Note : Les descriptions sont présentées dans la langue officielle dans laquelle elles ont été soumises.
WO 93J03146 2 i 13 h 8 ~ PCr/US92/062K3
-- 1 --
DISEASE ASSOCIATED B-CELL EPITOPES OF
TPO AND U SE THEREOF
Bacl~am~ o~ the_Invention
Part of th~ work leadin~ to this 1nver,tion was made with
lJ.S~ 60vernment funds. The U.S. Government has certaill rights
in this invent~on.
25 ~
Th~ present ~Qvention r~lates to the f~eld of molecular
b~ology and inlinuno~ogy. More par~icu~arly, the ~nvention
r~l~tes to the prod~ction of re~ombinant human thyroid
pero%idase in non-thyroidal eukaryotio cells . The invention
is further related to methods of using recombinant hulnan
thyro~d peroxidase, and, in par~icular, to methods of using
recombinant hu~an thyroid peroxidase in diaynosis of ilranune
disorders such as Hashimoto's thyroiditis.
2 ~ 3
w o 93/03146 PCT/US92~0628
-2--
Brief Description of the Related Art .
Hashimo~o's thyroiditis is the most common autoimmune
endocrinopathy, affecting, at least subclinically, up to 15%
S of the adult female population (Volpe, R., In Werner's The
ThYroid, 5th Edition ~Ingbar, S.H., et al., Eds.), J.B.
Lippincott Co., Philadelphia, pp. 1266-1291 (1986); Gordin,
A., et al., Acta EndocriQ~L 90:33-42 (1979)). Antibodies
: against a number of thyroid antigens are present in the sera
of these patients, including thyroglobulin and the thyroid
Umicrosomal" antigen ~Doniach, D., et a L, Clin. EndocrinoL.
Mçtab. 8:63-80 (1979); Weetman, A.P., et al., Endocr. Rev.
5:309-3S5 (1984)). Other antigens of lesser, or uncertain,
importance, include the second colloid antigen ~Do~iach, D.,
et al., Clin. Endocrinol. Metab. 8:63-89 (1979)~, tubulin
(Rousset, B., et al~, Clin. EXD. ImmUnO1. 52:325-332 (1983)),
~: DNA (Katakura, M., et al.,:J.~lin. Endocrinol. Metab. 64:405-
408 (1987)) and Autoimmune Thyroid Disease-Related Antigen I
(ATRA I) (Hirayu, H~:~ et al., J. Clin. Endocrinal..Metab.
; ~ 20 : 64:578-584 (19873).~ :
: ~ :Antibodies :against the microsomal antigen,: which is
:expressed: oo the cell~:surface (Khoury, E.L., Ç~ L, EXD.
Immunol.~45:315-328 (1981):; Nilsson, M., ç~_31~. Molec~ Cell.
Endocrinol. 53:177-185 (l987)), are believed to be of greater
25~ ~importance than those against thyroglobulin in the
::: :: pathogenesis of Hashimato's thyroid~tis. This is because
:anti~crosomal antibodies ~MSA) are~more closel~ associated
: ~ ~ :w~th the active phase of the disease (Volpe,.R., In ~erner's
The ThYroid, 5th Edition (Ingbar, S.H., et al., Eds.), J.B.
Lippincott Co., Philadelphia9 pp. 1266-1291 (19863; B~gner,
U., J. Cl in . Endocrinol . Metab. 59:734-738 (1984); Jansson,
R., et al ., Cl in. _EXD. Immunol. 63:80-86 (1986)) and are
~: complement-fixing (~Khoury, E.L., et al., EXP. Immunol. 45:315-
~ ' wos3/o3146 ~ 2 ~ ~ PCI`/VS92/06283
328 ~1981~). These àntibodies are, therefore, likely to
initiate thyroid cellular damage.
A major recent diseovery regarding Hashimoto's
thyroiditis is that the previously ill-defined microsomal
antigen is, at least in part, ~hyroid peroxidase (TP0), the
primary enzyme involved in thyroid hormone synthesis. This
conclusion was based on immunologic evidence (Czarnocka, B.,
FEBS Le_ters 109:147-152 ~1985); Portmann, L., et al., J.
Clin. Endocrinol. Metab. 61:1001-1003 (1985); ; Mariotti~ S.,
et al., J. Clin. Endocrinol. M tab. 65:987-993 t1987)) and
subsequently confirmed by the molecular cloning of the cDNA
for thèse proteins (M2gnusson, R.P.~ et_ al., J. BioL Chem.
262:13885-13888 (1987); Magnusson, R.P., et al., Mol.
Endocrinol. 1:856-861 (1987); Libert, R., et al., EMB0 J.
: 15 6:4193-4176 (1987); Kimura, S., et al., Proc. Natl. Açad. Sci.
USA 84:5555-5559 ~1987~) and the discovery that their derived
amino acid sequences are the same (Libert, R., e~ MB0 ~.
:4193-4176 (19871; Seto, P., et al . ~. Cl in . Invest.
80: 120~-1208 (1~87) ) .
20 ` PrSor to the present invention, a suitable preparation of
recombinant TP0 has not been available ~or studies on the
presumed abnormali~ties ~in in~nune regulation in Hashilnoto's
: thyroiditis, or for~the demonstration of the specific B-cell
: and T-cell epitopes involved in this disease. In this
: 25 respect, understanding:of the molecular ~echanisms involved ~n
the pathogenesis;of Hashimoto's thyroiditis lags far behind
that of other:immune:disorders, such as ~y~sthenia yravis, a
disease for which pure antigen (the acetylcholine r~ceptor)
has been obtained and epitopes already defined ~Tzartos, S.J.,
: 30 et al., Proc. Na~l. Acad. Sei. USA 85:28g9-2903 (1988)i
Hohlfeld, R., ~5_3~, J. Clin Invest. 81:657-660 (1988)).
~: Human TP0 ~hTP0) i~nunopurified by monoclon~l antibodies
(mAbs) has been available, but is of limited value ~ecause of:
(a) inadequate s~pplies of human thyroid tissue; (b) the
.
,3
WO 93/03146 Pcr/us92/o6283
dit`ficulties in purificatian of this membrane-bound antigen;
and (c) contamination with other thyroid autoantigens such as
thyroglobulin, which is highly abundant.
Fra~ments of hTP0 have been generated as recombinant
bacterial (~-galactosidase) fusion proteins, and reactivity of
a number of Hashimoto patient sera with small fragments of TP0
expressed as fusion proteins has been reported (Libert, R., et
al., EMB0 J. 6:4193-4176 (1987)~. Those data, however~ are
di~ficult to interpret, because the plaque assays used require
extensive pre-adsorption of polyclonal antisera (Hirayu, H.,
et al., J _Clin. Endocrino~ tab. 64:578-584 (1987)) and can
yield ~alse positive results.
For examplé, a reported fusion protein originally
described as reactive with 19 of 20 ~ashimoto patient sera
(Libert, R., et al., EMBO J. 6:4~93-4176 (1987~, clone C2)
has, upon immunopurificaticn with anti-~-galactosidase ~Abs,
been~ found to react with fewer Hashimoto patient sera in an
ELISA assay (Dinsart, C., ~L_3~ , 17th Annual Meetin~ o~ the
EuroDean Thvroi~ ssociation, Abstract #235 (1988)).
Thus, bacterial~fusion proteins, too, have been of
limited value becausé: (a)~ no combination o~ fragments has
been found that reacts with all Hashimoto's sera; ~b) the
conformation of the fusi~on protein may differ from that of the
native protein; and (cI the bacterial products ~ay be toxic
~; 25~ ~ when added to im~nè cel~ls in culture.
;~ 5UMMARY DF ~HE INVENTION
In order to obtain full-length hTPO free of other poten-
tial thyroid anti~ens, the present inventor achieved
~ ~ expression of re~ombinant h~P0 in non-thyroidal eukaryotic
; ~ cells~ Like native hTP0, this recombinant hTP0 is
enzymatically aotive, is expressed on the cell surface, and is
not a fusion protein.
~! WO 93/03146 ~ i i 3 ~ PCI'/U592/U62fi3
The reeombinant hTP0 of this invention is recognized in a
specific manner by sera from patients with Hashimoto's
thyroiditis ~hat contain "antimicrosomal" antibodies. All 36
Hashimoto patient sera selected to represent a range of
antimicrosomal antibody levels seen in this disease were
reactive with the eukaryotic-expressed recombinant hTP0 of the
invention.
It is an object of the present invention, then, to
provide ~or a convenient and economical source of ~ecombinant
hTPO, which does not suffer from ~he disadvantages assooiated
with the immuno-purified native protein or with the
recombinant fusion protein previously avail:able. The present
invention thus provides a number of important advances in the
oharacterization of the human thyroid micrusomal antigen, and
opens the way to substantial further developments in this
field. ::
Recombinant,: enzymatically-active, human thyroid
:: peroxidase has;: been:~generated in non-thyroidal eukaryotic
cells. Unlike bac~erial fusion proteins previously reported,
:~: 20 ~ :the confor~ation of~this protein is not encumbered by the p-
galactosidase: fusion partner~ Furthermore, unlike the
bacterially-produced ~protein, the TP0 is glycosylated. The
: demonstrati:on Qf~:~functional ~TP0 act~vity indicates
unequivocally ~that:: the~ cONA previously :cloned (Magnusson,
2~ R.P., et al.,~ iol~ _Chem. 262:~13885-13888 (1987); ~`.
Magnusson? R.P.,::et~al~ Mol. EndocrinoL 1:856-861 (1987~;
Llbert,:R., et ~ EMBO~J. 6:4193-4176 :(1987); K~mura, S., et
:~ al., Proc.: Natl._ Acad. ;Sci. USA 84:5555-5559 (1987)~, is
indeed TP0.
~ 30 The present; invention also provides for the
:~: identification~ o.f the ~-cell epitope on thyroid peroxidase
; associated with autoi:mmune thyroid disease. In add~tion, this
aspect of the invention provides a method for identifying the
: ~
211 3~
w o 93/0314~ PcT/uss2/~283
--6-
molecular interaction responsible for ~he ~-cell recognition
of thyroid peroxidase.
Experiments using the recombinant hTP0 o~ the in~ention
expressed in a non-thyroidal eukaryotic cell prove that TP0,
independent of any other potential thyroid antigen, is a major
autoantigen in Hashimoto's thyroiditis. Thus, all 36
Hashimoto's patient sera tested reacted specifically with
recombinant hTP0 in an approximately quantitative manner as
demonstrated by Western blot analysis. While previous
immunological studies strongly suggested that antimicrosomal
antibodies react with hTP0 (Czarnocka, B., FEBS Letters
109:147-152 ~1985); Portmann, L., et al., J. Clin. Endocrinol
Metab~ 61:1001-1003 (1985); Kotani, T., et al., J. Clin.
Endocrinol. Metab. 62:928-933 ~1986); Mariotti, S., et al., J.
Clin. _Endocrinol. Me~ab. 65:987-993 (1987)), it had been
difficult to exelude the possibility of contamination of the
imm~nopurified hTP0 antigen by other, unidentified, thyroid
antigens. The only thyroidal ~or, indeed, human) protein
produced by, or found in, the CH0-TP0 cells of the present
invention is hTP0. Even though human sera from both normal
:~ subjects and patients with Hashmoto's thyroiditis containantibodies that react with some antigen~s) of untransfected
CH0-cells, only the Hashimoto's patient sera react with the
recombinant hTP0. I~:
The present invention also sheds light on previous -`
sbservations that the microsomal antigen appeared as a doublet
when analyzed by polyacrylamide gel electrophoresis (PAGE~ and
Western blot ~Portmann, L., et al., J. Clin. Invest. 81:1217-
1224 (1988); Hamada, N., et al., J. Clin. En~ocrinol. ~etab
~:120-128 (19853; Hamada, N., et al.,) J. Clin. Invest.
79:813-825 11987~. It was not known whether the doublet
represented two separate proteins or the partial degradative
prod~ct o~ a single protein. Kimura et al. observed two forms
o~ hTP0 mRNA and cDNA, and suggested the possibility of
-: WO93/03146 2 i ~ .~ 2 $ a PCI`/US92/06283
--7 -
alternate splicing of the initial TP0 transcripts (Kimura, S.,
et al., Proc. _Natl. Acad. Sci. USA 84:5555-5559 (1987)).
Nagayama et al. reported the existence of four different forms
of hTP0 mRNA transcripts in cultured Graves' thyroid cells
after TSH stimulation (Nagayama, Y., et al., International
ThYroid svmDosium~ Tokyo, Japan, Abstract #42 (1988)). The
present discovery of a doublet as the product of a single,
intron-less, hTPO gene argues strongly against the likelihood
of alternate splicing.
.
The apparent conversion of the doublet to a single band
after protein reduceion, reminiscent of the data of Portmann
; ~et al.? with a crude human thyroid extract ~Portmann, L., et
al~., J. Clin. Invest.~ 81:1217-1224 (1~88)), suggests that
membrane-bound hTP0 is linked through disulfide bonds to
another, unidentified protein. An alternate interpretation,
n line with the model~of ~Taurog et al. (Yokoyama, N., et
al., Mol. Endocrinol.~ 2:838-844 (1988)), is that intrachain
disulfide bonds~within TPo may alter tbe gel migratory
behavior of TPO,~resul~ting in the appearance of multiple
fonms. ln contrast to~ ;observations of human thyroid
icrosomes in whSch the~primary antigen (under non-reducing
conditions? was~107 kD~in~ size~(Hamada, N., et al., J. Clin.
Endocrinol. Metab.~61~:120-128 ~1985)), the present in~entor
observed, under the~;;same conditions, that the major im-
~ munogenic form of~récombinant hTP0 in transfected C~0 cells is
about 200 k~ i~n~mass whlch is converted upon Nduction to a
; single band of about 110 kD. This difference may be related
to varied expression of hTP0 in different~cell types (human
and CH0). However, it was also reported that a 200 kD protein
was produced by~ subjecting the extracted human thyroid
microsomal 107 kD protein major band to PAGE under non-
reducing conditions (Hamada, N., et al., J. Clin. Endocrinol.
Metab. 61:120-128 ~1985)~. Also, the present finding of a
diminished 1l0 kD signJl after reduction of the reco~binant
.
W 0 93/03146 -8- PC~r/US9210628.-
hTP0 protsin is in accbrdance with other findings using the
native mierosomal antig2n (Gardas, A., et al., J. Endocrinol.
Invest. 11:385-388 (1988); Nakajima, Y., et al., Mol~ Cell.
Endocrinol. 53:15-23 (1987)). Thus, in its native state,
human ~P0 exists either as a multimer or in association with
another membrane protein of similar size. Epitope
recognition by autoantibodies may be conformation-dependent.
The derived amino acid sequence of hTP0 suggested to the
present inventor the presence in recombinant full-length hTP0
and ~hus~ in naturally-occurr~ng hTP0, of a signal peptide, as
well as a putative~ hydrophobic membrane-spanning region
(transmembrane domain) at the carboxyl terminus of the protein
:~: (amino acid residues 846-870) (Magnusson, R.P., et al., J.
Biol. Chem. 262:13885-13888 (1987); Magnusson, R.P., et al.,
Mol. Endocrino L 1:856-861 ~1987); Kimura, S., et al., Proc.
!b~ .ud~`u~L._9~ 84:5555-5~59 (1987); Libert, F., et al.,
Nucl. Acids Res. 15::6735 (1987)~. Naturally-occurring hTP0
has been shown to be~a thyroidal cell surface protein. Recom-
binant, enzymatically astive hTP0 :is also cell membrane-
~: 20 associated in stably transfected non-thyroidal eukaryot~c
cells (Kaufman, K.D., ~ , J. _Clin. Invest. 84:394-403
(1989~
While not intending to be bound by a particular theory,
~ : the present inventor:hypothesized that the signal peptide; 25 directs the human: TPO~through the cell membrane, but that the -
hydrophobic region :o~ hTPO beco~es embedded in the cell
; membrane, thereby~preventing secret~on~from the cell.
There has heretofore been no funct~onal proof that the
hTP0 hydrophobic region 846-870 corresponds ts a transmembrane
domain. The present invention demonstrates the existence of
a transmembrane domain:in hTP0, and that hTP0 is predom~nantly
an enzyme with an extracellular orientation. ~he insert~on~
by site-direeted mutagenesis, of a stop ~odon immediately
upstream of this putative transmembrane domain converts hTP0
' WO 93/03146 21 1 3 .J 8 a PCI`/US92/06283
g
into a secreted protein that is enzymatically active and
immunologically intact. By introducing the stop codon, the
hTP0 was truncated by 85 residues, removing the carboxyl
terminus (933 amino acids). Mutated hTP0 cDNA, inserted
S into a eukaryotic expression vector, was stably transfected
into CH0 cells. Immunoprecipitation and PAGE of cellular 35S-
-~ methionine-labeled proteins with Hashimoto's patient serum
~; ~ revealed a 105-101 kD doublet. In contrast, cells transfected
with wild-type hTPO~yielded a 112-105 kD doublet.
ln pulse-chase ;experiments, CH0 cells expressing the
truncated hTP0 protei~n ~secreted immunoprecipitable TP0 into
the culture medium~after 4 hours of chase, with levels
accumulating progressively~ over a 24 hour period. In
contrast, CH0 cells expressing wild-type hTP0 released no im-
munoprecipitable TP0 lnto~; the culture medium. The secreted,
truncated~ form of hTPO~;appeared as a single band of lesser
~ . ~
electrophoretic;mobil~ity,~ as opposed to the doublet expressed
within cells. ~TPO~enzymatic acti~vity was present in
conditioned medium~from~CHO cells transfected with the mutated
20~ hTP0, but was~;absent-~in conditioned~medium from cells
expressing wild-type hTP0. ~he stability of the mutated
m~ protein~appeared~simil~ar;to that of wild-type hTP0.
he secreted~form of~hTP0~ can be used to generate large
amounts of~soluble~TPO~protein for;~use in structural and
25 ~ ~ immunological studies, as~well as for diagnostic uses.
Thùs,~in one~embodiment, there is provided according to
tbe invention ~recombinant, enzymatically active, TP0, or a
functional or chemical~derivative thereof.
In another èmbodiment is provided hTP0 produced by non-
.
thyroidal eukaryotic cel;ls.
In another embod~ment there is provided according to the
`invention recombinant~ hTP0 that is enzymatically active,
immunologically intact and secretable, or a functional or
chemical derivative the~reof.
WO93/~ 8 ~ PCr/US92/0628..
Yet another embodiment of the invention comprises a
plasmid selected ~rom the group consisting of pECE-HTPO,
pHTPO(Ml ) -ECE-SV2-DHFR, pHTP0-DHFR-2B, pHTP0-DHFR-4C and
pHTP0-DHFR-4C -MTX .
S There is also provided according to the invention a non-
thyroidal eukaryotic cell transformed with any of these
plasmids, as well as methods of producing hTPO comprising
culturing the transformed cell under conditions allowing
expression of the hTPO and recovering the hTPO.
In yet another embodiment, the invention provides for an
antibody against the hTPO of the in~ention.
Further~ a method of detecting hTPO in a sample is
pro~ided acaording to the present invention, comprising
con~acting the sample with an antibody against full-length
recombinant hTP0 or an antibody against a secretable hTPO,
wherein the antibody is detectably labeled, so as to for~ a
complex between the hTP0 in the sample and the detectably
labeled antibody, and detecting the complexed or uncomplexed
: ~ ~ labeled antibo~y.
In~ an additional embodiment, there~ is proYided a k~t for
the detection of hTPO in~a sample, comprising:container means
comprising one or nlore c onltainQrs, wherein one of the
containers comprises detectably labeled antibody against hTPO.
Furt~her,~ a::method: of detecting ant~bodies to hTPO ~n a
~: 25 sample is providèd~ according to the present ~nvention,
comprising contacting the sample with full-length reco~binant
hTPO or secretable~ recombinant hTPO so as to form a complex
: ~ between an hTPO-specific~ antibody in the sample and the
recombinant hTPO, and detecting the complexed àntibody. ln an
additional embodiment, there is provided a kit for the
detection of antibodies to hTP0 in a sample, comprising
container means comprising one or more containers, wherein one
~: of said containers comprises recambinant hTPO.
: w o 93/03146 2 ~ 1 ~ 2 8 ~i `PCT~US9Z/~62~3
These and other non-limiting embodiments of the present
invention will be apparent ~o those of skill from the
following detailed description o~ the invention.
BRIEF DESCRIPTION OF THE D~A~IN6S
Fiqure 1. Construction of the expression plasmid pHTPO-
ECE. pHTPO-BS (upper right) was digested with Not I, the ends
bl~nted with the Klenow fragment of DNA polymerase I, and the
DNA subsequently digested with Xba I. The released Bluescript
vector was further digested with Sca I to obtain good
separation on agarose gel electrophoresis because of the
similar size of this vector (2.95 kb) and the HTPO cDNA
fragment (3.1 kb). The mammalian expression veetor pECE
1~ (Ellis, L., et al., Cell 45:721-732 (1986)) ~upper left) was
digest~d wi~h Eco RI, the ends blunted with the Klenow
fragment of DNA :polymerase I, and the DNA s~bsequently
: digested with Xba I. The diyested pHTPO-BS and pECE fragments
: were then ligated~using T4 DNA ligase (Maniatis, T., ~ 2 ,
Mole~ul~r_~ioloq~ A LaboratorY_Manual, Cold Spring Harbor
Laboratory, Cold Spring Harbor~ NY (1982)). The result~ng
plasmid, pHTPO-ECE (bottom~, was transfected into competent
XLl-B1ue cells (Strat~gene, San Diego, CA).
~iggrg _2. : Fluorescence-activated cell sorter (FACS~
analysis of ~HO ce1ls transfected with pHTP~-ECE. CHO-HTP512b
cells were processed as described herein.
Panel A: C~lls exposed to phycoerythrin (PE)-labeled
second antibody alone, ~without prior exposure to human seru~
Panel B: Cells incubated in serum ~1:1003 from a pat~ent
with Hashimoto's thyroiditis (ELISA value of 1.77g3 w~thout
subsequent incubation in PE-labeled s~cond antibody.
: Panel C: Cells sequentially incubated ~n the Hashimoto~s
serum described in panel B and in PE-labeled second antibody.
W O 93/03146 2 1 1 3 ~ 8 ~ -12- PC~/US92/Ob283.
Panel D: As in panel C, except that serum from a normal
individual, lacking antimicrosomal antibodies, was used.
Panels E and F: The same data as in panels C and D
plotted to show the forward scatter. These data indicate that
5the relative sizes of the cell populations reacting with the
normal and the Hashimoto's sera are the same.
Fiqure 3. Linear regression analysis of ELISAs using
antibodies against human thyroidal microsomes or against
recombinant human TP0.
10Fiq~e 4. Linear regression analysis of ELISAs using
antibodies against human thyroidal microsomes or against
recombinant hu~an TP0, 1/1000 dilution. "Cardiff" refers to
the source of the microsomal antigen of both Figures 3 and 4.
Fi~ure 5. Relative TPO activities observed in CHO cells
15transfected with pECE-HTP0, pHTP0-DHFR-2B and pHTP0-DHFR-4C,
shown plotted against methotrexate concentration.
Fiqure 6. Nucleotide sequence of human TP0 gene after
site-directed mutagenesis. The mutations incorporated two
stop codons, as well as an EcoRl site for confirmation, in the
20region immediately upstream from the transmembrane region of
the human TP0 ge~ne.
Fiqure 7. cDNA sequence and derived amino acid sequence
of human thyroid peroxidase (Magnusson, R.P., et a~., Mol.
~ndocrinol. l:BS6-861 (1987)).
25Fiaure 8. ~ Schematic diagram showing the expression
plasmid pHTPO(MI)-ECE-SVZ-DHFR.
Fiaure 9O Construction of the pl~smid pHTPO(Ml)-ECE-SV2-
DHFR.
Fiqure_10. Comparison of SI sera, selected to provide a
30spectrum of anti-MSA levels, in terms of their reactivity with
Graves' thyroid mi~rosomes and reco~binant, enzymatically-
active human TP0 generated in non-thyroidal eukaryotic cells.
The anti-MSA assay data are expressed as an ELISA index,
relative to a standard serum. Data f~r ~he anti-hTP0 antibody
WO 93/03146 2 i 1 3 ~ 8 ~ PCI /IJS92/06283
~ 13~
assay are expressed as ~absolute O.D. units, normalized to a
blank well value of 0.000. (A) serum dilution 1/100 (sera
from four normal patients are enclosed within the rectangle);
(B) serum dilution 1/1,000; (C) serum dilution 1/10,000.
Fiaure 11. Two sera (#11 and 27) reacting discrepantly
with human thyroid microsomes (A) and recombinant hTPO (B) are
reacting with an antigen other t~an hTPO in panel A at
standard ~1/100) serum dilution. Dilution curves are also
shown for two other sera ~#12 and 28) with similar anti-MSA
activity at standard se~um dilution.
