Note : Les descriptions sont présentées dans la langue officielle dans laquelle elles ont été soumises.
WO 92il719' ~ PCr/l,'S92tO~7:'
. .
THER~PEUTIC FRAGMENTS OF VON WILLEBRAND FACTOR
Cross-Reference to Related Ap~lications
This is a continuation-in-part of application Serial No.
07/613,004, filed November 13, 1990, which is a continuation-
in-part of Serial No. 07/600,183, filed October 17, 1990,
which is a continuation-in-part of Serial No. 07/519,606,
filed May 7, 1990, which is a continuation~in-part of Serial
No. 07/270,488, filed November 4, 1988, now abandoned, which
is a continuation of Serial No. 869,188, filed May 30, 1986,
now abandoned. This is also a continuation-in-part of
aforementioned Serial No. 07/600,183, filed October 17, 1990.
Field o~ the Invention
This invention relates to polypeptides which are useful
in the treatment of vascular clisorders such as thrombosis.
This invention relates also to polypeptides which are useful
in the treatment of hemorrhagic diseases, such as von
Willebrand disease (vWD). This invention further relates to
the production by recombinant DNA-directed methods o*
pharmacologically useful quantities of the po~ypeptides of
the present invention.
The term "hemostasis" refers to those processes which
comprise khe defense mechanisms of the body against loss of
circulating blood caused by vascular injury. Processes which
, . , .
: ` :
... .. . .
. , ~ . .
W092/1719~ ?~ ~ 5) rl 1 ~ PCT/US92/0247~
are normal as a physiologic response to vascular injury may
lead in pathologic circumstances, such as in a patient
afflicted with atherosclerotic vascular disease or chronic
congestive heart failure, to the formation of undesired
thrombi (clots) with resultant vascular occlusion.
Impairment of blood flow to organs under such circumstances
may lead to severe pathologic states, including myocardial
infarction, a leading cause of mortality in developed
countries.
The restriction or termination of the flow of blood
within the circulatory system in response to a wound or as a
result of a vascular disease state involves a complex series
of reactions which can be divided into two processes, primary
and secondary hemostasis. Primary hemostasis refers to the
process of platelet plug or soft clot formation. The
platelets are non-nucleated discoid structures approximately
2-5 microns in diameter derived from megakaryocytic cells.
Effective primary hemostasis is accomplished by platelet
adhesion, the interaction of platelets with the surface of
damaged vascular endothelium on which are exposed underlying
collagen fibers and/or other adhesive macromolecules such as
proteoylycans and glycosaminoglycans to which platelets bind.
Secondary hemostasis involves the reinforcement or
crosslinking of the soft platelet clot. This secondary
process is initiated by proteins circulating in the plasma
(coagulation factors) which are activated during primary
hemostasis, either in response to a wound or a vascular
disease state. The activation of these factors results
ultimately in the production of a polymeric matrix of the
protein fibrinogen (then called fibrin) which reinforces the
soft clot.
Therapeutic drugs for controlling thrombosis have been
classified according to the stage of hemostasis which is
affected by the administration thereof. Such prior art
~ompositions are typically classified as anticoagulants,
thrombolytics and platelet inhibitors.
The anticoagulant therapeutics typically represent a
class of drugs which intervene in secondary hemostasis.
Anticoagulants typically have no direct effect on an
WO92/17192 ~ S~2/02
established thrombus, nor do they reverse tissue damage.
Associated with the use of existing anticoagulants is the
hazard of hemorrhage, which may under some conditions be
greater than the clinical benefits otherwise provided by the
use thereof. As a result, anticoagulant therapy must be
closely monitored. Certain anticoagulants ac~ by inhibiting
the synthesis of vitamin K-dependent coagulation factors
resulting in the sequential depression of, for example,
factors II, VII, IX, and X. Representative anticoagulants
which are used clinically include coumarin, dicoumarol,
phenindione/ and phenprocoumon.
Thrombolytics act by lysing thrombi after they have been
formed. Thrombolytics such as streptokinase and urokinase
have been indicated for the management of acute myocardial
infarctions and have been used successfully to remove
intravascular clots if administered soon after thrombosis
occurs. However, the lysis effected thereby may be
incomplete and nonspecific, i.e., use~ul plasma fibrinogen,
in addition to fibrin polymers within clots, is affected. As
a result, a common adverse reaction associated with the use
of such therapeutics is hemorrhage.
A third classification, antiplatelet drugs, includes
drugs which suppress primary hemostasis by altering platelets
or their interaction with other circulatory system
components. The present invention relates to this
classification of antiplatelet drugs.
Reported Developments
Specific antiplatelet drugs oper~te by one or several
mechanisms. A first example involves reducing the
availability of ionized calcium within the platelet cytoplasm
thereby impairing activation of the platelet and resultant
aggregation. Pharmaceuticals representative of this strategy
include prostacyclin, and also Persatine~ (dipyridamole)
which may affect calcium concentrations by affecting the
concentration of cyclic AMP. Numerous side effects xelated
to the administration of these compounds have been reported.
An additional class of antiplatelet drugs acts by inhibiting
~`
WO 92/1719~ PCll/l,'S92/0~47~
~ 10 ~1 O O
the synthesis of thromboxane A2 within the platelet, reducing
the platelet activation response. Non-steroidal anti-
inflammatory agents, such as ibuprofen, phenolbutazone and
napthroxane may produce a similar effect by competitive
inhibition of a particular cyclooxygenase enzyme, which
catalyzes the synthesis of a precursor of thromboxane A2. A
similar therapeutic effect may be derived through the
administration of aspirin which has been demonstrated to
irreversably acetylate a cyclooxygenase enzyme necessary to
generate thromboxane A2. A third anti-platelet mechanism has
involved the platelet membrane so as to interfere with
surface receptor function. One such drug is dextran, a large
branched polysaccharide, which is believed to impair the
interaction of fibrinogen with platelet receptors that are
exposed during aggregation. Dextran is contraindicated for
patients with a history of renal problems or with cardiac
impairment. The therapeutic ticlopidine îs stated to inhibit
platelet adhesion and aggregation by suppressing the binding
of von Willebrand factor and/or fibrinogen to their
respective receptors on the platelet surface. However, it
has been found that ticlopidene possesses insufficient
specificity to eliminate the necessity of administering large
doses which, in turn, may be associated with clinical side
effects.
The aforementioned pharmaceuticals are ~oreign to the
body and may cause numerous adverse clinical side effects,
there being no way to prevent such compounds from
participating in other aspects of a patient's physiology or
biochemistry, particularly if high doses are required. It
would be desirable to provide for pharmaceuticals having such
specificity for certain of the reactions of hemostasis, that
they could be administered to patients at low doses, such
doses being much less likely to produce adverse effects in
patients.
An example of a pharmaceutical which is representative
of a therapeutic that is derived from natural components of
the hemostatic process is described in EPO Publication No.
317278. This publication discloses a method for inhibiting
thrombosis in a patient by administering to the patient a
WO92/1719~ P~ S92/02~7~
therapeutic polypeptide comprised of the amino-terminal
region of the ~ chain of platelet membrane glycoprotein Ib,
or a subfragment thereof.
The present invention is directed to the provision of
antithrombotic polypeptldes derived from a von Willebrand
factor, one of the proteins of the hemostatic mechanism.
Summary of the Present Invention
In accordance with the present invention, there is
provided a polypeptide patterned on a fragment of wild type
mature von Willebrand factor (vWF) subunit having one or more
binding sites of predetermined affinity for one or more of
the ligands selected from the group consisting of collagen,
glycosaminoglycans, proteoglycans, platelet glycoprotein Ib~,
platelet glycoprotein IIb/IIIa, or coagulation factor VIII,
said polypeptide having a modified amino acid sequence
relative to that of said fragment and an increased binding
affinity, relative to said predetermined affinity, for one or
more of said ligands.
In one embodiment, this invention provides for host
ZO cells containing recombinant vWF DNA sequences in which are
expressed biologically active and therapeutically useful
polypeptides related to the 52/48 kg/mole (kg/mol) tryptic
fragment or domain of mature vWF subunit.
Such polypeptides, when present in monomeric form, may
be used as antithrombotic agents. In dimerized form they can
be used as antihemorrhagic agents. When expressed in
mammalian host cells, such polypeptides are typically also
glycosylated.
` In accordance with the practice of this invention, there
are provided also biologically active polypeptides which are
effective in preventing adhesion of platelets to surfaces, in
inhibiting activation or aggregation of platelets, and in
inhibiting thrombosis. More specifically there are provided
polypeptides which are effective in inhibiting the binding of
von Willebrand factor multimers to platelet membrane
glycoprotein Ib~ and which are created by expression in host
cells of DNA sequences which reflect one or more mutations
WO92/1719~ PCT/US92/0247~
21071 00 6
determined from the vWF gene in one or more patients having
Type IIB von Willebrand disease, said mutations providing in
whole, or in part, the molecular basis for the disease.
Accordingly, there is provided a process for producing
from DNA encoding mature von Willebrand factor subunlt, or a
fragment thereof, a blologically active polypeptide which
process comprises the steps of (A) providing a DNA sequence
encoding a mature vWF subunit, or a fragment thereof, in
which one or more wild type codons are replaced by codons
specifying one or more amino acid mutations found in the vWF
DNA sequence of one or more Type IIB von Willebrand disease
patients; (B) inserting the DNA sequence so provided into a
suitable vector to create a construct comprising an
expression plasmid or viral expression vector, said construct
being capable of directing the expression in cells of said
biologically active polypeptide; (C) transforming a host cell
with said construct; and (D) culturing said transformed host
cell under conditions which cause expression within said host
cell of the polypeptide.
Known mutations reflective of the genotype and phenotype
of ~ype IIB von Willebrand disease and suitable for
incorporation into the DNA sequences useful in the practice
of the invention include Trp5s0 - Cys550; Ar~ Trp5~1; Ar~3
Trp~3; Val553 - Met553; and Glys6~ _ Asp561
It is believed that the inventionl and the mutagenesis
and protein expression procedures thereof, will be widely
practiced in the art to gen~erate mutant fragments of mature
von Willebrand factor subunit with improved therapeutic
utility.
Particularly useful examples of antithrombotic
polypeptides produced according to the practice of the
invention include the following:
(A) a monomeric polypeptide patterned upon a parent
polypeptide which comprises ~he amino acid sequence
35 . of that fragment of mature von Willebrand factor
subunit beginning approximately at residue 441
(arginine) and ending approximately at residue 730
(asparagine), or a subfragment thereof, in which
when compared to the parent polypeptide, one or
Wos~/1719~ CT/~'S92/0~17
more amino acid residues thereof are replaced by
the corresponding residues found at the equivalent
sequence positions of mature vWF subunit as
isolated from one or more humans with Type IIB von
Willebrand disease; and
(B) a polypeptide according to (A) above in which each
of cysteine residues 459, 462, ~L64, 471 and 474
thereof is replaced by a residue of glycine, and in
which cysteine residues 509 and 695 thereof are
linked by an intrachain disulfide bond.
Although the invention is described :initially in terms
of reproducing in recombinant DNA molecules particular
mutations determined from the vWF encoding DNA of Type IIB
disease patients, biologically active vWF-derived
polypeptides having similar or higher affinities for the
glycoprotein Ib(~) receptors of platelets and resultant
therapeutic utility may be artificially created by site
specific and random mutagenesis procedures.
Representative of these procedures is a process for
generating a biologically active mutant amino acid sequence
patterned upon wild type mature von Willebrand fac~or subunit
or a fragment thereof, said sequence demonstrating relative
to wild type subunit, or the said fragment thereof, an
increased binding affinity for GPIb~, and comprising the
steps of:
(A~ providing a population of oligonucleotides
corresponding to one or more mature vWF subunit DNA
~ubsequences and containing random mutations within
one or more of the codons within said subsequences;
(B) using the resultant population of mutant
oligonucleotides in a mutagenesis procedure with a
vWF or vWF fragment-encoding DNA sequence as
c template, thereby creating a random population of
mutagenized sequences;
(C) inserting the mixture of mutagenized vWF or vWF
fragment-encoding DNA sequences into plasmids or
vectors thereby creating a population of expression
plasmids or viral expression vectors;
... : : ,
WO92/1719~ P~T/US92/~247~
~0710~ 8
(D) inserting the resultant population of expression
plasmids or viral expression vectors into suitable
host cells;
(E) screening individual colonies or cultures of
resultant host cells for expression of vWF-derived
polypeptides having properties rleflective of Type
IIB vWF or of fragments thereof;
(F) having determined the DNA sequence of a vWF insert
in a colony or culture of a host cell expressing
vWF-derived polypeptide having said reflective
properties;
(G) expressing the mutagenized DNA sequence, or an
additional DNA sequence which is con~tructed to
reflect the changes identified in the mutagenized
sequence, in a host cell;
(H) isolating the mutant vWF-derived polypeptide
produced thereby.
Speaking more generally it is noted that von Willebrand
~actor is an unusually large, multivalent plasma protein that
is involved in platelet adhesion to the subendothelium and in
the formation of platelet plugs at sites of vascular injury.
Due specially to its multivalent character, the protein links
plate}ets to each other, to collagen and to
glycosaminoglycans and proteoglycans, and also protects and
then localizes coagulation factor VIII to the site of a
forming blood clot. The bivalent or multivalent character of
circulating vWF and the multiple potential function~ of each
mature subunit thereof provide a unique opportunity to affect
in vivo binding properties through mutagenesis o~ or covalent
alteration of the relevant binding sites.
Accordingly there is provided a process for producing a
polypeptide useful for treating or inhibiting thrombosis,
said polypeptide being patterned upon the wild type mature
vWF subunit, or a fragment thereof, and being derived -
therefrom as follows:
(A) providing a mutant vWF D~A sequence, said mutant
sequence being characterized as encoding a mature
vWF subunit, or a fragment thereof, the encoded
polypeptide having, relative to the corresponding
WO92/17192 ~ CT/U~92/0247
wild type polypeptide sequence, an increased
binding affinity for one or more of collagen,
glycosaminoglycans, proteoglycans, platelet
glycoprotein Ib~, platelet glycoprotein IIb/IIIa or
coagulation factor VIII;
(B) further mutagenizing the DNA sequence of (A) above
so that the encoded polypeptide expressed therefrom
has a lesser tendency to participate in disulfide-
induced dimerization or multimerization than the
polypeptide encoded by the DNA sequence of (A)
above; and
(C) expressing the further mutagenized DNA sequence of
(B) above in a host cell from which an undimerized
form of the encoded polypeptide may be extracted or
secreted.
Polypeptides of the present invention possess high
specificity for target binding domains on other
macromolecules, including platelet receptors involved in the
hemostatic mechanism. Generally speaking, polypeptides of
the present invention are believed to function by preventing
platelet adhesion, activation and aggregation, and are
expected to be effective at concentrations which are not
associated with clinically disadvantageous side effects.
Brief Description of the Drawinqs
Figure l is a table which shows the previously reported
amino acid and DNA se~uence for the mature von Willebrand
factor subunit (human) between residue 431 and residue 750
thereof (see also S~Q ID N0: l).
Figure 2 is a drawing of the disulfide dependent
association of two 5~/48 kg/mol vWF fragments to form a 116
kg/mol homodimer.
Figure 3 is a graph which shows the effect of two Type
IIB mutations on the ability of bacterially expressed vWF
fragments to bind to platelets.
Figure 4 is a graph which shows the effect of a single
Type I B mutation on the ability of bacterially-expressed vWF
fragments to bind platelets at two different concentrations
WO92/1719~ PCT/~'S92/02~7~
of a monocl~1~7 ~ ody which competes with vWF fragments
for platelet GPIb~ receptor.
Figure 5 is a map of the pCDM8 plasmid.
Figure 6 is a graph which shows the effect of the Trp5s0
~ Cys550 mutation on the affinity of the reduced and alkylated
36 kg/mol vWF fragment for platelet GPIb~ receptor.
Figure 7 is a graph which shows the effect of the Trp553
- Cys550 mutation on the affinity of the 116 kg/mol
homodimeric vWF fragment for platelet GPIb~ receptor.
lo Definltlons
Unless indicated otherwise herein, the following terms
have the indicated meanings.
Codon - A DNA sequence of three nucleotides (a triplet) which
encodes through mRNA an amino acid, a translation start
signal or a translation termination signal. For example, the
DNA nucleotide triplets TTA, TTG, CTT, CTC, CTA and CTG
encode the amino acid leucine ("Leu"); TAG, TAA and TGA are
translation stop signals; and ATG is a translation start
signal encoding methionine.
Structural Gene - A DNA sequence which encodes through its
corresponding messenger RNA ("mRNA") a sequence of amino
acids characteristic of a specific polypeptide. Structural
genes may also have RNAs as their primary product such as
transfer RNAs (tRNAs) or ribosomal RNAs (rRNAs).
Transcription - The process of producing RNA from a
structural gene.
Translation - The process of producing a polypeptide ~rom
~RNA.
Coding Sequence (Encoding DNA! - DNA sequences which, in ~he
appropriate reading frame, code ~or the amino acids of a
protein. For the purpose of the present invention, it should
be understood that the synthesis or use of a coding sequence
may necessarily involve synthesis or use of the corresponding
complementary strand, as shown by: 5'-CGG GGA GGA-3'/3'-
GCC CCT CCT-5' which "encvdes" the tripeptide NHt-arg-gly-
gly-C02H. A discussion of or claim to one strand is deemed
WO92/17]9' 11 2 ~ ~ 7 ~ ~ ~ PCT/U~9~/0~47~
to refer to or to claim the other strand and the double
stranded counterpart thereof as is appropriate, useful or
necessary in the practice of the art.
cDNA - A DNA molecule or sequence which has been
enzymatically synthesized from the sequence(s) present in an
mRNA template.
Transcribed Strand - The DNA strand whose nucleotide sequence
is read 3' ~ 5' by RNA polymerase to produce mRNA. This
strand is also referred to as the noncodina strand.
Codinq Strand or Non-Transcribed Strand - This strand is the
antiparallel compliment of the transcribed strand and has a
base sequence identical to that of the mRNA produced from the
transcribed strand except that thymine bases are present
(instead of uracil bases of the mRNA). It is referred to as
"coding" because like mRNA, and when examined 5' - 3', the
codons for translation may be directly discerned.
ssion - The process undergone by a structural gene to
produce a product. In the case of a protein product, it is a
combination of transcription and translation.
Mutation - A hereditable change in the genetic in~ormation of
a DNA molecule.
Recombinant DNA Molecule - A molecule consisti~g of se~ments
o~ DNA from different genomes which have been joined end-to-
end and have, or can be modified to have, the capacity to
in~ect some host cell and be maintained therein.
Replicon - the DNA required for replication in a particular
organism. It includes an origin of replication.
Bioloaical Activity - One or more functions, effects of,
activities performed or caused by a molecule in a biological
context (that is, in an organism or in an in vitrQ
facsimile). A characteristic biological activity of the 116
kg/mol homodimeric fragment of the mature von Wil}ebrand
factor subunit is the potential ability to bind to more than
one platelet GPIb receptor thereby enabling the molecule to
facilitate aggregation of platelets in the presence of
ristocetin. Other resultant or related effects of the 116
kg/mol species include function as a thrombotic and the
induction of platelet activation, and/or adhesion to
surfaces. Thus such a fragment has therapeutic utility in
wos2/1719~ PCT/~S92/02~7~
21071~0 12
the treatment of von Willebrand disease, as an
antihemorrhagic agent.
Similarly, a characteristic biological activity of the
5~/48 kg/mol monomeric fragm~nt of the mature von Willebrand
factor subunit is the potential ability to bind to only one
platelet GPIb receptor thereby enabling the molecule to
inhibit botrocetin-induced binding of multimeric vWF to
platelets. Other resultant or related ef~ects of the
undimerized 52/48 kg/mol species include inhibition of
platelet activation, aggregation, or adhesion to surfaces.
Thus, such a fragment has therapeutic utility as an
antithrombotic agent.
Mutant Polypeptide - A polypeptide derived from DNA encoding
a parent polypeptide, the DNA having been mutated leading to
the presence of one or more altered codons which dictate the
placement, during translation, into the mutant polypeptide
amino acid seguence of one or more substitute amino acids.
educinq Con~itions - Refers to the presence of a "reducing"
agent in a solution containing von Willebrand factor, or
polypeptides derived therefrom, which agent causes the
disruption of disulfide bonds of the vWF. ~owever,
consistent with usage typical in the art, the "reducing"
agent such as dithiothreitol ~DTT) causes a vWF disulfide
bond to be broken by formina a disulfide bond between a vWF
cysteine and the DTT with no net change in oxidation state of
the involved sulfur atoms.
Phaqe or Bacterio~haqe - Bacterial virus many of which
consist of DNA sequences encapsulated in a protein envelope
or coat ("capsid").
Promoter - DNA sequences upstream from a gene which promote
its transcription.
Cloninq Vehicle ~Vector) - A plasmid, phage DNA or other DNA
sequence which is able to replicate in a host cell, typically
characterized by one or a small number of endonuclease
recognition sites at which such DNA sequences may be cut in a
determinable ~ashion for the insertion of heterologous DNA
without attendant loss of an essential biological fur1ction of
the DNA, e.g., replication, production of coat proteins or
loss of expression control regions such as promoters or
W092/l7l9_ 13 '~Ji~ f~ 2/0247~
binding sites, and which may contain a selectable gene marker
suitable for use in the identification of host ~ells
transformed therewith, e.g., tetracycline resistance or
ampicillin resistance.
Plasmid - A nonchromosomal double-stranded DNA sequence
comprising an intact "replicon" such that the plasmid is
replicated in a host cell. When the plasmid is placed within
a procaryotic or eucaryotic host cell, the characteristics of
that cell may be changed (or transformed) as a result of the
DNA of the plasmid. For example, a plasmid carrying the gene
for tetracycline resistance ~TetR) transforms a cell
previously sensitive to tetracycline into one which is
resistant to it. A cell transformed by a plasmid is called a
"transformant."
Cloninq - The process of obtaining a population of organisms,
or DNA sequences or other macromolecules derived from one
such organism or sequence by asexual reproduction or DNA
replication.
~x~ression Plasmi~ - A plasmid into which has been inserted
the DNA being cloned, such as the von Willebrand factor
structural gene. The DNA sequence inserted therein may also
contain sequences which control the translation of mRNA
resultant therefrom, and contain restriction endonuclease
sites which facilitated assembly of, and may facilitate
further modification of, said expression plasmid. An
expression plasmid is capa~le of directing, in a host cell,
the expression therein of the encoded polypeptide and usually
contains a transcription promoter upstream from the DNA
sequence of the encoded structural gene. An expression
plasmid may or may not become integrated into the host
chromosomal DNA. For the purpose of this invention, an
integrated plasmid is nonetheless referred to as an
expression plasmid.
Viral Expression Vector - A viral expression vector is
similar to an expression plasmid except that the DNA may be
packaged into a viral particle that can transfect cells
throu~h a natural biological process.
Downstream - A nucleotide of the transcribed strand of a
structural gene is said to be downstream from another section
WV92/17192 PCT/~IS92/02~7~
2107 ~ 0~ 14 ``
of the gene if the nucleotide is normally read by RNA
polymerase after the earlier section of the gene. The
complimentary nucleotide of the nontranscribed strand, or the
corresponding base pair within the double stranded form of
the DNA, are also denominated downstream.
Additionally, and making reference to the direction of
transcription and of translation within the structural gene,
a restriction endonuclease sequence added upstream (or 5') to
the gene means it is added before the sequence encoding the
amino terminal end of the protein, while a modification
created downstream (or 3') to the structural gene means that
it is beyond the carboxy terminus-encoding region thereof.
von Willebrand factor ~vWF) - It is understood that all
references herein to von Willebrand factor refer to vWF in
humans. The term "von Willebrand factor" is intended to
include within its scope any and all of the tenns which are
defined below.
Pre-pro-vWF - von Willebrand factor is subject to extensive
posttranslational processing. "Pre-pro-vWF" contains (from
the N to the C terminus) a signal peptide comprised of
approximately 22 amino acid residues, a propeptide of
approximately 741 amino acids, and then the approximate 2,050
residues of circulating vWF.
Pro-vWF - The signal peptide has been removed from pre-pro-
vWF.Mature vWF - Circulating vWF as found in the plasma or as
bound to the subendothelium. It consists of a population of
polypeptide monomers which are typically associated into
numerous species of multimers thereof, each subunit of which
being 2,050 residues in length. Additionally, when expressed
in mammalian cells, mature vWF is usually glycosylated.
Additionally, von Willebrand factor is found as a
component of the subendothelial matrix, as a component of the
~-granules secreted by activated platelets, and as a
circulating blood plasma protein. It is possible that the
three-dimensional subunit structure or multisubunit structure
of vWF varies in these different contexts potentially caused,
for example, by differences in glycosylation. Such
differences do not prevent useful therapeutic vWF-derived
WO92/1719' ~ CT/~'S92/0247
polypeptides from being produced from the vWF DNA sequences
of endothelial cells or megakaryocytes according to the
practice of this invention.
Furthermore, it is possible that there are minor
biologically unimportant differences between the actual DNAs
and polypeptides manipulated or otherwise utilized in the
practice of the invention and the structural sequences of
amino acids or nucleotides thereof as reported herein. It is
understood that the invention encompasses any such
biologically unimportant variations. It is also understood
that within the genome of the human population there are
alleles encoding vWF subunits which contain unimportant amino
acid substitutes unrelated to Type IIB disease. It is
understood that the invention also encompasses the use of any
such variant sequences.
Heparin Bindinq Site - A domain comprised of one or more
regions of amino acid primary sequences of one or more mature
vWF subunits having a specific binding affinity for heparin
and/or other glycosaminoglycans and/or one or more species of
proteoglycans.
von Willebrand factor contains binding sites having
affinity for glycosaminoglycans, said sites being known to
demonstrate affinity for heparin or other glycosaminoglycans
patterned upon repeating units similar to those of heparin.
Because of these "heparin binding sites," vWF also has
affinity for proteoglycans (glycosaminoglycans anchored to a
protein core) typically found in the subendothelium.
Si~nal Peptide ~Sequence~ - A signal peptide is the sequence
of amino acids in a newly translated polypeptide which
signals translocation of the polypeptide across the membrane
of the endoplasmic reticulum and into the secretory pathway
~f the cell. A signal peptide typically occurs at the
beginning (amino terminus) of the protein and is 20-40 amino
acids long with a stretch of approximately 5-15 hydrophobic
amino acids in its center. Typically the signal se~uence is
proteolytically cleaved from the protein during, or soon
after, the process of translocation into the endoplasmic
reticulum. That portion of a gene or cDNA encoding a signal
peptide may also be referred to as a signal sequence.
WO92/1719~ PCT/~'S92/0247~
2~71~0 16
Wild Type Amino Acid Sequence - refers to the amino acid
sequence of mature vWF subunit, or of a fragment thereof,
which is present in the large majority of humans, and refers
also to any mutant amino acid sequence as isolated from vWF
of a particular person if no detectable functional
differences in the vWF with respect to its interaction with
GPIb~ result therefrom in humans.
Modified Amino Acid Sequence - reflects any change in the
primary structure of a sequence of amino acids of mature vWF
subunit compared to wild type sequence. Representative
examples of modifications with respect to one or more amino
acid residues at one or more primary sequence positions in a
polypeptide include deletions, additions, substitutions and
the covalent labelling of amino acids present therein or the
addition of amino acids containing such labels, i.e.,
radicals or blocking groups which affect the properties of
the amino acid residues so labelled.
Peptide - for the puxposes of this invention, the terms
"peptide" and "polypeptide" are interchangable.
Purified or Substantially in Pure Form - when used with
respect to one or more vWF-encoding DNAs or vWF-derived
polypeptides, these and similar terms mean that the
composition is substantially free of most of the cellular
protoplasm, non vWF-protein, or extracellular material with
which the DNA or polypeptide normally occurs in the body.
Monomeric - when used with respect to polypeptides,
"monomeric" refers to a polypeptide which is not covalently
linked to another polypeptide. "Dimeric" refers to a
covalent association of two monomers.
Fraoment - when used with respect to vWF subunit, this term
refers to any sequence composed of less than the 2,050 amino
acid residues of the mature subunit which can be generated by
deleting one or more residues from either the amino or the
carboxy terminals of said subunit, or by deletion of one or
more residues within the subunit. When used with respect to
mature multimeric vWF, the term refers to any combination of
subunits and/or fragments of subunits having a combined
molecular weight less than about 30 times the weight of a
single subunit.
W09/1719 17 ~ ~q~l7 ~ ~ ~CT/~'S92/02~7~
vWF-Derived PolypePtide - a vWF-derived polypeptide refers to
any amino acid sequence which is patterned upon the 2,050
residue mature vWF subunit sequence, or any combinations of
subsets thereof, and which contains any of the above defined
"modifications". Such derived polypeptides can be made
through expression of an appropriate encoding DNA or by
chemical modification of vWF subunit or a fragment thereof.
Other terms used in connection with the description of vWF-
derived polypeptides of the invention include "comparable
wild type sequence" and "equivalent sequence position" which
are best described by way of example.
With respect to the residue 441-730 fragment of mature
vWF subunit containing a cysteine residue at position 550,
the "comparable wild type sequence" is the 441-730 ~ragment
containing tryptophan at position 550. ~Equivalent sequence
position" means that the substituted amino acid (for example
Cys550) occupies the same position in the vWF-derived
polypeptide (position 550) as in the amino acid sequence of
vWF subunit from the Type IIB patient from which the mutation
was identified, and thus, for example, the incorporation of a
Trp550-Cys550 mutation into a vWF-derived polypeptide would not
affect the positioning of Lys~ or Val551.
Table l shows the standard three letter designations for
amino acids as used in the application.
WO92/17192 PCT/~IS92/02~7
2 i 0 7lO 0 l8
TABLE I
Alanine Ala
Cysteine Cys
Aspartic Acid Asp
5 Glutamic Acid Glu
Phenylalanine Phe
Glycine Gly
Histidine His
Isoleucine Ile
lO Lysine Lys
Leucine Leu
Methionine Met
Asparagine Asn
Proline Pro
15 Glutamine Gln
Arginine Arg
Serine Ser
Threonine Thr
Valine Val
20 Tryptophan Trp
Tyrosine Tyr
Detailed Description of the Invention
A ~Sequence Listing" pursuant to 37 CFR 1.821~c) for
nucleotide and amino acid sequences disclosed or referred to
herein is appended and made part of this application.
As set forth above, both the antithrombotic and
antihemorrhagic polypeptides of the present invention are
based upon fragments of the natural occurring protein von
Willebrand factor. For background purposes, there is set
forth hereafter information concerning this protein and its
role in hemostasis and thr~ombosis.
Description of the Role_of vWF in Hemostasis and Thrombosis
vWF performs an essential role in normal hemostasis
during vascular injury and is also of central importance in
the pathogenesis of acute thrombotic occlusions in diseased
blood vessels. Both of these roles involve the interaction
of vWF with platelets which are induced to bind at the
affected site and are then crosslinked. It is believed that
single platelets first adhPre to a thrombogenic surface after
which they become activated, a process involving major
metabolic changes and significant morphological changes
within the platelet. Activation is evidenced by the discharge
WO92/1719 ~ CT/~S92/02~7
19
of platelet storage granules containing adhesive substances
such as von Willebrand factor (an adhesive protein), and the
expression on the surface of the platelet of additional
functional adhesive sites. Once activated, and as a part of
normal hemostasis, platelet cells become aggregated, a
process which involves extensive cross~ king of the platelet
cells with additional types of adhesive proteins.
As stated above, these processes are normal as a
physiologic response to vascular injury. However, they may
lead in patholoyic circumstances, such as in diseased
vessels, to formation of undesired platelet thrombi with
resultant vascular occlusion.
Other circumstances in which it is desirable to prevent
deposition of platelets in blood vessels include the
prevention and treatment of stroke, and to prevent occlusion
of arterial grafts. Platelet thrombus formation during
surgical procedures may also interfere with attempts to
relieve preexisting vessel obstructions.
The adhesion of platelets to damaged or diseased vessels
occurs through mechanisms that involve specific platelet
membrane receptors which interact with specialized adhesive
molecules. One such platelet receptor is the glycoprotein
Ib-IX complex which consists of a noncovalent association of
two integral membrane proteins, glycoprotein Ib ~GPIb) and
glycoprotein IX (GPIX). The adhesive ligand of the GPIb-IX
complex is the protein von ~illebrand factor which is found
as a component of the subendothelial matrix, as a co~ponent
of the ~-granules secreted by activated platelets, and also
as a circulating blood plasma protein. The actual binding
site of the vWF to the GPIb-IX receptor has been localized on
the amino terminal region of the ~ chain of glycoprotein Ib
which is represented by GPIb(~).
- von Willebrand factor exists as a series of high
molecular weight multimers of up to 30 glycosylated subunits
per multimer in which the subunits are believed to be
identical, with each having an approximate molecular weight
of Z70,000 (Z70 kg/mol). Formation of an initial monolayer
of platelets covering injured endothelial surfaces is
believed to involve a bridging function in which surface
.. . ..
WO92/171~' PCT/~'S9'/0247~
2~71~ 20
bound multimeric vWF binds on the one side to components of
the subendothelium, such as collagen or proteoglycans, and on
the other side to the GPIb-IX receptor of a platelet
membrane. Evidence that von Willebrand factor is necessary
for thrombus formation has been provided by studies using
anti-vWF monoclonal antibodies to induce a deficieny in
circulating vWF, Bellinger, D.A. et al., Proc. Natl. Acad.
Sci.~ USA, 84, 8100-8104 (1987), and by studies utilizing a
monoclonal antibody specific for the platelet glycoprotein
IIb/IIIa receptor, Coller, B.S. et al., Blood, 68, 783
(1986). The essential role of von Willebrand factor in
hemostasis and thrombosis is further evidenced in patients
who are deficient in the glycoprotein Ib-IX complex. These
persons exhibit a disease state characterized by severe
bleeding following nominal vascular injury under otherwise
nonpathologic conditions.
It is believed that the interaction of multimeric vWF
with glycoprotein Ib-IX complex (at GPIb(~)) results in
platelet activation and facilitates the recruitment of
additional platelets to a now growing thrombus. The rapidly
accumulating platelets are also crosslinked (aggregated) by
the binding of fibrinogen at platelet glycoprotein IIb-IIIa
receptor sites, and possibly also by vWF at these sites,
and/or at additional glycoprotein Ib-IX receptor sites. In
addition, the glycoprotein IIb/IIIa receptor may also be
involved in the formation of the initial monolayer of
platelets. Of particular imPortance in this process is the
multimeric and multivalent character of circulating vWF,
which enables the macromolecule to effectively carry out its
binding and bridging functions.
Inactivation of the GPIb~ or GPIIb/IIIa receptors on the
platelets of a patient or inactivation of the binding sites
for vWF located in the subendothelium of a patient's vascular
system, thereby inhibiting the bridging ability of vWF, would
be of great medical importance for treating or inhibiting
thrombosis. Accordingly, the present invention relates to
the development of polypeptides which are effective in
accomplishing the foregoing.
WO9t/1719~ PCT/US92/02~7
21 21 ~7 ~ ~
Although preventing unwanted thrombi is of great
importance, there are circumstances where promoting thrombus
formation is desirable. von Willebrand disease, the most
common of the bleeding disorders, is the term used to
describe a heterogeneous disease state which results when von
Willebrand factor is produced in inadequate quantities or
when circulating vWF molecules are somehow defective.
