Note : Les descriptions sont présentées dans la langue officielle dans laquelle elles ont été soumises.
WO 94/02646 'Zl 4 PCT/US93/06828
-1-
ENRICHING AND IDENTIFYING FETAL CELLS
IN MATERNAL BLOOD FOR IN SITU HYBRIDIZATION
FIELD OF THE INVENTION
This invention generally pertains to a method of enriching fetal
cells from maternal blood and to a method for identifying such fetal cells,
and further to a process whereby such cells are specimens in an in situ
hybridization to detect nucleic acid sequences of clinical interest, e.g. to
identify the sex of a fetus, and to detect genetic abnormalities and/or viral
infections in fetal cells.
BACKGROUND OF THE INVENTION
The sex of a human fetus and certain fetal chromosomal
abnormalities are conventionally detected or confirmed by directly examining
the chromosomes in fetal cells by cytogenetic analysis or by testing for
specific sequences of DNA within the chromosomes using nucleic acid
analysis. In the past, these tests have required the collection and culturing
of living cells obtained through an outpatient surgical procedure involving
some risk to the mother or fetus. These cells, which have been shed from
the fetus, may be obtained by amniocentesis. Amniocentesis involves
inserting a needle through the abdominal wall into the uterus and
withdrawing a small amount of amniotic fluid. An alternative procedure
involves sampling the tissue of chorionic villi from the surface of the
placenta by inserting a catheter through the cervix or abdomen. However,
spontaneous miscarriage or other serious complications may occur in about
WO 94/02646 PCT/US93/06828
2140278 -
-2-
0.5% of amniocentesis procedures and about 1 % of chorionic villi
procedures. Fetal cells collected by amniocentesis or chorionic villi sampling
are conventionally grown in culture for several days and then examined for
abnormalities.
Various kinds of fetal cells have been characterized. Fetal cells
include, but are not limited to, fetal erythrocytes, lymphocytes and
trophoblasts. Trophoblasts include cytotrophoblast and syncytiotrophoblast
cells and cells which may be sampled from embryos produced by in vitro
fertilization techniques. As used herein, the term "erythrocytes" includes
erythroblasts, normoblasts and reticulocytes, as well as erythrocytes, unless
the contrary is clear from the context.
It is known that a small number of fetal cells circulate in the
mother's blood. About one in 4,000 to 7,000 fetal erythrocytes in maternal
blood circulation is a fetal nucleated red blood cell. Methods for detecting
certain of the fetal cells and/or separating them from the mother's blood
have been reported. See, e.g., S.C. Yeoh et al., Prenatal Diagnosis 11:117-
123 (1991); U.W. Mueller et al., Lancet 336:197-200 (1990); PCT
Publication No. WO 91/07660 to Childrens Medical Center Corp.; PCT
Publication No. WO 91 /16452 of Cellpro Incorporated; and United States
Patent No. 5,153,117.
For background on nucleic acid genetic testing, see e.g., P.G.
McDonough, Sem. Perinatol. 9:250-256 (1985), and W.G. Butler, et al,
Fertility & Sterility 51:375-386.
Nucleic acid hybridization techniques are based on the ability of
single-stranded DNA or RNA to pair, i.e. hybridize, with a complementary
nucleic acid strand. This hybridization reaction allows the development of
specific probes, or populations of probes, that can identify the presence of
specific genes (DNA) or polynucleotide sequences or the transcription and
expression of those genes (RNA).
By the use of specific nucleic acid (RNA or DNA) probes,
genetic markers for the gender or other genetic characteristic of the fetus
CA 02140278 2004-02-09
-3-
and for Infection and other disease states may be detected. Certain genetic
diseases are characterized by the presence of genes absent in normal tissue.
Other disease conditions are characterized by the expression of RNAs or
RNA translation products (i.e. peptides or proteins) which are not expressed
In normal cells. Some disease states are characterized by the absence of
certain genes or portions of genes, or the absence or alteration of expression
of gene products or proteins. Moreover, it is often desired to characterize
the gender of animal fetuses, such as bovine fetuses, as well as human.
Solution hybridization methods which require the destruction of
the cell and the isolation of the nucleic acids from the cell before carrying
out the hybridization reaction sacrifice the cellular integrity, spatial
resolution
and sensitivity of detection. Where relatively few cells are available for
Isolation, as with fetal cells circulating in maternal blood, solution
hybridization is not feasible.