Fiqure 12. Intra-assay variability of anti-hTPO antibody
: ELISA a~ standard (1/100) serum dilution. Mean _ standard
deviation of 10 iterations of anti~hTPO antibody ELISA results
for three autoimmune sera selected to represent low, medium,
and high autoantibody levels.
Fiqure 13. ~onfirmation, by nucleotide sequencing, of the
: mutations introduced into hTPO by site-directed mutagenesis.
The nucleotide positions referred to correspond to those
reported for human;TPO (Rousset, B., et ~l., Clin. EXP.
Immunol. ~:325-332 (1983)). TGA (2629-2631 bp) and TAG
; (2641-2643 bp) stop codons, as well as the EcoR1 site, in the
-~; mutated hTPO-M1 are shown on the right. The nucleotide
sequenee of wild-type hTPO is shown on the left.
Fi~ure 14. :tA) In~nunoprecipitation of mutated hTPO in
different clones o~ transfected :CHO cells. CHO - non-
:~ transfected CHO cells; CHO-TPO - HO cells transfected with
~: wild type hTPO; GHO-TPO-M1-POOLED :- pooled colonies of CHO
~: : cells transfected with the ~utated for~ of h~PO; CHO-TPO-M1-D
through K - ind~vidual colonies of CHO cells, transfected with
mutated hTPO, that were selected with cloning cylinders and
~: then expanded. Cells were radiolabeled with 35S-methionine
and immunoprecipitated with Hashi~oto's thyroiditis serum
containing high anti-hTPO antibody levels.
~. ~
W o 93/031462 1 1 3 2 8 ~ PCT/US92/0628
. -14-
(B) Immunoprecipitation of mutated hTPO from clones of
CHO-~PO-MI-K cells generated by limiting dilution.
Immunoprecipitations were performed with serum from a patient
with Hashimoto's thyroiditis with high anti-hTPO antibody
S levels. The specificity of the immunoprecipitation is shown
by the inability of serum from a normal individual (CON) to
precipitate the 105-101 kD doublet.
Fiqure 15. Biosynthesis and processing of TPO. lmmuno-
:: precipitation studies were performed with CHO cells expressing
wild-type hTPO ~upper panel ), and with CHO cells transfected
with the mutated form of hTPO ~lower panel). Pulse for 4 h ~0
hours of chase) with 35S-methionine was followed by chase with
unlabeled me~hionine for the indicated periods of time.
Immunoprecipitations were then performed on both eell lysates
and conditioned media, as indicateJ.
Fiqure_16. Human TPO enzymatic activity in the medium of
CHO cells after transfection with wild-type hTPO (cell line
CHO-TPO l2g) (Kotani, T., et al., J. Cl n_~docrinol._~Qta~.
62:928-933 (1986)) and CHO cells transfected with the mutated
form of hTPO (CHO-TPO-M1-Kl). Media were collected after 3
;: days nf culture. TPO enzymatic activity in the media was
measured by the guaiacol~assay. The time course shown refers
: to the accumulation of oxidized guaiacol substrate in the
assay, and not to the kinetics o~ enzyme secret~on into the
2~ medium.
Fiqure 17. (A) ~ T:cell clones from the thyroid ~nfiltrate
in Graves' disease, expanded in the absence of antigen~
recognize recombinant TPO. Clone + autologous irrad~ated PBL
- black bars; clone + PBL + control (untransfected) CHO
microsomes - striped bars; clone + PBL + CHO microsomes
~ransfected with TPO - grey bars. Results are expressed as
mean cpm of ~3H]thymidine incorporation from triplicate
cultures. Error bars indicate standard errors of the mean
WO 93/03146 2 i 13 ~ ~ ~ P~/US92/06283
-15-
~S.E.M). Similar results were obtained in three or msre
replicate experiments.
(B) Peripheral blood lymphocytes from both
patients and normal subjects proliferate in response to both
- control and TP0-transfected microsomes. PBL alone - black
bars; PBL + control microsomes - striped bars; PBL + TP0
transfected mierosomes - grey bars. Results are expressed as
mean cpm ~3H]thymidine incorporation of triplicate cultures
~Error bars indicate S.E.M.) 81 - patient from whom T cell
clones in Fig. 17A were derived; RG - another female with
Graves' disease; KH - normal control female. Similar results
have been obtained from other individuals in separate
expPriments.
Fi~ure 18. Determination of the epitope for the anti-
microsomal/TP0 monoclonal antibody 20.10. The nucleotide
sequences of the 5'- and 3'-ends were determined for 14 clones
selected from the hTP0 cDNA fragment library. These
boundaries are :annotated by the numbers assigned to the
nucleotides in hTP0 previously reported (Magnusson, R.P. 7 et
al~, Mol. Endo~r~nol. 1:856-861 (1987)). The smallest region
:~ of overl~p between all~ 14 clones is from 881-927 b.p. The
~irst two nucleotides in~:this span do not constitute a
complete codon, so the~epitope area can be defined as between
883-927 b.p., corresponding to the derived amino ac~d seq~ence
shown.
Fiqure 19. Deter~ination of the epitope recGgnized by
TP0 MAb 47. The nucleot~de sQquences of the 5'- and 3'-prime
. ends were determined for l8 clones in the TP0 cDNA fragment
library (see Materials and Methods) recognized by MAb 47. The
smallest region of overlap between all 18 clones is from 2Zl9-
2247 basep~irs in. the human ~P0 cDNA sequence~ coding for the
indic2ted ami no acids .
~: ~iqure 20. Western blot analysi s of human TPû, ~sing
TP0 MAb. Recombinant human TP0 expressed in Chinese hamster
WO 93/031~16 P~JUS92/0628 .~ .
2 1 ~ 3 2 ~ ~ 16--
ovary cells was used as antigen under denaturing and reducing
conditions (see Materials and Methods). After polyacrylamide
gel electrophoresis and transfer to the membranes, the
membranes were probed with the indicated antibodies. TPO MAb
1, Z, 9, 15, 18, 24, 30, 40, 47, 53, S9, 60 and 64 are mouse
MAbs generated against native undenatured human TPO ~Ruf, ~.,
et al., EndocrinQloqY 125:1211 8 (1989)). The c~ntrols ~Con~
are mouse MAbs raised against denatured human ~P~ (Portmann,
: L., et al., J. Clin. Invest. 81:1217-1224 (1988)) (A and B)
and control mouse ascitic ~luid (C). ~he sizes of the,mol wt
markers are shown on the left, and that of recombinant human
TP~ is indicated by the arrow.
DESCRIPTION OF THE PREFERRED EMBODIMENTS
In the following deseription, reference will be ~ade to
various methodologies known to those of skill in the art of
: molecular biology and immunology. Publications and other
aterials setting :forth such known methodologies to which
reference is ~ade are incorporated:~herein by reference in
their entireties as though~set forth in full.
Standard referen~e works setting forth the general
principles of recombinant DNA technology inelude ~atson, J.D.
et al., Molecular_Bio~loqy of the Gene, Volumes I and II, The
; ~25 BenjaminlCummings Publishing Company, Inc., publisher, Menlo
~: : Park, CA (1987)~ Darnell,~J.E. et al., Molecular Cell BiolQgy,
: :Scienti~ic American Books, Inc., publisher, New York, N.~.
~; ,(1986); Lewin,~B.M.~, Genes_II, John Wiley & Son, publishers,
New York, N.Y. (1985); Old, R.W., Q~ , PrinciDle~ of Ge~e
' 30 ManiPulation , An_Introduction to 6enetic Enqineerin~, 2d
edition, Univers.ity of ~California Press, publisher, Berkelay,
CA (1981); and Maniatis, T., et al., Molecular Glonin~: A
LaboratorY Manual, ~Cold Spring Harbor Laboratory, publisher,
Cold Spring Harbor, NY (1982).
WO 93/03t46 2 1 ~ 3 2 8 ~ PCI/US92/06283
- 17-
By "cloning" is meant the use of in vitrQ recombination
techniques to insert a particular gene or other DNA sequenee
into a vector molecule. In order to successfully clone a
desired gene, it is necessary to e~ploy methods for generating
S DNA fragments, for joining the fragments to vector molecules,
for introducing the composite DNA molecule into a host cell in
whieh it can replicate, and for selecting the clone having the
target gene from amongst the recipient host cells.
By "cDNA" is ~eant complementary or copy DNA produced
from an RNA template by the action of RNA-dependent DNA
polymerase (reYerse transcriptase~. Thus a "cDNA clone" means
a duplex DNA sequence complementary to an RNA molecule of
interest, carried in a cloning vector.
By "cDNA library" is meant a collection of recombinant
DNA molecules containing cDNA inserts which together comprise
the entire gel,ome of an organism. Such a cDNA library may be
prepared by methods known to those of skill, and descri bed ,
for example, in Maniatis ~ 1 , Molecular ClQninq: A
Laboratorv Manual, ~Yoer~- Generally, RNA is first isolated
from the cells of an organism from whose genome it is desired
to clone a particular gene. Preferred for the purposes of
the present in~ention are mammalian, and particularly human,
cell lines. A presently preferred veetor for this purpose is
the A-ZAP vector.
By "veetor~ is meant a DNA molecule, derived fro~ a
plasmid or bacterioph~ge, into which fragments of DNA may be
inserted or cloned. A vector will contain one or more unique
restriction sites, and may be capable of autonomous replica-
tion in a defined host or vehicle oryanism such that the
cloned sequence is reproducible. Thus, by ~DNA expression
vector" is meant any autonomous element capable of replieating
in a host independently of the host's chromosome, after
addi ti onal sequences of DNA have been incorporated into the
W o 93/03146 2 1 t 3 2 8 0 PCT/USg2/06283~ ~
-18-
autonomous element's genome. Such DNA expression vectors
include bacterial plasmids and phages.
By "substantially pure" is mean~ any antigen of the
present invention, or any gene encoding any such antigen,
which is essentially free o~ other antigens or genes,
respectively, or of other contaminants with which it might
normally be found in nature, and as such exists in a form not
found in nature. By ~functional derivative" is meant the
~fragments,n "variants,~ nanalogs,~ or ~chemical derivatives"
of a molecule. A "fragment" of a molecule, such as any of the
cDNA sequences of the ~present invention, is meant to refer to
any nucleotide subset of the molecule. A ~variant~ of such
~molecule is meant to refer to a naturally occurring molecule
substantially similar to either the entire moleoule, or a
fragment thereof. An "analog~ of a molecule is meant to refer
to a non-natural molecul~e substantially similar to either the
entire molecule or ?~ fragment thereof.
;: A molecule is said to be ~substantially similar~ to
: another molecule if the sequence of amino acids in both
~: 20 molecules is substantially the same. Substantially similar
amino acid molecules will possess a similar biological
: activity. Thus, provided~that two molecules possess a similar
activity,~ they~ are considered Yariants as that term is used
herein even if one:~of the:molecules:contains additional amino
: 25 ~ acid residues not found~in~the other, or if the s~quence of
amino acid~residues~ is~not identical. As used herein, a
: molecule is said to be:a ~chemical derivat~ve~ of another
mclecule when it contains additional chemical moieties not
nonnally a part of the molecule. Such ~oieties may improve
the molecule's solubility, absorption, biological half life,
etc. The moieties mày alternatively daerease the toxicity of
the molecule, ~liminate: or attenuate any undesirable side
: effect of the molecule, etc. Moieties sapable of mediating
: such effects are disclosed, for example, in Reminqtonis
"
; i WO93/03146 . 2 ~ ~ 3 f~ 8 0 PCI`/US92/06283
-19-
Pharmaceutical Sciences~, 16th ed., Mack Publishing Co.,
Easton, Penn. (1380).
Similarly, a Nfunctional derivative" of a gene of the
human TP0 antigen of the present invention is meant to include
~fragments~U "variants,~ or "analQgues" of the gene, which may
be "substantially similar" in nucleotide sequence, and which
encode a molecule possessing similar activity.
A DNA sequence encoding the human thyroid peroxidase of
:~ the present invention, or its functional derivatives, may be
recombined with vector ~NA in accordance with conventional
techniques, tncluding blunt-ended or staggered-ended termini
for ligation, restriction enzyme digestion to provide
: appropriate termini, : filling in of cohesive ends as
appropriate, alkaline phosphatase treatment to avoid
undesirable joining, and ligation with appropriate ligases.
Techniques for such manipulations ~re disclosed by Maniatis,
:; T., et al., suDra? and are well known in the art.
By "seoretion~ of recombinant hTP0 ~or the purposes of
the present invention, it is meant that the recombinant hTP0
20 ~ expressed by a host cell is directed: through and dissociated
: : from the host cell membrane.
~; : A nucleic acid~ molecule, ~such as DNA, is said to be
capable of expressing~ a po:~ypeptide if it contains
nucleotide sequences which contain transcriptional and
:
~25 translational regulatory information and such sequences are
~operably linked~ to n~cleotide sequences which encode the
polypeptide. An operable linkage~:is a linkage in which the
~regulatory DNA sequenoes and the DN~ sequence sought to b~
expressed are oonnected in such a way as to perm~t gene
expression. The precise nature of the regulatory regions
needed for gene ~xpression may vary from organis~ to organ~sm,
but shall in general include a promoter region which, in
prokaryotes, contains both the promoter (which directs the
initiation of RNA ~ranscription) as well as the DNA sequences
WO 93f03146 2 ~ ~ 3 2 ~ û PCI`/US92/062~:
-20-
which, when transcribed~into RNA, will signal the initiatian
of protein synthesis. Such regions will normally include
those 5'-non-coding sequences involved with initiation of
transcription and translation, such as the TATA box, capping
sequence, CMT sequence, and the like.
If desired, the non-coding region 3' to the gene sequence
coding for the protein may be obtained by the above-described
methods~ This region may be retained for its transcriptional
termination regulatory sequences, such as termination and
polyadenylation. Thus, ~ by retaining the 3'-region naturally
contiguous to the DNA sequence coding for the protein, the
transcriptional termination signals may be provided. Where
the transcriptional termination signals are not satisfactorily
functional in the expression host cell, then a 3' region
functional in the host cell:may be substituted.
Two DNA sequences:~(such as a promoter region sequence and
: a human thyroid peroxidase enco~ing sequence) are said to be
operably linked i~the nature of the linkage between the two
~: : DNA sequences does not (1):result in the introduction of a
frame-shi:ft mutation, ~(2) interfere with the ab1lity of the
promoter region sequence:to direct the transcription of the
: thyroid peroxidase :gene sequence, or: (3) interfere with the
ability ~cf the `thyroid~ ~peroxidase~ gene SequenGe to be
tran:scribed by :the promoter region sequence. A promoter
region~ wou:ld be operably~l:inked to a DNA sequenee if the
promoter were capablé: of effecting transcription of that DNA
sequence. Thus, to express the protein, transcriptio~al and
: translational signals~ reeognized by an appropriate host are
necessary.
: 30 The present invention encompasses the expression of the
human thyroid pe~oxidase protein ~or a functional d~rivative
thereof) in either prokaryotic or eukaryotic cells, although
:~ eukaryotiç ~and, particularly, non-thyroidal eukaryotic)
expression is preferred.
~~ WOg3/03146 2~ 80 P~l~/USg2/06~83
-21-
Preferred prokaryotic hosts include bacteria such as E.
coli. ~3~ , strePtomYces, Pseudomonas, Sal~onella9
Serratia, etc. The most preferred prokaryotic host is E.
coli. Other enterobacteria such as Salmonella tvDhimurium or
Serratia marcescens, and vario~s Pseudomonas species may also
be utilized. Under such conditions, the protein may not be
glycosylated. The procaryotic host must be compatible with
the replicon and control sequences in the expression plasmid.
To express the human:thyroid peroxidase protein (or a
functi~nal deriYatiYe thereof) in a prokaryotic cell (such as,
for example, E. coli, B. subtilis, Pseudomonas, StreDtomvces,
etc.), it is necessary to operably link the human TPO encoding
sequence to a func~ional prokaryotic promoter. Such promoters
may be either constitutive or, more preferably, regulatable
~i.e., inducible or derepressible~. Examples of eonstitutive
:~ promoters include the int promoter of bacteriophage ~, the bla
prcmoter of the ~-lactamase gene of p8R322, and the CAT
~ promot~r of the chloramphenicol acetyl transferase gene of
; ~: : pBR325, etc. Examples :of inducible prokaryotic promoters
include the ~ajor right and left promoters o~ bacteriophage
:: :
(PL and PR), the trD~ recA, lac~, lacI, and qal promoters of
E. coli, the e-amylase ~(Ulmanen, I., et al., J. Bacteriol.
~ 1~:176-1a2 (1985)3 and the o-28-specific promoters of 8.
: :: subtilis (6ilman~, M.Z., çt al., Gene 32:11-20 (1984)~, the
promoters of the bacteriophages of B3cillus (Gryczan, T.J.,
: In: The Molecular B~ol w v of the Bacilli, Academic Press,
Inc., NY (1982)), and~ E~g~yE~ promoters (Ward, J.M.7 et
: al., Moi. 6en. Genet. 203:468-478 (i986)). Prokaryotic
promoters are reviewed by Glick, B.R., (J. Ind. Micro~iol.
1:277-282 (1987)~; Cenatiempo, Y. (~iQÇh~ 68:505-516
~ ~ [1986)); and Gottesman, S.- (Ano. Rev. Genet. 18:415-q42
:~ (1984)).
Proper expression in a prokaryotic cell also requires the
presence of a ribosome binding site upstream of the gene-
W o 93/03l46 2 i ~ 3 2 8 ~ -22- PCT/US9~/062~'
encoding sequence. Such ribosome binding sites are disclosed,
for example, by Gold, L., et al. (Ann Rev. Microbiol. 35:365-
404 (1981)).
Most preferred hosts are eukaryotic hosts including
yeast, insects, fungi, and mammalian cells either in vivo, or
in tissue culture. Mammalian cells provide post-translational
modifications to protein molecules including correct folding
: or glycosylation at correct sites. ~ammalian cells which may
; be useful as hosts include cells of fibroblast origin such as
VER0 or CH0-Kl, or cells of lymphoid origin, such as the
: : hybridoma SP2/0-AG14 or the myeloma P3x63Sg8, and their
: derivatives. CH0 cells are presently preferred mammalian host
cells. COS cells also are convenient eukaryoti c hosts for
human thyroid peroxidase expression, as well as for study of
the regulation of human thyroid peroxidase expression.
For a mammalian cell host, many possible vector systems
~:: are available for the expression of human TPO. A wide variety
, .
of transcriptional and translational regulatory sequences may
;~ be employed, depending upon the nature of the host. The
~:~20 ~ transcriptional :and :translational regulatory signals may be
derived from viral sources, such as adenoYirus, bovine
papilloma virus, Simian~ virus, or the like, where the
regulatory signals~ are ~associated: with: a particul~r gene
which has a high~ l;evel of expression.~ Alternatively, pro
` 25 moters from mammalian~ expressîon products, such as ~ctin,
collagen, myosin,:: etc., may be employed. ~ranseriptional
nitiation regulatory~ signals may be selected which allow for
repression or activation~, so that expression of the genes ean
be modulated. :Of~interest are regulatory s~gnals which are
: 30 temperature-sensitive so that by varying the tcmperature,
expression can be représsed-or initiated, or are subject to
chemical regulation, e.g., metabolite.
Yeast provides substantial advantages in that it can also
carry out post-translational peptide modifications including
1 ~, w O 93/0314$ 211 3 ~ 8 ~ PCT/US92/06283
-23-
glycosylation. A number o~ recombinant DNA s~rategies exist
which utilize strong promoter sequences and high copy number
of plasmids which can be utilized for prcduction of the
desired proteins in yeast. Yeast recognizes leader sequences
S on cloned mammalian gene products and secretes peptides
bearing leader sequences (i.e., pre-peptides).
Further, by use of, for example, the yeast ubiquitin
hydrolase system, in vivo synthesis of ubiquitin-human TP0
fusion proteins may be accomplished. The fusion proteins so
produced may be processed in vivo or purified and processed ~n
vitro, allowing synthesis of the human TP0 protein with a
specified amino terminus sequence. Moreover, problems
associated with retention of initiation codon-derived
methionine residues in direct yeast (or bacterial) expression
~ay be avoided. Sabin et al., Bio/Technol~ 705-709
(1989); Miller ~_a~ , Bio/Teehnol. 7[7): 698-704 (1989).
Any of a series of yeast gene expression systems
incorporating promo~er and termination elements from the
actively expressed genes coding for glycolytic enzymes
2~ produced in large quantities when yeast are grown in ~ediu~s
rich in glucose can be utilized. Known glycolytic genes can
also provide very effi~ient transcriptional control signals.
For example, the promoter and terminator s~gnals of the
phosphoglycerate kinase gene can be utilized.
Production of human TP0 or functional derivatives thereof
in insects can be achieved, for example, by infect1ng the
insec~ host with a bacu10virus engineered to express human TP0
by methods known to those of skill. Thus, in one embodiment,
sequences encoding human TP0 ~ay be operab~y linked to the
regulatory regions of the viral polyhedrin protein (Jasny,
Science ~ 1653 (1987)). Infected with the recombinant
baculovirus, cultured insect cells, or the live insects
themselves, can produce the human TP0 protein in amounts as
great as 20 to 50% of total protein production . When l ive
WO 93~03146 ~ h ~ ~ PCfIUS92/0628
-24-
insects are to be used, caterpillars are presently preferred
hosts for large scale human TP0 production according to the
invention .
As discussed above, expression of the human thyroid
S peroxidase protein in eukaryotic hosts requires the use of
eukaryotic regulatory regions. SUCh regions will, in general,
include a promoter region sufficient to direct the initiation
of RNA synthesis. Pref~rred eukaryotic promoters include the
promoter of the mouse metallothionein I gene (Ham~r, D., et
al., J Mol APD1. Gen. 1:273-288 (1982)); the ~K promoter of
Herpes virus (McKnight, S., Cell 31:355-365 (1982)); the SV40
early promoter (Beno~ist, C., et al., Nature (Londonl 290:304-
310 (1981)); the yeast qal4 gene promoter ~Johnston, 5cA., et
al., Proc. Natl. Acad. Sci ~USA) 79:6971-6975 (1982); Silver,
P.A., et al., Proc Natl. Aca . Sci. (USA) 81:5951-5955
~1984)). Of these, presently the most preferred is the SV40
promoter.
As is widely known, translation of eukaryotic mRNA is
initiated at the codon which encodes the first methionine.
For this reason, it is preferable to ensure that the linkage
between a eukaryotic promoter and a DNA sequence which encodes
the human TP0 protein (or a functional derivative thereof)
does not contain any intervening codons which are capable of
encoding a methionine (i~.e., AUG). The presence of such
codons results either in a formation of a fusion protein (if
the AUG codon is in the same ~reading frame as hu~an ~P0
encoding DNA sequence) or a frame-shift mutation (if the AUG
codon is not in the same reading frame as the human TP0
encoding sequence).
The human TP0 encoding sequence and an operably linked
promoter may be introduced ~nto a recipient prokaryotic or
euka~yotic cell either as a non-replicating DNA (or RNA3
molecule, which may either be a linear molecule or, more
preferably, a closed covalent ciroular molecule. Since such
, WO93/03146 2 ~ ~ 3 2 ~ ~ PCI`/US92/06283
~5
molecules are incapable of autonomous replication3 the
expression of the human TP0 protein may occur through the
transient expression of the introduced sequence. Alter-
natively, permanent expression may occur through the integra-
tion of the introduced sequence into the host chromosome.
In one embodiment, a veotor is employed which is capable
of integrating the desired gene sequences into the host cell
chromosome. Cells which have stably integrated the introdueed
DNA into their chromosomes can be selected by also introducing
one or more markers which allow for selection of host cells
which contain the expression vector. The marker may provide
for prototrophy to an auxotropic host, biocide resistance,
e.g., antibiotics, or heavy metals, such as copper or the
like. The selectable marker gene c~n either be directly
linked to the DNA gene sequences to be expressed, or
: introduced into the same cell by co-transfection. Additional
: elements ~ay also be needed for optimal synthesis of single
~ chain binding protein mRNA. These elements may include splice
:: ~ signals, as well as transcrip~ion promoters, enhancers, and
termination signals.: cDNA expression veetors incorporating
such ele~ents include those described by Okayama9 H., Mol.
