ with clone #29 96-mer. A11 proteins were
tested at about l~M concentration except human serum
albumin which was used at 100 ~M. The results that were
obtained demonstrated that the 96-mer specifically bound
to thrombin and had little affinity for most of the other
proteins tested.
~0
. ~ :
W0 92/;4B~3 ~ ~ P~r/US92J01~2
13 0 -
Table
I
Proein In~u~ CP~3Ound CPM~ ~3Ound
Un~elected DNA
Control 75573 230 0
Thrombin 74706 6732 9.O
Prothrombin75366 183 ~0.5
Albumin 76560 1851 2.0
Cnymot~ypsin 75566 225 c0.5
Trypsin 73993 306 cO.S
Kallikrein76066 122 cO.5
Plasmin 74513 3994 5.0
Clonç_29 DNA
Control 81280 126 0
Thrombin 81753 48160 59.0
Prothrombin81580 8849 11.0
Albumin 85873 1778 2.0
Chymotrypsin 82953 207 ~0.5
Trypsin 75673 318 c0.5
Xallikrein84013 143 c0.5
Plasmin 82633 12323 15.0
TPA 81960 192 <0.5
Clone 29 DNA
Control 81886 917 o
Thrombin 82940 48796 59.0
Prothrombin91760 8719 g.5
Albumin 92473 234 c0.5
Chymotrypsin 97060 186 cO.5
Tryp~in 97846 429 cO.s
Kallikrein95053 1275 cO.5
Plasmin 66565 9704 15.0
TPA 98166 644 co.5
.. . . . . . . . . .. .
: .
- ,
~Vo92/1~3 2 1 0 ~ PCT/lJS92tO1~3
-131-
The thrombin 21-mer ancrod assay was conducted
as follows. Ancrod was suspended in sterile water at a
con~entration of 44 U/mL. 10 ~L ancrod solution was
added to 95 ~L of ~election buffer prewarmed to 37C.
100 ~L of this mixture was transferred to the coagulation
cup of the fibrometer described above, followed by
addition of 200 ~L of fibrinogen and 20 ~L of 21-mer DNA
(both prewarmed to 37C). TE buffer pH 7.0 was used as a
control lacking DNA. The control clot time was 25
seconds while the clot time in the presence of 500 nM 21-
mer was 24 seconds and was 26 seconds in the presence of
33 ~M 21-mer. This result demonstrated the specificity
on inhibition of fibrinogen cleavage was limited tO
thrombin; ancrod was not affected.
Bxam~le 17
Thrombin A~tamer Pharmacokinetlc Studies
A 15-mer single-stranded deoxynucleotide,
5' GGTTG&TGTGGTTGG 3', identified as a consensus sequence
from 30 thrombin aptamer clone3 as described in Example 6
above, was used. Young adult rats of mixed gender and
strain were used. The animals were anaesthetized and a
diester of the 15-mer was injected through a catheter in
200 ~l volumes (in 20 mM phosphate buffer, pH 7.4, 0.15 M
NaCl) at two concentrations, 90 that the final
concentration of 15-mer in the blood was about 0.5 and
5.0 ~M re~pectively, although the exact concentration
depends on the volume of distribution (which is unknown
for this oligonucleotide). These values are 10 to 100
times greater than the human in vitro Kd value. No
heparin was used for catheterization.
At 0, 5, 20 and 60 minutes, blood was withdrawn
from the animals (approx. 500 ~l aliquots), transferred
into tubes containing 0.1 volume citrate buffer, and
centrifused. Rat plasma was removed and tested in a
. ., . , .~,.
- ., ~ , . ~, , :
. ~
WO92/1~3 2 ~ O ~ g ~ PCT/US92/013~
-132-
thrombin clotting-time as~ay. Six animals were used at
each concentration, and three animals were injected with
the control carrier solution containing no 15-mer.
A prolonged clotting time was obser~ed at the 5
S minute time point at both concentration~, with ~he most
significant prolongation occurring at ~he higher dose
concentration. Little or no activity was obser~ed at 20
minutes. Thus, the 15-mer in blood withdrawn from rats 5
minutes post-injection was able to inhibit exogenously
added human thrombin. A separate APTT test at the 5
minute time point showed that the 15-mer also inhibited
rat blood coagulation, presumably by inhibiting rat
thrombin to a significant degree. The half-life of the
15-mer in rats appear~ to be about 2 minutes or less.
Exam~le 18
Thrombin 8ptamer Prima~e Studi~
Two thrombin aptamers were administered to
adult male cynomologous monkeys. Unsubstituted 15-mer
DNA with the sequence 5' GGTTGGTGTGGTTGG 3~ and an
analog, 5' GGTTGGTGTGGTT G G 3', containing thioate
internucleotide linkages at the indicated positions (*),
were used. Aptamer was delivered as an intravenous
bolus or infusion and then blood samples were withdrawn
at various times after delivery of the bolus or during
and after infusion. The catheter was heparinized after
the 10 minute timepoint. m e animals were not
systematically heparinized.
Thrombin inhibition was measured by a
prothrombin time test (PT) using a commercially available
kit, reagents and protocol (Sigma Diagno tics, St. Louis,
catalog Nos. T 0263 and 870-3). Inhibition of thrombin
was indicated by an increased clot time compared to the
control in the PT test. Clot times were obtained by
withdrawing a sample of blood, spinning out red cells and
, . ........ . .
- .. . .
. . , - . .
,. : . :, .
. . , . . : . .
: . - . . , . . .:
, ~ . . . . .