Various subtypes of the disease have been described. It is
apparent that supplying the bridging function of vWF is of
central importance in the treatment of patients afflicted
with von Willebrand disease. The present invention is
concerned with preparation of fragments of von Willebrand
factor capable of pPrforming a bridging function between the
GPIb(~) receptor or GPIIb/I~Ia receptor of the platelet
membrane and a receptor on another platelet, or between such
a receptor and components of the subendothelium, thereby
performing in affected individuals the crucial physiological
role of native multimeric von Willebrand factor.
Information Concerning the Structure of vWF
and the Desiqn of Therapeutics Derived Therefrom
As mentioned above, von Willebrand factor which
circulates in the blood exists as a series of high molecular
weight multimers containing up to 30 glycosylated subunits
per multimer in which the subunits are b~lieved to be
identical, each having an approximate molecular weight of
about 270 kgtmol. The circulating "mature" human subunit
consists of 2050 amino acid residues. Its structure is the
final result of extensive post-translational processing.
von Willebrand factor is synthesized in endothelial
cells and megakaryocytesO The vWF mRNA is comprised of
approximately 9,000 bases and encodes for a polypeptide
containing 2,813 amino acid residues. This protein is known
as 'Ipre-pro-vWF''. After translation and entry into the
endoplasmic reticulum, the von Willebrand factor subunit is
believed to rapidly dimerize via disulfide bonds involving
the carboxy and amino termini regions of respective subunits.
Associated with the passages of pre-pro-vWF into the
endoplasmic reticulum is the cleavage of the 22 amino acid
WO92/17192 PCT/~'S92/02~7~
2107~ 22
signal peptide resulting in the "pro vWF" form of the
polypeptide.
Other post translational even~s, the timing of which ls
not fully understood, include glycosylation of at least 22
sites, sulfation, and finally cleavage of a ~41 amino acid
sequence, the propeptide, from the amino terminal end of the
pro-subunit. Finally, dimerized mature v'WF subunits (each
subunit now comprising 2050 amino acids) are assembled into
multimers of larger size by formation of interchain disulfide
bonds.
The mature vWF protein from endothelial cells is either
secreted constitutively or stored in Weibel-Palade bodies for
later release. vWF from megakaryocytes is packaged into the
alpha granules of platelets and is secreted at the-time of
platelet activation.
The domain of the von Willebrand factor subunit which
binds to the platelet membrane glycoprotein Ib-IX receptor
(GPIb(~)) has been identified within a fragment of vWF. The
fragment may be generated by trypsin digestion, followed by
disulfide reduction, and extends from approximately residue
449 (valine) of the circulating subunit to approximately
residue 728 (lysine) thereof. Current evidence indicates
that this segment also contains (between residues 509 and 695
thereof) binding domains for components of the
subendothelium, such as collagen and proteoglycans, although
other regions of the mature vWF subunit may be more important
in recognizing these substances (an additional proteoglycan
or heparin binding site is located in residues 1-272 o~ the
mature subunit and an additional collagen binding site within
residues 9lO-lllO thereof). The tetrapeptide Arg Gly Asp Ser
(SEQ ID NO: 2) ~residues 1744 to 1747), a sequence which vWF
shares with many othsr adhesive proteins, is believed to
represont the platelet glycoprotein IIb-IIIa binding site.
The primary and tertiary structure of von Willebrand factor
and the location o~ functional domains thereof is reviewed by
Titani, K. et al., 7'Primary Structure of Human von Willebrand
Factor" in Coaaulation and Bleedinq Disorders: The Role of
Factor VIII and von Willebrand Factor, T. Zimmerman and Z.M.
Ruggeri, eds., Marcel Dekker, New York, 1989.
WO92/1719~ PCT/~'S92/02~7
23 ~ a/~
Figure 1 shows the previously reported amino acid and
DNA sequence for the mature von Willebrand factor subunit
(human) between residue 431 and residue 750. The 52/48
kg/mol fragment produced by tryptic digestion has an amino
terminus at residue 449 (valine) and extends approximately to
residue 728 (lysine). Amino acids are shown by standard
three letter designations. The DNA sequence is represented
by the coding strand (non-transcribed strand). Very little
polymorphism has been reported in the 52~48 human sequence
with one significant exception - histidine/aspartic acid at
position 709, see Mancuso, D.J. et al. J. Biol. Chem.,
264(33), 19514-19527, Table V, (1989). (See also SEQ ID NO:
1) ~
As described in the parent '606 application,
polypeptides derived from the above mentioned region of the
circulating (mature) von Willebrand factor subunit - from
approximately residue 4~9 to approximately residue 728, or
subsets thereof are considered useful as antithrombotic
pharmaceuticals when added to blood in such sufficient
amounts as to compete successfully with multimeric vWF for
platelet GPlb(~) receptor sites, thereby preventing monolayer
formation by, or crosslinking of~ the platelets in
circumstances where thrombus formation is undesirable, such
as in the treatment of vascular disorders. The '606
application identifies numerous publications which relate to
the structure, function and molecular genetics of von
Willebrand factor, such publications being incorporated
herein by reference.
With respect to the mutant therapeutic antithrombotic
polypeptides of the present invention, the following
information concerning vWF is of particular interest.
A fragment of mature von Willebrand factor having
platelet glycoprotein lb(~) binding activity and of
approximately 116,000 tll6 kg/mol) molecular weight is
isolated by digesting vWF with trypsin. If the 116 kg/mol
fragment is treated with a reducing agent capable of cleaving
disulfide bonds, a pair of identical fragments is generated~
Each of the identical fragments (which together comprise the
116 kg/mol polypeptide) has an apparent molecular weight of
WO 92/1719~ PCI`/ ~!s92/o ;!47:~
21~710~ 24
about 52,000 (52 kg/mol). (Polypeptide molecular weight are
typically measured by migration, relative to standards, in a
denaturing gel electrophoresis system. Weight values which
result are only approximate.)
Typically, the 52, 000 molecular weight fragment is
referred to as a "52/48" fragment reflectin~ the fact that
human enzyme systems glycosylate the fra~ment contributing to
its molecular weight. The amount of glycosylation varies
from molecule to molecule, with two weights, 52,000 and
48,000, being most common.
The 52/~8 ~ragment has been demonstrated to have as its
amino-terminus residue 449 ~valine) of the mature subunit,
and as its carboxy-terminus residue 728 (lysine) thereof.
Without the additional weight contributed by glycosylation,
the polypeptide has a molecular weight of approximately
38,000.
The 52/48 fragment has been demonstrated to
competitively inhibit the binding of von Willebrand factor to
platelets. However, manipulation of the 52/48 fragment or
its unglycosylated 38 kg/mol equivalent has proved difficult.
Successful manipulation of the fragment has typically
required that the cysteine residues thereof be reduced and
permanently alkylated. Without this treatment, undesired
reaction of the cysteine residues thereof invariably occurs,
leading to the formation of insoluble and biologically
inactive polypeptide aggregates unsuited for ef~ective use as
therapeutics.
It is known that the residue 449-728 fragment of mature
von Willebrand factor subunit, which contains the platelet
glycoprotein Ib(~ binding domain, has cysteine residues at
positions 459, 462, 464, 471, 474, 509 and 695. It is known
also that all of the cysteine residues of the mature vWF
subunit are involved in disulfide bonds. (Legaz, et al., J.
Biol. Chem., 248, 3946-3955 (1973)).
Marti, T. et al. Biochemistry, 26, 8099-8109 (1987)
conclusively identified mature subunit residues 471 and 474
as being involved in an intra~hain disulfide bond. Residues
509 and 695 were identified as being involved in a disulfide
bond, althouqh it was not demonstrated whether this pairing
WO 92/17191 PCT/~'S92/0247
25 ~
was intrachain or interchain (that is, within the same mature
vWF subunit).
Mohri, H. et al. J. Blol. Chem., 263(34), 17901-17904
(1988) inhibited the ristocetin-induced binding of ~
labelled multimeric vWF to formalin-fixed platelets with
peptide subfragments of the 449-728 subunit fragment.
Peptide subfragments fifteen residues in length were
synthesized and tested. Those peptides which represent
subunit sequence contained within, or overlapping with, two
distinct regions Leu469 to Asp498 and Glu689 to Val7~3 were found
to be active. Although individual peptides were shown to
interact with GPIb(~) receptor, a synergistic eff~ct was
noted when two peptides (one from each region) were used,
suggesting that the two sequences are in close spatial
relation in the correctly folded vWF molecule even though
they are far apart in the vWF subunit primary sequence.
Mohri, H. et al. tested their hypothesis by using the 15
residue peptides to map the epitopes of several murine
monoclonal anti-vWF antibodies which were selected because of
their ability to block the vWF-GPIb(~) interaction. The
epitope of NMC-4 was found to map into the same two discrete
regions of the vWF amino acid se~uence previously noted as
having GPIb(~) receptor binding capability (Leu~9-Asp498 and
Glu689-Val713). T~e epitope was demonstrated to require the
simultaneous presence of amino acid sequence from both
primary sequence regions as demonstrated by the binding of
NMC-4 to the homodimeric 116 kg/mol vWF subunit fragment in
unreduced form but not to the reduced 52/48 fragment.
Mohri concluded that the GPIb(~) binding domain of vWF
was formed by residues contained in two discontinuous
sequences Cys474-Pro4~B and Leu6~-Pro7~ maintained in proper
conformation in native vWF by disulfide bonding, although the
authors were unable to identify the cysteine residue which
formed the stabilizing bond(s) and whether the bonds were
intra or interchain.
Inasmuch as the present invention is concerned with the
production of certain mutant polypeptides that are cysteine-
deficient relative to the parent polypeptide, there is set
forth below background information concerning the sulfur-
WO92/17192 - PCT/~IS92/0247~
~1~71~0 26
containing amino acid cysteine and the nature of intrachain
and interchain disulfide bonds which are present in that
fragment of a mature vWF subunit comprising approximately
residue position 449 to 728, or which lin~ the subunit
fragment to similar domains on other subunits.
Information Concernina Cysteine and Disulfide Bonds
Cysteine is unique among the amino acids which typically
form the primary sequence of proteins in that, with rare
exceptions, it is the only amino acid which forms a covalent
bond to another residue of the protein other than a backbone
amide linkage, and thereby alters the three-dimensional
structure of the polypeptide.
The thiol group (SH) of a cysteine residue in a
polypeptide is capable of combining with the equivalent group
of another cysteine to form a covalent disulfide bridge (-S-
S-). Since cysteine residues otherwise far apart in the
primary sequence of the molecule can be combined in this way,
disulflde bonds are a potentially important factor in
determining the three dimensional structure of a protein.
In fact for many proteins, their structures, catalytic
activities, or other functions require that certain disulfide
bonds be formed. If a disulfide bond forms between two
cysteines contained within the primary sequence of one
polypeptide, the bond is defined as "intrachain." If the
cysteines forming a disulfide bond are found on different
protein molecules, or polypeptides thereof, the bond is
defined as "interchain."
The fragment of mature von Willebrand ~actor subunit
(approximate residues 449 to 728) which contains the platelet
glycoprotein lbf~) binding domain, and which is thus useful
in the design of antithrombotic therapeutics, contains 7
cy~teine residues, at positions 459, 462, 464, 471, 474, 509
and 695 thereof.
There is hereafter provided a first embodiment of the
invention involving recombinant DNA molecules expressed in
host bacterial cells and suitable for the expression of
therapeutic polypeptides patterned on vWF, and a second
embodiment involving recombinant DNA molecules expressed in
WO92/1719' ~ ~ 7 i ~ S92/0247~
27
host eucaryotic cells and suitable for the expression of
therapeutic polypeptides patterned on vWF, and a third
embodiment of the invention comprising the construction and
utilization of vWF-derived polypeptides reflecting enhanced
affinity for GPIb~ and patterned upon the polypeptides of the
aforementioned first and second embodiments.
First Embodiment of the Invention
(U.S. Serial No. 07/600,183)
A first embodiment of the inventi~n provides for
polypèptides derived from the residue 449-728 region of the
mature von Willebrand factor subunit which are useful in the
treatment of vascular disorders such as thrombosis.
Among the polypeptides so provided are
(A) a polypeptide patterned upon a parent polypeptide
and comprising the amino acid sequence of that
fra~ment of mature von Willebrand factor subunit
which begins approximately at residue 441
(arginine) and ends at approximately residue .733
(valine), or any subset thereof, in which one or
more of the cysteine residues normally present in
the parent polypeptide, or subset thereof, have
been deleted and/or replaced by one or more other
amino acids, said polypeptide having therefore less
tendency than the parent polypeptide, or subset
thereof, to form intra or interchain disulfide
bonds in aqueous media at a physiological pH; and
(B) a polypeptide comprising the amino acid sequence
from approximately residue 441 (arginine) to
approximately residue 733 (valine) of mature von
Willebrand factor subunit, or any subset of said
sequence which contains residues 509 (cysteine) and
695 (cysteine), wherein one or more of cysteine
residues 459, 462, 464, 471, and 474 are deleted or
replaced by one or more other amino acids.
Such molecules can be made from DNA which encodes that
fra~ment of mature von Willebrand factor subunit comprising
essentially the amino acid sequence from approximately
residue 441 (arginine) to approximately residue 733 (valine),
WO92/1719~ PCT/~'S92/0247~
21~ r~ ~ o 0 28 ~
or which encodes any subset of said amino acid sequence, a
mutant polypeptide fra~ment, or subset thereof, which
contains fewer cysteine residues than that of the comparable
wild-type amino acid sequence. Preparation of the molecules
comprises culturing a host organism trans~ormed with a
- biologically functional expression plasmicl which contains a
mutant DNA sequence encoding a portion of said von Willebrand
~actor subunit under conditions which effect expression of
the mutant von Willebrand factor fragment, or a subset
thereof, by the host organism and recovering said fragment
therefrom.
The preferred means for effecting mutagenesis of
cysteine codons in a vWF DNA to codons encoding amino acids
incapable of disulfide bonding is based upon the site
directed mutagenesis procedure of Kunkel, T.A., Proc. Natl.
Acad. Sci. U.S.A., 82, 488-492 (1985).
An important aspect of the embodiment is the provision
of compositions o~ said vWF~derived polypeptides wh:ich are
less prone to aggregation and denaturation caused by
undesired disulfide bonding within the inclusion bodies of
host expression cells (or resultant from inclusion body
solubilization procedures~ than previous preparations. The
development employs mutagenesis to limit the number of
cysteine residues present within said polypeptides.
More specifically, preparation of a mutant polypeptide
fragment which corresponds to that fragment of mature von
Willebrand subunit having an amino terminus at residue 441
(arginine) and a carboxy terminus at residue 733 (valine),
but which differs therefrom in that each o~ the cysteine
residues thereof is replaced by a glycine residue is
disclosed. The embodiment also teaches that retention of a
certain disulfide bond within polypeptides corresponding to
the 449-728 vWF subuni~ region is particularly important for
the design of therapeutic molecules derived therefrom.
To accomplish this, a cDNA clone encoding the von
Willebrand factor gene (for the pre-propeptide) was utilized.
The cDNA was then subjected to enzymatic amplification in a
polymerase chain reaction using oligonucleotides which
flanked the indicated region. The first oligonucleotide
WO92/1719~ 2 ~ S92~0247
29
representing coding strand DNA contained an EcoRI site 5' to
`the codon for residue 441 (arginine) and extended to the
codon for residue 446 (glycine). The second oligonucleotide,
corresponding to non-coding strand DNA, encoded amino acids
725 to 733 and encoded 3' to codon 733 a HindIII restriction
sequence. The resultant double stranded von Willebrand
factor cDNA corresponding to the amino acid sequence from
residue 441 to residue 733 (of the mature subunit) was then
inserted, using EcoRI and HindIII restrict:ion enzymes, into
the double stranded replicative form of bacteriophage M13mpl8
which contains a multiple cloning site having compatible
EcoRI and HindIII sequences. Following the procedure of
Xunkel, T.A., Proc. Natl. Acad. Sci. USA, 82, 488-492 (1985),
site directed mutagenesis was performed using hybridizing
oligonucleotides suitable for replacing all of the cysteine
codons (residue positions 459, 462, 464, 471, 474, 509 and
695) with individual glycine codons tsee Example 1) or 5 of
the cysteine codons (residue positions 459, 462, 464, 471 and
474) with individual glycine codons (see Example 4). Mutant
double stranded vWF cDNA fragments derived from the procedure
were removed from M13mpl8 phage by treatment with EcoRI and
HindIII restriction endonucleases, after which the ends of
the vWF cDNA fragments were modified with BamHI linkersO
The two types of mutant vWF cDNA, containing either 5 or
7 Cys to Gly mutations, were then separately ~lon~d into the
pET-3A expression vector (see Rosenberg, A.H. et al., Gene,
56, 125-136 tl987)) for expression from E.coli strain
BL21(DE3), Novagen Co., Madison, WI. pET-3A vehicle
containing cDNA for the vWF subunit fragment with 7 cysteine
to glycine mutations is referred to as l'p7EII, and as "p5E"
when the contained vWF cDNA fragment encoded the 5 above
specified cysteine to glycine mutations. Mutant von
Willebrand factor polypeptides produced by bacterial cultures
containing expression plasmid p5E were compared with those
expressed from cultures containing p7E plasmids. The p5E
mole~ule is capable of forming a disulfide bond between
cysteine residue 509 and 695 whereas the p7E molecule cannot.
WO92/17192 PCT/~IS92/02~7
2 1 07t oa 30
The behavior of p5E and p7E extracts was examined using
immunological methods (see ~xample 5). vWF-specific murine
monoclonal antibodies RG-46 and NMC-4 were used as probes.
RG-46 has been demonstrated to recognize as its epitope a
linear sequence of amino acids, comprising residues 694 to
708 within the mature von Willebrand fact:or subunit. The
binding of this antibody to its determinant is essentially
conformation independent. Mohri, H. et al., J. Biol. Chem.,
263(34), 17901-17904 (1988).
NMC-4 however, has as its epitope the domain of the von
Willebrand factor subunit which contains the glycoprotein Ib
binding site. Mapping of the epitope has demonstratecl that
it is contained within two discontinuous domains (comprising
approximately mature vWF subunit residues 474 to 488 and also
approximately residues 694 to 708) brought into disulfide-
dependent association, Mohri, H. et al., supra, although it
could not be determined whether the disulfide bond conferring
this tertiary conformation in the native vWF molecule was
intrachain or interchain. Id. at 17903.
Accordingly, 7.5 ~g samples (of protein) were first run
on 10~ SDS-polyacrylamide gels so that the antigenic behavior
of particular bands ~under reducing and nonreducing
conditions) could be compared with results obtained ~y
Coomassie blue staining. Immunoblotting ~"Western Blotting")
according to a standard procedure, Burnette, A. Anal.
Biochem., 112, 195-203 (1981), was then performed to compare
p5E and p7E extracts.
Briefly, it was ~ound that, under nonreducing
conditions, the single chain p5E polypeptide Pragment
~representing the sequence from residue 4~1 to residue 733)
displays an approximate 120 fold increase in binding affinity
for NMC-4 compared to the comparable cysteine-free species
isolated from p7E. After electrophoresis under reducing
conditions (utilizing 100 mM DTT), the single chain p5E
species shows a remarkably decreased affinity for NMC-4,
which was then very similar to that of the cysteine-free p7E
species under either reduced or nonreduced conditions. NMC-4
also failed, under reducing or non-reducing conditions, to
: ` :
WO92/1719~ 2 ~ ~ 7 ~ ~ ~ PCT/~IS92/0247~
recognize as an epitope disulfide-linked dimers from the p5E
extract.
The nitrocellulose filters used to produce autoradio-
graphs based on NMC-4 were rescreened with RG-45 by
subtracting the initial NMC-4 exposure response, which was
kept low through a combination of low antibody titer and
short exposure time. The binding of RG-46 to the 36,000
kg/mol p7E polypeptide on the filters was the same whether
reducing or non-reducing conditions were chosen, consistPnt
with the replacement of all cysteines by glycine in the
expressed polypeptide.
A large molecular weight vWF antigen (reactive to RG-46)
was present in the p5E polypeptide extract under nonreducing
conditions. These p5E vWF aggregates (reflecting interchain
disulfide bonds) migrated under reducing conditions in the
same position as the p7E polypeptide indicating disruption of
their disulfide contacts. However, the large p5E interchain
disulfide aggregates which are readily recognized under
nonreducing conditions by RG-~6 were not recognized by NMC-4
under either reducing or nonreducing conditions. It was thus
demonstrated that the disulfide bond between residues 509 and
695 in native multimeric vWF subunits represents an
intrachain contact.
The disulfide bond between residues 471 and 474 of the
mature vWF subunit has previously been shown to be an
intrachain contact, thus the aforementioned embodiment is
able to suggest that inter~chain disulfide bond(s) in
multisubunit mature vWF would be formed using one or more of
cysteine residues 459, 462 or 464.
This discovery is expected to be particularly useful in
the design of therapeutic vWF polypeptides patterned upon the
52/48 tryptic fragment (for use as antithrombotics) or
patterned instead upon the 116 kg/mol homodimer thereof (for
use as antihemorrhagics).
Disulfide Enqineerinq_in the A3 Sequence Domain
The 52/48 tryptic fragment of the mature vWF suhunit has
been established to comprise the amino acid sPquence between
residues 44g and 728. Contained within that sequence is a
WO92/171~2 , PCT/U~92/0247
2107 ~ 32
subfragment consistinq approximately of residues 500 to 700
known as the A~ domain. This domain has substantial amino
acid sequence homology to the A2 and A3 domains of the 2,050
residue subunit and which are located at approximately
residue positions 710-910 (A2) and 910-1110 (A3). See Titani,
K. et al "Primary Structure of Human von Willebrand Factor"
in Coa~ulation and Bleedinq Disorders, Marcel Dekker, New
York, 1989.
It has been discovered that these "A" domains also share
substantial amino acid sequence homology ~at minimum
approximately 15-20~) with similar domains in numerous other
adhesive proteins. Twenty percent sequence homology is
generally recognized as being far to great to appear by
chance. As recognized by Mancuso, D.J. et al J. Biol Chem,
15 264~33) 19514-19527 (1989), these homologies clearly suggest
that the vWF subunit is the product of a mosaic gene which
contains subregions shared by many other proteins. These
homologies probably arose from repeated gene segment
duplication and exon shuffling.
Pharmacologically active collagen binding polypeptides
can be derived ~rom the "A3" domain. The A3 domain contains
also a pair of cysteine residues which are believed to form
in vivo, a loop analogous to the residue 509-695 Al loop
structure. The potential utility of this new mutant vWF
fragment as an inhibitor of the binding of multimeric vWF to
collagen can be demonstrated following the procedures of
Pareti, F.I. et al., J. Biol. Chem., 262(28), 13835-13841
(1987) and Mohri, H. et al., J. Biol. Chem., 264(29), 17361-
17367 (1989).
Second Embodiment of the Invention
(U.S. Serial No 07/613.004~
This second embodiment includes within its scope the
recognition of certain of the roles performed by cysteine
residues present in the residue 449-728 primary sequence
fragment of the mature vWF subunit. In this connection, this
embodiment confirms that the cysteine 509-695 disulfide bond
is an intrachain bond and provides for effective therapeutics
incorporating the 509-695 bond for the purpose of treating
WO92/17192 2 ~ ~ 7 t ~ ~CT/US92/0247'
thrombosis, or for the purpose of treating von Willebrand's
disease.
Both the antithrombotic polypeptides and antihemorrhagic
polypeptides of this the second embodiment of the invention
are based upon that amino acid sequence domain which
comprises approximately residues 449 to 728 of the mature von
Willebrand factor subunit and which, if fully glycosylated,
would bP equivalent in weight to the 52/48 ~g/mol vWF subunit
fragment. In practice it is difficult to derive
therapeutically useful quantities of such polypeptides from
blood plasma. Difficulties include effective separation of
116 kg/mol and 52/48 kg/mol fragments from other components
of tryptic digests and effective sterilization of blood-
derived components from human viruses such as hepatitis and
AIDS. In addition, methods reported in the literature to
generate the 52/48 kg/mol monomer from the 116 kg/mol dimer
have utilized complete disulfide reduction with resultant
loss of tertiary structure. Certain important man:ipulations
of the 52/48 fragment, such as replacement of selective
cysteine residues to improve product utility and stability,
can only be accomplished in a practical sense by recombinant
DNA technology.
However, the production by recombinant DNA-directed
means of therapeutic vWF polypeptides analogous to the 52/48
tryptic fragment has met with certain limitations. It is
desirable that the polypeptide not only be made by the host
cells but that it be correctly folded for maximum therapeutic
utility. It is believed that the principal factor which has
to date prevented the expression of the most therapeutically
active forms o~ the 52/48 ~ragment is the incorrect folding
of the molecule caused by the linking up of cysteine residues
to form incorrect disulfide contacts. In addition, such
' polypeptides appear to exhibit hydrophobic properties or
solubility problems which would not be encountered if they
were to be contained within ~he entirety of the natural vWF
subunit, or were properly glycosylatad.
Of critical importance, therefore, to the synthesis of
vWF-derived therapeutic polypeptides is the selection of
conditions which minimize the formation of improper disulfide
WO92/17192 PCT/~'S92/0~47~
2la7l~
contacts~ Prior expression of such polypeptides from
recombinant DNA in host bacterial cells has certain
disadvantages. With reference to the first embodiment, newly
produced vWF polypeptides are unable to escape from the host
cells, causing them to be accumulated within insoluble
aggregates therein (inclusion bodies) where the effective
concentration of cysteine residues was extremely high. Under
these circumstances, disulfide bonds not characteristic of
the vWF molecule as it naturally exists in the plasma are
encouraged to, and do, form either within the inclusion
bodies or during attempts to solubilize the polypeptide
therefrom.
This embodiment provides a solution to these
difficulties by causing the vWF-derived polypeptides to be
expressed in mammalian cells using a DNA sequence which
encodes the polypeptide and which also encodes ~or a signal
peptide, the presence of which causes the vWF polypeptide to
be secreted from the host cells. Incorrect disulfide bond
formation is minimized by limiting the accumulation of high
local concentrations of the polypeptide as in inclusion
bodies.
In addition, enzymes present in the host eucaryotic
cells, unlike bacteria, are able to glycosylate (add
carbohydrate chains to~ the vWF-derived polypeptides
resulting in therapeutic molecules which more closely
resemble domains of vWF molecules derived from human plasma.
The recombinant 116 kg/mol polypeptide generated
according to this invention is demonstrated to represent a
dimer of the subunit fragment consisting of residues 441-730
and possesses an amount of glycosylation e~uivalent to that
found in the comparable region of plasma-derived vWF.
There follows hereafter a description of the types of
therapeutic vWF-derived polypeptides which have or may be
generated according to the effective recombinan~ procedures
of the second embodiment.
Recombinant vWF Polypeptides of the Second Embodiment
Stated broadly, this second embodiment includes any
fragment of mature von Willebrand subunit comprising that
WO9~/17192 2 ~ CT/~S9~02~7
sequence of amino acids between approxima~ely residue 449 and
approximately residue 728, or a subfragment thereof, from
which at least one of cysteine residues 459, 462 and 464
thereof is removed. Such removal reduces the tendency of the
fragment to form undesired interchain disulfide bonds (and
resultant dimers) with the result that therapeutic utility as
an antithrombotic is improved.
A further aspect of the embodiment encompasses a
glycosylated form of the above defined polypeptides.
In the design of antithrombotic polypeptides derived
from the aforementioned region of vWF, it is preferred that
cysteine residues be retained at positions 509 and 695 so
that the tertiary structure of the GPIb(~) binding domain of
the mature vWF subunit fragment is preserved.
Also preferred in the practice of the embodiment is a
glycosylated polypeptide derived from the aforementioned
region of vWF in which cysteine residues are retained at
; positions 509 and 695 and in which each of cysteine residues
459, 462 and 464 is deleted or replaced by residues of other
amino acids.
Additionally preferred in the practice of the embodiment
is a glycosylated polypeptide derived from the aforementioned
region of vWF in whioh cysteine residues are retained at
positions 509 and 695 and in which any one of cysteine
25 residues 459, 462 and 464 is deleted or replaced by a single
residue of another amino acid.
Important factors involved in the design of, or further
modification to, the preferred mutant polypeptides
~antithrombotics) of the invention are described hereafter.
Potential binding sites for collagens and glycosamino-
glycans (or proteoglycans) exist in the 449-728 tryptic
fragment in the loop region between cysteine residues 509 and
695. In the event that binding at these sites by such
macromolecules impairs the antithrombotic therapeutic utility
of any of the recombinant polypeptides of the invention by,
for example, also providing bridging to collagen, the
polypeptide can be redesigned tfor example, by proteolysis,
covalent labelling or mutagenesis) to delete or alter the
loop region, or a subdomain thereof.
WO92/17192 PCT/~S92/0~47
S2,~ Q7 l ~a 36
It is known that both platelets and von Willebrand
factor molecules contain large numbers of negative charges
such as, for example, those contributed by sialic acid. Such
charges can facilitate desirable mutual repulsion of the
molecules under non-injury conditions. The addition of one
or more positively charged residues of lysine and/or of
arginine extending, ~or example, from the amino and/or from
the carboxy terminus of the 52/48 tryptic: fragment or
recombinant equivalents thereof can overcome electrical
repulsions with respect to the GPIb(~) receptor, thus
facilitating use of the fragment as an antithrombotic
therapeutic.
In addition, and with respect to polypeptides patterned
upon the 449-728 vWF subunit fragment, it is within the scope
- 15 of the invention to remove certain cysteine residues by site
directed mutagenesis and to thereafter inactivate any
remaining cysteine residues by chemical inactivation thereof,
such as, for example, by S-carboxymethylation.
The second embodiment is also concerned with the
preparation o~ polypeptides which are useful in the treatment
of hemorrhagic disease. Stated broadly, there is provided a
process for the production by recombinant DNA-directed
methods of a dimeric polypeptide substantially equivalent to
the 116 kg/mol tryptic fragment derived from circulating vWF.
Z5 In accordance with the process, the monomeric fragment
initially formed assumes a tertiary structure suitable for
dimerization, and dimerization thereof is effected (see
Example 7). In addition, the process conditions are such
that it is possible to form a properly glycosylated dimeric
polypeptide.
There follows hereafter a discussion of means by which
polypeptides of the second embodiment can be prepared and, in
particular, by which such polypeptides can be effectively
secreted from host cells in proper folded form and possessing
preferably only those disulfide bonds whose presence is
consistent with therapeutic utility.
WO92/1719~ ~ ~ 0 7 ~$ ~/US92/0247
37
Prepara~ion of Mutant Polypeptides of the
Second Embodiment - Construction of
Suitable DNA Sequences and E~pression Plasmids
Essential elements necessary for the practice of the
embodiment are: (A) a DNA sequence which encodes the residue
449-728 domain of the mature vWF subunit; (B) an expression
plasmid or viral expression vector capab]e of directing in a
eucaryotic cell the expression therein of the aforementioned
residue 449-728 domain; and (C) a eucaryotic host cell in
which said expression may be effected.
The expression of the DNA sequence of the von Willebrand
factor subunit fragment is facilitated by placing a
eucaryotic consensus translation initiation sequence and a
methionine initiation codon upstream (5') to the residue 449-
728 encoding DNA. The vWF DNA sequence may be a cDNAsequence, or a genomic sequence such as, for example, may be
produced by enzymatic amplification from a genomic clone in a
polymerase chain reation. Expression of the residue 449-728
encoding se~uence is further facilitated by placing
downstream therefrom a translation initiation codon such as
TGA. The vWF-polypeptide so expressed typically remains
within the host cells because of the lack of attachment to
the nascent vWF polypeptide of a signal peptide. In such a
situation, purification o~ proteins expressed therein and the
extraction of pharmacologically useful quantities thereof are
more difficult to accomplish than if the polypeptide were
secreted into the culture medium of the host cells. Such
expression systems are nonetheless useful for diagnostic
assay purposes such as, for example, testing the proper
function of platelet GPIb-IX receptor complexes in a patient.
In the preferred practice of the invention in which the
polypeptide is secreted from the host cell, there is provided
a vWF-encoding DNA sequence for insertion into a suitable
host cell in which there is also inserted upstream from the
residue 449-728 encoding sequence thereof a DNA sequence
encoding the vWF signal peptide (see Example 7). Other vWF-
encoding DNA sequences corresponding to different regions of
the mature vWF subunit, or corresponding to the propeptide,
or to combinations of any of such regions, may be similarly
expressed by similarly placing them downstream from a vWF
WO92/l719~ PCT/US92/02~7~
210'7i00 38
signal peptide sequence in a suitable encoding DNA. When
attached to the amino terminal end of the residue 449-728
fragment of the vWF subunit, the signal peptide causes the
fragment to be recognized by cellular structures as a
polypeptide of the kind to be processed for ultimate
secretion from the cell, with concomitant cleavage of the
signal polypeptide from the 449-728 fra~nent.
With respect to the construction of a eucaryotic
expression system and the expression therein of the tryptic
52/48 kg/mol domain of mature subunit vWF (the residue 449-
728 fragment), it has been found (see Example 7) to be
conveneint to manipulate a slightly larger fragment
represented by residues 441 (arginine) to 730 (asparagine).
Other similar fragments containing small regions of
additional amino acids (besides the 449-728 residue
sequence~, which additional amino acids do not significantly
affect the function of said ~ragment, may also be expressed.
Similarly, functional fragments may be expressed from
which, when compared to the 449-728 fragment, several
residues adjacent to the amino and carboxy terminals have
been removed ~s long as the GPIb(~) binding se~uences are not
compromised.
It has also been found to be effective, with respect to
the construction of a suitable DNA sequence for encoding and
expressing the rssidue 441-730 fragment, to cause to be
inserted between the ~NA encoding the carboxy terminus of the
signal peptide and the cod~on for residue 441 codons for the
first three amino acids of the vWF propeptide (alanine-
glutamic acid-glycine) said codons being naturally found
directly downstream (3') to the signal sequence in the human
vWF gene.
A wide variety of expression plasmids or viral
expression vectors are suitable for the expression of the
residue 441-730 mature vWF subunit fragment or similar vWF
fra~ments. One factor of importance in selectins an
expression system is the provision in the plasmid or vector
of a high e~ficiency transcription promoter which is directly
adjacent to the cloned vWF insert.
WO92/17192 ~ 'S92/0247
39
Another factor of importance in the selection of an
expression plasmid or viral expression vector is the
provision in the plasmid or vector of an antibiotic
resistance gene marker so that, for example, continuous
selection for stable transformant eucaryotic host cells can
be applied.
Examples of plasmids suitable for use in the practice of
the invention include pCDM8, pCDM8~, pCDNAl, pCDNAl~, pMA~P~
and Rc/CMV. Preferred plasmids include pCDM8~, pcDNAl~
pM~ and Rc/CMV.
Examples of viral expression vector systems suitable for
the practice of the invention include those based upon
retroviruses and those based upon baculovirus Autoqrapha
californica nuclear polyhedrosis virus.
Representative host cells comprising permanent cell
lines suitable for use in the practice of the invention
include CHo-Kl Chinese hamster ovary cells, ATCC-CCL 61; COS-
l cells, SV-40 transformed African Green monkey kidney, ATCC-
CRL 1650; ATT 20 murine pituitary cells; RIN-5F rat
pancreatic ~ cells; cultured insect cel}s, Spodoptera
fruqiperda; or yeast ~Sarcomyces).
Example 7 contains a detailed explanation of preferred
procedures used to express and secrete the 441-730 sequence.
In that Example, the fragment is secreted as a homodimer held
together by one or more disulfide bonds involving cysteine
residues 459, 462 and 464. Expression of monomeric fragments
useful as antithrombo~ics necessitates control be made of the
disulfide bonding abilities of the monomers which is achieved
most preferably by mutagenesis procedures as described below.