Cel. Biol. 3:280 (1983).~
In a preferred~embodiment, the introduced sequence will
: be incorporated into a:~plasmid or viral vector capable of
autonomous replication in the recipient host. Any of a wide
:~ variety of vectors may be employed ~or this purpose. Factorsof 1mportance in ~selecting a particular plasmld or viral
Yector include:~ the ;ease with which recipient c~lls that
cont~in the ~ector may be recognized and selected from those
recipient cells which do not contain the vector; the number
of copies of the vectcr whieh are desired in a particular
host; and whether it is desirable to be 2ble to ~shuttle" the
: vector between host cells of different species. Preferred
prokaryotic vectors include plasmids such as those capable of
WO 93/03146 2 ~ 1 3 2 ~ ~ PCl/US92/0628 `~ ~
-26-
replication in E. coli `(such as, for example, pBR322, ColE1,
pSC101, pACYC 184, ~VX. . Such plasmids are, for example,
disclosed by Maniatis, T., et a L (In: Molecular Olonina. A
Laborator~__ anual, Cold Spring Harbor Press, Cold Spring
H~rbor, NY (1982)~. Bac llus plasmids include pC194, pC221,
pT127, etc. Such plasmids are disclosed by Gryczan, T. (In:
The_ M~o~cylar BioloqY of the Bacilli, Academic Press, NY
(1982), pp. 307-329). Suitable Stre~tomvces plasmids include
pIJ101 (Kendall, K~J., et al., J. Bacteriol. 169:4177 4183
~1987)), and streptomyces bacteriophages such as ~C31 (Chater,
K.F., et al., In: Sixth International SvmDosium on
tinomycet31es BioloqY, Akademiai Kaido, Budapest, Hungary
(1986), pp. 45-54).. Pseudomonas plasmids are reviewed by
John, J.F., et al. (Rev._Infect._Dis. 8:693-704 (1986)), ~nd
Izaki~ K. (~Dn. J. Bacteriol. 33:729-742 (1978)).
Preferred eukaryotic plasmids include BPV, vaccinia,
SV40, 2-micron circle, `etc., or their derivatives. Such
~:: plasmids are well known in the art (Botstein, D., et al.,
Miami Wntr. SvmP. 19:265-274 (1982); Broach, J.R., ln: The
:M~lecular Bioloqv of the Yeast_Sa~çharomYces: L1fe_CYcle and
InheritaQce, Cold Spring Harbor Laboratory, Cold Spring
: Harbor, NY, p. 445-470 (1981); Broach7 ~.R., Cell 28:203-204
(1982); Bollon, D.P., et al., ~. Clin. He~t~ Q1col. 10:39-
~`~ 48 (1980); Maniatis, ~., In: ~ell Bi~o10qy~_ lL_ omQrqhensiYe
~reatiSe~ Vol._3~ Gene_Expression~ Ac~demic Press, NY, pp.
: 563-608 ~1980))~.
: Once the vector or ~NA sequence cont~ining the con-
struct~s) has been prepared for expression, the vector or DNA
construct~s) may be ~ntroduced into an appropri~te host cell
by any of a variety of suitable means, including such
::; biochemical means as transformation, transfection,
conjugation, protoplast fusion, calcium phosphate-
precipitation, and application with polycations such as
diethylaminoethyl (DEA~) dextran, and such mechanical means as
` WO 93/03146 21 ~ 3 2 ~ ~ PCr/US92/06283
-27-
electroporation, direct; microinjection~ and microprojectile
(biolistic) bombardment (Johnston et al., Science 240(48581: :
1538 (}988)), etc.
After the introduction of the vector, recipient cells are
grown in a selective medium. which selects for the growth of
veetor-containing eells. Expression of the cloned gene
sequence(s) results in the produoticn of the human TPO
protein, or in the production of a fragment of this protein.
This can take place in the transformed cells as such, or
following the induction of these cells to differentiate.
The expressed protein may be isolated and purified in
accordance with conventional conditions, such as extraction,
precipitation, chr~omatography, affinity chromatography,
el ectrophores i s, or the 1 i ke . For exampl e, the cel 1 s may be
collected by centrifugation, vr with suitable buffers, lysed,
and the protein isolated by column chromatography, for
:~; example, on DEAE-cellulose, phosphocellulose, polyribocyti-
~ dylic acid-agarose, :hydroxyapatite or by- electrophoresis or
:; immunoprecipitation. Alternatively, the human TPO or
~unctional derivative thereof may be isolated by the use of
anti-human TPO antibodies. ~Such antibodies m~y be obtained by
well-known ~ethods~ some:of which as mentioned hereinafter.
ANJIBODIES S~CIFiC~FOR~:;hTPO
~5 The term "ant:ibody"~ ~Ab) or ~monoclonal antibodyU (nAb)
: as used herein is meant to:incl:ude intact molecules as well as
: : fragments thereo~ ~(such~ as, for example, Fab and F(ab' )2
: fragments) which are capable of binding an antigen. Fab and
F(ab')2 fragments lack the Fc fragment of intact antibody,
clear more rapidly from the circulation, and ~ay have le~s
non-specifie tissue~binding of an intact antibody (Wahl et
al., J. Nucl. Med. 2 :316-325 ~1983)).
Antibodies according to the present invention may be
prepared by any of a variety of methods. For example, cells
,.
W O 93/03146 21~ 3 ~ 8 i~ PCTtUS92/06283
-28-
expressing the human TP0 protein, or a functional derivative
thereof, can be administered to an animal in order to induce
the production of sera containing polyclonal antibodies that
are capable of binding human TP0.
~n a preferred method, antibodies according to the
present invention are mAbs. Such mAbs can be prepared using
hybridoma technology (Kohler et al., Nature 256:495 (1975);
Kohler et al., Eur.:J. Immunol. 6:511 (1976); Kohler ~_3~,
Eur. J. Immuno1. 6:~292 (1976); Hammerling et_ al., In:
Monoclonal Antibodies and T-Cell Hvbridomas, Elsevier, N.Y.,
pp. 563-681 ~1981)~ In general, such procedures involve
imm~nizing an animal~ with human TP0 antigen. The splenocytes
of such animals are extracted and fused with a suitable
: myeloma cell line. Any suitable myeloma cell line may be
: 15 employed in accordance :with the present invention. After
fusion, the resulting hybridoma cells are selectively
maintained in HAT medium, and then cloned by limiting dilution
as described by Wands,;J.R., et al. (Gastroenterolp~v 80:225-
232 (1981). The hybridoma cells obtained through such a
~: 20 selection are then assayed to identify clones which secrete
antibodies capable~of binding the human TP0 antigen.
Antibodies~acording to the present invention also may be
polyclonal, or, preferably, region ~ specific polyclonal
antibodies. Region~speci:fic polyc~onal antibodies and methods
of ;using them are~ described in co~pend~ng U.S. applicat~on
~: ; Serial Number 06/73l,470,::filed 07 May 1985, the specification~ of which is incorporated~ herein:by reference as though set
: ; forth in full. ~ : :
Antibodies against human TP0 according to the present
invention are well suited for use in standard immunodiagnosSic
~: assays known in the artt including such im~unometric or
~sandwich~ assays as the forward sandwich, reverse sandwich,
and simultaneous sandwich assays. The antibodies may be used
in any number of combinations as may be determîned by those of
''~''~W093/~3146 2~13~a P~r/us92/~6283
-29 -
skill without undue experimentation ~o effect immunoassays of
acceptable specificity, sensitivity, and accuracy for the
human TP0 antigen or equivalents thereof.
Standard reference works setting forth general prineiples
S of ~mmunology include Roitt, I., Essential Immunolo~, Six~h
d., Blackwell Scientific Publ kations, Publisher, Oxford
(1988); Kimball, J. W., Introduction to Immunoloqy, Second
Ed.1 Macmillan Publishing Co., Publisher, New York (1986~;
Roitt, I., et al., ImmunoloqY, Gower Medical Publishing Ltd.,
Publisher, London, (1985~; Campbell, A., ~Monoclonal Antibody
Technology," in, Burdon, R., et al., eds., Laboratory
Techniques in BiochemistrY and Molecular BioloqY, Volume 13,
Elsevier, Publisher, Amsterdam (1984); Klein, J., Immunol wY:
The Science of Self-Nonself Discrimination, John ~il ey & Sons,
Pu~lisher, New York (1982), and Kennett, R., et al., eds.,
: Monoclonal Qntibodies~ Hvbridoma: A New Dimension in
Biological AnalYses, Plenum~Presst Publisher, New York ~1980).
~: : By ~detecting~ it is intended to include determining the
prcsence or absence of a subst~nce or quantifying the amount
of a substance. ~he term thus refers to the use of the
materials, compositions, and methods of the present invention
for qualitative and quantitative determinations.
~; The isolation of other hybrido-as secret~ng mAbs of the
same specificity as those described herein~can be accomplished
25 : by the technique of anti-idiotypic screen1ng. Potocmjak, et
~: al., Science ~ 1637 ~(1982). Briefly, an anti-idiotypic
~: (anti-Id) antibody is an antibody which recognizes unique
determinants generally ~associated with the antigen-binding
site of an antibody. An Id antibody can be prepared by
immunizing an anim~l of the same species and genetic type
(e.g. mouse strain) as the source of the mAb with the mAb to
which an anti-Id is being prepared. The immunized animal will
recognize and respond to the idiotypic determinants of the
2 il~2~ ~
wo 93/03146 Pcr/uss2/0628..
-30-
immunizing antibody by producing an antibody to these
idiotypic determinants ~the anti-Id antibody).
By using an anti-Id antibody which is specific for
iditoypic determinants on a given mAb, it is then possible to
identify other B cell or hybridoma clones sharing that
idiotype. Idiotypic identity between the antibody product of
two clones makes it highly probable that the antibody products
of the two clones recognize the same antigenic epitopes.
The anti-Id antibody may also be used as an "immunogen~
to induce an i~mune.response in yet another ani~al, producing
a so-called ~nti-an~i-Id antibody~ The anti~anti-Id may be
epitopically identical to the original mAb which induced the
anti-Id.
Thus, by using antibodies to the idiotypic determinants
of a mAb, it is possible to identify other clones expressing
antibodies of identical specificity~
Accordingly, mAbs generated against the hTP0 antigen may
: be used to induce anti-Id antibodies in suitable animals, such
: as BALB/c mice. Spleen cells from such immunized mice ~re
used to produce anti-Id hybridomas secreting anti-Id mAbs.
Futher) the anti-Id mAbs can be ~oupled to a carrier such as
keyhole limpet hemocyanin (KLH) and used to immunize
: additional BALB/c m~ce. Sera from these mic~ w~ll contain
anti-anti-ld antibodies that have the binding properties o~
the original mAb specific for the hPT0 epitope. ~he anti--Id ~-
:~ ~Rbs thus have their~ own idiotypic ep~topes, or nidiot0pes~
structurally similar ts the epitope being evaluat.ed, such ~s
hTP0.
For replication, the hybridoma cells of this in~ention
.
may be cult~vated iDLY~ or in vivo. Production of h~gh
titers of mAbs in vivo production makes this the pres~ntly
pre~erred method of production. Briefly, cells from the
: individual hybridomas are injected intraperitoneally ~nto
pri stane-pri~ed BALBjc mice to produce ascites fluid
: ~ wog3/03l46 2i13~8~ PCI/US92/06283
-31 -
containing high concentrations o~ the desired mAbs~ MAbs of
isotype IgM or IgG may be purified from such ascites fluids,
or from culture supernatants, using column chromatography
methods well known to those of skill in the art.
Antibodies according to the present invention are
particularly sui~ed for use in immunoassays wherein they may
be utilized in liquid phase or bound to a solid phase carrier.
In addition, the antibodies in these immunoassays can be
detectably labeled in various ways.
There are many different labels and methods of labeling
known in the art. Examples of the types of labels which can
be used in the present invention include, but are not limited
to, enzymes, radioisotopes, fluorescent compounds, chemilumi-
nescent compounds, bioluminescent compounds and metal
chelates. Those of ordinary skill in the art will know of
;~ other suitable labels for binding to antibodies~ or will be
a~le to ascertain the same by the use of routine
`experimenta~ion. Furthermore, the binding of these labels to
antibodies can be accomplished us~ing standard techniques
~ commonly known to those of ordinary skill in the art.
,
One of the ways~ in whieh antibodies according to the
present invention can~be~detectably labeled is by linking the
` antibody to an enzyme. This enz~yme, in turn, when l~ter
exposed to its substrate, will react with the substrate in
25~ such a manner as to produce a chemical moiety wh kh can be
detected as, for exa ple, by spectrophotometric or fluoro-
metric means. Examples of enzymes ~which can be used to
;~ detectably label ant1bodies include malate dehydrogenase,
staphylococcal nuclease, delta-V-steroid isomerase, yeast
alcohol dehydrogenase, alpha-glycerophosphate dehydrogenase,
~; triose phosphate isomerase, biotin-avidin peroxidase,
horseradish peroxidase, alkaline phosphatase, asparaginase,
glucose oxidase, beta-galactosidase, ribonuclease, urease~
21 ~ 3~3
WO 93/03146 PCI`/US92/0628;~.
-32 -
catalase, glucose-VI-phosphate dehydrogenase, glucoamylase and
acetylcholihe esterase.
The presence of detectably labeled antibodies also can be
detected by labeling the antibodies with a radioactive isotope
whkh then can be determined by such means as the use of a
gamma counter or a scintillation counter. Isotopes which are
particularly useful for the purpose of the present invention
are 3H 125I, 32p, 35S, 14C, 51Cr, 36Cl, 57Co, 58Co, 59Fe and
75~e.
It is also possible to detect the binding of detectably
labeled antibodies by labeling the antibodies with
fluoreseent compound. When a fluorescently labeled antibody
is exposed to light of the proper wave length, its presence
then can be detected due to the fluorescence of the dye.
Among the most commsnly used fluorescent labeling compounds
are fluorosce~n, isothioyanate, rhodamine, phycoerythrin,
phycocyanin, ~ allophycocyanin, o-phthaldehyde and
fluorescamine.
: The antibodies of the i~vention also can be detectably
labeled ~sing ~luorescent emitting metals such as 152EU~ or
others of the lanthanide se~ies. These ~etals can be attached
:
:~ to the antibo~y molecule~using such metal chelating groups as
: diethylenetr~aminepentaacetic acid (DTPA) or ethylenediamine-
tetraacetic ~cid (EDTA).
Antibodies also ~can be detectably labeled by coupling
them to a chemiluminescent compound. The presence of the
chemi~uminescent-tagged antibody is then deter~ined by
detecting the presence of luminescence that arises during the
course of the che~ical reaction. Examples of part~cularly
useful chemiluminescent labeling compounds are luminal,
isoluminsl, theromatic acridinium ester, imidazole,
acridinium salts, oxalate ester , and dioxetane.
Likewise, a bioluminescent compound may be used to label
the antibodies according to the present invention. Biolumi-
2i~3,~
Wo 93/03146 PCr/US92/06283
-33 -
nescence is a type of chemiluminescence found in biological
systems in which a catalytic protein increases the efficiency
of the chemiluminescent reaction. ~he presence of a biolumi-
nescent antibody is determined by detecting the presence of
luminescence. Important bioluminescent compounds for purposes
of labeling include luciferin, luciferase and aequorin.
The antibodies and substantially purified antigen of the
present invention are ideally suited for the preparation of a
kit. Such a kit may comprise a carrier means being
compartmentalized to receive in close confinement therewith
one or more container means such as vials, tubes and the like,
each of said container means comprising ~he separate elements
of the assay to be used.
The types of assays which can be incorporated in kit form
are many, and includet for example, competitive and non-
; com~etitive assays. Typical examples of assays which can
utilize the antibodies of the invention are radioimmunoassays
(RIA), enzyme immunoassays tEIA), enzyme-linked immunosorbent
assays (ELISA), and immunometric, or sandwieh, ~mmunoassays.
~ By the term ~immunometric assay~ or ~sandwich i~muno-
assay,~ it is meant~to include simultaneous sandwich, forward
sandwich and reverse sandwich i~m~no?ssays. These terms are
well ~nderstood by those skil~ed in the art. Those of skill
will also appreciate that antibodies acc~rding to the present
invention will be useful in other variations and forms of
assays which are presently known or which may be developed in
the future. These are intended to be included within the
~scope of the present invention.
Forward sandwich assays are described, for example, in
United States Patents 3,8679517; 4,012,294 and 4,376,110.
; Reverse sandwich assays have been described, for example, in
United States Patents 4,093,876 and 4,376,110.
In the preferred mode for preforming the assays ~t is
important that certain ~blockers~ be presen~ in the incubation
2 1 i ~ 2 8 ~ PCT/US92/0628~
medium (usually added with the labeled soluble antibody). The
"blockers" are added to assure that non-specific proteins,
protease, or human antibodies to mouse immunoglobulins present
in the experimental sample do not cross-link or destroy the
antibodies on the solid phase support, or the radiolabeled
indicator antibody, to yield false positive or false negative
results. The selection of "blockers~ therefore adds
substantially to the specificity of the assays described in
the present invention.
It has b~en found that a number of nonrelevant (i.e. non-
specific3 antibodies of the same class or subclass (isotype)
as those used in the assays ~e.g. IgG1, ~gG2a, IgM, etc.) can
be used as "blockers."~ The concentration of the ~blockers"
(normally 1-100 ~9/~1 ) is important, in order to maintain the
.
:15 proper sensitivity yet inhibit any unwanted interference by
mutually occurring cross reactive proteins in human seru~.
In addition, the buffer system containing the ~blockers~ needs
to be optin~i zed . Pre~erred buffers are those based on weak
organic acids, such as imidazole, HEPPS, MOPS, TES, ADA, ACES,
, ~
HEPES, PIPES, TRIS, and the like, at physiological pH ranges.
Somewhat less preferred buffers are inorganic bu~fers such as
: phosphate, borate or carbonate. Finally, known protease
inhibitors should:be~added (normally at 0.01-10 ~g/ml) to the
buffer which contains the~nblockers.~
There are many solid phase i~nunoadsorbents which have
been employed and~which can be used in the present invention.
:~ Well knewn immunoadsorbents include glass, polystyrene,
polypropylene, dextran, nylon and other materials, in the form
of tubes, beads, and microtiter plates formed from or coated
with such materialsf and the 1 i ke . The immobi 1 i zed anti bodi es
can be either covalently o~ physically bound to the solid
phase immunoadsorbent, by techniques such as covalent bonding
: via an amide or ester linkage, or by adsorption. Those
skilled in the art w;ll know many other suitable solid phase
;: , w o 93/03146 2 1 1 3 2 ~ ~ PCT/USg2/06283
-35-
immunoadsorbents and methods for immobilizing antibodies
thereon, or will be able to ascert~in such, using no more than
routine experi~entation.
For in ViYO~ in vitro or in situ diagnosis, labels such
S as radionuotides may be bound to antibodies according to the
present invention either directly or by using an intermediary
functional group. An intermediary group which is often used
to bind radioisotopes which exist as metallic cations to anti-
bodies is diethylenetriaminepentaacetic acid (DTPA). Typical
examples of metallic cations which are bound in this manner
are 99mTc 123~ N, l31I, 97Ru, 67CU, 67Ga and 68GaO
The antibodies of the:invention can also be labeled with non-
: ~ : radioactive isotopes for purposes of diagnosis. Elements
whioh are particularly useful in ~his manner are 157Gd, 55Mn,
162Dy~ 52Cr and 56Fe.
: : ~he hTP0-encoding DNA sequence of the present invention,~:~ or a fragment thereof,: may be used as a DNA probe to isolateor detect complementary DNA sequences according to well-known
: hybridization methods. ~he human antigen genes may then be
~cloned and:expres~sed in a host to give the human antigen.
This human antigen ~ay then be used tn diagnostic assays for
the corresponding autoantibody.
~: : The :antigen of~ ~the invention may be isolated in
substantial~y pure :form employing antibodies according to the
present invention.~ :Thus, an embodiment of the present
invention provides~for:substantially pure hTP0, characterized
in that it is recognized by and binds to the ~n~i-hTP0
antibodies of the present invention. In another embodiment,
the present invention provides a ~ethod of isolatlng or
purifying hTP0 by forming a complex with one or more
antibodies directed against hTP0.
The substantially pure hTP0 of the present invention may
in turn be used to detect or measure antibody to hTPQ in a
sample, such as serum or urine. Thus, one embodiment of the
WO 93/V3146 2 ~ 1 ~ 2 8 ~ PCI`/US92/06283 .
-36-
present invention comprises a method of detecting the presence
or amount of antibody to hTPO in a sample, comprising
contac~ing the sample containing the antibody to hTPO with
detectably labeled hTPO, and detecting the label.
It will be appreciated that immunoreactive fractions and
immunoreactive analogs of hTPO also may be used. By the term
Himmunoreactive fraction" is intended any portion of the hTPO
antigen which demonstrates an equivalent recognition by, or
binding to, an antibody directed against hTPO. By the term
: 10 "immunoreactive analog" is intended a prutein which differs
from hTPO by one or more amino acids, but which demonstrates
: an equivalent recognition by, or binding to, an anti-hTPO
antibody.
T CELLS SPECIFIC FOR TPO
: Autoimmune diseases are thought to result at least in
part due tc persistent activation of T cells by self antigens
: (3aneway, C., ~y~ 341 482 (1989))o In the case of
autoimmune thyroidi~is, as in Hashimoto's thyroidits, such a
a self antigen can be any~epitope of TPO which is rec~gnized by
a:receptor on a T cell capable of helping a B cell make an
: : anti-TPO antibody, or a T cell invol~ed in the autoimmune
process by any other known mechanism ~see below).
One approach to the ~reatment of autoimmune thyroid
: :25 diseases as contemplated by the present inventor focuses on
disrupting the action of T lymphocytes involved in the disease
process. T cells are readily available from the thyroid, for
: example in Graves' dlsease in the form of infiltrates
extracted from thyroidectomy specimens. By studying such
infiltrates, it is possible to examine the ant19enic
specificities of T cells selected in vivo for their pathogenic
rel evance .
For example, the infiltrating T cells (as well as T cells
present in the circulation and in lymphoid organs such as
WO 93/03146 2 ~ ~ 3 2 8 O pcr/lJs92~o6283
-37 -
lymph nodes and spleen) can act as T helper (Th) cells,
responding to TPO epitopes, and helping 8 cells make specific
anti-TPO antibodies. Alternatively, or additionally, such T
cells can mediate a cell-mediated immune response and act on
S thyroid epithelial cells either directly or via the local
release of cytokines. This may lead to destruction of thyroid
: epithelial cells, when cytotoxic ~ cells specific for TPO are
: activated, or via an inflammatcry response mediated by a
different T cell class.
Disruption of the activation or action of such T eells
would serve to inhibit the production of anti-TPO antibodies,
on the one hand, or:of thyroid epithelium-damaging T cells on
the other.
One embodiment therefore provides peptides capable of
binding to the T cell receptor (TCR~ of a TPO-specific T cell.
Such TPO-related peptides include at least a portion of a ~
cell epitope of TPO Isuch as the NP-7 epitope of Example
~: XII). Useful peptides include a sequence of about 5 or more
amino acids of TPO,:or derivatives of sueh peptides, which are
capable of bind~ng:` to~the TCR of a TPO-specific T cell.
Acting as a competitive antagonist for the native
autoantigen, such a: peptide can inhibit: antigen presentation
to T cells, :or other:antigen-spec:ific cell-cell (e.g., T-~ or
T-B) interactions in ~the immune system which are needed for
:~: 25 generat~on of either anti-:TPO antibodies or TPO-specifie cell-
mediated~immunity:. (For~ discussion of such peptide-based
; : approaches to immunotherapy of autoimmune disease, see, for
example: Acha-Orbea, H., et al. (Ann. Rev. Immunol. 7:371-405
(1989); Kumar, V., et al., Ann. _Rev. Immuno~. Z:657-682
(19893; Urban, J.L. et al., Cell 54:577-592 ~19~9); ~raith,
D.C., et al. (Cell 57:709-715 (1989); Wraith, D~C., et a L,
~:: Cell 59:247-255 (1989); Urban, J.L., e~ alO, Cell 59:257-271
(1989); and Janeway, C.A., Nature 341:482-483 (~989), all of
which references are hereby incorporated by reference).
2~1328~
WO 93/03146 Pcr/us92/o6283
-38-
Another embodiment of the invention provides for a
pharmaceutical preparation comprising the above peptides. In
yet another embodi~ent ~f the invention, a method of treating
autolmmune disease, including but not limited to Hashimoto's
thyroiditis, is provided which comprises administering to a
patient suf~ering from such disease a pharmaceutical prepara-
tion comprising a TP0-related peptide.
An alternate peptide-based therapeutic strategy
contemplated within the scope of the present invention is
directed to vaccines comprising TP0-specific T cells (~ohen,
I.R., Immunol Rev. 94:5-21 (1986); Proq. Immunol. VI:491-499
(1986); Scientific Amer. 258:52-60 (1988); Hosp. Prac. pp.
57-64 (February 15, 1989); Cohen, I.R., et al., Immunol.