. ~
210 ~ b98
'`'092/1~3 PCT~US92/013B3
-133-
using the plasma in the PT test. Control thrombin PT
clot time values were obtained several minutes prior to
administration of aptamer. Briefly, the PT assay was
conducted using 0.1 mL of monkey plasma prewarmed to 370
C and 0.2 mL of a 1:1 mixture of thromboplastin (used
according to manufacturers instruction~) and CaC12 (25
mM), also prewarmed to 37C. Thrombin clot times were
measured with a fibrometer as described above.
The anin~ls were at least two years old and
varied in weight from 4 to 6 kg. Dose~ of aptamer were
adjusted for body weight. Aptamer DNA was dissolved in
sterile 20 mM phospha~e buffer (pH 7. 4) at a
concentration of 31.8 to 33.2 mg/mL and diluted in
sterile physiological saline prior to delivery. Lolus
injections were admini~tered to give a final
concentration of 22.5 mg/Rg (1 animal) of the diester
aptamer or 11.25 mg/Kg (1 animal) of the diester aptamer.
Infusions were administered over a 1 hour period to three
groups of animals: (i) 0.5 mg/kg/min of diester 15-mer (4
animals), (ii) 0.1 mg/kg/min of diester 15-mer (2
animals) and (iii) 0.5 mg/kg/min of thioate analog 15-
mer (2 animals).
PT assay results from the bolus in;ections
showed thrombin inhibition times of 7.8, 3.3 and 1.35
times control at 2.5, 5.0 and 10.0 min respectively after
delivery of the aptamer for the high dose animal.
Inhibition times of 5.6, 2.2 and 1.2 time~ control were
obtained from the low dose animal at the same time
points.
Figure 2 shows a plot of the PT times from the
4 animals that received the high dose diester infusion
compared to pretreatment control values. The data points
show the PT clot time as an average value obtained from
the 4 animals in the group. The arrows indicate time
point~ at the beginning and end of the infusion period.
~.
',
.:' - . .
.. . .. , . ~ ~
.. :- ~ . : - : .
:: . . ' '
:
W~92~ 3 ~ t~ Y ~ ~ & PCT/US~2/013
-134-
Thrombin inhibition peaked at about lO to 20 min after
the infu~ion was initiated and remained level until the
infusion period was terminated. Inhibitory activlty
decreased rapidly after the infusion of aptamer
terminated.
~ igh do~e diester and high do~e thioate animals
showed comparable inhibition of thrombin-mediated
clotting, with the high dose thioate giving a sustained
clo~ time of 2.5 to 2.7 times the control Yalue during
the course of the infusion. The low dose diester
compound gave a clot time of 1.4 to 1.5 times the control
value. These results demon~trated the efficacy of the
native and thioate analog aptamers in primates.
Exampl~ 19
Inhibition of E~tr~cor~ore~l Blood Clottinq
By Thrombin Apt~r
Anticoagulation of a hemodialy~is filter was
demonstrated using the 15-mer 5' GGTTGGTGTGGTTGG 3'
thrombin aptamer with human blood. A bolu~ of 15-mer DNA
was delivered to human blood at 37C to gi~e an aptamer
concentration of lO~M. The blood was contained in an
extracorporeal hemodialysis circuit (Travenol, Model No.
CA-90). Presgure proximal to the hemodialysis filter was
monitored to determine the time after administration of
aptamer that coagulation occurred. Blood coagulation was
marked by a pressure increase from about 50 mm Hg
observed with uncoagulated blood (blood ~low rate 200
.~L/min) to pressure of at least 400 mm ~g.
Using citrated whole blood (recalcified at time
zero), coagulation occurred at about 9 minutes after
fresh blood was placed in the hemodialy~is unit and
circulation was begun. (In a repeat of this control
experiment, coagulation occurred at 11 minutes.) A
heparin control (1 U/mL) gave sustained anticoagulation
.: :
2~ 01~8
`"092~ 3 PCTtUS~2/01383
~135-
until the experiment wa~ terminated at ~0 minutes after
start of circulation in the uni~. ~lood coagulation
occurred at 51 minutes in one trial with the 15-mer. In
a second trial, coagulation did not occur during the 80
minute course of the experiment.
Thus, methods for obtaining aptamers that
~pecifically bind ~erum proteins such a3 thrombin and
Factor X, eico~anoids, kinins such as bradykinin, and
cell surface liganda are described, as well as the
therapeutic utility of these aptamer~ and the use of the
aptamers in the detection and isolation of such
substances. Although preferred embodiments of the
subject invention have been described in ~ome detail, it
is understood that obvious variations can be made without
departing from the spirit and scope of the appended
claims.
,
W092/1~3 -136- PCT/US92/01383
~1 ~? r 1 )8
A. Extracell~L~r Proteins:
lipoprotein lipase
lecithinlist-cholesterol acyl transferase
apolipoprotein A-l
apollpoprotein II
apolipoprotein IV
apolipoprotein ~-48
apolipoprotein B-loo
apolipoprotein CI
apolipoprotein CII
apolipoprotein CIII
apolipoprotein D
apolipoprotein E
insulin
insulin-like growth factors I and II
angiotensin I
angiotensin II
renin
angiotensin converting enzyme
atrial natriuretic peptide
i~munoglobulin IgA constant region
i~munoglobulin IgG constant region
i~munoglobulin IgE constant region
immunoglobulin IgM constant region
immunoglobulin light chain kappa
i~munoglobulin light chain la~bda
imnunoglobulin IgG Fc portion
$mmunoglo~ulin IgM Fc portion
immunoglobulin IgE Fc portion
amyloid protein
beta- anyloid protein
substance P
leu-enkephalin
met-enkephalin
somatostatin
interleukin-l
interleukin-2
interleukin-3
interleukin-4
interleukin-5
interleukin-6
interleukin-7
interleukin-8
interleukin-9
interleukin-10
interleukin-ll
interleukin-12
interleukin-13
colony stimulating factor-macrophage
colcny stimulating factor-granulocyte
colony stimulating factor-macrophage/granulocyte
erythropoietin
Table 1/1
.. ... .