Mutagenesis of vWF DNA Encoding The
Mature_Suhunit Residue 449-728 Reaion
A variety of molecular biological techniques are
available which can be used to change cysteine codons for
those of other amino acids. Suitable techniques include
mutagenesis using a polymerase chain reaction, gapped-duplex
mutagenesis, and differential hybridization of an
oligonucleotide to DNA molecules differing at a single
nucleotide position. For a review of sui~able codon altering
techniques, see Kraik, C. "~se of Oligonucleotides for Site
WO92/1719~ 2 ~ PCT/~'S92/0247~
~-
Specific Mutagenesis", Biotechniques, Jan/Feb 1985 at page
12.
In the practice of this embodiment, it preferred to use
the site-directed or site-specific mutagenesis procedure of
Kunkel, T.A., Proc. Natl. Acad. Sci. USA, 82, 488-492 (1985).
This procedure takes advantage of a series of steps which
first produces, and then selects against, a uracil-containing
DNA template. Example 1 of the present lnvention explains in
detail the mutagenesis techniques used to create mutant vWF
cDNA.
Other publications which disclose site-directed
mutagenesis procedures are: Giese, N.A. et al., Science,
236, 1315 (1987); U.S. Patent No. 4,518,584; and U.S. Patent
No. 4,959,314.
It is also preferred in the practice of this embodiment
to cause to be substituted for one or more of the cysteine
codons of the wild type DNA se~uence codons for one or more
o~ the following amino acids: alanine, threonine, serine,
glycine, and asparagine. Replacement with alanine and
20 glycine codons is most preferred. The selection o~ a
replacement for any particular codon is generally independent
of the selection of a suitable replacement at any other
po~ition.
The following are representative examples of the types
of codon substitutions which can be made, using as an example
cysteine residue 459:
(A) the codon for cysteine 459 could be replaced by a
codon for glycine; or
(B) the codon for cysteine 459 could he replaced by two
or more codons such as one for serine and one ~or
glycine, such replacement resulting in a new amino
acid sequence: His458-Ser459(')-Gly4590-Gln~; or
(C) the codon for cysteine 459 could be deleted from
the cDNA, such deletion resulting in a shortened
amino acid sequence represented by - - - His458-
Gln4~- - -; or
(D) one or more codons for residues adjacent to
cysteine residue 459 could be deleted along with
codon 459 as represented by - - r~lu4s7-Gln4~- -.
WO92/1719~ 7 ~ S92/02~7
41
It is contemplated that codons for amino acids other than
alanine, threonine, serine, glycine or asparagine will also
be useful in the practice of the invention depending on the
particular primary, secondary, tertiary and quaternary
environment of the target cysteine residue.
It is considered desirable in the practice of this
embodiment to provide as a replacement for any particular
cysteine residue of the 449-728 tryptic vWF subunit fragment
an amino acid which can be accommodated at the cysteine
position with minimal perturbation of the secondary structure
(such as ~-helical or ~-sheet) of the wild type amino acid
sequence subsegment within which the~cysteine position is
located. In the practice of the present invention, alanine,
threonine, serine, glycine and asparagine will generally be
satisfactory because they are, like cysteine, neutrally
charged and have side chains which are small or relatively
small in size.
Substantial research has been conducted on the subject
of predicting within which types of structural domains of
proteins (~-helix, ~-sheet, or random coil) one is most
likely to find particular species of amino acids. Serine is
a preferred amino acid for use in the practice of this
invention because it most closely approximates the size and
polarity of cysteine and is believed not to disrupt ~-helical
and ~-sheet domains.
Reference, for example, to Chou, P.Y. et al.,
Biochemistry, 13(2), 211-222 (1974) and Chou, P.Y. et al.,
"Prediction of Protein Conformation,~ Biochemistry, l3(2),
222-244 (1974) provides further infor!mation useful in the
selection of replacement amino acids. Chou, P.Y. et al.
predicted the secondary structure of specified polypeptide
sequence segments based on rules for determining which
species of amino acids therein are likely to be found in the
center of, for example, an alpha helical region, and which
residues thereof would be likely to terminate propagation of
a helical zone, thus becoming a boundary residues or helix
breakers. Accordiny to Chou, P.Y. et al., supra, at 223,
cysteine and the group of threonine, serine, and asparagine
are found to be indif~erent to ~-helical structure, as
WO92/1719~ PCT/~S92/~247~
21071~0 42
opposed to being breakers or formers of such regions. Thus,
threonine, serine and asparagine are likely to leave
unperturbed an ~-helical region in which a potential target
cysteine might be located. Similarly, glycine, alanine and
serine were found to be more or less indifferent to the
formation of ~-regions. It is noted that serine, threonine
and asparagine residues represent possible new sites of
glycosylation making them potentially unsuitable replacement
residues at certain positions in secretory proteins subject
to glycosylation.
Generally, the primary consideration which should be
taken into account in connection with selecting suitable
amino acid replacements is whether the contemplated
substitution will have an adverse effect on the tertiary
structure of the fragment. Thus, other amino acids may be
suitable as acceptable substitutes for particular cysteine
residues as long as the new residues do not introduce
undesired changes in the tertiary structure of the 449-728
fragment. Reactivity with NMC-4 antibody is recommended as a
test of whether a mutant polypeptide has the desired
therapeutic properties.
The specific protocol used to generate the mutant vWF
residue 441-730 fragment containing cysteine to glycine
substitutions at each of residue positions 459, 462 and 464
is described in Example 9. The expression plasmid used
therein was designated pAD4/A3C.
The speci~ic protocol, adapted from that o~ Example 9,
and which was used to generate the three mutant residue 441-
730 fragments, each of which contains a different single Cys
~ Gly mutation (at positions 459, 462 or 464) is described in
Example 14. The respective expression plasmids used therein
were designated pAD4/G459, pAD4/G462 and pAD/G~ (collectively
"the pAD4/alC plasmids").
Properties of the Polypeptides of the Second Embodiment
Homodimeric l16 kg/mol vWF Fragments
Example 7 below discloses the use of stably transformed
CH0-Rl cells to express the unmutagenized residue 441-730 vWF
subunit fragment. As set forth in Example lO below, the
W092/171~2 ~ t~ 92/0247
43
unmutagenized fragment was also expressed in unstable COS-1
transformants.
SDS-polyacrylamide gel electrophoresis of secreted and
immunoprecipitated proteins derived from CHO-Kl cells
demonstrates that, under nonreducing conditlons, the dominant
vWF-derived polypeptide, detected by staining with Coomassie
blue, has an apparent molecular weight of about 116,000
(Example 7). This result was confirmed by characterizing
the polypeptides secreted by pAD4/WT trans~ormed COS-l cells
~Examples 12-14) using autoradiographs of 35S-labelled
proteins. Under disulfide-reducing conditions (such as in
the presence of 100 mM dithiothreitol) the 116 kg/mol
fragment was no longer detected and the vWF-derived material
appears as the expected 52/48 kg/mol monomer.
The apparent molecular weight of the recombinant 116
kg/mol polypeptide was consistent with the presence of said
polypeptide as a homodimer of the 4~1-730 fragment. This
homodimer carries also an amount of glycosylation equivalent
to that observed in the 116 kg/mol polypeptide isolated by
tryptic digestion of mature plasma (circulating) vWF. It is
thus demonstrated that expression of the 441-730 fragment in
the mammalian cell cultures of this invention ~avors the
formation of the disulfide-dependent 116 kg/mol dimer
thereof, mimicking the structure seen in plasma. That the
116 kg/mol fragment so formed represents a correctly ~olded
polypeptide was evidenced by its raaction (under nonreducing
conditions) with conformation-dependent NMC-4 antibody. This
antibody recognizes a properly assembled GPIb(~) binding site
(~xample 7). Reactivity with NMC-4 disappears under reducing
conditions.
The dimeric 116 kg/mol fragment which i5 within the
scope of the present embodiment and which contains two
GPIb(~) binding sites supports ristocetin-induced platelet
aggregation by virtue of its bivalent character. ~his was
evidenced in Example 8 below.
Since it was demonstrated in the first embodiment that
cysteine residues 471 and 474 and also residues 509 and 695
are involved in intrachain bonds, the interchain bonds which
stabilize ~he 116 kg/mol homodimer must be formed from one or
WO92/17192 Pcr/us92/o247~
2 1 0 ~ 44
more of residues 459, 462 and 464. It is further noted that
since residues 459, 462 and 464 are in such close proximity
in any monomer, there may be variation as to which particular
residue or residues contribute the interchain disulfide bond
or bonds which form the interpolypeptide contact in any
particular mature vWF dimer or multimer, or recombinant 116
kg/mol fragment. Therapeutically-active populations of
dimeric molecules can be generated according to the practice
of the invention utilizing any of the possible combinations
of interchain disulfide bonds. It is noted that it is
also possible that some structural folding or disulfide bond
formation associated with the generation of therapeutically
active conformations of the recombinant 116 kg/mol dimers of
the invention, or disulfide exchange therein, occurs after
the polypeptides are secreted from a host cell.
Since there are also contained within the 441-730 vWF
~ragment potential binding sites for collagens, proteoglycans
and glycosaminoglycans, the 116 kg/mol polypeptide is capable
of performing a bridging function between a platelet and the
subendothelium. This enables it to be used in a method for
inducing platelet adhesion to surfaces such as, for example,
vascular subendothelium. There is also provided a method of
inducing platelet activation and/or aggregation which
comprises contacting platelets with an effective amount of
the recombinant 116 kg/mol polypeptide.
It is noted that as long as at least one of the one or
more potential interchain disulfide bonds stabilizing the
homodimer is left intact, and the amino acid sequences
comprising the two GPIb(~) binding sites are preserved, that
other regions of one or more of the two monomeric fragments
thereof could be deleted, if necessary, to modify the
therapeutic properties of the dimer.
52/48 kglmol monomeric vWF fraqments
An important aspect of the second embodiment of the
invention is the provision of glycosylated 52/48 kg/mol
monomeric fragments of the vWF subunit having substantial
elements of normal tertiary structure. Such fragments have a
WO 92/17192 1 . PCr/1 'S92/02~7 ~
2 ~ q ~
reduced tendency to form dimers which tend to be unsuitable
for use as antithrombotic therapeutics.
Following the above described procedures for site
directed mutagenesis, residue 441-730 vWF fragments were
produced in which one or more of cysteine residues 459, 462
and 464 were replaced with glycine residues. Examples 9, 10
and 11 below explain the mutagenesis and cell culture
conditions necessary to create COS-l cell transformants
expressing these mutant vWF polypeptides. Examples 6 to 8 of
the invention describe the properties of the molecules so
derived in comparison with the recombinant 116 kglmol
polypeptide produced from pAD4/WT transformed COS-1 cells.
The vWF-derived polypeptides expressed by pAD4/~3C
transformed COS-1 cells (containing the vWF 441~730 DNA
se~uence, but with each of cysteine codons 459, 462 and 464
thereof replaced by single glycine codons) were compared with
the polypeptides secreted by pAD~/WT transformed COS-1 cells.
To perform the comparisons, 35S-methionine-supplemented
culture medium ~rom each culture was sub~ected to
immunoprecipitation using equal amounts of NMC-4 and RG-46
anti-vWF antibodies (Example 6) to collect the vWF-derived
secreted proteins. The immunoprecipitated vWF polypeptides
were then resolved by autoradiography of 35S-label on SDS
po~yacrylamide gels. No 116 kg/mol polypeptide could be
detected in culture extracts of pAD4/ 3C transformed cells
under nonreducing conditions. Instead, under either reducing
or nonreducing conditions,~a band having an apparent
molecular weight of 52 kgtmol was seen. In contrast, the
pAD4/WT transformed COS-1 cells produce under nonreducing
conditions, as expected, a polypeptide of apparent molecular
weight of 116 kg/mol.
The immunoprecipitation procedure was also repeated
using only conformation-dependent NMC-4 antibody (Example
13). The major vWF-derived component isolated ~rom the
culture medium of pAD4/WT transformed cells again had an
apparent molecular weight of 116 kg/mol under nonreducing
conditions and 52 kg/mol under reducing conditions. A band
of apparent 52 kg/mol molecular weight was detected under
nonreducing conditions on gels of pAD4/~3C derived
WO9~/1719' PCT/US92/0247
2 107 10 ~ 46
polypeptide material. As described in Example 13, reactivity
with NMC-4 antibody is important evidence that the 52 kg/mol
fragment detected in pAD~/~3C transformed cells possesses the
tertiary structure of the natural residue 441-730 domain.
The immunoprecipitatlon procedure was also used to
detect NMC-4 reactive vWF polypeptide prot~uced by pAD4/Alc
transformed COS-1 cells cultured under conditions similar to
those for pAD4/WT and ~3C transformants in the presence of 35S
methionine. Immunoprecipitated proteins were run under
reducing and nonreducing conditions in SDS-polyacrylamide
gels and compared with vWF polypeptides produced by pAD4/WT
and pAD4/~3C transformants (Example 14).
It was revealed that substitution of any one of cysteine
residues 459, 462 or 464 by glycine results predominantly in
a polypeptide having an apparent molecular weight of 52
kg/mol under nonreducing or reducing conditions, the
~ormation of the 116 kg/mol species having been prevented.
~ he apparent molecular weight of 52 kg/mol for
recombinant polypeptides derived from COS-1 cells transformed
with either pAD4/~3C or pAD4/a1C plasmids is consistent with
said-polypeptides being monomers of the 441-730 ~ragment,
while carrying also an amount of glycosylation equivalent to
that seen in the 52 kg/mol polypeptide as isolated from
tryptic digestion and reduction of mature plasma
(circulating) vWF.
Unlike the dimeric pQlypeptides of apparent 116 kg/mol
molecular weight, the monomeric 52 kg/mol polypeptides
produced by pAD4/~lC and pAD4/~3C plasmids are unlikely to be
capable of the bridging function associated with the dimer.
Accordingly, there is provided a method of preventing
platelet activation and/or aggregation which comprises
contacting platelets with an effective amount of a mutant
recombinant 52/48 kg/mol polypeptide which polypeptide shows
at least a substantially reduced tendency to dimerizP when
compared with nonmutant (wild type) recombinant 52/48 kg/mol
polypeptides.
There is further provided a method of prsventing the
adhesion of platelets to surfaces which comprises contacting
.
,
..
WO92/1719~ 2 ~ s92/o247
47
platelets with an effective amount of a mutant recombinant
52/48 kg/mol polypeptide which shows at least a substantially
reduced tendency to dimerize when compared with nonmutant
recombinant 52/48 kg/mol polypeptides.
Contained within the 441-730 vWF fragment are potential
binding sites for collagen (approximately residues 542-622)
and glycosaminoalycans and proteoglycans (also within the
residue 509-695 disulfide loop), in addition to the GPIb~
binding sites. It is probable because of steric
considerations that a single residue 441-730 ~ragment could
not perform effectively as a bridging, potentially
thrombotic, molecule. It is noted, however, that as long as
the GPIb(~) binding domain of the 52/~8 kg/mol monomer
(consisting of approximately the primary sequence regions
47~-488 and 694-708, and a tertiary domain thereof
contributed in part by the 509-695 disulfide bond) is
preserved, other regions (part of the heparin and collagen
binding loop) of the said 52/48 kg/mol monomeric fragment
could be deleted or altered, such as by proteolysis or by
mutagenesis, if necessary, to modify or preserve the
antithrombotic therapeutic properties thereof.
It is also possible that some structural folding or
disulfide bond formation associa-ted with the generation of
therapeutically active conformations of the recombinant 52/48
kg/mol monomers of the invention, or disulfide exchange
therein, occurs after the polypeptides are secreted from a
host cell.
The Present ~Third) Embodiment
Descri~tlon of the Embodiments of the Present Invention
This embodiment of the invention provides for
antithrombotic polypeptides patterned on mature von
Willebrand factor and fragments thereof. Stated more
precisely, this embodiment of the invention reflects the
discovery that certain mutant polypeptides patterned on
mature von Willebrand factor and capable of enhanced binding
(relative to wild type) to specific receptors or ligands of
vWF can be used to inhibit binding by native or wild type vWF
to the same receptors or ligands thereby preventing or
WO92/17192 PCT/US92/0247~
'~107~ 48
inhibiting thrombosis. The mutant vWF polypeptides having
antithrombotic activity can be expressed from recombinant
bacterial or eucaryotic expression systems.
A principal goal of the invention is to modify von
Willebrand factor or fragments thereof by, for example,
mutation or covalent labelling so that the vWF-derived
polypeptides bind to one or more receptors (ligands) with a
greater affinity than the comparable sequence of amino acids
present in wild type vWF, or in the equivalent fragment
thereof. Provision of such polypeptides having an "increased
binding affinity" allows for more effective clinical
treatments including the provision of an effective dose by a
lower concentration of therapeutic, with the result that
adverse clinical consequences such as immune response are
minimized. For the purpose of the invention, a binding
affinity is considered increased if the modification enhances
the therapeutic utility of the polypeptide by either (l)
increasing the affinity of the vWF-derived polypeptide for a
ligand by about 10% in relation to the comparable wild-type
sequence and as measured in a suitable in vitro or in vivo
assay, or (2) achieving an equivalent amount of binding to a
ligand with about 10% less polypeptide; or (3) with respect
to a particular amino acid sequence modification, achieving
(l) or (2) above by use of the said modification in
combination with one or more other "modifications" to the
amino acid sequence as that term was aboYe defined. More
preferably, therapeutics of the invention have an increased
binding af~inity of about 100% or more for a ligand and most
preferably an increased binding affinity for a ligand,
compared to the wild type sequence, of about 5 fold or
higher.
In the preferred practice of the invention, the mutant
polypeptides are designed to have only one binding function,
that is, they are capable of binding to only one receptor or
ligand, thereby praventing a bridging function in which two
or more components which participate in the hemostatic
process such as, for example, platelets and damaged vas;cular
wall tissue, are joined, potentially initiating an unwanted
thrombus. Methods are described below whereby such
WO 92/17192 2 ~ ~ 7 A &~ S92/02~7
` 49
additional binding functions can be avoided. The preferred
receptor or ligand of the mutant vWF polypeptides is platelet
membrane glycoprotein Ib~.
Preferred as clinically useful antithrombotic
polypeptides are those polypeptides patterned upon the mature
von Willebrand factor subunit amino acid 3equence between
approximately residue 441 and approximately residue 733, or
subfragments thereof, and having, relative to the wild type
amino acid sequence of said polypeptide, or of a subfragment
thereof, an enhanced affinity for platelet glycoprotein Ib~.
Additionally preferred are vWF-derived polypeptides having a
similarly enhanced affinity for platelet glycoprotein Iba
encompassing all or part of the mature subunit residue 441-
733 se~uence and containing additional vWF polypeptide
sequence.
Although vWF polypeptide fragments reflecting wild type
vWF sequences can be used to effect inhibition of the binding
of vWF to platelet GPIb~ receptors in patients, it is
desirable to identify polypeptides haviny enhanced affinity
for GPIb which are therefore effective at lower doses.
As will be described in detail, an important aspect of
the invention is the recognition that certain amino acid
substitutions, additions or deletions (compared to the wild
type vWF sequence) can be made in the polypeptides to enhance
their affinity for GPIb~, thereby making them more effective
when administered in therapeutic compositions.
A principal discovery~of the invention is t~at such
suitable amino acid substitutions, additions, or deletions
are reflected in, or are suggested by, the amino acid
se~uences of mature vWF subunit as derived from patients
afflicted with Type II~ of von Willebrand disease, said amino
acid sequence mutations being responsible for the affliction
which is mani~ested by a prolonged bleeding time after
injury.
As stated in Ruggeri, Z.M. and Zimmerman, T.S., Blood,
70(4), 895-904 (1987) at 896, "the term von Willebrand
disease (vWD) defines a bleeding disorder that is
heterogenous in its modalities of genetic transmission,
clinical and laboratory manifestations, and underlying
W092/1719' PCT/US92/0247~
21~7~ 50
pathogenic mechanisms. common to the different forms of the
disease is that they all represent a genetic disorder,
transmitted in an autosomal manner, which alters the
structure, functions or concentration of vWF." Numerous
separate types and subtypes of vWD have been determined based
on phenotypic characteristics of the respective proteins.
Of particular interest to the practice of the invention
is that variant of von Willebrand disease known as Type IIB,
the criteria for diagnosis thereof being provided by Ruggeri,
Z.M. et al., N. Enql. J. of Med.~ 302, 1047-1051 ~1980).
These criteria include a lifelong bleeding tendency, absence
of large vWF multimers circulating in plasma, and platelet
aggregation which is hyperresponsive to ristocetin, i.e.,
occuring with lower ri~tocetin concentrations than are needed
to induce aggregation in platelet-rich plasma of normal
individuals. Purified Type IIB vWF has an increased affinity
for platelets and, unlike vWF from normal individuals, binds
in vitro to platelet GPIb~ in the absence of any modulating
substance. See Berkowitz, S.D. et al., in Coaqulation and
~leedinq Disorders, von Willebrand Disease, Chapter 12,
Marcel Dekker, Inc., New York (1989). It is characteristic
of normal vWF under similar circumstances that it not bind to
platelets in the absence of an added helper molecule ~a
modulator) such as ristocetin or botrocetin. It should be
emphasized that normally circulating plasma VWF and platelets
do not interact, absent some physical or chemical stimulus
indicating damage to the vascular system. It is believed
that modulators used in in vitro assays fulfill the function
oE such an in vivo stimulus.
This invention recognizes the significance of the
greater IIB-type affinity for platelet receptors, which can
be demonstrated in the presence and/or in the absence of
modlllators (see Examples 18-19 and 23-24 below), the
mutations responsible therefor being used to design
therapeutic vWF fragments reflective of said mutations and
having enhanced antithrombotic utility.
As further evidence of the significance of these
mutations, patients afflicted with Type IIB von Willebrand
disease typically exhibit thrombocytopencia (a reduction in
WO92~17192 P~T/~'S92/02~7
51
the number o~ circulating functional platelets) which is
thought, Holmberg, L. et al., N. Enql. 3. Med., 309, 816-821
(1983), to result from intravascular platelet clumping
initiated by the binding of Type IIB vWF molecules to the
platelets. Platelets if so aggregated may be transiently
removed from circulation leaving the patient with inadequate
levels of functional platelets and less able to form clots in
the event of vascular injury.
Accordingly, this invention provides for vWF-derived
polypeptides which are designed to incorporate mutations
associated with Type IIB vWD phenotype and have therefore,
relative to the wild type sequence, an enhanced ability to
bind to platelet GPIb~ receptors. By occupying said GPIb~
receptor site, the polypeptides demonstrate antithrombotic
utility, that is, they prevent platelets from participating
in the processes which under normal or pathological
circumstances lead to thrombus formation. Representative of
processes involved in thrombus formation and which can be
inhibited by the polypeptides of the invention are platelet
adhesion, activation and aggregation.
It is important to note that viewed from the perspective
of designing new antithrombotic therapeutizs, the important
characteristic of the new polypeptides is an enhanced
affinity for GPIb~ receptor, irrespective of whether the
mutation is reflected in one or more particular IIB patients.
For the purposes of identifying or creating such therapeutic
polypeptides the terms "IIB-like", "IIB phenotype",
"reflective of Type IIB vWF", "IIB-like properties", and the
like, refer to enhanced binding of GPIb~. The methods
described below are useful in the identification or creation
of such other, additional polypeptide sequences. In
addition, and as described in Example 16 below, Type IIB
mutations or IIb-like mutations can be incorporated into vWF,
or fragments thereof, thereby providing enhanced a~finity for
GPIb~ even though said mutant amino acid residues are not
inserted into the polypeptide at the exact equivalent
se~uence positions that the mutations occupy in the vWF from
particular patients. It is understood that all such
W~92/1719~ PCT/US92/02~7~
2~37~0 52
resulting polypeptides having similar functional properties
are within the scope of the invention.
In the preferred practice of the invention, the
aforementioned antithrombotic polypeptides are made by a
process of genetic engineering (recombinant DNA technology)
which involves transferring into vWF-encodinq DNA that coding
information which causes the resultant expressed polypeptide
to contain one or more amino acid substitutions reflective of
vWF as isolated from one or more patients with Type IIB
disease. The types of amino acid mutations useful in the
design of said polypeptides and additional effective amino
acid substitutions, additions or deletions are described
below.
An additional aspect of the invention provides for the
chemical modification or inactivation of a side chain or one
or more amino acids in a vWF-derived polypeptide reflective
of wild type vWF leading to a polypeptide expressing the vWD
Type IIB phenotype.
As a result of the characterization of the functional
Z0 properties of the polypeptides resultant from the practice of
this embodiment of the invention, there is also provided an
explanation, with respect to particular patients, for the
molecular basis of Type IIB disea~e.
Example 15 of the invention provides procedures
representative of those which may be used to identify the
particular mutations in mature von Willebrand factor which
are responsible, in particular patients, for Type IIB von
Willebrand disease. One propositus was determined to have a
Trp550~Cys550 mutation. A second propositus was determined to
have an Arg5~Trp5~l mutation. A third propositus having
certain Type IIB-like symptoms (see Example 16, method 2
thereof) was determined to have a Gly56~Asp56~ mutation. In a
separate published study with respect to two other patients,
the mutations believed responsible for Type IIB phenotype
were identified as Arg~3~Trp543 and Val553~Met553. Cooney, K.A.
et al., Blood, 76(supp. 1), abstract 1661, page 418a, Nov.
15, 1990.
It is noted that although all of the known Type IIB
mutations arP determined from the residue 509-695 loop region
WO92/17i9~ ,J~ F~'S92/02
53
of the 52/4~ kg/mol tryptic fragment or vWF, additional
patients may come to be identified for whom the responsible
mutations are positioned outside the residue 509-695 loop or
outside of the residue 441-730 fragment itself. Example 15
provides for methods suitable to analyze also DNA encoding
mature vWF subunit sequence(s) outside of the above~indicated
domains thereof. The invention also provides for therapeutic
vWF-derived polypeptides that are designed to incorporate one
or more of such other potential mutations.
It was demonstrated in the first and second embodiments
of the invention that the interaction of the vWF fragment
comprising approximately residues 441-730 with platelet GPIb~
involves 'lactual binding regions or sequences" (residues 474-
488 and 69~-708 thereof) supported in the tertiary structure
of the fragment by a disulfide stabilized loop which
modulates the position and therefore the activity of the
actual binding regions. These sequences and the loop are
believed responsible for the adhesion of multisubunit vWF to
platelets at GPIb~ sites. It may be determined, however,
that additional amino acid seguences also participate in
binding to GPIb~ or in the modulation of said binding.
It was noted above that soluble plasma vWF and platelets
circulate in the blood without interacting with each other in
normal individuals unless stimulated by one or more vascular
injury-related signals. It is suggested therefore that
proper exposure of the actual GPIb~ binding sites in vWF, and
the regulation thereof, require particular conformation(s) of
adjacent structural regions of vWF including the residue 509-
695 sequence. Changes in conformation (such as in, adjacent
to, or caused by the disulfide-stabilized loop) are believed
necessary to facilitate the participation of vWF in
hemostasis and thrombosis by inducing binding to GPIb~.
These changes in conformation are further believed to be
subject to regulation, in vivo, and can be mimicked, in
vitro, by inserting into the loop or other applicable regions
of the mature subunit, or of a fragment of either, one or
more mutant amino acid substitutions as determined from Type
IIB patients. It is anticipated that certain other mutations
conferring Type IIB properties may function in different ways
WO92/1719~ PCT/USs2/02~7~
~107~ 54
to achieve the Type II8 phenotype but may be nonetheless
transferred into therapeutic polypeptides according to the
representative procedures of the invention (see Examples 17-
18, 21-22). It is also representative of the practice of the
invention to identify mutations in other types or subtypes of
von Willebrand disease such as Type I (New York), which
result in enhanced affinity for GPIb~ and which may be
incorporated into antithrombotic therapeutic polypeptides.
As elaborated below, understanding the function of these
substitutions or of the amino acids replaced thereby enables
the provision of further amino acid changes providing
equivalent or improved IIB~ e functional properties.
With respect to the invention of additional vWF-derived
polypeptides having antithrombotic utility and exhibiting ln
vitro or in vivo properties similar to polypeptides as
derived from patients with Type IIB disease, the following is
of particular significance. Methods l to 4 of Example 16
provide representative techniques for the identification of
potential amino acid substitutions which although not
identified from a particular Type IIB patient, confer
nonetheless Type IIB-like properties on recombinantly
produced vWF-derived polypeptides incorporating same. The
above methods are also representative of techniques which can
be used to identify proposed amino acid changes in the vWF
polypeptide sequence which effect an increased affinity for
GPIb~ and which do not correspond with any known human vWF
sequence.
(A) The technique of random mutagenesis, Hutahison,
C.A. et al., Proc. Natl. Acad. Sci. USA, 83, 710-
7l4 ~1986) can be used to generate a mature vWF (or
mature vWF fragment) encoding D~A with random codon
changes. By sequentially focusing on consecutive
series of lO to 20 codons from which mutant series
are generated, individual vWF-derived polypeptides
containing one or more random mutations in the loop
region, or other target regions can be generated.
Assay systems, suitable for screening large numbers
of individual bacterial clones to identify those
expressing polypeptide having enhanced binding
WO92/17192 ~ CT/~IS~2/02~7~
affinlty for GPIb~ are also described in Example
16.
(B~ An additional method whereby IIB-like polypeptides
tor other vWF-derived polypeptides having enhanced
binding affinity for GPIb~) can be identified
results from the observations that two of the five
Xnown IIB mutations (511, 543) involve Arg~Trp
substitutions, that presently all known mutations
are within the region of approximately residue 510
to approximately residue 570 and that the region
contains numerous other amino acid residues bearing
positive charges at physiological pH, substitution
for which by one or more neutral or negatively
charged residues is hereby postulated to disrupt
the proper in vivo function of the loop region,
including thereby the function of preventiny
interaction of GPIb~ and vWF until some stimulus or
signal related to vascular injury causes a
conformational change in vWF or in GPIb~ permitting
their interaction.
(C) Additional broadly applicable strategies are
provided in Method 4 of Example 16 (using Ar~ as
a representative example) which reflect the idea
that once a particular mutation is identified at a
particular position in the amino acid seguence of a
patient's vWF gene and it is determined by way of
functional studies that the mutation confers or
helps to confer the Type IIB phenotype, a
significant number of further equivalent (or more
effective) amino acid changes at or near that site
become possible. Indentification (screening) and
confirmation of the effects of such further amino
acid changes in vWF-derived polypeptides are
possible utilizing, for example, the representative
mutagenesis strategies of Examples 16-lB, 21-22
below to incorporate such mutations, and then the
screening systems of Example 16 to prove or
determine th2 utility thereof (see the section of
Example 16 entitled "Screening of mutant vWF-
WO92/1719~ PCT/~IS92/02~7~
2107100 56
derived polypeptides for enhanced GPIb~ binding
activity").
If, for example, it is determined that positive
charge at one or more of residue positions 511,
524, 534, 543, 545, 552, 563, 571, 573, 578, or 579
is necessary for or facilitates normal function of
the loop region, and that th~ absence thereof may
con~er Type IIB-like properties, then it may be
determined that a significant number of other
effective and related amino acicl sequence
permutations can be made surrounding the above-
mentioned residue position(s). Representative of
such a permutation strategy is the following.
Positive charge reduction and resultant IIB-like
activity may be accomplished using substitution of
various neutral residues or of residues possessing
negative charge at physiological pH. According to
the practice of the invention, and using Arg~3~Trp~3
as an example, since the effecting of a net change
. in charge of (-l) may explain the conferring of
IIB-like properties at this particular position,
making additional, or different substitutions~ or
additions of other negatively charged or neutral
residues may provide an equivalent enhanced GPIb~
binding effect. Alternately, proximal and
positively charged Arg~5 could be deleted or
substituted for. Parallel arguments apply to any
negatively charged residue positions of wild type
vWF determined by comparison with vWF from Type IIB
patients to be necessary for proper in vivo
function.
The following manipulations resulting in modified
amino acid sequences are also within the practicP
of the invention as are also other similar or
equivalent manipulations which would readily occur
to practitioners of the biochemical art: (l)
replacement of a residue which provides a
particular hydrogen bond or provides a particular
hydrophobic contact with a residue incapable of
W092/17192 PCT/~'S92/0247
57 ~ 4~
forming such a bond or contact, and (2) chemical
inastivation by covalent labelling of one or more
residues of wild type vWF amino acid sequence (such
as of Arg5~) using a covalent label which produces
the same change in functional behavior as any of
the aforementioned mutations.
(D) It is also contemplated that any of the above
strategies can be used in any combination thereof
so that, for example, one or more mutations from
the vWF gene of one Type IIB vWD patient could be
incorporated into a DNA encoding a vWF-derived
therapeutic polypeptide along with one or more
mutations from the DNA of another such patient, or
along with one or more mutations not derived from a
patient but predicted or determined in a vWF-
derived polypeptide to confer Type IIB-like
properties. Similarly, more than one such
predicted or determined mutation can be combined in
an encoding VNA for expression therefrom of a
therapeutic polypeptide.
(E) It should be noted that following the random
mutagenesis and screening strategy of Example 16,
or of such other mutation and screening strategies
as are well known to practitioners of the
biochemical art, other vWF-derived fragments having
enhanced GPIb~ binding ability, but not
characteristic o~f all aspects of Type IIB disease-
phenotype, can be generated which reflect mutations
that are nonetheless in the residue 509-695 region.
Other mutations conferring antithrombotic
therapeutic utility may also, of course, be
reflective of mutations in the "actual binding
regions or sequences" for GPIb~.
Preparation and testing of the
polvpe~tides of the invention_
There follows hereafter (and in Examples 15-24) a
discussion of means by which the antithrombotic polypeptides
of the present invention can be prepared and their utility
W092/17192 PCT~US92/0247
2 ~7 ~oa 58
confirmed. In this regard the teachings of the first and
second embodiments of the invention (including Examples l to
14 thereof) are particularly useful and it is suggested that
frequent reference thereto be made. By way of example, the
following teachings of those embodiments are noted:
elucidation of the roles of certain cysteine residues of
mature von Willebrand factor subunit and the manipulation of
said residue positions to design therapeutic polypeptidPs,
the preparation of vWF fragments having elements of tsrtiary
structure conferred by one or more disulfide bonds reflective
of the equivalent structure as present in circulating vWF and
also the preparation of vWF fragments lacking such elements,
- and the preparation, replication and expression of DNA
sequences encoding vWF, or mutant polypeptides derived from
vWF, or of fragments of either, and the structure, properties
and therapeutic function of the vWF-derived polypeptides
reported in the said e~bodiments including the potential
utility of glycosylation thereof.
Examples 15-24 of the invention are representative of
procedures useful in the practice of the invention, including
those for the preparation of DNA sequences from which can be
expressed the polypeptides of the invention, and those
whereby the utility of said polypeptides as antithrombotic
therapeutics can be demonstrated. Other suitable procedures
known to those skilled in the art may be substituted if
necessary and as the context requires.
Antihemorrhagic polypeptides derived
~rom the ~olypeptides of the invention
The aforementioned second embodiment of the invention
relates to the production by recombinant DNA technology o~
116 kg/mol homodimers of the mature vWF subuni~ residue 441-
730 fragment.
Reference to Figure 2 demonstrates that dimerization of
the 441-730 fragment involves one or more disulfide bonds of
cysteine residues 459, 462, and 464.
An additional aspect of the invention is the recognition
that certain amino acid substitutions, additions or
deletions, which in the context of a monomeric fragment (such
as 52/48 kg/mol fragment) have antithrombotic utility, have
.
WO92/1719~ PCT/~'S92/02~7~
59 ~ '3
instead antihemorrhagic utility when incorporated into a
dimeric fraqment (such as the 116 kg/mol fragment).