Amplification of nucleic acids, such as by polymerase chain
reaction, is a known technique, but with certain known drawbacks
preventing optimal speed and efficiency. For example, such techniques may
cause lysis of cells, may produce false positives due to sensitivity of the
technique, and may lead to loss of specificity where high levels of
amplification are required to detect a target that is present in low copy
number. Moreover, hybridization of the amplified target is required in any
event, so that multiple time-consuming steps are performed when
amplification is used.
In situ hybridization provides a technique for the determination
and quantitation of nucleic acids IDNA and RNA) in tissues at the single-cell
level. Such hybridization techniques can detect the presence or absence of
specific genes therein and may also be utilized to detect the expression of
gene products at the single-cell level.
In situ hybridization procedures are disclosed in U.S. Patent
No.5,225,326.
CA 02140278 2004-02-09
-4-
Despite the aforementioned knowledge, the prior art remains
deficient in the absence of a truly rapid, sensitive, efficient and practical
method of determining fetal gender and of detecting fetal abnormalities on a
routine basis without invading the mother's womb. Thus, the present
invention fulfills a long-felt need and desire in this field.
SUMMARY OF THE INVENTION
In one set of embodiments of the present Invention, there is
provided a method of identifying a fetal cell In a specimen. In these
embodiments, cells may be obtained from maternal peripheral blood,
umbilical cord blood, chorionic villus samples, etc. Cellular samples may be
used directly or may be concentrated as stated elsewhere herein to enrich
the population of fetal cells prior to analysis. Cells may be fixed In common
precipitating fixatives or cross-linking fixatives or may be used in the
following test without fixation. The procedure may be carried out with cells
deposited onto a solid support such as a glass microscope slide or used with
the cells in suspension. Prior to use, cells in suspension may be washed
with chilled PBS and mixed thoroughiy to ensure a single-cell suspension.
This method comprises the steps of obtaining a specimen that
contains fetal cells and detecting a marker that distinguishes fetal cells
from
maternal cells also present in the sample.
The most preferred method of identifying a cell as a fetal cell in
accordance with the present invention is to detect the presence of RNA for a
fetal protein, such as fetal hemoglobin (NbF) or a-fetoprotein. Such RNA is
generally messenger RNA (mRNA), but may alternatively or additionally
Include heteronuclear RNA (hnRNA) or ribosomal RNA (rRNA). This indicates
that the gene for the fetal protein is being transcribed and expressed. Such
detection is preferably performed within substantially intact cellular
membranes using In situ hybridization, preferably with synthetic DNA probes
directed towards the fetal protein RNA.
WO 94/02646 2140278 PCT/US93/06828
-5-
In a preferred embodiment synthetic DNA probes are employed,
to which chromofluors have been covalently attached. The binding of such
probes to fetal-cell-specific RNA within cells may be observed under the
microscope as a bright fluorescence or may be detected by fluorimetric
apparatus. By "fluorescence" we refer to any emission of detectable
radiation as a result of excitement with radiation of a different wavelength
than that emitted. The exciting radiation is conventionally ultraviolet or
visible light but may be infrared or other electromagnetic radiation.
Another preferred embodiment employs synthetic DNA probes
which are directly labeled, or may be indirectly labeled with enzymes such as
alkaline phosphatase. The binding of such probes to fetal RNA followed by
subsequent reaction of the enzymes with substrates to produce a detectable
product (e.g. blue or purple solid precipitated from the reaction of BCIP with
NBT) may be observed under the microscope.
The information resulting from such an assay may be used not
only to identify the status of the fetus, as will be discussed more
particularly
below, but also to provide a fetal hemoglobin estimation based on the
number of fetal erythrocytes detected, e.g. so as to assess the amount of
fetal-maternal hemorrhage in case of Rh incompatibility. The amount of
specific gamma globulin, containing anti Rh(D) to be administered, is
calculated from this estimation, to suppress maternal immune reaction to
fetal red blood cells entering maternal circulation.
Another embodiment of the present invention detects the
presence of at least two different RNAs in a cell. Fetal cells contain unique
mRNAs or mRNA species which are produced in cell types which do not
normally contain the particular mRNA species. The detection of these RNAs,
whether detected as messenger RNAs or heteronuclear RNAs (hnRNAs) can
serve to identify cells, or even subcellular fractions as fetal or embryonic
in
origin. While certain RNA populations are present in high abundance (e.g.,
fetal hemoglobin in fetal nucleated red blood cells), other fetal- or
embryonic-
specific RNAs are present in low abundance, either alone or even when
WO 94/02646 PCT/US93/06828
2140278
-6-
considered as a population of fetal-specific RNAs. In addition, certain RNA
species, while produced in certain fetal cells, may also be produced in
certain
maternal cells. However, there are situations where fetal cells express two
or more particular RNAs in the same cell while maternal cells from the same
specimen source do not contain both RNA species in the same cell. The
ability to detect multiple mRNA or hnRNA species simultaneously in the
same cell thereby enhances the ability to distinguish fetal cells from non-
fetal
(e.g. maternal) cells and offers a means of combining the signal produced
when only the unique set of RNAs is present so that a specific signal is
detected, which uniquely identifies fetal cells.