:, , . :~
. , .
i . , .
- ,,
W092/1~3 -l37- 2 1 ~ 4 6 9 8 PCT/USg2/01~3
myelin basic protein
carcinoembryonic antigen
collagen type I
collagen type II
collagen type III
collagen type IV
collagen type V
vitronectin
fibronectin
fibrinogen
albumin
aminopeptidase
amylase
avidin
~-cell growth factor
Bence-Jones protein
prothrombin (Factor II)
thrombin (Pactor IIa)
tissue factor (Factor III)
proaccelerin (Factor V)
accelerin (Factor Va)
proconvertin (Factor VII)
antihemophiliac factor (Factor VIII)
Christmas factor (Factor IX)
Stuart factor (Factor X)
plasma thromboplastin antecedent (Factor XI)
Hageman factor (Factor XII)
Fibrin-stabilizing factor (Factor XIII)
prekallikrein
high molecular weight kininogen
bradykinin
kinins
calcitonin
carboxypeptidase A
carboxypeptidase B
carboxypeptidase C
catalase
ceruloplasmin
cholinesterase
chymotrypsin
lipase
amylase
collagenase
complement protein Clq
complement protein Clr2
complement protein Cls2
complement protein C2
complement protein C2a
complement protein C2b
complement protein C3 convertase
complement protein C3
complement protein C3b
complement protein C4
complement protein C4a
Table 1~2
,: -, , , , :
. . . .
WO~2/1~W3 2 ~ g 8 PCT/US92/01383
comple~ent protein C4b
comple~ent protein c5a
comple~ent protein C5
co~plement protein C5b
complement protein C5 convertase
complement protein C6
complement protein C7
complement protein C8
comple~ent protein Cs
complement protein lytic complex
adrenocorticotropic hor~one
corticotropin releasing hormone
pepsin A
pepsin B
pepsin C
trypsin
elastase
enterokinase
leucine aminopeptidase
aminotripeptidase
dipeptidase
prolidase
prolinase
alpha-glucosidase
sucrase
msltase
beta-galactosidase
oligo glucosidase
lipase
phospholipase A and B
cholesterol esterase
monoacylglycerol lipase
carboxylic acid esterase
alkaline phosphatase
elastin
myelin protein Al
proenkephalin
enteropeptidase
L-asparagina6e
E-asparaginase
epidermal growth factor
fibrin
fibrinopeptide A
fibrinopeptide B
filaggrin
follicle-stimulating hormone
follicle-stimulating hormone releasing hormone
gastrin releasing peptide
growth hormone
glucagon
leutinizing hor~one
leutinizing hormone releasing hormone
human menopausal gonadotropin
prolactin.
Table 1/3
..... .. . .
: , , . : ,
:
.
,
210~6~8
W0~2/1~3 -139 PCTtUS9~/01~3
chorioniC gonadotropin
growth hormon~ releasing hormone
he~osiderin
placental lactogen
inhibin
kallikrein
acid keratin
vi~entin
desmin
glial fibrillary acidic protein
leukokinin
leupeptin
luciferase
melanin
melanotropin
melatonin
melanotropin release inhibiting hormone
nerve growth factor
oxytocin
vasopressin
neurophysin
neurotensin
beta-endorphin
adrenorphin
dynorphin
alpha neoendorphin
phospholipase A2
papain
plasmin
acidic alphal glycoprotein
alpha 1 lipoprotein
alpha trypsin inhibitor
betal lipoprotein
hemopexin
alpha 1 antitypsin
transferrin
plasminogen
platelet derived growth factor (alpha and beta)
acidic fibroblast growth factor
basic fibroblast growth factor
somatotropin release inhibitinq hormone
somatotropin releasing hormone
superoxide dismutase
thymosin
thyrotropin
thyrotropin releasing hormone
alpha fetoprotein
tumor necrosis factor-alpha
tumor necrosis factor-beta
vasoactive intestinal opeptide
von Willebrand factor
tissue plasminogen activator
qondatropin releasing hormone
parathyroid hormone
Table 1/4
.. . . .