Accordingly, such mutations may be incorporated into a DNA
sequence in a host eucaryotic cell which encodes the residue
441-730 fragment, with resultant expression therefrom
(following the procedure of Example 7) of a dimeric fragment
having enhanced binding affinity for GPIb~ and enhanced
(relative to wild type) antihemorrhagic activity. It is
important to note that, in order to have therapeutic utility,
such mutations must result in a fragment which does not bind
to platelet GPIb~ receptors while in solution, but binds only
when the vWF fragment has adhered to a surface, mimic]cing
thereby the changes in vWF structure which result from
binding, for example, to the subendothelium. Clone screening
assays designed to employing surface bound vWF fragments are
accordingly required.
With respect to amino acid changes suitable for
producing monomeric fragments having enhanced GPIb~ binding
affinity, and therefore antithrombotic activity, it is noted
that all such strategies ~including covalent modification of
particular amino acid residues) are suitable for generating
antihemorrhagic dimers having enhanced GPIb~ affinity.
Covalent modifications may of course be applied to 116 kg/mol
fragments produced by tryptic digestion.
Examples 7, 8 and 16 below, and the preceding discussion
thereof, contain representative methods which can be used to
produce and screen amino acid changes in the context of
dimeric vWF fragments having enhanced antihemorrhagic
activity. Other suitable procedures are generally known in
the art.
Additional Bindina Functions
; Although the invention is initially described in terms
of constructing therapeutically active fragments of mature
vWF subunit patterned upon the residue 441-730 domain thereof
and ha~ing enhanced affinity for platelet GPIb~ receptor, the
multivalent character of circulating vWF, and the multiple
potential ~unctions of each mature subunit provide a unique
i wos2/l7l9~ PCT/~S92/02~7~
21~7~ ~ 60 ~
opportunity to design other fragments of vWF having
additional enhanced antithrombotic properties.
A review of the particular functions of specific binding
domains in mature vWF is provided in zimmerman, T.S. and
Ruggeri, Z.M. Coagulation and Bleedin~ Disorders, Marcel
Dekker, New York, 1989. Particular functional domains of
mature vWF subunit having identified binding functions are as
follows: (A) residues 1744-1747 (Arg Gly Asp Ser - see SEQ ID
NO: 2) of the C02H terminal region of the subunit are
responsible for platelet glycoprotein IIbtIIIa binding; (B)
two independent binding sites for collagen within or
comprising approximately residue sequences 542-622 and 948-
998; (C) a binding domain for coagulation Factor VIIIc
between or comprising mature vWF subunit residues 1 to 272;
(D) binding domains for glycosaminoglycans (and
proteoglycans) localized to the residue 1-272 region and also
within the residue 509-695 region of the mature subunit; and
(E) the above described platelet glycoprotein Ib~ binding
domain.
By generating a population of randomly mutagenized DNA
sequences corresponding to one of the above binding domains
of vWF and then screening the expressed polypeptides produced
by resultant individual clones, appropriately sized inhibitor
polypeptides with enhanced binding activity toward one of the
above specified ligands or receptors may be derived. It is
noted that this procedure is also applicable to additional
binding domains of vWF for the same or different ligands or
receptors that may come to be determined. The mutagenesis
procedure is equally applicable to those of the above binding
functions of vWF which may be shown to involve participation
of two or more primary sequence regions of one or more mature
vWF subunits which assemble to form a combined total binding
domain.
Of particular importance as a source of new anti-
thrombotics is the 52/48 kg/mol tryptic fragment which hasmultiple potential ligand or receptor binding functions.
Reference to Figure 2 shows that the homodimeric 116 kg/mol
fragment (a dimer of the residue 441-730 fragment held
together by one or more disulfide bonds at positions 459,
WO~2/1719' ~ PCT/~'S92/02~7~
462, 464) can be used to cause adhesion or aggreqation of
platelets and therefore has antihemorrhagic utility, whereas
52/48 kg/mol monomers thereof stabilized against interchain
disulfide bond formation are capable of binding to a target
ligand or receptor to the exclusion of multimeric vWF and
therefore have utility as antithrombotics. If particular
circumstances are identified, however, wherein the function
of one binding site within the 5?/48 kg/mol fragment can be
affected adversely by engagement at another binding site
thereof of an additional ligand or receptor resulting in
undesireable binding properties, the fragment can be further
mutated or chemically altered to inactivate the particular
undesired binding activity.
It was mentioned previously that random mutagenesis
procedures, for example those of Hutchison, C.A. et al.,
Proc. Natl. Acad. Sci. USA, 83,710-714 (1986) could be used
to generate a population of DNA sequences encoding the 52/48
vWF fragment with random amino acid substitutions therein.
As further provided in Example 16 below, such individual
resultant DNA sequences (each contained preferably within a
bacterial clone) can be expressed and subie~ted to a large
scale screening system designed to detect those species among
the expressed vWF polypeptides which have enhanced binding
activity (higher affinity) toward the platelet GPIb~
receptor, said enhancement resulting either from one or more
mutations in the actual GPIba binding sequences (consisting
approximately of residues 474-488 and 694-708), or within
sequences (such as in thè case of known Type IIB mutations)
which modulate the properties of the actual binding
sequences.
Antithrombotic polypeptides which are monomeric and
which are unable to perform a potentially thrombotic bridging
function may also be designed to target the collagen fibers
such as are exposed at the site of disease-caused circulatory
system lesions, and upon which a thrombus may otherwise form.
By occupying these collagen binding sites, to the exclusion
of multimeric vWF, the complex sequence of events resulting
in platelet aggregation and thrombus formation can be
avoided.
W092/1~9~ 2 ~ ~ 7 ~ ~ O 6~ PCT/~'S9~/02~7~
The random mutagenesis procedure of Hutchison, C.A. et
al., supra, may be used to target the collagen binding domain
within the loop of the 52/48 kg/mol vWF fragment. Suitable
clones expressing polypeptides with enhanced binding activity
toward collagen may be screened according to the procedure of
Example 25. With respect to the design of such an
antithrombotic 52/48 kg/mol polypeptide having a high binding
affinity for collagen sites, it may be desireable to cause
substitution or deletion (by mutation) or inactivation ~by
chemical labelling or proteolysis) of the actual GPIb~
binding sequences in order to prevent a potentially
thrombotic bridging activity within the monomeric 52/48
kg/mol fragment.
A particularly important benefit of the invention, and
of the Second Embodiment thereof (see Examples g and 11), is
the provision of a 52/48 kg/mol vWF fragment which has a
substantially reduced tendency to participate in disulfide-
induced dimerization; it therefore lacks potentially
thrombotic bridging activity.
An additional collagen binding site is represented by
the A3 domain of the mature vWF subunit. This domain
comprises approximately residues 910-1100 o~ the subunit and
contains also a disulfide loop formed by cysteine residues
921 and 1108. The A3 domain is believed to represent a
partially autonomous structural domain containing within its
primary amino acid sequence information adequate to allow
assembly of a polypeptide patterned thereon into a structure
mimicing in whole or part the natural tertiary structure of
the A3 domain as present in multimeric vWF. The A3 domain
itself lacks additional cysteines, analogous, ~or example, to
cysteine residues 459, 462 and 464 positioned adjacent to the
Al domain, and which would tend to cause dimerization of the
fragment. Thus the A3 domain is a region from which to
derive effective antithrombotics.
As an example of the procedure used to express mutant
polypeptides which target exposed collagen fibers of the
subendothelium and representative o~ the mutagenesis strategy
used to target any other of the above-mentioned
macromolecules of the hemostatic mechanism, a DNA sequence
WO92/1719~ PCT/~IS92/0247
63
corresponding to the A3 domain may be prepared by any of
several standard methods bas~d upon the known vWF gene
sequence, the location of exon/intron boundaries therein, the
nucleotide sequence of available vWF mRNA or cDNA and the
known amino acid sequence of pre-pro-vWF. A vWF mRNA could
be used, for example, as a template for reverse transcriptase
with the resultant cDNA being subjected to a polymerase chain
reaction using suitable oligonucleotide primers to flank the
ends of the target A3 encoding r~gion. ~ nucleotide sequenc~
sufficiently large to facilitate efficient replication,
transcription and translation (such as corresponding to amino
acid positions 850-1150) can be chosen for amplification with
random mutagenesis, Hutchisonj C.A. et al., supra, applied to
emphasize permutation of the DNA region encoding amino acid
15 residues 948-998. Screening of clones expressing the
randomly mutagenized population of polypeptide sequences for
particular species demonstrating enhanced collagen binding
activity would follow the method of Example 27.
Bindinq Sites for Glvcosaminoqlycans and Proteoqlycans
Bacterial clones possessing mutagenized DNA sequences
corresponding to the "heparin binding sites" of the mature
vWF subunit tbelieved to be positioned in whole or part
within the loop of the 52/48 kg/mol fragment and also in
whole or part within the mature subunit region represented by
residues 1-272) may be similarly generated and screened for
the necessary enhanced binding affinity toward their
respective target macromolecules to create antithrombotic
therapeutic polypeptides. The screening procedure follows
the procedure of Examples 26 and 29.
The "heparin-binding domains" of vWF may prove to be
instrumental in the binding of vWF to exposed subendothelium
in response to vascular injury and in the pathogenesis of
vascular disease. It has been shown that vWF binds to
endothelial cell-produced extracellular matrices even after
collagen has been enzymatically digested away. It is likely
that proteoglycans are responsible for this interaction.
WOs2/17192 PCT/~'S92/~2~7~
~ a ~ 64
The ~latelet qlycoprotein IIb/IIIa receptor slte
Although the binding reaction believed primarily
responsible for crosslinklng (aggregation) of individual
platelets that have adhered to the subendotheliu~ at the site
of vascular injury is the bridging of platelet GPIIbjIIIa
receptor sites by fibrinogen, multimeric vWF can also
contribute to this crosslinking activity. Suitable vWF
fragments can also be used to inhibit the activity.
vWF and fibrinogen contain within their respective
polypeptides a domain of primary sequence consisting of Arg-
Gly-Asp (residues 1744-1746 in mature vWF subunit) which is
known to be at least part of the platelet GPIIb/IIIa
recognition site for these adhesive proteins. Synthetic
peptides patterned upon the Arg-Gly-Asp sequence have been
demonstrated to inhibit binding of fibrinogen or vWF to
platelet GPIIb/IIIa membrane receptors. See Ruggeri, Z.M. et
al., Proc. Natl. Acad. Sci., USA, 83, 5708-5712 (1986) and
U.S. Patent No. 4,683,291.
Aggregation of platelets (the result of which is the
crosslinked platelet mass or thrombus) can be inhibited in a
patient by administering therapeutic compositions containing
mutant polypeptides derived from the Arg-Gly-Asp region of
the mature vWF subunit. Such polypeptides possessing
enhanced binding affinity are effectively made by systematic
random mutagenesis (see Example 16, method 1 thereof) of a
- suitable DNA sequence encoding the GPIIb~IIIa binding domain
of vWF. Screening of mutant clones for expressed polypeptide
of enhanced binding activity follows the procedure of Example
28.
The Factor VIII Bindinq Domain
The above mutagenesis procedures are also applicable to
targeting the interaction of vWF with coagulation factor
VIII, a necessary participant in secondary hemostasis and
believed to be necessary to facilitate activation of
coagulation factor X by factor IX,. Factor VIII has been
shown to be extremely labile except when complexed to vWF.
This invention provides a fragment of vWF capable of binding
factor VIII, and having, relative to wild type, an enhanced
WO~2~1719' PCT/~'S92/~7
s~
affinity therefor, but of insufficient size to substantially
protect factor VIII so complexed from denaturation or
proteolysis. Screening of mutant vWF polypeptides for
enhanced binding affinity follows the procedure of Example
30.
.
Inactivation of Heparin Sites
With respect to the use of the 52/48 kg/mol vWF fragment
as an antithrombotic, or of any of the t:herapeutic
polypeptides patterned thereupon, the following
considerations are of particular significance. It has been
mentioned previously that it is possible for more than one of
the GPIb~, glycosaminoglycan (proteoglycan), or collagen
binding domains of such a therapeutic polypeptide to be
occupied by a respective target receptor or ligand at any
particular time. Methods were described to prevent one or
both of the undesired binding activities, said aforementioned
methods involving further modifications to the therapeutic
polypeptide.
It must be considered also that delivery of such
therapeutic polypeptides to target platelet GPIb~ receptors
in a patient suffering from vascular disease or otherwise at
risk to thrombosis involves the exposure of the polypeptide
to all of the macromolecules present in the vascular system,
a situation which is very different from a two or three
component in vitro binding assay at low total protein
concentration. It is noted, for example, that there are many
types of glycosaminoglycans and proteoglycans present in the
extracellular matrix (the subendothelium) of the vascular
system. Although proteoglycans may be deemed confined to
such a matrix and unavailable for binding to vWF in undamaged
vessels, glycosaminoglycans are more widely distributed.
In particular, glycosaminoglycans are found on the
surface of many types of human cells including those that
form the walls of blood vessels. In addition, heparin itself
has anticoagulant activity and is commonly administered to
patients presenting or suspected of presenting a vascular
disease state. Consequently, there is a considerable
possibility that the administration of a monomeric 52/48
WO 92/1719~ PCl`/~!S92/02~7~
2~07~ 66
kg/mol polypeptide or, for example, a modified form of the
polypeptide containing also one or more Type IIb mutations
(see Example 22 below) as an intended antithrombotic will be
ineffective, the therapeutic molecules having sufficient
affinity for the widely dispersed array of glycosaminoglycan
macromolecules or for additionally administered heparins.
Accordingly, it is preferred in the practice of the
invention, with respect to the design of antithrombotic
polypeptides patterned upon the 52t48 kg/mol vWF fragment,
said fragments intended to have affinity for platelet GPIb~
receptors, that the binding domain for glycosaminoglycans
within such fragments be deleted or inactivated by, for
example, one of the following methods:
(A) site directed or loop out mutagenesis in M13mpl8
(see Example 7) to ex~ress a further mutagenized
polypeptide from which the glycosaminoglycan
binding domain is deleted; or
(B) subjecting the mature subunit 52/48 kg/mol fragment
to selective proteolysis to preserve subfragments
of the residue 441-730 sequence having GPIb~
binding ability, and which can then be covalently
reattached, but minus a deleted section of the
fragment such as a subset of the intervening
residue 509-695 region; or
(C) covalent modification of the vWF amino acid
sequence domain which confers the additional and
undesired binding function to inactivate it.
A similar strategy can be employed to delete or inacti~ate
the collagen binding function of such therapeutic
polypeptides. Removal of both the potential collagen and
potential glycosaminoglycan (proteoglycan~ binding functions
~rom such vWF-derived therapeutics is also within the scope
of the invention.
Similar strategies may be used to modify different or
larger fragments of vWF directed to platelet GPIb~ binding
sites, including those up to the size of the entire mature
subunit thereof, or larger, and demonstrated to have
potential antithrombotic activity but one or more potential
binding sites for other ligands or receptors, the deletion or
WO92/17192 67 2 1 ~ 7 .~ ~
inactivation of which is preferable. Additionally, and with
respect to those polypeptides of the invention patterned upon
the mature vWF subunit, or a fragment thereof, which are
directed to receptor sites or macromolecules other than GPIb~
(see Example 25-30), it is noted that any other binding
function of the polypeptide can be delet:ed or inactivated by
the above-mentioned strategies.
Additionally preferred in the treatment of hemorrhagic
disease is a polypeptide patterned upon the 116 kg/mol vWF
homodimer (Example 7, below), directed to the platelet GPIb~
receptor, in which one or more other binding functions of the
polypeptide have been deleted or inactivated.
Antibodies with Therapeutic Activity
Antibodies, and particularly conformation dependent
lS antibodies, are powerful tools for analyzing the structure
and function of macromolecules. By blocXing macromolecular
interactions, antibodies can also have important therapeutic
utility.
Accordingly, this invention includes within its scope an
antibody which is specific for the vWF subunit, or any
polypeptide containing a subset thereof, and which is made by
a process which involves immunizing animals with a
polypeptide patterned upon the mature vWF subunit sequence
between approximately residue 441 and residue 730 thereof,
and containing one or more residues corresponding to a Type
IIB vWF, or with any other polypeptide of the invention.
Further diagnostic or therapeutically useful antibodies can
be generated against polypeptides so patterned upon the above
stated sequence region and in which cysteine residues 509 and
695 form a disulfide bond, thereby recreating important
domains of tertiary structure. Procedures useful in
immunizing animals with vWF polypeptides are well known in
the art.
Therapeutic com~ositions
one or more of the polypeptides of the present invention
can be formulated into pharmaceutical preparations for
therapeutic, diagnostic, or other uses. To prepare them for
WO92/1719~ . ' PCT/~IS92/02~7~
~107100 6~
intravenous administration, the compositions are dissolved in
water containing physiologically compatible substances such
as sodium chloride (e.g. at 0.35-2.0 M), glycine, and the
like and having a buffered pH compatible with physiological
conditions, which water and physiologically compatible
substances comprise a pharmaceutically acceptable carrier.
With respect to the monomeric 52/48 kg/mol polypeptides
of the invention or other antithrombotic polypeptides, the
amount to administer for the prevention or inhibition of
thrombosis will depend on the severity with which the patient
is subject to thrombosis, but can be determined readily for
any particular patient.
With respect to the recombinant 116 kg/mol polypeptides
of the invention, or other dimeric polypeptide subfragments
thereof, the amount to administer for the treatment of von
Willebrand disease will depend on the severity with which th~
patient is subject to hemorrhage, but can be determined
readily for any particular patient.
ExamPles
The following Examples are representative of the
practice of the invention.
I. Construction of vWF Polypeptides
Suitable to Carry IIb-Type Mutations
Example 1 - Expression of a mutant cysteine-free mature
von Willebrand factor subunit fragment having
an amino terminus at residue 441 (arginine)
and a ca~rb`oxy_terminus at residue 733 ~valine)_
Preparation of a cDNA Clone from
pre-pro-von Willebrand Factor mRNA
A cDNA clone encoding the entire von Willebrand factor
gene (for the pre-propeptide) was provided by Dr. ~ennis
Lynch, Dana-Farber Cancer Institute, Boston, MA and was
prepared as described in Lynch, D.C. et al., Cell, 41, 49-56
(1985). It had been deemed probable that the size of vWF
mRNA would likely exceed that of human 28S type rRNA.
Accordingly, total RNA from endothelial cells (the major
source of plasma vWF) was sedimented in sucrose gradients,
WO92/1719' ~ P~ 92/0~47
69
with RNA larger than 28S being selected for construction of a
cD~A library.
This enriched fraction was further purified using two
separate cycles of poly(u)-Sephadex0 chromatography to select
for RNA species (mRNA) having 3' polyadenylated ends. Lynch
et al., supra, estimated the prevalence of vWF mRNA in this
fraction at about 1 in 500, which fraction was used to
generate a cDNA library of approximately 60,000 independent
recombinants.
To generate the cDNA library, ~tandard techniques were
used. The mRNA population was primed using an oligo (dT)
primer, and then transcribed with a reverse transcriptase.
The RNA strands were then removed by alkaline hydrolysis,
leaving cDNA anticoding strands (equivalent to transcribed
strands) which were primed by hairpin looping for second
strand synthesis using DNA polymerase I. The hairpin loop
was removed with S~ nuclease and rough ends were repaired
with DNA polymerase I.
GC tailing, Maniatis, T. et al., Molecular Clonin~, 2nd
ed., v.1, p.5.56 tl987), was then used to anneal the cDNA
into plasmid vector pBR322. Oligo(dC) tails were added to
the cDNA fragments with terminal transferase and were
annealed to oligo(dG) tailed pBR322. The plasmids were
transformed into ampicillin sensitive E.coli, strain HB101
for propagation. Suitable clones were identified after
screening with 32P-la~elled- cDNA prepared as reverse
transcriptase product of immunopurified vWF polysomes.
Positive clones were subcloned into pSP64 (Promega Co.,
Madison, WI).
Primer Directed AmPlification of cDNA
cDNA representing the full length pre-pro-vWF gene from
pSP64 was subjected to enzymatic amplification in a
polymerase chain reaction. Based upon the e~tablished
nucleotide sequence of the pre pro-vWF gene, Bonthron, D. et
al. Nucl. Acids Res., 14(17), 7125-7127 (1986); Mancuso, D.
et al., . of Biolo~ical Çhemistry, v.264(33), 19514-19527
(1989) oligonucleotides flanking the region of interest
(designated (1), SEQ ID N0: 3, and (2), SEQ ID N0: 4) were
W092/1719~ ~0 7 ~ ~ ~ PCT/~'S92/0247
prepared. All oligonucleotides used herein were synthesized
by the phosphoramidite method , Sinha, et al., Tetrahedron
Letters, 24, 5843 ~1983), using a model 380B automated
system, Applied Biosystems, Foster City, CA.
Oligonucleotide (1) (SEQ ID N0: 3)
5'ACGAATTC CGG CGT TTT GCC TCA GGA3 '
EcoRI Arg~ Gly~
Oligonucleotide (2) (SEQ ID NO 4)
3'GG GAC CCC GGG TTC TCC TTG AGG TAC CA~ TCGAAG5'
5'cc cta ggg ccc aag agg aac tcc atg qta aqcttc3'
Leu~s Met732Val733HindIII
The oligonucleotides overlap the ends of the coding region
for that fragment of the mature vWF subunit which can be
produced by digestion with trypsin and which begins with
residue 449 (valine) and ends with residue 728 (lysine).
Oligonucleotide (1) corresponds to coding strand DNA
(analogous with mRNA) ~or amino acid positions 4~1 to 446 and
adds an EcoRI restriction site 5' to the codon for amino acid
441. Oligonucleotide (2) corresponds to the non-coding
strand (transcribed strand) of mature vWF DNA for amino acids
positions 725-733 and adds a HindIII restriction site 3' to
the codon for amino acid 733. The coding strand
complementary to (2) is shown in lower case letters.
Using the above oligonucleotides with the full length
cDNA as template, a cDNA~fragment corresponding to mature vWF
residues Nos. 441-733, and containing EcoRI and Hind III
linkers, was then synthesize~ in a polymerase chain reaction
following the method of Saiki, R.X. et al. Science, 239, 487-
491 (1988).
The procedure utilizes a segment of double-stranded vWF
cDNA, a subsegment of which is to be amplified, and two
single-stranded oligonucleotide primers (in this case
oligonucleotides (1), (2)) which flank the ends of the
subsegment. The primer oligonucleotides (in the presence of
a DNA polymerase and deoxyribonucleotide triphosphates) were
added in much higher concentrations than the DNA to be
amplified.
.
WO92/1719 ~ P ~ ~'S92t0~7
71
Specifically, PCR reactions were performed with a DNA
thermal cycler tPerkin Elmer Co., Norwalk, CT/Cetus
Corporation, Berkeley, CA) using Taq polymerase (Thermus
aquaticus). The reactions were run in lO0 ~e volumes
containing l.0 ~g of pre-pro-vWF cDNA, l.0 ~g of each
synthetic oligonucleotide primer, and buffer consisting of 50
mM KCl, lO mM Tris HCl ~pH 8.3), 1.5 m~ MgCl2, 0.1% gelatln
(BioRad Co., Richmond, CA) and 200 mM of each dNTP. PCR
conditions were 35 cycles of 30 seconds at 94OC, 30 seconds
at 52C and l minute at 72C. ~mplified fragments were then
purified and isolated by electrophoresis through a 2% agarose
gel, Maniatis et al., Molecular Cloninq A_Laborator~ Manual,
164-170, Cold Spring Harbor Lab., Cold Spring Harbor, NY
(1982).
The vast majority of polynucleotides which accumulate
after numerous rounds of denaturation, oligonucleotide
annealing, and synthesis, represent the desired double-
stranded cDNA subsegment suitable for further amplification
by cloning.
20- For some experiments, cDNA corresponding to the mature
vWF fragment beginning at amino acid sequence posi~ion 44l
and ending at position 733 was prepared and amplifisd
directly from platelet mRNA following the procedure of
Newman, P.J. et al. J. Clin. Invest., ~2, 739-743 (l988).
Primer nucleotides No. 440 and 733 were utilized as before
with the resulting cDNA containing EcoRI and HindIII linkers.
Insertion of cDNA into Ml3m~18 Cloninq Vehicle
The resultant double stranded von Willebrand factor cDNA
corresponding to the amino acid sequence from residue 44l to
733 was then inserted, using EcoRI and HindIII restriction
enzymes, into the double stranded replicative form of
bacteriophage Ml3mpl8 which contains a multiple cloning site
having compatible EcoRI and HindIII sequences.
Ml3 series filamentous phages infect male tF factor
containing) E.coli strains. The infecting form of the virus
is represented by single stranded DNA, the (') strand, which
i5 converted by host enzymes into a double stranded circular
form, con~aining also the minus (~) strand, which double
WO92tl7192 PCT/~'S92/0247
- 2107 1 a ~ 72
stranded structure is referred to as the replicative form
(RF). The ability to isolate a stable single stranded (+)
form of the virus is particularly useful to verify the
integrity of any cloned sequences therein. See Messing, J.,
Meth.~ ymz~gy, 101, 20-78 (1983); Yanish-Perron, C. et
- al., Gene, 33, 103-109 (1985).
Accordingly, the vWF cDNA insert was completely
sequenced using single-stranded dideoxy methodology (Sanger,
F. et al. Proc. Natl. Acad. Sci USA, 74, 5463-5467 (1977)),
utilizing the single-stranded (~) form of M13mpl8, to confirm
that the vWF cDNA fragment contained the correct coding
sequence for mature vWF subunit residues 441-733.
Site-Directed Mutaqenesis to Replace Cysteine Residues
Cysteine residues 459, 462, 464, 471, 474, 509, and 695,
within the mature vWF fragment corresponding to amino acids
441 to 733, were replaced with glycine residues by
substitution of glycine codons for cysteine codons in the
corresponding cDNA. In order to accomplish this,
oligonucleotides (see Sequence Listing ID NOS: 5-8)
encompassing the region of each cysteine codon of the vWF
cDNA were prepared as non-coding strand ~transcribed strand)
with the corresponding base substitutions needed to
substitute glycine for cysteine. The oligonucleotides used
were as follows:
Oligonucleotide (3) (SEQ ID NO: 5)
3'GGA CTC GTG CCG~GTC TAA CCG GTG CAA CTA CAA CAG5'
5'cct gag gac gg~ cag att qqc cac qqt gat gtt gtc3'
Pro Glu His Gly Gln Ile Gly His Gly Asp Val Val
~59 462 46~
(simultaneously replacing cysteines 459, 462, 464).
Oligonucleotide (4~ (SEQ ID NO: 6)
3'TTG GAG TGG CCA CTT CGG CCG GTC CTC GGC5'
5'aac ctc acc qqt gaa gcc qqc cag gag ccg3'
Asn Leu Thr Gly Glu Ala Gly Gln Glu Pro
471 474
(simultaneously replacing cysteines 471, 474)
WO92/1719' PCT/US92/02~7~
73 C2~ 7~
Oligonucleotide (5) (SEQ ID NO: 7)
3'CTA AAG ATG CCG TCG TCC G5'
5' gat ttc tac gqc agc agg c3'
Asp Phe Tyr Gly Ser Arg
509
(replacing cysteine 509)
Oligonucleotide (6) (SEQ ID NO: 8)
3' TCG ATG GAG CCA CTG GAA CGG5'
5'agc tac ctc qgt gac ctt gcc3'
lOSer Tyr Leu Gly Asp Leu Ala
695
(replacing cysteine 695)
Hybridizing oligonucleotides are shown in capita:L
letters and are equivalent to the transcribed strand (non-
coding DNA). The equivalent coding strand is shown in lowercase letters with the correspondiny amino acids shown by
standard three letter designation. (for designations see
Table l)
As elaborated below, cysteines 459, 462 and 464 were
replaced simultaneously using oligonucleotide (3). Cysteine
residues 471 and 474 were then replaced simultaneously using
oligonucleotide (~. Cysteine residues 509 and 695 were then
replaced individually using oligonucleotides (5) and (6)
respectively.
The cysteine to glycine cDNA substitutions were
accomplished following the procedure of Kunkel, T.A., Proc.
Natl. Acad. Sci. USA, 82,488-492 (198S) which procedure
repeats a series of steps for each oligonucleotide and takes
advantage of conditions which select against a uracil
containin~ DNA template:
(A) Ml3mpl8 phage, containing wild type vWF
cDNA corresponding to amino acid
positions 441 to 733, is grown in an
E.coli CJ236 mutant dut~ung~strain in a
urac~l rich medium. Since this E.coli
strain is deficient in deoxyuridine
triphosphatase (dut-), an intracellular
pool of dUTP accumulates which competes
with dTTP for incorporation into DNA.
WO92/1719' 2 ~ 0 71~ O PCT/~!S92/02~7~
74
(see Shlomai, J. et al. J. Biol. Chem.,
253(9), 3305-3312 (1978). Viral DNA
synthesized under these conditions
includes several uracil insertions per
vlral genome and is stable only in an
E.coli strain which is incapable of
removing uracil, suc:h as ~ung~) strains
which lack uracil gly~osylase. Uracil-
containing nucleoticles are lethal in
single stranded (+) M13mpl8 DNA in ung'
strains due to the creation of abasic
sites by uracil glycosylase.
(B) Single-stranded (+) viral DNA is isolated
from culture media in which phage were
grown in E.coli strain CJ236 dut~ung~.
The single stranded (~) form of the virus
contains the specified vWF cDNA at its
multiple cloning site which cDNA is
equivalent to the nontranscribed vWF DMA
strand.
(C) Oligonucleotide (3), which contains codon
alterations necessary to substitute
glycines for cysteines at positions 459,
462 and 464, is then annealed in vitro to
single stranded (+) phage DNA.
Generally, a wide range of
oligonucleotide concentrations is
suitable in this procedure. Typically 40
ng of oligonucleotide was annealed to
0.5-1.0 ~g M13mpl8 phage t~) DNA.
(D) All missing sequence of the M13mpl8(~)
strand is then completed in vitro using
T7 DNA polymerase and T4 D~A ligase in a
dTTP rich environment thereby generating
a transcribable vWF cDNA sequence
corresponding to amino acid positions 441
to 733 of the mature vWF subunit.
(E) The double stranded M13mpl8 phage, now
containing a thymine normal (~) strand
'
W O 9~/17192 PC~r/~!S92/0247~
75 2~
and a (+) strand with several uracil
substitutions, is transformed into a wild
type E.coli XL-1 Blue (Stratagene, La
Jolla, CA) strain which contains normal
levels of uracil glycosylase and
- deoxyuridine triphosphatase.
(F) Uracil glycosylase and other enzymes
present in the new host initiate
destruction of the uracil-containing (+)
strand of the double-strand phages,
leading after replication in the host of
remaining phage (~) strand DNA to the
presence of stable thymine-normal double
stranded (RF) DNA which reflects t:he
glycine mutations induced by the
oligonucleotide.
(G) Steps (A) to (F) of the above process are
then repeated for each of
oligonucleotides (4), (5) and (6) until
each successive cysteine codon of the vWF
sequence within the M13mpl8 phage has
been replaced by a glycine codon.
(H) Vpon completion of mutagenesis proceduras
the sequence of the vWF cDNA insert was
reconfirmed using the single stranded DNA
dideoxy method. (Sanger, F. et al.,
supra~
Construction of Expression Plasmids.
The double stranded vWF cDNA ~ragment containing 7 site-
specific cysteine to glycine mutations is then removed from
M13mpl8 phage by treatment with EcoRI and HindIII restriction
endonucleases, after which the ends of the fragment are
modified with BamHI linkers tRoberts, R.J. et al. Nature,
265, 82-~4 (1977)) for cloning into a high ef~iciency E.coli
expression vector. The particular expression vector chosen
is plasmid pET-3A, developed by Rosenberg, A.H. et al. Gene,
v.56, 125-135, (1987) and which is a pBR322 derivative
containing a high efficiency (~lO) T7 transcription promoter
WO92/1719~ PCT/~'S92/0247~
2~7~ 7~
directly adjacent to the ~amHI linker site. When containing
the above-specified fragment of mutant vWF cDNA, the pET~3A
vehicle is refered to as "p7E" or p7E expression plasmid.
A second pET-3A-derived expression plasmid (designated
p7D) was constructed containing the ident:ical vWF coding
- sequence cloned into the plasmid in the opposite orientation.
p7D should be unable to express the vWF polypeptide fragment.
A third expression plasmid (pJD18) contains wild type
52/48 tryptic vWF fragment CDNA encoding the vWF amin~ acid
lO sequence between residues 441 and 733, (with 7 cysteines) in
the same pET-3A vector.
The p7E (or p7D and pJD18) expression plasmids were then
cloned into an ampicillin sensitive E.coli strain, BL21(DE3),
Novagen Co., Madison WI, according to a well established
15 protocol Hanahan, D., J Mol. Biol., 166, 557-580 (1983).
Strain BL21(DE3) is engineered to contain a gene for T7 RNA
polymerase so that the vWF insert can be transcribed with
high efficiency.
Expression of Mutant vWF Polypeptides
2Q Three separate samples of E.coli strain BL21(DE3)
containing respectively p7E, p7D or pJDl8 expression plasmids
were innoculated into 5-6 ml of 2X-YT growth medium
containing 200 ~g/ml of ampicillin, and grown overnight at
- 37C to create fully grown cultures. 2X-YT growth medium
contains, per liter of water, lO gm Bacto-tryptone, 10 gm
yeast extract and 5 gm NaCl. Five ml of each overnight
culture was then innoculated into 500 ml of 2X-YT medium,
again containing 200 ~g/ml of ampicillin and grown for 2
hours at 37C with shaking.
After the 2 hour incubation period, the cultures were
induced for protein expression by addition of isopropyl-beta-
d-thiogalactopyranoside to a concentration of 5 mM. The
incubation was then continued ~or 3 hours at 37OC.
A high level of expression of vWF polypeptide was
obtained with p7E and pJD18 resulting in the generation of
cytoplasmic granules or "inclusion bodies" which contain high
concentrations of vWF polypeptide in essentially insoluble
form. Solubilization of vWF polypeptide was accomplished
WO92/1719~ ~ a 7 ~P~ S92/02~7
according to the followlng procedure. As explained in
Example 2, p7E and pJD~8 extracts responded very differently
to solubilization procedures. See Maniatis, T. et al.,
Molecular Cloninq, 2nd ed., vol. 3, Sec. 17.37, (1989) Cold
Spring Harbor Laboratory Press, Cold Spring Harbor, NY, for a
general discussion of the properties of, and successful
manipulation strategies for, inclusion bodies.
The cells were harvested by centrifugation at 4000 g for
15 minutes in a JA-14 rotor at 40C. The pelleted cells were
washed in 50 ml of ice cold buffer (O.l M NaCl, lO mM Tris pH
9.0, l mM EDTA) and repelleted by centrifugation at 4000 g at
4C.
The cell pellets from p7E, p7D and pJDl8 cultures were
each redissolved in 5 ml of lysing buffer and kept ice-cold
for 30 minutes. The lysing buffer comprises a solution of
sucrose 25%(w/v), 1 mM phenylmethylsulfonylfluoride (PMSF), 1
mM ethylene diaminetetraacetic acid tEDTA), 2 mg/ml lysozyme
and 50 mM Tris hydrochloride, adjusted to pH 8Ø
After the 30 minute incubation, aliquots of l.0 Molar
MgCl2 and MnCl2 were added to make the lysing solution lO mM
in each cation. Sixty ~g of DNAseI ~Boehringer-Mannheim) was
then added and the incubation was continued at room
temperature for 30 minutes.