TodaY 2:332-335 (1988)) and peptides mimicking the TCR of such
TP0-specific T cells (Vandenbark, A.A. et aL, Nature
541-544 (1989); Howell, M.D. et al., Science ~ 668-671
(1989)). Such preparations are administered to an indiYidual
to prevent or suppress an autoimmune response to TP0 by
inducing a state of "counter-autoimmunity.~ Such counter-
autoimmunity is thought to be mediated by T cells which sre
specific to the~TCR of the autoimmune (i.e., TP0-specific) T
cell (Cohen, suDra, Vandenbark t al., supraS and Sun, D. et
a L, Nature 332 843-845 (19881; EuroD. ~ munol. 18:1993-
1999 (1988))-
The invention is therefore directed to T cells specific
for TP0 capable of acting as a ~vaccine~ and inducing a state
~ of counter-autoi ~unity. Another embodiment includes ~CR-
;~ mimicking peptides of such T cells. Yet another embodiment is
directed to the T çells induced by such TP0-specific T cell
and TCR peptide Yaccines which mediate the counter-autoimmune
effec~s or down-regulate TP0-specific T cells. Another
embodiment of the invention provides for a pharmaceutical
preparation comprising such a T cell vaccine, TCR peptide, or
counter-au~oimmune T ce~l. In yet another embodiment of the
2 il~`280
3 WO 93/03146 P~/US92/06283
-39-
current invention, a method of treating autoimmune disease,
such as Hashimoto's thyroiditis, is provided which includes
the use of a pharmaceutical preparation eomprising either a
TP0 specific T cell vaccine9 a TCR peptide vaccine, or a
counter-autoimmune T cell specific for TP0-specific ~ cells.
An additional embodiment of the present invention is
dire~ted to a T suppressor (Ts) lymphocyte capable of
interacting specifically with an anti-TP0 B cell or T cell,
leading to suppression of an anti-TP0 immune response. Such
suppression could be of TP0-specific antibody production or of
TPO-specific T cell-mediated thyroid damage such as that
mediated by cyto~oxic ~ cells or in a TP0-specific delayed
hypersensitivity response. ~hus in one embodiment, the
invention is directed to an epitope of TPO capable of inducing
lS antigen-speci~ic Ts cells and its use in generating Ts cellsand in treating autoim~une thyroiditis. ~nother embodiment is
a TP0-specific Ts in a pharmaceutical preparation. Yet
another embcdiment is directed to a method of treating
autoimmune thyroiditis, such as Hashimoto's disease,
compr1sing administering a phanmaeeutical preparation
comprising a TP0 epitope capable of inducing Ts cells. An
addition~ embo~iment is a method o~ treating autoiafnune
thyroiditis by ~admini~stering a pharmaceutical preparation
~ ~ ~ comprising TP0-specific Ts cells capable of suppressing an
;~ ~ 25 anti-TP0 response~ For; a discussion of suppressor cells, see,
for example, Grèen, D.,~ et al., Ann. R~v. Im~unol- 1: 439
(1983) and Benacerraf, 8., In: The ~oloqY of I~munoloq~c
Disease, HP Publishing Co., Inc., NY, pp. 49-62 (1~83).
The present invention allows the determination of the T
cell epitope or epitopes o~ TP0 (see Example XII, below) USifl9
standard techniques commonly known to those of ord~nary skill
in the art. Further, the present invention makes possible the
characterization of the autoimmune TCR speeific to the TP0
using methods described in, ~or example, Burns, F., et al., J.
WO 93/~314'62 1 ~ PCr/US92/0628.~'.'.`~.`,.
-4U-
EXD~ _Med, 169: 27 (1989). If the autoimmune T cells can be
eliminated or prevented from reacting with the TP0, the
effects of thyroiditis may be greatly alleviated. T cells
that will accomplish this objective may be generated which are
5specifie for the autoimmune TCR for TP0 using methods
described in, for example, Aeha-Orbea, H., e~ al., Ann. Rev.
Immunol. 7: 371 ~1989).
The manner and: method of carrying out the present
10invention may be more fully~understood by those of skill by
reference to the following examples, which examples are not
: intended in any manner to limit the scope of the present
- invention or of the claims directed thereto.
15EXAM LE I
~:: Construction of a Human Graves' Thvroid cDNA Librarv
: A thyroid cDNA library was constructed to maximize the
~:~ inclusion of full-length ~cDNA in the coding ortentati~n.
20Hyperplastic thyroid tissue was obtained from a patient
: undergoing thyroidectomy ~for 6raves' di:sease. mRNA was
isolated accorting~to~the method of Han~et al. ~Han, J.~., çt
a}., Bio~hem. 26:1~17:-16~5:(1987~). Double-stranded cDNA was
synthesized from l5 ~g mRNA as described:by:6ubler and Hoffman
25~(6ubler, U., et ~al., Gene 2:263-269 (1983)). Not I ~nd Xba I
linker-primers/adaptors:~were incorp~rated into the cDNA to
create those :restriction sites at the S' and 3' ends~
respectively, of the cDNA (Han9 J.~H., et al~, Biochem.
1617-1625 (1987)). The cDNA was size~-selected ( > 1 kb) by
30agarose gel tSeap~aque,~ FMC, Rockland, ME) electrophoresis,
digested with Not l:and Xba I, ligated:into Not I- and Xba I-
cut bacteriophage lambda-Zap using T4 DNA ligase, and packaged
(Giga-Pak 60ld, Stratagene, San Diego, CA). The resulting
`` ~ WO93/03146 2i 132~ PCI/U592/1~6283
-41 -
phage library contained a to~al of 2 x 1Q4 recombinant clones
before ampl i fi cati on .
EXAMPLE I I
Screenin~ for Full-len~th Human TPO cDNA
The amplified cDNA library was plated at a density of 4
x 104 pfu per 150 ~ diameter dish and probed using the insert
from a partial human TPO e~NA clone (clone 19). Two positive
bacteriophage clones were isolated. A Bluescript phagemid
containing the human TPO cDNA insert was generated fro~ one of
these clones using the helper phage R408, according to the
Stratagene protocol. The resul~ing recombinant Bluescr~pt
plasmid (pHTP0-BS) contained bases 5-3060 of human thyroid
lS peroxidase cDNA, incl~ding the start of translation and the
~: poly-A tail. DNA ssquence was determined fro~ this double-
stranded plasmid using the Sequenase kit and protocol ~United
States Bio~he~ica~, Cleveland9 OH). Sequence within the cDNA
: was confir~ed to be identical to human TPO cDNA at the 5 and
3' ends and in the regions adjacent to 10 oligonucleotide
~: primers distributed throughout the cDNA (Magnusson, R.P., et
Mol. Endocrinol.. 1:856-861 ~1987~).
~MPLE IL I
:25 :Construc~on of QHTPO-E~E
The mawnalian cell expression vector pECE (Ellis7 L., et
L, Cell 45:721-732 (1986~) was obtained ~rom Dr. William
Rutter ~lJ.C.S.F.). Human TPO cDNA was cloned into the
multiple cloning site of this vector as described in Figure 1.
Enzyme reaction~ and DNA manipul ations were performed as
deseri bed i n Mani ati s et al . (Mani ati s 7 T ., ~, Mol ec~l ar
Bi ol oqy : A LaboratQr~anual, Csl d Spri ng Harbor Laboratory ,
Cold Spring Harbor, NY (1982) ) .
8~
w o 93J03146 PCT~US92~06283
-42-
EXAMPLE IV
Transfection of Chinese Hamster Ovary Cells with DHTP~-ECE
Chinese hamster ovary cell line CHO-K1 was maintained în
Hams' F-12 medium supplemented with 10% fetal bovine serum,
penicillin ~125 units/ml), streptomycin (100 ~g/ml) and
amphotericin-B (2.5 ~g/ml). Transfection and selection with
G-418 ~GIBCO, Grand Island, NY) was carried out by the method
10of Chen and Okayama (Chen, C., et al., Mol. Cell. Biol.
7:2745-2752 (1987)~. 20 ~g pHTPO-ECE plus 2 ~9 pSVZ-neo ~28)
` ~from Dr. John Baxter, U~C.S.F.) were used for the
transfection. Control transfections with 20 ~9 pECE plus 2 ~g
pSV2-neo, and 20 ~9 pSV2-neo alone, were performed
lSconcurrently.
~:~ EX~M_LE y
~:~ RNA Extraction and Northern_a1~ na~xsis
::,
:: ~ 20Total eellular RNA was extracted by the ~etho~ of
Chomczynski and Sacchi (Chomczynski, P., et al~, Anal.
Biochem. 162:156-159 ~1987)). ~ 15 ~9 of RNA was
electrophoresed in formaldehyde gels:as described by Maniatis
et al. (Maniatis, T., et al., Molecular:~ioloqY: A Labo~atorv
~:~ 25~ Manua~, Cold Spring Harbor Laboratory,, Cold Spring Harbor, NY
(1982)). ~RN:A~was~blotted onko a Zeta-Probe membrane (BioRad,
:~ : Richmond, CA) and probed with a 0.5~ kb human TPO cDNA probe
;~ ~ (clone 31 insert),:labeled to a specific activity of 4 X 109
cpm/~g DNA using the Multi-Prime labelling kit from Amersham
30(Arlington Heights, IL~.
' ~: '
~ 1 wo 93/031q6 2 ~ ~ ~ 2 8 0 P~/US92/062~3
-43 -
EXAMPLE VI
Western Bl ot Anal YSi s
Transfected CH0 cells were extracted ~o obtain soluble
S protein. Five 100 mm diameter dishes were washed 3 times with
calcium-magnesium free phosphate-buffered saline (PBS). After
aspiration, 5 ml uf 0.5% Triton X-100 in the same buffer,
supplemented with 10 ~9/~l leup~ptin, 0.5 mg/ml bacitracin and
2 nM phenyl~nethylsulfony~ fluoride (all from Sigma, St. Louis,
: 10 M0), were added to the first dish. This initial cell so~utionwas seraped and transferred successively to the other 4
dishes of oells. The cell solution was then tumbled for 1
hour at 4-C. Afte~ centrifugation for 3 ~inutes at 10,000 x
9, the supernatant was saved and stored at -20-C until use.
Protein content was determined (Bradford, M.M., Q~al. Biochem.
72:248-254 ~1976)~ and 50 ~9 protein/lane electrophoresed on a
7.5% polyacrylamide SDS gel (~aemmli, U.K., ~y~ 680-689
~ (1970~). Proteins were electrotransferred (30 V x 5 hours, or:~: 250 mA overnight) to nitrocellulose membranes ~Schleiche~ andSchuell, Keene, NHj in an electroblotting apparatus (Hoeff~r,
San Francisco, CA) containing 25 mM Tris, 192 mM glycine~ 20%
~: methanol. ln later éxperiments, transfer w~s acco~plished
using a Polyblot semi-dry electrotransfer syste~ (A~ric2n
Bionetic, Hayward,~CA):, according to~the directions of ths
ma~ufacturer. Membranes were rinsed once ~n TBS (0~1 M Tr~s9
pH 8.0, ~.15 M NaCl), then for 30-60 minutes at room
temperature tn:TBS containing 0.5 ~ Tween 20 (Sig~a, St.
Louis, M0). :After 3 further rinses with T~S-Tw~en, the blots
were probed as described by Young and Davis (Young, R.A., et
: 30 al., ~n Genetic ~n inee~inq: PrinciPals and M~thods, Plenum
~: Publishing Corp., 7.29-41 (1g35)) using a 1:250 dilution of amouse mAb against the thyroid microsom~l antigen (Portmann,
L7, et a L, Clin. Invest. 81:1217-1224 ~1988)), follow@d
2113~8&
w o 93/0314~ PCT/US9~/~628
-44-
by a 1:250 dilution of horseradish peroxidase-conjugated goat
anti^mouse IgG antibody (Sigma, St. Louis, MO).
In other experiments, CHO-HTP012b cell extracts were
probed using a panel o~ polyclonal ~ashimoto's thyroiditis
sera, provided by Dr. S. M. McLachlan, University of Wales,
Cardiff. Antimicrosomal an~ibody titers had previously been
determined by enzyme-linked immunosorbant assay ~ELISA) in the
presence of excess thyroglobulin (Jansson, R., et al., ~
Exp. Immunol. 63:80-86 (1986~). Multiple Hashimoto's
thyroiditis sera were applied to a single filter overnight at
4-~ using a Miniblotter 4~ manifold (Immunetics, Cambridge,
Mass.~. Membranes were then processed as described above,
except that alkaline phosphatase-conjugated goat anti-human
IgG, Fc fragment specific (Cappel, Organon Teknika Corp., West
Chester, PA) was used as ~he second antibody with nitroblue
tetrazolium ~0.3 mg/ml) and 5-bromo^4-chloro-3-indolyl-
phosphate (0.~5 mg/ml) in 100mM Tris, pU 9.5, 100 mM NaCl, 5
~ MgC12.
~ elÇ~
Fluorescence-activated Cell Sorter~IFQCS).Analy~is
: CHO-HTP012b cells were~processed as described by Ell~s et
al. (Ellis, L., et al., Cell 45:721-732 (1986~). In brief,
cells from d 100 mm diameter dish were detached by m~ld
trypsinization, and the cells rinsed and pelleted ~S ~inutes
at 100 x 9, 4-C) in Ham's F12 medium, 10% fetal calf ser~m
(see aboYe). The ce~ls were resuspended in 0.2 ml of
phosphate-buffered saline (PBS), 10mM Hepes, pH 7.4, 0.05% Na
azide (buf~er A~. Serum to be tested (2ul) was added for 30
minutes at 4-C, followed by two rinses in buffer A with 2%
fetal calf serum and resuspension in 0.2 ml of the same
solution. 25 ul of goat anti-human IgG, Fc speci~ic, affinity-
purified1 R-Phycoerythrin-labeled (Caltag, Sauth San
2 ~ S,.~ ,:
W o 93/0314~ PCT/US92~62~3
-45-
Francisco, CA) were added for another 30 minu~es at 4-C.
After 3 washes in buffer A, the cells were analyzed on a
fluorescence-~ctivated cell sorter.
S EX~MPLE VIII
Assày_of Human TP0 EnzYmatic Activitv
H~man TP0 activity was assayad following extraction from cell
miorosomes with trypsin and deoxycholate as previn~sly
described (Magnusson, R.P., t al., Endocrinol. 116:1493-1500
(19B5)~. In later experiments, a more rapid method was used.
Cells were suspended with a rubber scraper in 1.5 ml calcium-
maynesium free Dulbecco's phosphate-buffered saline and
protein determined on a ~ ul aliquot. The cells were then
1~ pelleted in a microeentrifuge for 2 minutes. Cold 0.1%
deoxycholate (0.2 ml/mg cellular protein) was added for 10
minutes. ~he extract was microcen~rifuged for 5 minutes and
the supernatant removed for assay. One guaiacol unit is
defined as a A470 of 1.0 per minute which is equivalent to
150 nmols g~aiacol oxidized per minute (Chance, B., et al.?
In ~ (Colow k k, S.P., et al.), Acad~mic
Press, New York 2:764-775 (195~)). One un~t of iodide
: peroxidase is defined as a A353 of 1.0 per ~inute whieh
:~ corresponds to 43 nmols I3- formed per minute (Magnusson,
2~ R.P., ç¢_31 , J.~ l.... Chem. ~2:13783-137gO ~1984)).
~9~L~
Pri~ar~ Culture of Human Graves~_~isease Thy~Q~d Cells
.
Human Graves' disease thyroid tissue was dispersed and
the cells cultured as previously deseribed ~Hinds, ~.E., et
al., J. Clin. Endocrino~. Metab. 52:1204-1210 (1981)). After
3 days in culture, fresh medium containing 12.5 mU/ml TSH was
211;, 2 ~
wo 93/03146 Pcr/uss2/o628:
-46-
added for an additional 3 days before the cells were harvested
and extracted as described above for the western blots.
EXAMPLE X
~omParison of Recombinant hTP0 and Microsomal Antiqen as
Sources of Antinen for~ELISAs for Anti-MSA~ti TP0 Antibodies
Sera fro~ 51 individual s were provided by Dr. S. M.
McLachlan (University of Wales College of Medicine, Cardiff,
U.K.). Forty seven of these sera were from patients with
autoimmune thyroid disease, selected to represent a balanced
spectrum of anti-MSA titers ~rom low to very high. Four sera
were from norm~l individuals. Anti-MSA and anti-TGA
antibodies were measured by the method of Schardt et al.
(Schardt, C.W., et al., J. Immunol.~Methods 55:1~5-168 (1982~)
and the ~ethod of Endo et al. (Endo, Y., et al., Clin. Chim.
Acta 103:67-77 (198C)), as modified by McLachlan et al.
(McLachlan, S.M., et al;, lmmunol. Letters 4:27-33 (1982)),
respectively. For t~e anti-MSA assay, human thyroid
microsomes were prepared from ~s~ozen 6raves' thyroid tissue
obtained at operation for the treatment of t51i s di sease
(Schardt, C.~l~, et al., J. Immunol. ~odls 5$:155-168
~1982)). In order to avoid cross-~eactivity of patients' sera
with any thyroglobulin remaining in the microso~al
preparatiQn, sera were pre-adsorbed in buffer corltaining 1ûO
g/~l (1.5 x 10-6 M) thyroglobulin (obi;ained from the same
tissue~ at 4~C o~ernight and thereafter at room ten~peratalre
for 2 hours before assay (Schardt, C.~3., et ~ ,~l~
Methods 55:155-168 (1982)).
3û The generati on of Chi nese hamster ovary (CH0) cel 1 s
~clone CH0-HTP0 12b) expressing enzymatically-acti-,fe hllman TP0
has been descri bed above . ~hese cel l s had been transfected
with the recombinant pl asmid pHTP0-ECE, constructed by the
insertion of a full-length human TP0 cDNA into the expression
vector pECE. CH0-HTP0 12b and CllO-K1 ~control, non-
`! w O g3~0314~ 2 1 ~ 3 2 8 ~ PCTt~S92/06283
-47-
transfected) cells were grown in Ham's F-12 medium
supplemented with 100 g/L fetal bovine serum (FBS), penicillin
(125 units/ml), genta~icin ~48 ~g/ml) and amphotericin-B (~.5
~g/ml). Cells were grown to confluence in 100 mm dishes, the
cells were rinsed three times with Dulbecco's calcium-
magnesium free, phosphate-buffered saline (PRS), and then
scraped into a solution containing 10 mM Tris, pH 7.4, 0.25 M
sucrose, 2 mM phenyl~ethyl sulfonyl fluoride, 10 ~g/ml
leupeptin, 0.5 mg/ml bacitracin (Buffer A). Cells were
homogenized for 20 seconds with a Poly~ron, centrifuged for 15
minutes at 10,000 x~ 9, 4-C, and the supernatant then
centrifuged for 1 hour at 100,00~ x 9, 4~C. The microsomal
pellet was resuspended in 0.5 ml of Buffer A, ho~ogenized in a
Dounce homogeni~er, and then frozen at 80-C until ~se.
Protein content was determined by the method o~ Bradford
Bradford, M.M., Anal. Biochem. 72:248-254 (1976)). Yield of
microsomal protein was approximately 100-200 ~9 per 100 mm
dish of confluent cells.
: Sera to be tested were stored in aliquots at -80-S beforeuse. The assay procedure was that of Schardt et al. (Schardt,
C.W., et al:., J. Immunol. Methods 55:1~S-168 (1982)), with
: slight modifications.~ Multiwell micro-ELISA plates (Dynatech
: Labs, Chantilly, VA) were coated (overnight at 4-C) with 4 ~g
: CH0-HTP0 12b or CH0-K1 microsomal protein per well in coating
:25 ~ buffer (0.05 M :sodium bicarbonate, pH 9~3, 0.02% sodium
: ~ azide3. The wells were then rinsed twice in 0.2 M Tris, pH
7.4,:0.15 M NaCl (Tris bu~ferJ, once in 0.2 M Tris, pH 7.4~
0.15 M NaCl, O.Q5% Tween 20 (Tris-Tween buffer), and once in
Tris buffer. 10~ ul of P~S, 50 g/L bovine seru~ albumin ~BSA3
~Sigma, St. LQUjS, MO) were added to each well and incubated
: for 20 minutes at room temperature. After aspiration, the
wells were washed twice in Tris buffer, once in Tris-Tween
; buffer, and once in Tris buffer.
w ~ 93~ ~ ~ 3 2 ~ ~ PCT/US9~/0~8
-48-
Serum samples were diluted 1/100, 1/1000 or 1/10,000 in
PBS, 5 g/L ~SA. 100 ul of the diluted serum sample were added
per well in duplicate and incubated for 1 hour at 37-C. The
wells were then washed three ti~es with PBS. 100 ul of
peroxidase-conjugated, affinity-purified, goat anti-human IgG,
Fc fragment specific antibody (Cappel, Organon Teknika Corp.,
West Chester, PA.), diluted 1/500 in PBS, 250 g/L FBS, were
added to each well and incubated for 1 hour at 37-C. The
wells were then washed four times with Tris-Tween buffer.
lQ 100 ul of substrate solution ~12 ~l of 0.23 M citrate, 0.26 M
: sodium phosphate, pH 5.0 solution + 12 uL 30% H22 + 4.2 mg
ortho~phenylenediamine) were added to each~well and incubated
for 30 minutes at room temperature. The reaction was stopped
by adding 100 ul of 20~o sulfuric acid to each well. ELISA
values (OD 490 nm) were measured in a micro-ELISA re~der and
normalized (blankedj to a well lacking antigen.
EXAMPLE XI
Oliqonucleotide-Directed Mutaaenesis of Human TPO cDNA
: 20 :A. METHODS
The non-coding strand of human TPO cDNA, in the phagemid
~;: : : Bluescript (Stratagene~ San Diegs,~CA), was used as a template
for oligonucleotide-directed mutagenesis. A 52 bp mutagenic
primer
~: 2S ~5'-A6GCTCCCTCGG6TGACTTG MTTCCCAT6TAGCTGG~TGCTCT6CTGATC~-3'),
:synthesized by the Moiecular Genetics Core Facility, San
Francisco Veterans' ;~Administration Medical Center, was
designed to geoerate two stop codons di:rectly upstream of the
~^ putative membrane-spanning region of the protein. Thus, T6A
and TAG codons were created at 2629-2631 bp and 2641-2643 bp
: in human TPO cDNA (Magnusson, R.P., et al., Mol. Endocrinol.
~ 856 861 (1g87)), respectively. For convenient screening of
:: mutants, an Eco RI restriction site tGM TTC, at 2630-2635 bp)
was created together with the first (TGA) stop codon. The
~ W 0 93/03146 21 ~ ~ 2 ~ ~ PCT/US92/06~83
-49-
mutagenesis procedure was performed according to the protocol
of the manufac$urer (Muta-gene phagemid in vitro mutag~nesis
kit, Bio~ad, Richmond, CA) to generate the plas~id pHTPO(M1)-
BS.
After confirmation of the mutation by nucleotide
sequencing (Sanger, F., et al., Proc. Natl. Acad. Sci. USA
74:5463-5467 (1977)) (Fig. 13), the cDNA was excised by
digestion of pHTPO(M1)-BS with Not I, the ends blunted with
the Klenow fragment of DNA Polymerase I, and the cDNA
liberated by digestion with Xba I. The mutated cDNA (3.05 Kb)
was su~stitu~ed for wild-type human TPO cDNA in the plasmid
pSV2-DHFR-ECE-HTPO, to generate pHTPO(M1)-ECE-SY2-DHFR. This
plasmid contains components of the expression vectors pECE
~Ellis, L., et al., Cell 45:721-732 (1986)) and pSV2-dhfr
:~ 15 (Lee, F., et al., Nature 294:228-232 (1981)), provided by ~r.
William Rutter ~University of California, San Francisco) and
r. Gordon Ringold~(Synte%, Palo Alto), respectively. In
brief, pSVZ-DHFR-E~E-HTPO was digested w~th Sal I, the ends
blunted~with the Klenow fragmeot of DNA polymerase I, and the
hTPO cDNA released by digestion with Xba I. The rema~ning
vector (pSV2-DHFR-ECE)~was~ treated with bacter~al alkaline
phosphatase, gel purified~ an~ recovered in SeaPlaque ~g~rose
FMC BioProducts, Rockland ME). Mutated hTPO cDNA, a~so
recovered in SeaPlaqùe agarose, was ligated ~nto this v~ctor.
Enz~es. Restriction enzymes, T4 DNA ligase and DNA
polymerase I, Klenow:fragment were obtained ~lternat~vely from
:: Bethesda Research Laboratories (Gaithersburg, MD)~ New England
Biolabs (Beverly,: MA) or ~oehringer-Mannhe~m (Indianapolis,
; IN)-
~: B. RESULTS AND DISCUSSION
Because multiple screenings of previously constr~cted
human thyroid cDNA library in lambda gtll (Magnusson, R.P., et
al., Mol. Endocrinol. 1:856 861 (1987)) only yielded
2 ~ 2 ~ ~
WO 93/03146 ` : PC~/US92/06~
-50- .
fragments of TP0 cDNA, a new thyroid cDNA library in lambda-
Zap was constructed as described herein. The plasmid pHTP0-BS
containing full-length human ~P0 cDNA was obtained from this
library. pHTP0-ECE was construc~ed from pHTP0-BS and the
~ammalian expression ve~tor pECE (Ellis, L., et a L, C~Ll
45:721-732 (1986)) according to the strategy shown in Figure
1, and was used for subsequent cell transfections.
