Note : Les descriptions sont présentées dans la langue officielle dans laquelle elles ont été soumises.
W093/021~4 PCT/US92/06~34
-1- 21 ~ 3&1 :~
REC0~2~5~ INFECTIOUS ~oVIN~ RHINOTRA~HEI~s VIRUS
Within this application several publications are
refer~nced by ar~bic numerals within parenth~ses. Full
citations for these publications may be found at the end
of the specification immediately preceding the claims.
lo The discIosures of the~e publication are hereby
incorporated by reference into this application in order
to more fully describe the 6tate of the art to which this
inYention pertain
~: 15 Field of_t~e In~entiQ~
The present invention in~ol~es recombinant infect~ous
bovine rhinotrachei~is (IBR) viru~e~ us~ul in vac~ine~
to protect bovines from naturally-occurring infectious
;20 bovine rhinotr~cheitis ~irus and other bovine di~ease~.
Backq~y_d ~
The ability to isola~e viral DNA and clone this i501ated
25 DNA into bacterial~ plasmids ~as greatly expanded the
approaches available~o ma~e~viral vaccines~ The methods
used to ma~e~ the present invention involve ~odi~ying
cloned viral~DNA;;se~uences ~y inser~i~ns, deletio~s and
single:or ~ult~iple~base:changes. The modi~ied DNA is
30 then reinserted:~in~to the viral ganome to render the virus
non-pathogenic.~: The~re~ulting live YirU~ may ~hen b~
fused in a vaccine to elicit ~n immune response in a h~st
ani~al:and to prot~ct the~ani~al against a di~ease.
.
35 ~ O~e group of animal~ viru~, the h~rpesYiruses or
erpetov~ridae, ~ i~s an: ex7~pl~ o~ a c~as~ of viruses
ame~abl~ to t~ approa~h~ These viru~e contain 100,0~0
:: :
: ~to 200,0~0 bas~ pairs of DNA as *heir genetic materialO
~ ~Importantly, several regions cf ~he genome have been
w093/02~ i3 ~ ~ 1 PCT/US92/0603
identified that are no~es~ential for the replication of
virus in vitro in cell culture. Modifications in these
regions of the DNA may lower the pathogenicity of the
: virus, i.e., attenuate the virus. For example,
inactivation of the th~midine kinase gene renders human
herpes simplex virus non-pathogenic (28), and
pseudorabies virus of swine non-pathogenic (29).
: Removal of part of the r~peat region render~ human herpes
simplex virus non-pathogenic (30,31). A repeat region
has been identif ied in Marek'~ disea~e ~irus that is
~ associa~ed with viral oncogenicity (32). A region in
:~ herpesvirus saimiri ha~ similarly been correlated with
oncogenicity ~33). Removal of part o~ th~ repeat region
renders pseudorabie~ virus non-path~g~nic (U.S. Patent
No. 4,877,737, i~sued October 31, 1389). A region in
pseudorabies viru has ~ en shown to ~e delQt~d in
naturally-occurring vaccine strains (11,3) and it has
been shown that these deletions are at l~aFt partly
responsible for the~ lack o~ pathogenicity of these
strains.
It is generally agreed that herpesviruse~ contain non-
: essential regions of DNA in various parts of the genome,
and that modifi~cations of these regions can attenu~te the
virus,~ leading:~ to a non-pat~ogenic ~traîn from which a
vaocine~may~be;derived.` The degree of attenuation of the
virus~is important to ~he utiIity of the virus as a
~ vaccinè. ::Deletions which cau~e too ~uch attenuation of
;,~: 30 the virus will result in a vaccine ~hat fail~ to elicit
: : : an adequate i~une:respon~e. Although several examples
` : of attenuating :deletions are knownr the appropriate
combination of del;etions:is not re~dily app~rent.
35 ~ Inf~ectious bovine~rhia~otrachei~ IBR~ vir~, an alph~-
herpesvirus with~ ~ a clas~ D genom~, ig an important
: pathogQn ~ c attle. It has been assoc:iated with
W093/02104 PCT/US92/06034
'~ 113 ~ ~ l
-3-
respir2tory, -ocular, reproductive, central nervous
system, enteric, neonatal, and dermal di~eases (34).
Ca~tle are the normal hosts of IBR virus, however it also
infects goats, swine, water buffalo, wildebeest, mink,
and ferrets. Experimental inf ecti~ns have been
established in m~le d~er, goats, swine, ferrets, and
rabbits ~3S).
Conventional modified live ~iru~ v~ccines hav~ been
widely used to control di~ea6es cau~ed ~y IBR virus.
However, these vaccine viruae~ may revert to virulence.
Nore rQcently, killed viru~ IBR vaccines have been used,
: but their efficacy appears to be marginal~
IBR virus has been analyzed at th~ mol~cular level a~
reviewed in Ludwig (36). A r~striction ~ap of the genome
is available in:this reference, which will aid in the
genetic engin~ering of IBR :according t~ ~he methods
provided by the pre~ent invention.
20~
: As reported ~n:the current l:iterature, IBR virus has been
engineered to~contain a thymidine ~ina e deletion (43,44~
and a deletion: in the gIII gene (45,46). However, no
evidence has been presented for the deletion~ in the US2,
repeat, gpG,~or~gpE regions. In the ~ubject application,
: we de~onctrate~:~the u~efulness of ~uch deletions for both
;the:attenuation of IBR viru~and for the dev~lop~nt o
: : - gene deleted~mark:er vaccines.
, : 30 As with other herpe virus~ R ~iru~ can b~co~e latent
in healthy ani~als~which ~ak~s th~m pot~ntial carrier~ of
the ~irus. `For~:thi r~ason:it i~ clearly ad~ant~ga~us to
be~able to ~distinguish anim~l~ ~accinated with non-
virulent virus from~animals infect~d with di~eas~-causing
~ wild~type: viru9.~ The de~lopment of differential
: vaccines and ~companion diagnostic te~t~ ha~ pro~en
valuable in the ~a~age~ent of p~eudorabies di~ease (47).
. .
~: ~
WO~3/0210~ PCT/US92/06034
j; r
-4
A similar differential marker vaccine would be of great
value in the management of IBR di~ease. The construction
of differential diagnostic~ has focused on the deletion
of glycoprotein&. Theoretically, the glycoprotein cho~en
to be the diagnoctic marker should have the following
characteristics~ the glycoprotein and its gene
should be non-essential for the production of infectious
virus in tissue culture; ~2) the glycoprotein should
elicit a major serological re~ponse in the animal; and
(3) the glycoprotein c~ould not be one ~hat makes a
significant con~ribution to the protective immunity.
Four major IBR virus glycoproteins (gI, gII, gIII, and
gIV) have been described in the literature (48). T~ree
of these genes, gI, gIII, and gIV, have been ~equenc~d
: 15 and shown to be homologous to the HSV glycoproteins gB,
gC, and gD, re~pective~y. Although it ha~ been sugge~ted
that the gII prctein is analogou~ to HSV gE, no sequence
; : evidence has been presented to confirm that ~uggection
:~ (48). The gB and~gD homologue are e~sential genes and
Zo would not be ~ppropriate~a~ deletion ~arker genes. The
gC gene ~of herpesvi ~ ~es has been shown to make a
significant contribution to protective immunity as a
target of~neutralizing antibody (49) and as a target of
cell-mediated i~munity ~50). Theref~re, the gC gene i~
:: 25 not desirable~ as~:a~:~deletion marker qene. As indicated
. above, Kit et;al.~(45) have de cribed the d~letion of the
IBR virus gIII: as~a~arker gene. It would be expected
:
that such a deletion:would compromi~e the ef~icacy of an
IBR va~ccine. :~
For pæeudorabie~ virus (PRV) ~ e criteria for a deletion
marker~ gene~are~ be t ~e~ by the glycoprotein X (51),
: Wirth et al. ~52) sugge~ts the existen~e o~ a ~gX
homolo~ e of:~NSV-l~ in the IBR virus. It i~ not clear
what is ~eant ~y~:this~becau~e ~lthough there ~ a PRV gX
gene, there is no:reported ~SV 1 gX gene or gX hb~ologous
~` ge~e. In any case, no sequence evidence i~ presented to
: : .
WO 93/0210~ PCr/US92/0603~
21~ 36 ~
--5--
~;upport thi~ ~;uggestion. We present clear e~rid~nc:e of
homologue~ of PRV gX ~HSV ~ gG) and PPcV gI (}ISV gE) in
IBR virus and demon trate their usefulne~;s as diagnostic
markers .
The present invention pro~rides a methc)d of producing a
fetal-safe, li~v~ recombinant IElR vinls which comprises
tr~ati~g ~rlral DNA from a naturally-occurring live IBR
virus so as to delete from the virus DNA corre~ponding l:o
10 the US2 region of the naturally-occurring IBR viru~. The
pres~nt invention i~BO provides viruse~; in which (1~ DNA
corr~sponding to the US2 region of naturally-occurr~ ng
IBR ~iru~ has been deleted, and ( 2 ) DN~ encoding gpG
and/or ~pE has bee~ altered or deleted. Such viruses are
15 useful in vaccine~; which need diagn~stic marker~ and are
safe for uæe in pregnant ani~als.
,
Th~ ability to engineer DNA YirU~ E with large genomes;,
such as vaccinia ~iru~ ~nd the herp~viru~e~, has led ~o
: 20 the ~inding ~ ~t the~e recombinant viru~ie~i can be u~ed as
~ ~ectors to deli~er: immu~ogen~ ~o animal~ (53). The
: : : herpe~viruses ~re attracti~e: candidates for d2~elopment
as:veotors because their host ran~e i~ pri~arily limited
: t~ a single: target spe~ie~ (54), and they have ~he
.
25 capacity for establi~hing a latent i~fection (55) that
: ~ could provide for ~able in ~ivo expre~ion of a desired
- cl~ned~polypeptide. ~erpe~viru~e~ have been enginser~d
: : to expre~ a~va~riety of foreign gene product~, ~uch as
boYine gro ~ hormone (56~ human tis~ue pla~iminogen
activator (57? ~ and E. coli B-galactosidase (58,59). In
addition, pos~ible~ i~munogenic polypeptid~s have b~2n
expre~ised by ~rp@~iru~eE. ~healy et al. (60) expre~ed
porticns o~ ~he hu~an :immu~ode~ieiency ~iru~ type 1
; env210pe g1ycoprot~in in pseudorabie~ virug (PXV) ~s
~usion to the~PRV glycoprotein III. ~he hepatiti~ B
virus ~urface anti~en (61) and a hybridl ~ n ~alaria
antigen frc~m Plasmodium falcipan~m have been expre~æE;ed in
W093/021~)~ PCT/US92/060~
?~ ç~
herpes simplex virUC type 1 (HSV~ 62): The IBR
viruses described above may be used as vectors for the
insertion of genes encodi~ antigens from microorganisms
: causing important cattle diseases. Such recombinant
viru~es would be multivalent vaccin~s protecting against
XBR as well as other diseases. Kit et al. (633 have
described the expre~sion of a Foot and Mouth disease
a~tigen in IBR viru In 50me of the prior applications
from which the ~ubject application cl~ims priority (which
precedes the Kit publication by at lea~t three ye~rs), we
described the use of IBR virus to expres~ ~everal foreign
::~ genes including the E. ccli B-galacto~ida e (lacZ) gene,
: the TN5 neomycin re~istance gene, and anti~ns from
bo~ine rota ~iru6t ~nd parainfluenza type 3 viru~ ~see
: 15 U.S. Serial No. 06/933,107, filed November 20, 1986 and
:~ U.S. Serial No. 07/078,519, filed July 27, 1987). These
~: ~ applications precede the Xit pub}ication by at lQa~t
three years. The ~viruBe~ deficribed in ~hi8 ~pplication
provide a combination of atte~auation, di~feren~iation and
multiYalency. These:properties make uch Viru8e8 useful
as vaacines for the management of cattle dis~a~e~.
`: : :
~::: : :
: : :
. ~;
~:: : : : :
;
W093/0210~ - PCT/VS92/0~0~
_7_ 2 . 1. i ~ s ~
SU~mary of the Invention
The present invention pro~ides recombinant infectious
bovine rhinotracheitis (IBR) viru~es useful in vaccines
~o protect bovines from infectious bovine rhinotracheitis
and other bovine disea6e~ The pres~nt invention further
providec methods for distinguishing an animal vaccinated
with the vaccine of the present invention from an animal
infected with a naturally-occurring IBR viru5 . The
present i m ention al50 provides isolated DN~ encoding the
gpE glycoprotein o IBR viru~ and isolated DNA encoding
the gpG glycoprotein of IBR viru~. The present invention
also provides; a method of producing a fetal-safe, live
recombinant IBR virus which compri~e~ treating viral DN~
from a naturally-occurring live IBR virus 60 a~ to delete
from the~virus DNA corre~ponding to the US2 r~gion o~ the
naturally-oocurring IBR~ viru8.
The present invention also provides isolated DNA sncoding
the US2 gene of 3n IB~viru~. The pre~ent invention
further pro~ides a homology vector for producing a
: recombinant ~BR viru by in~erting foreign DNA into the
genomic DNA of~an~IBR viru~ which c~mprises a double-
stranded ~DNA~:molecule~con~isting e entially of double-
stranded foreign~;~NA eneoding RNA which does not
naturalIy oeeur~in~an animal into whieh the reeombinant
; IBR is :introdueed and-at one ~nd of the foreign DNA,
double-stranded IBR~viral~DNA h~ologous to geno~ic DN~
~ ~ loeated at one:s~ide~of a~site on the gene~ie D~A whieh is
:, 30 not essential for replleation of the IBR virus and at the
; other end ;of~:the foreign DNA, doubl@-stranded IBR viral
DN~ h~mologous~ to~genomie DNA loeated at the othe~ side
of the same ~ite on~the geno~ic DNA.
: 35` The present inven~ion al80~ provides for a ho~ology ~ector
for~ produei~g~ a reeombinant~ I8R virus by deleting DN~
whic~ encodes a deteetable~arker whieh had b~en inserted
WO93/0210~ PCT/US92/060~
,~ ~, .
8-
into the genomic DNA of an IBR Yirus comprising a double-
stranded DNA molecule consisting essen~ially of double-
stranded IBR viral DNA homologous ~o the genomic DNA
which flank~ on each side the DNA to be deleted. The
present invention further provides a re¢ombinant IBR
virus compri~ing viral DNA from a naturally-occurring IBR
virus from which DNA from the US2 gene, the gpE
glycoprotein gene and the gpG glycoprotein gene has been
: deleted so that upon replication, the recombinant IBR
virus produces no gpE glycoprotein and no gpG
glycoprotein. The invention al~o provide-~ a vaccine
which comprises an effective immunizing amount of a
recombinant virus protective again~t bovine respiratory
disease complex and a suitable carrier.
.~ ,
::
. ~ , :
.
~ ,
:: :
:: :
: .
WO 93/0210~ PCr/US92/06034
2 1 t f ~
_9_
Brie;~E?~çxiP~ion o~ he Fig~re~
Figure 1 Details of the IBR Cooper Strain, Diagram c~f
IB:R genomic DNA . howing the Imique long,
internal rep~at, unique short / and Terminal
repeat regionC. Re~;triction map ~or the
enzymeg ~indIII, EcoRI, and XbaI are indicat~d
t 7 ) ~ragments are l~t~ered in ord~r of
d~creasing ~;ize. The uniqu~ ~hort r~gion is
al~5;o expanded for in~lu~;ion c~f more detail.
The lccation of ~ev~ral gene~ is also
indicat~d , th~y are uni~ short 2 (US2 ),
immediate ~arly g~nes (IE) (20), glycoprotein
G tgpG), glycoprotein IV (gpI~) (17) ~
glycoprotein E (51PE)- Note tha~ due to the
in~r~rsion o t:he ~hort r~gion, which irlcludl2s
the unique short, internal, a2~d t~rminal
repeatE;, fc)ur half molz~r ~indIII fragment~ are
present (~ dIII D, C, F, ~nd ~I~o
ZO
~igure 2 Details of S-I8R-0020 I:~iagra~ of S-IBR-002
genc~mic DNA showing the u~ique long, inter~aal
repeat, :: unigue~ ~hort t and Terminal rep~at
:regiohs. Res~riction ~aps for the enzyme~
~indIII, EcoRI, and XbaI are indicated (7).
Frag~nts are lette:red in order of de~:rea~;ing
~: size.~ The EcoRI B a:nd ~@ fragment~; are expanded
or inc:lu~ion of more detail. T~e ~800 B}?
rep~at d~1etion~ ~re indicated ~y ~lel~. Note
3 0 that due to the inv~rsion o~ the hort re~ion,
: ! ,
which includ~s t:he u~ique ~hort, in~ernal, and
te~ina~l: r~p~ats , f our half ~o~Lar ~indIIT
fragDlent~:~ are pres~nt ~(~indIXI D, C, F" and H) .
:: :
3 5 ~igure 3 DNA seqlaen~:e of th@ ~B~: Uniqlae Short 2 g~ne .
~l`he: saquence of the fir lOB0 ba~ pair~; Cl~
the ~indIII K f ragmeF~t, r~ading f rGm the
`:
' , .
WO 93/0210~ P~rlus92/0~0~s4
,t.;'~ 't~ O-
~'~indIII Kl~indIII O junction, are shown. The
unique ~hort 2 (US2~ gene i~; tranE;cribed toward
the ~indIII K/~indIII O junction a; indicated
in Figure l. The sequence has been rev~rsed
and complemented in order to l :how the
translation ~;tart and termination of US2 gene.
Fi~ure 4 Homology b~tween the IBR US2 protein and the
IJS2 proteins of HSV-1; PRV, ~SV~ 2, ~nd MDV.
(a~ Matrix plot of the amino ~cid s~quenc~ o~
the IBP~ US2 protein ( 3 09 ) again~t the amino
acid seqtaence of the HSV-l IJS2 protein (291)
~ 8 ~ ~ (b) Alignment o~ the confi~rved region
betw~en~I8R US2 :prot~in, HSV-l US2 prot~in, PRV
l US2 protein (256 amino acids) ~21~, HSV-2 US2
prot~in Ç291) (9) ,~ and ~DV U~;2 pre~t~in (270
; ~ amino :acid ) (1).
Figure 5 D~tail~ of the Na~al5~n d¢letion. Diagra3a o~
20 ~ genc~mic l:~NA showing the unique long,
intern~ epeat, unique ghort, and terminal
: repea~:regions. A r~ riction ~ap for ~he
enzy~e~HindIII i~ indicated. Fr~gments are
: lettered in~order of decreasing size. The
25~ ~ ~ uniyue shor~ region:i e~pand~d for inclusion
of:::~o~ detai1.~ The }o~a~ion of th~ deletion
in~the~ Na5algen KindIII::~ fragment is ~hown.
:; T~ree:~;:regions~:of DNA ~sq~ence:~;are a1so ~hown.
The~f~rst~1ine:~hows:the first~60 ba~e pair~
:upstream of:the H~ndI}I 0/Bi~dIII D junction in
the IBR~Cooper ~train.~ ~h~econd line ~h~w$
: the~fir t 60 ~a~e pairs up~tr~ of ~ indIII
K~indIII: D junction~in~the~Na~a1gen ~train.
The:third line ~h~w~ 60 ~a~e pairs fla~king ~he
: 35 : ~ ~DN~ ~ncoding a~ino ~cid~:5~ ~f:the IBR ~S2 gene
in the IBR Cooper strain~
.
::~ :
:: ;
:
WO 93/021W PCr/US92/06034
2 1 I r ~ ~3 ~ ~
Figure 6 Details of S-IBR-027. Diagram of S-IBR-û27
genomic DNA showing the unique lon~, internal
repeat, unique short, and terminal repeat
regions . Re;triction ~aps f or the enzymes
HindIII, EcoRI, and XbaI are indicatecl ( 7 ) .
~rag~ent~ are lettered in order o~ decrea~ing
~ize. The uniqu~ short region i8 al~o ~xpanded
for inclu~iorl of more detail. The loc2tion of
se~reral g~ne~ i s al~o indicated, they axe
unique short 2 ~US2) ~ fflediate ~arly gene~
(IE:) (20), glycoprotein G (gpG), glycoprotein
IV (gpIV) (17) ~ glycoprot~in E (gpE~ . The
unique ~;hort region ~nd repeat region da~l~tis~
are indiGatQd by delta~;. The l:ocation of the
approximately 1200 BP del~tion oiE the ~S2 g~ne
show~ in the expandsd r~giorl. Nc~te that due
to ~:he in~ersion o~E the ~;hort r~gion, Which
include- the ~ unique ~;hort, internal, and
kerm:inzll repea~s, f our half ~ol;~r ~i~dITI
, ~ ~
~ra0menlt~; are pres~nt (ElindIII I), C, F, a~ld ~I).
~; ~; Figure 7 Detailed de~3cription o~ the DNA inser~ion in
Homology Vector 129-71.50 Diagram ~howîng ~e
orientation: ~ o f DNA fragmerlt a~embled in
: :25 ~ plasmid ~129-71. 5. The origin of each ragment
is ~ indica~E~d i n the table. The æ~qlaences
located~ at ~ each of the jun tions b~tw~n
: fragment~ i al~o ~h~m~, Th~ re~riction eite!~
u~;ed~ to ~ g~nerz~te ei~ach iEra~a~nt as w~
~ thetic link~r B~quenc~s whit:h werQ ug~d ~o
oin the fras~gnts are de~;aribed ~or ~as::h
unction. ~ ~h~ synthetic~ r ~~q[uenc6~; are
underlined by a h~asvy~ bar. The loc:ation of
s~averal ~ ~ge~ae codins1 r~Pgion~ and regulatory
3 5 ~ nt~ is; ~ o giv~n. ~he foll~w~ng ~wo
co~ve~t~ons ar~3 u~3ed: rr~r~ in ~p~renth~
Eefer ts~ amino acid~;, and re trictlQn ~i~es
,
:
: :
WO 93/0210~ Pcr/us92/060
in brackets, ~], indicate the remrlants of sites
which were destroyed during corlstruction. The
foll~wing abbreviations are used:
polyadenylation signal ~pA), infectious bovine
rhino~racheitis virus (IBR), Herpes ~implex
viru~; type 1 (HSV-l), thymidine kina~;e ~TX),
neo~ycin re~i5tance (NE0), bac~erial tra~nsposon
Tn5 (TnS ) .
10 Figure ~ DNA ~e~auence o~ the IBPc glycoprç~tein G gene.
The ~equen::e of approximaltely 1400 ba~e pairs
o~ t:he ~i~dIII K ~ras~ment, ~tarting
approximately 2B00 base pair6 down~tream of the
~indIII ~/~indIIX 0 junction t are ~}lown . The
glycoprotein G (gpG) gene i~; tr~nscribed away
fr~m the ~indIII Kt~indIII O junction a~
in~icated in Figure lo The translational ~tart
and t~rmination of th~ gpG gerle are indicat~d.
: ;; 20 Figure g Hology between the I8R gpG protein, the gpX
protein of PR~r and the ~ protein o~ HSV-2.
(a) Matrix plot of ~he ;~ino acid sequence of
the IBR gpG protein (441) again t th~ amino
~: acid ~equence of the PRY gp~C prot~in (4g8)
: : 25 ( 12 ~ . (b) Alignment of the cs:~n~erv~d region
between IBR gpG protein, P~V gpX prol;~in, and
HSV-2 gpG protein ~699~ (9). N~t~ that IllPAC
IUB Bioche~ical Nomen . lature Co~amisgion
conYention~ are used.
Figure lO weBtern blot of proteins rel~a~3ed irato the
mediwn of IBR and P~ in ~c:ted cell, ~;howing
the ab~ence o$ gp~; in 5-PRV-û13, S-IBR-035 ~ S-
I13R-036, S~ I13R-037, and S-IBR; 038 but its
:: 3~ pres~nce in S-PR~ l60 ~nd wild ~ype S-IBR-000.
Lanes tA) 0.5 ~g purifi~d gpG, (B~ blank lane,
(C) S-P~V-160, (D~ S-PR~-013, (E) pre~stain~d
::
WO 93/0210~ PCr/ US92/û603~
2 ~
--13--
molecular weight markers, (F) 0.5 ,ug purified
gpG, [G) S-IBR 038, (H) S-IBR--037, (I) S-IBPc-
036, (J) S IBR-035 ~ tK) S-IBR--ooo (L)
uninf ected l~DBR cells, (M~ pre-stainQd
mol~3cular weight marker~. Media samples were
prep~red as de~cri~ied in the PREPARATION OF
H~RPESVIRUS C}~LL LYSATE:S. The concentrated
medi~ ~Erom ~:he inf ectiorl of one 6 cm dish of
infected cell wa& loaded in each ~ample lane
except for sample~; S-PRVoO~3 and S-PRV-160 ~or
which the media from two 6 s~m di~;he~ were
102d~d .
Figure ~1 Detailed de~;cription of the DNA ins~rtion in
~ 5 Pla~3~id 459-12 . 6. Dia~ram shcwirlg the
: ~ : o~ien~ation of DNa~ ~r~ ent~ as~;embled in
pla~D3ie~ 459-12.6. The ori~in o~ eac~ fraç~ent
indicat~d in th~ table. Th~ quenc~3
located at each of the jwctionE~ b~t:ween
fragment i8 al80 s~ Wno The reE~tris::~ion site~
u~ed ko generate 2as~ ragm~nt as well as
synthetic linker ~e~3uenc~s which were u~;ed 1:o
join~ the fra~ents are deE;cribad fcPr ~at:h
mction. The~ ~;ynthetic: linker ~;equences are
: underlined; by a hea~ bar. The loc:ation o~
Beveral ~ g en~ coding regio~ and regula$o:ry
el~ments ~ is; al~o giYen. l~e ~oll~w~ wo
convention~ a~e u~ed: numbers in par~nthes~æ,
ref~r to a~ino acids, and r~strictic~n 8i't~5
in brac:kets~ E~, ind~cate th~ r~mnant~ og gi~eç:
:
:~ whieh were d~stroyed during con~;truc:tior10 Th~
h
fol1c~wing~ abbreYiation ~re u~d: unis~ue
glyGoprotein G (gpG) ~ glycoprotein III (gpIII~,
lycoprot-in x (gpX3 ~ polly~d~nylal Son ~gnal
~ ~pa~ in~ctiou~ b~ine rhinotr;~c:h~iti~ 6riru~;
: (IBR), p eudorabi~ viru~ (PK~, and human
: cytom~g~lovirus: (HC~) .
.
: ~ :
WO g3/02~0~ PCI`/US9~/~fiO~
--14--
Figure 12 Detailed description of the DNA insertion in
Homology Vector 439-01.31. Diagram ~;howing the
orientation of DNA fragments as~;~mbled in
plasmid 439-01.31. The origin of ~ach fragment
~s indicated in the table . The sequen ::es
locat~.d at each of the junctions between
fragments is also sh~ The re~triction sites
used to generate each frag~enlt ~ well as
. ynthetic linker se~auence~ which were u~ed to
join the fragment~ ar~ degcribed for each
jun~:tionr The ~ynthetic linker ~Qquences are
underl~ned by a heavy b~r. The location oiE
several gene ccding regions and regulatory
element~ i~ also given . q~he f ollowing two
conventions are u~ed: nu~beræ in par~ntheses,
() ~ refer to a~ino acid~, and r~tric:tion ~ite~
~; in bracke~ , t~, indieate lthe r~Dant~; o~ sit~s
which were d~troyed during construs:tion. Tha
foll~wing abbreviation~ are u~ed: unique sho~t
:: ~ 20 2 (IJS2), glycoprotein ~ (~pG), glycoprotQin IV
(gpIV3, polyad~nylaticn signal (pA), in~ectious
; : bovine rhinotracheitis virus tIBR),
p~;~udorabie~ ~rirus (p}~r), and human
3~omegalovirus (HC;~r).
~: 25
Figure 13 D~tail~d description of the DMA insertion i~
Homology V~ctor 439-21.69. Diagram showing th~
rientation of: ~NA f ragmen~s as~e~bled ~ n
pla~id 4~9-21.69O Th0 origin o~ ~ach ~ragm~n~
, 30 i~ indicated in th~ tabl~ Th~ ~;equ~nces
lo ::ated at ~ach of the junction~; b~twe~2n
fragm~rats: i~ al~o fihown. Th~ r~. triction ~ite~
used~ ~ to ~ g~enerate eac:h iEra~nt a~3; well aE;
ynt:hetic linl~er E~quen ~ whi¢h w~re used to
~ ~ 35 ~oin th~ fr~ t~ ar~ d~ ri~d ~or ~sac:h
:: : Junc:tion. The: . ynthet~c li~ker s~equenc@~ are
~mderl:~ned by a he~s y bar, The location of
: ~
WO 93/OZ104 Pcr~us92/o6o3~
2 ~ , , 3
--15--
several gene coding region~ and regulatory
elements i~ also given. The following two
conv ntions are u~;ed: number~; in parenthese~,
~), rePer to amino acid~, and re~tric~ion sit~;
in brackets, [], irldic:ate the re~nants of sites
which were de~;troyed during ::onstruction. T~e
following abbreviations are used: unique short
2 (US2) I glycoprotein G ~gpG3, glyc:oprotein IV
(gpIV), polyadenyl~tion ~ignal (pA), in~ectious
bovine rhinotr~cheiti~ viru~ ( IBR~,
ps~udora~i~s viru~; (PRV), and hu~an
cytomQgal;:~viru (H~).
Figure 14 Detailed d~scription of the DNA in~;ertion in
Homology Vector .39-70.4. Diagram ~:howing the
orient;!~tic~n o DNA frag~srlt~ aE~@~bled in
pla~mid 439-70.4~ The origin ~ ~ac:h ~ragm~nt:
indic;~ted in the tab:L~. The ~equ~nc:e~
:~ locat~d at each OI ~he ju~c:tion~ ~etwe~n
fr;~gment~ ; al~o shown. The re~triction ~;it~
u~ed to generate ~ach fragmen. as well ~s
synthetic linker g~ ncs: which were u~ed to
join the fr~gment~ are degcribed for each
junction. The ~y~thetic lir~c~r 8equenGe~ are
~ urlderlined by a h~a~y bar. Th~ location of
several gene codinsl regions and regulatory
el~ments is al~o given. The following two
aonvention~ are u~;ed: ml~nber~; in par~ntheses,
~), r~Eer to amino acid~;, and r~s~riction sites
, ~ 30 . in bracketE~,~ 1]~ indil::ate the r~nnarsts of ~;ites
which were d~stroyed during cc~ns~ruction~, ~he
followin7 a~brevi~tion~ are u~@d: s~lyc:csprotein
G (gpG), glycoprotein IY (qpIY), ~nd infectiou~
~in~ ~ rhin~traGheiti~ ~inas ~ IBR) .
:~ 35
Fi~:r~ :15 I~NA sequence of ~e IBR 5~lycoprotein ~ g~n¢.
The sequenc:e of 2038 ba~e pair6 of th~ IBR
WO 93/0210~ PCr/US92/060
' uni~ue short region, ~tarting approximately
1325 ba~;e pairs upstream in the ~indIII
K/~indIII F junction in the ~indIII K fragment,
are showrl. The glycoprotein }: ~gpE) gene is
transcribed toward the ~indIII K/~indIII F
junction as indicated in Figure 1. The
transl2ltion ~tar~ and termination of the gpE
gene are indicated. Note that IUPAC-IUB
Biochemical Nomenclature Commi ~;ion conven1:ion~
are u~ed.
,
~: . Figure 16 Homology between the IBR gpE protein and the
gpl3 protein of HSV-~, the ~pI prot¢in of V~V,
and the g~ protein of PRV. (a) Mz~1:rix plot of
the amino ac:id ~quence of the IBR gpE protein
(617) ~ again~t ~ z~mino ac:id ~equ~nce of the
~; PRV: g~ protein~ (577) l64). (b) Alignmen~ of
the con~er~red region betwe~n IBR gpE protç!in
PRV gI~protein, and VZV ~pI protein ~37).
o : ~ :
. ; Figure 17 Deta~led description of a plasmid containi~g
the gpE gene. Diagram ~h~wing the orientation
of~DNA:;fragment~; to be a~embied in the gpE-
containin~ plasmid. ~ The or~gin of ~ach
Z~ f~agment~ i ~ indi~at~d in t~e table. The
sequence~ located at each ~f the junctions
between~fra9ments ~are al~o ~hown. ~he
;re~tri~ction~ site~ used to generate each
fr~qment are de~cribed~for ~ach junction~ T~e
- location of~sever~l gene c~ding regions and
regulatory~ el~ment~ is al~o given~ The
ollswing ~wo convent~ons ar~ u~d: ~ ~ er~ in
: : parenth,e~e~ refer t~ amino acid~, and
restriction ~ites in ~racket ~ t~, indicate the
~ ~ ~: re~nant~ ~of~ sit~ which~were~dg~troy~d during
onstruc~ion.;~The ~olIowing abbreviat~on are
: ~ used~ unique : glycoprotein E ~gpE3,
:: ~ :
WO 93/02104 Pcr/ US92/06034
3 ~ I ~
--17--
glycoproltein IV (gpIV), and infectious bovine
rhinotracheiti~ virus ( IBR) .