Twenty ml of buffer No. 1 (0.2 M NaCl, 2 mM EDTA, and l~
(w/v) 3-[(3-cholamidopropyl)-dimethylammonio]-l-
propanesulfonate (CHAPS), 1% (w/v) Non-idet 40, and 20 mM
Tris hydrochloride, pH 7.5) was then added to the incubation
mixture. The insoluble material was pelleted by
centrifugation at 14,000 g (12,000 rpm in a JA-20 rotor) for
30 minutes at 4C.
The relatively .insoluble pelleted material derived from
each culture (which contains the desired polypeptides except
in the case of p7D) was washed at 25C in lO ml of buffer No.
2 (0.5% (w/v) Triton X-lO0 surfactant, 2 mM EDTA, 0.02 M Tris
hydrochloride, pH 7.5) and vortexed extensively. The
suspension was centrifuged at 14,000 g for 30 minutes at 4C
and the supernatant was then discarded. The process of
resuspension of the pelleted material in buffer No. 2,
vortexing and centrifugation was repeated twice.
WO92/17192 PCT/US92/0247~
~1071~0 78 -
Each pellet was then washed in 5 ml of buffer No. 3
(0.02 M Tris hydrochloride, pH 7.5, and 2 mM EDTA) at 25DC
and vortexed extensively. The suspension was then
centrifuged at 4C for 30 minutes at 14,000 g after which the
supernatant was discarded leaving a pelll_t of inclusion body
derived material (the "wet pellet") with a clay-like
consistency (With respect to the following final steps, and
in replacement therefor, see also Example 20 which presents
an additional improved procedure).
The insoluble pellet was slowly redissolved in an 8
Molar ure~ solution held at room tempera~ure for 2 hours,
after which solubilization was continued overnight at 4C.
The urea-soluble material was extensively dialyzed against a
solution of 0.15 M NaCl containing 20 mM Hepes !N-[2-
hydroxyethyl]piperazine-N-[2-ethanesulfonic acid]) (pH 7.4)
("Hepes-buffered saline") at 4C. The solublized
peptide extracts were assayed for purity (Example 2), used in
vWF binding inhibition assays (Example 3) or subject to
further purification. Further purification steps should not
20- be delayed and the samples should remain cold.
The cysteine-free vWF polypeptide (comprising subunit
positions 441 to 733) constitutes more than 75% of the
material solubilized from the inclusion bodies according to
the above procedure. Further purification of the cysteine-
free mutant vWF polypeptide was accomplished by redialyzingthe partially purified peptide extract against 6 M
guanidine-HCl, 50 mM Tris HCl, pH 8.8 followed by dialysis
against 6 M urea, 25 mM Tris HCl, 20 mM KCl, O.l mM EDTA, pH
8Ø The extract was then subjected to high performance
liquid chromatography using ~-Sepharose~ Fast Flow
(Pharmacia, Uppsala, Sweden) for anion exchange. The column
was preequilibrated with 6 M urea, 25 mM Tris HCl, 20 mM KCl,
0.1 mM EDTA pH 8Ø Elution of the vWF polypeptide utilized
the same buffer except that the concentration of KCl was
raised to 250 mM. Polypeptide samples used for ~urther
assays were redialyzed against 0.15 M NaCl, 20 mM Hepes, pH
7.4. However, long term storage was best achieved in urea
buffer (6 M urea, 25 mM Tris HCl, 20 mM KCl, 0.1 mM EDTA pH
8Ø Final p7E-vWF polypeptide percent amino acid
WO92/17192 PCT/~IS92/0247~
~,~Q7~
79
compositions (by acid hydrolysis~ compared closely with
values predicted from published sequence informa~ion
(Bonthron, D. et al. and also Mancuso, D. et al. in Example
1, supra; see also Figure 1).
Example 2 - Characterization of the cysteine-free
mutant von Willebrand factor fragment
produced bY expression ~lasmid P7E
Urea solubilized and dialyzed polypeptides extracted
from inclusion bodies of cultures containing expression
plasmids p7E, p7D and pJD18 were analyzed using
polyacrylamide gel electrophoresis ~PAGE) and immunoblotting.
Characterization bv SDS-Polyacrylamide Gel Electrophoresis
The purity and nature of the expression plasmid
extracts, which had been urea-solubilized and then
extensively dialyzed, were first analyzed using the
denaturing sodium dodecylsulfate-polyacrylamide gel
electrophoresis procedure of Weber, K. et al. J. Biol. Chem.,
244, 4406-~412 (1969), as modified by Laemli, U.K. ~ature,
227, 680-685 (1970) using an acrylamide concentration of 10%.
The resultant gels were stained with Coomassie blue and
compared.
The extract from expression plasmid p7E contains as the
major component, the mutant von Willebrand factor polypeptide
which migrates with an apparent molecular weight of
approximately 36,000 gram/mole (g/mol). The polypeptide
appears as a single band under ~oth reducing conditions
(addition of between lO and 100 mM dithiothreitol "DTT" to
the sample for 5 min at 100C prior to running the gel in a
buffer also containing the same DTT concentration) and
nonreduciny conditions, which result is consistent with the
substitution of glycine residues for all of the cysteine
residues therein. No vWF polypeptide could be extracted from
host cells containing p7D expression plasmids as expected
from the opposite orientation of the vWF cDNA insert.
The cysteine-containing vWF polypeptide expressed by
host cells containing pJD18 plasmids, and which contains the
wild type amino acid sequence of the 52/48 fragment, (herein
WO92/1719' PCT/~'S92/02~7~
2~7~ 80
represented by a residue 441 to 733 cloned fragment) behaved
differently under reducing and nonreducing conditions of
electrophoresis. The wild-type sequence expressed from pJD18
forms intermolecular disulfide bridges resulting in large
molecular weight aggregates which are unable to enter the 10%
acrylamide gels. After reduction (incubation with 100 mM DTT
for 5 min at 100C), the vWF peptide migrates as a single
band with a molecular weight of approximately 38,000.
Characterization bv Immunoblottinq
Polypeptides expressed from p7E, p7D and pJD18 were
further characterized by immunoblotting ("Western blotting")
according to a standard procedure Burnett et al., A. Anal.
Biochem., 112, 195-203, (1981) and as recommended by reagent
- suppliers. Samples containing approximately 10 ~g of protein
from the urea-solubilized and dialyzed inclusion body
extracts of host cells (containing p7E, p7D and pJD18
plasmids) were subjected to electrophoresis on 10%
polyacrylamide gels, Laemli, U.K. Nature, 227, 680-685
(1970), in the presence of 2% concentration of sodium dodecyl
sulfate.
The proteins were blotted and immobilized onto a
nitrocellulose sheet ~Schleicher and Schuell, Keene, NH) and
the pattern was then visualized using immunoreactivity.
The von Willebrand factor-specific monoclonal antibodies
(from mice) used to identify the polypeptides were RG-46 (see
Fugimura, Y. et al. J. Biol. Chem., 261(1), 381-385 (1986),
Fulcher, C.A. et al. Proc. Natl. Acad. Sci. USA, 79, 1648-
1652 (1982)), and NMC-4 (Shima, M. et al. J. Nara Med.
Assoc., 36, 662-669 (1985) ), both of which have epitopes
within the expressed vWF polypeptide of this invention.
The secondary antibody (~2sI-rabbit anti-mouse IgG),
labelled by the method of Fraker, P.J. et al. Biochem.
Biophys. Res. Commun., 80, 849-857 (1978)), was incubated for
60 minutes at 25C on the nitrocellulose sheet. After
rinsing, the sheet was developed by autoradiography.
Peptide extracts from host cells containing p7E and
pJDl8 expression plasmids display strong immunoreactivity for
R5-46 antibody and a weaker but definite affinity for NMC-4
WO92/1719~ PCT/~!S92/02~7
81 ~ ~ 7~
antibody. As expected, peptide extracts from p7D plasmids
show no immunoreactivity with either RG-46 or NMC-4.
Example 3 - Inhibition of botrocetin-induced binding
of vW~ to platelets by the cysteine-free
mutant polypeptide exPressed bY p7E
It has been demonstrated that botrocetin, extracted from
the venom of Bothrops ~araraca modulates the in vitro binding
of multimeric von Willebrand factor to platelets (Read, et
al. Proc. Natl. Acad. Sci., 75, 4514-4518 (1978)) and that
botrocetin binds to vWF within the region thereof containing
amino acid sequence positions 441-733 (of the mature
subunit~, and thus the GPIb binding domain. (Andrews, R.K.
et al., Biochemistry, 28, 8317-8326 (1989)).
The urea-solubilized and dialyzed polypeptide extracts,
obtained (according to the method of Example 1) from cultures
containing expression plasmids p7E, p7D and pJD18, were
tested without further purification for their ability to
inhibit botrocetin-induced vWF binding to formalin-fixed
platelets on a dose dependent basis.
Formalin-fixed platelets, prepared according to the
method o~ ~acFarlane, D. et al., Thromb. Diath. Haemorrh. 34,
306-308 (1975), were pre-incubated at room temperature for 15
minutes with specified dilutions of peptide extracts obtained
from cultures containing pJD18, p7D, and p7E plasmids.
Botrocetin, (Sigma, St. Louis, M0) to a final concentration
of 0.4 ~g/ml, and ~sI-labelled multimeric vWF (isolated from
human plasma cryoprecipitate according to the method of
Fulcher, C.A. et al. Proc. Natl. Acad. Sci. USA, 79, 16~8-
1652 (1982), and labelled according to the method of Fraker,
P.J. et al. Biochem. Biophys. Res. Commun., 80, 849-857
(1978)) were then added to the incubation mixture, and the
~mount of ~ vWF bound to the platelets was determined.
~ vWF binding to the platelets was referenced against
100% binding which was defined as the amount of I~I- vWF
bound in the absence`of added peptide extracts.
Peptide extracts from expression plasmids p7D, and also
pJDlB ~unreduced and unalkylated) could not compete with
plasma-derived vWF for platelet GPIb receptor binding sites.
The peptide extract from plasmid p7E was effective in a dose
~ WO92/17]9~ PCT/~IS92/02~7~
2~7~ 82 -~-
dependent manner (using a range of o to 100 ~g extract/ml) in
inhibiting vWF binding. The concentration of urea-
solubilized polypeptide extract (~g/ml) in the incubation
mixture reflects the total protein concentration from the
extract. Addition of peptide extracts to the reaction
mixture causes certain nonspecific effects which raise
apparent initial binding to 110% of the value found in the
absence of the added peptide extracts. The l~-IvWF
concentration used was 2~g/ml.
Example 4 - Expression of a mutant vWF fragment of
reduced cysteine content containing a
disulfide-de~endant conformation
Utilizing the procedures of Example 1, except as
modified below, a mutant vWF polypeptide fragment
(corresponding to the mature vWF subunit sequence from
residue 441 to residue 733) was prepared in which the
cysteines at positions ~59, 462, 464, 471 and 474 were each
replaced by a glycine residue. Cysteine residues were
retained at positions 509 and 695, and allowed to form an
intrachain disulfide bond.
Site directed mutagenesis was performed only with
oligonucleotides No. 459 and 471, thereby substituting
glycine codons only at positions 459, 462, 464, 471 and 474.
Upon completion of mutagenesis procedures, the sequence of
the mutant vWF cDNA was confirmed using the single-stranded
dideoxy method.
The double-stranded~form of the vWF cDNA insert
~containing 5 cysteine to glycine mutations) was then removed
from M13mpl8 phage by treatment with EcoRI and HindIII
restriction endonucleases, modified as in Example 1 with
BamHI linkers, and cloned into pET-3A. The p~T-3A vehicle so
formed is referred to as "p5E" or p5E expression pIasmid.
The p5E expression plasmids were then cloned into
ampicillin sensitive E.coli strain BL21(DE3), Novagen Co.,
Madison, WI, according to the procedure o~ Hanahan, D., J.
Mol. Biol., 166, 557-580 (1983). The p5E mutant polypeptide
was expressed from cultures of E.coli BL21 (DE3) following the
procedure of Example l except that solubilization of
inclusion body pellet material in the presence of 8 Molar
WO92/17192 PCT/~IS92/02~7
83 2 ~ 't~
urea need not be continued beyond the initial 2 hour period
at room temperature, at which point redissolved material had
reached a concentration of 200 ~g/ml. Oxidation of cysteine
residues 509 and 695 to form a disulfide bond was
accomplished by dialysis overnight against ~epes-buffered
saline. Formation of intrachain rather than interchain
disulfide bonds is favored by allowing thiol oxidation to
proceed at a low protein concentration such as S0-100 ~g/ml.
As in Example 1 pertaining to the p7E extracts, final
purification of urea-solubilized inclusion body preparations
was accomplished by dialysis against the 6 M ~uanidine and 6
M urea buffers followed by anion exchange chromatography.
Example 5 - Characterization of the mutant vWF
fraqment ~roduced by expression plasmid p5E
The mutant von Willebrand factor polypeptides produced
by cultures containing expression plasmid p5E were
characterized utilizing the procedures of Example 2, and in
particular compared~with the vWF fragment expressed by
plasmid p7E.
Urea-solubilized and dialyzed polypeptides extracted
from inclusion bodies (according to the procedure of Example
4) were compared with similar extracts from p7E plasmid
cultures produced as in Example 1.
Characterization bY SDS-PolYacrYlamide Gel Electrophoresis
The denaturing sodium dodecylsulfate gel procedure of
Example 2 was used to compare the p5E vWF fragments, which
can form disulfide bonds using cysteine residues 509 and 695,
with the p7E fragment which has no cysteine residues.
Electrophoresis was conducted using 7.5 ~g of protein extract
30 per lane on 10% acrylamide gels under reducing (100 mM
dithiothreitol) and non-reducing conditions.
Under reducing conditions, and after staining with
Coomassie blue, extracts from p7E and p5E have identical
electrophoretic mobilities.
Electrophoresis under nonreducing conditions, however,
demonstrates the effects of disulfide bonds involving
residues 509 and 695. A substantial amount of the p5E
WO92/1719~ 2 1 ~ 7 1 ~ PCT/~S92/0247
84
extract appears as a high molecular weight complex (resulting
from interchain disulfide bonds) which enters the gel only
slightly. Densitometric scanning of the gels of initial
preparations indicates that approximately 25% of the p5E
polypeptide material found on nonreducing gels is represented
by monomers of the 441-733 fragment having an apparent
molecular weight of approximately 38,000. The percent of
monomer present in p5E extracts can be improved significantly
by conducting urea solubilization, dialysis, and thiol
oxidation at a more dilute protein concentration, such as 50-
100 ~g/ml, to favor intrachain rather than interchain
disulfide bond formation.
This p5E monomeric species has a slightly higher
mobility during electrophoresis under nonreducing conditions
than the comparable p7E product species which has no cysteine
residues. The mobilities of these p5E and p7E monomeric 38
kg/mol species appear identical under reducing conditions.
The slightly accelerated mobility of a polypeptide which
retains tertiary structure in the presence of SDS under
nonreducing conditions, when compared to the mobility of the
homologous polypeptide which the anionic detergent converts
completely into a negatively charged fully rigid rod under
said conditions, is generally considered suggestive of the
presence of an intrachain disulfide bond.
Characterization by Immunoblotting
The behavior of p5E and p7E extracts were also examined
using immwlological methods.
A~ in Example 2, vWF-specific murine monoclonal
antibodies RG-46 and NMC-4 were used as probes. RG-46 has
been demonstrated to recognize as its epitope a linear
sequence of amino acids, comprising residues 694 to 708,
within the mature von Willebrand factor subunit. The binding
of this antibody to its determinant is essentially
conformation independent. Mohri, H. et al., J. Biol. Chem.,
263(34), 17901-17904 (1988).
NMC-4 however, has as its epitope the domain of the von
Willebrand factor subunit which contains the glycoprotein Ib
binding site. Mapping of the epitope has demonstrated that
WO92/17192 PCT/~!S92/02~7~
2~ ~71~
it is contained within two discontinuous domains (comprising
approximately mature vWF subunit residues 474 to 488 and also
approximately residues 694 to 708) brought into disulfide-
dependent association; Mohri, H. et al., supra, although it
was unknown whether the disulfide bond conferring this
tertiary conformation in the native vWF molecule was
intrachain or interchain. Id. at 17903.
7.5 ~g samples ~of protein) were first run on 10% SDS
polyacrylamide gels so that the antigenic behavior of
particular bands (under reducing and nonreducing conditions)
could be compared with results obtained above by Coomassie
blue staining. Immunoblotting was performed as in Example 2
to compare p5E and p7E extracts.
Application of antibody to the nitrocellulose sheets was
usually accomplished with antibody solutions prepared as
follows. Mice were injected with B-lymphocyte hybridomas
producing NMC-4 or RG-46. Ascites fluid from peritoneal
tumors was collected and typically contained approximately 5
mg/ml of monoclonal antibody. The ascites fluid was mixed (l
part per lO00) into blocking fluid (PBS containing 5% (w/v)
non-fat dry milk, Carnation) to minimize non-specific
~ackground binding. The antibody-containing blocking fluid
was then applied to the nitrocellulose.
Under nonreducing conditions, the single chain p5E
polypeptide fragment (representing the sequence from residue
441 to residue 733) displayed an approximate 120 fold
increase in binding affi~ity for NMC-4 compared to the
comparable cystein-free species isolated from p7E also
representing the primary sequence from residue 441 to 733.
After electrophoresis under reducing conditions (utilizing
100 mM DTT), the single chain p5E species showed a remarkably
decreased affinity for NMC-4, which was then very similar to
that of the cysteine-free p7E species under either reduced or
nonreduced conditions. NMC-4 also fails, under reducing or
non-reducing conditions, to recognize as an epitope
disulfide-l-inked dimers from the p5E extract.
The nitrocellulose filters used to produce autoradio-
graphs based on MMC-4 were rescreened with RG-46 by
subtracting the initial NMC-4 exposure response, which was
- . . .
WO92/1719~ ~CT/U~92/02~7~
21071~ 86 -~
kept low through a c~mbination of low antibody titer and
short exposure time. The blnding of RG-46 to the p7E
36,000 kg/mol polypeptide on the filters is the same whether
reducing or non-reducing conditions were chosen, consistent
with the replacement of all cysteines by glycine in the
expressed polypeptide.
A large molecular weight vWF antigen (reactive to RG-46)
is present in the p5E polypeptide extract under nonreducing
co~ditions. These p5E vWF` aggregates (reflecting interchain
disulfide bonds) migrate under reducing conditions in the
same position as the p7E polypeptide indicating disruption of
their disulfide contacts. However, the large p5E interchain
disulfide aggregates which are readily recognized under
nonreducing conditions b~ RG-46 are not recognized by NMC-4
under eithex reducing or nonreducing conditions. It is thus
demonstrated that the disulfide bond between residues 509 and
695 in native multimeric vWF subunits represents an
intrachain contact.
Example 6 - Inhibition of the binding of an anti-GPIb
monoclonal antibody by ~5E polypeptide
Monoclonal antibody LJ-Ibl is known to complet~ly
inhibit von Willebrand factor-platelet glycoprotein Ib
interaction. Handa, M. et al., J. Biol. Chem., 261(27),
12579-12585 (1986). It reacts specifically with the amino
terminal 45 kg/mol domain of GPIb~ which contains the vWF
binding site. Vicente, V. et al., J. Biol. Chem., 265, 274-
280 (1990).
To assess the inhibitory activity of pSE extracts on
antibody binding, a concentration of LJ-Ibl was first
selected which would, in the absence of p5E extracts, provide
half-maximal binding.
LJ-Ibl was iodinated by the procedure of Fraker, D.J. et
al., Biochem. BioPhvs. Res. Commun., 80, 849-857 (1978) using
Il~ from Amersham, Arlington Heights, IL and Iodogen (Pierce
Chemical Co., Rockford, IL). Washed platelets were prepared
by the albumin density gradient technigue of Walsh, et al.,
Br. J. ~aematol., 36, 281-298 (1977), and used at a count of
1 x 108/ml. Half-maximal binding of antibody to platelets
WO92/171~2 PCT/US92/02~7
87
was observed at lO ~g/ml LJ-Ibl concentration, which
concentration was selected for p5E polypeptide inhibition
studies.
The p5E polypeptide extract was purified according to
the procedure of ~xample 4 including final purification of
the urea solubilized inclusion body preparation by dialysis
against 6.0 M guanidine and urea solutions followed by Q-
Sepharose¢ chromatography.
To evaluate binding, platelets were incubated for 30
minutes at 22-25C with LJ-Ibl (lO ~g/ml) and concentrations
of purified p5E polypeptide (.002-lO.0 ~Molar). At the end
of the incubation platelets with bound radioactivity were
separated from free antibody by centrifugation at 12000 g
through a 20% sucrose layer, in 0.15 M NaCl, 20 mM Hepes, pH
7.4, hereinafter "Hepes-buffered saline" buffer in a
microcentrifuge tube. Inhibition of LJ-Ibl binding was
plotted in the presence of 2 ~g/ml botrocetin (Sigma Chemical
Co., St. Louis, M0) and in the absence of botrocetin.
Less than 5 percent of the 1~I label bound to the
platelets was contributed by labelled substances other than
LJ-Ibl as determined by binding competition experiments in
the presence of a lO0 fold excess of unlabelled LJ-Ibl.
Background labelling was subtracted from data points. Binding
of 1~I LJ-Ibl was expressed as a percentage of a control
assay lacking recombinant polypeptides. Fifty percent
inhibition of 1~I L~-Ibl binding to platelets was achieved at
lO ~M of p5E polypeptide ~without botrocetin whereas in the
presence of botrocetin (2 ~g/ml), 50% inhibition may be
achieved at less than O.l ~M. It is known that botrocetin
induces in circulating multisubunit von Willebrand factor and
single subunits thereof a conformational change which
enhances or permits binding to the GPIb receptor. This
example demonstrates that the p5E polypeptide (containing an
intrachain cysteine 509-695 bond) beha~es very much like
native circulating von Willebrand factor-with respect to how
its activity is moduIated by botrocetin. Structural
similarity is therefore indicated.
. :'
W0~2~1719~ 21 ~7~a PC~/US92/02~7
. 88
Example 7 - Expression of homodimeric 116 kDa
von Willebrand factor fragment in
stable mammalian transformants
This example is illustrative of conditions under which a
DNA sequence encoding the mature vWF subunit fragment having
an amino terminus at residue 441 (arginine) and a carboxy
terminus at residue 730 (asparagine) may be expressed, and of
the secretion from cultured mammalian host cells of a
glycosylated homodimeric form of the 441-730 vWF fragment
having native tertiary structure.
Expression of the 116 kg/mol homodimer is achieved using
a DNA construct in which the following structural elements
are assembled in a 5' to 3' direction (referring to the
coding or nontranscribed strand):
15 . (A) a eucaryotic consensus translation initiation
sequence, CCACC; and
(B) the initiating vWF methionine codon followed by the
remaining 21 amino acids of the vWF signal peptide,
and
(C) the coding se~uence corresponding to the first
three amino acids from the amino terminus region of
the vWF propeptide; and
(D) the coding sequence for vWF amino acid residues
441-730, and
~E~ the "TGA" translation termination codon.
Preparation of a cDNA Clone from
Pre~o-vcn Willebrand Factor mRNA
The cDNA clone, pvWF, encoding the entire pre-pro-vWF
gene was obtained from Dr. Dennis Lynch, Dana-Farber Cancer
lnstitute, Boston, MA and was prepared as described in Lynch,
D.C. et al., Cell, 41, 49-56 (1985). Preparation of pvWF was
described in Example 1.
Primer Directed Amplification of cDNA - Phase I
The cDNA representing the full length pre-pre-vWF gene
from pSP64 was subjected to enzymatic amplification in a
polymerase chain reaction according to the method of Saiki,
R.K. et al. Science, 239, 487-491 (1988), as described in
Example 1.
WO92/17192 PCT/~IS92/02~7~
89 2 ~ ~ J ~
For PCR amplification, the following oligonucleotides
were synthesized by the phosphoramidite method, Sinha, et
al., Tetrahedron ~etters, 24, 5843 (1983~, using a model 380B
automated system, Applied Biosystems, Foster City, CA.
Oligonucleotide (7) - see SEQ ID N0: 9
5' - GTCGACGCCACCATGATTCCTGCCAGA - 3'
SalI Met
Oligonucleotide ~8) - see SEQ ID N0: lO
5' - TCAGTTTCTAGATACAGCCC - 3'
XbaI
In designing the oligonucleotides used herein, reference
was made to the established nucleotide sequence of the pre
pro-vWF gene, Bonthron, D. et al., Nucl. Acids Res., :L4(17),
7125 7127 (1986); Mancuso, D. et al., J. Biol. Chem.,
264(33), lg5l4-l9527 tl989).
Oligonucleotide (7) was used to create a SalI
restriction site fused 5' to a eucaryotic consensus
translation initiation sequence (CCACC) preceding the
initiating methionine codon of the vWF cDNA. See Kozak, M.
Cell, 44, 183-292 (1986).
Oligonucleotide ~8) hybridizes with the non-transcribed
strand (coding strand) of the vWF cDNA and overlaps with
nucleotides which are approximately 360 base pairs from the
initiating methionine in the pre-pro-vWF cDNA, thus spanning
(at ~esidues 120 and 121 within the pre-pro-vWF cDNA
sequence) an XbaI restri~tion site.
The polymerase chain reaction therefore synthesized a
cDNA fragment, containing (reading from 5' to 3' on the
coding strand) a SalI site, a consensus initiation sequence,
an initiating methionine codon, the codon sequence for the
signal peptide, and approximately, the first lO0 codons of
the propeptide, ~ollowed by an XbaI site.
Insertion of c~NA into Ml3mPl8 Cloninq Vehicle
The amplified cDNA fragment w~s then inserted, using
SalI and XbaI restriction enzymes, into the double stranded
replicative form of bacteriophage Ml3mpl8 which contains a
multiple cloning site having compatible SalI and XbaI
. .
: ' , ' : ' ,
, ~ .
'
W O 92/1719~ PC~r/~'S92/0247'
21~7~ go
sequences. The resulting clone is known as pADl. See
Arrand, J.R. et al. J. Mol. Biol., 118, 127-135 (1978) and
Zain, S.S. et al. J. Mol. Biol., 115, 249-255 tl977) for the
properties of SalI and XbaI restriction enzymes respectively.
The vWF cDNA insert was completely sequenced using single-
stranded dideoxy methodology (Sanger, F. et al. Proc. Natl.
Acad. Sci. USA, 74, 5463-5467 (1977)) to confirm that the vWF
cDNA fragment contained the correct vWF coding sequence.
Primer Directed Amplification of cDNA - Phase II
lOcDNA corresponding to ma~ure vWF amino acid residues 441
t~ 732 was then amplified in a polymerase chain reaction.
For amplification, the pvWF clone encoding the entire pre-
pro-vWF gene was used. Alternatively, a cDNA corresponding
to mature subunit residues 441 to 732 may be prepared and
then amplified directly from platelet mRNA following the
procedure of Newman, P.J. et al. J. Clin. Invest., 82, 739-
743 (1988).
Suitable flanking oligonucleotides were synthesized as
follows:
Oligonucleotide (9) - see SEQ ID N0: 11
5' - AC GAATTC CGG CGT TTT GCC TCA GGA - 3'
EcoRI Arg~Arg~2
Oligonucleotide (10) - see SEQ ID N0: 12
5' - G AAGCTT AC CAT GGA GTT CCT CTT GGG - 3'
25HindIII Met Ser Asn ~rg Lys Pro
732 731 730 729 728 727
` -or-
3' - GGG~ TTC TCC TTG- AGG- TAC CA TTCGAA G - 5 '
Pro Lys Arg Asn Ser Met HindIII
30727 728 729 730 731 732
~equivalent to anticoding strand)
The ends of the double stranded vW~ cDNA fragment
product were then modified with BamHI linkers (Roberts, R.J.
et al. Nature, 265, 82-8~ (1977)), digested with BamHI, and
35 inserted into the BamHI site of pAD1, which site is directly
downstream(3') from the XbaI site. The resultant plasmid was
designated pAD2.
Loopout Mutaqenesis of pAD2.
WO92/1719' PCT/~'S92/02~?~
91
Site-directed (loopout) mutagenesis was then performed
to synchronize the reading frames of the first insert with
the second insert simultaneously deleting all propeptide
codon sequence (except that encoding the first 3 amino
terminal residues of the propeptide), and the remaining bases
between the XbaI and BamHI sites.
As a loopout primer, the following oligonucleotide was
utilized which encodes the four carboxy-terminal amino acid
residues of the signal peptide, the three amino-terminal
residues of the propeptide, and amino acid residues 441 to
446 of the mature vWF subunit sequence.
Oligonucleotide (11) - see SEQ ID NO: 13
5' - GGGACCCTTTGTGCAGAAGGACGGCGTTTTGCCTCAGGA - 3'
Arg~ Gly~
The loopout of undesired nucleotide sequence was
accomplished following the procedure of Kunkel, T.A., Proc.
Natl. Acad. Sci. USA, 82, 488-492 ~1985). This procedure
involves the performance of a series of steps to take
advantage of conditions which select against a uracil
containing DNA template:
(A) M13mpl8 phage (containing cDNA corresponding to the
consensus translation initiation sequence, the
signal peptide, approximately the first 121 amino
acids of the propeptide, residual intervening
M13mpl8 polylinker sequence, and codons
corresponding to mature subunit sequence residues
441 to 732) is~grown in an E.coli CJ236 mutant
dut~ung~ strain in a uridine rich medium. Since
this E.coli strain is deficient in deoxyuridine
triphosphatase (dut-), an intracellular pool of
dUTP accumulates which competes with dTTP for
incorporation intc DNA. (see Shlomai, J. et al. J.
Biol. Chem., 253~9), 3305-3312 (1978). Viral DNA
synthesized under these conditions includes several
uracil insertions per viral genome and is stable
only in an E.coli strain which is incapable of
removing uracil, such as (ung~) strains which lack
uracil glycosylase. Uracil-containing nucleotides
are lethal in single stranded (+) M13mpl~ DNA in
WO92/1719~ PCT/US9~/0247~
210710~ 92
ung~ strains due to the creation of abasic sites by
uracil glycosylase.
(B~ Single-stranded (+) viral DNA is isolated from
culture media in which phage were grown in E.coli
strain CJ236 dut~ung~. The single stranded (+)
form of the virus contains the specified vWF cDNA
at its multlple cloning site. This cDNA is
equivalent to the transcribed vWF cDNA strand.
(C) Oligonucleotide (11) is then annealed in vitro to
lo single stranded (+) phage DNA, thereby looping out
the undesired sequence. Generally, a wide range of
oligonucleotide concentrations is suitable in this
procedure. Typically 40 ng of oligonucleotide was
annealed to 0.5-1.0 ~g M13mpl8 phage (+) DNA.
(D) All missing sequence of the M13mpl8(~) strand is
then completed in vitro using T7 DNA pol~nerase and
T4 DNA ligase in an environment containing dTTP,
dGTP, dATP and dCTP, thereby generating a chimeric
vWF cDNA sequence without the undesired
intermediate sequence.
(E) The double stranded M13mpl8 phage, now containing a
thymine normal (~~ strand and a ~+) strand with
several uracil substitutions, is transformed into a
wild type E.coli XL-1 Blue (Stratagene, La Jolla,
CA) strain which contains normal lev~l~ of uracil
glycosylase and deoxyuridine triphosphatase.
(F) Uracil glycosylase and other enzymes present in the
new host initiàte destruction of the uracil-
containing (+) strand of the double stranded
phages, leading after replication in the host of
remaining phage (~) strand DNA to the presence of
stable thymine-normal double stranded (RF) DNA
which reflects the desired deletion. Upon
completion of mutagenesis procedures, the sequence
of the vWF cDNA insert was confirmed using the
single stranded DNA dideoxy method. (Sanger, F. et
al., ~upra).
A second mutagenesis procedure, following steps (A~ to
(F~ above, was performed to add to the cDNA insert a
: '
.
WO92/1719' PCT/~'S92/0247
g3
translation termination codon (TGA)) and an XbaI restriction
site (TCTAGA)- The oligonucleotide, again synthesized by the
phosphoramadite method and containing also sequence homology
at its 3' end with the Ml3mpl8 vehicle sequence, was as
follows. The stop codon was added after residue 730.
Oligonucleotide (12) - see SEQ ID NO: 14
5'- GGGCCCAAG AGG AAC-TGA-TCTAGA AAGCTTGGCACTGGC -3'
Argn~sn73o XbaI
The final Ml3mpl8 recombinant containing the desired
construct as a SalI - XbaI insert was designated pAD3-l. In
addition to the XbaI site created 3' to the termination
codon, an XbaI site exists in the polylinker region of
Ml3mpl8 directly 5' to the SalI site. The vWF insert was
again sequenced by the dideoxy method to verify organization
and integrity of the components.
Cloning of the SalI - XbaI Fragment of
pAD3-l Into the pBluescript II KS( ) Vector
The SalI-XbaI fragment was then removed from pAD3-l (as
contained within the XbaI-XbaI fragment) and inserted into
pBluescript II KS~-) vector (Stratagene, La Jolla, CA) which
had baen previously digested with XbaI. pBluescript II KS(-)
contains an XhoI restriction site which is 5' to the XbaI
insert and a NotI site which is directly 3' to the XbaI
insert. A resultant plasmid selected as having the proper
~5 insert orienta~ion was designated pAD3-2. Reference to the
restriction map for pBluescript II KS(-) shows that an EcoRI
site is present in the polylinker region thereof between the
XhoI restriction site and the XbaI site, and is therefore
useful (see Example 21 below) for inserting vWF gene
sequences containing Type IIB mutations into pCDM8 vectors so
that stable mutant transformants can be generated.
Construction of Plasmids for Inteqration into Mammalian Cells
A selection procedure, based on aminoglycosidic
antibiotic resistance, was then employed to select
continuously for transformants which retained the vWF
expression plasmid.
WO92/17192 s~ PCT/~'S92/02~7
94
pCDM8 vector (developed by B. Seed et al. Nature, 329,
840-842 tl987) and available from Invitrogen, San Diego, CA)
was modified by Dr. Timothy O'Toole, Scripps Clinic and
Research Foundation, La Jolla, CA to include a neomycin
resistance gene (phosphotransferase II) that was cloned into
the BamHI restriction site of pCDM8 as a part of a 2000 base
pair BamHI fragment. The site of the BamHI insert is
indicated by an arrow in Figure 5. The protein produced by
the neomycin(neo) gene also confers resistance against other
aminoglycoside antibiotics such as Geneticin~ ~418 sulfate
(Gibco/Life Technologies, Inc., Gaithersburg, MD). The neo
gene is provided by the Tn5 transposable element and is
widely distributed in procaryots. Lewin, J., Genes, 3rd ed.,
p.596, Wiley & Sons (1987). The final construct places the
neo gene under the control of an SV40 early promoter.
Several other suitable expression vectors containing
neomycin resistance markers are commercially available:
pcDNA ln~ ~Invitrogen, San Diego, CA), Rc/CMV (Invitrogen,
San Diego, CA) and pMAMn~ (Clontech, Palo ~lto, CA). lf
necessary, the vWF fragment may be differently restricted or
modified for expression capability in these other expression
plasmids.
The XhoI-NotI fragment of pAD3-2 was kherefore inserted
into pCDM8~ which had been restricted with XhoI and NotI.
Ampicillin sensitive E.coli strain XS-127 cells (Invitrogen,
San Diego, CA~ were transformed with the resultant ligated
DNA mixture following the method of Hanahan, D., J. Mol.
Biol., 166, 557-580 (1983).