Chinese hamster ovary cells were co-transfected with
pHTP0-ECE and pSV2-nec, and 12 clones were tested for the
presence of TP0 mRNA by northern blot analysis. Total
cellular RNA (15 ~g/lane) from four pHTP0-ECE transfected
cell lines ~CH0-HTP04, CH0-HTP012, CH0-HTP014 and CH0-HTP017~,
and one control pSY2-neo-transfected cell line (C~0-pSV2-neo),
was subjected to northern blot analysis using a human TP0
cDNA probe, as described herein. For comparison, 1 ~9 of poly
; A+ mRNA prepared from a human thyroid gland from a Patient
with Graves' disease was used. 28S and 18S ribosomal RNA
markers, and an RNA molecular weight ladder ~B.R.L.,
6aithersburg, MD) were employed for molecular weight
determination.
; ~ Four of these clones, as well as one of four control
(pSV2-neo alone)~clones, revealed a 3.3 kb mRNA band in the
pHTP0-ECE-transfected clones. ~be size of the human TP~ mRNA
in the transfected CH0 cells is slightly larger than that in
the Grsves' thyroid~cells (3.1 kb), presu~ably be~ause of the
add~t~onal SV40 poly-A coding region at the 3' end of human
TP0 cDNA in the pHTP0-ECE plasmid ~see Figure 1).
Western blot~ analysis (under reducing conditions) of
proteins extracted from TP0-transfected CH0 cells, using a
3C ~ouse monoclonal anti-human thyroid microsomal antibody
~;~ (Portmann, L., ~t al., J. Clin. InYest. 81:1217-1224 ~1988)),
revealed an immunoreactive protein of 105-110 kD, as expected
for human thyroid peroxidase (Czarnocka, B., FEBS Letters
109:147-152 (1935); Ohtaki, S., et al., J. Clin Endocrinol.
~ wo 93/03146 21 1~ ~ 8 S~ Pcr/uss2/o6283
-51 -
Metab. 63:~70-576 (1986)). Briefly, 50 ~9 of mem~rane protein
or 30 ~9 of deoxycholate (DOC)-extracted protein from pHTPO-
ECE-transfected cell lines (CHO-HTP04, CHO-HTP012, CHO-HTP014,
CHO-HTP017), from a control cell line co-transfected with pECE
and pSV2-neo, and fro~ another control cell line transfected
with pSV2-neo alone, were subjected to SDS polyacrylamide gel
electrophoresis under reducing oonditions. The proteins were
electrotransferred to nitrocellulose membranes and then
probed, as described herein, with a mouse mAb against the
thyroid microsomal antigen (Portmann, L., et al., J. Clin.
Invest. 81:1217-1224 (1988) ) .
: Strong TPO enzyma~ic activity was evident in clone CHO-
HTP012, and in subclones~HO TP012b and CHO-TP012g, obtained
by limiting dilution (Table 1). Less enzy~atic activity was
detected in the other clones. TPO activity in the CHO-TP012
: clones was approximately the same as TPO activity in TSH-
:~ stimulated Graves' thyroid cells in monolayer culture (Table
~d~
~ In order to determine~ whether, as with native TPO in
: ~ 20 thyroid cells, the recombinant, hllman TP0 was expressed on the
;~ ~ surface of the CH0 cell s transfected with this ~ene, CH0-
HTP012b cells were subjected to FACS analysis (Figure 2).
, ~ ~
lncuba1;ion of these ::cel~s with high-titer MSA Hashimoto's
~. ~
serum ~ELISA value of :1.772; normal ~ 0.2) (Jansson, R., et
al., Clin.__ EXQ. I:m~nol. 63:80-86 (1986~) yielded
approximately 100-fold greater fluorescence than when these
cells were incubated wi:th control ;serum (Figure 2). Similar
results were obtained wi~th three: different Hashimoto's sera.
; The size of both the control and Hashi~oto's serum-incubated
cells was the same (Figures 3E and 3F), exclllding the
: :~ possibility that differences in cell size were, in part,
:: ~ responsible for the differences in signal.
~: A series of western blot studies was then performe~ with
protein from CHO-TPOl~b cells using a panel of Hashimoto's
2i~3Z~
w o 93/03t46 PCT/US92/0628
-~2-
sera with known antimicrosomal antibody levels as determined
by ELISA (Jansson, R., et al., Cl~L~ EXP. Immunol. 63:80-86
(1986)). Under non-reducing conditions, all 29 Hashimoto's
sera tested, unlike three normal sera, reacted with a major,
broad protein band of approximately 200 kD as well as with a
fainter doublet of about 110 kD. In aggregate, in studies
performed under non-reducing conditions, a total of 36
Hashimoto's sera tested, but not the six control sera, reacted
with these bands. The interexperimental variability in the
intensity of these bands, however, as well as methodological
limitations in analyzing many samples simultaneously,
precluded oomparison of results of all samples tested.
Nevertheless, it was apparent that, within a single large
experiment, the strongest signals were seen with sera
containing the highest antimicrosomal antibody ELISA values.
Some sera also recognized protein bands other than those
expected for TPO. ~These bands represented wild-type CHO
~;; antigens ~presented below). One apparent TPO-specific signal
of 110 kD also was~a non-speciFic wi~ld-type CHO signal. This
is discussed in more detail below.
Comparison ~of the` recombinant TPO signals on western
blots performed under reducing and non-reducing condit~ons
(using B-mercaptoethanol1 revealed the following with
; reduction: (a) loss of the 200 kD broad band; ~b) alteration
of the 110 kD signal so that it no longer clearly represents a
doublet; and ~c) lessening of the specific signals so that
; some of the weaker sera become negative. A non-immune serum
described above that reacted with a band of approximately 110
kD represents a wild-type CHO protein, and not TPO.
The specificity of the 200 kD and 110 kD bands discussed
aboYe was demonstrated in two separate experiments utilizing
wild-type, non-TPO-transfeeted, CHO cells. In the first
experiment, selected, potent Hashimoto's sera tested under the
most favorable ~i.e., non-reducing) conditions failed to react
~:, WO 93/~3146 2 i 1 ~ ~ 8 '~ PCI'/~JS92/û6283
-53-
with protein bands of 200 kD or 110 kD. The second experiment
indicated that the non-immune serum previously shown to react
with a band of 110 kD is a false-positive. This signal in
wild-type CH0 cel~ls is strong despite the use of unfavorable
(i.e. reducing) conditions.
To assess the sensitivity of detection of the specific
signal western blot analyses were performed with serial
dilutions of two Hashimoto s sera. The amount of TP0
generated in CH0-TP012b cells was sufficient to be detected
even when these Hashimoto s sera were diluted greater than
3000-fold.
Human TP0 contains 5 potential glycosylation sites. It
:
was therefore examined whether carbohydrate moieties are
important in the conformat;ion of the epitope(s) in the human
TP0 antigen(s) recognized by Hashimoto s sera. Western blot
n~lyses were perfonmed on proteins extracted from CH0-TP012b
cells pre~cultured for 20 hours in 0.5 ~g/ml tunicamycin an
inhibitor of protein glycosylation. This length of time was
~ chosen because it~was the longest tolerated without evidençe
;~ 20 of significant toxicity (i.e. cell loss). Tunicamycin
treatment had~ no ~apparent e~fect on antigen recogn~tion
syggesting that carbohydrate moieties may not be ~mportant
components of the microsomal antigen epitope(s). In a control
experiment tunicamycin~ treatment under simil~r cond~tions
decreased rad~olabel~ed D-glucosamin~ lncorporation ~nto
~:: : prote~ns by 56.3;+:~4.8 % (mean + S.D.~; n-3~. -
An ELISA carried ~ out using antibodies dire~ted against
the microsomal anti~en~ (MSA) was compared with an ELISA
~: . performed with antibodies directed against the r~combinant
human TPO of the present in~rent~on IF~gure 3). Very good
correlation 10.8385249) was observed. In fact th* anti-MSA
based ELIS~ resulted in false positives (indicated as
outlyers~ in Figure 3) which were not observed in the FLISA
based upon the anti-recombinant human TP0 antibody.
.
~ i i328 ~
WO 93/03146 PCI`/US92/0628',
-54-
These false positives are likely ~o result from non-
speci~ic reactions of antithyroglobulin an~ibodies with the
microsomes, and were not included in the linear regression
calculation for Figure 3. Support ~or this conclus~on is
found in Figure 4, which shows a linear regression analysis
analogous to that shown in Figure 3, but at a much greater
(1/1000) dilution. It can be seen from Figure 4 that the
increased dilution factor has substantially eliminated the
outlying data points seen at the lower dilution, and that the
correlation ~0.9060773) is significantly greater. This result
strongly suggests that the lowered specificity of the anti-MSA
based ELISA is, indeed, a function of antigen contamination.
Such problems, which lower assay specificity, might be
addressed by the use of non-recombinant, affinity-purified
1~ TP0. However7 generation of tr~ly pure, affinity-purified
natural TP0 has proven to be very difficult, if not
impossible, to achieve~ These problems are avoided by use of
;: the recombinant:human TPO antigen of the present invention.
; In order to further examine its specifictty, recombinant
human TPO was compared with Graves' thyroid microsomes as a
~ source of antigen in an ELISA procedure. The recombinant hTP0
:~ was present in microsomes prepared from a non~thyroidal, non-
human eukaryotic celi line which cannot, therefore, contain
thyroid-specific ant;igens other than hTP0. Nevertheless,
because sera from patients with autoimmune thyroiditis contaln
antibodies against numerous antigens, some Gf which may be
present in Ch~nese hamster ovary (~H0) cells ~Kaufman, K.D.,
et al., J. Clin.: Invest. 84:394-403 (1989~), each serum
~: sample was also assayed against microsomes prepared ~rom
control, non-transfected CHO cells.
In comparing the 51 ser~ at a standard (1/1~0) dilution
in bath the recombinant hTPO and the thyroid microsomal assay,
~: a moderately good correlation was observed (r~0.668; p<0.001)
(Fig. 10A~. Clearly~ however, there were some widely
2`~
` W~ 93/03146 PCI/US92/06283
_55_
discrepant values. In particular, two sera ~sera #11 and 27,
Fig. lOA, large circle and square, respectively) that were
very potent in the anti-MSA assay gave values in the anti-hTP0
antibody assay similar to the four normal sera (Fig. 10A, four
data points within rectangle near the origin). A number of
other sera, primarily in the high range of activity, also gave
significantly higher values with the thyroid microsomal
preparation than with recombinant hTP0 (Fig. 10A). At the
same serum dilution, a much lower correlation was observed
between the values obtained with thyroglobulin and recombinant
hTP0 as antigen ~r~0.315; p~0.05).
: In an autoimmune serum containing antibodies against
multiple antigens, the different antibodies are likely to have
varying affinities for their respective antigens. Serial
di~utions of sera will yield different profiles of ELISA
~ values based on- the affinity of each antibody-antigen
: interaction. If hTP0 is the primary autoantigen in the thyroid
microsomal preparation, the same serum dilution curve should
therefore be observed in assays using thyroid microsomes and
: 20 recombinant hTP0. In ~support of this hypothesis, at serum
dilutions of 1/1000 or; 1/10.000, the correlation in ELISA
~` values between thyroid microsomes and buman ~P0 was much
greater (r-0~906::~and~ 0.902, respectively; p<0.001) (F~gs. 10B
and 10C). Dramatically, the two sera that were strongly
~: 25 positive with the thyroid ~icrosomal but not with the
: ~ recombinant hTP0 ~antigen (Fig. 10A) were no longer
~: sign~ficantly discrepant between the two assays (F~g. 10B and
1~C). The dilution curves for these two sera were quite
different in the anti-MSA and antl-hTPD antibody assays (Fig.
~1A and 11B), confirming that these sera were reacting with
low a~finity to an antigen other than hTP0. These two sera
:: we~e also distinguished by their surprisingly h1gh levels of
anti-thyroglobulin antibody. In contrast~ other sera with
similar anti-MSA levels (at 1/100 serum dilution) yield normal
:~,
211328J
w o 93~03146 P~T/US92~062X3
-~6-
~ilution curves in both assays (sera ~12 and 28, Fig. 11A and
11B).
The anti-hTP0 antibody ELISA data were also expressed as
the difference between values obtained using the CH0-HTP0
microsomes and the CH0-K1 microsomes as antigen, to correct
for possible interference by anti-CH0 cell antibodies
(Kaufman, K.D., et al., J~ Clin. Invest. 84:394-403 (1989)).
No significant ehange was found in the correlation between the
thyroid microsomal and:the recombinant hTP0 assays using these
revised data at each of the three serum dilutions. Anti-CH~-
K1 antibody ELISA values~ for the 47 sera of patients with
autoimmune thyroid ~disease tested, at standard ~1/100)
dilution, were 0.164 + 0~066 SD (mean ~ SD).
The precision of the anti-hTP0 antibody ELISA was
assessed using three sera chosen to represent a spectrum of
; autoantibody potency.: Intra-assay variability (10 iterations
: for each serum) at standard (1/100) serum dilution, expressed
as mean + SD ~Fig. 12)~, was 0.346 + 0.18 (l:ow-potency serum),
0.599 + 0.44 ~medium~potency serum), and 0.923 + 0.94 (high-
potency serum). ~he intra-assay coefficients of variati-on
(CV) for thèse ~ séra were 5.12%, 7.3~%, and 10.~%,
respectively. The :inter-assay GV's (7 iterations for each
serum) were 5.36X~:~7.63X,~ and 7.2g%, respect~ely.
In another :aspect ~ of the present invention, 1t has
:~: 25 surprisingly:been discovered that CH0 cell expressinn-of human
TPO can b~ sign;ificantly increased by e~ploying a d~fferent
plasmid. A dihydrofolate reductase ~DHFR)-TP0 construct has
: ~ been made in which both genes (DHFR aod TP0) are driven by the
~ SV40 promoter (Figure 4). Screening of CH0 cells transfected
: 30 with these constructs has produced two plasmids, designatedpHTP0-DHFR-2B and pHTP0-DHFR-4C, which presently express
three-fold more~antigen than that achieved us~ng the pECE-HTP0
plasmid.
;
w o 93/03146 2 ~13 .~ P ~ ~US92/06283
-57-
The relative TP~ activities observed in CHO cells
transfected with pECE-HTPO, pHTPO-DHFR-2B and pHTPO-DHFR-4C
are shown plotted against ~ethotrexate concentration in Figure
5. Further, one partieular subclone9 designated pDHFR-TPO-4C-
MTX, has been found to express relatively greater amounts of
TPO than any other construct so far isolated, and, in this
regard, comprises the best mode presently contemplated of
expressing human TPO in CHO cells. The plasmid pDHFR-TPO- U -
MTX was deposited at the American Type Culture Collection,
12301 Parklawn Drive, Rockville, Maryland 20852 on October 3,
1989, with accession number CRL }0250.
Figure 5 shows that, *i~h increasing methotrexate
: concentrations~ a plateau is reached for CHO expression of TPO
by the pHTPO-DHFR-2B and pHTPO-D~FR-4C plas~ids. While not
intending to be bound by any par~icular theory, one possible
explanation for this observation is that the expressed full
length TPO gene is toxi~ to the host CHO cells, resulting in
selection ~or DHFR, but against TPO, at higher m~thotrexate
concentrations. The res~lt cf such selection might be th~t
DHFR is amplified while TPO is deleted.
Since the full length TPO gene is membrane-associated9
the present inventor hypothesized that it may be possible to
; increase TPQ production in CHO cells if the expressed protein
~ could somehow be dissociated ~rom the membrane. Accordingly,
:: 25 experiments haY~ been undertaken to generate a secretable fo~
of human TPQ~ by identifying and eliminating the wild-type
trans~embrane se~uence~from the gene.
Prema$ure termination in the synthesis of h~PO was
hypothesized to reduce the size of the hTPO-Ml protein from
933 to 848 amino acids. An original full langth human TPO
cDNA clone in B~uescript (pHTPO-BS) was submitted to s~te-
directed mutagenesis to produce plasmid pHTPO~M1)-BS. A
single-stranded DNA template was generated, and the indicated
52-~er oligonucleotide probe used for mutagenesis. The
8'~
WO 93/031'16 PCl`/US92/06283
-58-
mutations incorporated two stop codons, as well as an EcoR1
site fnr confirmation, in the region immediately upstream from
the transmembrane region of the human TP0 gene (Figure 6).
: The entire full length human TP0 gene sequence is shown for
comparison in Fi~ure 7.
As a consequence of the ~utation, a ~truncated" human TP0
protein is expressed which is secreted by the host cell rather
than bound to its membrane. The mutated hTP0 gene was excised
: ; from pHTPO(M1)-BS using Not I ~blunted with Klenow polymerase)
and Xba I, and was inserted into the corresponding sites of
pECE-SVZ-DHFR, to produce the expression plasmid pHTPO~M1)-
ECE-SV2-DHFR (Figure 8j. CH0 cells transfected with this
plasmid appear to produce a truncated human TP0 protein, which
is believed to retain the antigenic properties of the full
length protein, and which, accordingly, comprises another
emb~diment of the present invention. Construction of the
plasmid pHTPO(Ml?-ECE-SV2-DHFR is summarized in Figure 9.
After stable transfection of CH0 cells with the plasmid
pHTPO~M1)-ECE-S~2-DHFR containing the mutated hTP0 cDNA,
~0 individual~col:oni~es~of cells ~CH0-TP0-M1) were studied for the
expression of ~P0: (Fig.~14).
Because the kinetics of potentially-secreted hTP0-M1
protein were unknown, the expressi`on of this protein was
~: ln1tially screened:~for in CH0 cell lysates, slnce particulate.
TP0 would be expected tn be detectable ~even if the protein
: ~ were, in large part, secreted. Randomly selected CH0-TP0-M1
clones showed~ evidence~ of variable cellular TP0 expression
(F~g. 14~. A doublet of approximately 105-101 kD was
spec~fically immunoprecipitated from lysates of these clones
by serum from a patient with Hashimoto's thyro1d1tis. In CH0
cells transfected with wild-type hTP0 cDNA, Hashimoto's serum
~: immunoprecipitated a doublet of larger size, 112-105 kD, and
: neither doublet was detected in non-transfected CH0 cells
~ (Fig. 14A), as previously observed ~Kauf~an, K.D., et al., J.
2 i ~ ~ 2 ~ ~,
W o 93/03146 PCT/U~92/~6283
-59-
Clin. Invest. 84:394-~03 (1989)). Immunoreactive TPO was
absent f~om the cell surface of the CHO-TPO-M1 cells, as
demonstrated by the lack of immunofluorescence when these
cells were pre-incubated wi~h Hashimoto's thyroiditis serum
and fluorescently-tagged goat anti-human IgG antibody, unlike
CHO cells transfected with wild-type hTPO (Kaufman, K.D., et
al., J. Clin. Invest. 84:394-403 (1989)).
: In order to determine whether mutated hTPO-M1 is a
secreted protein, the biosynthesis and processing of both
hTPO-MI and wild-type hTPO was examined in pulse-chase
experiments. First, clone ~HO-TPO-M1-K, with the highest
expression of truncated :TPO (Fig. 14A), was subcloned by
limiting dilution, and one cell line (CHO-TPO-M1-K1) was
seleeted for further studies (Fig. 14B). Over a 24 hour chase
period, radiolabeled hTPO-M1 protein was secreted by cells
into the culture medium and detected by immunoprecipitation
with Hashimoto's serum (Fig. 15). This secreted protein was
~::: present in the culture~ medium after 4 hours of chase, with
~ ~ levels accumulating progressively over a 24 hour period.
: ~: 20 Interestingly, the ~secreted, immunoprecipitable hTPO-M1: prote~n appeared as a single band of lesser electrophoretic
mobility on the polyacrylamide gel, as compared with lts cell-
,
associated form. In contrast, CHO cells express~ng wild-type
:~ ~ hTPO secreted no detectable im~unoprecip~table ~aterial into
the culture medium. ~ The cell-associated hTPO and hTPO-M1
proteins were:: similarly stable, with their radiolabeled
~: ~ : immunoprecipitates;increasing between O and 4 hours of chase.
Amounts of radiolabeled, immunoprecipitable wild-type hTPO
protein at 24 hours of chase were simllar to basel~ne (O
hours). The obserYed decrease in s~gnal in CHO-TPO-Ml~Kl cell
:: lysates from 4 to 24 hours is parall~led by an increase in
:~ ~ signal in the medium of these cells, supporting the concept
of a secre~ed p~otein, which, accordingly, comprises another
enlbodiment of the present invention.
wos3/o3146 ~ Ii 3 8 ~ Pcr~uss2/06283 ~ ;
-60-
In order to prove that the irnmunoprecipitable ma$erial
released into the culture media by CH0-TP0-Ml-Kl cells was,
indeed, TP0, conditioned media were tested for TP0 enzymatic
activity. TP0 actiYity (l.û guaiacol U/lO ml medium~ was
clearly present in the culture medium from the CH0 cells
expressing the mutated form ~f hTP0 (Fig. 16). In contrast9
there was no detectable enzymatic ac~ivity in conditioned
media from CH0 cells expressing wild-type hTP0 (Fig. 16),
despite strong TP0 activity present in lysates o~ these cells,
as previously described (Kaufman, ~.D., et al., J. Clin.
Invest. 84:394-403 (1989)).
Table I
Thyroid Peroxidase (TP0) Activity in CH0-TP012 Cells
and in ~SH-Stim~lated Graves' Disease
Human Thyroid Cell Primary Cultures
Cel rType 6uaiacol Percxidase lodide Peroxidase
: 20 (units/mg protein) (units/mg protein)
CH0-pECE b - o
~control~
CH0-pSV2-neo 0 0
:~ (control)
:~ Human thyroid cell-s 4.7 3.0
4.6 3.4
CH0-HTPO12 3~6 nd
CH0-HTP012b 4.0 3.1
CH0-~TP012g 3.1 1.9
: 35
Summsry of data fro~ multiple determinations of guaiacol and
iodide TP0 activity measured in deoxycholate extracts,
prepared from 100 mm diameter dishes o~ the indicated cells.
Graves' disease-affected human thyroid cells were cultured for
3 days in 12.5 mU~ml human TSH.
nd - not done
YVO 93/031~ 2 1 ~ ,~ 8 0 P ~ /USg2/06283
-61-
EXAMPLE XII
TPO S~ecifi _ el~ls~ Lr3~e Thvroid in Graves' Disease
Taking advantage of the availability of reco~binant TPO~
the occurrence of in vivo selection for T cells specific for
this autoantigen in the intrathyroidal population has been
examined.
A. METHODS
Infiltrating mononuclear cells were extracted ~rom the
: thyroidec~omy specimen of a 26 year old female (CX81:HLA-Al~2; B8, 37; DR3; DRw52; DQw2) with persistently relapsing
Graves' disease and a high titer of antithyroid microsomal
antibodies ~1:640) by enzyme digestion followed by overnight
incubation and separation of the non-adherent cells as
~ previously described (Londei, M. et _al., Science 228:85-89
: (1985)). The activated cells were selectively expanded by
growth in recombinant: IL-2 (Ajinomoto - 20 ng/~l) and 10%
: 20 human serum in RPMl-1640 (6ibco) for one week. Cells were
:~ further expanded,:~ nonspecif~cally with the add~t~on of
~ irradiated autologous peripheral blood lymphocytes as f~eder
: ~ cells, OKT3 00noclonal antibody (30 ng/ml) and IL-2 for two
weeks prior to cloning at limited dilution ~0.5 eells~well)
with OKT3/lL-2 and DR-matched antigen presen~ing cells (APCj.
Further expansion and maintenance of all clones was by 1-2
weekly restimulations with OKT3/IL~2 and HLA un~atched
irra~iated feeder cells. Cells were assayed at the end of the
feeding cycle and a minimum of 5 days after their ~ast
3~ sxposure to IL-2.
Proli~eration assays were performed over 3 days in
:~ triplicate microtiter wells. Irradiated autologous P~L (2 - 5
x 104) were added to 104 clone T cells in 200 ~1 of 10% human
serum. 1 ~1 of neat microsome ~protein concentration 5 mg/ml)
W o 93/03146 ~CT/US92/06283~ :
-62-
was added per well. 1 ~Ci of [3H]thymidine was added for the
final 6 hours of the assay prior to harvesting onto glass
fiber filters and scintillation eounting.
Peripheral blood mononuclear cells purified by sucrose
S gradient centrifuga~ion (Ly~phoprep - Nycomed) were incubated
at 105 cells per well in ~icrotiter wells containing 200 ~1
10% human serum. Control or TPO microsomes in 1-2 ~1 were
: added per well as above. Cultures were incubated for 5-6 days
~: and pulsed with [3H]thymidine in the last 6-18 hours prior to
harvesting and scintil1ation counting.