Figure 1~ Detailed de~;cription of the DNA insertiorl in
the homology ~vector 536-03.5. I)iagram showiny
tbe orientation of DNA frag~ents ts~ be
as ;;6~mb1ed in the homology vec:tor . The origin
of eac:h ~xag~nt iE; indicated in th~ table.
The ~ quenc~ located at aac:h of ~he junctions
betw~en fr~g~ent i~ al80 shown. The
restriction site~; u~;ed to g~nerate each
fra~ent a5 we}l aE~ synthetic linker ~eguenc:e~;
whiah w~re uE~d to Join the fragments are
de~;cribed for s~ch junction. The æynthetic
linker ~quences~ ar~ underlined ~ a heavy bar.
Th~ lc~astion of:~everal g~ne coding r~gion~ and
regul~tory el~ents i~ o gi~ren. ~!h~
following ~wo corlven~ionE~ ~r2 u~ nu~ber~; ~n
parenthe6e~ (), refer to a~ino ~cid!;, and
r~ricl:ion ~ite~ in ~acket~;, t], iTldic:ate the
remnant~; of ~it~ wh,ich were de~troy~d during
construction . The f ollo~ing abbreviation~ are
~: used: glycoprotein E (gpE), i~mediate early
promoter ~ (IE), irlfectiou bovine
rhinc3tracheitis ~irus ~IBR), and p~euc~orabies
vi~us ~ (PIi~V)~.
Figure l~ Con~ tion of RQco~binant S-IBR-004 ~
S-I~ 04 il; an IBR rQc~bina~ Vi~ell8 c:ar~ing
an in~;erted :Eoreign gene (Nl:C)) under ~he
con~ro1 o~ th~ PRV gpX pr~oter. A new Xb~
;ite~ wa~ created at~ th2 ~h3rt lmique region a~d
the ori~inal SacI ~ite wa~; del~ted.
Fiqure~20 Con~tru~ion of R~s:om~inant S IBR-008 Yiru~c
S-IBR-008 ~s a r~co~bi3~ant XBR vina; t~at has
a :bo~rine ~ rotaY~rus glycoprot~in gene and th~
:
:~ :
: ~:
WO 93/021~ P~/USg2/0603
--1 8--
plasmid vec:tor inserted in the Xba~ site on the
w~ique long region. A site ~pecif ic deletion
was c:reated at the ~SacI ~ ~ite due to the lvss
of NEO gene in the small unique region.
Figure 21 Se~uenc:e of the PI-3 (SF-4 Strain~ HN Gene.
Note that IUPAC-IUB Biochemical Nomenclature
Commi~;~;ion convention~ are u~ied.
10 Figure 22 Details ~f S-IBR-Ol 8 Con~truction.
A. Fir~t line ~how~ the IBR (Coop~r Stxain) Ba3~
C f ragment map . S~cond line ~hows the
con~truction of the alpha-4 pxoDIoter on the PI~
3 HN gene and it~ insertion intv the ~ndIII
6i~e! in B~I-C. Al o ~hown are the beta gal
and n~omyc:in (NEO) s~ene c:onE;tru~:tionE; usld r the
control o the gX proDIo3:~r that were put into
the XbaI ~site and u~ed a~; ~elec able marker~; to
ZO purify t:he rec~mbinarlt viru~.
, ~
~:: :::
B. The BamHI-C frag3l~ent ~ap of 5-IBR 018 ~f~er
insertion of the PI-3 IIN, be~a-gal, and
: nec~mycin gene~.
- 2 5
C . The ~ S~ R-O1 no~e ~howing the loca~on of
the~: three in~ert~d ~eign gene~.
Legend: B = B~I; :H -~indIII; X ~ XbaI; S - StuI; ~L
. - uni;;lue~long r~ion; US ~ unîq~e short region;
IR = internal repoat r~ion; TR - t~rminal
repeat r~gion.
: :: :
~: Figur~ 23 Details of :S-IBR-019 Construction~
3 5 : ~ ~ :
: A. First line ~hows the IBR (C:ooper Strain~ Ba~I-
C fragm~nt map. Second line ~how~; the
'
WO 93/02104 PCr/US~2/0603~
~ 1 .i r J i
--1~
construction of the alpha-4 proInoter on the PI-
3 F gene and it~ in~ertion intc~ the HindIII
si~e in BamHI-C. Alsc3 shown ~re the beta~ gal ~:
and n~omycln (NEO) gene con~;tructiorls under khe
control of the gX promoter lt~at were put into
the XbaI ~ite and u;ed a~; ~electable allarkers to
purify the recombinant viru~;.
13. The BamHI-C frag~ent ~nap c3f S-IBR-019 after
inE~ertion of the PI-3 F, beta gal, and neomycin
- gene~.
C. The S-IBR-0~9 geno~e ~howing the loc:ation of
the thr ee inserted f oreign gen~,
Figure 24 ~ ailed de i;cription of the l:~NP, i~artion in
~omology ~ec:tor 591-21. 20., Th~ diagram ~how~
the oriQntation of . I)Nl~. ~ra~@n~; a~sembl~d in
p~a~mid 591 21.20. The nrigin oi~ each fragment
2 O i~ d~sc:ribad in the ~a~ERI~S A2~ ~HOD~;
section. ~ The se~auenc~3 loe:ated at t2~e
junction betwaen l3ach frag~fflent ~re ~:hc~wn. The
rQstricl:ion ~:ite u~s~d to g~nerate e~c:h
fragment as well ~as: synthetic linker ~equenc~3s ~-
whioh were u~e~d to join the fragment~; are
~: ~ describ~d f or each junction . The synthetic .
cer ;~Qqu~nce~ ar~ underlirl~d by a doubl~
:: ~ b~r. l'he~ loc:ation o~E ~e Tk gk~ne s:odiTIg r~gion
i~; al s;o gi~n .~ The f oll~wing ~b70 ¢on~etltions
ar~ u5ed: nu~r~ in par~nthe. i~ re~er ~o
a~ino acids, and r~tri$ti~n 5itQ~5; in brac:k~t~
~: : [J indicate ~ re~nan~: of ~it~s which w~re
dç~s~royed~: during con s;truc:ti0n,. The ~ollowi~g
abbreviation i~; u~3ed, in~ctiou~ bovine
x~inotrachei~is ~ IBR).
~.
WO 93/0210~ PCr/lJS92/0603
3 2 (~--
Fi~ure 25 Detailed description of the marker gene
insertion in Homolo5~y Vector 591-46.12. The
diagram ~:how6 the orientation of DNA f ragments
a~eTIlbled in the marker gene. The origin of
each fragment is described in the MATERIAL5 AND
ME~ODS 6ection,. The ~equence~ located at the
junction~; betwQen ~ach ~ragmenl: and at the end~
o~ the mark¢r g~ne are showTI. The r~st:xic:tic)n
sit~s u~d to generate each frag~ent are
indioated at the appropriate jun tion. The
location o~ the uidA gen~ codirlg r~gion i~ also
gi~n. The following two conv~n~io~; are used:
n~r~ in p~r~nkh~ () re~er to alaino ac:id~;,
and restriction sites in brac:ket~; ~ ] indic:ate
the r~ant~; of 6il:~6 whic:h were del3troyed
ring aonstruction. The following
abbreYiation~ are u~ed, ps~udorabi~ viru~
(P~V~, uronida~e A gerle (ui3LA), ~sch~3r~c:hi~
coli (E. c:oli), herpe ~impIea~ viru~ ~ype 1
(HSV-la ~ poly adenylation ~ignal (p~), and
glycoprotein X (s~pX).
Legend: B -- Ban~lHI; H = BindIII; X = Xb~I; S 5 StuI; IJL
= unique long region; US = unique short region;
2 5 IR = internal repeat region; 1~ -- terminal
repeat region.
:~`
''
:.
~'~
W093/0210~ PCT~US~2/0603
-21- 211 3
p~a~led Descr~ion of th~-lnvention
The present invention provide~ a recombin~nt IBR virus
comprising viral DNA from a naturally-~ccurring IBR Yirus
in which DNA encoding gpG glycoprotein has been altered
or deleted ~o that upon r~plication the recombinant IBR
virus produces no gpG glycoprotein. The DNA encoding gpG
glycoprotein may be del~ted or foreign DNA may be
inserted into the DNA ~ncoding gpG glycoprotein. The DNA
10 encoding gpG glycoprotein may be deleted and :vreign DN~
~ay b~ inserted in place of the deleted DNA ellcoding gpG
glycoprotein.
The pres~nt invention further provides a recombi~nt IBR
virus comprising vlral DNa fro~ a naturally-occurrin~ IBR
virus in which DNA ~ncoding 5pG glycoprot~in ha ~een
altered or deleted ~nd DNA enc~di~g ~ e gpE glycoprotein
ha5 b~en altered or deleted ~o that upon replication the
recombina~t IBR viru8 produceG no gpG glycopro~ein and no
20 gpE glycoproteirl. The D~A encoding gpE glycopro~eirl ~ay
be deleted c~r f oreign DNA may b~ in~erted into the 3~A
encod~ing gpE glycoprotein. ~he DNA encoding gpE
glycoprotein ~ay be deleted and foreign ON~ may be
: ~ ~ inserted in place of the deleted I~NA encoding gpE
~ .
:glycoprotein.
The pr~sent invention fl;rther provide~ a recombinant IBR
virus compr~ising viral;DNA from a naturally-occurring IBR
virus in which DNA~ ~enc:oding gpG glycoproltein has been
3 0 alter~d or deleted E;O that lapon replicati~l~ the
rec~mbinarlt IBR vi~ produces no gpG glycoproltein, DNA
corr~ponding to : the US2 region of the naturally-
oc:curring IBR virus has b~n delet~d, and DNA encoding
the gpE glycoprot~in :ha~ n ~lter~d or d~letEsd,.
3 5
'rh2 pr~ nt invs~nt~c~n al~o ~?rovideF a rec:o~binant IBR
virus ::omprising viral D~A from a na~urally-oc{:urring I8R
WO93/021~ PCT/US92/060
~ 22-
virus in which (l) DNA corresponding to the US2 region of
the naturally occurring IBR virus has been deleted, and
(2) DNA encoding qpG glycoprotein has been altered or
deleted. The DN~ encoding the gpG glycoprotein may be
deleted or foreign DNA may be in erted in place of the
deleted DNA encoding gpG glycoprotein. Foreign DNA may
be inserted in place of the deleted DNA corre~pon~ing to
the US2 region of the naturally-occurring ~BR virus.
.
The present inven~ion also pro~ides 5-IBR-037, a
recombinant IBR viru~ comprisiny viral DNA from a
~: naturally-oc¢urring IBR virus in which ~1) DNA
corresponding: to ~the ~US2 region of the naturally-
occurring I~R VirUE has b~en deleted, and (2) DNA
e~coding gpG glycoprotein has been delet~id. S-IBR-037
was deposited on April 16, 1991 pur~uant to the Budapest
Treaty on the~In~ernational~Depo~it of ~i~roor~ani~ms for
the Purposes of Patent~Procedure with ~he Patent Culture
Depository of th~American:Type Cul~ure Co}lection, 12301
Parklawn Drive,~Rockville,~Maryland 2085~ U.S.A. under
ATCC Accession No~.~ VR 2320.
: The present invention:~also provide~ a recombinant IBR
: virus comprising ~iral:DNA from a~naturally-~ccurring IBR
vixus in~which~`(l)~DNA~corre8pondin~ ~o the U52 reyion of
~ .
the naturally-occurring IBR:viru~ has b~en del~ted and a
: foreign DNA~sequence which encodes .:.t~ tL~ .ll B-
galactosida6e~ha6 ;been inéerted in plaoe:of the deleted
DNA~enGoding gpG:glycoprotein, and t2j ~DNA encoding gpG
glycoprotein;ha~ been ~l~ered or delete~c Th~ pre~e~t
invention al~o provide~two example~ of such ~iru~e~, S-
: ` IBR-035 and S-IB~-036.~
The pr~sent invention~further;pr~id~s a reco~bina~t IBR
35 Yi~s co~prising viral DNA~from a na~urally-occurring IBR
virus~in which~D~A encoding gp~gIycoprotQ~n ha~ been
alt~red or deleted ~o that upon replication the
`
::
:
W~93/~2104 PCT/US92/060~
2~ 1 3~
-~3-
recombinant IBR virus produces no gpE glycoprotein. The
DNA encoding gpE glycoprotein may be deleted or foreign
DNA may be in~erted in ~he DNA encoding gpE glycoprotein.
The DNA ~ncoding gpE glycoprotein may be deleted and
foreign DNA may be inserted in pla~e of the deleted DNA
encoding gpE glycoprotein.
The present inv~ntion fu~her provides a recombinant ~BR
virus compri~ing viral DNA fro~ a naturally-occurring IBR
virus in whîch DN~ ancoding gpE glycoprotein has be~n
al ~r~d or delet~d ~o that upon replication the
recombinant IBR viru~ produces no gpE glycoprotein and
DNA corre~ponding to the US2 r~gion of the naturally
occurring IBR viru~ ha~ been deleted.
The present inv~ntion furtber provid~ a recombinant IER
viru~ co~pri~ing ~iral DNA fro~ a naturally-occurring IB~
Vi~5 f r~m w~ich ~ DNA in th~ uniqu~ short region of khe
naturally-occuxrin~ I~R viru~ has bsen del~t~d. Foreign
: 20 ~N~ may b~ in~rt2d into th~ DNA o~ th~ recombinant IBR
virus. The ~or~ign~DNA may be in~erted into the XbaI
site in ~he long uni~ue region. The forei~n DN~ may be
: ~ a se~uence which~ encodes~bovine rotavirus glycoprotein
: 38; this ~e ~ ence:may be inserted into the XbaI ~ite in
25 : the long uni~ue r~gion. ~ ..
The prese~t ~nvention provide-e S I3R-008, a r~combinant
R:virus co~pri~ing vira;l~DN~r~ a naturally occurring
IBR ~iru~from which~DN~co~ e~ponding t~ the US2 region `~
of ~h~ naturally-occurring I~ viru has b~n del~ted a~d
in which a ~rei9n DNA ~equence which ~ncod~ bovine
rotaviru~ glycopro~ein 38~ha ~en in~erted into the XbaI
site in th8 long unique region. S-IBR-008 wa~ deposited ~.
on JunE 18, 19~6~pur~uant to the Budape~t Treaty on th~
35 Internat~onal Depo5it o~icxoorgani6mC ~or th~ Puxpo~ ;
: of Pate~t Procedure ~ith the Pat~nt Culture ~epo~itory of
the ~merican Type ~ulture Collection, 12301 Parklawn -;.
,
WOg3/~210~ PCT/US~2/060
C~
~ 24
Drive, Rockville, Maryland 20852 U.S~A. under ~TCC
Accession No. YR 2141.
The pre~ent invention further provide~ a recombinant IBR
virus comprising ~iral D~A from a naturally-occurxing IBR
virus from which ~1) DNA corresponding to the US2 r~gion
of the natural~y-occurring IBR virus ha~ been deleted and
(2) at lea~t a portion of both repeat sequence~ has been
deleted. The pro~ent invention further provides an
examp1e of such a recombinant virus, desi~nated S-IBR-
02?. S-IBR-027 was deposited on April 17, 1991 pursuant
to the Budapest TrQat~ on the International Deposit of
Microorganisms for:the Purposes of Patent Procedure with
the Patent Culture Depository of the American Type
Culture Collection, 12301 Parklawn Drive, Rockville,
~aryland 20852 U.S.A. under~ATCC acces~icn No. VR 2322.
: :
The present invention f ~ er pro~ides a recombinant IBR
virus comprising vir~l DNA from a natura11y-ocourring IBR
virus fro~ which at lea t~ a portion o~ both repeat
se~uences has~been~deleted.~ :
The~present invention~further provides a recombinant IBR
virus àomprising~viral DNA from a naturally-occurring IBR
2~5 virus:fro~ which~ t~ at:1east a portion of both repeat
:: :sequences:~has been deleted~and ~2) ~NA encoding one or ~: more EcoRV ~restriction 6ites~ ha~ been d~le~ed. The
: prese~t invention:~further provide~ an example of 8UC~ a
recombinant virus~ dQ~ignated S-IBR-002. S-~BR-002 wa~ -
deposit~d on June~ 18,~ 1986 pur~uant to the ~udape~t
:Treaty on:the In~ernational Deposit of ~icroorgani~m for
: t~e Purpo~es of Patent~Procedure with the Patent Cultur~
: : Depository of the~American~ype Culture Collection, 12301
Parklawn Drive,:Rockvillej ~ary~and 20&52 U.S.A. under
35 ATCC Acces~ioD ~o.~:~VR~2140. ~::
WO 93~2 1 ()~
2 ~ 1 ~` G 1 1 PCr/US92/0603~
--25--
The present invention further provide a recombinant IBR
virus comprising vixal DNA from a naturally-oc:curring IBR
virUC from which t1) at least a portion of both repeat
sequence~ has ~en dPleted and (2) wher~in foreign DN~
has b2en inserted into the DN~ of the recombinant IBR
virus . The f oreign DNA may be a s~quence which encodes
the Tn5 ~E0 gene.
The pr~sent invention further provid~ S-IBR-020, a
recombinant IBR viru~ compri~ing ~iral DN~ froD~ a
naturally-occurring IBR viru from which ( 1 ) at least a
portion of both r~peat fiequ¢nce has been deleted and (2)
whereir~ ~a foreign DNA s~quence which encod~s the q~n5 NE0
gene has be~n inserted int:o the DNA o~ the recombinan~
IBR virus.
The pre~6~nt invention a1so provide~ a reco~inant IBPc
virus comprising vixal DNA ~ro~ a naturallyoc~ccurring IBR
virlls frc~m which ( 1) at lQa~t a portion o~ b~th reP~aat
2û sequence ha~i; been de1eted, (2) ~rh~rein a ~~ DNA ..
sequence whi::h encode~; the ~n5 ~E0 gene ha~ been il~Serted
:~ into the DNA of the recombinant ~BR YirUE;, a~ t3)
wherein at l~ast a portion of the thymidine kin~ gene
bas been deletedl :
Th~ pre~en~ invention also prc~Yide~ 21 r~c~mbirlt IBR
virus: compri~ing viral DNA~ from a naturally-oc~ ng ~R
virus: ~rom which ( 1 ) at 1east a portion o* ~ot2repaat
seguenae~ ha~; been: deleted, (2) wherein a ~ ~n DNA
sequence s~Jhich enco~es ~he Tn5 NEO 3ene ha5 b~eJl~e~:ed
into ~e DNA ~3f the reco~inant IBR virus ~nd ( 3 )
wherein at least a portion of~ the thymidine k~è yene
has be~n d~le~2d. ~ ~he: ubject in~elltio~ e~ an
exa~pl~ of ~uch a ~ reconlbinant viru , de~ign~;-IBR-
028. S ;IBR;:02~ wa~ depoE;ited~ on ~lay 14" 1991 g!an~ to ~ :
the E~udapeet Treaty Oll the Inter~ational ~t of
~icroorganis2as for t:he Purpose o~ Patent ~r~e With
~ .
S~
W093/021~)~ PCT/US92tO6
26-
the Patent Culture Depo~itory of the American Type
Culture Coll~ction, 12301 Parklawn Drive, Rockville,
Maryland 20852 U.S,A. under ATCC Acce~sion No. VR 2326.
The present invention ~rther provide~ a reccmbinant IBR
virus compri~ing ~iral DNA ~rom a naturally-occuxring IBR
virus in which a foreign DNA ~equence which encodes the
~n5 NEO gene has b~en infiert2d into the viral D~A. The
Tn5 NEO gen~ ~ay ~ und~r the control of an in~erted,
upstrea~, pseudorabies viru~ glycoprotein X promoter~
The subjQct in~ention f ~ er provide~ an example of a
rQc~mbina~t viru~ wherein the Tn5 NEO g~ne i~ under the
: control of an in~erted, up~trQam~ pseudorabiec ~irus
qlycoprotein ~ promot , de~ignated ~-IBR-004. S-IBR-004
wa~ deposited on May 23, l9B6 pur6uant to ~he Budap~t
Treaty on the International Deposit of ~qicroorgani~las for
~: the ~oses of Pat~nt Procladur~ with the Pat~nt Culture
Depository o~ *h~ A~rican qype Culture e::ollection, 12391
Parklawn Drive, Rockville, l~aryland 20852 U.S.A. under
ATCC Accession No. VR Z134.
The sub3ect invention further pro~rides a recombinant IBR
virus c:omprising viral DNA from a naturally occurring IBR
virus: in which :a fo~eign DNA ~equence which encodes the
~he~.i~ B-galacto idase and Tn5 ~E:0 gene~, and ~.
the parain~luenza type 3 virus hemagglutinin g~ne, HN,
ha~ be~n insert:ed into~ the viral DNA~ The ~;ubject
inventio~s provide~ ~an ~ example OI such a Eecombinant
virus, d~ ignated S~IBR 018
The subject inveIItion further provide~; a rec:ombinant IBR
'ViEU8 coD~prising viral~:~DNA ~roDI a naturally-occurring IBR
virus in which a: foreign DNA ~equence ~hich eneod~-~ the
: ~ ~ B-galacto~ids e a~d Tn5 NEO s~en~, and
the parainfIuetlza ~ 3 Yi~ fu~ion gene, F, h~s bQen
inserted intQ the viral DNA. Th~ sub; ect invention
W093tO21~ PCT/US92/06034
-27~ t.~.
provides an example of such a recombinant virus,
designated S-IBR-Ol9.
The recombinant viruses of the subject invention were
derived from the Cooper Strain. However, other IBR
viruse~, uch as the LA ~train or the 3156 ~train, may
also be u~ed.
The subject invention al~o provides a vaccine which
: 10 compri~e~ a suita~le carrier and an effective immunizin~
amount of any of ~ e recombinant Yiruces of the present
invention. The vacc~ne ~ay contain either inactivated or
live rec~mbinant viru~. ~
:
Suitable carriers for the recombinant ViXU6 are well
known in the art and include protein~, ~ugar~, etc. one
example of such a~suitable: carri~r i~ a phy~iologically
: balanced cultur~ medium containing one or more
: stabilizing agents such as~hydrolyz~d p~otein8, la~tose,
2:0 etc. Preferably, the li~e vaccine ifi created by taking
~:`
tissue cu}ture~fluids and adding ~tabilizing ag~nts such
as stabilized, hydrolyzad- protein~. Preferably, the
inactivated vaccine u~s ti~sue culture fluid~ directly
after :inactivation:of the~virus.
~ :~
The subject invention al o provides:a Yaccine which
~ ~ ~ comprises a suitable carri~r and an;~effe5tiYe immunizing
::~; amount of a rec~mbinant virus comprising viral DN~ from
: a na~urally-o curring IBR virus in~which~DNA encoding ~pG
3~ glycoprotein has been:altered or delQted ~o that upon
replication the reoombinant IBR virus produ~es no gpG
glycoprotein.
:: The subject invention~provide~ a ~accine which c~prise~
~: 35 a suitable carri~r and~an e~fectivQ i~munizing a~ount of
a reco~b~nant IBR; viru~ co~prising viral N~ from a
naturally-oecurriDg IBR viru~ in which DNA encoding gpG
:
W~93/0210~ PCT/US92/06034
28-
glycoprotein has been altered or deleted and DNA encoding
the gpE glycoprotei~ has been altered or deleted so that
upon replication the recombinant IBR viru~ produces no
gpG glycoprotein and no gpE glycoprotein.
The subject invention also provides a vaccine which
comprises a suitable carrier and an effective immunizing
amount of a recombinant IBR virus comprising viral DNA :
from a naturally-occurring IBR virus in which DNA
10 encoding gpG glycoprotein ha bQ~n altered or deleted 60 ~;
that upon replication the recombinant IBR viru~ produces
; no gpG glycoprotein, DNA corre:sponding to the US2 region
~: of ~he naturally~occurring IBR virus has :been deleted, :~
and DNA encoding th~e gpE glycoprotein has been altered or
deleted.
The subject inv~ntion: ~urther provides a vaccine which
co~prises a ~uitable~carrier and an effective immunizing
: :amount of a recombinant IBR ~irus~ compri~ing viral DNA
~ from a naturally-oc¢urring: IB~ viru~ in which (1) DNA
corresponding to~;the US2 region of the naturally-
occurring IBR virus ha~ been deleted, and (2) DNA
encoding gpG glycoprotein has:been altered or deleted. -:
:: ,
;2~5 : The subject: invention al o proYides: a ~accine which
compri~es a suitable carri:er and an eff~ective immunizin~
amount o~a recomb~ina~t:IBR viru~ comprisin~ viral DNA
from~ a:~ naturally-occurrin~ IBR virus in which DNA
encoding gpE glycoprotein ha ~ been a:ltered~:or d~leted 80
~ ~ 30 that upon replication ~he recombinant IBR viru8 prod~ce~
;~no gpE glycoprotein.~; .
: The subject invéntion provides a vaccine which Gomprises
~; ~ a:~uitable carrier~and~an effective iDmunizing a~ount ~f
35 ::a: recombinant:IBR~virus :comprising viral D~A ~rom a
;naturally-oc~urring~IB~:~iru~ in~which DN~ eneoding gpE
glycoprot@in ha~ been:alterad: or deleted ~o th~t upon
WO 93/0210~ PCI'/~1S~2/0603~
-29- 2 ~ i 3 ~ ~ 1
replication the recombinant IBR virus produaes no gpE
glyc:oprotein and DNA corresponding to the US2 regi~n of
the nakurally-occ~Lrring IBk virus has been deîeted.
5 The ~ubject inventiorl al80 provides a vaccine which
cc~mprise~; a ~uitabl~ carrier and an ~ffectiva~ i~aunizing
amount of a recombinant IBR ~riru6 compxi~;ing viral DNA
from a naturally-occurring IBR viru~ from which DNA
corresponding to ~e US2 region of the naturally-
10 occurring IBR ~rirus ha~ be~n deleted.
The subjec:t iJlvention provide~ a vac:cin~ which coDIpri~esa E;uitable aarr~er ~nd an e~fecti~re i~munizing a~ount of
a reco~binant IBR Vinl6; o~mprising viral I:~NA fr~m a
15 naturally-occurrins~ IBR 'v~ru8 from which at least a
portion of both rep~at ~equences ha~ n deleted.
,
The sub;ect i~rention ~urther provides a ~accine which
compri~es a ~uitable carrier and an e~ective immunizing
2 0 amvunt of a r~combinant IBR ~iru~ compri~ing viral D~A
rom a natura}ly-o~urr:ing IBR ~irus in which a for~iyn
DNA sequence which encod~ the Tn5 NEO g~ne ha~ ~een
inserted into ~he~viral DNA.
The subject invention also pro~ide~ a vaccin~ which
comprise~ a ~uitable carrier and an effectiv~ immunizing
amo~nt~ a recombinant I~R virus comprising viral ~NA
from a naturally-occurring IBR viru~ in whi~h a ~oreign
DN~ ~guenc~;whi~h~ ~encodes the ]_.e:=Lh:L~
ga~acto~idas~ aDd Tn5 N~O geneg, and the parainfluenza
type 3 viru& hemagglutinin gene, ~N, has bee~ inserted
into ~he viral DNA.
The subject inv~ ion also pr~vides a vac~ n~ which
co~pri~ a ~uitable c~rri~r and an ~ Gti~e i~mu~izing
a~o~nt of a re~o~bi~ant IBR viru~ co~pri$ing viral DN~
fr~ a na~urally oceurring IBR viru~ in which a f oreign
WO 93/0211)1 PCI /lJS92/060
~sOi~ 30--
DNA sequ2nce which encodes the Esc~eriçhia Ç~li B-
galactosidase and Tn5 NEO genes, and the parainf luenza
type 3 virus fusion gene, F, has been inserted into the
viral I)N~.
:.
All of the ~raccines de cribed hereinabove and hereinbelow
may contain either i~lactivated or live r~co~binant virus~, :
The vaccine~ may be admini~tered by any of the methods
well known to those ~kill~d in the art, for example, by
intramuscular, ~ubcutaneou~, intraperitonaal, or
intravenous injection. AlternatiYely, the ~accine may be
administ~rlad intranasally or orally.
The pre~ent invention also pro~ride~: a method oP
immuniz ing an ani~l again8t i~lf ec:tious bovine
r~inotrach~iti~3 virus which compri~es administering to
th~ ani~al ~n ef ec:tive i~unizing dose oP any o~ the
vaccines of the present i~ven~ion. ~he animal ~ay b~
bovine.
The sul~ject invent:ion ~ ;o pro~ide a ~ethod for
distinguishin~ ~n ~ani~al vaccinated with a ~accine which
comprises an ef f ective îr~unizing a~aount of a reco~inant
vinls of th~ present inv~ntion from an 2Inimal infec~ed
with a naturally-occurrihg IBR ~ ; which compri~C
analyzing a ~amp~e of a body :flui~l fro~ the arlimal ~or
the pr~ence of ç~pG glycoprotein: of IBR virla~ and at
lea~t one other antigen ~normally ~xpres~ed in an animal
inf~cted by a nalturally-ocGurring IBR viru~;t id~nti:fyinçl
antigens ~ whiC:h are pre~ent in the ~dy :Eluid, and
d~ter~i ning whether ~pG glycoprotein i~; pre~i;ent in the
body fluid. The pre~ence of antig~ns which are normally
expres!s~d in an animal by a naturally-occurring IB~ virus
and th~: ab~nce of gpG glyooprol:~in in the body ~luid is
indicative o~ an ~nimal ~raccinated with the vac:cine and
not inIect~d wit~ a naturally-occu~ing IBR v~ rus ~. Th~
presence of an~ig~n~ and gpG; glycopro~in in the body
' '
WO 93/~2104 P~r/US9~/06û~
2 ;~
--3 l--
f luid may be determined by detecting in the body f 1 uid
antibodie~; specif ic f or the antigens an~l gpG
glycoprotein .
5 One of the vaccines that i5 u~eful in this method i~ a
vaccine which compri~; a ~uitable carrier and an
effei::tive i~munizing amount of a recombinant virus
csmpri~ing viral DNA fro~ a naturally-occurring IBR viru~
in which DNA ~ancoding gpG glycoprotein ha~ b~en altered
10 or deleted ~o that upon replication the recombinant IBPc
virus produces no gpG qlycoprotein. Another vaccirle that
i use~ul in this m~thod i5 a vaccine which compri~e~ a
suitable carrier and an effective immunizing amount of a
recombiDant IBR viru~ ompri~s;ing vir~l DNA f rom a
15 naturally-occurring IBR viru6 in which DNA ~ncod~ng gpG
glycoprotein ha~ en alter~d or delet~d and DNA ~ncoding
the gp~ glye:oprotein ha~ lt~3r~d or d~ ted 80 that
upon replication ~e r~c~mbinant IBR v~ru~ prnduce~ no
gpG glycoprotein 2nd n~ gpE glycoprotein. Y~t ano~her
0 vaccine that i~ useful i~ thi~ method is a vaccine which
o~prises a suitable carrier and an effecti~e immunizing
amount o~ a reco~binant IBR viru co~pri~ing viral D~A
: ~ from a naturally occurring IBR YirU~ in w~ich DNA
en~oding ypG glycoprotein has bee~ ltered or deleted ~o
25~ that~upon replication ~he recombinant BR virus produces
~ no ~pG glycopro~ DNA corre~ponding to the US2 region
:~ ~ of~ the~ naturally-occurring:IBA virus has been delet~d,
and DNA enc~inq the gpE glycoprotein has~been altered or
del-ted. Still~another~v~ccine tha~ i~ u~ful in thi~
method~ is a ~accin~ which c~mpri~e~ a ~uitable carrie~
and an ef~ctive i~unizing amount of a r~combinant T8R
: virus co~prisi~g Yiral~DNA~fr~m a natuxally-occurring IBR
:~irus in which tl)~DNA corr~ ponding:to the US2 r~gion of
: the n~turally-occurring IBR viru ha been:del~ted, and
: ~2~:D~A ~ncoding;~pG~ glycoprotein ha~ be~n altered or
~ d~}~t~d. ~ ~
: ~ ,
:
: :'
WO 93/021~ PCrf US92/060
3 2 -
Th~ present invention also pro~rides a method f or
distingui~hing an animal vaccinated with a vaccine which
comprises an effective immunizing amount of a r-~combinant
virus of the present invention from an animal infected
S with a naturally-occurring IBR virus which c:ompri;es
analyzing a ~ample of ~ body fluid from the animal for
the presence of gpE glycoprotein of IBR Virll5 and at
least one other antigen normally expres~;ed in an animal
infected by a naturally~occurring IBR virus, identifying
antigens which ~are pre ent in ~he body f luid and
determining whether gpE glycoprotein is pre~:ent in the
body fluid. The pr~3 ence of antigenE; which are normally
expressed in an aniD~al by a naturally-oc:currillg IB~ virus
and the absence of gpE glycoprotein in the body ~luid is
indicati~e of an ani~al vaccinated with the vas::cine and
no~ inf ected wi~h a naturally; occurring IBR ~riru~ . Th~
presence of antigen~ and gpE glycoproteia~ in ~he body
~luid ~ay be deter~ined by detecting in the body f luid
: ~ antibodies ~pecif ic f or the antigens and gpE
~` 2 0 glycoprotein .