': :
O92/1~3 -140- PCT/US92/01383
antithrombin III
protein C
protein S
activated protein c
interferon alpha
interferon beta
interferon gamma
ferritin
haptoglobin
HDL
LDL
VLDL
TGF (alpha and beta)
Steel Factor (stem cell growth factor)
HB-epidermal growth factor
FGF-6
SLF
KGF
DDNF
NT-3
oncogene protein
in~2 oncogene protein
h~ oncogene protein
Cell_~rface p~Q~çins
CDla thymocyte cell surface protein
CDlb cortical thymocyte, dermal cell surface protein
CDlc cortical thymocyte cell surface protein
C~2 E rosette receptor
CD3 T cell receptor complex
CD4 T helper/inducer cell surface protein
CD5 T cel s, B cell, cell surface protein
CD6 Pan T, B cells o~ CLL cell surface protein
CD7 T cells, NK cell surface protein
CD8 T cytotoxic/suppressor, NX cell surface protein
CD9 Monocytes, Pre-B, platelet cell surface protein
CDlO CALLA, Pre-B, granulocyte cell surface protein
CDlla LFA-l Alpha chain
CDllb Mac l ~adhesion molecule)
CDllc pl50-95 (adhesion molecule)
CDw12 ~onocyte, granulocyte, platelet cell surface protein
CDl3 Pan myeloid (CA ~+ mobilization) cell surface protein
CDl4 Monocyte cell surface protein
CDl5 Hapten X (fucosyl N acetyllactosamine), granulocyte
CDl6 IgG Fc Recep~or III, low affinity
CDwl7 Lactoceramide
CDl8 B chain of LFh-l, Mac l, pl50-95
CDl9 Pan B, cell surface protein
CD20 B cell~, dendritic reticular cell surface protein
CD21 B cells, dendritic cells, CR2 (EBV Rc) Epstein Barr Virus
Receptor
Table l/5
. . :
~10~6~8
WOg2/1~W3 -141 PCT~US92/01383
CD22 B cell, cell surface protein
CD23 IgE Fc Receptor low ~ffinity
CD24 ~ cell, cell sur~ace protein
CD25 IL2 Recep~or
CD26 Dip4ptylpeptidase IV of activated T lymphocytes
CD27 Mature T cell surface protein
CD28 Tp44 Ag, T cells, plasma cell surface protein
CD29 VLA Beta chain
CD30 bctivation antigen
CD31 Myeloid Ag. gplla Antigen
CD32 IgG Fc Receptor
CD33 Pan myeloid cell surface protein
CD34 Lymphoid and myeloid precursor cell surface protein
CD35 CRl, granulocytes, monocyte~, dendritic cell 6urface
protein
CD36 gpIV, thro~bospondin receptor
CD37 ~ cell, cell surface protein
CD38 B & T csll and plasmocyte cell ~urface protein
CD39 B cells, macrophages, endot~ellal cell ~urface protein
CD40 B cells, B lymphocytes carcinoma (BLCa) cell surface
protein
CD41a gpIIb/IIIa
CD4lb gpIIb
CD42a gpIX
CD42b gpIb
CD43 T cells, granulocytes, RBC, cell surface protein
CD44 T cells, pre-B, granulocytes, cell surface protein
CD45 Leukocyte co~mon antiqen (LCA)
CD45Ra Restricted LCA, subset of CD4 + T cells
CD45Rb Leukocyte cell surface protein
CD45Ro Restricted LCA
CD46 Membrane Cofactor Protein (MCP)
CD47 N-linked glycan
CD48 Leukocytes (PI-PLC linked)
CDw49a al VLA chain
CDw49b gpIaIIa, a2 VLA clain, collagen receptor
C~w49c a3 VLA chain
CDw49d a4 VLA chain
CDw49e gplc, aS VLA chnin
CDw49f gpIcIIa, a6 VLA chain, laminin receptor
CDw50 Leukocyte cell surface protein
CD51 a chain vitronectin Rc (VNR) receptor
C~52 Campat~.-l, leukocyte cell surface protein
CD53 Leukocyte cell surface protein :~
CD54 ICAM-l (Intrac~llular Adhesion Molecule), leukocytes
CD55 DAF (~ecay Accelerating Factor)
CD56 N-CAH (NKH-1), Adhesion Molecule
CD57 HN~1, Natural Riller cell surface protein
CD58 Leukocyte functional antigen cell surface protein
CD59 Leukocyte cell surface protein
CDw60 Neu AC-Neu Gal, T lymphocytes subset
CD61 gpIIIa, VNR B chain, Integrin B3
CD62 GMP-140 (PADGEM)
CD63 Activated platelet cell surface protein
Table 1/6
- ';, ;' ~ '
, ~ - ,~' ' .~ '
1 , ,,
: .
WO92/1~W3 21 O ~ ~ ~ 42- PCT/US92/01383
CD64 Pc receptor, ~onocytes
C~w65 Fucogan~lioside
C~6 Granulocyte cell surface protein
CD67 Gr~nul~cyte (PI linked) cell surface protein
CD68 MAcrophaqe cell surface protein
CD69 Activation Inducer Molecul~
CDw70 Activnted B & T cells, Reed Sternberg cell, cell surface
protein
CD71 Transferrin receptor
CD72 Pan B cell ~urface protein
CD73 Ecto5'Nucleotidase
CD74 Class II a6sociated invarlant chain
CDw75 Hatur~ B cell surface protein
CD76 Mature B cells, T cell subset, granulocyte cell surface
protein
CD77 Globatrioasylcera~ide (Gb3), Burkitt's lymphoma cell
surface protein
CDw78 Pan B (monocyte) cell surface protein
ICAM-1 Thrombin Receptor
IPAAM 2 p-glyc~protein (MDR-1 gene product)
VCAM-1 (MDR-2 gene product)
BLAM-l
T-cell receptor
Histocompatibility antigen~ tCell surface antigens)
HLA-A1, HLA-A2, HLA-A3, HLA-All, HLA-A23t9), HLA-A24(9),
HLA-A25(10), HLA-A26(10), H~A-A29(wl9), HLA-A30(wl9),HLA-A31(wl9),
HLA-A32(wl9), HLA-A33(wl9), HLA-Aw34(10), HLA-Aw36, HLA-Aw43,
HLA-Aw66(10), HLA-Aw68(28), HLA-Aw69(28), HLA-Aw74(wl9),