Plasmids from resultant colonies were characterized by
restriction mapping and DNA sequencing to identify colonies
which contained the intended insert. One such appropriate
plasmid (designated pAD5/WT) was maintained in E.coli strain
XS-127, and was selected for mammalian cell transformation
procedures.
Prior to use in trans~orming mammalian cells,
supercoiled plasmids (pAD5tWT) were recovered from host
E.coli by an alkaline cell lysis procedure, Birnboim, H.C.
and Doly, J., Nucleic Acids Research, 7,1513 (1979), followed
by purification by CsCl/ethidium bromide equilibrium
WO92/1719~ PCTt~!S92/02~7~
95 2~7~
centrifugation according to Maniatis, T. et al., Molecular
Cloninq, 2nd ed., p. 1.42, Cold Spring Harbor Laboratory
Press (1987).
Transformation of Chinese Hamster Ovary Cells
pAD5/WT was introduced into C~0-Kl Chinese hamster ovary
cells (ATCC-CCL 61) by a standard calcium phosphate-mediated
transfection procedure. Chen, C. et al. Mol. Cell. Biol.,
7(8), 2745-2752 (1987).
CHo-Kl cells were grown at 37C in Dulbecco~s modified
Eagle's medium (DMEM) (Gibco/Life Technologies, Inc.,
Gaithersburg, MD) supplemented with 10% heat-inactivated
fetal calf serum (FCS), 0.5 mM of each nonessential amino
acid (from NEAA supplement, Whittaker, Wal~ersville, MD) and
2 mM L-glutamine under a 5% CO2 atmosphere, and then
subcultured 24 hours prior to transformation at a density of
1.5 x 105 cells per 60 mm tissue culture dish (approximately
25% of confluence). CH0-Kl cells have a doubling time in
DMEM/10%FCS of approximately 16 hours under these conditions.
To accomplish transformation, pAD5/WT plasmids were
recovered from cultures of E.coli strain XS-127, according to
the method of Birnboim, H.C. and Doly, J., Nucleic Acids
Research, 7, 1513 (1979). Ten ~g of plasmids were applied to
the cells of each 60 mm dish in a calcium phosphate solution
according to the method of Chen et al., supra. After
inoculation with plasmid, the cells were maintained in
DMEM/10% FCS for 8 hours at 37C in a 5% CO2 atmosphere.
The growth medium was then replaced with a solution of
phosphate-buffered saline, 137 mM NaCl, 2.7 mM KCl, 4.3 mM
Na2HP04 7H20/1.4 mM KH2P04, pH 7.4, hereinafter "PBS",
containing also 10% (v/v) glycerol. The cultures were then
maintained in glycerol-PBS for 2 minutes to increase the
efficiency of transformation (see Ausukel, et al., eds.
Current Protocols in Molecular Biolo~y, p.9.1.3, Wiley & Sons
(1987). After 2 minutes the glycerol-PBS solution was
replaced with DMEM/10% FCS.
After approximately 24 hours of growth at 37C in a 5%
C02 atmosphere, the cells were trypsinized as follows.
Growth medium for each dish was replaced by 3 ml of 0.25%
WO~2/1~197 PCT/V~92/0247~
2 1 ~
trypsin in PBS. Trypsinization was conducted ~or 3 minutes.
The trypsin-containing medium was removed and the dishes were
then placed in the incubator for a further 15 minutes after
which the cells were resuspended in DMEM containing lo~ fetal
calf serum. The cells from each dish were then split 20
fold, and plated at a density of 3 x 104 cells/60 mm dish
(approximately 5~ of confluence).
Production of stable transformants, which have
integrated the plasmid DNA, was then accomplished by adding
Geneticin0 G418 sulfate to the 60 mm dishes to a
concentration of 0.8 mg/ml. Growth was continued ~or 10-14
days at 37C in a 5% C02 atmosphere. Surviving independent
colonies were transferred to 12- well plates using cl~ning
rings and then grown for another seven days in DMEM/10% FCS
supplemented with 0.8 mg/ml of Geneticin~. ~nder these
conditions, 3 to 7 surviving colonies per plate were apparent
after 10-14 days. Approximately 100 stable transformants can
be isolated from each original 60 mM dish originally
containing approximately 5 x 105 cells at a plate density of
20 - 50-70% of confluence.
Fifty to seventy percent of G418-resistant cell lines
produce the 441-730 mature vWF subunit fragment. The
specific geometry of integration of each clone presumably
prevents expression in all cases. Stable transformants wer~
then cultured and maintained at all times in medium
containing Geneticin~ G418 sulfate (.8 mg/ml) ko apply
continuous selection.
Colonies expressing the recombinant 441-730 vWF
polypeptide were detected by dot-blot analysis on nitro-
cellulose after lysis in disruption bu~fer (see Cullen,Methods in EnzYmoloqv, 152, 684-704 (1987)) comprising lO mM
Tris HCl, pH 7.8, 15~ mM NaCl, 5 mM EDTA, 10 mM benzamidine,
1 mM PMSF, 1% (w/v) Non-idet 40 (an octylphenol-ethylene
oxide condensate containing an average of 9 moles of ethylene
oxide/mole phenol), Sigma, St. Louis, MO. RG-46 (see
Fugimura, Y. et al. J. Biol. Chem., 261(1), 381-385 (1986)
and Fulcher, C.A. et al. Proc. Natl. Acad. Sci. USA, 79,
1648-1652 (1982)) was used as the primary antibody. The
secondary antibody (~2sI-rabbit anti-mouse IgG) which had been
WO92/17192 PCT/~'S92/02~7
97 ~ ~7 ~
labelled by the method of Fraker, P.J. et al. Biochem.
Biophys. Res. Commun., 80, 8~9-857 t1978) was incubated for
60 minutes at 25C on the nitrocellulose sheet. After
rinsing, the nitrocellulose was developed by autoradiography
S to identify those colonies expressing the vWF fragment.
secretion of_the von Willebrand Factor Fragment
Secretion of the 441-730 mature vWF subunit fragment
into the culture medium by CH0-K1 cells was confirmed by
immunoprecipitation and immunoaffinity chromatography of
culture medium.
Confluent transformed CH0-K1 cells were rinsed three
times with PBS to remove bovine vWF and then incubated in
DMEM without FCS for 16 hours at 37C in a 5% CO2 atmosphere.
To a 5 ml volume of the culture medium was added a 1/10
volume (0.5 ml) of lOx immunoprecipitation buffer (lOxIPB)
which comprises 100 mM Tris HCl, pH 7.5, 1.5 M NaCl, 10 mM
EDTA, and 10% (w/v) Non-idet 40. It has been established
that bovine vWF-derived polypeptides present in fetal calf
serum do not react with NMC-4.
The mixture was then incubated for 16 hours at 4C with
approximately 0.05 mg of NMC-4 or 0.05 mg of RG-46 murine
monoclonal anti-vWF antibody (or 0.1 mg of both) allowing
formation of IgG-vWF complexes. Immune complexes were
precipitated by taking advantage of the affinity of protein A
(isolated from the cell wall of Staphvlococcus aureus) for
constant regions of heavy-chain antibody polypeptides
following generally the method of Cullen, B. et al., Meth.
Enzymoloqy, }52, 684-704 (1987). See also Harlow, E. et al.
eds, Antibodies, A Laboratory Manual, Chapters 14-15, Cold
Spring Harbor ~aboratory Press (1988).
Protein A-Sepharose~ beads were purchased from Sigma,
St. Louis, M0. Immune complexes were then precipitated with
the beads in the presence of 3 M NaCl/1.5 M glycine (pH B.9),
and washed twice with lx IPB and then once with lx IPB
without Non-idet 40.
Immunoprecipitated proteins were then electrophoresed in
polyacrylamide gels containing sodium docecyl sulfate (SDS-
PAGE) following the method of Weber, K. et al., J. Biol.
WO92/17192 PCT/~'S92/02~7;
2~07100 98 _
Chem., 244, 4406-4412 ~1969), or as modified by Laemli, U.K.,
Nature, 227, 680-685 (1970), using an acrylamide
concentration of 10%. Samples of immune-complexed vWF
protein were dissociated prior to electrophoresis by heating
at lOO~C for 5 minutes in non-reducing and 2~ SDS-containing
acrylamide gel sample buf~er to disrupt non-covalent bonds.
The protein A-Sepharose~4B beads were spun down and
discarded. Visualization was accomplished with Coomassie
blue staining which revealed the dominant vWF-derived
polypeptide species to have an apparent molecular weight,
based on molecular weight markers, of about 115,000 g/mol.
Protein bands in duplicate gels were blotted and
immobilized onto nitrocellulose sheets (Schleicher & Schuell
Co., Keene, N~) and the pat~ern was then visualized using
immunoreactivity according to the hiqhly sensitive 7'Western
blot" technique. Burnette, et al., A. Anal. Biochem., 112,
195-203 (1981).
The von Willebrand factor-specific monoclonal antibodies
(~rom mice) used to identify the polypeptides were RG~46 (see
20 Fugimura, Y. et al. J. Biol. Chem., 261(1), 381-385 (1986),
Fulcher, C.A. et al., Proc. Natl. Acad. Sci. USA, 79, 1648-
1652 (1982)), and NMC-4 (Shima, M. et al., J. Nara Med.
Assoc., 36, 662 669 (1985)), both of which have epitopes
within the expressed vWF polypeptide of this invention.
The secondary antibody (~ rabbit anti-mouse IgG),
labelled by the method of Fraker, P.J. et al., Biochem.
Bio~hvs. Res. Commun., 80, 849-~57 (1978)), was incubated for
60 minutes at 25C on the nitrocellulose sheet. After
rinsing, the sheet was developed by autoradiography.
Growth medium from non-transformed CHO-Kl cells shows no
immunoreactivity with RG-46 and NMC-~ anti-vWF monoclonal
antibodies under identical conditions.
The 116 kg/mol fragment may also be isolated from the
culture medium of CHO-Kl cells using immunoaffinity
35 chromatography. Approximately 300~g of the 116 kg/mol
fragment can be recovered from 500 ml of culture medium
derived from transformed CHO-Kl culture plates using NMC-4
antibodies coupled to particles of Sepharose~4B.
WO92/1719~ PCT/US92/02~7~
gg 21~7~3~
Example 8 - Induction of platelet aggregation by
the homodimeric 116 kg/mol von Willebrand
factor fraqment derived from the
culture medium of stable CHO-K1 transformants
The tryptic 116 kg/mol fragment has been previously
characterized as a dimer consisting of two identical
disulfide-linked subunits each correspond~ing to the tryptic
52/48 kg/mol fragment of vWF and containing the mature
subunit sequence from residue 449 to residue 728. Owing to
its bivalent character, the dimeric 116 kg/mol fragment can
support ristocetin-induced platelet aggregation whereas the
constituent 52/48 kg/mol subunit cannot (see Mohri, ~. et
al., J. Biol. Chem., 264(29), 17361-17367 (1989)).
Stable pAD5/WT CHO-K1 transformants, and untransformed
CHO-K1 cells as controls, were each grown to 90% of
confluence in DMEM/10% FCS, at 37C in a 5% CO2 atmosphere.
The 60 mm plates were then rinsed twice with PBS and the
incubation was continued in DMEM (without FCS) for 24 hours.
The resultant serum-free culture medium was collected and
concentrated (at 18C) 300 fold in a centrifugation-
filtration apparatus, Centricon 30, Amicon Co., Lexington,
Dose-dependent platelet aggregation curves were obtained
by the addition of concentrated culture medium from pADS/WT
transformed cells to platelets. No aggregation was seen in
the presence of control culture medium derived from
untransformed CHO-K1 cells. Platelets for the assay were
prepared using albumin density gradients according to the
procedure of Walsh, et al. British J. of Hematoloqy, 36, 281-
298 (1977). Aggregation was monitored in siliconized glasscuvettes maintained at 37C with constant stirring (1200 rpm)
in a Lumi-aggregometer (Chrono-Log Corp., Havertown, PA).
Aggregation experiments followed generally the procedure of
Mohri, H. et al., J. Biol. Chem., 264(29), 17361-17367
~1989). Two to ten ~l quantities of 300-fold concentrated
FCS-free DMEM from cultures of pAD5/WT-transformed and
control untransformed CHO-K1 cells (CM) were brought up to
100 ~l by dilution with "Hepes" buffered saline, comprising
20 mM Hepes, N-[2-hydroxyethyl]piperazine-NL[2-
ethanesulfonic acid]l (pH 7.4), and 0.15 M NaCl. The 100 ~l
W092/1719~ PCT/US92/02~7~
~ 1~7 1~ ~ loo
samples were then mixed with 200 ~1 of platelet suspension (4x 108/ml) and then incubated with stirring in the
aggregometer for 5 minutes. Ristocetin was then added to a
final concentration of lmg/ml at the injection timepoints
ttime zero). Aggregation was monitored by recording changes
in light transmittance. Platelet aggregation can be observed
with as little as 100 ~1 of unconcentrated serum-free medium
from pAD5/WT-transformed cell lines. Serum-free medium from
control untransformed cultures concentrat:ed up to 300 fold,
and assayed at up to 10 ~1 concentrated medium/100 ~1 sample
did not induce platelet aggregation.
Preincubation with Monoclonal Antibodies
As a further control to confirm the specificity of the
ristocetin-induced 116 kg/mol vWF fragment-platelet
interaction, platelets were preincubated with anti-platelet
glycoprotein Ib monoclonal antibody LJ-Ibl which has been
specifically demonstrated to block vWF-platelet GPIb-IX
receptor interaction (Handa, et al., J. Biol. Chem., 261,
12579-1~585 (1986)).
Platelets subjected to this preincubation did not
exhibit an aggregation response whereas platelets similarly
preincubated with monoclonal antibody LJ-CP3 (Trapani-
Lombardo et al., J. Clin. Invest., 76, 1950-1958 (1985) gave
an effective aggregation response. LJ-CP3 has been
demonstrated to block platelet GPIIb/IIIa receptor sites and
not vWF-specific GPIb-IX receptors. To perform the assays
antibody LJ-Ibl or antibody LJ-CP3 was added, at a
concentration of 100 ~g/ml, to the platelet/serum mixture
while the mixture was being stirred in the aggregometer, and
at a timepoint one minute prior to the point when ristocetin
(to 1 mg/ml) was added.
Example 9 - Construction of a mammalian transformant
for the expression of the monomeric
441-730 mature von Willebrand factor
subunit fragment with cysteine-to-glycine
mutations at residues 459 462 and 464
This example is illustrative of conditions under which a
DNA sequence encoding a mature vWF subunit fragment, which
WO92/17192 2 ~ ~ 7 ~ ~ i3 PCT/~'S92/0217
101
has an amino terminus at resldue 441 (arginine) and a carboxy
terminus at residue 730 (asparagine) and which further
contains glycine residues substituted for cysteine residues
at positions 459, 462 and 464 thereof, can be constructed and
transfected into mammalian cells.
The SalI-XbaI insert of pAD3-2 (see Example 7) was
removed by restriction and then cloned into pcDNAl vector
(Invitrogen, San Diego, CA) which had been previously
digested with XhoI and XbaI restriction enzymes. Since XhoI
and SalI restriction sites contain identical internal
sequences -TCGA- / -AGCT- , a SalI restricted fragment may
be annealed into an XhoI site. The fragments were ligated
with T4 DNA ligase; however the integrity of the XhoI site
was not restored. This plasmid construct was designated
pAD4/WT.
Site-directed mutaqenesis usinq Ml3mpl8
pAD4/~T was restricted with EcoRI and SmaI enzymes.
pcDNAl vector contains an EcoRI site within its polylinker
region which is upstream from the XhoI ("SalI") s:ite but
contains no SmaI site. As shown in Figure l (SEQ ID NO: l),
a unique SmaI site (CCCGGG) is contained within the vWF cDNA
insert, spanning mature subunit residues 716 (glycine) to
residue 718 (glycine).
Accordingly, an approximate 950 base pair EcoRI-SmaI
2S fragment of pAD4/WT was subcloned into the EcoRI-SmaI site
within the polylinker region of Ml3mpl8 phage. The vWF
sequence in Ml3mpl8 was then mutagenized and reinserted into
the previously restricted pAD4/WT construct leading to
reassembly of the intact residue 441-730 vWF sequence.
The mutagenesis followed the procedure of Example l and
Kunkel, T.A., supra, and utilized the following
oligonucleotide.
..
W092/1719~ PCT/~'~92/0247~
21V7~ 102 ~-
Oligonucleotide ~13) - see SEQ ID No: 15
3' - GGACTCGTGCCGGTCTAA_CGGTGCCACTACAACAG - 5'
5' - cctgagcacqqccagatt qccacqqtgatgttgtc - 3'
Gly459 Gly462 Gly4~
The hybridizing oligonucleotide is shown (3' - 5') in
capital letters and is equivalent to transcribed strand (non-
coding strand DNA). Underlined letters indicate the single
base mutations for the mutant codons. The equivalent coding
strand is shown in lower case letters with the corresponding
glycine substitutions identified by three letter designation.
The mutant 950 base pair EcoRI-SmaI fragment was then
re-inserted into the EcoRI-SmaI site of the previously
restricted pAD4/WT plasmid. The mutant construct was
designated pAD4/~3C. To facilitate long-term storage and
propagation, pAD4/A3C was transformed into ampicillin
sensitive E.coli strain XS-127 according to the method of
Hanahan, D., J. Mol. Biol., 166, 557-580 (1983).
Consistent with the procedures of Example l, the
sequence of the mutant cDNA was confirmed by the dideoxy
method and the plasmid was purified by CsCl/ethidium bromide
equilibrium centrifugation.
pAD4/a3C was introduced into COS-l cells (SV 40
transformed African Green monkey kidney cells, ATCC - CRL
1650) by a standard calcium phosphate-mediated transfection
procedure. Chen, C. et al., Mol. Cell. Biol., 7(8), 2745-
2752 (1987).
COS-l cells were grown at 37C in Dulbecco's modified
Eagle's medium (DMEM) (Gibco/Life Technologies, Inc.,
Gaithersburg, MD) supplemented with 10% fetal calf serum
(FCS) under a 5% CO2 atmosphere, and then subcultured 24
hours prior to transformation at a density of l.5 x lO5
cells/60 mm tissue culture dish (approximately 25~ of
confluence). COS-l cells have a doubling time in DMEM/10%
FCS of approximately 20 hours under these conditions.
To accomplish transformation, pAD4/~3C plasmids were
recovered from cultures of E.coli strain XS-127 according to
the method of Birnboim, H.C. and Doly, J., Nucleic Acids
WO92/1719~ 7 ~ ~ ~ P~T/~S92/02~7
103
Research, 7, 1513 (1979). Ten ~g of plasmids were applied to
the cells of each 60 mm dish in a calcium phosphate solution
according to the method of Chen et al., supra. After
inoculation with plasmid, the cells were maintained in
DMEM/10% FCS for 8 hours at 37C in a 5% CO2 atmosphere.
The growth medium was then replaced with a solution of
phosphate-buffered saline/10% (v/v) glycerol. The cultures
were then maintained in glyoerol-PBS for 2 minutes to
facilitate the production of transformants (Ausukel, et al.
eds, Current Protocols in Molecular Bioloqv, p.9.1.3, Wiley &
Sons (1987)). After 2 minutes, the glycerol-PBS solution was
replaced with DMEM/10% FCS. Antibiotic resistance was not
used to select for stable transformants. The cells were then
maintained at 37C in DMEM/10% FCS in a 5% CO2 atmosphere.
Example 10 - Transformation of COS-1
cells by pAD4/WT plasmids
COS-l ce~ls were also transformed successfully with
pAD4/WT plasmids. Although antibiotic resistance was not
used to select ~or stable transformants, transient expression
of the 116 kg/mol fragment therefrom was particularly useful
for the purpose of comparing the properties of the 116 kg/mol
mutagenized polypeptide produced by pAD4/~3C plasmids to
those o~ the pAD4/WT 116 kg/mol homodimer.
Following the procedures of Example 9, pAD4/WT plasmids
were recovered from storage cultures of E.coli strain XS-127.
Transformation of COS-1 cells with pAD4/WT was then
accomplished using the procedures of Example 9. The cells
were then maintained at 37C in DMEM/10% FCS in a 5% CO2
atmosphere.
Example 11 - Construction of mammalian transformants
which express mutant 441-730 mature von
Willebrand factor subunit fragments
wherein each mutant contains a single
cYsteine-to-qlycine substitution
Following the procedures of Example 9, and using
suitable oligonucleotides for site-directed mutagenesis,
three plasmids (pAD4/G459, pAD4/G452 and pAD4/G464, collectively
referred to as "pAD4/AlC plasmids") were constructed. Such
plasmids are identical to pAD4/WT except that each contains a
W092/1719~ 7 ~ ~3 9 PCT/US~2/02~7~
104
single base pair mutation which corresponds to a single
cysteine to glycine substitution at mature vWF subunit
residue positions 459, 462 and 46~ respectively. The
oligonucleotides used are identical to oligonucleotide (13)
used to prepare pAD4/A3C except that each contains only one
of the three mutant codons of that oligonucleotide, the other
two codons being represented by the wild type coding
sequence. To facilitate long-term storiage and propagation,
samples of pAD4/G459, pAD4/G462, and pAD4/~ were each cloned
into ampicillin sensitive E.coli strain XS-127 following the
method of Example 9.
Consistent with the procedures of ~xample 9, the
sequences of the mutant cDNAs were confirmed by the dideoxy
method and the plasmids were purified by CsCl/ethidium
bromide equilibrium centrifugation.
Transformation of COS-1 cells with either pAD4/G459,
pAD4/G462 or pAD4/G4~ plasmids was accomplished according to
the protocol of Example 9. Antibiotic resistance was not
used to select for stable transformants. The cells were then
20 maintained at 37C in DMEM/10% FCS in a 5~ CO2 atmosphere.
Example 12 - Expression and characterization
of von Willebrand factor subunit
fragments by COS-l cells transformed
with pAD4/WT and pAD41a3C plasmids
COS-1 cells which had been transformed with pAD4/A3c or
pAD4/WT plasmids according to the procedures of Examples 9
and 10 respectively were cultured to express the encoded vWF
DNA as explained below. COS-1 cells similarly transformed
with pcDNA1 plasmid vector (not containing a vWF CDNA insert)
were used as controls.
COS-l cells at a density of 4-5 x 105/60 mm dish were
transformed by adding, at time zero, 10 ~g of pAD4/WT,
pAD4/~3C or pcDNAl plasmid. Following the procedure of
Examples 9 and 10, the cells were glycerol-shocked after a
period of 8 hours. The cells were then covere~ with DMEM/10%
FCS at 37C in a 5% CO2 atmosphere for 32 hours.
The cells for each culture were then rinsed three times
with PBS and the incubation was continued with DMEM (without
~CS) which was supplemented with 35S-methionine (Amersham Co.,
WO92/1719~ PCT/~'S92/02~7
105
Arlington Heights, IL) having a specific activity of l000
Ci/mmol to a final concentration of l00 ~Ci/ml. The cells
were returned to the incubator for 16 hours, after which time
the respective culture media were harvested for purification
by immunoprecipitation of secreted vWF polypeptid~s.
Immunoprecipitation followed generally the procedure of
Example 7. Five ml volumes of culture media were incubated
with 0.5 ml of l0X immunoprecipitation buffer, 0.05 mg of
NMC-4 antibody and 0.05 mg of R~-46 antibody for 16 hours.
Treatment with protein A-Sepharose~4B was performed
according to Example 7. Samples of IgG-complexed vWF protein
were dissociated prior to SDS-PAGE in SDS-containing sample
buffer.
For analysis of the vWF polypeptides under reducing
conditions, the sample buffer was modified to contain l00 mM
dithiothreitol (DTT).
Results
IThe gels run under reducing and non-reducing conditions
were dried and subject to autoradiography to develop the 35S
label. No 35S-labelled protein was detected as an
immunoprecipitate derived from control cultures of COS-l
cells (transformed by unmodified pcDNAl vehicle~ under either
reducing or non-reducing conditions.
COS-l cells transformed with pAD4/WT plasmids produce,
under non-reducing conditions, a prominent 35S-labelled band
of an approximate apparen~t molecular weight of 116,000. This
value is consistent wikh proper mammalian glycosylation of
the 441-730 fragment. When run under reducing conditions, no
116 kg/mol material is apparent, consistent with the
reduction o~ the disulfide bonds which stabilize the 116
Xg/mol homodimer. Under reducing conditions, a prominent 35S-
labelled band is visualized of approximately 52,000 apparent
molecular weight. The apparent 52 kg/mol value is again
consistent with proper glycosylation of the reduced monomeric
441-730 fragment.
The gel lanes corresponding to transformation with
pAD4/a3C show no apparent 116 kg/mol material. Instead a
WO92/1719~ PCT/~'S92/0247~
7~ ~ 106
band is apparent, under reducing and non-reducing conditions,
at an apparent molecular weight of approximately 52,000.
Thus, mutagenesis to replace cysteine residues 459, 462
and 464 within the 441-730 vWF fragment with glycine residues
results in the successful expression of a non-dimerizing
polypeptide presumably having only intrachain ~471 to 474 and
509 to 695) disulfide bonds. Interaction with NMC-4 (see
also Example 7) is known to require an intact 509 to 695
intrachain disulfide bond, thereby demonstrating the presence
of native wild type tertiary structure in the polypeptide
produced by pAD4/~3C.
The presence in the gels of low molecular weight 35S-
labelled material (under reducing and non-reducing
conditions) probably indicates that not all vWF polypeptides
produced by pAD4/WT constructs successfully dimerize and that
proteolysis and/or incomplete glycosylation of the
polypeptide may prevent higher yields. Proteolysis and/or
incomplete glycosylation also presurnably affect the yield of
the monomeric vWF polypeptide produced by the pAD4/~3C
transformants. Some high molecular weight aggregate material
(essentially not entering the gels) is present in non-reduced
samples from pAD4/WT and pAD4/~3C.
Exam le l3 - Use of NMC-4 monoclonal antibody
to immunoprecipitate vWF polypeptides
secreted by pAD4/WT and pAD4/A3c
transformed COS-l cells
The NMC-4 monoclonal antibody has as its epitope the
domain of the von Willebrand factor subunit which contains
the glycoprotein Ib binding site. Mapping of the epitope has
demonstrated that it is contained within two discontinuous
domains (comprising approximately mature vWF subunit residues
474 to 488 and also approximately residues 694 to 708)
brought into disulfide-dependent association by an intrachain
(residues 509 to 695) disulfide bond.
Thus, reactivity with NMC-4 is important evidence of
whether a particular recombinant 441-730 mature vWF subunit
fragment has assumed the tertiary structure of the analogous
wild type residue 441-730 domain.
J~
WO92/1719~ PCT/~'S92/02~7
107
Accordingly, the procedure of Example 12 was followed to
characterize vWF polypeptides secreted by pAD4/WT and
pAD4/~3C transformed COS-1 cells, with the modification that
immunoprecipitation of the culture media was effected solely
with NMC-4 antibody (O.05 mg NMC-4 per 5 ml of culture media
to which 0.5 ml of 10X immunoprecipitat:ion buffer had-been
added).
Samples were run under reducing and non-reducing
conditions. Consistent with the results of Example 12, the
major component isolated from pAD4/WT culture medium has an
apparent molecular weight of 116 kg/mol under non-reducing
conditions and 52 kg/mol under reducing conditions.
Although only a small fraction of the total pAD4/~3C
derived vWF polypeptide material binds to NMC-4 (compared to
conformation independent RG-46), a band of apparent molecular
weight of 52 kg/mol is visible under reducing and non-
reducing conditions in gels of NMC-4 immunoprecipitates~
Example 14 - Expression and characterization of
von Willebrand factor subunit fragments
produced by COS-l cells transformed with
~AD4/G459, pAD4/G462 or PAD4/G~ plasmids
Transformation of COS-1 cells by either pAD4/G459,
pAD4~G~2 or pAD4/G4~ plasmid (collectively the '~pAD4/~lC
plasmids") was accomplished according to the procedure of
Example 1~. Culture media were analyzed for secreted vWF
polypeptide according to the procedure of Example 7, using
only NMC-4 for immunoprecipitation.
35S-labelled proteins, prepared according to Example 12,
were immunoprecipitated by NMC-4 and run in SDS-
polyacrylamide gels under reducing and non-reducing
conditions and compared with vWF antigen produced by pAD4/WT
and pAD4/A3C transformants. Substitution of any one of the
3 cysteines (459, 462, 464) believed responsible for
interchain disulfide contacts in native mature subunits
prevents the formation of the homodimeric 116 kg/mol
polypeptide characteristic of pAD4/WT transformed COS-1
cells. These three vWF antigens with a single glycine
substitution appear predominantly as monomeric polypeptides
of an apparent molecular weight of 52,000 under reducing or
WO92/1719~ PCT/~'S92/02~7
~ ~7 1~ a 108
non-reducing conditions. That the predominant material has
an apparent molecular weight of 52 kg/mol is strongly
suggestive of correct glycosylation by the COS-1 cell
transformants duplicating glycosylation seen in the human
52/~8 kg/mol tryptic vWF fragment. Some proteolyzed and/or
inadequately glycosylated vWF antigen (molecular weight less
than 52 kg/mol) is also apparent in the gels. The relatively
small fraction of pAD4/A3C vWF polypeptide which is
successfully folded and secreted, thereby presenting an NMC-4
epitope, was shown by the low intensity of the pAD4/~3C
transformant autoradiograph band of apparent 52,000 molecular
weight.
II. Introduction of Type IIB Mutations into vWF PolypePtides
Example 15 - Genetic characterization of patients
with Type IIB von Willebrand disease
This example demonstrates the procedure used to identify
the mutation(s) in the mature von Willebrand factor subunit
responsible for Type IIB von Willebrand disease in particular
patients. Patients selected for screening were previously
determined to ~ulfill all of the criteria for a diagnosis of
Type IIB von Willebrand disease. See Ruggeri, Z.M. et al.,
N. ~nal. J. Med., 302, 1047-1051 (1980).
The propositus determined to have a vWF gene with a
Trp550 _ Cys550 mutation is identified as patient No. 7 in the
study reported in Kyrle, P.A. et al., Br. J. Hemat., 69, 55-
59 ~1988~. The propositus determined to have a vWF gene with
an Arg5~ Trpsll mutation ïs identified as patient No. 8 in
the same study. Samples of blood were drawn from patients
after obtaining informed consent according to the Declaration
of Helsinki and institutional guidelines.
Platelets were collected from 50 ml of blood drawn into
a 5 ml volume of 3.Z% trisodium citrate as anticoagulant.
The residual total platelet RNA was then isolated by
ultracentrifugation through a cesium chloride cushion
following the procedure of Newman, P.J. et al., J._Clin.
Invest., 82, 739-743 ~1988).
To generate double stranded cDNA, standard techniques
were used. Total platelet RNA was primed for first-strand
WO 92/1719'~ , r~ 7'Cr/1,~592/0247'
109
cDNA synthesis with a vWF-specific oligonucleotide
corresponding to the non-coding strand (transcribed strand)
for mature vWF subunit residues 899-908.
Oligonucleotide (14) - see SEQ ID N0: 16
3' GGA CTG GAC CAC GAC GTC TCC ACG ACG AGG TTCGAA 5-'
Pro Ser HindIII
8g9 908
The primed vWF mRNA population was then used as template
for reverse transcriptase (from Moloney murine leukemia
virus, Gibco/Bethesda Research Laboratories, Gaithersburg,
MD) according to the procedure of Maniatis, T. et al.,
Molecular_Clonina, 2 ed., Cold Spring Harbor Laboratory
Press, Cold Spring Harbor, NY (1989). The RNA strands were
then removed by alkaline hydrolysis and the first strand cDNA
was primed for second strand synthesis using DNA polymerase I
and then amplified iII a polymerase chain reaction ("PCR") as
described in Example 1 using oligonucleotide 14, and also
oligonucleotide 15 (equivalent to coding strand, non-
transcribed strand DNA, corresponding to amino acid residues
20- 428-436).
Oligonucleotide ~15) - see SEQ ID N0: 17
5' GAATTC GTT GAC CCT GAA GAC TGT CCA GTG TGT 3'
EcoRI Val Cys
428 436
The product of a vWF pseudogene (said gene having an
intron-exon arrangement similar to that of the functional
gene within the region thereof corresponding to the mRNA
region selected for amplification) was avoided in the PCR
reaction by selecting priming oligonucleotides complementary
to exons 23 and 24 ~Mancuso, D.J. et al., ~. Biol. Chem.,
264, 19514-19527 (1989)) which are separated in the
~ functional gene by a 2000 base pair intron. Amplified DNA of
- the predicted length was therefore verified to be derived
fro~ platelet cDN~ and not from genomic DNA corresponding to
small quantities of leukocytes or other cells which ~ay have
contaminated the platelet preparation.
The amplified 1.4 kilobase cDNA fragment corresponding
to mature subunit residues 428-908 was then subjected to
further rounds of PCR amplification which split the fragment
WO92/1719~ % 10 7 ~ O ~ PCT/US92/0247
110
into two smaller overlapping cDNA regions (corresponding to
amino acid residues 440-670 and 660-905) to facilitate
sequence analysis.
Priming oligonucleotides therefor were synthesized
(according to the method of Example 1) to correspond
approximately to the first twenty nucleotides on the 5'
(upstream) and 3' (downstream) ends of each of the two
overlapping fragments and contained also either an EcoRI (if
5') or HindIII (if 3') restriction sequence so that the
amplified 440-670 or 660-905 sequances so prepared could be
inserted into M13mpl8 phage for sequencing. Resultant double
stranded vWF cDNA corresponding to the residue 440-670 or
660-905 fragment was then inserted into the multiple cloning
site of the double stranded replicative form of bacteriophage
M13mpl8 using EcoRI and Hind III restriction enzymes, and
then sequenced by the single-stranded dideoxy method (Example
1, Sanger, F. supra)
one patient was found to have a mutation at the codon
corresponding to mature subunit residue 550 that specified a
Trp to Cys mutation (5 TGG3 ~5TGC3). The transversion
mutation destroys an AvaII restriction site overlapping
codons for residues 550-552 of the mature subunit. Absence
of the restriction site was confirmed in the patient's
genomic DN~. Another patient was found to have a mutation at
the codon corresponding to mature subunit residue 511
specifying an Arg to Trp mutation (sAGG3 ~ 5TGG3). Both
patients were found to be heterozygous for their particular
amino acid substitutions, a finding consistent with the
autosomal dominant mode of inheritance seen in most Type IIB
patients. Ruggeri, Z.M. et al., N. Enal. J. Med., 302, 1047-
10~1 (1980).
In the event the mutation or mutations responsible for
the altered properties o~ the mature vWF subunit from other
particular Type IIB patients cannot be resolved into the
above region of the mRNA, corresponding to residues 428-908,
other regions may be selected for study using suitable
oligonucleotides with reference to the published DNA sequence
for the vWF gene.
~, P ~ J
WO92/1719' PCT/~IS92/02~7
111
Example 16 - Mutagenesis of peptide subdomains of
vWF to create additional vWF-derived
polypeptides havinq T~p_ IIB-like proPerties
It has been demonstrated that the GPIb(~) binding domain
of vWF is formed primarily by residues contained in two
discontinuous sequences, comprising approximately Cys474-Pro488
and approximately Leu5~-Pro708 maintained in proper
conformation in native vWF by disulflde bonding. Mohri, H.
et al., J. Biol. Chem., 263(34), 17901-17904 (1988). It has
also been demonstrated that an intrachain disulfide bond
which is necessary to provide that conformation is formed by
cysteine residues 509 and 695 (U.S. Application Serial No.