One of the vaccine~ u~;eful in this meth~d i~ a vaccine
whic:h compri~es a suitable carrier and an e~f ~ctive
immunizing amoun~ of a recombinant IBR virus compri~;ing
vira~l DNA from a naturally-oc:curring IBR viru~; in which
~: ~ DN~ encoding gpG glycoprotein hzl~ been altered or deleted
and DN~ encoding the gpE glycoprotein ha~; be6!n alterQd or
deleted 80 that ~ upon r~plication the recombinant IBR
virus pr~duces 210 gpG gly5::0protein and no gpE
3 0 glycoproteir . Anc~ther vac:cine that iç; u~e~ul i~ thi6
method i-~ a vaccine which o~prises a . uitable carrier
and an e~f ~ctive immunizing amount of a recom~inant IE~
virus co~p~ising ~iral: DNA fro~ a naturally occurrin0 IBR
virus in which DNA ~ncoding gp~; glycopr4tein ha~; b~Qn
altered or d~let~d ~;o~ that upon replication the
recombinant IBR ~iru~ produces no gpG glycoprotein, I~NA
c:orrespollding to the US2 region of the naturally-
WO93/0~10~ PCT/US92/06~3~
_33- 2 ~ ~ :3 S ~ ~
occurring IBR virus has been deleted, and DN~ encoding
the ~pE gly~oprotein ha~ b2en altered or deleted. Yet
another ~accine that is useful in thi~ method is a
vaccine which comprises a suitable carrier and an
e~fective immunizing amount of a recombinant IBR virus
compri6ing viral DN~ from a naturally-occurring IBR viru~
in which DNA encoding gpE glycoprotein has been altered
or deleted ~o that Upo~ replîcation ~he recombinant IBR
viru8 produce~ no gpE glycoprotein. Still ancther
vaccine that is u~e~ul in this method i~ a vaccine which
: compri~es a suitable carrier snd an effective immunizing
amount of a recombinant IBR virus comprising viral DNA
from a natura1ly-occurring IBR viru~ in which DNA
encoding gpE glycoprotein has been altered or deleted BO
~5 that upon replication the recombinant IBR ~irus produces
no ~ E ~lycoprotein and DNA correspo~ding to the US2
; region of ~ e naturally-occurri~g IBR ~iru~ has b~n
: deleted.
The present invention al~o provides isolated DNA encoding
the gpG glyooprotein of IBX virus. The subject invention
also provides purified recombinant gpG glycoprotein
~; ~ encoded~by the DNA encoding ~he gpG glycoprotein of IBR
virus. The s ~ ject: invention further provides a
recombinant cloning :vector which compri~ the DN~
; . enco~ing the~qpG~glycoprotein of IBR viru~. The subject
invention ~also proYide9~a;r~combinant expreEsion vector
whi;ch comprioes the~DNA encodin~ the ~pG gl~c~protein of
IBR Yirus. : me ~subject i m ention provide~ a host cell
which co~pri~es t~e~reco~binant expression vector which
co~ris~s~ the DNA encoding the gpG glycoprotein of IBR
virusO
: ~ The ~ubJec~ invention al80 provides a ~ethod o~ producing a polypeptid~whi¢h co~pri~e9 ~rowing the host cell which
co~prises the :r~co~binant ~xpr-~sion vector which
: comprises the~DNA encoding the gpG glycoprot~in of IBR
'
W093/02~0~ PCT/US92/060
34-
irus under condition~ ~uch that the recombinant
expre~sion vector expre~ses gpG glycoprotein and
reco~ering the gpG glyc~protein so expressed.
The subject invention also provides an antibody directed
to an epitope of the purified gpG glycoprotein of IBR
~iru~ en~oded by the DNA encoding the gpG glycoprotein of
IBR ~iru~. The antibody may be a monoclonal antibody.
~0 The ~ubject invention al~o proYides a method o~ detecting
the presence or ab~ence of gpG glycoprotein of IB~ virus
in a sample which comprises co~tacting:the 6a~ple with an
anti~ody directed to an epitope of the purified gpG
glycoprotein of I~R viru8 encoded by the DN~ encoding the
gpG glycoprotein of IBR viru~ under condition~ such that
the ant~body form~ a aomplex with any gpG glycoprotein
present in the ~ample and detecting the pr~ence or
ab~ence of 6uch complex:. The saæple may be bovine-
:: :
~ : ~ :derived. ~ ~
,
The subjec~ invention also:provide i~olated DNA encodingthe gpE glyooprotein;of IBR~viru5. The ~ubj~ct invention
also provides puri~ied~ reco~binant ~pE glycoprotein
encoded by th~DNA encod~ing the gpE glyaoprotein Gf IBR
~i~us. :The ~ubject~ invention furthar provides a
: re~ombinant ~cloning ~vector~ which co~pris~s the DNA
encoding the gpE~glycoprotein~o IBR ~i~us. ~he subject
:invention pro~idec~:a~rec~mbinant expre~ion ~ector which
~ comprises the DNA~:enc ~ ing the ~pE glyc~protein of IBR
viruæ.~ The subject inv~ntion al~o pro~ide6 a ho~t cell
which comprises the~recQmbinant ~xpression vector which
:: co~prisos the~DNA~encoding the gpE glycoprotein o~ IBR
~ virus. ~
:: 35 ~:The subject inv ntion~al60 provids~ a ~thod o~ producing
a polypeptide which comprises growing ~he h~t cell which
co~prises the reco~binant expres~ion vector which
:
WO93/0210~ PCT/US92/0603~
compri~es the DNA encoding the gpE glycoprotein of IBR
virus under conditions su~h that the recombinant
expre~si~n vector expre~es gpE glycoprotein and
recovering ~he gpE glycoprotein ~o e~prec~d.
The ~ubject in~en~ion alco provide~ an antibody direct~d
to an epitope of the purified gpE glycoprotein of IBR
viru~ encoded by the ~NA encoding the ~pE glycoprotein of
IB~ Y~ru~. The antib~dy ~ay be a monoclonal antibody.
The subject invention al~o provid~s a method o~ detecting
the pres~nce or ab~ence of gpE glycopro~ein of IBR viru~
in a sa~ple which com~ri~es ~ont~ctirlg the sample with an
antibody dir~ated to an epitope of the purif ied gpE
15 glyeoprotein o~ IBR Vinlfi enc:oded by the DNA eneoding the
gpE glyeoprotein o IBR ~iru~ wldsr eondition~ ~uah that
the antibody ~orms a eompl~x with any gpE glyeoprot~in
present in the s;aD~pl~ at~d d~at~eting the pr~nee ox
absenee of sueh c::omplex. The ~a~ple may be boYine-
2 0 d~rived .
The ~;ubject in~en~ion also provide~ a metbod of prodùeinga fetal-~afe, live recombinant IBR ~rirus whieh eomprise;
treating ~riral DNA from~: a naturally-oec:urring live IBR
25 viru~ so a~ to delete~from the virus DNA eorre~;pQndillg to
the US2 region of the naturallyooee~Lrring IBR viru~;.
~:
The subject invention al~o provides a recombinant
p~eudorabi~s ~rirus designate~ S-PKV-160. The subjec:t
30 in~e~tion al~o provide~ an antibody which directed to an
epitop~ of the r--coD~inant p~eudorabies viru5 de~ ed
S--P~aV 60~
The subject i~e~ion al~;o pr~Yide; ieolated DN~ ~ncoding
3 5 t:h~ US2 g~e o~ ~n IB~ viru~ ~ The pr~snt invention
fu~her provide~ a h~olog~ vsc:tor for producing a
recombinan~ IBR viru~ by in~ertin~ foreign D~ ~nto the
:
,,:
W093/0210~ PCT/US92/0603~
3 36
genomic DNA of an IBR virus which comprises a double-
stranded DNA molecule consisting essentially of double-
stranded foreign DNA encoding RNA which does not
naturally occur in an animal into which the recombinant
IBR is introduced, with at one end of the fsreign DNA,
double-8tranded IBR viral DN~ homologous to genomic DNA
located at one side of a site on the genomic DNA which is
not e~sential for replication of the XBR Yirus and at the
other end of the foreign DNA, double-gtranded IBR viral
DNA homologou~ ts geno~ic DNA located at the other ~ide
: of the same gite on the genomic DNA. ~he double-~tranded
foreign DNA may ~urther compri~e :a promoter. The
promoter can be ~ro~ HSV-l a 4 immediate early gen~,
Human cyto~galovirus immediate ~arly gene or
pseudorabies virus glycoprotein X gene. The double-
stranded for-ign ; DN~ may further compri~e a
: : polyadenylation si ~ al~ The polyadenylation ~ignal may
be~from~HSV-l thy~idine kinase gene or p~eudorabies viru~
glycoprotein X gene~ The subject ~n~ention al~o provides
: 2~0 a homology vector wherein the RNA encode~ a polypeptide.
The polypeptide may be a detectable ~ark~r such as
~; ~ Esoher;içhia oo1i~B-ga1aGtosi~aae or bacteria~ transposon
neomycin~resistance protein. :The DNA which encodes the
~ ,
polypeptide may~be~flanked on each side by re triction
sites~ ~permi~tting~s~id ~DN~ to:~be cut out with a
res~riction endoDuc1ea~e~which:cuts at a limit~d number
:of~sites~on ~e:~enome.~:~The subject in~e~tion ~ur~her
provide ~ or;~ a~:: homology vector w~erein the up~tream
doub1e-strandéd~IBR~vira1 DNA i~ homologous to genomic
DNA pre~ent within ~ ~approxi~ately 860 bp NcoI to BamHX
: sub~ragment~of the~:~indIII A fragment of IBR virus and
the downstream ~double-~tranded ~IBR viral DNA is
:: homologous~ ~to ~:genomic DNA present wi~hin the
approximately~I74~ bp~BglII to StuI sub~ra~ment of the
35~ ~indIII A frag~ent~;o~:IBR ~iru~.
WO93/02104 PCT/US92/06034
21 1.-~ .., ?
-37- ~
The ~ubject inv~ntion ~urther provid~s a homology vector
wherein upstream double-Rtranded f oreign DNA which
compri~es a prom~ter and downstream double-~tranded
~orei~n DNA which comprises a polyadenylation signal
flank on each side double-stranded foreign DNA which
~ncodes a detectable marker. The invention further a
homology vector wherein the upstream pro~ot~r i~
homologou~ to genomic DNA pr~ent within the
approximately 490 bp PruII to BamHI ~ubfragment of the
: 10 BamHI N fragment of HSV-1 and khe downstream
polyadenylation ~ignal i~ homologou~ tu genomic DNA
pre~nt within the approximately 784 bp SmaI to Sm~I
sub~ragm~nt of the BamHI Q fragment of HSV-1. The
inventicn urther provides:a homology veator wherein the
DNA which encode~ a:~ tectable marker i~ ho~ologous to
the approximately 1541 bp Bg1II to BamHI fragment of Tn5.
. The subject inv~ntion al~o provide~ a homology v~ctor
wherein the up~tream double-~trand~d IBR vir~l DNA i~
homologous to ~ genomic :~DNA pr~ent within the
approximately 3593:bp ~lndIII to XhoI subfragm~nt o~ the
: ~ HindIII K fragment of IBR viru~ and the downstrea~
:~ double-stranded IBR viral DNA i~ homologous to genomic
DNA preFent within~:the~ approximately 785 bp XhoI to Nd21
25 ~ subfragment of the~indIII K:~rag~ent of IBR virus. The
: i m ention ~furt~er:~provide~ a ho~ology vector wher~in
upstrQ2m doub1e-~tranded foreign N~ which co~prises a
pro~oter:~nd~downstr~am doubl~o~tr~nded forelgn D~A wh~ch
comprises~ a:~polyad-nylation ~igna1 flank on eaoh ~ide ~;
: 30 double-~rand~d~ foreign DNA which enc~de~ ~ d~tectable
.~
marker. This upstr~am~promoter i~ homologou~ to genomic
DNA present within~ he~approximat~ly 1191 bp ~va}I to
PstI ~ubfragment~of the XbaI B frag~ent of H~MV and the
~ dQwn~tre~am polyadenyla~ion sequ~n~e is homologous to
: ~ ~5~geno~c ~NA pr-sent~within the approxi~at~ly 753 bp SalI
;~ ~ to Nd~I ~ubfragm~nt of the BamHI ~7 irag~nt of ~Y. The
DNA which encode~ a ~etectable ~arker is ho~ologou~ to
,:
:
~.
WO 93/0~104 PCr/US92/060~
, f;; ~ ir ~
, q;~ ~ --38--
the approximately 3347 bp BalI to BamHI fragment of
pJF751~
The invention further provide~ a homology vector wherein
5 th~ up~tream dou~le-s:trand~d IBR ~iral DNA i~ homologouE;
to genomic DNA pre~;ent wi'chin the approximately 888 bp
Mlu~ to SmaI sub~ragm~nt Q~ the ~indIII X fragment of IBR
viru~ and the do~m tr~am dlouble-stranded IE~ viral DNA i8
homolo~ous to genomic: DNA pr~ent within th~
10 approxi~at~ly 7~5 bp XhoI to NdeI sub~rag~ent of the
~indIII K fragm~nt of IBR Vl:rU8~ ~he upl3trs~ double-
s~randed for~ign DN~ ay aompri~e a proJnoter and double-
stranded f oreign DNA which compri~e a polyadenylation
signal f lank on each side doubl~strandlæd f oreign DNA
15 which enc~des a detec:table mark~rO The ~ubject invention
al80 pro~rides a ho~nol~ ctor wher~in the up~t~Qam
promoter i~; ho~ol~ou~ ~o ~nomic DNA pr~s~nt wi~in the
appr~ximately llgl bp Av~II to P~tI ~ubfragme~nt o~ ~he
XbaI B fragDIent of HCMV and the d~wnstrea~
2 0 polyadenylation ~ignal ifi hoallologou~ to g~noD~ic DNA
present wi~hin thl3 appr~xi~at~.,y 753 bp S~lI to Nd~3I
sub~ragment o~f the BamHI # 7 f ragment of PRV . The DNA
which encodes a detectable ~arker iE; homc~log0us to the
approximately 3347 bp BalI to B~II fragment of pJF571.
The pre~ent in~rention further ~rovide~ a hc~ool~y v~ctor
wheFein the upstrea~ double-E~tran6 led IBR vir2ll DNA i~
homc)logous to genomic DNA pre~;ent within the
.
apprcxiD~ately :1704 bp SmaI to S~I 3subfragment of the
30 ~?ndIII K ~ra~ent oiE IBR virus and the down~;tream
double-~;tranded IBR viral DNA i~ hosologous to geno~nic
DN~ pr~sent within the approxi~at~ly 742 bp l~heI to Bg~I
subfragment of the S~aI 2.5XB fra~ent of IBR viruE;. The
pre E;ent invention furth-r provid~ a hc~ology vectQr
35 wherein up~r~a~ double-strand~d for~ DNA which
compri~; a ~ pro~oter and down~ r~am doubl6~-~P randed
f oreiqn DNP,. which c:ompriE~; a polyadenyla~ion ~i;is~nal
WO93/021~4 PCT/US92/0603
~39~
flank on each ~ide double-~tranded foreign DNA which
encodes a detectable marker, The up~tream prouoter i~
ho~ologous to genomic DNA present within the
approximately 413 bp SalI to Ba~HI subfragment of the
BamHI #lO fragment of PRV and the downstream
polyadenylation signal i8 homologous to gen~mic DNA
present within the approximately 754 bp Nd~I to SalI
~ubfragment of the BamHI #7 fragm~nt of P~. The
detectable marker is homologous to the approximately 3010
bp BamHI to PvuII fragment of pJF751.
The pre~ent invention provides for a h3mology vector ~or
producing a recombinsnt IBR virus by d~leting DNA which
enaodes a detectable marker which had been in~erted into
the genomic DNA of an IBR viru co~pri~ing a double-
stranded DNA molecule con6istin~ e~entially of double-
stranded IBR viral DNA homol~ou~ to the genomic DNA
which flank on each side the DNA to b~ del~t~d. The
subject invention further provid~s a ho~ology vector
wherein the upstream double-strand~d IBR viral DNA i6
~ homologou~ to geno~ic DNA pr~nt within the
: ~ approximately 888 bp MluI to SmaI subfrag~ent of the
~indIII K fragment: of IBR viru~ and the downstr~am
: double stranded IBR viral DNA is homologou~ to g~nomic
DNA preBent within~t:he approYimately 785 bp XhoI to Nd~
:~ subfra~ment of the~indIII K frag~ent of IBR virus.
~: The pre~ent inve~tion al~o provid~s a ~ethod of
i ~ izing: an: animal again~t infectlou~ bovine
rhinotracheitis viru~ which compris~s ad~ini~tering to
: the ~ni~l an effecti~e immunizing do~e of a~y o~ the
:~ : vaccines of the pre~ent:invention. ~he ~ni~al may be a
: bovine. The ubject~ ~invention al~ provides a
: recombinant IBR virus compri~ing viral DNA from a
naturally-occurring IBR viru~ ~ro~ wh~ch ~t lea~t a
portion of both ~:re~t s~quence~ have ~een dslet~d,
~pecifically, ~herein DNA ~ncoding one or m~re Eco~V
,
WO93J~210~ ~ ~ PCT/USg2/0603'1
?J~
-40-
restriction site~ ha~ been deleted, and wherein foreign
DNA has been inserted into the DNA of the recombinant
virus. The foreign DNA may be a DMA sequence which
encodes bovine viral diarrhea virus glycoprotein gp53.
The subject invention provide~ an example of such a
recombinant IBR viru~, de6ignated S-IBR-032.
The subject invention provides a recombinant IBR ~iru~
compri~ing ~iral DNA from a naturally-occurring IBR viru~
from which DNA fro~ the US2 gQne, the gpE glycoprotein
gene and the gpG glycoprotein gene have been deleted 60
tha~ upon replication, ~he recombinant IBR viru8 produces
no gpE glycoprotein and no gpG glyc~protein. A Foreign
DNA sequence may be in~erted in place of the deleted DNA
I5 which encodes gpE glycoprotein. The forei~n DNA sequence
that may be in~erted can;be a foreign DN~ s~uence which
encodes ~ B-galacto~idase. ~he ~ubj~ct
invention provide~ an exa~ple of such a recombinant
virus, designated:S-IBR-039.
The cubject invention furth~r provide~ a recombinant IBR
virus comprising viral DNA fro~ a naturally-occurring IBR
- virus in which DNA:Srom the:US2, gpE glycoprotein gene,
the:gpG glycoprotein:gene and the thymidine kinase gene
has been deleted~:~ 80 that upon replication, the
recombinant IBR :viru~:produce~ no gpE glycoprotein, no
~ spG glycoprotein and no:~thymidine kinase. The su~jec~
: : :invention provide~ an exampie of ~uch a recombinant
viru~ de ignat-d S-IBR-045. A foreign DNA s~guence may
be insert~d in ~pl~oe o~ the deleted DNA encoding gp~
glycopro~ein. : The~ :foreign DNA ~equence ~ay encode
gol~ B-salacto~ida~e. The s~bj~ct invention
provides an Qxamp~e~ of ~uch a recombinant YirU~,
: designated S-IBR-044.~ The foreign DNA ~equ~nce may
encode b~vine viral diarrhea viru gp53 glyeGprotein.
The subject ~invention :pro~ides an ~xample o~ such a
recombinant ~irus, designated S-IBR-046. The f oreign DNA
WO 93/02104 PCI/US92/0603~
~1 ~ 3~
--41 ~
equ~nce may encode Parainf luenza virus type 3 fusion
protein and Parain~luenza viru~; type 3 hemagglutinin
protein ~ The subj ect application provides ~n example of
such a Virll6, de6igna ~d S-IBPc-047. The foreign DNA
5 sequence ~nay encode Bovin~ respiratory ~ync:ytial v irus
~u~ion protein, Bovine re~pir~tory E;yneytial ~virus
attac:hment protein and Bovine re~piratory syncytial viru~
nucleocap~id prot~in. The ~ubject in~ention provide~ an
~xa~nple of ~uch a r~co~binant viru~, designa~ed S-IBR
10 049. The fc~reign DNA sequence may encod~ ~E~
;i~ leukotoxin and ~11~ iron
r~gulat~d nuter membxane protein~. The sUbjQC:t inv~ntion
provides an exa~E~l~ of sueh a r~eombin~nt viruc,
de~ignat~d S~ OSl.
The E~ubjeet inv~ntion al~o proYid~s a r~e~bin~nt IBR
virus eompri~in~ ~riral DNA frola ~ naturally-oec:urring IBR
virus from whic:h DNA fro~ 'che US2 gs~e, thq~ gpE
glyeop~otein g~ne, the ~ glyeoprot~in gen~ and the
20 ~ymidine kin~se gene hav~ b~en deleted ~o ~hat upon
rep}ieation, t;he reeombinant IBR viru~ produe~ ne gpE
lyeoprotein, no gpG çllyeoprotein and no ~hy~idine
kina~e. The ~ubjeet invention provid@s Por a ~or~ign ~NA
se~enee in~erted in plaee of the ~NA whieh eneodes
2 5 thymidine kin~se . The f oreign DNA ~e~e~see may ~neode
glucuronida~e. ~rh~ pre~ent inventlon
further provid~ a r~combiriant Yirll~i; wh~r~in a forei~
DNA ~quence i~ :ln~;ert~d: in~pl~c~ of the l)NA ~ncoding gpE
glycopro~ain. The Soreign DNA ~quence ~nay ~ncod~
30 ~_b=.s:i~ B-galaGto~ida~e. The present in~ention
f~arther pro~ide~ an exampl~ of ~uch a re-:~inant viru~,
de~i;ignat~d S-IB~a ~ ; 04 3 .:
::
The ~ ct in~ntion al80 prvvide~ a ~ac:cine which
35 co~ri~ an ~ffective i~u~i~ing a~ t of any of the
rQco~binant viru~ o~ ~he pre~e~lt i~Y~ ion and a
WO 93/0210~ PCr/US92~0603
42-
suitable carrier. The vaccine may contain either
inactivated or live recombinant virus.
The pr~sent inventic~n provides a vaccine which compris~;
5 an effective iT~rmunizing amount of recombinant virus
protective again~;t bovin~ rasp~ratory disea~e coDIlplex and
a suitable carrier. A recombinant viru~ may be a
recom~inant IBR virus and the recc~mbinant virus can
consist e~sentially of any or all of the recombinant
10 viru~s of the present invention.
The subjee:t in~rention al~o provid~s for a vaccine which
comprises an effective i~nmunizing amount o~ a recombinant
v~rus and non-recombinant viru~ protective againt;t bovine
15 respiratory di#ea~e complex and a ~uitable carri~r.
The subject irlY~ntion further provid~ a vaecine which
co~pris~ all effective i~unizing amount of a recc~mbir~ant
IBR ~rirus and non-recombinant viru~ protective again8t
bovine respiratory di~ease complex and a suitable
:~ carrier. The recombinant IBR ~iru~ can con~i~t :~
: ess~ntially of any or all of the r~combinant viru~e~ of
the subject invention.
For purpo~e6 of thi~ i~ven~ion, the infectious di~ea~e~
that contribute to~ bovine ~re~piratory di~ea~e c~mplex
include inf~ctious bovine rhinotracheitis, parainfluenza
: type 3 virus, ~ bovine viral diarrhea viru~, bovine
respiratory ~yncytizl virus~and Pasteurella hae~olytica.
For purpo~es of the pr~ent invention, ~on-recQmbinant
: viru~e~ can include, but : are not li~ed to;
conventionally deriv~d viru~es ~hich includ2 kill@d
virus, inactivated bact~rin~, and ~odified live viru5~.
Th~ ~ubject inventio~ further provides ~or a method o~
: immunizing ~n ani~a~ a~ain~t inf~ctious bovine
W093/0210~ PC~/US92tO~03~
2 ~ .A _ 3
-43-
rhinotracheiti~ which comprise~ admini~tering to the
animal an immunizing dofie of any of the vaccine~ of the
present invention. The ~ubject invention further
provides a method of immunizing an animal against
Parainflu~nza type 3 which compri~es administering to the
animal an immunizing dose of the vaccine of the pre~ent
invention tha~ contain~ the IBR viru~ encoding antigens
for Parain~luenza type 3 viru~. The 8ubj ect invention
,. ,
further provide6 a method of immunizing an animal again~t
bovine viral diarrhea which compris~G admini~tering to
the animal an immunizing doAe of the vaccine of the
present invention that contains the IBR virus encoding
antigens for bovine vir~l diarrhea viru~. The subject
invention further provides a method of immunizing an
animal against b~vine re~piratory yncytial virus disease
which compris~ ~d~inistering to ~h~ animal an immunizing
~: : do~e of the vaccine of the pr~sent invention that
contain~ the IBR viru~ encoding antigen~ for bovine
respirato ~: syncytial virus. Th~ ~ubj~ct invention
:~ 20 further provides for a method o~ immunizing ~n animal
against Pneu~onic pasteurellosis which c~mpri~e~
administering to ~the animal an immunizing do e of the
vaccine cf the present invention ~hat contain~ the IBR
: viru~ encoding a~tigens for Pasteurella haemolytica.
he invention further pro~ides a method of immunizing ~n
animal against~bovine respiratory dis~se compl~x which
mprises administering ~to an animal an immunizing dos~
of th~ vacci~e~con~aining the recomblnant IB~ viruse~ o~
30 ~ the pre~ent inv~ntion or the recombinant ~iru~e~ o~ ~he
present inv~ntion and non-r~combinan~ virus~. For
: purpose~ o~ thiD i m e~tion, ~h~ anima~ ~ay be a bovine.
The inv~ntion: ~fuxther ; provide a m~thod for
distinguishing an ani~al vac4inat~d with a vaccin~ which
:35 co~prises an eff~ective ~ ~unizing amount of a reco~bina~t
virus of the pr~s~nt:inv~ntion fr~m an ani~al infect~d
with~ a naturally~occurring IBR virus which c~pri~es
.
W093/0210~ PCT~US92/060
s~ -44-
analyzing a ~ample of a body fluid from the animal forthe pre~ence of gpE glycoprotein of BR virus and at
least one other antigen ncrmally expressed in an ani~al
infected by a naturally-occurring IBR virus, identifying
antigens which are pre~ent in the body fluid and
determining whet~er gpE glycoprotein i5 present in the
body fluid, the presence of antigens which are normally
expres~ed in an animal by a naturally-occurring IBR virus :
and the absence of gpE glycoprotein in the body fluid
being indicative of an animal vaccinated with the vaccine
- and n~t infected with a naturaIly-occurring IBR virus.
.
.,
. .
:
'
,: ~
;
,
.
W~) 93/021~ PC~r/US9~/0603~
2 ~ i3 ~
--4 5--
Matçria ls ~nd Method~s
PREPARATION OF IBR VIRUS STOC~ SAP~PLES. IBR virus s1:oc:k
samples were prepared by infecting MDB~ cell~ at a
5 multiplicity of infection of 0 . Ol PPrtJ/cell in Dulbecco' s
Modified Eagle Medium (DMEM) containing 2 mM glutamine,
100 units/ml penicillin, 100 units/ml streptomycin (the~e
~mponents were obtained from Irvine Scientific or an
equivalent supplier, and hereafter are r~ferred to a~
complete DME medium) plus 1% fetal bovine ~erum. After
cytopathic effect wa~ complet~, the medium and cells were
harvested and the cells were pelleted at 3000 rpm ~or 5
minutes in a clinical c~ntrifuge. Cell~ were r~fiuspended
in 1l10 the original volume of mediu~, and an e~ual
volume of skim milk (9% skim milk powder in H20
weight/volume) was added. The viru~ sample was frozen at
70C. The titers were u~ually about 10~ PY~/ml.
,
PREPARATION OF HERPESVIRUS DNA. For herp~viru6 DN~
preparation, a confluent ~onolayer of cells ~MDBK for IBR
virus or Vero;for PRV) in a::25 cm2 flask or 60 mm pe~ri
~;~ dish was infected with 100 ~l of virus sample. After
: overnight incubation, or when th~ cell~ were showing 100%
cytopathic effect, the cell~ were scraped int~ the
25 medium. The cells and~medi~ were centrifug~d at 3000
,
rpm for 5 minutes~in a:clinical centrifugeO The medium
was decanted, and~the cell pellet was gen~ly re~u~pended
in 0.5 ml of solut:ion containing 0.5%::NONIDET P-40 (NP-
40, purcha ed fro~ Sig~a~Chemical Co., St. Louis, MO).
~he sample was incubated at roo~ te~pexature for 10
minutes. Ten ~l of a:stock ~olution of RNase A (Sig~a3
was added (stock wa~ lO m~jml, boiled for 10 minutes t~
inactivate DNAse). The sa~ple was centrifuged to pelle~
nuclei. The DNA:pellet wa~ remov~d with a pasteur
pipette o~ wooden ~stick and discard~d. The ~upernatant
fluid was decanted into a 1.5 ~l Eppendorf tube
containing 25 ~l of 20% sodium dodecyl sul~at~ (Sigma)
W093/02104 PCT/~]S92/06~3
; .';~?~ -46-
25 ~1 proteina~e-K (10 mg/ml; B~ehringer Mannheim).
The sample was mixed and incubated at 37~c for 30-60
minute~. An equal volume of water-saturated phenol was
added and the ~ample was mixed briefly~ The sample was
centrifuged in an Eppendorf minifuge for 5 minutes at
full speed. The upper aqueous phase was removed to a new
Eppendorf tube, and two volumes of absolute ethanol were
added and the tube put at -20C for 30 minutes to
precipitate nucIeic acid. The sample was centrifuged in
an Eppendorf minifuge for 5 minute~. The supernatant was
: ~ decanted, and the pellet wa5:wash~d with -300 ~1 of 80%
ethanol, ~ollowed by centrifugation in an Eppendorf
minifuge for 5 minutes. The supernatant was decanted,
and the pelIet was air dried and rehydrated in ~16 ~1 H~O.
For the preparation of larger amounts of DNA, the
procedure was scaled up to ~tart with a 850 cm2 roller
~: bottle of M~BX cell~.~ The DNA~was stQred in 0.01 N tris
:;; pH 7.5, 1 mM EDTA at 40C.
,
,
Z:O ~PREPARATION OF~ HERPESV}RUS CELL LYSATES. For cell ly~ate
preparation, serum free medi~m wa~ u~ed. A confluent
monalayer of cells~(~ BK for: BR viru6 or Vero for PRV)
in a~25 cm2 flask or~a:60 mm petri dish was infected with
100 ~1~ of virus~sample. A$ter cytopathic effect was
2~5 compléte, the:~mediu~:and: cells were~harve~ted a~d the
cells~ wore pelleted:~at 3000 rpm for 5 minutes in a
clinical ~:;centrifuge.~ For media ~sa~ples medi ~ was
~: ~ concentrated approximately;IO-~old ~by filtration with a
: centricon-lO :~microconcéntrator (Amicon). ~or cell
samples the cell pellet was resu~pended in 250 ~1 o~
disruption :buffer (2% sodium dodecyl sulfate, 2% B-
mercaptoethanol)~ The sampl~s :were soniGated f or 3 0
second~on ice and~stored~at -20C.
~ 35: WESTERN BLOTTING PROCEDUR~.~ Samples of ly~ate~, co~tr~l~
and protein s~andard~ ~ere~run on a polyacrylamide gel
according to the~procedure sf Lae~mli (2). After gel
~.
:: :
WO 93/02104 PCr/US92/0603~
_47_ 2 1 1 i ~ ~ 1
el ectrophoresis the proteills were transf erred according
to Sambroo3c ( 14 ) . The primary antibody was a mouse
hyper-immune serum raised against c~emically-syalthesized
gp~ peptides (a2nino acids 232-252 and 267-287) linked to
keyhole limp~t hemocyanin. The econdary antibody was a
goat a~ti-mouse alkaline p~o~phatase coupled antibody.