Transfe~tion o~ CHO cells with the complete eDNA for
Human TPO cloned into the expression vector pECE and the
preparation of cell microsomes from trans~ected and
untransfected CHO cells was as described above.
B. RESULTS
_YiYQ activated thyroid infiltrating T cells were
: selected by growth in recombinant IL-2. The resultant
~: ~ populati:on was then further expanded non-specifically by
20: stimulation with anti^~lB3 antibodies (OKT3) in combination
::~ with IL-2. Lines so derived consistently showed a marked
~: : rcsponse to autologous thyroid epithelial cells in the
absence of added~antigen-presenting cells (APC). For examplet
: the following leYels of T cell stimulat~on, measured is
25 : : incorporation of radiolabeled thymidine9 were observed:
T cell~s: 51 ~ 3;cpm;
: . Thyroid epithelial cells ~TEC): 62 ~ 8 cpm;
~ cells + TEC: 6108 ~ 1040 cpm.
T cell clones were obtained by plating the lines at
limiting dilution (0.5 eells/well) followed by further
:~: expansion with IL-2 and OKT3. In this way, antigen-specific
selection was avoided prior to sereening of the clones.
: The complete sequence of human TPO eDNA was eloned into
the mammalian expression veetor pECE and transfected into
l w o 93/~3146 2 ~ 1 ~ 2 ~ ~ PCT/~S92~06283
-63-
Chinese Hamster Ovary ~CHO) cells as described above. These
transfected cells express high levels of immunoreactive and
enzymatical ly active TPO. Microsomes prepared from
transfected CHO cells were found to induce significant
proliferation of 5 of 24 clones derived from the
intrathyroidal population (Figure 17A). These cells showed no
response to untransfected CHO microsomes (Figure 17A).
In contrast, peripheral blood T cells (PBL) from the same
: indîvidual, from other Graves' patients, or fram normal
controls, responded to both transfected and untransfected
preparations (Figure 17B). PBL reactivity to CHO cell derived
proteins is not unexpected as similar reactivity has been
described with other xenogeneic cell extracts (~an Vliet, E.
et_al., EuroP. J.~Immunol. 19:213 216 (1989)). However, it
demonstrates the difference:in antigenic repertoire between
thyroid infiltrating and peripheral blood T cells, as at ns
: timé was any response to untransfected CHO microscmes seen
: :~ with thyroid-derived T cells (Fiyure 17A and Table IV).
~ ::
WO 93/03146 2~ ~L3 PCI/US92/06283
-64-
TABLE I I
Sites Of NP Synthe~ic Pe~tides In Human TP0
_ 933 ----
NP-1 111 ---- 131
NP-2 116 ---- 13~
NP-3 187 ---- 204
NP-4 234 ---- 250
NP-6 426 ---- 440
NP-7 535 ---- 551
NP-8 669 ---- 686
NP-9 693 ---- 716
NP-lQ 724 ---- 739
~: NP-13 : 487 ---- 504
Position of synthetic peptides used to screen T cells in human
TP0 sequence. Residues are numbered from the a~ino terminus.
TABLE I I I
~: ; Res~onses of T Cell: Clone c43 to NP Pep~ides
Peptide Concentration ~ua/ul)
- :
.0 1
: NP-1 ~ 48 72 52
: NP-2 85 54 63
~- 35 NP-3 59 62 62
NP-4 :~ 50 67 109 `~
~h NP-6 65 60 102
NP-7 ?71 6190 16235
NP-8 : 68 85 221
:~ 40 NP-9 69 S2 80
NP-1~ 63 101 55
NP-13 38 69 121
:~
Responses (in count~s pe~ ~inute, cpmJ of thyroid derived T
cell clone c43 to the panel of synthetic peptides of Table II.
Peptides were used at the concentrations shown. Response of
- ~43 + autologous feeders alone was 101 ~ 16 cpm. S.E.M. of
responses was consistently less than 15% of the mean. The
response of c43 to NP-7 was con~irmed in 5 subse~uent
experiments with similar resu~ts.
.
WO 93~03146 ~ ~ ~L 3 2 8 ~1 PCI`~US92/06283
-65-
TABLE IV
ResPonse of T Cell~l~s~t~l~icrosomes and to NP-7
Clpne Antiqenis PreparatioQ ~
Control TP0 APC+NP-7
Microsome ~licrosome_ APC 11OU~L1 )
c25 7~ ~ 13 8024 ~ 1144 123 ~ 32 78 ~ 8
c39 175 ~ 22 13824 ~ 1556 23~ ~ 19 276 ~ 65
c~5 54 ~ 11 1203 ~ 111 70 ~ ~ 64 ~ 6
c6~ 78 ~ 10 3757 ~ ~17 167 ~ 4 232 ~ 89
c103 75 ~ 12 4575 ~ 479 76 ~ 12 54 ~ 5
c43 6~4 t 39~ ~121 ~ 554 82 ~ 12 17173 ~ 1984
c75 84 ~ 15 151 t 30 346 ~ 107 25~4 ~ 135
c104 ~4 ~ 6 260 ~ 26 68 ~ 14 5Q15 ~ 747
c105 172 ~ 30 1028 ~ 141 5g9 ~ 5~ 4~5~ ~ 338
c3 71~11 78~20 75~11 60~5
c9 72 ~ 4 452 ~ 32 71 ~ 4 258 ~ 46
c18 63 ~ 3 62 ~ 10 49 ~
c20 126 ~ 21 704 ~ 89 102 ~ ~ 106 ~ 17
~29 121 ~: 27 156 ~ 17 1~7 ~ 7 86 ~ 5
~60 197 ~ 110 345 ~ 84 310 :~: 53 536 ~ S0
c64 50 ~ 3 150 + 13 86 + 20 228 ~ ~2
~70 ~ 76 + 17 138 + 23 93 ~ 20 154 i: ~0
~77 Sl ~ 8 645 ~ 28~ 94 ~ 11 242 ~ 43
c82 18~4 ~ 1434246 ~ 176 8318 ~ 191 6632 i: 292
c83 19~ ~ 44 139 ~ 26 130 :~ 13 77 ~ 7
s:94 :9~ 8 114 ~ 17 7~ ~ 6 ~2 8
~5 44 ~ 6 ~9 ~ 9 62 ~ 25 ~74 ~ 48.
c98 ~7 ~ 9 96 ~ 14 88 ~ 8 7û ~ 5
~100 99 ~ 15 81 1~ 2S2 + lû 1~
Res~onses of thyroid-deriYed T cell clones to ~P0 micros3mes
and peptide NP-7. - NP-7 ~10 ~g/ml ) or control or ~P0
m~crosomes ~0.5 to 1 ~13 were added per well as indicated.
Autologous i~radiated PBL or EBV-transforoed B cells were used
as antigen presenting cells (APC) at an APC:T cell ratio of
bet~eeen 2 and 5. RQSU1tS are the ~ean cpm (~ S.E.M. ) of
triplicate wells. Positive results were conf1rmed in 2 to 7
different experiments.
2~3~
W O 93/03146 PCT/US92/06283
-66-
Clones were further screened using a panel of 10
synthetic peptides based o~ the ~P0 sequence, seleeted using
two T cell motif algarithms (Rothbard, J.B., Ann. Inst.
Pasteur 137E:5l8 526 (1986); DeLisis, C. et al., Proc. Natl.
Acad. Sci U$A 82:7~48-7052 (l985)) as shown in Table II. Two
clones (c43 and c105) which showed only a small response to
TP0 microsomes (Table IV~ showed a spectfic response to a
~; peptide (NP-7) corresponding to residues 535-551 of TP0
(~able III and IV). Two additional clones ~c75 and c104),
unresponsive to the whole TP0 microsome preparation, showed
significant responses to NP-7. In contrast, the 5 clones
hi~hly reactive to TP0 microsomes (c25, c39, c65, c69, c103)
did not respond to NP-7 :(Table IV). No response to NP-7 was
seen with the patients' peripheral blood T cells (PBL alone =
609 + 190 cpm; PBL + NP-7 (10 ~g/ml) ~ 302 + 38 cpm).
C. DISCUSSION
~: The lack o~ recognition of NP-7 by TP0 responsive clones
suggests the presence ~o~ additional T cell epitopes on TP0
: 20: distinct from NP-7. The obser~ation that clones specific for
:; an epitope derivYd from the TP0 sequence (NP-7) are present at
high frequency in the thyroid infiltrate, and yet respond
poorly ~or not at all~ to whole ~P0 presented by APC of
peripheral blood origin, is noteworthy.
25: These results~ proYide the first clear evidence in human
organ-specif~c ~utoimmuni~ty Shat a significant propor~ion of
activated T cells infiltrating the target tissue recognize an
: antigenic protein specific to that tissue. This is consistent
with the ~inding of collagen type II-specific ~ cells in the
joint in rheumatoid arthritis (Londei, M. ~ L. eLQÇ~_~35
Acad. Sci. USA 86:636-640 (1989)). These results also define
the site of a T cell epitope within TP0 ~residues 535-551~ and
~:: provide e~idence for the presence of at least two distinst
~ epitopes on a single target molecule in the same individual.
:
2 1 :~ 3 2 Q. ~1
:. W O 93/03146 PCT~U~92/~6283 -67-
Such information is very important for the design of
appropriate peptide-based immunotherapy, as discussed above.
EXAMPLE XIII
Molecular:Determination of a B Cell EDito~e ofTP0
To determine preeisely, at the amino acid level, the
epitopes in human TP0 that are recognized by antibodies in the
sera of patients with autoimmu~e thyroid disease, a panel of
mAbs gene~ated against natural TP0 was studied. The binding
of some of these mAbs to TP0 was ;nhibited by patients' sera,
and determination of the TP0 epitopes recognized by these mAb
would, indirectly, define the disease-associated epitope(s).
This panel of 13 mAbs was used to screen a lambda-2ap
library constructed to eontain, exclusively, 20Q-500 bp random
fragments of TP0 eDNA. When expressed as bacteri~l fusion
proteins, 1j6 of the 3.8 x 1o6 cDNA fragments would express
random 66-166 amino acids fragments of TP0.
For sereening, binding of murine anti-TP0 mAb (1:4
dilut1On) was detec~ed using peroxidase-conjugated goat anti-
mouse i~munoglobulin antibodyO Positive plaques were revea~ed
with only one of the thirteen mAb tested (mAb-47). MAb-47
bound TP0 with; high:affinity but did not interfere with the
25 ~ enzymatic :actiYity::of TP0. Human anti-TP0 autoantibodies.
:: s~rongly inhibited the binding of mAb-47 at 1:20 dilution.
The nucleotide :sequences of seYen randomly selected
clones recognized by mAb-47 were determined. All the clones
: spanned ~he same region of the TP0 cDNA, overlapping in the
reg~on of 2180-2171~ bp. This region encodes 30 amino acids
(at pos~t~on 698-728) in the TP0 protein.
Anti-~P0 mAb-47 is unique among 13 mAbs tested in that it
recognizes a continuous epitope on TP0. The other mAbs
presumably recognize discontinuous epitopes. The competitive
binding to TP0 of mAb-47 and naturally occurring anti-TP0
2 1 1 3 ,~ ~ ~
WO 93/03146 . Pcr/US92/0628
-68~
autoantibodies suggests that mAb-47 defines a natural,
disease-associated TP0 epitope.
To further elucidate the molecular and cellular basis
for the pathogenesis of autoimmune thyroid disease, it will
be very important to identify the sites (epitopes) on TP0
recognized by the anti-TP0 antibodies in Hashimoto's
thyroiditis patients. Prior approaches to the examination of
this question have included the use of immunological probes
(polyclonal or monoclonal anti-TP0 antisera) (Libert, F., et
al., EMB0 J. 6:4~93-4196 ~1987); Ludgate, M., et al., J. Clin.
Endocrinol. Metab. 68:1091-1096 (1989); Doble, N.D., et al.,
Immunol. 64:23-29 (19881; Ruf, J., et al., Endocrinol.
125:1211-1218 (1989); Laing, P., J. Clin. Lab. Immun~l~ 19:19
23 (1986); Kohno, Y., et al., J. Clin. Endocrinol. Metab.
68:766-773 (1989)) and limited proteolytic digestion
(Yokoyama, N., et al., J. Clin. Endocrinol. Metab. 68:766-773
; (1989)). By these means, se~eral distinct antibody binding
regions appear to be present in TP0.
However, TPo is an ext:remely large antigen
; 20 (approximately 107 :kD), and these techniques have not allowed
~ ~ definition of the~precise epitopes involved. The present
;:: inventor therefore undertook to screen, with sera from
patients with Hashimoto's thyroiditist a bacteriophage
(lambda-Zap) human tbyroid:~cDNA~expression library containing
:25 large numbers o:f hTPO~cDNA~fragments. -~.
~ Each of these :fragments is 200-500 b.p. in length~
: : ~ coding for TP0 pol:ypeptides of 66-166 amino acids. The
: entire hTPn protein~ comprises 933 amino acids. These TP0
polypeptide fragments are expressed as bacterial fusion
proteins, so called because the protein is a hybrid of a 10
kD fragment of ~-galactosidase linked to the thyroid ~rotein
component.
::~
~ . WO93/03146 2 ~ ~28~ Pcr/US92/~6283
-69-
METHODS
TPO cDNA fraqment library construction: A full-length ~3.05
kb) cDNA clone as described above for human thyroid
peroxidase was released from its Bluescript vector
(Stratagene, San Diego, CA.) by digestion with EcoRI (BRL
laboratories~ Gaithersburg, MD) and NotI (Bochringer,
Mannhcim, West Germany). Because both vector and insert are
of similar length, the Bluescript was further digested with
ScaI (New England Biolabs, Beverly, MA.). The TPO cDNA was
purified by agarose gel electrophoresis and electroelution.
The cDNA was then digested ~6 minutes at room temperature)
into small random-sized fragments with DNAase I (0.1 ng
DNase/vg c~NA) (BRL) in 20 mM Tris-ffCl, pH 7.5, 1.5 mM MnC12
and bovine serum albumin, 100 vg/ml. After electrophoresis
in 2X SeaPlaque agarose (FMC Bio Products, Rockland, ME), TPO
cDNA fragments 200-500 brp~ in length were recovered by
electroelution. The ends of the fragments were blunted with
the Klenow fragment of DNA polymerase I~ and ligated to ~sQRI
:: linkers (GMTTCGGCACGAG) containing a nonphosphorylat~d ~QRI
: 20 cohesive end and a phosphorylated blunt end (Pharma~ia,
P1scataway, NJ). After phosphorylation with polynucleotide
kinase, excess linkers were removed by electrophoresis in 2%
SeaPlaque agarose. The lirker-ligated cDNA was again size-
selected ~200-500 b.p.), electroe?uted, ethanol precipitatcd
:~ 25 and I:igated into EcoRI-cut lambda-Zap vector (Stratagene).
:~ After packaging (giga Pak Gold, Stratagene), the library was
amplified in XLl-blue cells (Stratagene~. cD~A insert sizes
were confirmed by the polymerase chain rea~tion (PCR) ~Saiki,
R.K., et aI , Science ~39:487-491 (1988)) using the Bluescript
reverse and -20 primers. PCR analysis of the ~C2~ hTPO cDNA
: ~ region (Libert~.F., et al., EMBO J. 6:4193-4196 ~1987);
Ludgate, M., et al., J. Clin. Endocrinol. Metab. 68:1091 1096
(1989)) in the ~PO cDNA fragment library was performed using
t wo ol ig on ucl e otide 22-mer primers ~5'-
w O 93~3~ 3 2 8 ~ PCT/US~2/06283~`:
-70-
GGTTAC MTGAGTGGAGGGA6Ti and 5' - GTGGCTGTTCTCCCACCAAAAC)
spanning the region 1852 -2112 b.p. in hTP0 (17). PGR (30
cycles) was for 1 minute at 94-C, 2 minutes at 55-C and 1
minute at 72-0. For screening the library, the PCR-generated
DNA was labeled with 32P-~CTP to a specific radioactivity of
0.8 x 109 cpm/vg DNA using the random primer method
~Multiprime; Amersham, Arlington Heights, IL). The screening
procedure employed standard techniques (Maniatis, T., et al.,
Molecular BioloqY: A LaboratorY Manual, Cold Spring Harbor
Laboratory~ ~old Spring Harbor, NY (1982)), with final washes
of 30 minutes (x 2j at 55-C in 0.1 x SSC, 1% SDS buffer (1 x
SSC in 150 #aCl, I5 mM Na citrate, pH 7.5). Autoradiography
of the nitrocellulose fi~lters was performed with Kodak XAR-~
film.
ImmunoIoqical screeninq of the TP0 sub-l ibrarY: The lambda-
Zap library containing TPO cDNA fragments, plated in ~. coli
Y1090 at about 3:x 104 pfu per 150 mm diameter Petri dish,
~: was screened as; previously described (Seto, P.7 et al.~ ~.
ClinO lnvest.~80:1205-1208 (1987)). In brief, after 3.5
hours at 42-C, ni:trocellulose filters soaked in 10mM
: isopropyl-thio-beta-D-galactopyranoside ~(IPT6) were overlayed
for 3.5 hours at 37-C.~ Filters were removed, washed in TBS
buffer (1:0 mM Tris~HCl, pH 7.5,;150 mM:~Natl) containing 0.0~%
Tween, lncubated~ for: 15 minutes at room temperature in
TBS/Tween containing~2X Carnat~on ~ilk, rinsed with TBS/Tween,
: and then incubated~ overnight at 4-C :w1th antibody. For
nunological screening,~ rnouse monoclonal ant~body (#20.10)
against the thyroid microsomal antigen (Po~tmann, L., et aL,
J. Clin. Invest. 81:1217-1224 (1988)) was used at a 1:200
dilution. Because :of the very low background ~nd strong
~: signal achieved with mono lonal antibodies, pre-adsorption
: with bacterial proteins is not necessary prior to screening,
as previously described (Seto, P.~ et al.~ J. Clin. lnvest.
! WO 93/fl3146 2 1 1 3 2 8 ~ PCT/US92/06283
80:1205-1208 (1987)). Antisera from 13 Hashimoto's
thyroiditis patients with high titer tntimicrosomal an~ibodies
were used under a variety of different conditions at a
dilution of 1:200. In contrast to preYious experience in
S screening lambda gtll libraries with Hashimoto's sera (Hirayu,
H., et a L, J. Olin. Endocrinol. Metab. 64:S78-584 (1987~,
screening of the lambda-ZAP libraries provided very littl2
background with such sera, and, in general, pre-adsorption was
not required to reduce this non-specific background. When
pre-adsorption was performed, Y1090 proteins were immobilized
on nitrocellulose filters. ln addition, affinity-purified
anti-TPO antibodies, prepared using recombinant hTPO expressed
on the surface of Chinese hamster ovary (CHO) cells also were
used as immobilized antigen (Kaufman, K.D., et al., J. Clin.
Invest. 84:394-403 (1989~). For this procedure, 1 ml of
serum was diluted 1:10 in phosphate-buffered saline (PBS~
containing 0~05% ~ Na azide and lmM phenylmethyl
sulfonylfluoride (PMSF). TPO-CHO cells (approxlmately 108)
were resuspended by light trypsinization, diluted in PBS
containing 10X calf serum, pelleted (5 m1nutes at 1~000 x g),
and resuspended in the diluted antibody for 1 hour at 4-C.
Unbound antibody was removed by pelleting the cells, followed
by a rinse in ice-cold PB5. After recovery by centrifugation
5 minutes at l,OOO~ x 9), the cells were resuspended and
incuba~ed for 15~minutes at 4-C in 150 mM acetic ac~d ~n PBS
~ontaining 0.05% Na azide~and 1 mM PMSF. NaOH and 1 M Tris,
pH 7.5, were added to neutralize the acetic acid, and the
cells and particulate material were removed by centrifuyation
; (5 minutes at 1,000 x 9, and then for 30 minutes at 100,000 x
9, 4-C), leaving the affinity-purified antibody in the
supernatant~ The efficiency of the af~inity p~rification was
approximately 50%, as measured by ELISA (Schardt, C.W., et
al., J. Immunol. Methods 55:155-168 (1982)).
2 ~ 2 ~ ~
w o 93/03146 PCT/US92/06283`~
-72-
The detection systems for antibody bound to fusion
proteins were as previously described (Seto, P., et al.. J.
Clin. Invest. 80:1205-1208 ~1987)), using the following
antisera: For the mouse antimicrosomal monoclonal antibody,
peroxidase-conjugated, affinity-purified goat anti-mouse IyG
(heavy and light chain specific) ~Cappel, Organon, West
Chester, PA.) at a dilution of 1:300~ ~or the polyclonal
human antisera, anti-human IgG (Fc ~ragment, gamma chain
specific) (Cappel) at a dilution o~ 1:300. Color was
developed with 2.8 mM 4-chloro-1-naphthol (Sigma, St. Louis,
MO). The quality of the immunological reagents used in the
polyclonal antibody screening procedure was confirmed by
their ability to generate a strong signal with eukaryotic
recombinant hTPO on western blot analysis (Kaufman, K.D., et
al., J. Clin. Invest. 84:394-403 ~1989)). Positive clones
: were plaque-purified to homogeneity. Control screening of
potentially positive plaques was performed by omitting the
: first (anti-TP0) antibody in the screening procedure.
Nucleotide sequence analvsis of ~elected clones: Plaque-
purified lambda-Zap phage were used to generate Bluescript
plasmids containing the fragment o~ TPO cDNA whose respective
fusion proteins had been detected by the antisera. ~his
procedure used the helper phage R408 according to the
protocol of the manufacturer (Stratagene). Rescued phage~ids
were used to infect XLl-blue bacteria ~Stratagene). Plasmids
were prepared from individual colonies (Maniatis, T., et al.,
Molecular Biolaqy:_ A Laboratorv Manual, Cold Spring Harbor
Laboratory, Cold Spring Har~or, NY (1982)), and the sizes of
the cDNA inserts were assessed by digestion with EsoRI.
Nucleotide sequencing of se~eeted plasmid cDNA inserts was
performed by the dideoxynucleotide termination method (Sanger,
F., et al., Proc. Natl. Acad. Sci. USA 74:5463-5467 (1977)).
~ w o ~3/03146 21 i 3 2 8 0 PCT/US92m~283
-73-
Nucleotide sequence analysis was performed using the software
provided by Bionet.
RESULTS
Localization of the eDi~oDe_fo~____onoclonal antibodY aqainst
thYroid_Qeroxidase. In order to define ~he epitope~s) for
anti-TP0 antibodies in patients with autoimmune thyroid
disease, it was first necessary to determine the validity of
the immunologîcal screening of a hTP0 cDNA fragment sub-
library (Mehra, V., et al., Proc. Natl Acad. Sci. USQ
83:7013-7017 ~1986)).: For this purpose, a monoclonal antibody
generated against the thyroid microsomal antigen ~Portmann,
L., et al., J. _Clin. Invest. 81:1217-1224 (1988)) that had
been used successfully in the past to clone this antigen from
a Graves' thyroid cDNA library (Hirayu, H., et al., ? Clin.
Endocrinol. Metab. 64:578-584 (1987)) was used. The new TP0
cDNA fragment sublibrary constructed contained 3.8 x 106
recombinant clones, with an effective t~correct orientation
~ and reading frame) size one-sixth of this number. The insert: 20 sizes were confinmed:to be in the 200-500 b.p. range.
Screening of this ~library with the anti-microsomal
~: antigen monoclonal antibody yielded 6-12 ~positiYe plaques per
1,000 plaques screened. Fourteen positive clones were
randomly chosen: for: partial nucleotide sequencing to
25: delineate the position of their TP0 cDNA inserts relative to
: the entire TP0 gene~ Twelve of the 14 c~ones had cDNA
: inserts of 160-350 b.p. Two clones (U and Y) that had cDNA
inserts slightly larger~:than the expected 500 b.p. maximum
were fo~nd, upon nucleotide sequencing, to have double cDNA
inserts. As an indication of the success of the proced~re,
all 14 clones r~cognized by the monoc~onal antibody spanned
; ~ the same region (746~ 150 b.p.) of the hTP0 gene (Magnusson,
R.P.9 et al., Mol. Endocrinol. 1:856 861 (1987)) ~Figure 18).
The maximum region common to all clones, and therefQre an
2i ~ 328~
w o 93/03146 PcT/us92lo62s3;
-74-
indicativn of a common epitope, was between bases 881 and 927
(M MC CCA TGT TTT CCC ATA CM CTC CCG GAG GAG GCC C6G CCG
GCC), oorresponding to a derived amino acid sequenee of only
15 residues (Asn Pro Cys Phe Pro Ile Gln Leu Pro ~lu Glu Ala
Arg Pro Ala~. Therefore, the epitope recognized by the
monoclonal antibody lies within this 15 amino acid span.