07/600,183, filed October 17, 1990 and Examples 1-6 reported
herein). The present development provides substantial
evidence that the "loop" region of the mature vWF subunit
(between residues 509 and 695) modulates the binding
properties toward GPIb~ of the above mentioned primary
sequence regions of vWF. The following methods are
representative of techniques which can be employed to (A)
identify within the "loop" region of vWF further potentially
important primary sequence subdomains or specific amino acids
involved in modulating binding of vWF to GPIb~; and/or (B)
create artificial vWF-derived polypeptide sequences with
altered modulating or binding activity.
Method 1 Random mutagenesis of the "loop"
to generate antithrombotic or
antihemorrhaqic thera~eutic ~olypeptides
Using vWF DNA from plasmid p5E (which encodes the amino
acid sequence comprising mature subunit residues 441 to 733
in which the cysteine residues at positions 459, 462, 464,
471 and 474 thereof are replaced by ~lycine residues), and
random mutant oligonucleotides which will sequentially span
the entire 187 amino acid "loop", novel variant DNA sequences
can be constructed which encode variant vWF-derived
polypeptides. Resultant potential therapeutic polypeptides
can be screened for relative binding affinity (1) in direct
hinding assays for affinity to GPIb~, or (2) in botrocetin or
ristocetin induced binding assays, or (3) to conformation
dependent vWF-specific antibodies. Random mutagenesis
PCT/~IS92/02~7~
'~10711~ 112
experiments can also be performed using vWF DNA constructs
suitable for expression in mammalian cells such as those of
Example 7.
Preparation of Oligonucleotides
Mutant oligonucleotides suitable for site directed
mutagenesis protocols and spanning sequential 10 amino acid
subdomains of the loop (for example corresponding to amino
acids 510 - 519, 520 - 529, 530 - 539) can be generated using
a procedure designed to yield a randomly mutagenized
oligonucleotide population. Hutchison, C.A. et al., Proc.
Natl. Acad. Sci. USA, 83, 710-714 (1986). The randomized
vWF oligonucleotide is then hybridized, for example, to
M13mpl8 to copy the mutation into a residue 441-733 encoding
DNA sequence. The method of Hutchison, C.A. et al.
relies on automated synthesis of the oligonucleotide from the
3' end. In the Hutchison procedure, a random oligonucleotide
population suitable for causing permutation of the residues
between positions 504 and 524 of the mature vWF subunit would
be constructed as follows. The oligonucleotide corresponds
to transcribed strand DNA. As the chain is then built
stepwise by the nonenzymatic 3'~5' addition of subsequent
bases (comprising the part of the vWF loop region to be
surveyed), each of the four nucleoside phosphoramidite
reservoirs (A,T,G,C) for oligonucleotide synthesis would be
"doped" with a small amount of each of the other three bases.
Incorporation of one of the "doping" nucleotides would result
in a mutant oligonucleotide~ The amount of doping can be
adjusted to control results. The resultant xandomized
population of mutant oligonucleotides is then used in the
standard site directed mutagenesis protocol (Example 1) to
construct a pool of mutagenized vWF "loop" DNA sequences in
M13mpl8 corresponding to the mature vWF subunit residue 441-
733 fragment and suitable for subcloning into a bacterial
expression system.
It is possible to control the number of mutations per
molecule by controlling the composition of the base mixtures.
For example, it is possible to select for only single base
pair substitutions or to select for molecules which have 2,
WO92/1719~ CT/~'S92/02~7
113
3, 4, or more muta~ions. The procedure developed by
Hutchison, supra typically employed solutions of each of the
four bases in which approximately l.5% impurity of each of
the other three bases contaminates the original base
solutions. Mutagenesis using this particular doped mixture
resulted in roughly 4l~ of clones with no base substitutions,
40% with one, 15% with two, 3% with three and 0.7% with four
~for target nucleotide sequences corresponding to lO amino
acids).
The resultant mutant Ml3mpl8 populations are then
subject to restriction (Example l), and the mutagenized DNA
sequences are inserted into vectors or plasmids such as pET-
3A for expression in host bacterial cells. Large scale
screening of ~ammalian clones is generally much more
difficult than for bacterial clones. However, promising
mutations identified in bacterial constructs may later be
inserted into mammalian or other eucaryotic host cells for
~urther testing or for commercial-scale polypeptide
production.
The mutant clones can then be screened in GPIb~ binding
assays or in binding assays with vWF-specific monoclonal
antibodies (as described below). Mutant clones having cell
lysates which exhibit enhanced platelet binding or antibody
response can be sequenced to determine the amino acid
alteration(s) responsible for the mutant phenotype. In this
way a very systematic analysis of the loop region of vWF can
be performed and mutations which alter the binding of vWF to
GPIb~ can be identified.
The mutagenesis techniques of Method l above is equally
applicable to permuting the amino acid sequence regions o~
the mature subunit believed to represent the actual GPIb
binding site ~Leu469-Asp498 and Glu589-Val7~3) for the purpose of
enhancing their GPIb~ affinity.
Method_2 Random mutation of targeted
subdomains to develop therapeutic polypeptides
To date, five residue positions within the residue 44l-
733 region of mature vWF subunit have been identified which
when appropriately mutated result in potentiation of platelet
WO92/1719~ PCT/~S92/0217~
7~0 114
aggrsgation response and with Type IIB disease. These sites
are at amino acid positions 5~1 (Arg~Trp), 543 (Arg~Trp), 550
(Trp-Cys), 553 (Val~Met), and also posslbly 561 (Gly~Asp).
(The patient with a mutation at position 561 exhibits some
Type IIB-like disease symptoms, namely enhanced platelet
aggregation with low doses of ristocetin and was treated at
the Greene Hospital of Scripps Clinic and Research
Foundation, La Jolla, CA). Since the known mutations
indicate primary se~uence subdomains wherein Type IIB
properties can be generated, random mutagenesis of the DN~
corresponding to short peptide sequences directly adjacent to
these particular sites would be emphasized. Randomly
mutagenized oligonucleotides, prepared and used as described
above, and which span domains of approximately lO amino acids
adjacent to residues 510, 520, 530, 540, 550, 56~, 570 and
580 can be utilized.
Method 3 Mutagenesis o~ speci~ic target amino
acids to develop therapeutic polypeptides
Two o~ the known mutations which correlate with Type IIB
von Willebrand disease result in replacement of a wild type
codon, encoding a positively charged amino acid, with a codon
corresponding to a neutral residue. It is probable that the
electrical charge of particular subdomains in the "loop" must
be maintained for proper in vivo function (i.e. preventing
interaction of GPIb~ with circulating multimeric plasma vWF
until vascular injury triggers a sequence of events resulting
in a con~ormational change in the vWF molecule or its GPIb~
receptor). P~sitively charged amino acids that are proximal
to arginine residues 511 and 543 can also be specifical}y
mutated to code for amino acids which are neutral or possess,
at physiological pH, negatively changed side chains. In
addition, Type IIB disease-conferring neutral mutant codons
such as Trp~3, may be replaced by codons for other neutral or
negatively charged amino acids. Representative further
target amino acid sites predicted to yield mutant
polypeptides having Type IIB properties and resultant
therapeutic utility include the arginine residues at
positions 524, 545, 552, 571, 573, 578 and 579, the lysine
WO 92/1 71 9'~ 3 ~ p~/1 !S~2/02~7
115
residues at positions 534 and 549 and the histidine residues
at positions 559 and 563.
Method 4 Generation of additional mutant
oligonucleotide constructs
havinq therapeutic activitY
There are numerous additional mutagenesis stratagies
which can be used to probe the specific structural features
and amino acid sequence requirements therefor which confer
upon the vWF loop region the ability to modulate GPIb~
binding. Such strategies are also useful in constructing
vWF-derived polypeptides containing, for example, mutant loop
regions which are useful as therapeutics. Representative,
additional mutagenesis strategies are hereafter described.
In the practice of this invention, effective
substitutions need not be made at the exact residue positions
corresponding to the targeted wild type residues. For
example, substitution of cysteine for Lys~9 or Val55~ or for
other nearby residues instead of for Trp550 may be performed,
with the resultant polypeptides being subjected to screening
for therapeutic utility.
Table 2 presents representative examples of potentially
useful amino acid substitutions, deletions and additions
which accomplish net reduction of positive charge at or
adjacent to specific sites. Similar strategies can be
employed at or adjacent to other specific residues of vWF to
accomplish net reduction of negative charge or to break or
for~ a hydrogen bond, salt bridge, or hydrophobic contact.
WO92/1719~ PCT/USg~/02~7~
~l 071~ 116
Table 2
with respect to the sequence: Ser Arg Leu -
510 512
a substitution of a neutral for Arg5~ ~ a neutral residue
or negatively charged residue: such as {;ly, Ser, Asn, Ala,
or Gln5~l, or, for example,
Asp
an insertion of a negatively Arg5ll Asp Leu5~2
charged residue:
10 a deletion of a positively Cys Ser Leu
charged residue: 510 512
Cloned vWF polypeptide constructs reflecting known Type
IIB mutations may also be subject to the above mentioned
random mutagenesis procedures and then screened for
restoration of normal binding function such as, for example,
having a normal response in a modulator-induced GPlb~ binding
assay. For example, it may be demonstrated that a particular
"reversion" mutation proximal to residue 511 would compensate
for, and nullify the effect of the original Arg~Trp5~l Type
IIB mutation. The associated DNA sequence can then be
determined to identify the relevant counteracting amino acid.
Such procedures can be used to give important further
evidencP as to which other residue positions in the mature
subunit vWF amino acid sequence are important modulators of
GPIb~ binding.
Screening of mutant vWF-derived
~olypeptides ~or enhanced GPIb~ bindinq activity
There is hereafter presented an effective method to
screen randomly mutagenized mature vWF subunit polypeptide
~equences for enhanced GPIb~ binding activity, and resultant
enhanced therapeutic utility.
To perform the assays, a device used for the enzyme-
linked immunofiltration assay technique (ELIF~), Pierce
Chemical Co., Rockford, IL, can be adapted in combination
with immobilization of the mutant vWF-derived polypeptides to
be tested. It is considered most e~ficient to initially test
the effect of mutant codons on vWF polypeptides expressed
WO 92/1719~ 3pCT/~92/0247
117
from bacterial constructs and to then copy potentially useful
mutations (using, for example, mutagenesis in M13mpl8 vehicle
and the procedure of Example 22) into a mammalian expression
construct. High levels of mutant vWF polypeptides
correspondin~ to mutant DNA sequences c~n be expressed from
pET-3A type bacterial expression plasmids such as p5E.
Mutant polypeptides constitute a major portion of host E.coli
cell lysates and can be readily screened for GPIb~ affinity.
Accordingly, site directed mutagenesis can be performed
following the procedure of Example 1 usin~ as template in
M13mpl8 the vWF fragment corresponding to p5E expression
plasmid (Example 4) which because of the use of BamHI linkers
in assembly of p5E is recovered therefrom and inserted into
M13mpl8 as an XbaI/HindIII fragment (see Example 17). For
the oligonucleotide pool, oligonucleotides each having
randomly mutagenized residue 505 to 524 sequences are used.
The mutagenized population of M13mpl8 constructs can be
cloned into pET-3A plasmids a~ter which the expression
plasmids can be transformed into E.coli BL21 (DE3) following
the procedure of Example l. Preparation of mutant
polypeptide extracts from E.coli BL21(DE3) for screening
follows the procedure of Example l with the final step being
solubilization of extracted inclusion body material with 8 M
urea at room temperature for 2 hours.
Resultant extracts of expressed mutant p5E-type vWF
polypeptidas are immobilized following the manufacturer's
instructions onto a nitrocellulose membrane (0.45~ pore size)
using 96-well sample application plates (Easy-Titer0 ELIFA
System, Pierce Co., Rock~ord, IL) and a vacuum chamber.
Commercially available pump materials can be used. The
apparatu~ is suitable for screening large series of clone
lysates in an EhIFA or dot blot system and allows also
quantitative transfer of sample fluids to underlying
microtiter wells without cross contamination.
Immobilization of the vWF polypeptides is accomplished
by causing a suitable volume, such as 200 ~l, of each
resuspended inclusion body pellet material (in 8 M urea) to
be ~acuum-drawn through the individual wells to the
nitrocellulose membrane over a 5 minute period. Several 200
O92/1719~ PCT/~'S92/02~7
s~ 118
~l volumes of Hepes-buffered saline are then drawn through
the membrane to remove urea.
The protein binding capacity of the membrane is then
saturated by passing through it three consecutive 200 ~l
aliquots of HEPES/BSA buffer herein comprising 20 mM Hepes,
pH 7.4, 150 mM NaCl, and 1~ wtv bovine serum albumin
(Calbiochem, La Jolla, CA).
After completion of the above procedure to minimize
background caused by nonspecific interaction, a 50 ~l volume
of HEPES/BSA containing botrocetin (at approximately 0.5
~g/ml) or containing ristocetin ( at approximately 1 mg/ml)
can be vacuum drawn through the nitrocellulose membrane again
over a 5 minute period. The ristocetin-induced precipitation
of bacterially-expressed vWF polypeptides observed under some
test conditions is not expected to cause difficulty in this
assay as the polypeptide is already immobilized.
GPIb(~) represented by its external domain,
glycocalicin, or the 45 kg/mol tryptic fragment thereof is
next applied to the nitrocellulose using the vacuum system
and the 96-well plate. The GPIb~ fragments are purified and
~iodinated by standard procedures. Vicente, V. et al., J.
Biol. Chem., 265, 274-280 (1990). 50 ~l aliquots of
HEPES/BSA containing 12sI-GPIb~ fragments (0.25 ~g/ml having a
recommended specific activity of between approximately 5X108
and approximately 5x109 cpm/mg) can then be vacuum drawn
through the nitrocellulose filter over 5 minutes.
The membrane is then allowed to dry and discs
corresponding to the position of each application well are
cut out and counted in a ~ scintillation spectrometer to
determine bound radioactivity. An autoradiograph of the
membrane can also be obtained before cutting out the discs in
order to ascertain that there was no leakage of radioactivity
from one well to another. The counting process may be
facilitated by scanning the developed autoradiogram in a
densitometer to digitize the intensity of developed spots.
As long as the autoradiogram is not excessively
overdeveloped, beyond the linear region of response, useful
qualitative results are obtained.
fl~ JL V; ~ U V
WO 92/1 71 9' PCr/l_lS92tO2~7:`
119
An alternate procedure to derive from individual host
E.coli clones an impure extract which can be screened in
immunoblot or dotblot procedures is as follows. A large set
of individual E.coli colonies carrying separate randomly
mutagenized vWF inserts is picked and grown overnight as
separate cultures. The cultures are then diluted 1:100 and
grown to an OD~ of 1Ø vWF fragment synthesis is induced
by adding isopropyl-~-d-thiogalactopyranoside (IPTG), U.S.
Biochemicals, Cleveland, OH, to 5 mM and continuing growth
for approximately 2.5 hours. The cells are harvested by
centrifugation for 1 minute at 10,000 g and then ~ashed and
repelleted (at 10,000 g) 3 times with phosphate buffered
saline (0.14 M NaCl, 0.1 M Na2HPO4 pH 7.0). The bacterial
pellet is then solubilized by boiling for 10 minutes in a
buffer comprising 0.01 M NaH~PO4, 10 mM Na2EDTA, 1~ ~w/v)
sodium dodecylsulfate, pH 7Ø The incubation is continued
for 2 hours at 60C in the presence also of 10 mM
dithiothreitol (DTT). Suitable volumes (such as 200 ~1) of
such extracts can be used directly in ELIFA apparatus or dot
immunoblot analyses. Prior to adding l25I-GPIb~ to the plate
several rinses of Hepes-buffered saline are washed through
the wells. This extract preparation technique is applicable
to the screening requirements posed by Examples 25-30.
vWF derived polypeptides from colonies representing the
most intense response are selected for confirmation of
enhanced binding using methods such as subjecting purified or
partially purified extra~ts therefrom as appropriate to (A)
immunoblotting according to the procedure of Example 2 with
con~ormation-dependent NMC-4 antibody; (B) assaying for
ability to inhibit botrocetin-induced vWF binding to
formalin-fixed platelets on a dose dependent basis (Example
3); or (C) assayed for ability to inhibit the binding of anti
GPIb~ monoclonal antibodies to platelets (Example 6). The
procedure of Example 6 can be readily adapted as a
supplementary screening system for other target receptors
besides GPIb~ (see Examples 25-30).
Clones which confer enhanced positive responses in these
systems are then subjected to standard DNA sequencing
procedures to identify the vWF gene mutations responsible for
; WO92/1719~ PCT/~'S92/02~7~
'Z~7~0'~ 120 -
the mutant properties. The appropriate mutations may be
copied, according to the procedure of Example 22, into a vWF
DNA sequence within a plasmid (such as a pAD5/WT-pCDM8n~
expression plasmid) suitable for expression in cHO-~l cells.
Further cnaracterization, such as enhanced potential for
induction of platelet aggregation by ll6 kg/mol homodimers
thereof can then be performed.
Example 17 - Selection of oligonucleo1tides for
expression in E.coli of Eragments
of mature von Willebrand factor subunit
reflectinq Type IIB disease mutations
This example demonstrates the mutagenesis strategy for
expression in E.coli of the vWF subunit sequence encoded by
p5E or p7E plasmid, said constructs containing also Trp5~ or
Cys550 mutations.
p7E and p5E expression plasmids (Examples l and 4) were
recovered from cultures of E.coli strain BL21 (DE3) according
to the alkaline lysis procedure of Birnboim, H.C. and Doly,
J., Nucleic Acids Research, 7, 1513 (1979).
The p5E and p7E constructs contain, in reference to the
vWF BamHI insert, an upstream XbaI site and a downstream
HindIII site. The BamHI site at which the vWF sequence is
inserted is positioned directly between an upstream
initiating methionine codon of the parent plasmid and a
downstream stop codon thereof. Rosenberg, A.H. et al., Gene,
56, 125 (1987). As a result of the structure of pET-3A and
the position of the BamHI~ site therein, expressed p5E or p7E
vWF polypeptides contain also a 17 residue amino terminal
se~uence extension derived from the gene lO capsid protein of
the vector.
Accordingly the XbaI/HindIII fragment was removed from
p5E or p7E and inserted into Ml3mpl8 which had been
previously restricted with XbaI and HindIII.
Site directed mutagenesis was then performed in Ml3mpl8,
according to the procedure of Examples l and 4 using the
following oligonucleotides (for p7E) to insert either a Trp5
or Cys550 mutation.
WO92/1719~ PCT/~'S92/02~7
121
For Trp5~: Oligonucleotide (16) - see SEQ ID N0: 18
3i G ATGCCG TCG ACC GATGACCT 5'
Tyrso8 TrPsl ~
and for Cys550: Oligonucleotide (17) - see SEQ ID NO: l9
3' GG-GTCTTCACGCAGGCGCACC 5'
Gln548 Cys550
Oligonucleotides are equivalent to non-coding strand
(transcribed strand) DNA with the secreted single stranded
(+) form of M13mpl8 DNA containing coding strand vWF DNA.
Similar manipulations were performed to insert either
the Trp5~ (using oligonucleotide 18) or Cys550 (again using
oligonucleotide 17) mutation into a p5E construct. With
respect to the Trp5~ p5E insertion, the hybridizing oligo-
nucleotide reflected a Cys509 codon instead of the previously
inserted glycine509 mutation as shown below.
Oligonucleotide (18) - see SEQ ID N0: 20
3' G-ATG ACGTCGACCGATGACTT 5'
Tyr508Cys5O9 TrP511
Exam~,le 18 Effect of recombinant von Willebrand factor
p5E fragments reflecting Type IIB mutations
on the binding of anti-glycoprotein Ib
monoclonal antibod~ LJ-Ibl tQ platelets
Following the procedure of Example 17, the von
Willebrand factor DNA sequence as contained within p5E
(Example 4) was mutagenized to contain either a tryptophan
codon or a cysteine codon corresponding ~o residue positions
511 and 550 respectively.
The mutant polypeptides were expressed in E.coli strain
BL21(DE3), and then solubilized from inclusion bodies,
according to the procedure of Example 4.
Final purification of the monomeric p5E, p5E-Trp5~ and
p5E-Cys550 polypeptides was accomplished as in Example 4 by
dialysis against 6 M guanidine and urea buffers followed by
anion exchange chromatography.
The ability of p5E-Trp5~, p5E-Cys550, and p5E polypeptides
to compete with LJ-Ibl for binding to platelets was
WO92/17192 PCT/~'S92/02~7~
21~7~ 122
demonstrated over a polypeptide concentration of between
about 0.03 and about 2.5 ~M. LJ-Ibl was prepared as
described in Handa, M. et al., J. Biol. Chem., 261(27),
12579-12585 (1986), iodinated according to the procsdure of
Example 6 above, purified on protein-A Sepharose~ (Sigma, St.
Louis, M0) according to the method of Ey, P.L. et al.,
Immunochemistry, 15, 429-436 (1978) and then used in the
competition assays at a concentration of 20 ~g/ml. Washed
platelets (used at 1 x 108/ml) were also prepared according
to the procedure of Example 6.
The assay is based on the ability under certain
circumstances of native vWF to inhibit the binding to
platelets of the anti-glycoprotein Ib monoclonal antibody LJ-
Ibl. The antibody is also a potent inhibitor of vWF binding
to platelets, indicating that the epitope of LJ-Ibl must
overlap with the vWF binding site in GPIb~.
Incubations were performed by mixing the purified
fragments at specified concentrations ~Figure 3) with washed
platelets and l25I-LJ-Ibl for 30 minutes at 22-25C. After
the incubation separation of platelet-bound from free
antibody was achieved by centrifugation through a layer of
20% sucrose in Hepes-buffered saline at 12,000 g for 4
minutes. See Ruggeri, Z.M. et al., J. Clin. Invest., 72, 1-
12 (1983). Residual antibody binding (Figure 3) is expressed
as a percentage of binding determined from control incubation
mixtures containing LJ-Ibl (20 ~g/ml) in 20 mM Hepes, 150 mM
NaCl, pH 7.4 without vWF fragments. The figure demonstrates
that both the Trp5~ and the Cys550 Type IIB mutations increase
the affinity of the purified polypeptide for GPIb~.
Example 19 - Ef~ect of the recombinant ~5~ vWF
fragment containing a Cys55 mutation
on LJ-Ibl binding to platelets at
different monoclonal antibodv concentrations
This example further demonstrates, at two different
monoclonal antibody concentrations, the effect of the Trp550
to Cys550 mutation on the binding of the residue 441-733 vWF
subunit fragment to platelet GPIb~.
W092/1719~ PCT/~92tO2~7~
, 123 ~ ~7~a~
Following the procedure of Example 18, vWF polypeptide
(p5E or p5E-Cys550) was incubated at various concentrations
~Figure 4) with washed platelets (1 x 108/ml) for 30 minutes
at 22-250c but in the presenc~ of either 6 or 20 ~g/ml of LJ-
Ibl. The assay otherwise followed the procedure of Example
18. As demonstrated in Figure 4, the Cys550 polypeptide
competes for platelet GPIb~ receptor at both antibody
concentrations with a higher affinity than the wild ~ype p5E
polypeptide. The affinity of the p5E-Cys550 molecule for
platelet receptor is at least 5-fold greater than that of the
"wild type" p5E molecule. An additional procedure to test,
the behavior of vWF polypeptides containing Type IIB
mutations is dependent on direct binding of ~I-labelled
polypeptides to platelets. It is noted also that most of the
p5E-Cys550 molecules in the samples whose activity was
demonstrated in Figures 3 and 4 are dimers.
The results of Examples 18 and 19 are consistent with
the hypothesis that amino acid substitutions in the cysteine
509-695 loop region of the mature vWF subunit are,responsible
for the molecular basis of Type IIB von Willebrand disease.
Example 20 - An improved procedure to
solubilize recombinant bacterially-
expressed and disulfide-stabilized
residue 441-733 vWF fragments
An optimized procedure for the solubilization of "p5E-
type" polypeptides with formation of disulfide bonds therein
has been developed which is believed to comprise an improved
method to practice this aspect of the invention. Following
this new procedure, a sample of "wet pellet" (Example 1)
weighing approximately 350 mg was dissolved in lO ml of a
buffer composed of 6 M guanidine HCl, 50 mM Tris, pH 8.8.
Dithiothreitol (DTT) was then added to a final concentration
of 10 mM, and the mixture was allow~d to set at 37C for two
hours. The protein concentration of the solution was
determined by a bicinchoninic acid (BCA) titration kit
(Pierce Chemical Co., Rockford, IL). A typical final result
is 2 mg/ml.
Seven ml of the above solution was then diluted to 140
ml with 3 M guanidine HCl, 50 mM Tris, pH 8.8 and then
W092/1719' PCT/US92/02~7-
2~ 124
subjected to dialysis for approximately 24 hours against
Hepes-buffered saline using several reservoir changes.
Oxidation of thiol groups occurs during dialysis as the DTT
is removed.
The desired oxidized p5E-type molec~lle can be purified
by reverse phase HPLC on a lx30 cm C8 co:lumn (Vydac Co.,
Hesperia, CA) using an acetonitrile gradient. The remaining
components of the eluting solvent are a constant amount of n-
propanol (3~) and a constant amount of trifluoroacetic acid
(0.1%), with the balance being spectrograde purity water.
The recommended acetonitrile gradient profile is 30% for
5 minutes, increasing linearly to ~6~ in 35 minutes, to 70
in 5 minutes, and maintained at 70% for an additional 10
minutes. The column is operated at a constant flow rate of
2.5 ml/min. The oxidized monomer of p5E itself (Example 4)
corresponds to the most hydrophilic major peak, eluting at
approximately 40 minutes.
Example 21 - Expression in stable mammalian
transformants o~ the homodimeric
116 kg/mol von Willebrand ~actor fragment
containina a Trp550 to Cys550 mutation
This example is illustrative of conditions under ~hich a
DNA sequence encoding the mature vWF subunit fragment having
an amino terminus at residue 441 (arginine) and a carboxy
terminus at residue 730 (asparagine), and containing also a
Type IIB mutation may be expressed in a stable mammalian cell
transformant with secretion therefrom of the polypeptide.
The mutation strategy of Example 9 was adopted, with
modifications, to insert the Cys550 codon mutation into a
pCDM8~ construct.
Following the procedure of Birnboim, ~.C. and Doly, J.,
Nucleic Acids Research, 7, 1513 (1979~, pAD4tWT plasmids were
recovered from storage cultures of E.coli strain XS127. The
approximate 950 base pair EcoRI-SmaI fragment of pAD4/WT
(Example 9) was subcloned into the EcoRI-SmaI site within the
polylinker region of M13mpl8 phage. The vWF sequence in
M13mpl8 was then mutagenized according to the site directed
mutagenesis protocol of Example l. Oligonucleotide 17 (see
Example 17) was used to insert the Trp550~Cys550 mutation.
W092/17192 PCT/~'S92/02~7
125
The oligonucleotide is equivalent to non-coding strand
(transcribed strand) DNA with the secreted single stranded
(+) form of M13mpl8 DNA containing coding strand vWF DNA.
The mutagenized DNA sequence was recovered as the EcoRI-
SmaI fragment and subcloned into pAD5/WT (Example 7) whichhad been previously digested with EcoRI and SmaI.
Review of the cloning strategy of Example 7 discloses
that the XhoI-NotI fragment of pAD3-2 (containing the
expression construct ~or wild type vWF residues 441-730)
contains the following sequence of elements
5'-XhoI..... EcoRI..... XbaI-SalI-vWF expression ~onstruct-XbaI-NotI-3
wherein the EcoRI site is acquired by cloning the XbaI-
restricted vWF insert into pBluescript II XS(). A SmaI site
is defined within the vWF coding sequence corresponding to
amino acid residues 716-718. Reference to Figure 5 shows
that the XhoI-NotI fragment can be appropriately inserted
into pCDM8-type vectors for expression. Consequently,
insertion of the mutagenized EcoRI-SmaI fragment as a
replacement for the equivalent EcoRI-SmaI fragment of pAD5/WT
creates a construct from which the Type IIB-mutated 441-730
vWF sequence can be expressed.
No SmaI restriction sites are contained in the parent
pCDM8 plasmid. (The complete nucleotide sequence of pCMD8 is
available from Invitrogen, San Diego, CA). In addition to
the SmaI site at vWF residues 716-718, an additional SmaI
site is contributed to the pAD5/WT construct as part of the
pBluescript II XS() polylinker (upstream from the vWF "XbaI-
XbaI" insert and downstream from the EcoRI site). A further
SmaI site arises in the 2000 base pair neomycin resistance
gene fragment cloned into the BamHI site of pCDMB to create
pCDM8~.
A strategy of (1) partial digestion with SmaI, and (2)
agarose gel purification of the appropriately restricted
vehicle fragment was used to assure reassembly of the proper
expression vector. Five ~g of pAD5/WT plasmid were incubated
with 5 units of EcoRI for 60 minutes at 37C resulting in
complete digestion of the site and a homogenous population of
linear fragments. A partial digest with SmaI was then
accomplished using 5 ~g of linearized plasmid as substrate
WOg~/17192 PCT/~'S92/0247
126
for o.~ uQl7t~o~ SmaI (at 370C for 15 minutes). Plasmid
fragments were purified on an agarose sizing gel and a
population of linearized plasmid of approximately 7.3 kb
having been cleaved at the vWF residue 716-718 site was
selected for insertion of the mutagenized EcoRI-SmaI
fragment.
The Arg5~ to Trp5~ mutation may be similarly expressed in
a 116 kg/mol homodimer using oligonucleotide (18) in the
mutagenesis protocol. Alternatively, using two or more
complete cycles of mutagenesis in Ml3mpl8, the Trp5~, Cys550
and further Type IIB mutations may be expressed in a single
polypeptide.
Experimental procedures for effecting stable
transformation of Chinese hamster ovary cells and for
immunopurification of secreted 116 kg/mol vWF polypeptide
were described in Example 7. For the purpose of purifying
vWF polypeptides containing IIB mutations according to the
present example, however, an immunoaffinity column procedure
was used.
Twenty mg of purified NMC-4 antibody were coupled to
CNBr-activated Sepharose~ 4B beads tPharmacia, ~ppsala,
Sweden). The column was preequilibrated with 0.5 M LiCl, 50
mM Tris HCl, pH 7.4, containing 0.05% (w/v) NaN3.
Culture plates containing confluent CH0-Kl cells were
covered with DMEM/10% FCS and incubated for 24 hours. The
medium was then collected. In a typical experiment, 500 ml
of resultant culture medium containing secreted polypeptides
were then applied to the immunoaffinity column. The column
was then extensively washed with 15 bed volumes of
equilibration buffer. vWF antigens were then eluted using a
solution of equilibration buffer containing also 3 M NaSCN.
The eluted vWF polypeptides were concentrated by
ultracentrifugation and then dialyzed against Hepes-saline
buffer (150 mM NaCl, 20 mM Hepes, pH 7.4). Protein
concentrations were determined using the bicinchoninic acid
titration method (Pierce Che~ical Co., Rockford, IL).
An alternate strategy for the transfer of Type IIB
mutation codons to pAD5/WT expression constructs is to
transform pAD3-2 into E.coll CJ236 and select for bacterial
,; .
WO92/1719~ PCT/~'S92/0247
127
colonies resistant to ampicillin (conferred by plasmid) and
chloramphenicol (conferred by host CJ236). An individual
colony is grown in 2X-YT culture medium to late log phase and
diluted l:lOo in fresh medium in the presence of VCS-Ml3
(helper filamentous phage available from Strategene, La
Jolla, CA~ see Maniatis, T. et al., eds. Molecular Cloninq,
2nd ed., Cold Spring Harbor Laboratory Press, 1989. After
another overnight incubation, single-stranded uracil-
containing DNA is isolated from secreted filamentous phage
and the DNA is subjected to the standard extension reaction
associated with mutagenesis using mutant oligonucleotides
that are identical to the coding strand of vWF except for the
intended mutation(s). After the extension reaction, the DNA
is transformed into E.coli XL-l Blue cells, tStratagene, La
Jolla, CA), selected with ampicillin and tetracycline and the
resultant colonies characterized for the presence of mutant
plasmids. The vWF inserts within the mutant plasmids are
sequenced completely to confirm the absence of any aclditional
mutagenic errors. The vWF insert is cloned into pcDMsn~ as
20 .an XhoI/NotI fragment as described above for the yeneration
of pAD5/~T.
An additional strategy is to transform pAD51WT into
CJ236 and to select on plates containing chloramphenicol and
kanamycin (Xanr is conferred by the neomycin gene). A single
resistant colony is picked and grown as described above for
preparation of single-stranded DNA. An extension reaction
using a coding strand oligonucleotide followed by
transformation into XS-127 results in colonies with
mutations, the frequencies ranging from 20-100%, depending
upon the oligo and purity of the single-stranded DNA used in
the mutagenesis reaction. Mutant colonies are sequenced to
verify the targeted mutation, and the lack of any unexpected
mutation. The mutant plasmids are ready for transformation
into CH0-Kl cells for the es_ablishment of stable cell lines.
WO92/1719~ PCT/~'S92/02~7~
~7~ ~ 128
Example 22 - Construction of a stable mammalian
transformant for the expression of the
monomeric 441-730 mature von Willebrand
factor subunit fragment with cysteine-to-
glycine mutations at residues 459, 462
and 464 and containing also one or
more mutations reflective of Type IIB disease
Following the procedure of Examples 9 and 21, an EcoRI-
SmaI fragment may be removed from pAD4/WT plasmid and
subjected to two or more successive rGunds of site directed
mutagenesis in Ml3mpl8 to (A) replace one or more of cysteine
residues 459, 462 and 464 with, for example, glycine or
alanine codons and (B) substitute one or more mutant codons
identified from Type IIB patients or one or more codons which
confer on the resulting polypeptide properties reflective of
Type IIB von Willebrand disease.
Oligonucleotide 13 can be used to substitute glycine
codons for each of the above specified cysteine codons
thereby preventing formation of the 116 kg/mol homodimer and
leading to khe expression of 52/48 Xg/mol monomers with wild
type tertiary structure. ~ second round of mutagenesis
using, for example, oligonucleotide 17 or 18 is used to
insert Type IIB point mutations, in this case Cys550 or Trp511.
Similarly, monomeric residue 441-730 fragments
refl~cting Type IIB codon mutations and only one or two of
glycine substitutions at positions 459, 462 and 464 may be
made following the above procedure and using the
oligonucleotides of Example ll.
Alternate or additional strategies for the trans:Eer of
Type IIB mutant codons to pAD5 constructs according to this
Example, and from which can be generated 52/48 kg/mol
monomeric fragments, are provided in Example 21 above.
Example 23 - Effect of reduced and alkylated recombinant
von Willebrand factor fragment reflecting
the Cys550 Type IIB mutation on the
binding of anti-glycoprotein Ib
monoclonal antibody LJ-Ibl to platelets
This example demonstrates that residue position 550 in
the mature vWF subunit has no direct effect on binding to
GPIb~ but is important in the context of modulating the
,
:'
WO9~/17192 ~1 0 7 ~ ~ ~ PCT/~!Sg2/02~7
129
structure of the vWF subunit and hence activlty of the GPIb~
binding region (residues 474-48~ and 694-708).
p5E polypeptide was expressed and purified accoxding to
an improved procedure which modifies the method of Example 1.
The corresponding p5E-Cys550 polypeptide was similarly
expressed and purified. The inclusion body solubilization
method of Example 1 was followed up to the solubilization
step which utilized 6 M guanidine HCl, 50 mM Tris, pH 8.8,
said solution now containing 10 mM dithiothreitol.
Incubation in this solution, according to the new procedure,
continued for 60 minutes at 37C. p5E and p5E-Cys55
polypeptides were then S-carboxymethylated with iodoacetamide
according to the procedure of Fujimura, Y. et al., J. Biol.