MOLECUL~R BIOLOGICAL TECHNIQUES . Techni~ue~ f or the
~anipulation of bacteria and DNA, including such
proc~dures as di5~stion with re~triction endonuclea~es,
gel 6~1ec:trophore~ , extra~:tion o~ DNA ~rom gels t
ligation, phosphorylation with kina~e, treatment w~ th
phosphatase, ~r~wth of ~acte~ial culture~, tran~;formation
of bacteria with DNA, and other molecular biological
methods are described by Maniatis (6). Ea~cept as noted,
these were used wi~ mi~or variati~n.
LIGATION . DN~ was j oined toyether by the action o~ the
enzyme T4 DNA liga~e ~BRL). Ligation r~3c~ions contai~ed
variou~ ~ount~; of DNA ~from 0.2 to 20~g), 2~mlq Tris; p~I
~:: 7 . 5 , lOmM ~gC12 , lOm~ dithio'chreitol ~DTT), 200 ~q ATP
and 20 units T4 DN~ ligase in 10-20 ~1 f inal r~actian
volume. The ligation proceeded iEor 3-16 hour~ at 15C:~
I)NA SEQUENCING. Sequencing was per~ormed using the BRI,
Sequena~e Xit and~ 35S-dATP (NEN) . R~ac:tion~ u~;ing both
the dGTP miYe~ and: the: dITP ~ixe~; were per~o~nsd to
~: clarify areas o~ compression~, AlternatiYelyt c~mpr~ d
area~; were re~;ol~ed ~on f ormamide gel~ . Te31lplate~ wexe
do~le-strand~d plas~id ~;ubc:lorleg or single gtras~ded M13
subclone~, and pri~Qrs were ei~her ~ade to khe v~ctor
jus~ outside the insert~ to: be ~quenc~d, or to previou~ly
obtain~cl s~quenc:e. ~ Sequence obtained wa~3 a~ ez~lbled and
co~pared using Dna5t;~r ~software. ~anipulation and
cs~pari n of ~ ne~ obtain~d was p~r~or~d with
: ~ Superclone ar~d SuperE~e~ progra~æ fr~ Coral Software.
W~ 93/02tO~ Pcr/U~92/06(
8--
SOUTHERN BLOTTING OF DNA . The general procedure f or
Southern blotting wa~ taXen f rom Maniatis t 6 ) . DNA was
blotted to nitrocellulose f ilters and hybridized to
appropriate, labeled DNA probes . Probefi f or southern
5 blots were prepared using either the Nonradioacti-,re 1:7NA
Labeling and Detection Kit of Boehringer Mannheim or the
nick translation kit of Bethesda Research Laboratories
tBRI,). In both cases the manufacturers' recommended
procedures were followed. ~:
DNA TRANSFECTION FOR GENERATINt;: RECOMBINANT VIRUS. The
method i~; ba6ed upon the calcium pho~;ph~te procedure of
- Graham and Van der Eb (24) with the following
modific:ation~;. Virus and/or pla~mid ~DN~ w~re diluted to
29~ ~1 in 0.01 M Tris pH 7.5, lmM EDTA. Forty ~1 2M CaCl2
was added follQwed by an e~al volume of 2X HEPES
buffered saline (lOg N-2-hydroxyethyl piperazine N'-2-
ethane~ulfonic acid tHEPES), 16g NaCl, 0.74g KCl, 0.25g
Na2KP04~2H20, 2g~dextro~e~:per liter ~I20 and bu~fered with
20 NaOH to pH 7.4). The mixture: waç: then incubated on ice
for 10 minut~ and then added dropwiE;e to an 80%
confluent monolayer:~of NDBK or rabbit ~kin (RS) cells
~: ; growing in~ a 60:mm petri dish under 5 ml of ~edium ~DME
: ~ ~ plus~2%.~fetal bovine serum). ~The cells were incubated 4
25: hours at 37oC~in a~humidified~incubator containing 5% C02.
The cells~were then wa hed with three 5 ml aliquots of
lXPBS:~1.15g Na2HP04, 0.2g KH2P04, 0.8g Na~l, 0~2g ~Cl per
liter H20~, and fed:~with 5::ml of ~edium lDME plus 2~ fetal
: bovine seru~ The~cells were incubated at 37C as ab~e
:~ 30 for 3-7 day~ until cytopathic effect from th~ virus was
.
50-lQ09~. Viru~ wa~ hanr~sted a~ de~cribed above for the
preparation of viNs stocks. ~:; This: ~toclc wa~ re~erred to
a~ a transfection~stock~and was:sub~equently æcreened ~or
recombinant virus~by~the BLUOGAL SCREEN ~R REC~MBINANT
35 IBR VIRUS. ~: ~
:
. ~
. '
: :
WO 93/02104 PCr/US92/0603
--49--
HOMOLOGOUS RECOMBIIJATION PROCEDURE FOR GENERATING
RECO~BINANT HERPESVI~US. This method relies upon the :~
homolc~gous recombination between herpesvirus DNA and
plasmid hc~mology ~rector DNA whieh occur8 in tissue
5 cultur~ cellc co-tran~:f ectQd with th~;e ele~ents . From
O .1-1. 0 ,ug of pla~id DNA containing f~reign DNA f lanked
by appropriate herpe~virus cloned se~uence~ (the homology
~rects~r) were mixQd with approximately O. 3 ~Lg of intact
herpe~virus DNA. The DNAs were diluted to 298 ,ul in 0.01
10 M Tri~ pH 7 . 5, lmM EDTA and tran~f~cted into MDBK cells
according to the DNA TRANSFECTION FOR GENERATING
RECOMBINANT VIRUS (~ee above).
: .
DIRECT LIGATION PROCEDI)RE FOR GENER~TING RECOMBINA~T :
HERPESVIRUS. Rather than using homology vectors and
relying upon homologous recombination to generate
recombinant viru~, we:have also deve}oped the technique
~ of direct ligation to engineer herpesviru~es. In thi~
: instance, a cloned for~i~n gene did not require flanking
herpesviru~ DNA s-qu~nce~ but only required that it have
restriction sites~ available to cut out the foreign gene
fragment from the plas~id vector. A compatible
restriction enzyme was u ed:to cut herpe~virus DNA. A
requirement o~ the:technique was that the restriction
~ enzyme used to cut ~the~ herpQ~virus DNA must cut at a
limited number of ~ite~. We have u~ed XbaI, which cut~
IBR virus DNA in one place. We have al~o used Eco~V
which cut~ IBR vi~ ~DNA:in~two place~. For PRV we have
u~ed Xb~I and HindIII, both of which cut in two plac~.
Restriction ~ sites~ j previously introduced into
herpe~viru~e~ by :other methods ~ay al~o be used. ~he -:
: herpes~irus DNA~was~-ixed with a 30-~old m~lar ~xce~s of
plasmid DNA (typically 5~g of viruR D~A to lQ~ of
plas~id ~NA), snd ~he mixture wae cUt with the
appr~pr~a~e r~triction enzy~a. The DMA ~ixt~xe was
ph~nol extracted~ and ethanol precipitat~d to r~mo~e
regtriction ~nzymes, and ligated ~ogether aacord~ng to
:.
:
WO93/0210~ PCT/~IS92/0603
~'v~' ~50-
the ligation procedure detailed ab~e. The ligated DNAmixture wa~ then re6uspended in 298 ~1 0.01 M Tris pH
7.5, lmM EDTA and transfected into cells (MDBK or RS for
IBR viru~ and Vero for PRV) according to the DNA
TRANSFECrION FOR GENERATING RECOMBINANT VIRUS (see
above). The direct ligation procedure may al~o be u~ed
to delete DNA fr~ herp~viru~es. Non-e~sential DNA
which i~ flank~d by appropriate re~triction enzyme sites
may be deleted ~y digesting the virus DNA with such
enzymes and religation. The frequency of engineered
viruses generated by the direct ligation procedure is
high enough ~hat screening can be accomplished by
r~striction enxyme analy is of randomly picked plaques : .
. . .
from the transfection ~tock.
BL~OGAL S~EN FOR RECOMBINANT HERPESVIRUS. When the
E.aoli B-galacto~ida~e (lacZ) marker gene wa~
: incorporated into a recombinant viru~ the plaques
: containing recombinant6 were ~visua}iz~d by a æimple
:20 assay. The chemical BLUOCAI~ IGIB~O-Bethefida Research
.
Labs) wa~: incorporated (Z00 :~g/ml) into the agaro~e
verlay during the:plaque assay, and plaque~ that
: expressed active B-galacto~idase turned blue. The blue
pIaques were then~picked~;onto fre~h ~ell~ (MDBK for IBR
~: ~25 virus and Vero for~ PRV)~ and purified by further blue
plaque :isolations.~ ~In:recombinant virus ~trategiQ8 in
which the~ E.coli B-galacto~idase ~rker gene:is removQd,
~: ~:the a66ay involves;~plague purifying~w~it~ plaque~ from a
back~round :of parental blue:plagu~c. In b~th case
3;0 viruses were typically purifi~d with three rounds of
; ~plaque purification.
: ~ SCREEN FOR RECOMBIN~NT~:HE~PESVIRUS XPRESSING ENZXM~IC
MARKER GENES~ When the~E. coli ~ galacto~idas~ (~acZ) or
B-glucuronida~e (uidAj;mark~r gene wa~ incorporated ~nto
a reco~binant ~iru~ th~ plaques ~o~taining r~combinant~
ware visualiz~d by a simple assay. The enzymatic
. ~.
'
WO93/02104 2 ~ PCT/~S92/0603
-51- :~
sub~trate was incorporated (300 ~g/ml) into the agaro~e
overlay during the plaque as~ay. For the lacZ marker
gene the substrate BLUOGAL (halogenated indolyl-B-D~
galactosidase, Bethe da Research Labs) was used. For the
uidA marker gene the 6ub~trate X-Glucuro Chx (5-bromo-4-
chloro-3-indolyl-B-D-glucuronic acid Cyclohexyl~mmonium
salt, Bio~ynth ~G) was used. Plaque~ that expre~sed
active marker enzyme turned blue. The blue plaques were
then pick~d onto fre6h cell~ and purified by further blue
plaque i~olation. ~n reco~binant virus strategies in
which the enzymatic marker gene i~ removed the assay
involves plague purifying white plaque6 from a background
vf parental blue plaque~. In both ca~e~ viru~e6 were
typically purified with~ ~ ee round~ ~f plaque
purification.
. '
: ~ ANTIBODY SGREEN FOR ~RECOMBINANT NERPESVIRUS~ A third
met~od for scr~ening the~reco.mbinant viru~ stock was to
look directly for the~expr~s~ion of the foreign gene with
20 antibodie~. Herpesviru6 plaque6 w~re spotted and picked
by inserting a toothpick thxough the agarose ab~ve the
plaque and scraping the plaque ar~a on the di~h. Viru~e~
were then ~insed~from the toothpick by inserting the
toothpick into a ~we~:l of :a 96-well ~icro-titer dish
~25 ~(~Falcon Plastics) ;:containing a confluent monolayer of
tis~u~ aulture cells;that had been w4~hed 3 time~ in DME :
m2dium without ~erum. It~wa i~portant for the viru8 to
grow: without æerum at thi~ ~tage to allow the ::~
immunologica:l procedure~to~work. After cyto~a~hic eff~ct
30 wa complete, the~plates were put at -70C to freeze and ~ :
lyse the cells. The mediu~ wa~ ~hawed, and the
-freeze/thaw procedure:wa ~:repeat~d a ~e~ond ti~a. Then
: 50-l00 ~icroliter- of~m~diu~ were r~o~ed fr~m each well ~:
and filter~d under :vacuu~ through a nitrocellulo~e ~ ~;
~e~br~ne ~S~S BA85) using ~ ~otBlot- ~pparatus (B~L).
The filter blots were soaked in a blocking solution o~
~0.01 M Tris pH 7.5, 0.l M NaCl, 3% bovine ~r~ albumin ; ;:
,
."'~
WO93/021~ PCT/US92/060
~ 52-
'~ at room temperature for two hours with shaking. The
filter blots were then placed in a sealable bag ~Sears
SEAL-A-MEAL or equivalent), and 10 mls of the blocking
solution that contained 10 microliters of antibody
specific for the forei~n protein were added. After
overnight incubation at room temperature with ~haking,
the blot wa~ washed 3 time6 with 100 mls 0.01 M Tri~, pH
7.5, 0.~ M NaCl, 0.05% Tween 20 detergent (Sigma). The
blot W~E put in another sealable bag and 10 ~18 blocking
solu~ion containing 106 counts per minut~ of 1251-protein
A (New England Nuclear) were added. After allowing the
protein A to bind to the antibody for 2 hours at roo~
temperature with shaking, the blot wa~ wa~hed a~ above,
dried, and overlayed :with : an X-ray film and an
intensifying ~creen (Dupont) and autoradiographed for 1-3
days at -70~C. The f il~ was developed by standard
: procedure8. Viru~ from::the po~iti~e w~ which
- contained the recombinant viru wa~ further purified~
;~:20 SELECTION OF G418 RESISTANT IBR VIRUS~ The antibiotic
G418 (GIBC9) ha a wide range:of inhibitory activity on
protein : synthe~is. ;~ ~However, reco~binant viru~es
expre ing the a~inoglycosidase 3'-phosphotranFfera~e,
encoded:~:by:the NEO~gene:of ~ e tran~po6able element Tn5,
25: are resistant` to :~G418. The transfection ~tock~ of
recombinant viruses~were grown on MDBR cells in the
presence of 500 ~g/ml~G418 in co~plete DME ~edium plus 1%
: fetal bovine serum. ~;After::one~ or~ two day6 at 37C,
plaques :from thle ~dishes: inoculate~ with the highest
.,
: 30 dilution of virus~were~picked for virus ~tocks. ~he
selection was repeated a second~or third ~i~e. The ~irus :~
stocks generated from tAe~G418 ~e1ection were tested for : -~
NEO gene :insertion ~y~:: the~SOUTHERN BLOTTING OF DNA
~ ~hybridi2ation pro~edure described above.
: CONSTRUCTI~N OF DELETI~N~VIRUSES. The strategy used to ~ -
construct deletion; viruses involved the use of either :~;
.. :-,
,., ~ . . ,
: ~ . , ,:
W~93/~21~ PCT/US92~0603~
2 ~ t ~ ;~ gi
-53-
homologous recombination and/or direct ligation
technique~. Initially a virus wa~ constructed ~ia
homologous recombination, in which the DNA to be deleted
was replaced with a marker gene such as Eo col i B-
galactosidase (lacZ~ or B-glucuronidase (uidA). A second
virus was then constructed in which ~he marker gene was
deleted either by homologous recombination or via direct
li~ation. The advantage of thi8 ~trategy i~ that both
viruses may be purified ~y the SCREEN FOR RECOMBINANT
HERP~SVIRUS EXPR~SSING ENZYMATIC ~ARKER GENES. The first
virus is puri~ied by picking blue plague from a white
plaque background, the~ second virus is purified by
picking white plaques from a blue plaque background.
Several homology vectors were con~tructed for the purpo~e
of deleting ~ e ~ , gpE and Tk gene coding regions. A
; detailed description of the~e ho~olog~ v~ctors follow~.
: HOMOLOGY VECT~R 129-71.5.~ The plasmid 129-71.5 wa~
: 20~ constructed for the purpo6- of:deleting a portion of the
TK :gene coding; region from the I8R viru~. It
incorporates a ~3electabl- ~ marker, the bacterial
transposon neomycin re~i~tance gene, fl2nked by IBR ~irus ~ :
DNA. Upstream of the marker gene is an approximately 860
25~ :base pair fr~g~ent of IBR viru~ DNA which ends with
sequenc-s nco~ing a~ino ~acids 1-62 of the TK pri~ary
~: ~ an~lation product. Downstream of the ~arker gene iB ~n
approximat-ly 1741 ~bas-~pair~ frag~ent of I~R virus DNA
: :which begins ~ith s-queno-s ncoding amino acids 156-367
3Q of the TX primary tran~:lation product. Wh~n thi8 plasmid
is used according to the HOMOL0GOU~ R~C~MBINaTION ~ :
PROC ~ UR~ FOR GENERATING RECOMBINANT H~RPESVI~US, it will :
replace the DNA coding for amino acid~ 63-15S of ~he TK
primary tran~lation product with DNA coding for the
~arker gene. :Not~hat the marker g~ne will be und~r the
control of t~e h~rpe simplex type 1 alpha-4 immediate
early gene promot~r (5). A detailed de~cription of ~he
- .:.
'' :'' "
WO93/0210~ PCT/US97/060
54-
plasmid is given in Figure 7. It wa~ constructed from
the indicated DNA ~ources utilizing standard recombinant
DNA techniques ~6). It may be con6tructed by joining
restriction fragments from ~he following sources with the
synthetic DNA ~equences indicated in Figure 7. The
plasmid vector i~ derived from an approximately 2975 base
pair SmaI to ~indIII rectriction fragment of pSP65
(Promega)~ Fragment 1 is an approximately 860 base pair
NcoI to BamHI re6t~iction fragment of the IBR viru~
HindIII restriction fragment A:(7). Thi~ fragment i~
: located on an approximately 5500 ba~e pair ClaI to NruI
fragment contain~d in the IBR virus ~indIII A fragment.
: Fragment 2 i8 an approximately 490 ba~e pair PvuII to
BamHI restriction ub-fragment of the ~SV-l BamHI
restriction fragment N (5). Note ~ at the HSV-l oriS
region has been removed:from this:frag~ent by deletion of
; ` the sequences betw~en the:Sm~I ~ite~ locat~d 1483 and l28
base pair6 away from the PvuII end (lO). Fragm~nt 3 i8
: an approximately ~:1541 : ba~e pair BglII to Ba~HI
20~ :restriction fragment o~ plasmid~pNE0 (P.L~ Biochemicals,
Inc.). Fragment 4~i~ an appro~i~ately 784 base p~ir SmaI
to SmaI res~riction: sub-frag~ent :of the HSV-l BamHI
~: ~: restriction~frag~ent~Q (lO)~. Note:that thi fragment is
orien~ed~such~that the~po1yadenylation sequence 5AATAAA)
is 1~cated~closest to junction D. ~Frag~ent 5 i~ an
approYlmately 1741~base~ pair~ BglI~ to StuI restriction
sub-fragmént~rom:;the IBR ~indIII r~triction~fralgment A
PLASMID ~59-12;.6.~The:~lasmid 459-12.6 wa~ g~nerated for
the purpo~e of Gonstructin~a:recombinant cloning vector
which~e ~ e~e~the~IBR~Yiru~ glycoprotein G.~ This was
: accomplished by inserting:~the IBR virus ~pG g~ne~into S~
PR~-013 (U.S. Serial~ No. 07/823,102 filed January ~7,
3~ ~19~6). Plas~id 459-l2.6 cDnt~in~ a chimeric ~ene under
.... .
:: the control of:the~IBR~viru~;gpG pro~Qter. Th~ chimeric :-
gene expr~sses a fusion protein con~isting of th~ fir~t
.~
WO93/02104 P~T/US92/0603~
2 ~ .~L ~
-55-
362 amino acid~ of IBR virus gpG fu~ed to amino acids
421-467 of the PRV gpIII (13) followed by amino acids
480-498 of the PRV gpX (12~. The c~imeric gene is
flanked by ~indIII restriction sites. When thi~ plasmid
i used with S-PRV-013 and the restriction enzyme ~indIII
according to the DIRECT LIGATION PROCEDURE FOR GENER~TING
RECOMBINANT ~ERPESVIRUS th~ re~ulting recombinant will
e~pres~ the IBR viru~ gpG. A detailed description of the
plasmid is given in Figure 11. It was constructed from
the indicated DNA 80urces utilizing standard re~o~binant
DNA technique~ (6). It may be constructed by ~oining
restriction fragmentR fro~ the~following ~ource~ with the
synthetic DNA ~equenPec indicated in Figure ll. The
piasmid vector is derived f:rom an approximately 2999 ba~e
pair XbaI to Xb~I restriction fragment of a hybrid
cloning vector derivQd from:pSP64 and pSP65 (Prom~ga).
The hybrid cloning v~ctor waB con~tructed by ~oining
approximztely 1369 ba~e pair~PvuI to SmaI frag~ent from
pSP64 with the approxi-ately 1652 base pair PruI to SmaI
fragment from pSP65. Frag~ent 1 i5 an approximately 182
base pair PstI to ~ooRV restriction sub-fra~ment of the
HCMV XbaI re~tri~tion~fragment B (16). Fragment 2 i8 an
approximately 2121 base pair~MluI to XhoI restriction
:: ~ sub-fragm~nt o~ the~IBR~ viru~ ~indIII re6triction
;25 fragment K (7). Fragment 3~ an approximately 121 ba~e
pair XhoI to B~HI re~triction ~ub- f ragment of the PRV
Bam~I restriction`frag~ent:~2 ~3). Fragm~nt 4 i~ an
approxi~ately 760 base:pair NdeI to SalI re~triction ~ub-
fragment of the PRV:BamHI~restric~ion ~ra~ent ~7 (3).
3~0
:: :
~OMO~0GY VECTOR 439-01.31. ~The plasmid 439-01.31 was ~:
construa~ed for the:p ~ ose of deleting a portion of the
: gpG gene coding region:~ from ~he IBR YiXU5~ Tt :~
.
incorporates an ~ E.~oli~ B-ga1acto~idase ~arker gene : :~ -
f~anked by I~R viru~ DNA. Down~tr~a~ o~ th~ m2rkeF g~ne
i~ an approxi~ately 3593 ba~e:pair ra~ent o~ IBR viru~ :
: DNA which end5 with 8e~uen~e~ encoding the first 262
: . ,.
- ~
WO93/0210~ PCT/US92/060
acids of the gpG primary translation product.
upstream of the marker gene is an approximately 785 base
pair fragment of IBR ~irus DNA which begins with
sequences encoding the la~t 80 amino acids of the gpG
primary translation product. When this pla~mid is used
according to the HOMOLOGOU5 RECOMBINATION PROCEDURE FOR
GENER~TING RECOMBINANT HERPESVI~US it will replace the
DNA coding for amino acid~ 263-361 of the gpG primary
translation produc~ with DNA codiny for the marker ge~e.
Note that the ~-galactosida6e (lacZ) mark~r gene will be
under the control of the human cytomegalovirufi imm~diate
early gene promoter. A detaiIed description of the
plasmid is given in Fi~ure 12. It wa constructed from
the indicated:DNA ~ource~ utilizing standard recombinant
DNA technique~ ~6). It may be constructed by joining
re~triction fragments from the following ~ource~ with the
cynthetic DNA ~equence indicated in Figure 12. The
plasmid ve~tor i~ derived from an approximately 2965 base
pair ~indIII to~ SmaI restriction fragment of pSP64
(Promega). ~ragment l i5 an approximately 3593 base pair
HindIII to~ XhoI restriction frag~ent of the I8R ~indIII
restrietion fragment: K~ ~(7). Fragment 2 is an
approximately 753 base ~pair SalI to NdeI restrietion
,
fragment of th~ PRV BamHI restrietion fragment #7 ~3).
Note that this :fragment was::re~eeted with Exonuelea~e
Sl nuelea~e~digestion su d that approximately 57 base
pairs~:were~re~oved from the~:NdeI end. Fragment 3 i~ an
: approximately 3347 base~pair BalI to BamHI re~rietion
fragment of plasmid pJF751 :(38). Frag~ent 4 is an
:30 approx~imately 1191 base p~ir Av~I tG PstI restrietion
fragment from the HCMV XbaI re~triction fragment E ~16).
: Frag-ent 5 is~an approx~imately 785 b~se pair XhoI to NdeI
restrietion fragment from the IBR ~ III restrieti~n
fragment X (7).~ :Note that the laeZ marker gene is
flanked~by XbaI sites loeated at Junetion B and Junetion
E in this pla~mid permitting the marker ~ene to be eut
out with XbaI. ~
..
WO93/0210~ PCT/~IS92/060
-57-
HOMOLOGY VECTOR 439-21.69. The pla~mid 439-21.69 was
con~tructed for the purpo~e of deleting a portion of the
~pG gene coding region from the IBR viru~. It
incorporate~ an E~coli B-galacto~ida e (lacZ) marker
gene flanked by IBR virus DNA. Down~tream of the marker
gene is an approximately 888 ba~e pair fragment of IBR
virus DNA which begins approxi~ately 1042 baRe pairs
up~tream of the initiation codon of the gpG gQne and ends
approximately 154 ba~e pairs upstream of the initiation
codon of the gpG gene. Up~trea~ of the marker gene is an
approYimately 785 ba~e pair fragment of IBR virus DNA
which begin~ with sequences encoding the last 80 amino
acids of the gpG primary tran~lation product. When this
plasmid is used according to th~HOMOLOGOUS RECO~BINATION
PROCEDURE FOR GEN ~ TING RECOMBINANT HERPESVIRUS it will
replace the DNA coding for amino aaid~ 1-361 of the gpG
primary tran~lation product with DNA coding for the
~, . .
: marker gene. Note that the B-galactoEidase (lacZ) marker
.. ...
gene will be under~ the; control of the human ~;t~'''
cytomegalovirus immediate ear}y gene pro~ot~r. A detailed
~ description of the:plas~id is given in Figure 13. It was : -:
:~ ~ constructed fro~ the indic:ated DNA ~ourae~ utilizing ~:
standard recombinant~ DNA~ tec~ique~ (6). It may be
: ~ : constructed by ioining restriction fragment~ from the
25~ following source with the ~yn~etic DNA ~equence~ :
~ . . .
indicated in Figure:13. The~pla~id v~ctor i6 deriv2d
~: : from an approximately~:2965 base~ pair ~indIII to SmaI
re~triction~frag~ent of pSP64~(Pro~ga). Fr~gment 1 i~
an approximately 3593 ba~e p~ir ~indIII t~ XhoI
30: restriction fragment of the IBR ~indIII regtriction
frag~ent~X (7)~ Fr~g~ent 2 i8 an~pproxi~ately 753 baae
: ; ~ pair SalI to~Nde~:restriction fra~nt of the PRV BamHI
restriction frag~ent~ 7 (:3~ Note~hat th~ fragment wa~
~- ~resect-d wi~h~ExonuGl~ase ~ /S1 nucl-ase dig~sti~n such
: 3~ ~th~t ~pproxi~a~ely 5~:~2s~ p~ir~ were ram~v~d ~rom th~
NdeI ~nd~ Frag~ent 3 is~ an appr~ximately 3347 ba~e pair
BalI to ~ BamHI re~triction :fr~gment of plasmid pJF751
:
WO93/021~ PC~/US92/06034
,.~ p, ~
5 8--
(~8). Fragment 4 is an approximately 1191 base pair AvaI
to PstI restriction fragment from the HCMV XbaI
restriction fragment E (16). Fragment 5 is an
approximately 785 base pair XhoI to NdeI restriction
fragment from the IBR ~lndIII re~triction fra~ment K (7).
Note that the lacZ marker gene is flanked by X~aI site~
located at Junction B and Junction E in this plasmid
permitting the marker gene to be cut out with XbaI.
. . .
HOMOLOGY VECTOR 439-70.4. The plasmid 439-70.4 was
constructed for the purpo~e of deleting the E. coli B~
galacto~ida e (lacZ) marker gene ~rom S-IB~-035 virus.
: It incorporates two regionF of IBR viral DNA which flank
the ~arker gene in S-IBR-035. :The firRt region is an
approximately 888 base pair fragm~nt of IBR virus DNA
which begins approximately 1042 baae pair~ upstream of
the initiation codon of ~the~ gpG gene and end~
~approximately 154 ba~e:pairs~up6tr~am of the initiation
codon of the gpG~ gene. ~ The: second region i~ an
20: :approximat~ly 785~base pair~ frag~ent of IBR :viru~ DNA
which begins with~sequ¢nces encoding the last 80 amino
acids of the gpG primary~tran~lation product. When this
plasmid is used;:~in~ conjunction with S-IBR-035 DNA
: acaording to the~HOHOLOGOUS~RECOM~3INATION P~OCED ~ FOR
25~ GENERATING RECOMBINANT:HERPESVIRUS it will deIete the D~A
coding for thè E.coli B-galactosida~e (lacZ) marker gene.
A detailad~descr-i~ption:;of~the~plas~id i~ giYen~in Figuxe
14~. ~It~was;~oonstructed::fro~the indicated DNA;~ource~
u~ilizing :standàrd reco~binant~DNA kechniqua~ (6). It
may be con~tructed by Joining re~triction fragment~ from
the:following sQurce~with tbe ~ynthetic DNA ~equences
: : indicated;~:in ~Figure:;14. ~The plas~id vector is derived
:from an ~approximately 29~5 ~ase:pair ~indIII to S~aI
~ restriction fragment~;of:pSP64~(Pro~ega3~ Fr~gment 1 i~
: 35 ~an approYi-ately ~35~3 ~ ba~e pair ~indII~ to XhoI
: re~tr~etion ~r~gm-nt of ~he~: IBR ~indIII restriction
~ fragment X (7~. Fragmént 2 i8 an ~pproxi~ately 785 b~se
~,
WO93/0210~ PCT/US92/0603~
_59_ 2 ~
pair X~oI t~ NdeI restriction fragment from the IBR
~indIII restriction fragment K (7).
IBR VIRU5 gpE PLASMID. A plasmid may be generated for
the purpo e of constructing a recombinant cloning vector
which ~xpres~es the IBR virus glycoprotein E (gpE). This
pla~mid may be used to in~ert ~he IBR virus gpE gene into
S-PRV~002 (U.S. Patent No. 4,877,737). The pla mid will
contain the gpE g~ne f~anked by XbaI re~triction sites.
When thi~ pla~m7d is used with S-PRV-002 and the
re~triction enzyme XbaI according to the DIRECT LIGATION
PROCEDURE FOR GENERATING RECOMBINANT HERP~SVIRUS the
resulting reco~binant will expr~s~ the IBR viru~ gpE. A
detailed description of the plasmid is given in Figure
17. It may be con~tructad, utilizing ~tandard
recombinant DNA techniqueE (6), by joining rQ~triction
fragments from the following source~. The plasmid vector
is derived frcm an~approxi~ately 299g ba~e pair Xb~I to
;` ; Xb I restriction frag~ant of a hybrid cloning vector
20~ derived from pSP64~and ~pSP65 (Promega). The hybrid
cloning v~ctor ~was construGted by joi~ing an
~ -
approximately l369 base pair PvuI to S~aI fragment fxom
pSP64~ with the approximately 1652 base pair PvuI to SmaI
fragment from pSP65.~ Fra~ment;l is an approximately 3647
25 ~ ~base pair NdeI to ~indIII;~restr~iction ~ub-fr~g~ent of tbe
IBR virus ~indIII~restriction frag3ent K (7). ~ragment
2 is an approximately~832 ~base ~pair HindIII to SacI
restriction: ub-fragment~ of an IBR:~irus 2400 bzse pair
SmaI restriction~fragme~t. ~Thi~ &~I fra ~ ent has been
cloned into the SmaI site of the pla~id pSP64 (Pro~ega).
This pla~id i~ deæignated PSYl645. PSYl645 was
; ~ ~ deposited ~on~ July~: 16~ 91 pursuant to the Budapest
Treaty on the Internationa;l Depo~it of ~icroor~anis~s for
the Purpose~ of Patent:Procedure with the Pat~nt Culture
..
35~ ~epo~it~ry of the~Amarican ~ e Culture:Call~ction, 12301
~Par~lawn Drive, Roc~ville, Maryland Z0852 U~S.A. under
~TCC Acc~sion No. 68650. Note that the lacZ marker gene
.
'
:
WO93/0210~ PCT/US~2/060
6~-
is flanked by XbaI sites located at Junction B and
Junction E in this plasmid permitting the marker gene to
be cut out with XbaI.
HOMOLOSY VECrOR 536-03.5. The plasmid 536-03.5 was
constructed for the purpose of del~ting a portion of the
gpE gene coding region from the IBR virus. It
incorporates an E.coli B-ga1acto~idase (lacZ) ~arker gene
flanked by IBR ~irus DNA. Up~traam of the marker gene is
an approximately 1704 base pair frag~ent of IBR virus DNA
which ends with equ~nce~ encoding amino acids 1-76 of
the gpE primary trans1ation product. Down~tream of the
marker gene is an approximately 742 bace pair frag~ent of
IBR virus DNA which begins with ~equences encoding amino
acids 548-617 of the gpE primary trans1ation product.
When this pla6mid i~ u~ed~:according t~ the HOMOLOGOUS
RECOMBINATION PROCEDURE~ FOR: G~NERATING RECOMBINANT
HERPESYIRUS, it:will replace the DNA coding for amino
: ~ acids 77-547 of ~he gpE~primary tran~lation product with
O~ DNA coding for ~the marker: gene. Not~ that the B~
; galactosidase (lacZ)~ marker gene will be under the
:control of the PRV~gpX.:;A:~detailed de~cript~on of the
plasmid~ is~ given~in~Figure~18. It ~ay be c~nstructed
: ~ ~ util:izlng standard reoombinant:DNA techniqu~ (6j, by
25~ joining re~triction~fragments from the following ~ources
;:with~the ~ynthetic DNA;~equences indicated in Figure 18.