EPitoPe(s L for the antimicrosl~mall~5L--3ntibodies in
autoimmune th~roid disease. Approximately forty screenings
of the same TP0 cDNA fragment sub-library described above
with sera from patients with Hashimoto's thyroiditis did not
yield any positive clones. The modifications that were tried
included: 1) the use of different host baeteria (BB4, XLl
blue and Y1090) in which to express the TP0 fusion proteins;
2) variation in the antibody binding detection system,
including the use of anti-human IgG antibody or protein A
:: ~rom different vendors, as:well as different incubation times
~:~ and temperatures; and 3) the use of thirteen differentpatients' sera with potent anti-TP0 activity. The sera were
tested in multip~e ways: without bacterial pre-adsorptton;
following adsorption with bacterial lysate; or after
affinity-purification with recombinant h~P0. As internal
controls in the~screening procedure, the ~onoclonal antibody
~: always yielded the expected number of positive clones.Quite surprisingly, it was not possible to detect the
25 : epitope expressed within the 86 amino acid C2 hTP0 - .
: polypeptide frag~ent, as previously reported (Libert, F., et
~: al., ~MB0 J. 6:4193-4196 t1987); Ludgate, M., et al., J. Clin.Endocrinol. Metab.: 68:1091-1096 (1989)). Because of the
possibility that the fragment library employed ~ight lack the
C2 region, S2 region presenee was tested by PCR, using
oligonucleotide primers complementary to each end of the C2
region. A fragment of the expected size (261 b.p.) was
clearly detected. Further, by using this PCR-generated
fragment as a probe to screen the library, it was determined
WO 93/03146 ~ PCl'/llS92/06283
-75-
that approximately lOYo of the plaques in the library contain
C2 sequence.
Because of these negative results with the Hashimoto's
thyroiditis sera in the hTP0 cDNA fragment llbrary, these
sera also were used to screen lambda-Zap Graves' thyroid
libraries (both oligo-dT and random-primed), constructed as
described previously ~Kaufman, K7D.~ et al., J. ~lin. Invest.
84:394-403 (1989)). The oligo-dT-primed library contains
n~merous full-length copies of TP0 cDNA ~3.1 kb), as was
demonstrated by the ability to express enzymatically active,
antigenically intact TP0, when such cDNA was subcloned from
: the phage vector into a eukaryotic expression plasmid, and
stably-transfected into eukaryo:tic Chinese hamster ovary cells
(Kaufman, K.D., et al., 3. Clin. Invest. 84:394-403 (1989)).
Despite this, no specific signal was detected in screening
this lambda-Zap library with 13 potent Hashimoto's sera that
strongly react immunologically with TPQ expressed in
eukaryotic cells ~Kaufman, K.D., et al., J. Clin.. Invest.
84:394-403 (1989)). ~ Many strongly reacting plaques were
observed in these~:screenings, in which plaques reacted w~th
the second antibody (anti-human lgG) even in the absence of
patients' serum. Similar findings were obtained in the past
with a Graves' thyroid cDNA:library in Iambda gtll (Hirayu~
~ H., et al., J. Clin. Endocrinol. Metab. 64:578-584 (19873).
:~ 25 These clones may represent l96 present in B-lymphocytes in the
:~ GraYes' thyroid gland:frsm:which the library was made.
A potential~ difficulty with protein expr~ssion in a
full-length cDNA phage library is that stop codons in the 5'-
untranslated region of the cDNA insert may interrupt the
translation of ths foreign protein, which is inserted
downstream of the ~-galactosidase portion of the fusion
protein. To eliminate this possiblity~ two additional
; approaches were attempted. The first was screening of a
~ random-primed human thyroid cD~A lambda-ZAP library,
2~13280
wo 93/03146 -76- Pc~r/US92/06283~'' '''
constructed in the same manner as the oligo-dT primed
library, with the exception that random primers, rather than
oligo-dT, were used for first strand cDNA synthesis. This
library contains cDNA clones with a bias against full-length
S cDNA copies. The second approach was to delete the 5'-
untranslated region from the full-length hTP0 cDNA clone in
the Bluescript plasmid generated from the lambda-Zap clone
~Kaufman, K.D., et al., J._Clin. Invest. 84:394-403 (1989)).
This deletion was accomplished by digestion of this plasmid
with XhnI, thereby releasing 154 b.p. of the 5'-end of hTP0
cDNA, leaving the entire TP0 protein (minus the signal
peptide) remaining in reading frame with the ~-galactosidase
component of the 81uescript plasmid. This new plasmid
construct was transfected into XL1-Blue host bacteria for
IS fusion protein generation ~Strata~ene, S~n Diego CA) and
western blot analysis. Neither the random-primed library nor
the ~h~I deletion mutant generated a hTP0 protein that could
be recognized by Hashimoto's antisera, or with anti-TP0
antibody affinity-purified from these sera using recombinant
hTP0.
,
DISCUSSIOII
The present ~ data provide the first definition, at a
precise molecular level, of an epitope recognized by an
antibody against a thy~oid autoantigen. Previous studies
; using polyclonal~ or monoclonal antibodies against human
thyroglobulin (Male? D.K., et al., Tmmunol. ~4:419-426 (1985)9
Fukuma, N., et ~al., Immunol. 67:129-131 (1989)) or TP0
(Libert, F., et al., EMBO J. 6:4193-4196 (1987); Ludgate, M.,
et al., J. Clin. Endocrinol Metab. 68:1091-1096 ~1989);
Doble, N.D., et al., Immunol. 64:23-29 (1988); ; Laing, P., J.
Clin. Lab. Immunol. 19:19 23 (1986); Kohno, Y., ~ L. J-
Clin. Endocrinol. Met~b. 68:766-773 (1989); Yokoyama, N., et
al., J. Clin. Endocr1nol. Metab. 68:766-77~ ~1989)) have
) w ~ 93/03146 2 1 ~ 3 2 8 `~ - PCT/US92/06283
-77-
suggested that these antibodies recognize different regions of
the antigen3 but no study has been able to localize an epitope
to a region of the molecule as small as 15 amino acid residues
in size. The minimu~ size of a B-cell (antibody-recognized)
epitope is under discussion, b~t is believed to be on the
order of S-10 amino acid residues (Van Regenmortel, M.H.Y., et
al., Immunol. Lett. 17:95 108 (1988)). Therefsre, the 15
residue span of the present invention is very close to the
size of the epitope itself.
A remarkable finding in this exampl Q iS ~he striking
contrast between the positive results with the anti-
microsomal/TP0 monoclonal antibody, and the inability of
naturally-occurring, disease-associated anti-TP0 antibodies
to recognize the 66-166 amino acid TP0 fragments expressed in
the library employed. Unlike more linear T-cell epitopes,
naturally occurring B-cell epitopes may be more
confornational, and subject to influence by the secondary or
even tertiary structure of the molecule. DislJlfide bands and
contiguity of loops of the folded protein that may be far
d~stant in its 1 inear structure, may corltribute to the
formation of a B-cell epitope. The present data suggest that
the epitope(s) for the disease-associated anti-TPO antibodies
are highly conformational.
: 25 EXAMPLE XIY
~rther Determinati:on of the ~ Cell EPitoQe on TP0
This example provides an important step in understanding
the pathogenesis of Hashimoto's thyroidltis by def~ning the
epitope recognized by antithyroid peroxidase (anti^TP0)
antibodies. ln Example XIII, a human TPO cDNA sublibrary was
constructed expressing random fragments of the protein (each
66-166 amino acids in length) (Mehra, V., et al., Proc. Natl.
Acad. Sci. USA 83:7013-7017 ~1986)). However~ serum from
J X ~
WO 93/03146 PCl`/US92/0628~;
-78-
patients with Hashimoto's disease with high titers oF anti-TPO
antibodies failed to recognize any of t~ese TPO protein
fragments. ln contras$, TPO fragments in this library were
recognized by a mouse monoclonal antibody (MAb) against
denatured human TPO. These data support previous evidenee
(Hamada, N., et al., J. Clin. Endocrinol. Metab. 64:230-238
(1987); Nakajima, Y., et al., M~l. Cell. Endocrinol. 53:15-23
(1987)) that the disease-associated TPO epitopes are hi~hly
conformational and are likely to be fonmed by noncontiguous
(discontinuous) regions of the linear amino aeid sequence.
This example presents the determination of the disease-
associated B-cell epitopes on TPO, using a panel o~ 13 MAb
generated against nondenatured human TPO (Ruf, J., et al.,
Endocrinol w Y 125:1211:8 (1989)). The binding of some of
these MAb to native TPO is inhibited by anti-TPO antibodies in
~ the serum of patients with autoimmune thyroid disease (Ruf,
;~ J., et al.~ EndDcrinoloq~ 1~5:1211-8 ~1989)), indicating that~: : these particular MAb epitopes correspond to or are in the
vicinity of the disease-associated epitopes. Determination of
: the epitopes for some of the TPO MAb in the panel could~
therefore, delineate molecular domains of the autoimmune
thyroid disease-associated B-cell epitopes.
~: : MATERIALS AND METHODS
~ :.
O Fraqment Librarv: The construction of the TPO rtndom
fragment cDNA library ~(3.8 x 106 plaque-forming units) has
been described previously. Immunoscreening of the library was
performed by standard techniques, as previously described,
using 13 mouse MAb generated against native human TPO ~Ruf,
J., et al., Endo~rinolonv 125:1211 8 (1989)). Posit~ve clones
:; were plaque-purified and used to generate Bluescript plasmids
for nucleotide sequencing of the cDNA inserts (Sanger~ F. ~ et
al., Proc. Natl. Acad. Sci. USA 74:5463-5467 (1977)). The
: i w o s3fo3146 2 ~ 1 3 ~ 8 ~ PCT/US92/06283
-79-
DNA sequences of independent clones were aligned with the TPO
cDNA sequence to localize the minimum region of overlap that
encompasses the epitope (Mehra, V., et al., Proc. Natl. Acad.
Sci._USA 83:7013-7017 (1986)).
Western Blots: Recombinant human TPO stably expressed by
Chinese hamster ovary cells was used as antigen. Cells were
cultured, scraped into buffer containing 10 mM Tris (pH 7.4),
0.25 M sucrose, 2 mg/mL bacitracint 1 mM phenylmethylsul~onyl-
fl~oride, 0.1 mM N-~-p-tosyl-L-lysine-chloromethylketone, and
0.1 mM leupeptin (all from Sigma Chemical Co., St. Louis, MO),
and a microsomal fraction was prepared, all as previously
described. The protein concentration was determined by the
method of Brad~ord ~Bradford, M.M., Anal. Biochem. 72:238-254
(1976)). Samples ~-100 ~9 protein) were treated with 2%
: sodium dodecyl s~lfate and 5% ~-mercaptoethanol (final
concentrations) and subjected to 7.5% polyacrylamide gel
electrophoresis (Laemmli, U.K., Nature ~ 680-685 ~1970~).
: Proteins were transferred to a ProBlot membrane (Applied
: 20 Biosystems, Foster City, OA) usihg the Milli8lot transfer
system (Millipore Co., : 8edford, MA) according to the
:~ manufacturer's recommendations. Membranes were processed as
previously described, with minor modifications. Incubations
with MAb ~1:1000 dilution~ were performed overnight at 4^C.
: ~ 25 MAb binding was :detected with horseradish peroxidase^linked
sheep antimouse ~immunoglobulin G F(ab')2 (Amersham
International, Aylesbury, Buckinghamshire, United Kingdom~
diluted 1:1,000 ~using 0.5 mg/mL 4-chloro-1-naphthol, 0.57
mg/mL imidazole~ 17% methanol, and 0.42X hydrogen peroxide as
substrate.
: RESULTS
w 0 9~/~ j4~280 PCr/USg~/06283
-80-
Of the 13 mause MAbs generated against nondenatured human
TP0 (Ruf, J., et aL., Endocrinoloqv 125:1211 8 (1989)), only
1 (no. 47~ recognized TP0 protein fragments expressed by the
cDNA library. The nucleotide sequences were determined for 18
randomly selected cDNA clones. All cDNA inserts spanned the
same region of the TP0 cDNA sequence (Figure 19). The minimal
region common to all cDNA fragments was between basepairs 2219
and 2247 of the human TP0 cDNA nucleotide sequence, coding
for 9 amino acids ~residues 713-721) in the protein. These
nine amino acids thus represent at least a part of the epitope
for anti-TP0 monoclonal antibody 47. The inability of the
other 12 TP0 MAb to necognize TP0 peptide fragments expressed
by the library could not be attributed to technical
difficulties in the screening procedure, because internal
controls, TP0 MAb 47 and TP0 MAb 20.10 (Portmann, L., et al.,
J. Clin. Invest. 81:1217-1224 (1988)) all were strongly
positive.
To compare the reactivity of the panel of 13 MAb to TPQ
fragments generated by the cDNA library (see above) with
reactivity to the entire TP0 ~rotein, Western blot analyses
~ were perfor~ed using these MAb as probes and recombinant human
- TP0 expressed in CH0 cells as antigen. For the TP0
fragments, only MAb 47 reacted with the entire TP0 molecule
under denaturating and reducing cond~tions (Figure 20). As a
control, TP0 MAb 20.10 (Portmann, L., et al., ~. Clin l nvest.
81:1217-1224 (1988)~, generated against the denatured protein
and previously shown to recognize a linear epitope between TP0
a~ino acids 266-281 IFinke, R., et al.. J. Clin. Endocrinol.
Metab. 71:53-59 (1990~), also detected a protein of similar
size. Consistent with previous enzyme-linked immunosorbent
assay data (Ruf, J., t al., ndocrinoloqY 125:1211-8 (1989)),
all 13 MAb against native TP0 immunoprecipitated nondenatured
reco~binant human TP0.
' wo 93/031~6 2 L 1 3 2 8 0 Pcr/usg2/o6283
-81 -
DISCUSSION
The present data demonstrate that only one (no. 47) of a
panel of 13 MAb generated against native hùman TPO reacts with
random 66-166 amino acid fragments of the 933-~mino acid TP0
molecule. Consistent with this observation, only MAb 47
recognizes intact TP0 after denaturation and reduction,
although all 13 MAb in this panel recognize native
: nondenatured human TPO (Ruf, J., et al., EndocrinoloaY
125:1211 8 (1~89)). In agreement with our findings, MAb 47 is
unique in this panel of TPO Mab, in that it was the only MAb
whose binding to TPO could not be abolished by dithinthreitol
: treatment of the protein. The epitope for TP0 MAb 47 (amino
acids 713-721) is different frGm that for TP0 MAb 20.10 (amino
~cids 266-281). Furthermore, TP0 MAb 20.10 reacts only with
denatured TPO (Portmann, L., et al., J. Clin._Invest. 81:1217-
24 (1988)).
Our findings reinforce the emerging concept that many B-
cell epitopes are conformational and are likely to be
discontinuous. By this;it is meant that epitopes on globular
proteins are :dependent on 3-dimensional structure and consist
of a number of different regions of the tinear protein brought
into apposition by protein folding. Thus, only 1 of 13 MAb
generated by immunizing mice with native TPO recognlzes a
: 25 linear epitope~ expressed in 2 TPO fragment library or after
: unfolding of T N by~:denaturation and reduction. Because MAb47 also recognizes the native TPO protein, amino acids 713-721
must be situated on the surface of human TPO (unlike amino
acids 266-281 recognized by ~P0 MAb 20.10). Other cont~guous
loops in the folded protein deriYed from d~fferent regions of
the linear sequence may also contribute to the epitope for MAb
47. Amino acids 713-721 may be the minimum needed for
reoognition by the antibody.
2 ~ 1 328 ~
WO 93/03146 PCI`/US92/06283 .
-82 -
The binding of TP0 `MAb 47 to human TP0 is inhibited by
anti-TPO antibodies in the serum of patients with autoimmune
thyroid disease (Ruf, J., et al., Endocrinoloq~ 125:1211-8
(1989~). Therefore, the linear nine-amino acid (residues 713-
721) epitope for MAb 47 either corresponds or is close to an
autoantibody-asssciated TP0 B-cell epitope. The present data
define specific amino acids in a domain containing an epi~ope
for thyroid autoantibodies. Competition studies with MAb 47
(Ruf, J., et al., Endocrinology 125:1211-8 tl989)) suggest
that the idiotypic antibody in autoimmune thyroid disease
serum that interacts with the MAb 47 epitope is uncommsn.
EXAMPLE XV
OverexPression of Secreted hTP0 in Non-ThYroidal EukarYotic
Cells
~; Previous examples describe expression of reoombinant
~: human TP~ (hTP0) as both the native, membrane-associated
~: enzyme and as a truncated,~ secreted protein. In the present
.example, the overexpression of the secreted form of
recombinant hTP0 in eukaryotic cells is described. hTP0 gene
: amplification was accomplished with a vector containing the
: ~ mouse dihydrofolate ~ reductase (dhfr) gene. Stably
;~ ~ transfected Chinese~hamster ovary ~CH0) c~lls were grown in
the presence of progressively increasing concentrations of
: methotrexate (MTX). TP0 expression was measured
~ i~muoologically in an enzyme-linked immunosorbant assay
: ~ELISA) using anti-TP0 antibodies. Attempts to also
overqxpress the wild-type~ membrane-associated for~ of the
. enzyme w~re less successful. ~hile some amplification of the
native hTP0 gene was observed, it was not possible to aohieve
a level of protein expression significantly higher than that
ob~erved in some high-producing cell lines prior to
initiation of selective pressure by MTX. Indeed, above 100
nM MTX, the immunoreactive hTP0 content of cells actually
~ ~ w o 93/03146 2 ~ 1 3 t? 8 ~ PCT~US92/06283
-83-
diminished. In contrast, progressive overexpression of the
truncated, secreted form of hTPO up to a final MTX
concentration of lO,OOO nM was observed. Slot-blot analysis
of genomic DNA from transfected cells revealed parallel
amplification of the dhfr and truncated hTPO genes. High-
: leYel expression of seereted hTPO provides a means by which
large amounts of biologically and immunologically active hTPO
protein may be obtained.
MATER~ALS AND METHODS
: Construction of the exPressiun Dlasmid--~lsLL~ =LL~:h
and DSV~-DHFR-ECE-hTPO-MI~: Full-length hTPO cDNA in the
expression vector pECE was digested with ~y~I and the ends
blunted with the Klenow fragment of DNA polymerase I. The
expression vector pSV2-dhfr (kindly provided by Dr. G~rdon
Ringold, Syntex, Palo Alto, ~A~ was digested with ~RI, the
ends blunted with Klenow fragment of DNA polymerase I, and
the vector treated with bacterial alkaline phosphatase. The
blunt-ended~ linearized ve~tor and cDNA were ligated together
to form the recombinant plasmid pSV2-DHFR-ECE-HTPO. The cDNA
;h ~ coding for the secreted~:form of hTPO thTPO-Ml), generated in
Bluescript by site~directed ~utagenesis, was exchanged for
wild-type hTPO cDNA in the plasmid pSV2-DHFR-ECE-HTPO to
generate pS~2-DHFR-ECE-HTPO-MI.
Transfection o~_pSV2-DHF~:ECE-HTPO and ~SV2-DHFR-ECE-~
into _C~ ghfr- cells and amp1i~i~ation with meth~t~çxate:
~:~ CHO dhfr- cells (CHO-3G44; kindly provided by Dr. Robert
Schimke, Stanford University, Palo Alto, CA) were maintained
3C in Ham's F-12 medium supplemented with 10% fet~l calf serum,
~:: penicillin ~lOO U/ml), gentamicin ~40 ug/ml) and amphotericin
B (2.5 ug/ml). ~ransfection with plasmid DNA (10 ug) was
: performed by the calcium phosphate precipitation method (Chen,
;~ C., et al., Mol. _Cell. Biol. 7:2745~2752 (1987)).
2~32~
w o 93Jo3146 PCT/US92~06283C~,
-84-
Transfected cells were selected for in thymidine-, guanidine-,
and hyposanthine-free Ham's F-12 medium supplemented with 10%
dialyzed fetal calf serum and antibiotics as above.
Individual clones were selected with cloning cylinders and 2
S clones with high levels of TP0 expression (clones CH0-HTP0-2B
and CH0-HTP0-C4C) were subsequently used for amplification.
Methotrexate ~MTX) was added to this selective cell culture
medium as an initial concentration of 3.3 nM and surviving -~
:
~ cells were harvested and expanded. The methotrexate
;~ 10 concentration was~ sequentially increased by 3.33-fold
increments until a final concentration of 10,000 nm (100 ~M)
was reached. ~ ~
ELISA of CH0-hTP0 and CHO-hTPO-Ml cells: ELISA of human sera
(kindly provided by Dr. Sandra McLachlan, Cardiff, ~ales, UK)
of control and MTX-treated CH0-hTP0 cells was modified from
the method of Schardt ~ 311 ~J. Immunol. Metho~ 55:155-168
(1982)), as described ~above, using cellular microsomes.
Because the hTP0-Ml~protein ~is secreted into the medium of
~CH0-hTP0-M1 cells,~ three-day conditioned media~were collected
from these cells.~ Proteins from these media were precipitated
and treated, as described above. Antigen for ELISA of human
sera~was applied~as;l oa ~ul~ of~the dialyzed~protein precipitate
per well, approximately 300 ug protein;~ diluted 1:1 in 2 x
~ coating buffer~(O.~ M~ sodiu~ bicarbonate, pH 9.3 + 0.04X
~` sodium azide).;~B~ecause~more than one ELISA was used for all
MTX concentrations,~ values are reported as an ELISA index
;~ ; referenced to 1000 nM~MTX~;values used~ across assays of each
cell type. The same sera were used in ELISAs of each cell
type.
.
Genomic DNA extraction of CW0-hTP0-M1 cells: Cells from
confluent 100 mm diameter dishes of CH0-hTP0-M1 cells
surviving at each MTX concentration were frozen and kept at
.
.~ WO 93/03146 2 ~13 2 8 ~ Pcr/us92/o6283
. .~
-85-
-80-C until replated (100 mm dish), grown ~o confluence, and
used ~or extraction of genomic DNA. Cells were rinsed three
times in 5 ml ice-cold Dulbecco's phosphate-buffered saline,
calcium- and magnesium-free (PBS-CMF). The cells were then
scraped from the dish, recovered by centrifugation for 10
minutes at 2000 rpm, 4-C. ~he pellet was resuspended in 2
volumes (100-200 ul) 320 mM sucrose9 10 mM Tris-Clq pH 7.59 5
~ MgCl2, 17~ Triton X-100, and kept on ice for 30 minutes.
The suspension was centrifuged for 15 minutes at 2500 rpm
:10 ~4-C), and the pellet resuspended in 4.5 ml 10 mM NaCl, 10 mM
Tris-Cl, pH 7.5, 10 mM EDTA. RNAse digestion (addition of
4.5 ~l iO ~g/ml DNase-free RNase for 60 min at room
temperature) was followed by pr~teinase K digestion
overnight at 37-C (addition of 0.5 ml 10~ SDS + 0.1 ml 10
mg/~l proteinase K)~ The DNA was then extracted two or three
: times (until the aqueous phase was clear) with 5 ml 0.1 M
Tris-buffered phenol, pH 7.4:CHCl3~ 4% isoamyl alcohol ~ 1:1 ),
followed by an equal volume extraction with CHCl3, 4% isoamyl
alcohol. The D~A was precipitated with 0.1 vo~ume 3 M sodium
acetate, pH 5.2 and 2 volumes ethanol at -80-C for 2 hours and
the pellet resuspended in 0.5 ml TE (10 mM Tris, pH 8.0, 1 mM
EDTA). Quality and quantity of genomic DNA samples were
:~ assessed by agarose gel e7ectrophoresis and OD at 260 nm.
~ 6enomic DNA yield ~ro~ a 100 ~m dish of confluent cells was
: ~ Z5 40-160 ~9.
:
S1Q~ blot analvsis of CHO-hTPO-M1 cells: 6enomic DNA ~15 ug)
from CHO-hTPO-M1 cells :was digested with EcoRI, ethanol-
pre~ipitated, resuspended in TE buffer, and requantified by
OD at 260 nm. Aliquots of this DNA (1.0, 0.5, or 0.25 ug~
were diluted in 0.5 ml 0.4 N NaOH, 10 mM EDTA, boiled for 10
minutes and placed on ice. Nylon membrane filters (Hybond-N
RPN, 3050N, hmersham ~orporation, Arlington Heights, IL),
rinsed in 0.4 N NaOH, were applied to a slot-blot apparatus
21132~
WO 93/03146 PC~/US~2/0628
-~6-
(Minifold II, Schleicher & Schuell, Keene, NH) and the wells
were rinsed with 0.5 ml 0.4 N NaOH and vacuum dried.
Individual 0.5 ml genomic DNA samples were added per well,
vacuum was applied brief~y, and the wells were rinsed with
0.5 ml 0.4 N NaOH and vacuum dried. Fhe filters were
removed~ washed briefly in 2x SS~ (0.3 M NaCl, 0.03 M sodium
citrate, pH 7.0) and air dried. 6enomic DNA was cross-~inked
to the filters by UV irradiation (UY Stratalinker 2400~
Stratagene, La Jolla, CA), and the filters probed with a
labeled, PCR-derived, 0.3 kb fragment of the mouse dhfr cDNA,
washed, and autoradiograms performed. Following confirmed
removal of first label after boiling in 0.1x SSC (0.015 M
NaCl, 0.0015 M sodium citrate), 0.1% SDS for 1 hour, the
filters were reprobed with a labeled 0.56 kb fragment of human
TPO cDNA, washed, and photographed.