An alternative method for identifying fetal cells is to detect a
substance that is present in fetal cells but not in the maternal blood cells
which would be present in the sample. One such substance which is
particularly effective for such detection is cytokeratin, which may be
detected by an antibody thereto. Another such substance is the peptide
fetal hemoglobin, which may be detected by stain such as acid hematoxylin
and eosin B (e.g. Sigma Diagnostics, P.O. 14508, St. Louis, MO 63178, cat.
no. 285) or by an antibody to fetal hemoglobin.
Yet a further alternative method for identifying fetal cells is to
detect an RNA that is present in fetal cells and a peptide. The RNA may be
detected by nucleic acid hybridization, and the peptide may be detected by
the binding of an antibody thereto or by staining.
A further set of embodiments of the present invention involve
enriching the relative proportion of fetal cells in the specimen compared to
other cells, e.g. maternal cells. Such enrichment may preferably take place
by selectively removing maternal cells, e.g. by contacting the sample with a
ligand to a cell surface component, the ligand being capable of being
selectively separated from the sample. Preferably the ligand is an antibody
to an antigen generally present on maternal blood cells. Desirably the ligand
is bound to a solid matrix for separation from the liquid containing the
sample. Preferably the matrix is a magnetic bead. The matrix may
WO 94/02646 214 OZ73 PC'T/US93/06828
-7-
alternatively be in the form of a column through which the cell suspension is
passed.
In a preferred embodiment, the antibody comprises a
monoclonal antibody to CD45. This antibody selectively binds to an epitope
expressed on all isoforms of the human leukocyte common antigen (LCA)
family, which are expressed on all leukocytes. Fetal erythrocytes are
preferably enriched in such manner. Additional antibodies which may be
employed, along with or instead of anti-CD45, include anti-CD13, anti-CD34,
anti-CD44 and anti-CD31. Preferably the amount of antibody used is from
about 2 to about 20 Ng per million leukocytes in the sample.
Alternatively, or in addition to the aforesaid, fetal cells may be
selectively enriched by density gradient centrifugation. Fetal erythrocytes,
lymphocytes or trophoblasts are preferably enriched in such manner.
Subsequently, the fetal cells are detected as generally stated hereinabove.
In another embodiment of the present invention, there is
provided a novel method of identifying fetal cells in a specimen. This
method comprises the steps of obtaining a specimen that contains fetal cells
and preliminarily labeling the fetal cells through the use of a fluorescent
label
which may be detected by instrumentation. Subsequently, the fetal cells are
concentrated using flow cytometry.
In another embodiment of the present invention, there is
provided a novel method of,detecting a nucleic acid sequence in a fetal cell
having substantially intact cellular membranes by in situ hybridization
comprising the steps of fixing said fetal cell with a medium comprising at
least one agent selected from the group consisting of a precipitating agent
and a cross-linking agent; contacting said fixed specimen with a
hybridization solution consisting of a denaturing agent, hybrid stabilizing
agent, buffering agent, selective membrane pore-forming agent, and at least
one synthetic oligonucleotide probe having a nucleotide sequence at least
substantially complementary to a target nucleotide sequence to be detected,
said contacting being under hybridizing conditions at a temperature of 15 C
WO 94/02646 PCT/US93/06828
2140278
-8-
to 80 C for about 5 to 240 minutes in the presence of at least one
detectable label; and detecting hybrid formation by means of said label.
In yet another embodiment of the present invention, there is
provided a novel method of detecting the presence of a nucleic acid
sequence in a fetal cell having substantially intact cellular membranes by in
situ hybridization comprising steps of contacting said fetal cell with a
medium comprising a denaturing agent, a hybrid stabilizing agent, a buffering
agent, a membrane pore-forming agent, and at least one synthetic
oligonucleotide probe having a nucleotide sequence at least substantially
complementary to a specific target nucleotide sequence to be detected, said
contacting to be under hybridizing conditions in the presence of at least one
detectable label; and detecting hybrid formation by means of said label.