The plasmid~vector;~:~is~:;derived fro~ an approxi~ately 2975
base~pair Sm~I to ~indIII:r~striction fragment of p~P65
:(Promega). Fragment~ an~pproximately~1704 bas~ pair
~SmaI to SmaI restric~ion:~u~-fra~ment of th~ IBR ~indIII
reætriction fragment~ K ~ (73. Frag~ent 2 i~ an
approximately 413~ba-e~:pair S~lI to B~mHI re6triction
ragment #7 ~3).~ Fragment~5 is an approxi~ately 742 ba e
~ pair Nh~I to:BglI~:~ub-fra~ment of an IBR viru~ 2400 base
: ~ 35~ pair SmaI~fr~gment.~ ~hi~SmaI:~frag~nt ha~ b~en cloned
: into the SmaI ~ite of the~plas~id pSP64 (Promega). This
pla8mid i~design~ted~PSY1645:, PS~1645 waB dsposit~d on
:
:
W~93/~210~ PCT/~IS92/~603~
2 1 1 ~4 5 .. 1.
~uly 16, 1991 with the American Type Culture Collection.
Note that the lacZ marker gene is fla~ked by XbaI sites
located at Junction B and Junction E in thi~ plas~id
permitting the marker gene to be cut out with XbaI.
VACCINATION ST~DIES IN CALVES WITH ~NACTIVATED IBR VIRUS.
Calves t seronegative to IBR viru~, were hou~ed in
facilities secure from IBR virus expo ure. Groups of
four calve~ were vaccinat~d intr~muscularly with vaccines
containing 107-3 or 108- plaque forming units of
inactivated IBR virus formulated with an oîl adjuvant.
: A second vaccina~ion was giv~n 21 day~ later; ~our calves
were maintained a~ unvaccinated control~. At 21 day~
after the ~cond vaccination, animals were challenged
intranasally wi~h virulent wild-type IBR vîrus. After
~ vaccination and challenge, anLmal~ were ob~ervQd and the
;~ injection:~ite wa~ palpat~d~weekly. Blood Bamples were
taken on day6 O, 7, 21,: 28, and 42 post vaccinatio~.
Af~ter challenge, animal~ were ob~erved daily or clinical
signs of IBR. Blood~s ~ pl~ee were taken on days 7 and 13
post challenge. Na al swab6 were collect~d on days 3, 6,
9, and~l2 po t challenge.
PURIFIC~TION OF IBR VIRUS~ gpG. ~ gpG was purified from the
25~ tis~ue culture ~edium of;infected MDBK c~ Confluent
MDBX~ cell~s ~in serum-fr~e ~medium were infected at a
mu~tiplicity:~f inf~ection equal to S, with wild type,
Cocper strain of;~IBR~ virus~ The~cells ~nd media were
harvèQted~ at;~approximately~ twenty-two; hour~ a~ter
30: infection, when the ~el~s howed con iderabl~ ~ opathic
: effect and the ~luidfi were centrifuged at 5000 ~pm $or 15
~ utes.
: ~ ~ T~e 6upe~natant fluid wa~concentrsted~approximately 10-
~; 35 ~ ~old by ultrafiltration through an~Amicon ym-30 ~brane,
: and dialyzed against~lOmM NaPC~ p~ 7.2. The di~ly~ate was
treated for 20:~i~utes~at OC with 70~ perchloric acid to
:
WO 93/021~1 PCI /US92/0603
~'~"v~J ~ -62-
a f inal concentration of 0 ~ 2~f perchloric acid, then
c~ntrifuged at 12, 000 rpm for 20 minuteC. The
supernatant f luid wa,s then ~ialyzed against 2 0mM Tris pH
9.5.
:
The acid~solu~le prot~ins were ~3eparated by column
chromatography on a Dl~E-Sephacel anion exchaFIg~ column
using a liner yradi~rJt elution: 0 to ~00% A to B where
~ = 20m~ pH 9.5 and B = 20mlM Tri~ pH 9.5/800 mM
NaCl. The gpG eluted at approxi~at~ly 35-~0% B. Peak
fractions were a~sayed ~y ~estern blot using anti gpG
peptide sera. Reactive fractiorl~ were com} ined and
dialyzed again~;t 5 m~l Tris pX 7Ø Th~ ~;ample wa~ then
c:oncentrated 10-~old by lyophilization and ~tor~d at -~
-2~C. ::
ELIS~ ASSAY. A standard ~nzyDle-link~d immunosorbent ;
assay (EI.ISA) protocol was used to d~t~rmine the im~u~e
status of cattle following vacc:ination and challenge.
0:: ' ,,
A purif ied gpG antigen: ol~stion ( 100 ,~-l at 1 ng/~l in
PBS~ was allowed to absorb to the well~ o~ ~icrotiter
dishes for 18 hour~ at 4C. The coated well were rinsed
one ti~e with PBS. Wells~ were bloc:ked by adding 250 ~l
: 25~ of PBS Gontaining 1% BSA (Sig~a) and inr-~ating 1 hour at
: 37 C. The 3:~1Ockad wells were rins6~d one time with PBS
containing û~ 02% Tween 2 0. !50 ~l of te6t ~er~n
tpré~,riously ~diluted: 1:2 in~ P~S contairling 1% BSA) were
~ ~ :
added to the well~: and incubated 1 hour at 37 C. The
3 0 antise~ wa~ remove~ and the wells were wash~d 3 time
with PB5 containing 0,02% q~ween 20. 50 ~l of a . olution
containi~g a~n~i~bovine ~ IgG c~upl~d to hor~eradi~;h
peroxida~i;e (diluted :1: 500 in PBS cor~taining 1% BSA,
Ki~kegaard and Perry Labor~tori~s, Inr~ ) was added to
visuali&e the w~118 con~aining antibc7dy ag~in~;t th~
~;pec:i~ic antigen. The ~;olution wa~ inc:ubz~ted 1 bour at
37~C, then removed and the wel}~; were wal3hed 3 time~; with
.
W093/02~0~ PCT/US92/0603~
2 t a 3 ~
-63-
PBS containing 0.02% Tween 20. 100 ~l of substrate
solution (ATBS, Kirkegaard and Perry Laboratorie~, Inc.)
were added to each well and color wa~ allowed to develop
for 15 minute~. The reaction was terminated by addition
of O.lM oxalic acid. The color was r~ad at ab~orbance
410nm on an automatic plate reader.
PROCEDURE FOR GENERATING MONOCL~NAL ANTIBODIES. To
produce monoclona1 antib~diQs, 8 to 10 week old BALB/c
female mice were ~accinat~d:intraperitoneally ~ev~n times
at two to four week interva1s with ~07 PFU of S-PRV-160.
: Three week~ after the la~t vaccination, mice were......
injected intraperitoneally with 40 ~g of purified gpG. : -
Spleen~ were r~mo~ed:from the mice ~hree days after the ~
15 last antigen dose. ~::
,., :: .,
Splenocyte~ were fu~ed~;with mouse NSl/Ag4 plasmacyto~a
cells by the procedure ~odified from Qi and Herzenberg,
~39). Spl~nocytes~and plas~acytoma cellfi were pelleted
20~ together by centrifugation~at 300~x g for 1~0 minutes.
One ml of a 50%~ Eolution of polyethyl~ne glycol (m.w.
1300;-1600) was added to the~cell pell~t with stirring
: over one minute.~ ~ulbecco's modified Eagles's medium (5
ml) was added: to:the~cell~over~three minute~. Cell~
25:~ :were~pelleted:by~centrifugation::at 300 x g for 10 minute~
and resuepended in~medium with lO% fetal bovine seru~ and
containing lOO ~N~ ~ oxanthine, 0:.4 ~ a~inopterin and 16
thy~idine ~(HAT~ Célls~ 100 ~l) were added to the
well~: of eight ~to~ ten 96-well tis.ue ~ulture plates
containing 100 ~l of nor~al:~ pleen fe~der layer cell~ and
: incubated at 37C. Cell~ wer~f~d with fresh H~T m~diu~
::every thr~e to:four dayæ~
ybrido~a culture ~upèrnatant~were tested by ~he ELISA
: 35 ASSAY in 96-well ~icr~tite~plat~ co~ted with ~00 ng of
: purified gpG~ Supern~tants f~ro~ reactive hybrido~as were
further analyz~d ~y~:b~ k-pla~ue agsay and by Wes~ern
. .:
~: :
WO 93/02 ~ 0~ PCI /US92/(~61)?s~
~}- ~ 64~
Blot. Selected hybridomas were cloned twice by limiting
dilution. Al:c~tic: fluid was produced by intraperitoneal
injection of 5 X lO6 hybridoma s::ell~; into pri~tane-tr~ated
BALB/c mice.
:
METHOD FOR cDNA CLONING BOVI~E ROTAVIRUS gp38 GENE. The ~ ~
Calf N~braska ~train of bovine ro~avirus (USDA) was ~ ~:
propagated on ~A-104 ealls (~esus DlonJcey kidney eells
from MA Bioproduet~;). Conflu~nt monolayers were infec~ed
at a multiplieity of infeetion of greater tAan 10 in DM1~
- eontaining 5 mierogra~/ml tryp8irl. Cells w~re ineubated
with viru~ for 4~ hours or until a cytopathie e~fec:t was
obtained. Media and eell debris were eolleeted and
centrifuged at 10, 000 x ~ for 20 minute at 4C. The
1~ supernatant eontaining the rotavirus was th~n eentrifuged
a~ 10,000 x g in a preparative Beekman Ti45 rotor at 4C.
Virus pellets wer~ r~su~;pended in SM medium (50 ~1 l~
HCl pH 7 ~ 5, 100 mM KCl, 10 ~M ~lgCl2) and homogenized
1 ightly in a Dounee-type homogenizer . The re~uspended
virus was cen~rifuged at 10, 000 x g for 10 mirlute~ then
loaded onto 25-50% C~Cl gradients in S~ bu~f ~r .
Gradients were cen~rifuged at 100, 000 x g for 4 hours at
2 0 C . The two blue white band~ repre~enting intact
virions and cores of rotavirus were collected, diluted,
25 and the CsCl gradient procedure wa~ repeated a ~;ecsnd
time. Viru~ obtained from the s~c:ond gradient was
dialyzed overnight against Sl~ buffer at 4 DC.
Dialy~ed bovine rota~iru~ wa~ twice extracted with an
30 equal volume o~ SDS/phenol, then ~wice Dlore with
c:hlorofor~ oamylaleohol (24:1). The double ~;tranded
RNA was precipitat~d with ethanol in the ~?r6~s~nce o 0~.2
M sodium acetate, centrifuged and r ~uspended in waterl,
The yield was typically 100 mic~ogr~; from 1,000 cm2 of
35 ingeGted cell~ ~
~:,
WO ~3/0210~ PCr/US92/0603~1
2 1 1 3 fs ~ ~3
65--
160 microgra~; of double-~tranded bovine rotavirus RNA
obtained from the above procedure wa~ mixed with one
micrcgram each of two ~ynthetic oligonucleotide primers
i~ a volume of 160 microliter (sequence~ of primers were~
5'-G~GAATTCTGCAGGTCACATCATACAATTCTAATC~AAG-3' and
S'-GGGAATTCTGCAGGCTTTAAAAGAGAGAATTTCCGTTTGGCTA-3')
derived from the published ~equence of bovine rotavirus
(~0). The RNA-primer mixture was bniled for 3 minute in
a water bath then chilled on iceO Additions of 25
microliters of 1 ~ Tri -HCl pH 8.3, 35 microliters of 1
- M KCl, 10 microlitere of 0.25 M ~gCl2, 7 microliters of
O.7 M ~-mercaptoethanol, 7 microliter of 20 m~ dNTP's,
and 6 microliters of reverse tranEcriptase tlO0 unitæ)
were made sequentia~ly. The reaction was incubated at
1~ 420C for 1.5 hours then 10 microliter~ of 0.5 M EDTA pH
8.0 wa~ added and the solution was extracted once with
chloroform:phenol (1:1). The aqueou~ }ayer w~ removed
and to it 250 microliters of 4 M ammonium acetate and 1.0
~1 of 95% ethanol wa added, the ~ixture was frozen in
dry ice and centrifuged in the cold~ The re~ulting
pellet was resuspended:in 100 ~icroliters of lO mM Tris-
~: H~l pH 7.5 and :the aYmonium aceta~e precipitationprocedure~was repeàted~ The pellet wa~ re~u~pended in
: :100 microliters of 0.3~M KOH and incubated at room
~ temperatuxe overnight,~ then~at~37~C for 2 hour~. The
solution was brought to~eutral pH by addition of 10
microliter of 3.0 M~HCl and:25 microliterg of 1.0 M
:Tris-HCl pH 7.5 The:re ulting single-~tranded cDNA was
then precipitated~: two timQs ~by th~ abo~e~described
am~onium acetate-ethanol procedure. Th~ pellet obtained
was re~uspend~d in 50 microliters of 10 mM Tri~-HCl p~
7.5, lOO ~M NaCI, 1 mM:EDTA, boiIed in a water bath for
: 2 minutes, then incu~ated~at 59C for 16 hours~ The
so~ution was~ ly~philized to:a voIume of 15 ~icroliters
35: and the re~ulting double-~tranded cDNA was run on a 1.0~
agarose ge~ (Sigma~agaro~e Type II~. ~he ~thidi~m
bromide-stained:DN~ ~igrating at l,OOO-l,lOO base pair
: ~,
- .. ~
'':,'~"'
,~
W093/0210~ PCT/US92/06034
~c~ 66-
length wa~ exci~ed ~rom the gel a~d electroeluted in a
CBS electroeluter device. The solution was lyophilized,
and the cDNA wa~ resuspended in 25 microliters of waterr
To this solution was added 2 microliters of l.0 M Tri~
HCl pH 7.5, 2 microliters of l M KCl, l microliter of
0.2~ M MgC12, 1 microliter of 20 mM dNTP's and S units of
E. coli DNA polymera~e I. The reaction was incubated at
roo~ te~perature for ~5 minutes, then chloroform/phenol
extracted and ammonium acstate-ethanol precipitated as
described abo~e. The r~sulting cDNA wa~ tailed with dCTP
using terminal deoxynucleotide tran~era~e (BRL buffer
and enzyme u~ed). The reaction wae stopped with 2
microliter ~of 0.5 M EDTA, chloroform/phenol extracted
and precipitated with sodium acetate in the:pre~ence of
lO micrograms of carrier tRNA. The resuspended cDNA wa~
mixed with 200 ng of d~MP-tailed P~t I cut pBR322 (BRL
catalog #5355SA) in 200 microliters of lO ~M Tri~HCl pH
7.5, lO0 ~M NaCl, 1 ~M EDTA, heated to 65~C for 5
~inute~, then 57C for 2 hours.- The annealQd cDNA~vector
pBR3~2 was transfor~ed:onto~ _çQli DH~l cell6 prepared
for high efficiency transformation. Colonie~ that ~howed
~: ~sensitivity~ to ~mpicillin and tetracycline re~istance
were~ grown and DNA~ wa~ prepared and cut with Pst I to
determine the size of the cDNA in~ert. Several clones
: 2:5;~ ~ having Pst I inserts of l,050-1,;lO0 ba~e pairs were
: ana~yzed and found~to~have identical re~triction enzyme
~:~ ;digest pattern~. For one~of the~e c:loneæ, ~h~ l,lO0 ba~e
pair P~tI :insert ~was~ubcloned~ into a ~13 phage
sequencing~vector.;: Part of the ~DNA -eguence of thi~
clone was deter~ined and was found to be identical to the
published seguence (40
cDNA C~ONING. cDNA cloning ref~rs to the method~ used to
~con~ert RNA moleoule~ into DN~ ~olecules foIlowing state
o~ the art proc~dur~ Applicants' method~ are described
in~ Gubler and ~Hoff~n t23). Be~he~a Re~earch
Laboratories (Gaither~burg, ~D) have de gned a cDNA
~",.'''. `;.'"
'
.
WO 93/0210~ ~Cr/US92/0603~
-67~ 3 ~ ~
Cloning Kit that is very similar tc) the procedures used
by applicant~i and containS the best ~et of reagents and
protocols to duplicate our ~e~ulks.
5 For cloning viru~; ~RNA specie~, a host cell line
~i;ensi~ive to infection by the viru~ wa~ infected at 5-10
plaque f orming units per cell . When c:ytopathic ef f ect
was e~ident, but before total destruction, the medium was
removed and the cel~ were ly~ed in lo ml~ ly~is buffer
10(4 M ~ianidine thiocyanate, 0.1% antifoam A, 25 ~M ~;odium
citrate pH 7 . O, O~ 5% N-lauroyl 5arco~;ine, 0 . 1 M beta-
: : mercaptoethanol). : The cell ly~ate was poured into a
~sterilized ~ounce homogenizer and homogenized on ice 8-10
times until the Bolution wa~s : homogenoue. For RNA
purification, 8 ml~ of cell lysate were gently layered
over 3.5 mls of CsCl olution (5.7 ~ CsCl, 25 ~M ~odium
citrate p~ 7.0) in~a Beck~an SW41 centrifuge tube. The
:samples were aentr~ifuged for 18 hours at 20C at 36,000
: rpm in a Beckman SW41:rotor.~ The t ~ ~ were put on ice
20 and~ the supernatants ~ from the tubes were carefully
;;: remo w d by aspiration~ to :~leave th~ RNA pellet
undisturbed. The~ pellet~ wa& resu~p~nded in 400
microliters glass~distilled~ water, and 2.6 mls of
uanidine: solution~: ~7.5~:M guan:idine-HCl, :25 ~M ~odium
25~ citrate~pH :7~0,~5~M~ dithiothreitol) w~re added. Then
0.37 volumes of:~1 ~ acetic acid were added,~followed by
0.~5 volumes of~cold~ethanol; and: the sample wa~ put at -
20C ror::l8:hours:~to~precipitate RN~. The precipitate
~ was collect~d~by~centrifugation in a Sor~all centrifuge
30 : for 10 min at 4C at lO,OQ0 rpm in an SS34 rotor. The
pellet wa dissolvGd~in~ 1~.0 ml di~till~d ~ater,
recentrifuged a~:l3,000~rpm,:~and~h~ ~upernatant ~aved.
:RNA:was reextrActed~from the pelle~ 2~more ti~e as ab~vs
~ with 0.5 ~1 di~t~illed~;~wat-r,: and th~ .upernatants were
: 35 pooled. A o.~:volu~e~of 2 M pota ~iu~ ae~tate ~lution
was ~dded to the sa~ple~followed by 2 volume~ o~ cold
ethanol and the sa~ple wa~ put at -20~ for 18 hour~
~. :
... ..
WO 93/0210~ P~r/US92/06
3'`' -68-
The precipitated RNA was collected by centrifugation in
the SS34 rotor at 4~C for 10 minutes at 10, ooo rpm. The
pellet was dis~ol~red in 1 ml distilled water and the
corlc~ntration taken by abç:orption at A260/289. The RNA
wa ~;tored at -70~C.
mRNA containing polyadenyla~e tails (poly~A) was selected
u~ing oligo-dT cellulo~e tPharmaci~ #27 5543-0). Three
milligra~s o~ tc~tal RNA was boil~d and chilled and
applied to a 100 mg oligo dT cellulose colu~ in binding
bUffer (0~1 Pq TriS PH 7.5, 0.5 M LiC1, 5 ~M E~TA PH 8~0,
0.1~ ChiUm dOdeCY1 8UIfate). Th~ r~tZ-in~d PO1Y-A+ RNA
WaS e1Uted ~rOm the CO1Umn With e1UtiOn bUfPer ~5 m~[ Tri5
jH 7.5, 1 mM EDTA PH 8.0, 0.1% sodium dodecyl sulfate).
This mR~A waC reapplied to an oligodT column in binding
buffer and eluted again in elution buffer., The 8amp
was pr~cipitated with 200 mM sodium acetat~ and 2 ~rolu~nes
c:old etha~ol at 20C for 18 hours. The ~UJA was
resuspended in 50 microliter~3 di~tilled water.
2 0
Ten microgram ~poly-A~ RNA was d~natured in ~0 mM methyl
~mercury hydroxide for 6 ~ minut~ at 22C. Beta-
mercaptoethanol w~s added to 75 mM and the sample was .
incubated for 5 ~in at 22C. The reaction ~aixlkure for
first strand c:DNA synth~ci in 0.25 ml contained 1
microgra~ oligc~-dT ~primer (P L Biochamical~ or
ro~ram ~ynt~:ic :~primer, 28 unitE; plac~ntal
r~bonucl~a~e inl~ibitor (Beth~da Re~d~arch Iab6 #~518SA), ~ ;
100 ~ qri~ pH 8.3,~ 140~ Cl, 10 m~ Nç~12, 0~8 ml~ dATP,
dCTP, dGTP, and dlTP tPharmae:ia3, 100 ~icrocuri~s 32p_
labelled dCTP (New England Nuclear ~NE~;-0~3H), and 180
units A~IV rever$e ~ tran~criptase (~olec:ular ~enetic~
Resource~ G 101). The ~raac~ion was incuba~ed at ~L2C :-:
for 90 ~inut~s, :and :then was~: ter~iIaa~@d with 20 ml~ EDTA
p~I 8Ø The sa~ple wa~ e~trac:t~d with 2m equal volu~ of
phenol/ehloroform (1:1) and precipitated with 2 M
ammonium acetate and 2 volu~e of cold ethanol -2 0 C ~or
',
W093/0210~ PCT/VS92/OfiO3~
2~ à P ~
-69-
3 hour~. After precipitation and centrifugation, the
pellet was di~olved in 100 microliters distilled water.
The sample was loaded onto a 15 ml G-100 Sephadex col~mn
~Pharmacia) in buffer (100 mM Tris pH 7.5, 1 mM EDTA pH
8.90, 100 mM NaCl). The leading edg~ of the eluted DNA
~raction~ were pooled, and DNA was concentrated by
lyophîlization until the volu~e was about 100
microliters, then the DNA was precipitated with ammonium
acetate plus ethanol as aboYe.
The entire ~ir~t ~trand:sample wa~ u~ed ~or ~econd ~trand
reaction which follow the Gubler and Hoffman (23) method
except that 50 miarograms/ml dNTP'~, 5.4 units DNA
polymerase I (Boehringer ~annheim #642-711) t and 100
units/ml E. coli DNA Iigase (New England Biolabs #205) in
a total volume of 50 ~icroliters wer~ used. After ~econd
strand synthe~i~, the cDN~ wa~ ph~nol/chloroform
~extracted and precipitated. The DNA wa~ re~uspended in
10 microliter~ distilled~water, treated with 1 microgram
RNase A for 10 ~inute~at ~2C, and e~ctrophoresed
through a l~ agarose gel (Sigma Type II agarose) in 4 0 mM
Tris-acetate bu~fer:pH 6.85.~ The gel wa~ stained with
ethidium bromide, and DNA in~the expected ~ize range was
excised from the~gel and :electr~luted in 8 mM Tris-
2~ acetate ~pH 6.85. :Electroeluted DNA was lyophilized toabout 100 microliters, ~and~precipitat~d with ammonium
acetate and ethanol a~above~.~ The DNA wa~ r~u~pended in
,
~ 20 microliter water.~
-
, ~
Oligo-dC tails were added ~o ~he D~A to facilitate
cloning. The :reaction contained ~ e D~A, 100 mM
: ~ potassium cacodylate pH~7.Z,~ 0.2 mM dithiot~reitol, 2 m~
CaCl2, 80 micromoles ~ dCTP, a~d 25 units terminal .
deoxy~ucleotidyl transferaæe~(Nolecular Genetic Resources
~9~1001) in 50 ~icroliter~.~ After 30 minute~ at 37C, the
reaction wa~ terminated~with 10 m~ EDTA, and the ~ample
' ~
. :
WO 93/0210~ ~ PCr/lJS92/060~
~ti~
~, --70--
wa~; phenol/chloroform e~racted and precipita~ed as
above .
The dC-tail~d DNA Gample waE; annealed to 200 ng pla~3mid
vec:tor pBR322 that contained oligo-dG t~ilC ~Bethesda
R~;earch I.abs #5355 SA/SB) in 200 microliter~; of 0 . 01
Tris pH 7 . 5, O . 1 M NaCl, 1 mM EDTA pH 8 . O at 65C for 2
minutes and then 57C for 2 hours. Fr~h com~tent E.
coli D~-l cell~ were prepar~d and trarlsform~d a~
d~scribed by Ha~a~an ( ~a 1 ) u~ing half the ann~aled cDNA
sampl2 in twenty 200 Dlicroliter alilauot~ of c~lls.
~rran ~ormed cell~; were plated on L-broth agar plates plus
10 ~icrogra~s/~l tetracyclin~. Colonies were screened
f or t,he pre~ence o~ in~ert~ into the ampicillin gen~
using Amp8creen ~BQthesda R~search La~bfi #5537 UA), and
the positi ve colonies WerQ pic:ked ~or analy~
. .
POLY~ SE FILL~IN R15ACq~ )N. DNA wa~ re~;u~pended in
buf f er containing 50 ~ Tri pH 7 . 4, 50 ~M KCl, 5 ~iM
Mg::I2, and 400 mic:romolar each of the four
deoxynucleotides. Ten units of Xlenow DNA poly~ra~e
RL) were added and ~h~ reaction wafi allowed to proce~d
f or 15 minute~ at room temperat~are . The DNA wa~ then ~:
~: phenol extracted and: ethanol precipitated as above. ; :
:
HO~OIOGY VECrOR 523-78 . 72 . ~The p}a mid 523-7B . 72 was
: ~ ~ c onstructed~for the purpo~;e ~f deletirag a p~ion of ~he
:: gpE gene coding region f rom the BR viru~ may also :~ .
be u~ed to in~rt foreign DNA into IBR~, Pla~mid 523 n
78.72 may be construc~6~d by digestiorl of t:he pla~id 536~
03 . 5 with ~he ~nzyme XbaI follc~wed by religation 'co
re~ove the lacZ marker gene . : . : :
: .
HO~OIOGY V~ R 591-21.20. The pla~;~id 591-21.20 wa
con~tructed ~or the purpo8e oiE d~letirlg a poxtion of the
IBR thymidine kinase gene. It Dlay al. o be:u~d to in8ert :l
:
WO93/0210~ PCT/US92/0603~
2 ~
-71-
foreign DNA into IBR. It contain~ a unique BglII
restriction enzyme site into which foreign DNA may be
in~erted. It may be constructed utilizing standard
recombinant DNA techniques (6, 14) by joining restriction
~ragments from the following sources with the synthetic
DNA ~equence~ indicated in figure 24. The pla~id v~ctor
is derived from an approximately 2999 ba~e pair SalI to
SalI re~triction fragment of pSP64 ~Pro~ega~. ~ragment
1 is an approximately 1400 ba~e pair SalI to NarI
restriction ~ubfrag~ent contained on the approximately
2700 base pair SalI-Sal~ restriction subfragm~nt of the
IBR ~indIII restriction fragment A (72). Fragment 2 is
an approximately 1215 ba~e pair BglIII to SalI
restriction ~ubfragment contained on the approximately
2700 ba~e pair SalI-S~lI restriction subfragment of the
IBR ~indIII re~triction fragment A (72).
~ :.
HOMOLOGY VECTOR 552-46.12. The pla~mid 591-46.12 was
constructed for the purpo6e of deleting a portion o the
Tk gene csding region from the IBR viru~. It
incorporate6 an E. coli B-glucuronida~e (uidA) marker
: gene ~lanked by IBR viru~:DNA. The uidA marker gene was
inserted into the~homology vector 591-21.20 at the unique
BglII site. The marker :gene i~ oriented in the ~ame
25:: direction as the Tk gene: in~ the ho~ology vector. A
de~ailed descrlption of the marker gene i given in
~:: : figure~25. It may be con~tructed utilizing ~tand~rd
recombinant DNA~technique6~ 14) by joining reBtrictio~
: fr~ ~ ents fro~ the following ~ourc~8 with the ~nthetic
DNA ~e ~ nces indicated in figure 25. Fragment 1 i~ an
approxi~ately 404 bas~ pair S~lI to Eco~I restriction
subfragment of the PRV BamHI restriction fragment #10
(3)~ Note ~ at the ~coRI ~ ite was introduced at the
~ location in~icat~d in fi~ure~l2 by P~R cloning. Fragment
2 is an approximately ~l823 ba~e pair ~coRI to SmaI
~ .
fragment o~ the plasmid pRAJ260 ~Clonetech). Note that
the ~coRI hnd 5~ I site6 were:introduced at the location~
W~3/0210~ PCT/~S92/0
iV` -72 -
indicated in f igure 25 by PCR cloning. Fragment 3 i5 an
approximately 784 base pair Sm2I to SmaI restriction
subfra~ment of the HSV-l BamHI restriction fragment Q
(10). Note that this fragment is oriented such that the
polyadenylation se~uence ~AATAAA) is located closest to
junction C.
C~ONING OF BOVINE VIRAL DIARRHEA VIRUS gp53 GENE. The
bovine viral diarrhea (~VDV) gp53 gene was cloned
es entially as de~cribed ear~lier ~see cDNA CLONING) using
the random priming method t6). Viral RNA prepared fr~m
BVDV Singer strain gr~wn in MADIN-DARBY bovine kidney
DBK) cells was converted to cDNA uGing the rando~
priming method. The~ cDNA was u~ed for ~econd st~and
reaction (23) and the resulting double stranded DNA was
used ~loned a~ described in the~cDNA C~DNING procedure.
:~ From this procedure;a series of clonefi were obtained that
comprised parts of~ the~:;genome of BVDV~ The location o~
the~gene~for gp53 gene ha6 been published (66~ and this
20~ sequence information was uced to locate and isolate the
:gps3 enaoding région from~ the 449 kilodalton :primary
translation product~open reading frame:contain~d in the
complete cDNA clone.:~
2~5~ The~ gp53~ encoding~gene ~of BVDV was al80 cloned
essentially as~desoribed by Xatz et: al. for the HA gene
of human~influenza~virus.~ Viral RNA prepared from the
Singer strain of~VDV~virus~grown in MDBK cells was first
con~erted to cDNA:~utiI;izing an oligo :nu~leotide primer
30~ specific for:the~targot ~ene. The cDNA wa~ then u~ed a~
a template or polym~rase~:chain r~action (PCR~ cloning
7)~of the gp53 géne~ The PCR primeræ were designed to
; incorporate restriction ~endonuclease enzym~ sites that
permi~:the cloning o~:the:amplified coding reyi~n into
~ectors that contain~the~ppropriat~ ~ignals for gene
expression~in IBR.::T~e:gp53:gen~ of the Singer strain of
BVDV was cloned~:using the foll~wing olig~ nucleotide
::
: : : '
- .:
WO93/021~}~ PCT/~IS92/0603
-73-
primers: 5'-CATAGATCTTGT~GTGCTGTCCGACTTCG~A-3' for cDNA
priming and w~ combined with 5'-
CGTGGATCCTCAATTACAAGAGGTATCGTCTAC-3' for PCR
amplification. Note that this general ~trat~gy may be
u~ed to clone the gp53 coding region ~rom BVDV strains
other than Singer.
CL~NING OF BOVINE RESPIRATORY SYNCYTIAL V~RUS FUSION
PROTEIN AND NUCLEOCAPSI~ PROTEIN GENES. The bovine
~O respiratory viru~ (BRS~) fu8ion ~F), attàchment (G), an
nucl~ocap~id pro ein ~N) genes ~ay be cloned essentially
as described by Ka~z ~t al~ for the HA gene o~ human
influenza. Yiral RN~ prepared ~rom virus grown in bovine
nasal turbin~te ~BTj ceIl~ ls first converted to cDNA
utilizing an oligo nucleotide priDaer ~peci~ic for the
target g~ne . Th~ ~DNA i~ then u~ed as a template f or
polymerase chain r~action (~CR) clonirlg ~ ~7 ) of the
targeted region. ~ The PCR pri~ner~ are d~igned to
incorpor~te r~triction ~ites which permit the cloning of
:~ 20 the amplifie~l coding :region~ into vectors containing the
appropriate ~ignal~ f or expressiorl in IBR ., one pair of
oligo nucleotid~ will be ~ required for aach codi~g
region . The N gen~ coding ~ region f rom the BRS~ strain
~. .