RESULTS
~: Recombinant plasmids pSV2-dhfr-ece-hTPO and pSV2 dhfr-
ece-hTPO-M1 were transfected into CHO dhfr- cells to produce
CHO-TPO and CHO-TPO-M1 cell lines, respectiYely. ~hese cell
lines were grown in progressively increasing (3.33 fold) MTX
: concentrations up to 1000 (membrane-associated hTPO) or
10,000 (secreted~hTPO), each cycle taking a ~inimum of three
weeks. Cells at each stage of ampl if ication were cryo-
preserved and were replated after the final amplification
~: step for comparisoo of the levels of immunoreactive hTPO
expression.
~:~ Content o~ wild type membrane-associated human TPO in
microsomal fractions from cell lines CHO-HTPO-25 and CHO-
HTPO-C4C was quantitated immunologically by ELISA using anti-
TPO antibodies in Hashimato's thyroiditis serum. In bsth cell
lines, some degree of amplification of TPO immunoreactiYity
was evident with increasing MTX concentrations, reaching a
: maximum at 100 nm MTX. This increase was followed by a
~328~,
WO93/03146 PCl/US9~/06283
-87 -
gradual fall in immunoreactive TPO protein at higher MTX
concentrations up to 1 uM. There was a minimal increase of
TPO expression in CHO-HTPO-C40, the cell line with the higher
basal (pre-MTX) hTPO content. While there was a greater
increment in TPO expression in CHO-HTPO-2B cells, the maximum
level achieved was only slightly higher than that in the CHO-
HTPO-C4C cells. During MTX-induced gene amplification of both
the CHO-HTPO and CH0-HTP0-Ml cells, there appeared to be
: greater cell death at the 100 to 333 nM MTX step than at lower
10 `~ concentrations, with a delay in growth of surviving cells to
confluence.
In contrast to the limited overexpression of TPO with
the membrane-associated form of the enzyme~ overexpression of
the secreted form of hTPO by CHO-HTPO-Ml cells was much
greater. In these cells, most of the TPO is secreted into
the medium, with little remaining in the cells. TPO
expression increased markedly ovsr baseline beginning at 333
: ~ nM MTX, with progressive increments up to the highest
~;~ concentration of used (10 uM). Slot-blot analysis of geno~icZO DNA:from CHO-HTPO~Ml cells using either a dhfr o~ hTPO DNA
probe revealed similar amplification patterns parallel to
that of the pattern of TPO protein expression.
: A comparison was :made of the amount of TPO available
fro~ the membrane-asssciated (CHO-HTPO-2B cells) and secreted
protein ~CHO-HTPO-Ml cetls) for ~mmunological detection in an
: ELISA. Three-day~condjtioned media from a single 100 mm d1sh
: of confluent CHO-HTPO-Ml cells (1:0~ uM MTXJ yielded
significan~ly more TP~ ~protein than did microsomes prepared
from a 100 mm confi uent dish of CHO-HTPO-2B cells (100 nM
MTX), Both of these cell lines repr~sented their highest
levels of TPO expression.
2 i i ~ 2 8 u
WO 93~03146 P~r/US92/0~28
-88-
~ EXAMP~E XYI
The Role of Carbohydrate Moieties in Reco~n _ion Q f TP0 bv
Anti-TPO Antibodies in Hashimoto's Thvroiditis
Carbohydrate moieties on hTP0 may contribute to the
epitopes recognized by anti-hTP0 antibodies in Hashimoto's
thyroiditis. This is because bacterial fusion proteins,
unlike proteins expressed in eukaryotic cells, are not
glycosylated. Very little is known about the carbohydrate
moieties in hTP0. Human TP0 (Ruf, J., et al., Acta Endocrinol.
SUW1 . 281 :49-56 (1987) ) and the microsomal antigen (Kajita,
Y., et al., EEBS Lett.. 187:334 338 (1985)) are bound to the
lectin concanaval:in A:. The latter is also partially bound to
lentil lectin (Kajita, Y., et al., FEBS _Lett. 187:334-338
(1985)). It is unknown whether the hTP0 carbohydrate
:~ structures are N-linked? 0-1 inked~ or both. In the present
; ~ example, the nature of the carbohydrate components of hTP0 was
examined, and whether or not hTPO carbohydrate plays a role in
the structure of naturally occurring epitopes in Hashimoto's
20~ thyroiditis.
.
METH005 AND MAT~RIALS ~
Cell culture.~_ Protein __E~diolabelino and . hTPQ
munoDreG1pitation: ~Chinese ha~ster ovary (CH0) cells
stably expressing:human hTP0 (CH0-TP0 129) ~Kaufman, K.D., et
, J. Clin. Invest.~84:394-403 (1989)) were cultured in 100
mm diameter dishes ~in~ F12 medium containing lOX, fetal calf
serum,:100 U/ml penicillin, 40 ~g/ml gentamicin and 2.5 ~g/ml
~ amphotericin B. For radiolabeling, subconfluent cells were
: 30 rinsed twice in ~phosphate-buffered saline without calcium and
magnesium (PBS-CMF),:and were then incubated for 15-20 minutes
~: in methionine~free F12 medium ~3 ml/dish) containing lOX,
dialyzed fetal calf serum. 35S-methionine (>1100 C;/mmO1-,
~:~ Amersham, Arlington Heights, IL) was then added to the medium
~3 WO 93/03146 2 ~ 1 3 2 8 0 PCr/US92/06283
-89-
(0.2 mCi/ml), and the incubation was ~ontinued for 2-4 hours
at 37-C. The medi~m was removed and the cells were rinsed
twice in P~S-CMF, scraped into ice-cold PBS-CMF, pelleted for
10 minutes ~t 1000 x g (4-C), washed once in 10 ml of the same
buffer, and the cell pellet resuspended (0.3 ml/dish of cells)
in homogenizatisn buffer (50 ~M Hepes, pH 7.5, 1% Triton X- -
100, 0.1 mM phenylmethylsulfonyl fluoride, 2 mg/ml bacitracin,
0.25 mM TLCK (N-p-tosyl-l-lysine chloro-methyl ketone) and 0.1
mM leupeptin (Sigma Chemical Co., St. Louis, M0). After
shaking for 1 hour at room temperature, the mixture was
centrifuged for 1 hour at 100,000 x g (4-C), and the
: supernatant was diluted to 1 ml in immunoprecipitation buffer
: 510 mM Na phosphate, pH 7.2, 1 M NaCl, 0.1~ Na dodecylsulfate,
0.5% NP-40 and 2 ~M EDTA).
The 1 ml of solubilized cellular proteins was pre-
adsorbed twi~e for 10:~minutes at room temperature with 80 ul
of 10% IgG-Sorb (Staphylococcus A3 (The Enzyme Center, Malden,
MA), follo~ed by removal of the IgG-Sorb by centrifugation
for 3 minutes at 10,000 x g in a microfuge. Hashimoto's
: 20 ~ thyroiditis sera with high titers (ELISA readings ~1.5 O.D.
units) o~ anti-hTP0 antibodies were:added to a final dilution
of: 1:2aO. Similar~:results were obtained with three separate
sera. After incubation: :overnight at 4-C, 150 ~l of Ig~-Sorb
were added, and the~ tubes rotated end over end for 2-4 hours
a~t room temperature. : ~ The IgG-Sorb was recovered by
centrifugation~ for 5~minutes~at 10,000 x g, washed 5 tî~es
with 1 ml of immunoprecipitation buffer, and then once with 10
ris, pH 7.5, 2: ~ ~ EDTA and 0.5~ Na dodecylsulfate.
Finally, the pellet was resuspended in Laemmti sample buffer
~31), with 50 ~M dithiothreitol (~TT), boiled for 3 min~tes,
and applied t~ 6% polyacrylamide gels. Molecular weight
markers (sigma9 St. Louis, M0) were as follows: 205 kD
~:~ : myosin; 116 kD ~-galaetosidase; 97 kD phusphorylase b; 66 kD
~,rJ,~~ "~, ,;,;i "~ ,,",}~,~;~,,~" ,," ", ",~
WO g3/03146 PCr/U~92/06283~
-90-
bovine serum albumin; 45 kD ovalbumin. Au~oradiography was
performed with Kodak XAR-5 film.
EnzYm~tic _deqlYcosYlation of immunoDreciPitated human
TP0: Recombinant, radiolabeled hTPO, immunoprecipitated and
S bound to lgG-Sorb, as described above, was recovered in
enzymatic digestion buffers rather than in Laemmli sample
buffer. Enzymatic digestions (18 hours at 37-C) were as
follows: endoglycanase F (Boehringer-Mannheim, West Germ~ny,
30 U/ml; in 100 mM Na phosphate buffer, pH 6.0, 50 mM EDTA,
0.1% SDS, 1% beta-mercaptoethanol and l% NP40); endoglycanase
H (Boehringer, 0.2 U/ml; in the same buffer as for endo F,
except that EDTA was omitted); 0-glycanase (Boehringer, 2.5
U/ml; same buffer as for:endo H); and neuraminidase (Sigma, l
U/mli in 100 mM Na acetate, pH 5.2, 5 mM EDTA and lX ~-
mercaptoethanol). As a control, to monitor degradation of
~ the hTP0, each exper1mant inoluded a sample incubated in
:~ parallel without added enzyme.
Lectin affinltY chromatoqraDhy: Detergent extracts of
CH0-TP0 cells ~5-7 l00;~mm~diameter dishes) were radiolabeled
with 355-methionine~(see:~above) and applied to 2 m~ bed
: volume columns of Concanavalin A ~Con Al, peanut agglutinin
(PNA), wheat ge:rm;agglut~nin (WGA), Ricinus communîs agglutin
l (RCAl) and Ulex~ Europaeus (UEA-F) agarose-bound lectins
all purchased from Vector Laboratories, Burlingame, CA).
For application to the columns, samples (0.3 ml) were d1luted
to lO ml: in Buffer~A~(20 mM ~ris HGl, pH 7.4, l~0 mM NaCl,
0.1% Triton X-lO0)~, supplemented with the following for each
~: individual lectin:: WGA~ and RCAl- 1 mM EDTA; Con A - lmM
CaC~2, 1 mM MnC12; PNA - lmM CaGl2, 1 mM MgC12; UEA F - lmM
CaC12. After application to the columns, the unbound
proteins were removed by washin~ with 50 ml of the forcgoing
Buffer A's. Specifically adsorbed proteins were eluted with
25 ml of the following (all at 300 mM):- WGA, N-
acetylglucosamine; PNA and RCAl, D-galactose; Con A, ~-
' .~ WO 9~S/03246 2 1 1 3 .~ ~ ~ P~/US92/06283
-31 -
methyl^D-mannnside; and UEA-F, ~-fucose. Fractions of 0.5 ml
were collected and counted for radioactivîty in a liquid
scintillation counter. The two fractions containing the peak
of the eluted radioactivity were pooled (1 ml) and subjected
to immunoprecipitation with anti-hTP0 antibodies in the sera
of patients with Hashimoto's thyroiditis, followed by
polyaerylamide electrophoresis and autoradiography (see
above).
RE~ULTS
As described above, the derived amino acid sequence of
human TP0 (Magnusson, R.P., et al., Mol. Endocrinol 1:856 861
(1987); Kimura, S., et al., Proc. Natl. Acad. Sci. USA
84:5555-5559 (1987); Libert, F., et al., Nucl. Acids Res.
15:6~35 ~1987) )~ suggests that there are 5 potential
: glycosylation sites in the extracellular domain of the enzyme.
This is based on the tri-peptide algorithm for glycosylation
~:: sites of Asn-X-Ser/Thr (X refers to any amino acid; the thirdposition can be either Ser or ~hr3. Carbohydrate chains can be
linked to the Asn residue (N-linked3, or to the Ser or Thr
residues (0-linked).
To determine whether hTP0 carbohydrate moieties were N-
linked, 0-linked, or both, and also to obtain information
about the charac~eristics of the carbohydrate component(s~,
2S: : hTP0 was digested:~with a~number Df d~glycosylating enzymes of
ary1ng specificity. To prepare radiolabel~d hTP0, pruteins
in Chinese hamster ovary (CH0) cells expressing recombinant
~: h~PO: were radiolabeled with 35S-methionine, followed by
im~unoprecipitation with anti-hTP0 antibodies present in the
~ i .
serum of patients with Hashimoto's thyroiditis. As observed
: previously on western blot analysis (Kaufman, K.D.~ et al.~ J.
Clin. Invest. 84:394-403 (1989)), recombinant hTP0 was
present as a doublet of approximately 115 kD and 110 kD, with
the relative dominanee of the 115 kD and the 110 kb bands
211~i~8~ù
WO 93/03146 PCI`/US92/06283
-92 -
varying from experiment to experiment. Digestion with
endoglycosidase (endo) F, which removes both complex and
polymannose (Thotakura, N.R., et al., Meth. EnzYmol. 138:350
359 (1987)) N-linked glycans by cleaving the glycosidic
linkage between the two N-acetyl glucosamine (GlcNac) residues
in the chitobiose core, increased the electrophoretic mobility
of the hTP0 doublet to approximately 110 kD and 105 kD. Endo
H, which acts similarly to endo F on polymannose but
differently from endo F on complex glycans, also converted the
mobility of hTP0 to a 110 kD and 105 kD doublet. In co~trast,
0-glycanase and neuraminidase, which remove 0-linked glycans
and terminal neuraminic acid, respectively, did not alter the
mobility of radiolabeled hTP0. These data suggest that human
TP~ contains only polymannose N-iinked glycans.
1~ Lectin af~inity chromatography (Merkle, R.K., et al.,
: ~ Meth. Enzvmol. ~ 232-259 (l987)) provided further support
for the polymannose::nature of ~he hTP0 carbohydrate moieties.
Thus, radiolabeled, recombinant hTP0 was retained only on
cQncanavalin A-Sepharose~ which binds with hiyh affinity to N-
~ 20 linked oligosaccharides in which at least two outer mannos@
: ~ resid~es are either unsubstituted, or are substituted on~y at
: ; - position C-2 by another sugar. Bound hTP0 could be eluted
with 300 mM ~-methyl-D-mannoside. TP0 did not bind to wheat
germ: agglutinin~(specificity for terminal and ~nternal GlcNac
25~ and terminal neuraminic acid), Ricinus communis agglutinin 1
(RCA1) (highest affinity~ for bi- and tri-antennary N-linked
oligosaccharides with~ terminal galactose resid~es), peanut
agglutinin (termi~al Gal-~-1,3-GalNac) or Ulex europaeus
(terminal ~-L-fucose).
Having determined the type of carbohydrate present in
: reeombinant human TPO, the:inventor invest~gated whether theseresidues play a role in the disease-associated epitopes on
hTP0 that are recognized by anti-hTP0 antibodies in
Hashimuto's thyroiditis.
~: 1 Wog3/03146 2; ~L 3 2 ~ ~ Pcr/us92/o6283
-93 -
Radiolabeled recombinant hTPO was first partially
p~rified by concana~alin A-Sepharose affinity chromatography,
next digested with three different glycanases, and finally
subjected to immunoprecipitation with anti-hTP0 antibody in
Hashimoto's thyroiditis serum. Complete removal of the N-
linked carbohydrate chains distal to the chitobiose core with
endo F and endo H did not prevent antibody binding. In view
of the complexity of these experiments, it is importank to
note the completeness of N-glycanase treatment. Thus, after
deglycosylation, all of the hTPO immunoprecipitated was as the
smaller (110 kD and 105 kD) doublet. As a further control,
digestion with 0-glycanase led to the imm4~oprecipitation of
an unaltered hTP0 form (115 kD and 110 kD).
DISCUSSION
Previous studies have shown that the thyroid microsomal
antigen (Kajita, Y., et al., FE~S Lett. 18~:334-338 (1985))
~: and immunopurified, non-recombinant human TP0 (Ruf, J~, et
al., ~cta Endocrinol. SUD~-1. 281:49-56 (1987)) are bound by
concanavalin A. However, the present in~entor is not aware
of other data on the nature of the oligosaccharide (glycan)
~ moieties in human TP0. By taking advantage of the expression
;~ of recombinant human TP0 in non-thyroidal eukaryotic cells as
: described hereinabove9 the present data provide new
information on this subject.
Thus, by both glycan enzymat~c digestion and by
dl~ferential lectin affinity chroma~ography, the data
presented in this example provide strong evidence that all the
carbohydrate moieties on hTP0 are linked to Asn residues (N-
1 inked) and not to Ser or Thr ~O-l inked~. Furthermore, the
selective deglyeosylation with endo H (Thotakura, N.R., et
al., Meth. _En7ymol. 138:350-359 (1987)), as well as the
seleetive adsorption to concanavalin A (Merkle, R.K., et al.,
Z~ 3146 Pcr/usg2/o628
-94-
Meth. Enzymol. 138:232-259 (1987)), suggests that these N-
linked oligosaccharides are o~ the polymannose variety. ~:
Most important ~rom the perspective of the pathogenesis
of Hashimoto's thyroiditis, the present data indicate that the
S ol igosaecharides present in hTP0 do not significantly
influence the epitopes recognized by anti-hTP0 antibodies in
the sera of patients with autoimmune thyroid disease,
primarily Hashimoto's thyroiditis.
An assumption inherent in the present example is that the
glyçan components of recombinant hTP0 are structurally the
same as those in TP0 present in human thyroid cells in vivo.
While it cannot be excluded that Chinese hamster ovary cells
may glycosylate the hTP0 polypeptide chain in a manner
different from human thyroid cells, ;t is likely that any
such differences would be minor. Thus, unlike the
. polypeptide glycosylation pa'tern in yeast and bacteria,
glycosylation in eukaryotic Chlnese hamster ovary cells would
be very similar, if not identical, to that in human thyroid
cells. Further support for this assumption is that
r~ecombinant hTP0 in Chinese hamster ovary cells is
functionally actiYe~ at the same level present ~n human
thyroid cells in monolayer culture ~Kaufman, K.D., et al., J.
Clin. Invest. 84:394-403 (1989)). In add~tion, virtually all
: sera from patients with Hashimo~o's thyroiditis that contain
anti-microsomal antibodies can recognize th~s form o~ -
recombinant human TPO on western blot analysis (Kaufman, K.D.,
et al., J. Clin. Invest. 84:394~403 (1989)) or by ELISA.
Thus, by definition, the recombinant human TP0 of the present
invention contains the releYant, disease-associated epitopes
on hTPO.
The present. findings that removal of the carbohydrate
moieties on human TP0 does not affect the antigenicity o~ the
molecule with respect to recognition by anti-hTP0 antibodies
in Hashi~oto's thyroiditis serum are consistent with data
wo93/03146 211 3 2 8 ~ PCI`/IIS92/062B3
_95
obtained with ~unicamyc~n (see Example XIJ. However, the
present data are much stronger.
The present data suggest that oligosaccharide camponents
in hTP0 are not part of the ~natural n epitopes reoognized by
anti-hTPO antibodies in the sera of patients with autoinmune
thyroiditis. However, it remains possible that the
glycosy7ated portion of the molecule eculd influence the
interaction of the antibody with its epitope(s), such as by
altering the affinity of this interaction. Al~hough not
intending to be bound by any particular theory, there is
increasing recoghition that the majority of epitopes
recognized by both polyclonal and monoclonal antibodies are
discontinuous. That is, by folding of the polypeptide chain,
the three-dimensional structure of a protein may bring into
apposition, as an epitope, widely separated, ~discontinuous~
regions of the polypeptide chain. This three-dimensional
;~ : configurat~on may be l:acking in peptide fragments, or may be
altered by the ~-:galactosidase component of the bacterial
~: : fusion protein.
The present data relate to the recognition of ep~topes on
::
TP0 by :antibodies ~B cell epitopes). Th.ese B-cell epitopes
are now recognized~to~:be~distinct from epitopes presented to
: T-cells in a~major::histocompatibility antigen (MHC) restricted
manner (Livingstone,: A~.M.~, et al., Ann. Rev Immunol. 5:477-
: 25 501 (1987)). B-cell epitopes are likely to be important in
mediating damage ~by the immune system to the thyroid gland,
while T-cell :epitopes are likely to be relatively m~re
important in the initiation of the autoimmune process.
.
8 ~
wo 93/03146 Pcr/uss2/062s~
-96-
i EXAMPLE XVI I
Identif~cation and Seauencilffl_gf~ ell Reqion CaPable of
Bindinq B-Cell EDitoDe n ThYroid Peroxidase
The sequences disclosed by the invention in, inter alia,
Examples XIII and XIV provide for a method of identifying the
interaction responsible fcr the ~-cell recognition of ~hyroid
peroxidase.
In detail, using the sequences disclosed in Examples XIII
and XIY of the preferred: embodiments, it is possible to
isolate the proteins which bind to these sequences. This is
accomplished using methods, well known in the art, of
purifying a protein which binds to a speci~ic DNA sequence.
Preferably, a protein which binds to a specific DNA se~uence
is purified using affinity chromatography. Specifically, the
nine a~îno acid sequence corresponding to residues 713-721 of
thyroid peroxidase is immobilized on an appropria$e ~atrix,
such as Sepharose~ and used as an affinity matrix to purify
~` 20 the proteins which bind to the particular se~uence (Arcangioli
B., et al., Eur. J. Biochem. 179:359 364 (1989)).
Preferably:, the DNA binding protein is extracted from
human ~ cells. The protein extra~t, obtained from the ~ cell,
is appl:ied to a colu~n which eontains the immobilized DNA
sequence of interest. Proteins which are not capable of
b~nding to the ~DNA ;sequence are washed off the column.
Proteins which bind to the~DNA sequence are removed from the
column using a salt gradient. The proteins eluted from such a
column are enriched: for the proteins which bind to the
specific DNA sequences immobilized on the matrix. ~he DNA
binding protein is further purified using procedures well
known in the art, such as ion exchange chromatography, high
performance liquid chromatography, size exclusion
chromatography, and the like.
During the purification of the DNA binding protein, the
protein is assayed~ for example, using the well known gel
~ w o 93/03146 2 1 1 ~ 2 8 ~ PCT/US92/062~3
-97-
retardation assay ~Garner, M.M. et al., Nucl. Acid Res.
9:3047 (1981); Fried, M. et al., Nucl. Acid Res. 9:6506
(1981)), or other well known methods.
Once t~e DNA binding protein is purified, a partial
amino acid sequence is obtained from the N-terminal of the
protein. Alternatively~ the protein is tryptically mapped
and the amino acid sequence at one of the fragments is
determined by methods known in the art.
; The deduced amino acid sequence is used to generate an
oligonucleotide probe. The encoding sequence can be based on
codons which are known to be more frequently used by the
: organism. Alternatively~ the probe can consist of a mixture
of all the possible codon combination which could encode the
polypeptide. Such methods are well known in the art.
A probe complementary to the amino acid sequence is used
to screen either a cDNA or genomic l ibrary for the genomic
sequences which encode the DNA binding protein. Once the gene
; encoding the DNA~binding protein has been obtained, the
; sequence of the DNA is determined according to well known
2~ methods. The~gene can~be~used to obta~n large amounts of the
protein from a recombinant host, or the sequence can be used
in ~utational analysis to furt~er define the functional
regions within~the;~protein which interacts with the DNk.
Alternatively? proteins which bind to ~-cell epitope
(residues 713-712) are isolated by identifying a clone
expressing the protein using well known techniques such as
:Southwestern blotting (Sharp, Z.D. et al., Biochim ~io~h~!s
A~ta, 1048:306-309 (1990); Gunther, C. V. et al ., 6enes Pev.
4:667-679 (1990); and Walker, M.D. et al., Nucleie Acids Res.
18:1159 1166 (1990)).
In a Southw~stern blot, a labeled DNA sequence is used to
screen a cDNA expression library whose expressed proteins have
been immobilized on a filter via colony or plaque transfer.
The labeled DNA sequences bind to colonies or plaques which
2 ~ ~
WO 93/03146 PCI`/US92/06283Ej~
98
express a protein capable of binding to the particular DNA
sequence. Clones expressing a protein which bind to the
labeled DNA sequence are purified and the cDNA insert which
encodes the DNA binding protein is isolated and sequenced.
The isolated DNA can be used to express large amounts of the
protein for further purification and study, used in isolating
the genomic sequences corresponding to the cDNA, or used to
generate functional~derivative of the binding protein.
The present invention is thus directed to DNA binding
proteins which ~can bind~ to the ~-cell epitope and to
functional derivatives thereof.
: ~ :
. : ~ :
~ ~ :
. ~
:
~. ~
::;:~ :: :
~ :