Optionally, the hybridization medium may contain a fixative agent.
In yet another embodiment of the present invention, there is
provided a novel kit for the identification of a fetal cell in-a specimen.
In another embodiment of the present invention, there is
provided a kit for the enrichment of fetal cells within a blood specimen
including means for creating a density gradient for separating out fetal cells
of interest.
In still yet another embodiment of the present invention, there is
provided a novel kit for the enrichment of fetal cells from a specimen, such
as preferably maternal peripheral blood, and the detection of nucleic acid
sequence in such fetal cells. This kit comprises an antibody to a cell surface
antigen present on most or all adult white blood cells, which antibody may
be bound to a matrix to facilitate separation. The kit further comprises a
hybridization solution comprising a denaturing agent, hybrid stabilizing
agent,
buffering agent, and a membrane pore-forming agent. In addition, this kit
contains a supply of an oligonucleotide probe capable of hybridizing with a
target fetal RNA nucleotide sequence. Advantageously, such a kit also
includes another detectably different probe capable of hybridizing with a
nucleic acid sequence of clinical interest.
WO 94/02646 2140279 PCT/US93/06828
-9-
Various kinds of fetal cells are characterized by cell type. In a
preferred embodiment, this invention relates to fetal nucleated erythrocytes.
Alternatively, the present invention may involve fetal trophoblasts, which
term includes both cytotrophoblast and syncytiotrophoblast cells. The fetal
cells are preferably separated from maternal peripheral blood by ligand
binding of maternal cells or density gradient centrifugation. However, the
procedures of the present invention may alternatively be applied to samples
obtained by percutaneous sampling of umbilical cord blood, amniocentesis,
chorionic villi sampling or other procedures, if the advantages obtained by
maternal peripheral blood sampling are not required.
Following enrichment of the fetal cells as mentioned above, the
cells may be distinguished or separated from maternal cells by recognition of
a fetal cell antigen, e.g., by staining with a labeled antibody to cytokeratin
or
to fetal hemoglobin, by staining for fetal hemoglobin, or preferably by in
situ
hybridization using DNA probes to messenger RNA (mRNA) sequences that
are present in such fetal cells but not in maternal blood cells.
Various antibodies have been used to discriminate between fetal
and maternal cells. An antibody to cytokeratin attached to a fluorescent
label is especially desirable for use without interfering with the nucleic
acid
hybridization performed in accordance with the present invention.
However, a preferred method in accordance with this invention,
uses in situ hybridization performed on cells that are obtained from maternal
peripheral blood using probes and conditions that select for messenger RNA
(mRNA) bearing sequences that are transcribed in fetal cells but not in the
maternal blood cells. In accordance with the present invention, it has been
found that mRNA for fetal hemoglobin (HbF) is an especially good marker of
such cells for detection by in situ hybridization.
Alternatively, certain methods of the present invention may
involve embryonic cells fertilized in vitro, or products of conception, which
do not need to be separated or distinguished from maternal cells.
WO 94/02646 2140278 PCT/US93/06828
-10-
An advantage of the hybridization technique of a preferred
embodiment of the present invention is that it is possible to perform the
hybridization to detect fetal mRNA sequences under conditions similar to (or
preferably the same as) those used to detect genetic or viral DNA.
Moreover, in a most preferred embodiment, a single incubation step is
performed in which probes for mRNA and probes for DNA are present in the
hybridization cocktail.
The in situ hybridization techniques of the present invention are
capable of detecting even a single genetic abnormality in a single cell.
Incubation in accordance with the present invention is desirably less than
about 120 minutes, and preferably between about 5 and about 30 minutes.
If a procedure for detecting a genetic abnormality involving somewhat fewer
than 1500 bases is desired, increasing the time of incubation, even beyond
240 minutes, may often provide the needed result.
Another aspect of this invention is to detect genetic
abnormalities, such as additions, deletions, translocations and
rearrangements, that are characterized by nucleotide sequences of as few as
15 base pairs. In this aspect, the present invention is not limited to the
detection of such genetic abnormalities in fetal cells, but also is applicable
to
nucleic acid from virtually any source. The cells containing the target
nucleic
acid molecules may be eukaryotic cells (e.g., human cells, including cells
derived from blood, skin, bone, lung, nervous system, liver, uterus, testes,
prostate, mucous membrane, or in general any part of ectoderm, mesoderm
or endoderm), prokaryotic cells (e.g., bacteria), plant cells, or any other
type
of cell. They can be simple eukaryotes such as yeast or derived from
complex eukaryotes such as humans. Moreover, the invention may be used
to distinguish various strains of viruses, as well as cellular DNA or RNA. In
that event, the target strands of nucleic acid may be in a non-enveloped
virus or an enveloped virus (having a non-enveloped membrane such as a
lipid protein membrane).