A51908 (or :39l-2??)~ would be cloned utilizing the
: 25 f o l l o: w i n g p r i m e r ~ : 5 ~
AAAAG~TCT~AGCAAGGTCAAACTAAATGAC~CrTTCA~C-3' for cDNA
p r i ~ i: n g ~ a~n d ~ c O~R~ b i ~ e d w i t h 5 ' -
::cGTGG;ATccAAcT~Ach~ITccAcaqcATTA~cTrrGGGATr 3~ for
: The G gene coding regi~n from~;the BRS~ ~train AS1908 (or
391-27?) ~ould ~e c}oned utilizing the ollowing primer~
5' TATAG~T~TTCA~ACCCATCATCTTAAA~T~AAGA QTT~-3' for cD~A
p r i ~ i n g:: a n:d~ c o ~ b i n e d w i t h 5 ' -
CGTGG~TCCA~AAT~A~ATGTTATATGGAGGTGTGTTG-3' for PCR. The
F gene fro~ ~tx~in A51908 for 391~2~?~ of B~SV would be
clonQd ~ utilizi~ the:~ fol:lowin~ pri~ers: 5'
T~TAGATCTAAC~GCC~TGAGGATGATCATCAGCA~TA~C-3' for c~N~
p r i m i n g ~n d ~ c o m b i n e d w i t h 5 ' -
WO93/0210~ PCT/~'S92/060~
r I t
.,
~3~ 74-
CGTGGATCCTTCTGAGGTTTAGATTGTAAACATTATGCA-3' f~r PCR. Note
that this general strategy may be used to clone the
coding region of F and N genes from other strains of
BRSV.
CLONING OF PAST~URP:LI,A ~AE:WOLYTICA LEUKOTOXIN AND IRON
REGULATED OUTER ~EMBRANE PROTEIN(S). The P~steurella
haemolytica train A1 leukotoxin gene may be cloned from
a geno~ic D~A sample. Genomic DNA i~ prepared from P.
hAemolytica ~1 cells grown in culture (68) by the ~ethods
described in Maniati~ et al. (1982). The purified P.
:: haemolytica DNA is then used:as a template for polymerase
chain reaction (PCR) cloning (67) of the targeted
..
leukotoxin gene. The PCR~primers are de~igned so that
restriction endonucl~a~e ~ites are incorporated that
:~ allow the cloning~of the 102 kilodalton toxin portion o~
the gene into vectors containing the appropriate signals
: for expression in IBR. T~e;~P. h~molytica A1 (ATTC 43279
biotype A, serotype 1~ l-ukotoxin gene would be clon~d
: 20 uti~lizing the~ following prlmers: 5'-
TATAGATCTTAGACTTACAACCCTAAAAAAC-3' and 5'~
CGTGGATC~A~CrCTATAATGTGTG ACAATATAG-3' for P~R, Note
that this general ~strate~ ~ay be u~ed to clone the
coding regions~ for~;:the~ le:ukotoxin gene of all P.
2~5~ ~; haemolytica serotypes.
The P.~ h~molytica~ A1 ~iron regulated outer ~embrane
proteins (I~P~ of 3 ~ajor polypeptides with molecular
weights of 3s,~70~and~:~100~ki1Oda1tons. The DN~ coding
!30 :for the array of P. hà~emolytica genes can be cloned in
Escher~'chia coli~u5ing~:plas~id ~ectors e~Bentially as
: describe~:in Maniatis et~a1~ (1982). The clone library
~ ~ is constrlaated by ~;partial~: digestion of the gerlo~nic DNA.
: ~ : The IRP genes can ~e is:olated ~rom this library of P.
; :35 :~haemolytica clones~by~crQening for the production of
:~: iron: regula~ed outer:~embrane antigen~ by a colony
enzyme-1inked immunosorbent assay blot method with
,
,
WO93/0210~ PCT/US92/0603~
2 ~
-75-
antiserum that is ~pecific to the IRPs. This antiserum
may be obtained by eluting antibodie~ deri.ved from
polyclonal antiserum rai~ed against whole P. ha~molytica
or membrane enriched fraction but selectively bound to :
5 the ~RPs on Western blots ~69). The specificity of the ~ :
antibodies can be verified by immunoblot ~creening of P. ~
h~molytica polypeptide from iron restricted and iron : ~:
induced cultures. : :~-
. ~.
, ~ ,.~ .
. : . .
, ,~
. . ~, . .
~, '
,: .
" :.
, ~:; ~ ~
.. .
: . ~ . . ~
.
:: ~ :;
:
`
:
.
w093/0210~ PCT/US92/
~ J-~ -76-
E ~ ~ES
xam~le 1
S-IBR-002
S-IBR-002 i~ an IBR virue that ha~ a deletion of
approximately 800 bp in the repeat region of the genome.
This deletion removes the only two EcoRV r~striction
sites on the ~irus genome and an adjacent BglII site
(Figure 2j.
:~ To con~truct this viru5, the DIRECT LIGAT}ON PROCEDURE
FOR ~GENERATING RECOMBINANT~HERPESVIRUS was performed.
Purified IBR virus DNA (Cooper ~train) digested with
; ~ EcoRV restriction enzyme~wa~ mixed with Dr~I-re triction
enzymé-dige6t~d plas~id DNA containing the ~ . coli B-
ala~ctosidase ~lacZ)~gene~under the control o~ the HSV~
TK`~promoter. After ligation ~ho mixture was u~d to
~transfect animal cells: and ~the tran fection ~tock was
screened~ for recombinant IBR viru~by~ ~he SOUTHERN
:BLOTTING :OF :DNA~ procedure. The final r~sult of the
purification w~5: the~recombinant;I;BR virus~designated S-
;IBR-002.: It was~shown by Southern hybridization that
25~ ;this~virus does not carry~any~foreign genes. Restriction
:enx ~ e an~lysis~:also ;showed~ that the insertion sites
(EcoRV3:~in both~repéat5~ w re~deleted.~Figure 2 ~hows the
restriction map~of~ the ~coR}~B ~ragme~t whtch contains
: the ~EcoRV re~triction~ ~8ite5 and the:~map o~ S-IB~-002
;30 which;lacks the ~c RV siteg.~ SoIBR-002 wa~ depo~ited on
June~ l8, l~86 pursuant~to~ the ~Budapegt Treaty on the
Int~rnationa:l Depos~it~of:~icroorganlæ~ for the Purposes
of Patent:Procedure~with~the~Patent Culture Depository of
: the ~American Type;~Culture~ Collection, 12301 Parklawn
:~:35 Drive, Rock~ille,~:Maryland::~:20852 U.S~:A. under ATCC
~: : Accession No. VR~140.
: .
: : :
WO93/0210~ PCT/~'S92/060~
_77_ 2 ~ 3
A ~tudy was conducted to determine the ~afety and
serological re~ponse of young calve~ following
intramu~cular administration of S-IBR 002. These results :
are pre ented in Table l. Three calve~ were inoculated
intramuscular~y with 107 PFU of S-IBR-002. Clinical
signs of IBR and febrile response were absent in these
calv~s ~ as well afi in the contact control calf. All
three calves d~veloped ~ignificant n~utralizing antibody
to IBR virus but the contact control remaine~ ;.
seronegative. T~ese r~sult~ ~uggQct that S-IBR-002 i6
useful a~ a vaccine again~t IBR di~ase.
" ~
; ' ' ;'''
::
,
;
~ : : : :
: ~ :
. ::
'~
..
WO 93/02 ~ Pcr/ us92/060
,c~"~ 78-
Table 1. Serc~logic and Clinical Response of Young Calves Following Vaccination with S-
IBR-002
_=___ ___ _~ .
Virus Calf Clinical Virus Antibody Titer
Construct # and Isola~don'Days Post lllo~atio~
~FesbrOilDse O 7 14 ¦ 2l _
_ , , ... ~ _ _ _ _ _l
28 NONE (~) <2 c4 6 5 3 I ~;
, . ~ I - ~, .
S-IBR-002 30 NO~ . ( ) __ ~2 <4 6 ~26 ¦ :
94 NONE ~ (~) c2 ~4 6 3 8 ¦ .
. . . _ __ . -. I , , .
Colltrol 32 NONE (-) < 4 < 4 c 4 < 2~ 4
. .. ------- ~ '~ ~
~F~om nasal swabs and peripberal blood leuko~ytes.
-,
: ~ : . ......
:'
:
;'
.
-'. ' ~ ,
. ' '
. -'
WO 93/0210~ PCl~USg2/06034
2 ~ ~ ~ & ~ ~
--79--
~ .
T~Jni~ort 2 ~ne
5 The unique ~3hort r~gion of IBR virus contains a gene
homologou~3 to the US2 gene of several other
herpeE~riruse~. In the ~;tUdies de~cribed below we E;how
that deletion of the I~ unique short 2 gene (U~2 ) may
render the viru~ ~af e f or u~e in pregnant cows, as
10 determined by direct f~al inoculation~
Ob~;erving that the Na~algen IBR va;ccine ~train will not
cau~e abortion wh~n u~ed in IBR ~usceptibl~ pregnant co~rs
at Yariou~ 8ta~e8 of gestation ( 18 , 65 ), we attempted to
15 determine th~ genoDlic lesion responsible f or thi~
prop~rty. We ch~r~cteriz~d the g~nome of this ~rirus by
re#triction ~apping and DN~ ~equ~nce analy~i~. It was
deter~ined that a ma~or portion of the IEs:Ea virus US2 gel-e
was deleted ~ro~ the Na~algen viru~. Restriction ~apping
~: 20 of the Na alg~n vi~ indicated ~hat the ~i~dIII K
frag~ent co~tained~ an~ approximately 800 ~a~e pair
: : deletion. The deletion was localiz~d to the Qnd of the
~indIII K Fragment~located next to the ~indIII O-fragment
(see Figure 1). Therefore, the ~indIII K fragment from
~:~ 25 the Ccoper strain wa~ s~bcloned and thig region wa~
sequenced. ~he fir~t 1080 ba~e pairs of the ~ragment
were found to contain an open rsading fra~e ~ORF~ coding
for 30g a~ino:acid~ ee Figure 3). ~he ORF i~ 68% GIC
and enc~des a protein;with a predicted ~olecular weight
: 30 of 46,094. Co~parison of the ~eguence of the predicted
prot~in with se~ue~ce~ of gen~ pr~duct~ of ~SY-1, PR~,
HSV-2, and ~DV in~the unique ~hort roegion indicat~d that
~hi~ ORF i~ nO~OlOgOu~ ~to the~herpe~viru~:US2 gsne (~e
Figur~ 4)D Al~h~ugh the:functio~ of the herpe~irus US2
gene i~ not k~wn, :~he g~ne has ~een ~hown to be
none8li~3ntial ~or :rowth o~ HSV in c~311 culture (4 ,19) .
, .. .
WO 93/0~10~ PCr/US92/060~i
'"'J~ 80-
., ~
The US~ gene has alE;o been hown to be deleted in the PRV
vaccine strains Norden and Bartha ( 11) .
The ~indIII K fragment from the Na~;algen virus was
5 subcloned and the deletion region wa~; ~equenced. When
the sequence obtairled f rom the Nasalgen 2;train was
::ompared to the s~3uence obtained from the Cooper strain
( ~ee Figure 5 ), it w~s po~;sible to determine that amino
acids 59 to 309 of the US2 gene had been delet~d. ~t was
10 al80 determin~d that mo~t of the ~indIII O i~ragm~nt had
- alsc~ been deleted.
Cattle Ftudi~s ha~re shown that the Na~algen ~rirus will
not c:au~e abortion when used in IBR-~u~ceptible pregnant
ows at various ~i;taq~s of ge~tation (18). Since the only
major dif~erence betw~sen t}~e wild-type IESR ~'crain and the
3~asalgen strain resides in the deletion D th~ S2 g~ne,
this gene may ~ involYed in the ~etal ~rirulenc:e ob~;erv~d
:~ for the wild type: viru5.
.
~ -
:
WO93/02104 PCT/US92/0603~
2~ 13~
-81
~ix~m~
S-IB~-027
S-IBR-027 is an IBR ~irUc that h~ a deletion of
approxi~ately 800 bp in the repeat re~ions and
approximately 1200 ~p in the &hort unique region of the
genome. The deletion in the ~hort unique region removes
the US2 gene (Fi ~ e 6). The repe~t deletion was derived
from the parental viru~ S-IBR-002 and is de~cribed in
: Example 2.
To construct thi~ Yirus, the HOMOL0GOUS RECOMBINATION
PROCEDURE: FOR: GENERATING RECOMBINAN~ HERPESVIRUS was
performed. A homology vector containing the bacterial
; transposon ~n5~ :NEO (amino~lyco~ida~e 3'-
: phosphotran~f~ra~e) gene under the control of the HSV ~4
promoter flanked by~s~quen~es from the IBR viru5 TX gene
was construct~d. The IBR virus homology regions were
derived from tbe~TK~gene.;~The:upstr~am homology included
the first amino acid~of;~the~qR g~ne (15) and extended
approximately 800:basQ pair upstr~am of the TX coding
re~ion. me downstream~homology included amino acids 156
to~3:57~and extended downstream of the TK coding region
25 ~approximately:~60~ba~e: pairs.: S-IB~-002 DNA wa~ ~ixed
: : with~the::homology`vector~and~transfected into rabbit skin
cells as indicated:: in the~wthod~. Th2 tran~fection
stock: was oelected: acoording~to the SELECTION OF G418
~: ~ SISTANT IBR~VIRUS.;~:Individual clone~ were pIck~d aft~r
: 30 one round of :s~lection and analyz~d by the 80UTHERN
BL~TTING OF D~A:procedure.:When ~ probe d~riv~d from the
NEO~gene was:u~ed ~in~ this analysi~ one clone.was found
~;~ :: :which did not ~hybridize to the NEO probe but had a
indIII re6tric~icn ~dige tion patter~ clearly di~tinct
~::: : 35 ~r ~ ~e parental S-IB.R-002. Furth~r an~lysi~ indicat~d
that the NEO~had~not been~in~ rted into th~ TX region~
~;
W093/0210~ ~ PCT/US92tO6
.~t~,;
-82- ~
however an approximately 1200 ba~e pair deletion had ;
occurred in the ~indIII K fragment.
In order to characterize the HindIII K deletion, that
fragment wa6 6ubcloned and subjected to restriction
mapping. Utilizing a series of oligonucleotide probe~
deri~ed from the wild type sequence it wag determined
that approximately 1200 base paira were deleted from the
end of the ~indIII K fragment ~djacent to the ~indIII
KlHindIII O ~unction t~ee Figuxe 6). Thi6 deletion
: remove~ the entire coding region of the US2 gene. S-IBR-
027 was deposited on April 17, 1991 pursuant to the
: Budapest~ Treaty on the International Deposit of
: Microorganism for the Purpose~ of Pat~nt Procedure with
the Patent Culture Depository of the American Type
Culture CO11QCtiOn, 12301 Parklawn ~rive, ~ockvillQ~
Marylan~ 20852 U.S.A. under ATC:C Acce~ion No. V~ 2322.
,
:: :
Di~ect fetal inoculation ig the most ~en~itive ~e~t for
determining the: ~afety o~ live, IBR vaccineB as xegards
their use in pregnant~cow~ or in calve6 nur~ing pregnant
cows. Threé virus ~con~truct~ were te~t~d for fetal
: ~ safety ~by ~inoculating: directly into the ~ vine ~etus,
: 2:5 following laparotomy~ to expose~ the uteru~. Abortion
: occurring ~within~ seYen ;~ day~ after inoculation was
con6idered to be ~urgically-induced.~ If fetuse aborted
after;thig time,~ti~u~ ~ample~:~were re~ved and cultured
~for the~ presencè~of~the :IBR ~cons~ruct.~ C~e~are~n
:section were~ perfor~ed on cow with fetu~a~ ~urviving
for gr~ater than 3D:day~ post-inoculation. Fetal ti~ue
was removed~for viru~ cultu~ing and blood sa~ples were
~:~ taken for evaluation:of;:seru~antibcdy to IBR viru~
: . : .
35:~ The S-IBR-OZ7 construct de~c~ibed ab~ve wa~ te~ed, as
~: ~ well a~ two other construct~, S-IBR-020 and S-IBR-028.
The S-IBR-020 construct wa~ deriv~d ~ro~ the Cooper ~:
.
. ~
WO93/02104 2 ~ 1 o3 & ~1 ~ PCT/US92/06034
-83-
strain of IBR viru~ by maki~g deletions in the repeat
region o~ the DNA an~ by in~erting the Tn5 NE0 gene.
The S-IB~-028 construct wa~ derived from the Cooper
strain of IBR viru~ by ~aking deletion~ in the repeat
region of the DNA and in the TK gene. The Tn5 NE0 gene
was also inserted into the TK deletion.
~he following re~ult5 were obtai~d fro~ ~tudie~ with the
three viru~ con~tructs. In the ~tudie~ with S-IBR-020,
two fetu6es were inoculated, one at approximately 130-140
days g~tation and the other ~t approxim~tely ~70-180
days gestation. The younger fetus aborted tw~nty days
after inoculation, but virus could not be recovered ~rom
ti~sue 8ample~ 0~ thi~ fetu~ (Table 2). The other fetus
w~ live and appeared normal when it wa~ surgically
re~ved 60 day~ poct-inoculation. In ~tudi~G with S-IBR-
~: 0~7, four fetu~és,: ranging in age from 125 day¢ to ~250
days, were ino~ulated (Table 2). All f~tu~es ~urvived
and app~ared normal~ In studies with S-IBR-028, tbree
fetuses, ranging in age from: 140 days to >250 days/ were
inocu1ated. The youngest; and: eld~st fetuE;e~ sur~rived and
appeared nor~al, ~ however the fetus inocu1ated at 160-170
: ~ :
: ~ days gestation aborted nine days after inoculation~
.
:~ 25 Direct fetal inoculation:is the mo~t sen~itive test for
~éasuring the ~safety of live, IBR ~iru~eg u~ed in
`pre~nant: cows. ~ To~date, the gene(s) involved in fetal
virulence has not:~baen reported. We have engineered IBR
viru6es with delétion~ in~three diff~rent ~gions o~ IBR
30 virus DNA and then~ determinsd ~he e~fect of the gene :~
deletion. All three virU~ con~t~ucts te~ted hav~ a
~ deletion in the ~r~p~t region of the DNA and two
:~ cons~ruct~ do not~have TK activity. On~ feku inoculated
wit~ each of ~he~ TK- con~truct~ ha~ a~ort~d. In
~contras~ he oon~ruct ;with deletion~ in the rep~a~
regi~n~ and th~ US2~gene ~S-IB~-027) ha~ b~en inocula~ed
into four fetu~es with no adver e reaction~.
:
~:
.`'
wo 93/02104 pcr/lJss2/o6
p ~ 8 4-- -
s~
,.,
Table 2. Safety of IBR Viruses for Bovine Fetuses
~ _ _
Construct Fetal Age^ Results
, -~ , , _ ~
Fetus abortzd Day 20 post-
13~140 I:)ays iDocula~on; no ~s isolated
~ _ __ _
~IBR 020 No~mal, live fetus 60 days post-
17~180 Days i~oculadon
. .. ... ~ ..
No~mal, live fetus 60 days post-
. 125-135 Days L~oculatio~
~_~
Normal, live calf bom 56 days
15~160 Days post-inoculation
. . . ," , ,
~IBR~027 No~al, live calf born 30 days
22~2~ Days post~inoculation
'.
Normal, l~ve calf bon~ 30 diays
>250 Da~ post-in~ulation
. . _ _ _ _ _ _ . __ ...
: Normal, live fetus 60 days post- ~.
14~15~ Days in~ation
_
: ~etus aborted Day 9 post-
~IBR~28 16~170 Days ~lloculation; ~o ~us isolated
1~ ~ ,~
Normal, li~e ~1 b~ 12 days
>250 Days po~t^inocul~on
~ ~':
~Appro~mate age ~t t;me of virus iIl~cula~lio~ ~:
:
W~93~02104 P~T/US92/0603~
2 ~ l 3 ~ 1 ~
-85-
We have shown that S-IBR-027 is ~afe for fetal
inoculation in contrast to S-IBR-020 and S-IBR~028 which
are not. Although all three viru es were engineered by
similar approachec, the di~tingui~hing diff~r~nce of S-
IBR-027 ic the deletion of ths US2 gene. We have also
~hown ~hat the Na~alg~n virus, which WBS ~enerated by
~nd~pendent me~hod~ and i~ al~o æafe for u~e in ~R
susceptible pregnant cows, ha~ been deleted in the US2
gene.
Although th~ S-IBR-027 a~d Nasalgen hav~ the si~ilar
prop~rty of fQtal saPety, S-IBR-027 o~ferfi additional
advantages. The major portion of the US2 gene (251 out
o~ 309 amino acid~) ha~ been deleted in the Na~algen
viru~. Thi~ deletion wQuld e~le~rly inactivake ~he g~ne,
howev~r the r~aining por~ion of ~he gen~ may ~ake it
~nore li~Qly to rey~rt;to virulence via r~combinat~on with
other virus~ he compl~te eoding re~iora of t:he US2 has
20 been deleted ~ro~ S-IBR-027 malcing it le~ kely that
this gene could be :restored and r evert ~he viru~ to
virulence. The S-IBR-0~7 con~truct al~o c:a~rie~ an
: important deletion; in :the repeat region, which is rlot
pres~nt in~ the: Nasalqen viru : A deletion in the
25 analogou6 region~ of the p~eudorabies virus ~PRV) ha~ bee~
sht~wn to be valuable in attenuating PRV f or swiale ( ~ee ~ . .
U,.S. Patent No. 4,877,737~. ThiE d~letion ha~ also been
sho~n ~o att~nuate~IBR for cat~le as ~e~n in the testing
of S-IBR-002 (-ae~ ExampIe 1)~
~ :~
; .;~ ,~
: : ~ ,''
":
W~ 93/02~04 PC~/US92J~034
86-
S-IBR-02
S-IBR-028 i~ an IBR viru~ that ha~ a deletion of
approxi~ately 800 bp ir the r~psat regions and
apprDxi~aately 250 bp in the TX region of th~ genome. The
delQtion in the T~ r~g~ on inactivates the TK geneO The
10 r~p~at del~tion wa~ deri~v~d froDI the parental viru8 S-
- IBR~002 and i8 de~t:ribed in ~ca~ple 2.
TC~ ce)nBtnact thi~ virll~i;, the HOMOLOGOUS RECOMBINATIOM
PROCDURE FOR S;}3NE~ING RECOMBINA2~T HERPESVIRU~; waB
perf or~ed . A homology ~ector containiny the bacterial
tran~po80n T~5 NEO ~ (~mi~oglyc4~idase 3 ' -
phosphotran~ra~e) g~ne ur~d~r the control of the HSV-1
4 gene promoter fla~ed by !guence~ from the IBR ~rirll5
TK gene was col~struct~d. The :IBR ~iru~ homology regions
were d6!riv~d fro~ ~the TK gen~. The up~tream hom~loçly
included a~aino acid~ l to 62 of the ~R gene (lr~) and ::~
extend~d approximately:674 base pairs up~3tream of the TK
coding;~ rsgion. ~e do~str~m homology included ~nino
: acids 156 to 357 and e~ended downstream of th~ TK codin
region ~pproxi~ately 1138 baR~! pair~. S-IBR-002 D~A was
mixed with the homology v~ctor l~9-7 l . 5 and trz~n~f ~cted
into rab~it skin ;cells:as indicated in the ~thod~. The :~
tran fection ~ tock ~ was ~elQct~d according to the
S ~ CTION OF G418~RES~STANT IBR~:VIRUS.
:
Indivi~ua1 c1One~ were: pick~d after two round~ of
s~1~ction and ~nalyz~d~ ~y th~ SOUI~ERN BL0T~I~G O~ DNA
proc~durc. ~veral c1One were;a~sayed for TK activity
by a 14~-thymidine incorporation a~ay (2~. One c1One
~hich was ~n~gati~e for ~R activity was chssen and
character1zed by digectio~ with ~ndIII and ~baI~ The
re~triction:endonuclca~e an~ly~is confir~ed tbat the NEO
: ' . .'
: -, .
WO 93/02104 2 ~ ? 3 S ~ 3 PCT/US92~06034
--87--
gene had been inserted into the TK gene. This clone,
deRignated S-IBR-028, was d~posited on May 14, 1991
pur~uan~ tG the Budape~t Treaty on the International
Deposit of Microorganisms for the Purpo~e~ of Patent
Procedure with the Patent Culture Depository of the
American Type Culture Collection, 12301 Parklawn Drive,
Rockville, ~aryland 20852 U.S.A. under ATCC Acces~ion
No. VR 2326.
~ ~ :
,,,
, . .
,
,
;
::
~ ` :
,
:
WO 93/02104 PCr/USg2/0603
5 ~ 8 -
$~ç~
G1Y~ O~ q~e
5 Deletion of the PRV gpX gene ha~ been shown to be
valuable both a~ an att~nuating lesion and as a nega~iv~
serological marker (~Qe U.S. Serial No. 192~866, filed
llay 11, 1988 nc~w U. S. Pat~rlt No0 5, 0~7 r 237 i~sued
S~pt~nber 10, 1991). Isl the ~tudi~ de~cri~d below we
19 ~how th~t the uni~ue short r~gion of I8R Yiru co~t~ins
a gene ho~ologou~3 ~o ~6~ gene of PRV.
The sequerlce of an appro$i~nately 1400 ba~e pair region of
the IBR ~indIII g f ragment ( ~ee Figure 8 3, 1 o~ated
15 approximately 2800 ba~e pair~; down~tr~ of the ~indIII
K/~J~dIII 0 jun ::tion wa; d~t~rmin~d. Thi6 region was
found ~o contain an ORF c:sdling for 441 a~ino acids~
transl~t~d in the dirQc:t~ on ~way froDI the ~indIII
K/~iAdIII O j~mction (~ Figu:re 1). The 0~ iE~ 6996 ~;~C
20 and encodes a prot~in with~ a pr~dict~d ~ol~ r weiqht
o~ 58, 583 . Comparison of the ~equence of the predicte~
protein with ~quence ~of gç~ne produat~ of ~SY 2 and P}~V
in the w~ : short region indicated that thi8 ORF is
~omolc~gou~ to the herps~viru~ gpG gene ( ~e Figure 9 ) ~
25 Th~ complete gpG gene re~id~ on ~n approxi~tely 2B00
ba e pair MluI to Nd~ fra~ent of the I~R YirU8
:: ~lindIII X fr;~aeIIt. ~ mi~ ag~nt has b~en cloned a~
a blunt e~ded~ ~rag~ent intc~ e pla mid pSP64. l~his
p~a mid is designalted PSY16~3. PSY1643 was dsposi~ed on
July 16, 1991 pur~;uant to the Budap~;t Tr~aty on tl
Inter3~at:Lonal Dlepo t of ~croc)rga~is~. ~or the ~rpo~e~
o~ Pat~at ~oa~dure wit~ t~e Pat~nt ~ultu~e l)epo~itory of
the Am~rican qype~ Culture ~Collection, 12301 3?arklawn
Drive, Rock~rille, Maryl~nd 20852 U.S.A. und~r A~CC
: ~ 35 Ac:c~;iorl No. 6~652. ~i~æ pla~id D~ay be u~d to con~
the ~equenc:e of ~h~ ~pG gene,. Th~ nce o~ the ~pG
gene ~ay al~;o be conf irD~ed by comparing the appropriate
WO 93/021n4 i c~ r~ ~ P~/US92/06034
2 ~. s . ~
--~39--
DNA ~equence of the wild type virus S-IBR-OOO ( Cooper
strain with the ~equence of the gpG deleted virus S-IBR-
0 3 7 (ATCC Acce s ion No . 2 3 2 0 ) .
5 To conf irm the expres~ion of the IBR viru~; gpG gene
product, cells were infected with IBR virus and samples
of media from infected cultures were subjected to SDS-
p~lyacryla~ide gel electrophoresis. The gel wa~ blotted
and analyzed u~ing the~ESTERN B~OTTING PROCEDURE. The
IO anti-~erum u~ed was a mouse hyper-immune ~ru~ rai~ed
again~t chemicalIy-synthesi&ed gpG p~ptides (amino acids
..
242-254 and 269-289): linked to keyhole limpet hemocyanin.
As shown in Figure lO,:gpG is:prominent in:the media of
cells infected with wild type virus~(S-IBR-OOO), but is
not detected in media of mock infected cells.
.
:
.
:: ; : :
,
. -,
. ~ ,
,'.,
,: , : ~,
,
: ~
~: ~
:
'
.
WO93/0210~ pcT/uss2/o6o34
~ g o--
~xampl~ 6
S~P~-160
S-PRV-160 is a pseudorabi~s viru5 that has a de1etion in
the TK gene in the long unique region, a deletion in the
repeat region, and an approximately 14l4 base pair
deletion in the gpX coding r~gion. The gene for E. coli
B-galacto~idase (lacZ:gene) wa~ inserted in the place of
the gpX gene and is under the contro1 of the gpX
promoter. A chimeric gene coding for an IB~ viru~ gp~,
PRV gpIII and PRV gpX fusion protein wa~ inserted at t~e
: HindIII sites located:in aach repeat.
S-PRV-160 wa~ con~truct~d uti1izing pla~mid 459-12~6,
pseudorabie~ viru6~ S-PRV-013 (see U.S. Serial No~
: ~23,1~2, fi1ed January 27,~1986 now U.S. Paten~ No.
~: 5,068,192 is~ued November 26, 1991 and U.S. Serial No.
07l192,866, filed: ~ay l1,; 1988~now U.S. Patent No.
;20~ 5~,047,237 issued September:10,~:1991) and the restriction
enzyme~ ndIII~ in~ the DIRECT LIGATION PROCEDURE FOR
GENERATING RE~OMBINANT~HERPESVIRUS. Sevexa1 c1Ones were
screened by digestion with~:~indIII for the pre~ence of
the ~indIII band~conta;ining~the~chimeric gene incert from
25- ~ pla~mid 459-12.6.~ One~c1O~e~ exhibiting the correct
indI~ insert~band was cho~en~and:de~igna~ed S-PRV-16~.
S~PRV-160~va~ con~truct~d ~80 ~ that it would expres6
~ ~ ~: precise1y the gpG~spec~fic a~ino~:~cid~ that vere deleted
: ~: 30 ~ in S-IBR-037. Thic~ allow~ the gpG fu~ion protein
expressed in :S-PRV-160~to;~be u ed as an antigen to
identify antib~dies;directed~:again~ th~ wild type virus
as~ opposed:~to~antibodies~ directed again~t S-IBR-037.
Note that gpX, the~PRY~homologue ~ IBR ~ixus gpG, has
35: been delet~d ~fro~ S-PRV-l60 :to preY~nt any confusion
resulting~rom~ross reactivity~that might exist between
the two pr~tein~. ~To confirm that~S-P~V-l60 do~s express
:
:
WO 93/0210~ PCr/US92/0603~
2 ~ , r~ L .¦
--91--
IBR virus gpG, a We~;tern blot analysis was performed. As
can }~e seen in Figure 10, gpG E;pecif ic antibody does
react with an appropriately ~ized media protein from S-
P~V-160 .
S-PRV-160 may al80 be utilized as an antigerl for the
production c~f gpG ~i;pec:if ic ~onoclonal antibs:~dies . Such
antibodieE; are u~3;eful in the develoEament of diagnostic
test~ ~p~cif ic for t~e gpG protein. Monoclonal
10 antibodie~ were gen~ratQd in ~ice utilizing S-PRV-160
aacording to the PROCEDURE FOR GENl~ATING ~!IONO~LONAL
ANTIBC)DIES . One of these antibodies ' clone 3-lG7 was
.
hown to react speci~ically with purified gpG in the gpG
ELISA aE;say.
.
. .
: ;
:
WO 93/0210~ PCI`/l,'~;9~/0603
9 2--
iJ:
f~'- X~Ple 7
S~IBR- 0 3 5
S-IBR-035 is an IBR ~virus that h~s two deletions in the
short unique region of the g~nome. The first deletion is
approximat~ly 2500 base pairs and begin~ in th~ ~indIII
K fragment approximately 1750 ba~e pairs down~tream of
the ~indIII Ol~ndIII K junction and extends back through
that junction. This deletion removes the US2 gene. The
- second deletivn i5 approximately 294 ba~e pair~ and
begins in the hi~dIII K fragment approximately 3900 ba~;e
pair~ down~trea,la of the h'indIII K/~i~dIII O junction and
ex~ends back toward that junction. This d~letion remove~
aminG acid~ 263 to 361 of the gpG gelle. The gene for
E.coli B-galacto~idase (lacZ gene) wa~ in6erted into the
deletic~n in the ~G gene and is under the e~o~trol of the
HCMY iR mediate early proter .
,:
.