HLA-Bw4(4a), H~A-Bw6(4b), HLA-i37, HLA-B8, HLA-B13, HLA-B18,
HLA-B27, HLA-B35, HLA-B37, HLA-B38(16), HLA-B39(16), HLA-Bw41,
HLA-Bw42, HLA-B44(12), HLA-B45(12), HLA-Bw46, HLA-Bw47, HLA-Bw48,
HLA-B49(21), HLA-Bw50(21), HLA-B51t5), HLA-Bw52(S), HLA-Bw53,
HLA-Bw54(22), H~A-Bw55(22), HLA-BwS6(22), HLA-Bw57(17),
RLA-Bw58(17), HIA-~w59, HLA-Bw60(40), ~IA-~w61(40), ~LA-Bw 62(15),
~YLA-Bw63(15~, HLA-Bw64(14), HLA-Bw65(14), HLA-Bw67, HLA-Bw71(70),
H~A-Bw72~70), HLA-~w73, RLA-Bw75(15), HLA-Bw76(15),
HLA-Bw77(15), ~LA-Cwl, HLA-Cw2, HLA-Cw3, HLA-Cw4, HLA-Cw5, HLA-Cw6,
HLA-Cw7, NLA-Cw8, HLA-Cw9(3), NLA-Cw10(3), HLA-CWll, HLA-Dwl,
HLA-Dw2, HIA-Dw3, HLA-Dw4, HLA-DwS, ~LA-Dw8, HLA-Dw9, HLA-DwlO,
HlA-Dwll(7), HLA-Dw12, HLA-Dw13, HLA-Dw14, HLA-Dw15, HLA-Dw16,
HIA-Dw17(7), HLA-D~18(w6), HLA-Dwl9(w6), HLA-Dw20, HLA-Dw21,
HL~-Dw22, HLA-Dw23, HLA-Dw24, HLA-Dw25, HLA-Dw26, HLA-DRl, HLA-DR2,
HLA-DR3, HLA-DR4, HLA-DR5, HLA-DRw6, HLA-DR7, HLA-DRw8, HLA-DR9,
HLA-DRwlO, HLA-DRw11(5), HLA-DRW12(5), HLA-DRW13(6), HLA-DRw14(6),
HLA-DRW15(2), HLA-DRw16(2), HLA-DRw17(3), HLA-DRw18(3), HLA-DRw52,
HLA-DRw53, HLA-DQwl, HLA-DQw2, HLA-DQw3, HLA-DQw4, HLA-DQw5(wl),
HLA-~Qw6(wl), HLA-DQw7(w3), HLA-DQw8(w3), ELA-D~w9(w3), HLA-DPwl,
H~ -DPw2, HLA-DPw3, HLA-DPw4, HLA-DPw5, HLA-DPw6
Table 1/7
'~092/1~3 2 10 ~ 6 9 8 PCT~US92/01383
Insulin receptor
Insulin-like growt~ f~ctor receptor
Sodiu~/potassiu~ ATPase
Sodium/chloride cotransporter
IL-l receptor
IL-3 receptor
IL-4 receptor
Parathyroid hor~one receptor
GnRH receptor
CSF-H receptor
CSF-GM receptor
CSF-G receptor
Erythropoietin receptor
Complement receptor
Clb reeeptor
EGF receptor
Follicle stimulating hormone receptor
Follicle stimulatinq hormone releasing hormone receptor
Growth hor~one receptor
Gluca~on receptor
Leutinizing horDone receptor
Leutinizing hor~one releasing hornone receptor
Growth hor~one releasing hormone receptor
Nerve growth faetor receptor
Molanotropin release inhibiting hormone receptor
Platelet derived growth factor receptor (alpha and beta)
Fibroblast growth faetor receptor (1 and 2)
Somatotropin release inhibiting hormone receptor
So~atotropin relea~ing hormone receptor
Thyrotropin reeeptor
Thyrotropin releasing hornone receptor
Tumor neerosis faetor - ~lpha reeeptor
Tu~or neerosis factor - beta receptor
Complement C3a reeeptor
Complement CSa reeeptor
Complement C3b reeeptor
Complement CR2 reeeptor
Complement C~3 reeeptor
CSF-l reeeptor
GNCSF receptor
SLF reeeptor
fl~ oneogene protein
oncogene protein
2 oneogene protein
trk-B oneogene protein
oneogene protein
c-fem~ oneogene protein
c-kit oncogene protein
oneogene protein
HER-2~n~U oneogene protein
ki~ oneogene protein
Table l/8
~ ~, ,. : : : -
- , :. . . .
,, . . -......... .
WO92/14843 21~ 8 144- PCl~US92/01383
C. Virus and ~act~rial Tar~ets
HIV-l/HIV-2
reverse transcriptase (including RNAse H)
protease
integrase
gag proteins ~including pl~,p24, pl5)
tat protein
rev protein
nef protein
vif protein
vpr protein
vpu protein
envelope proteins (including gp 120, gp41)
HTLV-I/II
gag proteins ~including gp24, gpl9, gpl5)
protease
pol (including reverse trasncriptase and RNAse H)
envelope genes (including gp46 and gp41)
tax
rex
Human papillomaviruses
E7 protein
E6 protein
E6* protein
E4 protein
El proteins
El-~4 protein6
E2 proteins
capsid.proteins (L1 and L2)
Influenza A and B
polymerase proteins (including PA, PBl, and P~2)
hemagglutinin (~A)
neuraminidase (NA)
nucleoprotein (NP)
Ml and M2 proteins
NS1 and NS2 proteins
Hepatitis B
Envelope (surface antigenP pxoteins (including pre-Sl, pre-S2 and
Nucleocapsid (core) proteins
P-gene product
X-gene product
Table l/9
~ '
. ~ :
:
,'
-l45- PCT/US92J01~,
~092~1~3 ~10~9
I~med;ate ear~Y (alPhducgs tipncluding gNA pol pl40~ DBP
Late (gamma) structural gene products
Herpes si~plex Virus
thymidine kinase
ribonucleotide reductase
virus-encoded envelope glycoproteins
EiPmmtdiiate early gene products (including ZLFl protein and RLFl
earlY gene Piroductdsuctiase thymidine klnaSe IXLFli)
virus-encoded glycoproteins
lipopolysaccharides (from gram negative or gram positive bacteria)
botuli~um toxin
diptheria tox~n
cholera toxin
endotoxin
D. Intracellular Targets (proteins/lipids/etc)
LipidS
fatty acids
glycerides
glycerylethers
phospholipids
sphingolipids
steroids
fat soluble vitamins
glycolipid
phospholipids
phosphatidic acids (cephalins)
sphingomyelin
plasmalogens
phosphatidyl inositol
phosphatidyl choline
phosphatidyl serine
phosphatidyl inositol
diphosphatidyl glycerol
oleic
palmitic
stearic acids
linoleic acid
acylcoenzyme A
Table l/lO
- . . .