Chem., 262, 1734-1739 (1987). The extract was then subjected
to high performance liquid chromatography first using Q-
Sepharose~ Fast Flow (Pharmacia, Uppsala, Sweden) for anion
exchange followed by cation exchange on a Protein-Pack SP 8HR
column ~Waters Co., Bedford, MA).
The resultant polypeptides contain glycine residues at
positions 459, 462, 464, 471 and 474 and chemically
inactivated cysteines at positions 509 and 695, and in the
case of p5E-Cys550, an additional chemically inactivated
cysteine at position 550. Consistant with the lack of
glycosylation arising in the bacterial expression system, the
polypeptides have apparent molecular weights of approximately
36 kg/mol.
Binding inhibition assays were performed generally
according to the procedure of Example 18 with 10 ~g/ml of
~ LJ-Ibl being used to evaluate the inhibitory effect of
vWF polypeptides on antibody binding. Ten ~g/ml is
approximately the concentration of LJ-Ibl at which, in these
assays, half-maximal binding of antibody to platelets is
acheived. Various concentrations of vWF-derived polypeptide
(Figure 6) were used with the constant amount of LJ-Ibl.
Non-specific binding was determined in the presence of a 100
fold excess of unlabelled LJ-Ibl and has been subtracted from
all data points. Binding of the antibody was again expressed
as a percentage of that ~easured for the control mixture
lacking recombinant polypeptide.
WO92/1719~ PCT/U~92/0247~
2 ~O'~a 130 ~
Figure 6 demonstrates comparative antibody binding
inhibition results for the reduced and alkylated p5E molecule
(r36/Trp550) and for the mutant reduced and alkylated p5E
molecule carrying also a reduced and alkylated cysteine at
position 550 (r36/Cys550).
It can be seen (Figure 6) that, in the reduced and
alkylated fragments (which have no stablle tertiary
structure), substitution of Trp550 by cysteine does not effect
binding to GPIb, presumably because the GPIb~ binding
sequences are already exposed. ~t is an~icipated that
numerous other amino acid species could also occupy position
550 without effect under these assay conditions. It is
likely that only when the polypeptide is assembled into a
three dimensional structure having conformational domains
mimicking those of the native subunit that the effects of
mutations altering the activity of the loop region are
evident. The result o~ this Example is in contrast to that
of Example 18 (Figure 3) where the Cys550 mutation
substantially enhanced the binding of bacterially-expressed
polypeptide to platelets to the exclusion of LJ-Ibl in the
context of a p5E construct which polypeptide possessed the
509-695 loop.
It has also been discovered that addition of botrocetin
at a concentration of approximately 0.4 ~g/ml up to about lO
~g/ml or higher, to a suitable concentration of bacterially-
expressed residue 441-733 vWF fragment (such as approximately
0.5 ~ Molar) substantially enhances the ability of the vWF
~ragment to inhibit the binding of an anti-GPIb~ monoclonal
antibody to GPIb~, as measured by the concentration of the
vWF fragment necessary to achieve half-maximal inhib.ition.
Specific variants of the vWF fragment for which the effect
can be demonstrated includes the p5E molecule containing an
intrachain disulfide bond, reduced and alkylated p5E
polypeptide, the p7E polypeptide, and the fragment comprising
residues 445-733 when reduced and alkylated. As was
previously noted, the expressed residue 441-733 fragments of
the invention contain attached to the amino terminal residue
(441~ a 17 residue amino acid sequence derived fram the gene
lO capsid protein of the pET-3A vector. It is very likely
.
,
WO92/17192 PCT/~l~9~/0247
131
that complexes of the residue 441-730 mature vWF subunit
fragment or subfragments thereof (and whether or not
glycosylated), formed with other appropriate molecules will
enhance the affinity (and resultant antithrombotic utility)
- 5 of the vWF fragment or subfragment for GPIb~, or for other
known or potential receptors or ligands. In addition, the
therapeutic effects of such complexes may be appropriately
mimicked or duplicated by effecting within the residue 441-
730 fragment appropriate amino acid sequence mutations.
Example 24 - Inhibition of antibody binding
to platelets by mutant and
non-mutant homodimeric 116 kg/mol
fraqments expressed from CH0-Kl cells
For this example, measurement of binding inhibition was
performed according to the procedure of Example 23 except
that ristocetin (Sigma, St. Louis, M0) was added to a final
concentration of 1 mg/ml at a point in time 30 minutes prior
to centrifugation. Wild type recombinant 116 kg/mol
homodimer (Trp550) was prepared as described in Example 7.
The DNA corresponding to mutant 116 kg/mol homodimer ~Cys5~)
was prepared according to the procedure of Example 21 with
expression thereof followin~ the procedure of Example 7, as
modified in Example 21.
The inhibitory effects of mammalian-expressed vWF
fragments on anti-GPIb~ antibody binding to platelets were
found to be different in certain respects than those of the
fragments expressed ~rom bacteria. The wild type recombinant
116 kg/mol homodimers performed similarly to native
multimeric vWF in that they effectively inhibit antibody
binding in the presence of ristocetin (and also botrocetin)
but are ineffective in its absence (Figure 7). However, in
contrast to the results seen with the native sequence 116
kg/mol homodimer (referred to as rll6/Trp550 in Figure 7), the
rll6/Cys55 homodimer effectively inhibits LJ-Ibl binding
without ristocetin, although the inhibitory effect is further
enhanced when ristocetin is added thus reproducing the
classic functional abnormality of Type IIB von Willebrand
factor. In the presence of ristocetin, the ability of the
116 kg/mol homodimer to inhibit antibody bindin~ is increased
WO92~17192 PCT/US92/02~7~
2~ 39 132
approximately 10 fold as a result of the Trp550 ~ Cys550
mutation.
The combined results of Examples 23 and 24 strongly
suggest that the two segments of the 52/48 kg/mol fragment
believed to represent the actual GPIb~ binding site (residues
474-488 and 694-708) may be prevented from effectively
interacting with the GPIb~ receptor when the vWF subunits
possess a native conformation such as pre!sented by
circulating vWF. Disruption of tertiary structure (as in the
case of reduced and alkylated E.coli-expressed polypeptides)
or modulation thereof (as in circulating vWF of Type IIB
patients, or in normal vWF molecules affected by a stimulus
associated with a thrombotic or wound event) results in
proper exposure of the binding sequences of vWF for GPIb~.
An additional procedure to test the behavior of horoodimeric
vWF polypeptides containing Type IIB mutations (or
antithrombotic monomers patterned thereon and derived by
mutation of cysteine residues at one or more of positions
459, 462 and 464) is dependent on direct binding of
labelled polypeptide to platelets.
III. Develo~ment of Additional Antithrombotic Polypeptides
Example 25 - Screening of mutant antithrombotic
polypeptide fragments pattern~d
on the residue 441-730 region of
mature von Willebrand factor subunit
havinq enhanced affinity for collaqen
Following the procedure of Method 1 of Example 16,
random mutagenesis can be performed on a cDNA corresponding
30 to the residue ~41-730 vWF fragment, to target the collagen
binding domain encoded therein. Mohri, H. et al., J. Biol.
Chem., 264~29), 17361-17367 (1989) have determined that the
mature suhunit residue sequence 512-673 is necessary ~in the
dimeric 116 kg/mol vWF fragment) to support binding to
collagen. Binding to collagen was further reported therein
to require intact disulfide bonds, an observation which was
stated to have at least two possibl~ explanations.
As stated by Mohri, H. et al., collagen may bind
elements within the residue sequence 512-673, or to the
residue 597-621 subdomain thereof, when an appropriate
'.`'` '`
WO92/1719~ PCT/US92/0247
133
disulfide-stabilized tertiary structure is present.
Alternatively, the actual binding regions in the 52/48 kg/mol
fragment are outside the 512-673 region but require
stabilization of a functional conformation by said internal
region. Roth, G.J. et al., siochemistry~ 25, 8357-8361
(1986) have identified a Type III collagen-binding do~ain as
within the residue 542-662 sequence of t:he fragment.
For the purpose of identifying vWF--derived
antithrombotic polypeptides with enhanced collagen binding
ability, all or part of a cDNA encoding the 441-730 frayment
can be subject to random mutagenesis. The population of
resultant mutagenized vWF DNA sequences is then reinserted
into pET-3A plasmid, as an XbaI-HindIII insert, for
transformation of host bacterial cells followed by expression
therein and large scale screening for desired mutant
phenotypes. Mutations giving enhanced binding may then be
inserted into mammalian or other eucaryotic host cell
constructs for further testing.
A large scale screening assay suitable for detecting
enhanced affinity of the mutant polypeptides for collagen can
be patterned upon the screening assay for GPIb~ binding in
Example 16, with appropriate modifications.
Specifically, the mutagenized population of M13mpl8
constructs is cloned into pET-3~ plasmid followed by
transformation of E.coli BL21(DE3). Partial purification of
bacterial inclusion body lysates follows the procedure of
Example 16. Contacting of the resultant vWF fragments with
ristocetin or botrocetin is omitted. ~ monomeric type III
collagen is applied to the nitrocellulose i~stead of ~
GPIb~ as in Example 16. Monomeric type III collagen is
prepared according to the procedure of Roth, G.J. et al.,
Biochemistry, 25, 8357-8361 (1986) and iodinated following
the method of Bolton, A.E. and Hunter, W.M., Biochem. J.,
133, 529-539 ~1973). Application o~ 50 ~l aliquots of
monomeric collagen ~0.25 ~g/ml) having a specific activity of
between approximately 5 x 1o8 and approximately 5 x 101
cpm/mg should result in an adequate bound signal in relation
to nonspecific binding. Other suitable quantities and
specific activities can be determined and substituted as
WO92/1719~ PCT/~'S92/02~7
~ 134
necessary. The alternate assay of Example 16 based upon
incubation with SDS and then DTT to prepare lysa~es is
equally applicable.
Additional screening strategies useful to confirm the
properties of a much smaller number of bacterial clones which
gave positive responses in the above assay (and using
labelled vWF fragments and unlabelled collagen) are provided
by the binding assays of Pareti, F.I. et al., J. Biol. Chem.,
262 (28), 13835-13841 (1987) and Mohri, H. et al., J._Biol.
Chem., 264 (29), 17361-17367 (1989) . The I~I labelling
procedures described herein allow for specific activities
varying over many orders of magnitude so that a wide range of
receptor (ligand) and vWF fragment concentrations can be
interacted.
Example 26 - Screening of mutant antithrombotic polypeptide
fragments patterned on the residue
441-730 region of mature von Willehrand
factor subunit having enhanced affinity
for qlycosaminoglycans or Proteoql,vcans
20- The binding of heparin to vWF has been determined to
involve one or more amino acid subsequences within the
residue 512-673 domain. It is likely that this binding
activity is conferred by limited linear subsequences within
the above stated region since it has been demonstrated that
both the intact disulfide-stabilized 116 kg/mol homodimer and
the reduced and alkylated 52/48 kg/mol monomer are equally
effective in inhibiting vWF-heparin interaction. Mohri, H.
et al., J. Biol. Chem., 264(29), 17361-17367 (1989).
The mutagenesis strategy of Example 16, method 1 is used
3a to create a randomized population of DNA sequences in
bacterial clones, with the screening of suitable colonies
~ollowing the procedure of Example 25 except that
radiolabelled heparin is substituted for collagen as binding
ligand. Labelling is accomplished by subjecting heparin
sodium salt (porcine intestinal mucosa, grade II, Sigma, St.
Louis, MO) or similar material to derivatization with
fluoresceinamine followed by iodination of the conjugate.
The l25I labelling procedure allows for specific activities of
heparin varying over many orders of magnitude so that a wide
WO9~/17197 PCT/~'S92/02~7
135
range of receptor (ligand) and vWF fragment concentrates can
be interacted. Smith, J.W. and Knauer, D.J. Anal. Biochem~,
160, 105-114 (1987).
As noted previously, it is possible that the collagen,
and more importantly, the heparin binding domains of
antithrombotic polypeptides patterned upon 52/48 kg/mol vWF
fragment will prevent the anti-GPIb~ activity of the
- molecule, such as by causing the polypeptide to be bound at
nonspecific "heparin binding sites" throughout the vascular
system. The random mutagenesis procedure oE this Example
could also be used to screen for a mutant binding subsequence
having less affinity for glycosaminoglycans (or
proteoglycans) or collagen than present in the wild type
sequence, thereby providing an additional alternate method of
inactivating said binding activities.
Additional screening strategies useful to confirm the
desired properties expressed in a much smaller number of
clones giving positive responses in the first assay (and
using labelled vWF fragments and unlabelled hepar:in) are
provided by Mohri, H. et al., J. Biol. Chem., 264(29), 17361-
17367 (1989) and Fugimura, Y. et al., J. Biol. Chem., 262(4),
1734-1739 (1987).
Example 27 - Screening of mutant antithrombotic
polypeptide fragments patterned
on the A3 domain of mature von
Willebrand factor subunit having
enhanced affinity for collaqen
Following the procedure of Example 1, a double stranded
cDNA encoding the entire vWF protein (for the pre-propeptide)
is amplified in a polymerase chain reaction using synthetic
oligonucleotides selected to flank the A3 domain encoding
region, said oligonucleotides carrying also 5' or 3'
restriction sequences suitable for creating a vWF insert in
the multiple cloning site of M13mpl8. The strategy of
Examples 16 and 25 is again applied to generate, by random
mutagenesis of subregions of the encoding cDNA, mutant vWF
polypeptides with potential enhanced binding activity toward
collagen. The collagen binding region of the A3 domain is
stated to comprise residues 948-998 thereof (Roth, G.J. et
2 1 0 ~1 0 ~ 136 PCT~'S92/02~7
al., Biochemistry, 25, 8357-8361 (1986)) although it is
anticipated that other subdomains of the domain may
participate in binding.
Example 28 - screening of mutant antilhrombotic
polypeptide fragments patterned on
mature von Willebrand factor subunit
having enhanced affinity for the
Platelet glycoprotein IIb/IIIa receptor site
The screening assay of Example 16 for mutant vWF-derived
polypeptides having enhanced platelet GPIb~ binding activity
is modified as described below to identify mutant vWF
polypeptides having enhanced platelet GPIIb/IIIa receptor
binding affinity.
The region of vWF cDNA selected for PCR amplification is
recommended to encompass a region corresponding to
approximately 100 amino acid residues on either side of the
Arg Gly Asp Ser sequence (subunit residues 1744-1747).
Qligonucleotides for amplification are again designed to
contain 5' and 3' terminal restriction sequences so that the
cDNA may be inserted into M13mpl8 phage for random
mutagenesis.
Preparation of oligonucleotides for random mutagenesis
of the target domain (focusing on the residues directly
proximal to and including Arg Gly Asp Ser) follows Method 1
of Example 16. With respect to the binding assay, neither
botrocetin or ristocetin is applied to the nitrocellulose.
~ GPIIb/IIIa purified by the method of Fitzgerald, L.A. et
al., Anal. Biochem., 151, 169-177 (}985) or Newman, P.J. and
Kahn, R.A., Anal. Biochem., 132, 215-218 (1983) and labelled
by the method of Bolton, A.E. and Hunter, W.M., Biochem. J.,
133,529-539 (1973) is substituted for t~I GPIb~. Applied to
the 96-well plates are 50 ~l aliquots of HEPES/BSA containing
G~IIb/IIIa at a suitable concentration thereof, such as
approximately 0.25 ~g/ml or higher, with a specific activity
of between approximately 5 x 1o8 and approximately 5 x 101
cpm/mg. The I~I labelling procedure allows for specific
activities varying over many orders of magnitude so that a
wide range of receptor (ligand) and vWF fragment
concentrations can be interacted.
WO92/1719~ PCT/~'S92/~2~7
137
An additional screening strateg~ ~e~ o confirm the
properties of a much smaller number of bacterial clones
giving positive responses in the first assay (and using
labelled vWF fragments and unlabelled GPIIb/IIIa is provided
by Ruggeri, Z.M. et al., J. Clin. Invest., 72, ~-12 (1983).
Example 29 - Screening of mutant antithrombotic polypeptide
fragments patterned on the residue
1-272 region of mature von Willebrand
factor subunit having enhanced affinity
for qlycosaminoqlycans and_proteoqlycans
The strategy of Example 26 is applied using a suitable
amplified cDNA to generate mutant polypeptides derived from
the residue 1-272 domain of mature vWF subunit with potential
enhanced binding activity toward glycosaminoglycans and
proteoglycans.
Example 30 - Screening of mutant antithrombotic
polypeptide fragments patterned on
the residue 1-272 region of mature
von Willebrand factor subunit having
20. enhanced affinitY for factor VIII
The general strategy of Examples 16 and 25 is applied to
ge~erate and detect mutant polypeptides patterned on vWF with
enhanced binding activity toward factor VIII. Coagulation
factor VIII, purified by the me~hod of Fulcher, C.A. and
Zimmerman, T.S., Proc. Natl. Acad. Sci. USA, 79, 1648-1652
(1982) and labelled with I~I to specific activities
comparable to that of the` other ligands in Examples 25-29 is
used. The I~I labelling procedure allows for specific
activities varying over many orders of magnitude so that a
wide range of receptor (ligand) and vWF fragment concentrates
can be interacted.
Deposit of Strains Useful in Practicin~ the Invention
Deposits of biologically pure cultures of the following
strains were made under the Budapest Treaty with the American
Type Culture Collection, 12301 Parklawn Drive, Rockville,
Maryland. The accession numbers indicated were assigned
WO92tl7192 PCT/US92/02~7
2~ 138
after successful viability testing, and the requisite fees
were paid.
Access to said cultures will be available during
pendency of the patent application to one determined by the
Commissioner of the United States Patent and Trademark Office
to be entitled thereto under 37 C.F.R. 1.14 and 35 U.S.C.
122, or if and when such access is required by the Budapest
Treaty. All restriction on availability of said cultures to
the public will be irrevocably removed upon the granting of a
patent based upon the application and said cultures will
remain permanently available for a term of at least five
years after the most recent request for the furnishing of
samples and in any case for a period of at least 30 years
after the date of the deposits. Should the cultures become
nonviable or be inadvertantly destroyed, they will be
replaced with viable culture(s) of the same taxonomic
description.
$train/Plasmid ATCC No. De~osit Date
E.coli p5E BL21 (DE3) 96.3 ATCC 68406 9/19/go
20 E.coli XS127 96.4 ATCC 68407 9/19/90
WO92/17192 2 ~ PCT/U~92/0247
139
SEQUENCE LISTING
(1) GENERAL INFO~MATION:
(i) APPLICANT: Ruggeri, Zaverio M. ,and
Ware, Jerry, invento:rs
on behalf of Scripps Clinic and Research
Foundation
(ii) TITLE OF INVENTION: Therapeutic Fragments of von
Willebrand Factor
(iii~NUMBER OF SEQUENCES: 20
(iv) CORRESPONDENCE ADDRESS:
(A) ADDRESSEE: Scripps Clinic and Research
Foundation
(B) STREET: 10666 North Torrey Pines Road
(C) CITY: La Jolla
(D) STATE: California
(E) COUNTRY: United States
(F) ZIP: 92037
(v) COMPUTER READABLE FORM:
(A) MEDIUM TYPE: 1.2 megabyte 5 1/4" floppy
(B) COMPUTER: AST Bravo 386SX IBM PC comp.
(C) OPERATING SYSTEM: MS DOS version 3.2
(D~ SOFTWARE: WordPerfect 5.1 conv. to ASCII
(vi) CURRENT APPLICATION DATA:
(A) APPLICATION NUMBER: Express Mail Label
TB002596077US
(B) FILING DATE: 27-Mar-92
(C) CLASSIFICATION:
(vii)PRIOR APPLICATION DATA: This appl. is a c-i-p o~
(A) APPLICATION NUMBER: US 07/613,004
(B) FILING DATE: 13-Nov-1990
(vii)PRIOR APPLICATION DATA: This appl. is a c-i-p of
(A) APPLICATION NUMBER: US 07/600,183
~B) FILING DATE: 17-Oct-1990
(viii)ATTORNEY/AGENT INFORMATION:
(A) NAME: Barron, Alexis
(B) REGISTRATION NUMBER: 22,702
(C) REFERENCE/DOCKET NUMBER: P16,633-E PCT
(ix) TELECQMMUNICATION INFORMATION: -
WO92/17192 PCT/US92/0247~
~ t ~ 140
- (A) TELEPHONE: (215) 923-4466
(B) TELEFAX: (215) 923-2189
~2) INFORMATION FOR SEQ ID NO: 1:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 960
(B) TYPE: Nucleic Acid
(C) STRANDEDNESS: single stranded
(D) TOPOLOGY: Linear
(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 1:
10GAA GAC TGT CCA GTG TGT GAG GTG GCT GGC 30
Glu Asp Cys Pro Val Cys Glu Val Ala Gly
435 440
CGG CGT TTT GCC TCA GGA AAG AAA GTC ACC 60
Arg Arg Phe Ala Ser Gly Lys Lys Val Thr
15 445 450
TTG AAT CCC AGT GAC CCT GAG CAC TGC CAG 90
Leu Asn Pro Ser Asp Pro Glu His Cys Gln
455 460
ATT TGC CAC TGT GAT GTT GTC AAC CTC ACC 120
20Ile Cys His Cys Asp Val Val Asn Leu Thr
465 470
TGT GAA GCC TGC CAG GAG CCG GGA GGC CTG 150
Cys Glu Ala Cys Gln Glu Pro Gly Gly Leu
475 480
25GTG GTG CCT CCC ACA GAT GCC CCG GTG AGC 180
Val Val Pro Pro Thr Asp Ala Pro Val Ser
485 490
CCC ACC ACT CTG TAT GTG GAG GAC ATC TCG 210
Pro Thr Thr Leu Tyr Val Glu Asp Ile 5er
495 500
GAA CCG CCG TTG CAC GAT TTC TAC TGC AGC 240
Glu Pro Pro Leu His Asp Phe Tyr Cys Ser
505 510
AGG CTA CTG GAC CTG GTC TTC CTG CTG GAT 270
35Arg Leu Leu Asp Leu Val Phe Leu Leu Asp
515 520
GGC TCC TCC AGG CTG TCC GAG GCT GAG TTT 300
Gly Ser Ser Arg Leu Ser Glu Ala Glu Phe
525 530
WO92/17192PCT/US92/02~7
1~1
GAA GTG CTG AAG GCC TTT GTG GTG GAC ATG 330
Glu Val Leu Lys Ala Phe Val Val Asp Met
535 540
ATG GAG CGG CTG CGC ATC TCC CAG AAG TGG 360
5Met Glu Arg Leu Arg Ile Ser Gln Lys Trp
545 550
GTC CGC GTG GCC GTG GTG GAG TAC CAC GAC 390
Val Arg Val Ala Val Val Glu Tyr His Asp
555 560
10GGC TTC CAC GCC TAC ATC GGG CTC AAG GAC 420
Gly Ser His Ala Tyr Ile Gly Leu Lys Asp
565 570
CGG AAG CGA CCG TCA GAG CTG CGG CGC ATT 450
Arg Lys Arg Pro Ser Glu Leu Arg Arg Ile
15 575 5~0
GCC AGC CAG GTG AAG TAT GCG GGC AGC CAG 480
Ala Ser Gln Val Lys Tyr Ala Gly Ser Gln
585 590
GTG GCC TCC ACC AGC GAG GTC TTG AAA TAC 510
20Val Ala Ser Thr Ser Glu Val Leu Lys Tyr
595 600
ACA CTG TTC CAA ATC TTC AGC AAG ATC GAC 540
Thr Leu Phe Gln Ile Phe Ser Lys Ile Asp
605 610
25CGC CCT GAA GCC TCC CGC ATC GCC CTG CTC 570
Arg Pro Glu Ala Ser Arg Xle Ala Leu Leu
615 620
CTG ATG GCC AGC CAG GAG CCC CAA CGG ATG 600
Leu Met Ala Ser Gln Glu Pro Gln Arg Met
: 30 ~25 630
TCC CGG AAC TTT GTC CGC TAC GTC CAG GGC 630
Ser Arg Asn Phe Val Arg Tyr Yal Gln Gly
635 640
CTG AAG AAG AAG AAG GTC ATT GTG ATC CCG 660
35Leu Lys Lys Lys Lys Val Ile Val Ile Pro
645 650
GTG GGC ATT GGG CCC CAT GCC AAC CTC AAG 690
Val Gly Ile Gly Pro His Ala Asn Leu Lys
655 660
40CAG ATC CGC CTC ATC GAG AAG CAG GCC CCT 720
Gln Ile Arg Leu Ile Glu Lys Gln Ala Pro
:~ 665 670
WO 92/1~1~2 PCr/US92/0247~
~1~7~ 142
GAG AAC AAG GCC TTC GTG CT5 AGC AGT GTG 750
Glu Asn Lys Ala Phe Val Leu Ser Ser Val
675 680
GAT GAG CTG GAG CAG CAA AGG GAC GAG ATC 780
5Asp Glu Leu Glu Gln ~ln Arg Asp Glu Ile
685 690
GTT AGC TAC CTC TGT GAC CTT GCC CCT GAA 8 l 0
Yal Ser Tyr Leu Cys Asp Leu Ala Pro Glu
695 700
lOGCC CCT CCT CCT ACT CTG CCC CCC CAC ATG 840
Ala Pro Pro Pro Thr Leu Pro Pro His Met
705 710
GCA CAA GTC ACT GTG GGC CCG GGG CTC TTG 870
Ala Gln Val Thr Val Gly Pro Gly Leu Leu
15 715 720
GGG GTT TCG ACC CTG GGG CCC AAG AGG AAC 90 O
Gly Val Ser Thr Leu Gly Pro Lys Arg Asn
725 730
TCC ATG GTT CTG GAT GTG GCG TTC GTC CTG 930
20Ser Met Val Leu Asp Val Ala Phe Val Leu
735 740
GAA GGA TCG GAC AAA ATT GGT GAA GCC GAC 960
:;lu Gly Ser Asp Lys Ile Gly Glu Ala Asp
745 750
25 ~2) INFORI~IOI~ FOR SEQ ID NO: 2:
i) SEQUENCE CHAR~CTERISTICS:
(A) LENGTH: 4
(B) TYPE: Amino acid
( C ) STRANDEDNESS:
(D) TOPOLOGY: Linear
(Xi) SEQUEN(;E DESCRIPTION: SEQ ID NO: 2:
Arg Gly Asp Ser
(2) INFORMATION FOR SEQ ID NO: 3:
t i ) S ~:QUENCE CHARZ~CTERI STI CS: A
(A) LENGTH: 26
(B) TYPE: Nucleic acid
(C) STRANDEDNESS: single stranded
(D) TOPOLOGY: Linear
. ~ . . . .
:
WO92/17192 ~ Q ~ PCT/~S92/0247
143
(xi~ SEQUENCE DESCRIPTION: SEQ ID NO: 3:
ACGAATTC CGG CGT TTT GCC TCA GGA 26
(2) INFO~MATION FOR SEQ ID NO: ~o
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 35 base pairs
(B) TYP : Nucleic acid
(C) STRANDEDNESS: single stranded
(D) TOPOLOGY: Linear
(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 4:
GAAGCT TAC CAT GGA GTT CCT CTT GGG CCC CAG GG 35
(2) INFORMATION FOR SEQ ID NO: 5:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 36 base pairs
tB) TYPE: Nucleic acid
(C) STRANDEDNESS: single stranded
(D) TOPOLOGY: Linear
(Xi) SEQUENCE DESCRIPTION: SEQ ID NO: 5:
GAC AAC ATC AAC GTG GCC AAT CTG GCC GTG CTC AGG 36
(2) INFOR~ATION FOR SEQ ID NO: 6:
(i) SEQUENCE CHARACTERISTICS-
(A) LENGTH: 30 base pairs
(B) TYPE: Nucleic acid
(C) STRANDEDNESS: single stranded
(D) TOPOLOGY: Linear
(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 6:
CGG CTC CTG GCC GGC TTC A~C GGT GAG GTT 30
~2) IN~ORMATION FOR SEQ ID NO: 7:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: l9 base pairs
(B) TYPE: Nucleic acid
(C) STRANDEDNESS: single stranded
(D) TOPOLOGY: Lin~ar
(Xi) SEQVENCE DESCRIPTION: SEQ ID NO: 7:
G CCT GCT GCC GTA GAA ATC l9
W~92/1719' PCT/US92/0247~
2 la7 ~ 144 ..
(2) INFORMATION FOR SEQ ID NO: B:
(i) SEQUENCE CHARACTERISTICS:
~A) LENGTH: 21 base pairs
(~) TYPE: Nucleic acid
(C) STRANDEDNESS: single stranded
(D) TOPOLOGY: ~inear
(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 8: -
GGC AAG GTC ACC GAG GTA GCT 2l
~2) INFOR~ATION FOR 8EQ ID NO: 9:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 27
(B) TYPE: Nucleic acid
(C) STRANDEDNESS~ single stranded
(D) TOPOLOGY: Linear
(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 9:
GT CGACGCCACC ATG ATT CCT GCC AGA 27
(21 INFORMATION FOR SEQ ID NO: l0:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 20
(B) TYPE: Nucleic acid
(C) STRANDEDNESS: single strande~
(D) TQPOLOGY: Linear
(xi) SEQUENCE DESCRIPTIOM: SEQ ID NO: l0:
TCAGTTTCTA GATACAGCCC 20
(2) INFORM~TION FOR SEQ ID NO~
(i) SEQUENCE CHARACTERISTICS:
(A) ~ENGTH: 26
tB) TYPE: Nucleic acid
(C) STRANDEDNESS: single stranded
(D) TOPOLOGY: Linear
(xi) SEQUENCE DESCRIPTION: SEQ ID NO: ll:
ACGAATTC CGG CGT TTT GCC TCA GGA 26
(2) INFO~MATION FOR SEQ ID NO: 12.
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 27 base pairs
u ~
WO92/171~2 Pcr/uss2/
145
(B) TYPE: Nucleic acid
(C) STRANDEDNESS: single stranded
(D) TOPOLOGY: Linear
(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 12:
GAAGCTTAC CAT GGA GTT CCT CTT GGG 27
(2) INFORMATION FOR SEQ ID NO: 13:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 39
(B) TYPE: Nucleic acid
(C) STRANDEDNESS: single stranded
(D) TOPOLOGY: Linear
(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 13:
GGG ACC CTT TGT GCA GAA GGA ~ 2l
CGG CGT TTT GCC TCA GGA 39
(2) INFORMATION FOR SEQ ID NO~
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 39
(B) TYPE: Nucleic acid
(C) STRANDEDNESS: single stranded
(D) TOPOLOGY: Linear
(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 14:
GGG CCC AAG AGG AAC TGA l8
TCTAGAAAGC TTGGCACTGG C 39
~2) INFORMATION FOR SEQ ID NO: 15:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 36
(B) TYPE: Nucleic acid
(C) STRANDEDNESS: single stranded
(D) TOPOLOGY: Linear
(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 15:
GAC AAC ATC ACC GTG GCC 18
AAT CTG GCC GTG CTC AGG 36
(2) I~FORMATION FOX SEQ ID NO: l6:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 36
WO92/1719~ PCT/~'S92/0247
2 l 07~ 0~ 146
(B) TYPE: Nucleic acid
(C) STRANDEDNESS: single stranded
(D) TOPOLOGY: Linear
(xi) SEQUENCE DESCRIPTION: SEQ ID ~O: 16.
AAGCTT GGA GCA GCA CCT 18
CTG CAG CAC CAG GTC AGG 3 6
(2) INFORMATION FOR SEQ ID NO: 17:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 33
(B) TYPE: Nucleic acid
- (C) STRANDEDNESS: single stranded
(D) TOPOLOGY: Linear
(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 17:
GAATTC GTT GAC CCT GA~ 18
GAC TGT CCA GTG TGT 3 3
2 ) INFORMATION FOR SEQ ID NO: 18:
~i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 2l
(B) TYPE: Nucleic acid
(C) STRANDEDNESS: Single stranded
(D) TOPOLOGY: Linear
(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 18:
TC CAG TAG CCA GCT GCC GTA G 2l
(2) ~NFO~MATION FOR SEQ ID NO: l9:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 2l
(B) TYPE: Nucleic acid
~C) STRANDEDNESS: Single stranded
(D) TOPOLOGY: Linear
(xi) SEQUENCE DESCRIPTION: SEQ ID NO: l9:
C CAC GCG GAC GCA CTT CTG GG 2 l
(2) INFORMATION FOR SEQ ID NO: 20:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 21
3S (B) TYPE: Nucleic acid
WO92/17192 147 .~
(C) STRANDEDNESS: Single stranded
(D) TOPOLOGY: Linear
(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 20:
TT CAG TAG CCA GCT GCA GTA G 2l
~2) INFORM~TION FO~ SEQ ID NO: 21:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 320
(B) TYPE: Amino acid
(C) STRANDEDNESS:
10(D) I'OPOLOGY: Linear
(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 21:
Glu Asp Cys Pro Val Cys Glu Val Ala Gly
435 440
Arg Arg Phe Ala Ser Gly Lys Lys Val Thr
15445 450
Leu Asn Pro Ser Asp Pro Glu His Cys Gln
~55 460
Ile Cys His Cys Asp Val Val Asn Leu Thr
465 470
20Cys Glu Ala Cys Gln Glu Pro Gly Gly Leu
475 4~0
Val Val Pro Pro Thr Asp Ala Pro Val Ser
485 490
Pro Thr Thr Leu Tyr Val Glu Asp Ile Ser
25495 500
Glu Pro Pro Leu His Asp Phe Tyr Cys Ser
505 510
Arg Leu Leu Asp Leu Val Phe Leu Leu Asp
515 520
30Gly Ser Ser Arg Leu Ser Glu Ala Glu Phe
525 530
Glu Val Leu Lys Ala Phe Val Val Asp Met
535 540
Met Glu Arg Leu Arg Ile Ser Gln Lys Trp
35545 550
Val Arg Val Ala Val Val Glu Tyr His Asp
555 560
WO92/17192PCT/~'S92/0247~
2~7~ 148
Gly Ser His Ala Tyr Ile Gly Leu Lys Asp
565 570
Arg Lys Arg Pro Ser Glu Leu Arg Arg Ile
575 580
5Ala Ser Gln Val Lys Tyr Ala Gly Ser Gln
585 590
Val Ala Ser Thr Ser Glu Yal Leu Lys Tyr
595 600
Thr Leu Phe Gln Ile Phe Ser Lys Ile Asp
605 610
Arg Pro Glu Ala Ser Arg Ile Ala Leu Leu
615 6~0
Leu Met Ala Ser Gln Glu Pro Gln Arg Met
625 630
15Ser Arg Asn Phe Val Arg Tyr Val Gln Gly
635 640
Leu Lys Lys Lys Lys Val Ile Val Ile Pro
645 650
Val Gly Ile Gly Pro His Ala Asn Leu Lys
655 660
Gln Ile Arg Leu Ile Glu Lys Gln Ala Pro
665 670
Glu Asn Lys Ala Phe Val Leu Ser Ser Val
675 680
25Asp Glu Leu Glu Gln Gln Arg Asp Glu Ile
685 690
Val Ser Tyr Leu Cys Asp Leu Ala Pro Glu
`695 700
Ala Pro Pro Pro Thr Leu Pro Pro His Met
705 710
Ala Gln Val Thr Val Gly Pro Gly Leu Leu
715 720
. Gly Val Ser Thr Leu Gly Pro Lys Arg Asn
725 730
35Ser Met Val Leu Asp Val Ala Phe Val 1eu
735- 740
Glu Gly Ser Asp Lys Ile Gly Glu Ala Asp
745 750