S-IBR-035 was derived from S-IBR-000 ~Cooper ~;train~.
his was accompli~hed utilizing the homology vect~r 439-
:: 01.31 (~ee:M~teria1s and Methods~ and ~irus S-IBR-000 in
: the ~O~O ~ US RECOMBINATION: PROCE~URE FOR GENER~TING
R~CQMBINANT HERPESVIRUS. The transfection stock was
~25 screened by the :BLUOGAL SC~EEN FOR REC~MBINANT
HERPESVI~US~ The fi~al result of blue p1aque
purification ~a~ the r~oombinant virus d~ig~atQd S~IBR-
03 5 0 Thi~: viru8 ~wa:s characterized by re~triction mapping
and the:SOUT~ERN BLOTTING DNA procedure. Thi~ ana1ysi~
confirm~d the in ertion of the ~-ga1acto~ida~e (1acZ~
marker gene and the d~1etion of~ approxi~ately 294 ba~e
pairs of the gpG gene~ It was al~o confir~ed that an
approximate1y 2500 ba e pair teletion had occurred in ~he
r~gion of ~he US2 gene.
WO93/02104 PCT/VS92/0603~
2 ~ ~ 3 ~
-~3-
S~ Q~6
S-IBR-036 is an IBR virus that has two deletions in the
short unique r~gion of the genome. The fir~t deletion is
approximately 2-00 base:pairs and i~ 5imilar to the
deletion in SoI~R-035 ~ee E~ampl~ 7) which re~oves the
US2 gene. The second d~letion i~ approximately 1230 ba~e
pairs and begins in the ~indIII K fragment approximately
3~900 b~se pairs down~trea~ of the ~indIII O/ErindIII K
j~anction and ~xtend back toward that junction. This
deletion r~moves amino acid~ 1 to 361 of the gpG gene.
; T~e gene for E.coli ~-galactosidase (lacZ gene) was
insert~d into the deletion in the gpG gene ~nd i~ und~r
the control of ~ the HCMV i~mediate ~arly promoter.
: : S-IBR-036 wa~ derivad from S-IBR-OOO (Coop~r Gtrain).
Thi :wa~ accomplish~d;utilizing the ho~ol ~ Yector 43~-
~: : 20 21.~69 (see ~aterials and~Meth~d6) and viru~ S-IBR-OOO in
: the HOM~LOGOUS ~ECOMBINATION PROCEDURE FOR GENERATING
R~COMBINANT HERPESVIRUS. ~The~ tran fection stock wa~
screened~ by the~ BLUOG~L SCREEN FO~ RECO~BINANT
HERPESVIRUS.~ ~he ~flnal :~result of blue plaque
~: 2~5 purification wa the recombinant viru~ de&ignated S-IBR-
036. Thi~;virus~was characterized by re~txiction mapping
and ~he~SOUTH ~ ~BLOT~ING;DNA~procedur~O Thi analy~i~
confirmed the~in-Qrtion ~of~the B-galacto~idafie (lacZ)
: mark~r gene~and the~;deletion~f approxi~at~ly 1230 ba~e
pair~ o~the gpG gène. :It was al~o con~ir~ed that an
approximately 25~0~base~pair deletion h~d occurred in ~he
region of the US2 gene~(see~abvve).
:
WO 93/02104 PCI/VS92/0603
3`~ -94-
~2le_9 :~.
S~ R-037
5 S-IBR-037 is an IBR viru~ that has two deletions in the
short unique region of the genome. The first deletion is
approximately 2500 base pair6 a~d begins in ~he ~indIII
K frag~ent approximately 1750 base pairs downstream of
the HindIII Q/~indIII K junction and extend~ back through
10 that junction. Thi~ dele~ion removes the US2 gene. The
second deletion is approxi~ately 1230 base pairs and
begins in the ~lndIII K fragme~: approximately 3900 ba~e
pairs d~wn tream of~ the ~rindIII 0/~ndIII K junction and
extends back toward that junction. This deletion removes
amino acid~ 1 to 3 61 of ~e ~pG gene . ;~
.
S-IBR-037 was deri~red fro~ S-IBR-035. This was
accomplished utilizing the homology ve~:tor ~39-7004 (cee
~atarial nd M~thods) and viru S-IBR-035 in t:he
2 0 HOMOLOGOU5 RECOI~BINATION ~ PROCED~ Ft~R GENERATING
RECOI~BINA~ HERPESVIPcUS . The ~ransf ection stoc: lc was
scr~en~d: by the BI,UOGAL SCREEN FOR ~CO~3INANT
ERPlE:5VIl~US. The result of white plaque purification was
the rec:ombinant ~ YirUS designated S-IBR-037~ Thi~ virus
:.
:25 was characterized~by:restriction mapping and th~ SO~THERN
BLOTTING~DNA~ ~rocedure.: This analysis confirm~d ~he
d~Ietion:of the::B gala~to~idase (lacZ) marker gene and
the deletion of:approximately~123~ ba&e pairs of th~ gpG
gene. It was~also:cDnfirm~d tha~ an approx~mat~ly 2500
base pair deletion had occurred in the r~gion of the US2
gene (~e abo~e). S IBR-037 wa~ depo~ited on April 16,
1991:pur~uant t~ the Budap~t Trea~y on the International
: ~Deposit of Microorganis~ for the Puxpo~es of Patent
~Proc¢dur~ with the~ Patent Culture Depogitory of the
: 35 American T~p Cul~ure~Collection, 12301 Parklawn Drive,
Rockville, ~aryl~n~ 20852 U~5~A. under ATCC ACGe~SiOn
~o~ ~R 232~. -
wos3/o21o~ PCT/US92/06034
2 1 1 o3 S l L.
--95--
To test the efficacy of S~IBR-037 as an inacti~ated IBR
`virus vaccine in protecting susc~ptible calves against
virulent IBR virus challenge, a study was performed
according to the VACCINATION STUDIES IN CALVES WITH
INACTIVATED IBR VIRUS. The following re~ults were
obse~red.
Virus neutralization antibody tîter~ were elicited in
~ animals after the fir~t vaccination (~ae Table 3).
; ~ : 10 Antibody titers were no~:significantly different between
::- animals that received a vaccine dose of 107~3 virus and
:~ animals vaccinated~ with:108 virus. After the 6econd
vaccination, mean antibody titers increa~ed to ~:19 and
i:32, respectively~ for~the 1073 and 108 vaccine
groups. Control:animals rémained seronegative to IBR
virus~throughout the~accination period. Antibody titer~
in both vaccinate~;groups ~howed:an increa~e typica} of an
anamnestic re~ponse after~challenge with virulent IB~
virus. :By 13 day~ po~t:~challenge, ~ean:antib~ody titer~
20: were 1:152:and~ 1-.215~for~the;107-3 and 108 vaccinate
group~ respectively.~In contra~t, mean antibody titers
in challenged control;animals:~were 1:4 at 7:day~ and 1:8
at 13 days po~t~challenge. ~
2~5~ Nasal swabs were~collected:~from:~challenged animal~ to
determine whether vaccination decreased the ti~e of viru~
shedding (Table 4).~:The;~06t;dra~àtic difPerence ~etween
vaccinates and~control~ani~a}~s~was ~b~erved at ~2 day~
po5t~challenge.~ At~thi8~ ti~e,~:seventy-fi~e~:percent of
control animala continue;to ~hed, wherea6, only twenty-
~: fi~e:percent of~ both vàccinate group hed YirU~. virus
: was not isolated~from~control~;or~:vaocinated group5 at 15
: : days post challenge~
"~
,:
:: - ` ~
W(~ 93/0~10~ P~/US~2/06034
. " ~
v~ 96-
Table 3. Genera~on of ~irus neutrali~ng a~tibody Ln animals vaccinated with iIlactivatedS-IBR-037 vaccine.
____
Antibody titer~ on days:
. ,
. Post Va~a~on Post Challenge
Ammal No. _ . _ ~ _
7 21 28 42 7 13
__ _ _ _ . .__ __ _
Controls
.. _ . .__ _
9 s2 s2 52 ~2 4 4
. _ . i~ _ _~ ," _
2~ s2 i2 s2 ~2 4 8
. . _ . ~ . _ . .'
32 S2 S2 S2 s2 4 16
_~ .. . _ .... .. .. .. .
64 s~ . 5~ 52 ~2 4 8 .
_ _ . __ __ .
G~ 52 S2 : 52 ~ s2 4 8
.. ..
Vac~ates
~ dose 10~3
1~---- _- . ~ ,_
1 ~ 8 : 32 64 64 1~8
_ . _ _ ~ ~ . .
: 2 ~ ~32 64 64 256
1. . . ~ . . -- .. . _ ;. . ~ ~ ~
~ ~2 8 ~ ~6 ~ ~4 512
~ :: 1 - - ---- - ~ ~ , _ :
~ 36 S2 ~ 4 16 4 16 232
I ,, . . . . . ~ . ____
: : GMT : s 2 . : ~ 6.7 22.619.0 A534 152.2
1;- .: ~ ~ _ . ~ ~ . . I
~7accmates : :
: : dos~ 108 ~
1~ -- ~:~ ------~
~ ~ I 7 c2 43~ :~ ~ 8 64 ~56
~ . _ ~ _ _ _.~ ~ __ .................................... ~ l
~ 30 ~ ~ 2:~ :~ :28 64 128 128 2~12~
____ _ ~ . : ~ __ __ I
33 : :~ S~ ~ : 16 ~:~ ~: 32: : 128 1~8 ~6
., ~ _ _ ~ . . . .. ,. I
69 s2; ; ~ ~ 16 ~ ~ 1~8 ~56
__ . . . _ . . . __ __
GP~T s2` 6.7 32 32 1~.6 : !153
_ _ _ _ __ ___ _= ..
:
: ~ ~ Statistically greater than controls (p5 0.05)
:: ~Expressed as reaprocal: of dilution.
:
. ..
WO 93/0210~ Pcr/~ls92/o6o3
--9 7 ~
Table 4. Isolation of IBR virus from vacc~ated and anvaccinated control aninlals after
challenge with virulent IBR virus.
_
IBR virus isola~ om animals
Animal No. o~ days post challe~ge
. _ _ ~ l2
_ . _ _
1~ `- -- , ~_ I
1 9 ~ + ~ D l
I_~ . ~ ~ + . . . _ , I
1 32 ~ _ + . - - l
~ , ~_ _ , + I :.
1~ . - . -- ... I
I Vac~ates
¦ dose 10 __ __ .
1 1 ~ + +
: ~~ . + + . ~
~: 11- - .;--~- - -.
36 ~ + _ _
, I . , . ~ ~ _
I Vaccin~tes
I dose 108
I . - _ ~ . . . . . .
1 30 _ .
: ~ I; ~ + ~ _____
. , ~ ,, _ _ ~ ~ . _
69 + ~
______ _____
,
:
wo 93/02104 PC~/US92/V603~ :
~ ~ .13 '~ 9 8 -
J ~ .
Table 5. Vac~nated animals demonstrate reduced clinical si~s of IBR.
_.,
Clinical scores post challenge
_ . ~. . _ _ ,;
Animal No.At~ de8 Ulcersb Serious Mucopumlent TemperatureC :
DischargeC Discharge
, , _ . . . . ..
Con~aols
, _ ~ ~ , _..... _
9 ~ 3 11 5 3
__ :
~2 2 2 12 3 1
_ = ~ . _ , , . _
32 5 3 11 0 4
. ,_ . .. __ .. ; . . .,
~4 6 3 11 1 1
. - . __ ~_ . . . _
G~IS 4.5 2.8: 11.3 23 23
_ _ __ ~
Vac~ates
d~se 1073
- ~ ~ -- . _ _ ___
1 0 2 1 ~ 0
~ " .. . . .. _ ~ ~
0 1 3 0
. . . . _ ~ ~ . . . .
: 25 O : 2 6 2 O
~ __ ~ __ ~
36f 6 ~ 2 : 1 13 0
I . _ _ --- . . . . __
: C;MS 15 1.8 ~ 2.~ 2.3 O
~ ~ - ... _ ~ _......................... , ,.,:: ~ : : Vaccinates
dose 108
~: ~ _ , . ~ ~. , _ _ . _ , _
: 7 1 2 1 0 0
,, .... . ~ _, _
: :~ 3~ 1~ ~ 2 ~ 2 0
:,,~ . __ _ ,
~: 33 12 ~: o ~ 0
__ ~ , , . ... _
69 : 1 : :2 ~ 0 0 0
~ . ,_ __ ___
G~S ~ 1 ~:: 2 : 0.8 :~ 05 0 ~-
_____~_ ___ __. '~':
' Days with depressed attitude.;
b Number o~ulcers.
Dayswitll: seroL~s discharge. ::
d Days with mucopululon~ harge.
Days with ~ 2~ above b~eline tempera~ur~.
f A~imal e~ibited mucopurule~t discharge on the day of challenge a~d for 13 days post challe~ge.
Statisti~allly great than ~trols ~p O.QS)
'
,.
WO 93/02104 PCI/US92/OS03
J~
_~9 ~ . .
Animals were ob~erved dail y for 13 days post challenge
for clinical ~ ; of IBR infec:tion. Clinical disea~e
was evaluated with r~RpQc:t to attitude, the number of
5 ulcers, ext~nt of serious and ~uc:opurulent discharge and
the number of days with elevated t~perature. The
re. ults pr~fiented in Table 5 ~;how that vacc:inated ani~al~;
e~ibited le~ severe di~ea~e than dicl unvaccinated
control animals~ Control ~nimal~ ~howed ~::linical
10 depreesion (n~titude" in ~able 5) for 4.5 days compared
Wit}l 1 to 1. 5 day f or vaccinated ~r~imal~ . The amount
and ext~nt of ~erous diac:harg~ wa~ sub~tantially reduc:ed
in both vaccin~te~ s~oup~ comparQd wi~h con~rolE;. The
extent of mucopurul~nt di#charg~ wa~ also x~duc~d in
15 vaccinated ani~als ,: al~hough to a lee~er degree .
H~wever, vaccinate anim~l ~3 6 did hav~ mucopurulent
d~scharge on the~ day of challeng~ and i~ not t::onsistent
wi~h the results:for o~her vaccinate~. None o~ the
vaccina~ sxhibit~d temperature~ of 22F a~ove baseline.
In contra6t, all control ani~als 2xhibit~d el~at~d
: temperatures of ~2F: over ~a~eline ~nd 2 of 4 control
animals had tempera~ures~o~ 104F and a~ove.
~accination ~f cal~e~ with inactivated 5-IBR-037 vaccine
; 25 pr~otected the animals against ~irulent wild-type IBR
:; ~ vixu~ challenge. ~`Virus ;neutralization titer~ w~re
stati~tically great r ~ in Yaccinatedl than in control
animals.: ~ anamnes~ic response in antibody titer wa~
observed 7 day~ pozt ch311~nge, indicating the
devel~pment of humoral me~ory responBe~ Exc~pt ~or 7
day~ po6t challe~ge, ~n~utralization tit~r between the
107~3 a~d l08~~vaccinate groups were not tati~tically
differen~. Fe~er: vaccinated animals ~hed virulent
challenge viru~; than con~rol animal~i. Th~;e re~ults
35 ~;ugS~es~ t ~rulont IBR viru~ is cl~ared ~ore ~apidly
in vaccirlated than in unvaccinat~d aniDIal~;. Clinical
symptoms of IBR vin~ f ection were al~o r~duced ir~
WO93/02104 P~T/US92/0603~
~ ~ 3 ~
~accinated animals. After challenge, both vaccinate
group~ exhibited fewer days of depre~ed attitude,
reduced serous discharge, and n~ elevated te~perature
compAred with control~. :
S
In order to show that gpG antibody i5 produced in
vaccinated calve~ ~ollowing exposure to wild-type virus,
~erum samples taken:pre- and po8t-exposure to wild-type
viruses were subj~cted to the ELISA a~say. Samples tak~n
at the day of chall~nge and at 13 day6 po~t-challenge
were analyzed. A~ ~een in Table 6, the po6t-challenge
absorbance reading:s: for gpG incresse for each animal
(ratiQ of > 1.0), indi:cating .that within 13 days of
: ~infection a detectable immune respon~e to gpG i~ present.
:,.
.
:
.,: .
-
- . .
~';
::
:: :
WO 93/021û~ PCI/US92/06~3~1
Table 6. Detection of antibody to gpC~ in serum of ~als vaccinated with S-IBR-037
and challenged with wild ~pe.
I
Animal No. R.atio of pre- vs. post challeIlge~
Controls I
,, . ~. I
9 1~2 I
I
22 1~96
~ . ~ , ~ . _ I
32 1.87 l
~_~ ~
64 2.19 l
, _ _
Vac~tes do~e :
1073
~ , , , ~ . l
2U 1.4() ::~
1--- Z; ~ ~.
36 1.18
: ~ ...................... , - :. .. , .
Vaccin~tes dose
: : 108 ' ; ,:-
~ ~ --~ i
: ~
30 ` :1.29
;~ 33 152 ~;
69 ~
___ _ ::,
~ : - :
Animals were ~hsllellged ~ ~ PFU of wild ~ipe IBR~s. ~e~halleDge serum
~om day:of challenge, post~challenge scrum from 13 days post challe~ge. Data reflects
the average of ~he ratio of absorba~e re~Aings for three independent ELISA
~: ~ determina~oDs.
. .
::.~
:." .
WO93/0210~ PCT/US92/lK0~
~ ?~& ~ 1 -102-
;-
~x~mPle 10 .
-IR~-0~
s
5-IBR-038 is an IBR virus that ha~ two deletions in ~he
short unique region of the genome. The first deletion i~
approxi~ately 2500 ba~ pair~ and be~ins in the ~i~dIII
K fragm~nt approximately 1750 ba~e pair~ downstream of
the~ HindIII O/~indIII K junction and extends back through
t:hat junction. This deletion remove~ the US2 gene. The
second deletion i~ approximately 294 base pair~ and
~egins in the ~indIII K fragment approximately 3900 base
pairs ~ ;tream of the ~indIII K/~rindIII O junction and
15 extend~; back toward that junction. This deletion relaoYe~
amino acids 261 to 359 of the gpG gen~
.
S IBR-038 r~ulted from the removal of the.marker gene
. .
from S-IBR-0~5 (~e abo~e). Thi~ wa~ acco~pli~hed by ~
20 digestion of S-IBR-035 with XbaI a6 d~crib~d in the .~:
: DIRECT LIGATION PROCED ~ FOR GENERATING REC~MBI~TAMT
HERPES~IRUS. The structure of S-IBR-035 wa~ confirm~d by
restriction enzyme~analy~is with ~indI~I, Bam~X and XbaI.
''
:
-
:~
WO 93/02104 PCr/lJS92/~)603
--103--
Examle 11
GlycQ~Q~ein E ~ne
5 Deletion of the PRV gI gene has b~en shown to be valuablebc~th as an attenuating lesion and a r~egative ~erological
marker ( 3 ~ 4 2 ), In the studiQ~ described below w~ show
that the uni~ue ~hor~ region of IBV viru~ ::ontain~ a gene
ho~ologous to the gI gene of PRV.
The ~;equence of 2038 base pairs of t~e IBR unls~ue short
regio~, ~tartins3 approximat~ly 1325 ba~e pairs upstrea~
of the ~rindIII K/HindIII F junction in the ~naIII ~C
fr~g~ent wa~ deter~ined. Thie r~gion w~ found ko
15 contain an ORF codins~ ~or 617 amino acilds t~an~lated in
the direc~ion away from ~e ~indIII KJllindIII O junc~ion
~s~s~ Figur~ l) . Th~ ORF i6 79~ 596 ~;~C and ~nc:od~: a
prot~in wi th a predicted molecular w~ight of
approximately 88,~80. C~mpariEon o~ ~e ~equence of th~
20 predicted protein with ~x;eq~len~es o~ g~ e product~ o~ HSV-
1, VZV, and PRV in th~ unique hort regiorl indicalted that
this ORF is homologous to the herpe~virus gp~ g~ne ( see
Fis~ur2 16).
~', '
25 The DNA ~ncoding the gpE g~ne has been clon~d in two
plasmids, PSY1644 and PSY164S. The a~aino terminal ha~ f
cf the gene ~encoding ~amino acid~ 276) was cloned as ~n
approximately 2300 ba6~æ pair ~ra~eni: re~ulting from a
partial S~aI dige~t~ of wIld ~ type S-IBR-000 (Cooper
30 Strain) DNA. This fra~ent waæ inserted into the plas~id
psP6~a to yield PSY1644. Thi~s pl2~s~idt designated
PSY1644, was depo5ited on: July 16, 1991 p~suarlt to th~
BUdaP2~;t Tr~atY On ~the ~ InternatiOna1 DePOSit O~
MiCrO~gani8~ fOr the Purp~eS O Patent PrOC~dUre With
35 the Patent Culture ~@PO~itOrY Of the A~eric:an Typ~
Culture CO11~CtiOn, 12301 Par1C1aWn DriVe~ ROC:k~i11e~
~arY1and 2U~52 IJ. S.A. under AT~C ACC~8~iOn ND. 68651.
WO 93/0210~ PCl/US92/0~03
4-
The carboxyl-terminal half of t~e gene (encoding amino
acids 277-617 ) was cloned as an approximately 2400 ba~;e
pair SmaI f ragment . The f ragment was inserted into the
placmid pSP64 to yield PSY1645. This plasmid, designated
S PSY16~a5, wa~ deposited on July 16, 1991 pursuant to the
Budape~t Treaty on the International Deposit of
Microorgani~m~ f or the PlLrpO8e~; of Patent Procedure with
the Patent Culture Depository of the American ~e
Culture Coll~ction, 12301 Parklawn Drive, P~ockville,
Maryland 20852 U.S.A. under ATCC Acce~sion No. 68650.
Thes~ pla~mids may be u23ed to confirm th~ ~equence of the
gpE g~ne.
. .
~:'
.
':
' `'':
,
;~
.
WO93/021~ PCT/US92/06034
2.~.. .1 .~ ; 1
-105-
~e~z
PseudQr~kiçs vL~Us expressin~ la~_Yi~Y~ g._
A pseudorabies virus analogous to S-PRV-160 may be
con~tructed for the purpo~e of expres ing the IBR virus
gpE. Thi~ may be accompli~hed by in~erting the gene
: coding for IBR virus gpE into S-PRV-00~ (U.S. Patent No.
4~877,737)~
Such an expre~sion vector may be con~tructed utilizing
the IBR viru~ gpE pla~mid~ describ4d in the methods
section, p~eudorabies virus S-PRV-002 and the re6triction
.
enzyme XbaI in the: DIRECT LIGATION PROCEDURE FOR
GENER~TING RECOMBINANT~HERPESVIRUS. Viruses re~ulting
fro~ this procedure ~ y be ~cr~ned by dige~tion with
:: ~ XbaI for~the presence o~ the Xb~I band containing the IBR
~ virus gpE gene.
..
,
20~ Thè gpE protein expreg~ed from thic vee-or may be u~ed as
an antigen to identi~y antibodies direeted against the
~ wild:t:ype virus a~ oppo ed to antibodie~ direeted against
: gpE deleted viruæes. This~virus may also be utilized as
an antigen for the~production of gpE ~pecifie mo~oclonal
:~ antibodie~. ; Sùeh antibodies are u eful in the
development of diagnostie te~ts sp¢eifie for the gpE
protein.~ Monoclonal~a~tibodie ~may be generated in ~iee
:~ ~ utilizing; ~thi6~ viru~ ~aeeording to the PROCEDURE FOR
: GENERATING ~ONOCLOUAL ANTIBODIES.
~ ~
WO93/0210~ ~ ~ PCr/lJS92/060
,iq~i~t; ~
... .
--106--
~LQ~ ' ' -
G1YCOX:~rC)~ein E deleted I~R vir~sçs
The HOMOL~GY VECTOR 536-03.5 Wa~ U5~d tO generate VariOUS
gpE-deleted IBR viru&es. Utilizing the general ~;trategy
descr~bed in CONSTRUCTIO~J OF DELETION VIRUSES, a gpE .
deletion o~ approximately 1410 ba~e pair~ ( a~ino acid~
77-547) was introduced ~nto two dif:Eerent IBR viru~
backbonea, S-IBR-~00 ~ Cooper Strain) and S-IBR-037 . The
~rirus resulting from t:he S-I~R-000 par~nt c:ontains the
gpE del~tion alone. The YirU~; resulting fro~ the S-IBR-
037 parent cs:~ntains the gpE ~e}etion in coniunction with
the US2 and s~pG deletionE;. The lacZ D~arkcr gene may be :
remc~v~æd from the~e viru~e utilizing the procedure~
outlined in ~ ~e~ods section.
,~
The~;e gpE~deleted viruse~ are of gre~at Yalue a~ IBR
vac:cine~. Th~ir co~ination of dif~er~nt d~letion~ will
: Z0 ~ provide the varying: degr~c~ o~; attenuation w~ h are
re~ired for a superior vaccirle. The$e viruses will also :
,
~provide a negative ~serological marker which ~ay be used
to distinguish vaccinated from infected animals. The
~rirus containing both gpG and~ gpE dsletions should be of
even greater value ~y having two negative marker~. ~he
a~railability o f two~:negative marker~ permits s~ae ~aarker ;~
to~be u~;ed a~5 a, con~irmatory te!;tr ~greatly inc:rea~ing the
reliability of such a: diagno~;tic dete~nination.
~ .
.',.':.
: .
: ::
: ~
WO 93/0210~ P~r/US92/060~
--10 7 ~ L
Exa~e ~4
S--IBR-004
s
S-IBR-004 i~ an IBR recombinant viru~ carrying an
inserted foreign gene, Tn5 NEO (aminoglycoside 3 ~-
phscphotran fera~) gene, under the control of the
pseudorabies virus (PRV) glycoprotein X promoter.
To con6truct this YirUS , the HindIII K DPIA fragment from
wild type IBR virus: wa~ clon~d into the pla~mid pSP64 at
the HindIII ~ite. This plasmid wa~ dasigna~ed pSY524 .
P. map o~ th~ HindI~I~ K fragment is ~hown in Figure l9.
15 The DNA from the ~oI site to the HindIII ~ite and
containing: the NdeI ~ Bit~e fro~ pSY524 wa~ cloned into
; . .
:~ :` plasmid pSP65 ~nd~ ~ called pSY846. The NdeI to EcoRI
f ragment waR re~ao~ed ~ fr~m pSY846 ~ by digestion with NdeI
and EcoRI :restriction ~enzymQ 1 folIowad by PO~ERASE
: 20 ~ F:CI,L-XN ~E:A~rION and LIGATION. : The re~ulting pla mid wa~
alled pSY862. ~ The plaFmid pNEO (P.L. Biochemicals;
: ~ Inc.) contains the aminoglyco~ide 3:'-pho photran~era~E~e
(NEo; gene and confer~ registance to ampicillin and
neomycin on E. c~ol~ host~. ~ The ~co~ing region of thi8
ene~ ~:BglII-Bam~ fragment) waE isolat~d and cloned
between the PR~ ~ gpX ~: pro~oter and the HSV-T~ poly A
sequence~ in a plasmid called pSY845.
The ~EO ~ene~ cons~ruct: ~ in pSY845 wa~ exci~d with
30 HindIII, ~ade blunt ende~ by the P~LY~SE PILL-IN
REACTTO~, : and clo~ed: ~ ~ :into the SacI ~it~: of plac~id
pSY862~. The final product ~was~ called p5Y868.
Wild t:ype IBR D~A w~s ~D~ixed with pSY868 DNA and the
35 mix~ure ~a tr~nsfected into ral:hi~ ~kin cell~; to
generate re~:o~binant IBR. Th~ r~cc~ina~t IBR ~irus
carrying a functional ~N~50 gene was then isolated and
W093/02104 ,~ PCT/US92/06034
,,9~ ,t ~ 9 ~
-108-
purified according t~ the SELECTION OF G418 RESISTANT IBR
VIRUS method.
S-IBR-004 recombinant IBR was sh~wn to expre~s the NEO
gene by the fact that cells infected with thi6 virus were
resi~tant to the toxicity of G418. A detailed ~ap of the
plasmid construction is shown in Figure 19. The
~tructure of S-IBR-004 i6 al~o ~hown in Figure 19. S-
IBR-004 wa~ depo~ited on May 23, 1986 pur~uant to the
Budapest Treaty on the :International Depo~it of
- ~ Microorganism~ for the Purposes of Patent Procedure with
the Patent Culture Depository of the Xmerican Type
Cu~ture Collection, 12301 Parkl~wn Drive, Roakville~
Maryland 208~52~U.:5.A~. under~ATCC Accession N~. VR 2134.
:~ : . ,,
:: : : :
: : : :
:: :
::
WO 93/1~210~ PCr/VS92/060~s~
2 ~ ; . J
--lO9o
;E:xa~le 15
S~ OO~
S S-IBR-008 is an IBR viru~; ~hat has a deletion in the
short unique region, and an in~ertion oï t:he bovine
rotaviru~; glycoprotein 38 (gp38) gene in ~hs Xb I ~ite in
the long lanigue region.
10 The bovine rota~rus gp38 gene wa~ cloned utilizing the
MET~IOD FOR cDNA CLONING B~VIN13 ROTAVI~US gp38 GENE. The
bovine rotaviru~ gp38 ge~n3 was t:hen engin~ered to contain
herpesvirus regulatory ~;ignal~ ~; shown in Fi~ure 20.
This was accompli~;hed by cloning the gp3~ gene Ba~II
lS fragment contained in pSYl053 between the Bam~I and BglII
si~es in pSYlO5Z. The re~ulting pl~mid, pSYl023,
contain~d th~ PRV gpX promoter in front of the ~p3~ gene,
and ~e HSV~ polyad~nylation sign~l behind the gp38
ge~e. The entire construct was flank~d by XbsI ~3ites to
: ~ :; 20 allow for the insertic~n of the Xl~aI fra~Fment inlto :I:BR by
direct ligation~
: ~
S-IBR-004 was the starting virus for the generation of S-
IBR-008. S-IBR-004 DNA: and: pSYlO23 DtJA were mixed
25 togeth~r, c:ut with~XbaI, and tr~nsf~ctl3d in~o r~bbit ~kin
~: celll;: acc:Qrding ::to: the DI~ECT LIGATION PROCEDI~RE FOR
:: .
: G;ENERATING RECONBINA~T: HERPESVIRUS~. The tran~;ection
~tcck wa~ ~cre~n~d for res::ombinarlt ~i~u~ by the ANTIBOOY
:
SCREE:N FOR RE:CO~INANq' :HERPESVI~US procedure u~ing
30 antibodi~; prepared agaln~t the rotavirus gp3B prot~in~
~; ~ one of ~the viruf~es purified by:this E;creen wæs ~;~IBR-008,
which ha~; the following characteristicc. It e:ontain~; the
rota~riruE; gp38 gene plu~ the pla~ 3)NA in~erted into
35 the X~aI site in ~ *~e~ long unique r~gion of ~h~ viru~
genome, but no longer ~ aontain the NEO gQne o:E par~nt S
IB~-004 in the lmique hort region. In fa~t, a ~mall :~:
', ~
W093/02104 PCT/US~2/0603~
~ 3~J ;t ~ .
L . 1 1 0
deletion was created in the unique short region at the
location of the NEO gene, as evidenced by the absence of
an XbaI site at this location in S-IBR-008.
~:
S S-IBR-008 was shown to be expre~ing the rotavirus gp38
gene by analysis of RNA transcription in infected cells,
: and by the ANTIBODY SCREEN FOR RECOMBINANT HERPESVIRUS ~:
procedure using antibodies specific for the gp38 gene.
S-IBR-008 was deposited on June~l8, 1986 pursuant to the
Budape~t Tr~aty~ on the International Deposit of
:~ Microorganisms for~:the~Purpo~e~ o~ Patent Procedure with
the Patent Culture Depository of the American Type ~ -
Culture Collection, ~12301~ Parklawn Drive, Rockville, ~;
Maryland :20852;; U.S~.A.~:under ATCC Accession No. VR 2141.
The structure of S-IBR-008 i~ sh~wn in Figure 20. ;:
: ~: ,
:: : :
WO 93/02104 PCr/VS92/0603~
2 ~
~X~
S--I~R--0l8
S S-IBP~-018 is an IBR virus that hag three f oreign gene~;
inserted: the E~.CD~i beta-galacto~ida~;e gene and the
neomycin re~istance gene in the XbaI sit2 in the unique
lon$~ region, and the parain~lu~nza type 3 (PI-3 ) viru~
hemagglutinin gene tHN) in the h'indIII ~ite in the urlique
10 long r~gi~n immediately adjacent to the XbaI ~ite.
For clonins~ the PI-3 ~N gene, the S~-4 ~train of PI-3 was
grown in MADIN-DARBY bovine kidney (NDBK3 cell~ in
culture and ~NA was extracted fro~ in~Eect~d cell~. The
15 RNA wa~ u~d in a reYerl3e transcription protocol a~;
outlined in ~e cDNA~ CI-ONING proc~dure 118ing poly-dT a~
pri~er for r~verRe transcxipta~e. Prom thi~ procedure,
.
a series o} clone~ w~s obtained that compri~d parts~ o~
the geno~e o~ the PI-3 ~irus. The loc:a~ion of the gene
~20 for the hu~an PI 3 H~l gane ha~ n pu~ hed ~25,26) and
thi~ ~ nforma1;ion wa~ u~ed ~u locate the gen~ in
,
~applicant ' bo~ine PI-3 cl~ne~. ~ The entire Op~tl reading
f ra~e of the ~ bovine PI-3 HN gene was 6~ss~uenced by
. applicants and is given in Figurc 21.