.,. . ;, . .
- ~. - ,
'&~3
-146_
.-iti ~actride PC7/lJS92/0138;~
.etinOid acid 21 0 ~ 6 9 8
~,,"~" Y 1~ ns
tdrltterpeneS s
~S
eS terS
~ndrOgeDs
to 3-deoxyoctan
~~
'.
~ ton~ gene Produ t
hemOggllOobbln gartcselona
hemoglobinn Beth ISrea
hemoglOb. Unbury
he~glO~iln ~nPrt 1~S,
hemoglObin ranston
hhee~609l0bln ~reteil
~ D_pun6; Abngel es
heltOggl0bbin G~er
hemoglObinn H2immersmith
hemoglObin ~lr.shima
hemOgglbbln ~ aPolis ~:
,,
~able 1/11 ,'
- . . I
, ~ ,,:, ,, , - - . -, -. . :, ; '
-: , : : : . - : , . : :
- ~ : . :::
W092t1~W3 210 1 S ~ 8
nemoglobin Kempsey
he~oglobin Kenya
hemoqlobin Lepore
hemoglobin M
hemoglobin M Hyde Park
hemoglobin M Iwate
hemoglobin M Saskatoon
hemoglobin Nancy
hemoglobin Philly
hemoglobin Quong Sze
hemoglobin Ranier
hemoglobin Raleigh
hemoglobin S
hemoglobin Sealy
hemoglobin Seattle
hemoglobin St. Louis
hemoglobin St. Mande
hemoglobin Titusville
hemoglobin Torino
hemoglobin Wayne
hemoglobin York
hemoglobin Zurich
E~ oncogene protein
~kl oncogene protein
mç~ oncogene protein
Ha-ras oncogene protein
Ki-ras oncogene protein
N-ra~ oncogene protein
fps oncogene protein
mos oncogene protein
oncogene protein
~L~ oncogene protein
ç~k oncogene protein
dbl oncogene protein
~1 oncogene protein
y~ oncogene protein
fpr oncogene protein
L~myQ oncogene protein
int-l oncogene protein
ets oncogene protein
bcl-~ oncogene protein
Table l/12
;,.. ...
:: . . . ,~. .
. ,. .. : .: . . . . : : .
: , .;~
W092/1~843 -148 21~ 698
PC-r/US92/01383
-
1-acylglycerol-3-phosphate acyltransferase
~b-hydroxy-steroid dehydrogenase(EC5.3.3. 1 )
~hydroxybutyrate dehydrogenase
3-ketothiolase
5'-nucleotidase
~oxoguanosine deglycosylase
11~hydroxylase (EC 1.14.15.4)
1~hydroxylase
21-steroid hydroxylase(EC 1.14.99.10)
2,3-oxidosqualene lanosterol cyc~ase
24,2~sterol reductase
a-actin
a-mannosidase
a-melogenin
a-tubulin
acetolactate synthase
acetyl glucosaminyl transferase
acetyl spermine deactylase
acetyl transacylase
acetyl~oA carboxylase
acetyl-CoA malate citrate synthase acetyl cholinesterase
aad phosphatase
acid protease
aconitase
actin
adenosine deaminase
adenosylhomocysteine hydrolase
adenosylmethionine decarboxylase
adenylate cyclase
adenylate deaminase
adenylate kinase
adenylsuccinate lyase
adenylsuccinate synthase
alanine aminotransferase
alcohol dehydrogenase
aldolase
aldose reductase
alkaline phosphatase
amidophosphoribosylamine transferase
AMP phosphodiesterase
amyloid b/A4 protein
amyloid precursor protein
ankarin
arginase
argininosuccinate Iyase
argininosuccinate synthetase
Table 1/13
:. : .: ,: .
: ,.: ,
. -: , :
.. ' , :, :.
, ' .. ~
wo 92~14843 -149- ~ 3 8 PCr/US92tOl383
aromatase
aryl sulfatase
aspartate aminotransferase
aspartate transcarbamoylase
ATP diphosphohydrolase
ATPase
~actin
~glucuronidase
~glycerophosphatase
~ketoacyl-ACP reductase
~ketoacyl-ACP sythetase
~spectrin
b-tropomyosin
~tubulin
C5a inactivation factor
calcitoin
calmodulin
calpain I
calreticulin
carbamoyl-phosphate synthetase
carbonic anhydrase
casein kinase 1
casein kinase 2
catalase
catechol methyltransferase
cathepsin
cathepsin B and L
cdc 2 p34
cdclO
cdc 13 p60
cdc 25 p80
chaparonin
cholesterol esterase
cholesterol monooxygenase
citrate synthetase
clathrin
collagenase
connective tissue activating peptide
core protein
cortisol dehydrogenase
cydin A and B
cyclophilin
cytidine deaminase
cytidylate deaminase
cytodhrome C peroxidase
Table 1/1 4
' ' .' ',; ' ., ' ~ ' : ' `' ' :
- .