The HSV ICP4 pr~not~r wa~ used to expre~g the PI-3 HN
gene and the HSV~ poly-A ~ignal wa~ used to terminate
transcription. ~The~ en~ineerirlg of thi~ construct wa~
done~ as hown; in~ Figure:; 22 A arld B. The conC~rlact
c:onta~rled (5' t~ 3'~ the HSV ICP4 proter, the IC:P4 TATA
box, the ICP4 cap site, a: fusion wit:hin ~the IP4 5'
untranslated ~rs~ion to :the PI-3 HP8 s~ene at th~ ~hal ~;ite,
the HN ~ene ~tart codon, the HN structural gene, th~a HN
s~op:codon, ~ fusion within the ~N 3' untranF~t~d r~gion
ko the HSV q~ u~tran~lated 3' region, and ~ the ~st.r TK
. , .
poly A ~ignal ~;equence.: ~
, : :
: ,
-
.:
:. ~
WO93/0210~ PCT/U~92/0603
~ ~ -112-
Thi~ plasmid also contained the ~eta-galacto~ida~e (lacZ)
gene under the control of the PRV gpX promoter with the
gpX poly-A termination signal, as well as the neomycin
resistance gene under the control of the gpX p~omoter
with the TK poly-A termination signal. The~e latter two
genes were cloned in tandem at the XbaI s~te in BamHI-C
fragment (Figure 22 A and B). rhis BamHI-C ~ragment ~;~
contained the ho~nology region~ for u~e in the DNA
TRANSFECTION FOR GENERATING RECOMBINANT VIRUS procedure.
After the trans~ection step in the proaedure, the
resulting recombinant viru~ from the tran~f~ction stock
wa~ selected fo~ by the SELECTION OF G418 ~ SISTANT IBR
VIRUS procedure, followed by the B~UOGAI~ SCREEN FOR
RECOMBINANT HERPESVIRUS procedure t and subsequently
analyzed for the insertion of the PI-3 HN gene by the
SOVTH~RN ~LOTTING OF DNA: procedure. The viru that
~:~ resulted from this screening was~designated S-IBR-018.
~ S-IBR-018~was depo~it~d on July 21, 1987 pursuant to the
: 20 Budapest Treaty~:on the International Deposit of
Microorgani6ms ~or~the Purpo8e8 of Patent Pracedure with
; the Patent :Culture Depository of the American Type
Culture Col~lection, 12301~ Parklawn Drive, Rockville,
; : Maryland~ Z0852 U.S.A. under ATCC Accession No. VR 2180.
25~:: The structure of~S-IBR-018 is hown in Figure 22 C.
: ~
~; .:~
~ .
.
,,,~
: ,.,:,,
W~93/0210~ PCT/VS92/06034
,J ~_v ;,, ~5
-113- ~:
E~a~Ple~
" .
S~ 019
S S-IBR-019 is an IBR virus that has three foreign genes ::
inserted: the ~ beta-galactosidase (lacZ) gene and
the neo~ycin r~istance gene in the Xb~I 8it2 in the
unique }ong region, and the parainfluenza ~ype 3 (PI 3)
virus fusio~ gene (F) in the ~indIII site in the lo~g
unique reqion adjacent to the XbaI ~ite.
For cloning the PI-3 F g~ne, the SF-4 ~train of PI-3 wa~
grown i~ ~DBX c~lls in culture and RNA waC ex*r~cted fro~
infected cell~. The RNA wa~ us~d in a r~verse
transcription protocol a~ outlined in ~he cDNA C~VNI~G
proced ~ e using poly-dT as pri~er ~or re~er~e
~ transcripta.e. Fro~ this:procedurs, a ~rie~ of clon~
: was obtained:that~ comprised parts of th~ geno2e of the
PI 3 viru~. ~he lo~ation of ~ e gene ~or the Sendai
virus F g~e hæ8 b~n published (27) and ~hi~ co~parative
sequence informa~ion was used to l~cat~ t~e ho~ologou~
gene in applinants' bovin~ ~PI-3 c}ones.
: The HSV alpha-4 promoter was u~ed to e~press ~he PI-3 F
gene and th~ HSV TK~poly-A signal was u~e~ to t~rminate
transcripti~n.:~ The~construct contained (5~ to 3') the
: : : HSV alpha-4 p~omoter, the alpha-4 T~TA box, th~ alpha-4
cap ite,~fusion in~he alph2-4 5' untran~lat~d region
to ~he PI-3 F g@n~, ~h~F:~tart codon, th~::F structural
30 gene,!t~e F stop codon,~a fusion in the ~ 3' untran~lat~d ~;~
region to the HSV TR 3:' untranslated r~gion, and th~ Tg ~;
~` :poly-~ s~gnal ~equence~
This plasmid also~contained the b~ta-g~lacto~idase (lacZ)
:
35: gene under ~he a~ntrol of the PRY gpX pr~moter wi~ the :: :
gpX poly-A termination signal, a~ well ~R ~he n~omycin
resi~tanae gene under the control o~ the gpX promGter
~ ':
WO93/02104 PCT/US92/0603~
" ~
th the TK poly-A te~mination signal~ The=e latter two
genes were cloned in tandem at the XbaI site in BamHI-C
fragment (Figure 23 A and B). This BamHI-C fragment
contained the homology region~ for use in the DNA
S ~ SFECTION FOR GENERATING XECOMBINANT VIRUS procedure~
After the tran~fection ~tep in the procedure, the
re~ulting rec~binant virus from the tran#f~ction ~tock
was selected for by the SELECTION OF G418 RESISTANT
HERPESVIRUS procedure, followed by the BLU~GAL SCREEN
FOR R~COMBINANT HERPESVXR~S procedure, a~d subsequently
analyzed for the insertion of the PI-3 F gene by SOUTHERN
BLO ~ ING OF DNA proc duxe. The viru~ that re~ulted from
this screenin~ was de8ignated S-IBR-0l9.
T~e structure of S-IBR-Ol9 is shown in Figure ~3 C.
, ~
:
.
. . .
: ~.
.
~.,
: . ' ;~ ':
~.,~,,
WO 93/021~)4 Pcr/us92/060~4 ~
-115- 2 1 ~ ~q ~
xan~ 18
S--IB~03 2
S S-IBR-û32 is an IBR virus that has two foreign genes
in~erted: the Escherichia c:oli beta-galac:tosidase (lacZ)
gene with the bovine viral diarrhea viru~; (B~JDV) ~53
gene fused to the lacZ C-kexminus and in~;erted in the
long unique region at the XbaI r@striction endonuclea~;e
site~.
. .
For cloning the BVDV gp53 g~ne, the Singer ~train of B~DV
was gr3wn in MADII~-DARBY bovine kidn~y (~DBK) c~ ; in
culture and t:he RNA wa~; ~xtracted f ~om in~ected cells .
The RNA wa~; used in a rever~e transcripta~e proce;dure 3~
outlin~d in the cDN~ CLONIN~; procedure us~ng random
pri~ner f~r r~v~ær~;e tran~c:riptase. Fro~ thi~ procedur~,
a slarie~; of clones ~wa~ obtained ~hat c~pri#~d part~; of
the genome! o~ BVIDV. The location c~f ~ne g~n~ 'f or BV~V
~p53 ha~; been publi5hed (66 j and thi~ comparative
sequence inf or~ation wa~ used to locate the h~mologous
gene in the appliGant ~ s BVDV clones .
~: .
The PRV gpX promoter was~ u~ed to expr~; lat:Z with a
region of BVDV gp53 fusedl to the C-te~ninus, and the PRV
poly-A signal was ~us~d to terminate transcription. P~
,
plasmid :construs::t was ~engin~ered thzlt con~ain~d ~5' to
3 ' ) the PRY ç~pX pro~ot~r: ~nd then ~ coding re~i0n
consisting o~ ino a~cid codons~1-7 of t~he PRV gpX gene,
lO 1024 o~ E:~cherichi~ coli: lacZ gene~ and 6~4-758 o
the BVDV ~ajor open reading ~ra~e, and t:he PRV poly-A
s~quenc:e. This :lacZ ~ ~fu~ion gerle c:zas~l2tte ~ra then
ex~ ed f rQm the plasDid ~ vector at 'che f lanking XbaI
sit:es and cloned into the unique XbaI ~;it~ ~ n IBR-002
using the in ritro ligation ~et;hod de~ ri~d in
CONSqrRUC:TION OF DELETION VIRUSI:S. A~t~r the tran~;fection
step in DNA l~NSFE~TION FOR GENERAT:I:NG RECO~INANT VIRU5
,
", ~ ~r~
WO 93/02101 PCl/US92/0603~1
,~ b. ~ --116--
~cédure, the re~:ulting recombinant virus was -creened
and isolated f rom the tran~;f ection stock u ing the
BLUOGAL SCREEN FOR RECQMBINANT HERPESVIRUS procedure,
and subE;equently analyzed f or the insertion of the B~)V
S gp53 region by SOUTHERN BLOTTIN~; OF DNA procedure. The
virlls that re~;ulted from this screening was designated S-
IBR-032
,
:'''.
~:
.
.,.:
''"',
Wo 93/02104 Pcr/US92/06034
--117--
Exa~
S-IBR-03 9
S-IB~ 039 is an IBR ~ hat has three dele~ions in the
short uniqu~ region of the genome. The first deletion i~;
approximat~ly 2500 ba~e pair~ and begin~ in the ~indIXI
K fragment approximately 1759 ba~e pair~ down~trea~ c~
the ~ II O/~ndIII K junction and extsnd6 back thrc~ugh
that junction~ This d~letion ~emoves the US2 gen~. The
second deletion i~ approximately 1230 base pair~; and
begins in the ~indIII K fragm~nt approaci~eately 3gO0 ba~e
pairs d~wn stream of the ~ndIII Ot~ind X ~unction and
exte3~ds back t~ward that junction. Thi~ d~l~tis~n r~moves
lS a~nino acid~ 1 to 36~1~ of the gpG g~ne. ~he third deletion
is approximately 1410 ba~e pairs and remov~ o acids
77-547 o~ the gpE gene.
S-IBR-039 was derived fr~ S-IBR-037. This wa
accompli~hed util~zin~ the homology vector 536-03~5 (~:ee
~TE~IALS AND ME:TliODS~: and v rus S-IBR-037 in the
HOMOLOGOUS RECOMBINATION P~OCEDURE ~OR $~N~ATING
RECOMBINANT HERPESVIRUS . The transf ecticl~n stoc:k wa~
screened by the ~ SCREEN ~ FOR REC~2~BINANT H~PES~RUS
~: 25 EX~RES~ING EN~YNATIC ~ARKER GENES~ The r~;ult of 3:~1ue
plaque puri~ication wa~ the reco~binant viru~ d~i;ignat~d
S-IBR-039. This ;viru~ wa~ haraoterized by re~ ria~ion
mappinSI :and the ~SOUTHERN BLOq~ING DN~ proc~dur~
analy~is confirmed;the~ insertion of th~ B-galacto~;ida~e
(lacZ) ~ark~r ~en~ and the deletion of approxi~aa~ely 1230
bas~ pair of the :gpG ~eneD It was al~o c:onfir~ed that
an approyiDl:a~ely~ 1410~ base ~pair :del~ion has occurr@d in
the regibn of th~ gpE gene ~sèe above). Thi~ Yinl~E; will
b~ useful as ~ vaccine to protect cattle fro~ inf~ction
with IBR v~ Th~ deletions o~ the glycoprot~ins G and
E gene~ ~rom this VirUfi al80 prc~Yide~; ~0 ~legat:iYe
,~
,
WO 93/~)21~ PCr/lJS92/0603~
IJ ~ 118--
serological ~arkers for differentiating it frc7m wild type - .
IBR .
: : ~
" ~,:
.
, :.
,... :,,
: ~ ' ',,'",~
, ': .
.,''
~:
WO 93/02 1 04 PCI /VS92/06034
~' 13~
--119--
~:x~mPle 2 0
S-IB~4 5
S-IBR-045, a recombinant IBR viru~ with deletion~ in the
Tk, US2, gpG and gpE gen~6 may be con~truc:t~d in the
foll~wing manner. SoI13R-~45 would be derived frc~m S-IBR-
039 (see example 19) through the con~truction of twc
intermediate viru8e~ . Th~ f ir~;t intermediate <rirus, S-
II3R-û43, would be corlstn3cted utilizing the h~mology
vec:tor 591-~16.12 (~ee ~TERI~LS AND ~hT}IODS) and virus S-
IBR-039 in the HO~O~GOUS RECOMBINATION PROCEDI)RE FOR
GENERP~TING 2~3COMBIIU~NT HERPESVIRUS . The tran~f 2ction
stock would be #creened by ~e SCREEN FOR }U~CO~qBINANT
HER~?ESVIRIJS EXPRESSING ENZ~TIC ~R~R GENES for a white
plaque rec~abinant Yirll8 (uidA sub~trat~). The r~;ulting
virug would have deIetion of the Tk, llS2, gpG arld gpE:
gene~ and in~ertiorl o~ lacZ g~ne in the gB g~ns~ d~l~tican~
Fir~ally, S-IBR-045 would be con~t~u~ted, utilizing the
homologyvèc:tor 523~78.72 (~e~ ERIAL8AND~ODS) and
virus S-lBR-044 in ~e HOMOLOGOUS REC~5BINATION PRl:3CEDURE
FOR GENERATING RECONBIN~ HERPESYIR~S. The ~ran~fec:tion
~;: stock would be scr~ned by the ~;CREEN: FOR RECO~qBINANT
HERPESVIRUS E~RESSING ENZ~L~TIC ~5ARKER GENES for a white
plaque r~eombirlant virus ( lacZ ~ub trate3: ,. This virus
.
will be usef:ul as a vaccine~ to pxotect cattle fro~
infectiun ~with I~. ~ The co~bination of deletion; will
provide t~e appr~priate attealuatiorl which i~ required for ::
.
a s~ erior ~ as:ci~e. Thi~ virus will al~o provides ~wo ~:
negative ~erologioaI markers ~hich ~ay be las~d to ~-
distingllish vaccinated from infected animal~, The
availability of two negatlv¢ ma~k~r~ permits one marker : -
to be u~ed a~ a confirD~atory ts t, gr~atly irlcrQaSing the
relia~ility of ~uc~ a diagno~tic detç!r2ni~ation.
: ::
-:
WO93/02104 PCT~US92~0603~
? ~ 120-
~ .
S-IBR-Q~6
S-IBR-046, a recombinant IBR viru~ with deletion~ in the
Tk, US2, gpG and gpE gene~ and ~he bovine viral diarrhea
viru~ gp53 gene inserted in place of the gpE g~ne, may be
con~tructed in the following manner. SDIBR-0~6 would be
deri~ed from S-IBR-044 (~-e example 2Q~. It would be
constructed utilizing the homology vector 523-78.72, into
which the bovine ~iral diarrhea viru~ gp53 gene has been
insertea, and ~iru~ S-IBR-044 in ~he HOMOLOGOUS
RECONBINA~ION PROCEDURE FOR G~NERATING RECOMBINANT
HERPESVIRUS. Note that ~ e bovine diarrhea virus gene
would be cloned~using t-chnique~ desGribed in the methods
section. The gp53 gene would:be placed under the control
of the HCMV immediate early~pro~oter. The transfection
stock would be scre~ned by the;~SCREEN FOR RECOMBINANT
: HERPESVIRUS EXPRESSING:ENZ~YMATIC~HARXER GENES for a white
: plaque recombinant virus (lacZ sub~trate)~ Thi~ viru~
~:~ 20 will be u e~ul a~ a vaccine to protect cattle from
in~ection with IBR~virus and~bovine viral diarrhea viru~
.:
:, ~
. ...
Y~O 93/02104 PCr/US92/060~s~
~m~
~=~=~
S S-IBR-047, a recombinant IBR virus with sleletions in the
Tk, US2, gpG and gpE genes and the parainf luenza type 3
ger~es for hemagglutinin and fusion protein in~erted in
place of the gpl3 gene may be constructed in the foll~wing ~:
~anrler . S-IBR-047 would be deriv~d from S-IBR-044 ( see
10 exa~ple 20). It wou1d be constructed utilizing the
homo1Ogy vector 523-78.72, into which the parainf1uenza
type 3 virs hemagg1utinin and fu~ion gene~ haz been
ins~rted, and viru6 S-IBR-~44 in the ~OMOLOGOUS
RECOMBINATION P~OCEDURE FOR: GENERATING RECOMBINANT
,. .
15 H~3RPESVI~US . Note ~a~ the parail~f 1uenza type 3 ~rirus
gen~s would be clOned u~ g t~chniqu~s de~crib~d in the
method~ s~ction~ ~ T h~ transfe~ion ~;toa}c would be
screened by the SCREE:N : FOR Rl:COMBI~ ER~ESVIRUS
EXPRl!:SSING ENZ~IC ~ ER GENES f or a white plaque
20 reco~ ant virus (lacZ~ sub~trate) . This viru will be
u~eful as a vaccine to prot~ct cattle from in~ec~ion with
R vlru~ ;!md parain~lu~nzl~ type 3 virus.
, ~ ~
- :
,
: ~ .
:
: - ~
, ,
:
WO 93/02~04 P~/US92/06~)3~
? ~ 3~
J ' ' --1 2 2--
Examp1e ~ 3
S-IBR.-04 9
S S-IBR-04 9, a recombinant IBR viru~; with de1etions in the
Tk, US2, gpG and gpE genes and the bo~rine respiratory
~;yncytia1 Vinl& genes :Eor the attachment, nu~ eocapsid
and fu~ion proteins in~erted in plac~ of lthe gp:l3 gene may
be construc:ted in the following ~anner. S-IBR-049 would
be derived froD~ S-IBR--044 ~e exa~ple 20). Xt wou1d be
construated utilizing the homol~ vector 523-7~.72, into
which the bovine respiratory sync~tial viru8 atta;:h~ent
nucleocap~id and fu~ion gene~ had been in~ert:ed and virus
S-IBR-044 in the HO~OLOGOUS RECOMBIN~TION PROCEDUR~ FOR
15 GENERATING ~COMBINANT HERPESVIRUS. ~3ol:e that the bovine
re~;pira~ory ~c~ial 'Vinl8 gene~ would ~:>e cloned u~3ing
technigues desc:ribed in the 31lethod~ fiec~ion. The
atta~hment prc~t~in g~ne would be placed under the conl:rol
~ o~ ~he HC~qV i~diate ~arly promoter and t:he ~usion and
20 nucleocap .id protein: gerle~ would be placed lander the PRV
gpX promoter . The transf ection ~tock would be ~;cr~sned
by the SCREEN FOR RECO~INANq ~ERPESVI~US I5XPRESSING
~: ENZ~ATIC MARKER GENES for a~ white pla51ue recombinant
virus (lacZ sub~trate~) . This Yirus will b~ u~eful as a
25 vacc:ine to prot~act~ cattle frc:~m in~ectiorl with IBR virus
and bovine respiratory syncytial.
:
WO93/021~4 PCT/US92/06034
2~. 13~i~t 1
-123-
~h~
:
S S-IBR-051, a recombinant IBR viru~ with deletions in the
Tk, US2, gpG and ypE g~ne~ and the Pasteurell~ ~ :
haemolytica genes for the leukotoxin and iron regulated
outer membrane protein~ in~erted in place ~f the gpE
gene, ~ay be cnnstructed in the following mannerO S-I~R-
051 would be derived from S-IBR-~44 (see example 20). It ;
would be con~tructed utiliæing the homology vector 523- :
78.72, into whi~h the Pasteur~lla ha~molytica leukotoxin
and iron regulated outer m~brane prot~in gen~s had b~en ~
inserted~ and ~irus S-IBR-044 :in the HOMOLOGOUS .
15 RECOMBINATION PROCEDURE :FOR GEN ~ TING RECOMBIN~NT :
HE~PESVIRUS~ Note that the P~t~Ur~llR haemolytica genefi
would be cloned using the t~chniques d~cribQd in the
~2thods s~ction. The leukotoxin;gene would be placed :
. .
und~r the control of t he HCIIV iDediate early promoter
:~ 20 and the iron regulated outer meDlbrane protein genes would
be placed under the P~V ~ pron~oter. ~he t~an~fec:tion
:stock would be~ screened~ :by the~ SCREEN FOR RECOMBINANT ~;
HE~PESVIRUS EXPRESSING ENZYMATIC ~RKE~a ~NES for a white
plaque recombinant virus (lacZ substrate);. Thi6 Vi~U ::
will ~ useful as~ a vaccine~ to ~protect cattle from
infection with IBR~ ~rirus :and Pasteurella ha~molytic:a.
. ~
`
.:
-
WO93/02104 PC~tUS92/~6034
124-
Exam~le 25
Shi~inq Fever vaçcia~ :
S Shipping fever or bovine respiratory dis~ase ~BRD)
complax is manif~ted a~ a result of a combination of
i~ectioufi disease~ of cattle and additional stres~
related factors (70). Re~piratory Yiru8 infection~
augmented by pathophysiological effect~ of stress~ alter :~
:10 the su~ceptibility' of cattle to P~steu~ella organism~
that are normally pr~sent in the upper respiratory tract
by a number o~ ;mQchanism6. Control of the viral :,~
infections that initiate B ~ a well a~ control of the
terminal bacterial pn umonia is e~sential to preventing '~,~
the disea~e Ryndrome (71).
:: ~ The ~ajor inf~ctious di~ease~ that contribute to BRD are:
, . .~
: infectious bovine~:rhinotracheitis viru8, parainfluenza
: type 3 ~virufi~ bovine viral diarrhea viru~, bo~ine
2~ respiratory syncytial~viru'~,~ and P~ste~r~lln hn~molytica
71)~.: The applicants' exDmple~; 1 ~ ough 24 d~scribe
vaccine inventions~that individually immunize against the
various co~ponent~ : of::BRD. ~An extension of the
:~ ~ applicants' approach~is to combine vaccine6 in a manner
so as:to ~control~he array~of disease p~thogenE with a
single i~munizatio~. :::~ To~ this end, at ~east ~wo
approaches~ can;~be~;~taken:;~ fir~ti:mixing of the variou~
IBR vector~d ::ant~igenfi~ BRsv~: ~ PI-3, BVDV and P.
Haemolytica~ in~a~i:gingle~vaccine dos~, and~secondly, the
individual antigens (BRSV, B~DV, PI-3 ~nd P. haemolytica)
can be:simultaneously~cloned:~into the fia~e IBR backbone
viru :~ote that~a~ combination of: antigen& could be
included in one:or~ore I:BR backbone viru~es o a~ to
: limit the :nu-ber~;~of IBR~;~viru~es re~uir~d for BRD
:35 : protection. ~Al~o,:,~conventionall~ derived vaccin~s
: (killed vi~u~,: inactivated~bactérins and modified li~e
viruses) could be:included ~as :part of the BRD vaccine
WO 93/0210~ PCr/US92/0603~ -
2~ 13~ 13
--12 5
f ormulation should such vac ::ine cc~mponents prove to be
more ef f e ive . ~
,: ' . ' '
.,.
'' ~"'.'''"'';
: , ..
, ''.
:: .
.: :.
~, ! ,
' ' "`
,, ' ' ':
..
' ~"'~ '',. "'''.
~".
..';. ~ ,-`'.`'`
WO ~3/0210~ Pcr/us92/06
,, A ~
1 2 6
Pc~f e~ençes
1 . J . L. Cantello et al ., Jsurnal of Virology 6S , 1584~
1588 ( 1991) .................................................... ....
2. U.KI. Lae~li, Nature 227, 6BO~685 ~1970).
3. B. Lomniczi et al., Journal of Virolo~y ~, 970-979
~19~4). ;
,
4~ R. Longn~cker and B. Roizman, Science ~, 573-576
( 1987 ) .
~,".,~
S. Mackem and B. Roizman, Proc. Natl. Acad. sci. USA :. ~
Z~, 4917-~21 ~1982). : .
6. T. Maniatis et al.,
~l~nual, Cold Spring Harbor Pre~s ~982).
~ .
7 . ~r . E . Mayf ield et al ., Journal of Virology ~., 259- : -
2 ~4 ( 198 3 ) .
8 ~ D o J ~ McGeoch et al ., ;lournal of Molecular Biology
13 ( 19E~5~
9. D,;J. ~lcGeoch et al., Journal of General Virology.~.,
19 38 (~9~7).
10. D.;r. IqcGeoch et al., Journal of General Virology 69,
1531-1574 (1988).
11. E.A. Petrovskis et al., Journal of Virology ~Q, 116-
~69 tl986).
12. T.J~ Rea et al., 3Ournal of Virology ~, 21 29 : ~ -
(1985~.
:.
W~ 93/02104 PCr/US92/0603~
2 ~ ~
-12 7 -
13. A.K~ Robbins et al., Journal of Virology ~, 339-347
(1~86) . ~.
~,.. .
1 4 . J . Sambrook et al .,
3~" Second Edition, Cold Spring Harbor Press
( 198g ) -
15 . G . A . Smith et al ~, ~ournal of General Virolo~ ~,
2417-2~24 (1990). ~.
16. D.R. The~msen ~t al., Gene ~, 207-217, (19~
'' ' ''' ,'~.
17. S.X. Tikoo et al., Journal of Virology ~, 5132-5142 - -:
.. ..
~1990) .
18. C.E. Aron~;on, ed~
~Q~giQ~f VaterinaFy ~l~dic:ine Publ,, Co7 ~ I~nexa,
KS, pp. 138-139 (1982-19833~ ;
,
1~. P.C. W~ber et al., Science ~, 575-579 ~19873.
20 . U. S . Wi~t:h et al ., Journal of :~irology ~ , 195-205
tl991).~
~:
2î. :M. Zijil ~t al., Js:~urnal of Virolc)gy ~;L, 1747-1755
tl990)
22. L. Villarreal and P. ~Ber~, Ss~:ierlce ~ 1~3 185
~:1977).
,
23. U. Gubl~r ~nd B.J. Hoffman/ Gene ~, 263 269 (1983).
24. F.L. Graham and P. Van d r Eb, Yirology ~, 556~567
(1~73).
:
25 . N. Elatlgo et: al.; Journal o~ Vir~logy ~ Z, 4~ 89 . ;~
tlg8
WC) ~3/021~ PC-r/US92/060?~
1 2 8--
26. M.K. Spriggs and P.L. Collins, Journal of Virology
~, 646-6S~ 86).
27. B.M. ~lumberg et al~, Journal of General Virology
66, 3~7-331 (19~5).
280 R. W. Price and P~. Kahn, Infection and Immunity 34,
571~580 (1981).
29. P. B. Ten~er et al., J. of General Virology ~,
13~9-1373 (1983).`
30 . B. Roiz~an et al., Cold Sprirlg Harbor Co~ference on
New Approaches to Viral Vaccines (S~ptember, 1983).
31. R. L. Thompson et al., Virology ;L~., 180-192 ~1983).
32. X. Fulcuchi et al., Proc. Natl. ~¢ad. Sc:i. U.S.~. ~,
751-754, 1905.
33. J. M. Kc)omey et~ al., J. of Virology ~, 662-66
1984.
34. S.B. ~ohanty and S.X. Dutta, Vçte~, ~'lj~olo~v, :
I.ea and Febiger, :Philade1phia (1981).
3 5 . R. CralldelI in ~, page~:
543-546, W.B. Saurlder, ;Philadelphia (1981). ~ -
36. H. I.udwig in ,~-e=iD~, ~rc~l. 2, B. Roizman, ;
ed ., Plenum Pres~ ~t l983 )
37~, A.J. Davi~on, l~O Journal, ~, 2203-2209 (19R3).
38. F.A. E'errari et al., J. of Bact~riolo~y ~;L, 556-562
198g.
,
WO 93/02104 2 1 1 ~3 ~ ~ ~ PCr/US92/0603~1
-129-
3 9 . V . T . Oi and L. A . Her~enberg, ~h~i~
5~" Freeman Publ. Co., San
Franci co tl980). pp. 351-372.
~0. S. Ihara et al., Virology 12~, 268-278 (1982~.
: ':
41. D. Hanahan, ~olecular Biology 1~, 557-580 ~1983).
42. M.W~ M~211encamp et al., J. of Clinical ~icrobiology
~Z ~ 220~-2213 (19~9) . . ;
, :,
43. ~Kilt st al., ~.S. Patent No. 4,824,667, i. ~ued ~pril
25,1989.
44. Rit et al., U.S. Pat~nt 4,703,011, i~E;ued October
27, 19~7.
45 . ~it et al., Tb~ V6~terinary Record ~ Z, 363-364
9~
46. Europ~an Patent Pub1ication EP 0 326 ~27 A2,
::: published Augu;t 2 , 1989 .
~7 . ~ederaI Register, Vol. 55, No. 90, pp. 19245-192S3
t~aY 9, 1990) .
48. Fitzpatriclc et al., ~ J. of Virol. ~, 4239r 4288
~19~8~
49. T. Ben-Por~t et al. ~ Virol. 154, 325-334 51986) .
,.~.: ,. ;,
50. F., Zu¢k¢nGan ;~t al., i~
~, Ed. J. van Oir chot, ~luwer,
L~adon (1989~) . pp. 107-117.
... :
51. L.. E:. Po~;t et al., J. Reprod. Fert., Suppl~ ~" 97-104
( 1990 ) . " ' '
' ;'' ~
....
WO 93/021~ PCr/US92/06034
52. Wirth et al., J. of Virol. ~.r 4882-4~89 ~1989).
53. B. Moss, Science 252~ 1662-1667 (1991).
54. R.W. Honess, J. of G~neral Virolc~gy ~, ~077-~107
, ~
1984 ) .
~' ' :''.
55. Cook & steYen~ J. of G~neral Virology 31t 75-80
t1976) :
56. Desrosiers et al., Moleculzlr and Cellular Biolo~
: 2796 2803 ( lg851 .
57 . Thomsen et al ,, Gene ~Z, 2~61-265 ( 1 987 3
.. ..
58. Weir and Nar~yanan, ~ Nucleic Acids Research ~, ~ :
10267-10282 ~(1988).
5g. Spaete ara~l ~loCarski, ~ Proceedings o~ the National
:
~ ~ ; Ac:ademy of s~ nces U,.S.A. ~84, 7213-7217 (19B7).
,: ~
60:.~ Whealy et al~ ournal: of Virology 62, 4185-4194 ` ~ : (1988~
`61. Shih et al., ~Proc~ings: of ~ the Nat~ onal Academy of
Scienc~s U. ~ .A. ~ 5867-5870 t lg8~4 ) . ::
62. ~ Edwards e~al;., in~ V~
~:,~ pp. 223~-234,: `Alan: Ris5: :~nc. (1988) .
~,
:~ 63. Procee~ding o~:t~e~:94kh Annual P~eetia3g ~f the unitQd ~;;;
States Ani~al Health Associatiorl, pp. 66~75 (1990). ~: -
64. E~A. ~Petrovskis. et; al.~, Journal o~ Virology ~ 5
3 ~ 1986) ~
~-.
,
~: : ' ~ '
` ,,- .`' :~
W~ 93/~2104 P~r/US92/0~)03~
2 ~ .2. .L.
--13 1--
65 . Todd ~t al ., U, S . Patent No . 4 , 132 , 775 , issued
~anuary 2, 1979.
~6 . M. S . Collett et al ., ~ournal of Virology ~ , 200-
208, ( 1g88 ) .
67 . M.A. Innis et al ., PCR Protocol~; : A Guide ~o
:~lethods and Applications, 84-91, Academic Pr~
Inc:. San l)iego (1990).
~8. R.D. Walker, ~t al., Am. J. Vet Res. ~, 1230-123
tl984)
6~. ~50 Harlow, and D. Lane, Antibodies: A I,aboratory
Manual, Cold Spring Harbor Pr~ N~w York (~988). ~ .
70~ C~Ao Hjerpe, Th~ Bovins R~piratory E~i~ea~3e Complex.
In: Current Veterinary Th~rapy 2: Food ~nimal
Practice . Ed . by J . L. Howard, Philadelphia, W . B .
Saunders Co., 1986 , pp 670-680 .
71. F. Fenner, et al., ~PIechaniEn~s of Di~a e
Production: P.cute Infections", ~S~-
Academic: Press, Inc., Orlando, Florida, 1987, pp
183-~û2 . ~ -
~ ~ . .-;
72. T. Inglae, et al. ,~ Journal of Gen~ra~ VirolQgy
919-93~ ~1989). ~ .
,.
:' , "'"'';~
~ :`