wo 92/14843 2 1 0 ~ So P~r/US92/01383
cytochrome P450
cytosine methyl transferase
defensin
diacylglycerol acyltransferase
dihydrofolate reductase
dihydrouracil dehydrogenase
dihydroorotatase
dihydroorotate dehydrogenase
dioxygenase
dopamine monooxygenase
dynenin
elastase
elastin
elongation factor Tu
endo-rhamosidase
enolase
enoyl-ACP hydratase
enoyl-ACP reductase
fatty acid synthetase
ferritin
ferrodoxin
fructose bisphosphate aldolase
fumarase
GABA aminotransferase
galactosidase
gelatinase
gelsolin
glucophosphate isomerase
glucosylceramide galactosyl transferase
glutaminase
glutamine phosphoribosylpyrophosphate amidotransferase
glycerol phosphate acyl transferase
glycerol phosphate dehydrogenase
glycinamide ribonucleotide transfomylase
GTP binding protein
heavy meromyosin
hexokinase
histaminase
histidine decarboxylase
HSP 27
hydropyrimidine hydrolase
hydroxy acyl CoA dehydrogenase
hydroxy steriod dehydrogenase
hydroxy-methylglutaryl CoA cleavage enzyme
hydroxy-methylglutaryl CoA reductase
hydroxy-methylglutaryl CoA sythetase
Table 1/15
: . . :.
- .:: . . . .. .. .
: ' , . -, ~ -
.
,
Wo92/1~843 -151 ~ 6~ Pcrtuss~/ol383
hypoxanthine-guanine phosphoribosyl transferase
IMP dehydrogenase
indole Iyase
inositol phosphate phosphatase
isocitrate lyase
kinin generating enzyme
lactate dehydrogenase
lactoferrin
laminin
leukocyte elastase
lipocortin
lipoxygenase
long chain fatty acid CoA ligase
lysozyme
major basic protein
malate dehydrogenase
malate synthase
malonyl transacylase
mannosidase
methionine adenosyltransferase
mixed function oxygenase
myloperoxidase
myofilament
myristoyltransferase
N-acetyl glucuronidase
Na/K ATPase
NAD-dependent sterol 4-carboxylase
NADase
NADPH-dependent 3-oxosteroid reductase
nexin
nudeolar protein B23
nudeoside diphosphate kinase
ornithine aminotransferase
ornithine carbamoyltransferase
ornithine decarboxylase
orotate decarboxylase
orotate phosphoribosyl transferase
peptidyl prolyl isomerase
peptidylamidoglycolate lyase
phenylalanine hydroxylase
phosphatidate phosphatase
phosphoenol pyruvate carboxykinase
phosphofructokinase
phosphoglucokinase
phosphoglucomutase
Table 1/16
, . . ..
~, .:
- . . ,: ~ - : , .
WO g2/14~43 -152-
8 PCT/US92/01383.
phosphoglycerate kinase
phosphoglyceromutase
phospholipase A2
phospholipase C
phospholipase CG1
phospholipase D
phospholipase S
phosphoribomutase
phosphoribosylphosphate transferase
plasminogen activator inhibitor
platelet factor 4
porin
pRb rentinablastoma gene product
properidin
proshglandin synthase
Protein kinase C
purine nucleoside phosphorylase
pyruvate dehydrogenase
pyruvate kinase
ribonucleotide reductase
ribosephosphate pyrophosphate kinase
ricin tropoelastin
serine/threonine kinase
spectrin
spermine synthase
squalene epoxidase
squalene monooxygenase
sterol methyltansferase
suc 1 pl3
succinyl CoA synthetase
superoxide dismutase
tartrate dehydrogenase
thioesterase
thioredoxin
thrombospondin
thromboxane A2 synthetase
thymidylate synthetase
transacylase
triosephosphate dehyrogenase
triosephosphate isomerase
tRNA synthetase
tropomyosin
tryptophan synthase
tubulin
tyrosine kinase
ubioquinone reductase
Table 1/17
. : , , . ,, . , . :
,, . :. ~
' - ' . : ' ' - ,
,
YO g2/~4843 -153- PCr/US92tO1383~l
210~59~
uridine monophosphate kinase
urokinase type plasminogen activator
vitamin K reductase
wee -1 gene product
xanthine dehydrogenase
xanthine oxidase
xylosyl transferase
E. Small Molecules and Other Compounds
2-phc~sphoglycerate
~hydroxy acyl~oA
3-phospho-5^pyrophosphomevalonate
3-phosphoglycerate
3-phosphohydroxypyruvate
3-phosphoserine
5-alpha-dihydrotestosterone
5-phospho-beta-ribosylamine
5-phosphoribosyl 1-pyrophosphate
5-phospho-alpha-ribosyl-1-pyrophosphate
5'-phosphoribosyl-4-carboxamide-5-aminoimidazole
6-benzylaminopurine
17-hydroxyprogesterone
acetominophen
acetyl-coenzyme A
acetylcholine
acetylsalicylic acid
adenine
adenosine
ADP
a~latoxin B1
aflatoxin Gl
aflatoxin M1
aldosterone
allantoin
allodeoxycholic acid
allopurinol
alpha ketoglutarate
alpha,beta-dihydroxy-beta-methylvalerate
alpha-aceto-alpha-hydroxybutyrate
alpha-amino-beta-ketoadipate
alpha-bungarotoxin
alpha-carotine
alpha-keto-beta-methylvalerate
alpha-keto-glutarate
alpha-ketobutyrate
Table 1/18
1843 - 1 5 4 - ` D ~ 6 ~ US92/o~
~ ha-ketoglutarate
~miloride
aminopterin
AMP
amylopectin
~Imylose
anti-diuretic hormone
an tipyrine
arachidic acid
arachidonic acid
arecoline
arginine
argininosuccinate
ascorbic acid
aspartate sernialdehyde
aspartyl phosphate
atropine
bacitracine
benztropine
beta-caratine
betamethazone
bilirubin
biliverdin
biotin
carbachol
carbamoyl phosphate
carboline
carnitine
CDP
cholesterol
cholic acid
chorismic acid
cis aconitate
citrate
citrulline
CMP
cocaine
codeine
Coenzyme Q
coenzyme A
corticosterone
cortisol
cortisone
coumarin
creatine
i
Table 1/1 9
;
:
,
' ~o 92~t4~43 - 1 5 5 - PCr/US92/01383
2la~s
creatinine
crP
cyanocobalamin
cyclic AMP
cyclic CMP
cyclic GMP
cyclic TMP
cystathionine
cytidine
cytochrome
~Erythrose
D-Fructose
D Galactosamine
D glucose
D Glucuronic acid
dADP
dAMP
dATP
dCDP
dCMP
d~-l~
delta^4-androstenedione
deoxyadenosyl cobalamin
deoxycholic acid
dGDP
dGMP
dGTP
dihydroorotate
dihydroxyphenylalanine
diphosphoglycerate
dopamine
dTDP
dTMP
dTIl~
dUDP
dUMP
dUTP
eosinophil chemotactic factor of anaaphyaxis-A
epinephrine
estriol
estrone
ethynylestradiol
PAD
farnesyl pyrophosphate
fatty Acyl-s~oA
ferrodoxin
Table 1/20
. - ~ . . . . .
- ,
.
.
~ ~10~8 -156
~o 92/1~3 Pcr~llS92/01383
.
FM~
FMNH2
folic acid
fructose 2,6-diphosphate
fructose
~ructose 1~6-diphosphate
fructo5e 6-phosphate
Fructose1 ,6-diphosphate
fumarate
galactose
galactose
GalNAc
gama-aminolevulinate
gamma-carotene
gas~ic inhibitory protein
gaunidinoacetate
GDP
gentamycin
glucosamine
glucosamine 6-phosphate
glucose
glucose 1,6-diphosphate
glucose 1-phosphate
glucose 6-phosphate
Glutamate
glutamate semialdehyde
glutaryl-CoA
glutathione
glyceraldehyde 3-phosphate
glycerol 1-phosphate
glychocholate
glycine
glyoxylate
GMP
GTP
guanine
hemicholine
histamine
homogentisate
homoserine
hydrocortisone
hydroxyproline
indole
inosine
inositol
inositol phosphate
Table 1/21
.
.
92~l4843 -157~ 21a4~98Pcr/us92/ol383
~ttermediate molecular weight eosinophil chemotactic factor of
isocitrate
isopentenyl pyrophosphate
L-alanine
L-arginine
L-asparagine
L-aspartic acid
L-aspartic acid
L-azoser~ne
L-cysteine
L-Fucose
I,-glutarnic acid
L-glutamine
L-histidine
L-isoleucine
L-leucine
L-lysine
L-malate
L-methionine
L-phenylalanine
L-proline
L-serine
L-threonine
L-tryptophane
L-tyrosine
L-valine
lanosterol
leukotriene B4
leukotriene C4
leukotriene D4
leukotrienes
lipoic acid
luciferin
malonate
malonyl-CoA
methocholine
methotrexate
methylenetetrahydrofolate
methylmalonyl-CoA -
mevalonate
mevalonate-5-phosphate
muscarin
N-Formylmethionine
NAD
NADH
NADP
Table 1/22
, . ~
. ~ .
~ . .
: . :
: ` ` : - ,
WO 92/14843
- 1 5 8 - PCT/IJS92/01383 -
NADPH
neostigrnine
nicotinamide
nicotine
nicotinic acid
norepinephrine
ornithine
oxaloacetate
oxotremorine
p-benzoquinone
pancuronium
pantothenic acid
para-aminobenzoic acid
phosphenolpyruva te
phosphocreatinine
physostigmine
pilocarpine
piperidine
pirenzipine
plastoquinone
platelet-activating factor
porphobilinogen
pregnenolone
progesterone
prolinamide
propionyl-CoA
prostaglandin D2
protoporphyrin IX
pteridine
pyridoxal
pyridoxal phosphate
pyridoxal phosphate
pyridoxamine
pyridoxamine phosphate
pyrodoxine
pyroglutamic acid
pyrophosphate
pyrrolidine
pyrroiine-S-carboxylate
pyrrolizidine
quinplizidine
quinuclidinylbromide
RGD peptide
riboflavin
ribose
s-adenosylhomocysteine
Table 1/23
... .. ..
' ' .
.
~ . ..
,
~o 92/14843 -15 9- Pcr/us92/o1383
210~98
-adenosylmethionine
scopolamine
serotonin
slow-reacting substance of anaphylaxis
squalene
suberyldicholine
succinate
succinyl-CoA
taurocholate
testosterone
tetrahydrofolic acid
thiamine
thioredoxin
thromboxane A2
thromboxane B2
thymine
tropane
ubiquinol
ubiquinone
UDP
UDP-galactose
UMP
uracil
urea
uric acid
UTP
vitamin A
vitamin D
vitamin E
vitamin K
TabIe l/2 4
.
.. . . - . . , :, -
... .
,. . ..
,: - , . .. - -