CA 02140278 2007-10-16
-11-
BRIEF DESCRIPTION OF THE DRAWINGS
Figure 1 shows the use of in situ hybridization to determine
the numerical status of chromosomes X, Y and 18 in normal male aminocytes.
Figure 2 shows tl-ie siniultaneous detection of the X and Y
chromosomes within amriiocytes and white blood cells.
Figure 3 shows a schematic representation of the technique
preferably used to enrich fetal erythrocytes from maternal blood in
accordance with the present invention.
Figure 4 shows a schematic representation of the technique
preferably used to enrich fetal troplioblasts from maternal blood in
accordance with the present invention.
Figtire 5 shows ttie use of probes for fetal hemoglobin
messenger RNA to identify fetal eryttirocytes.
Figure 6 shows ttre use of anti-cytokeratin antibodies to
positively identify fetal cells in maternal blood.
Figure 7 stiows the detection of the Y chromosome within a
fetal trophoblast, positively identified using the anti-cytokeratin antibody,
and isolated from maternal blood.
Figure 8 shows the use of in situ hybridization to determine
the numerical status of chromosomes X, Y and 18 in placental trophoblasts
that have been positively identified using the anti-cytokeratin antibody.
Figure 9 shows ttie use of in situ hybridization to fetal-cell-
specific rnRNA to positively identify amniocytes and trophoblasts.
DESCRIPTION OF TI4E PREFERRED EMBODIMENTS
The methods of ttie present invention may be tised to identify
fetal cells in a wide variety of specirnens. Representative examples of such
specimens include materna{ peripheral blood, placental tissue, chorionic
villi,
arnniotic fluid and embryonic tissue. For the reasons stated above, maternal
peripheral blood is the preferable specimen, which in the past has been the
WO 94/02646 PC'I'/US93/06828
2140278
-12-
most difficult to obtain reliable and consistent results with because of the
high ratio between maternal cells (which interfere with any assay of fetal
nucleic acid) and fetal cells.
The methods of the present invention may be used to detect a
number of fetal cells in a specimen. Representative examples of such fetal
cells include trophoblasts, nucleated red blood cells (erythrocytes), fetal
epithelial cells, fetal mesothelial cells, fetal lymphocytes and fetal
embryonic
cells.
The methods of the present invention may be used to detect
fetal- cell-specific polynucleotide sequences, that is, oligonucleotides,
within
a fetal cell. Without limiting the present invention, the novel methods of the
present invention may be used to detect a virus or a chromosome within a
fetal cell. Representative examples of viruses detectable by the present
invention include a human immunodeficiency virus, hepatitis virus and herpes
virus. Representative examples of chromosomes detected by the present
invention include the human X chromosome, the Y chromosome and
Chromosomes 1, 13, 16, 18 and 21.
The sensitivity of the in situ hybridization techniques of the
present invention permit the visual and photographic detection of a single
copy of a genetic sequence present within a single cell.
For example and not by way of limitation, using a single
fluorophor on each probe, with each probe being about 25 bases in length, a
genetic sequence of approximately 6,000 bases can be reliably detected by
viewing the results through a standard fluorescent microscope. When four
fluorophors are attached to a single probe, the presence or absence of a
particular genetic sequence of approximately 1500 bases can be reliably
detected, using the period of incubation taught herein. Moreover, when
using probes for corresponding sequences from both the "sense" and the
"anti-sense" strands of a two-stranded nucleic acid, one can detect the
presence or absence of a sequence as short as approximately 750 base pairs
using such periods of incubation described herein. Alternatively, one may
WO 94/02646 2~ ~ 0Z78 PCT/US93/06828
-13-
potentially detect as few as 15 to 20 base pairs using an image analysis
system.
Similarly, if a fetal cell is infected with a virus, such as the
Human Immunodeficiency Virus (HIV), the viral nucleic acid (RNA or DNA)
incorporated in the fetal cell's nucleic acid sequence can be detected by the
in situ hybridization techniques of the present invention.
The present invention allows for multiple targets to be tested
simultaneously, using a single sample of cells. This permits the maximum
amount of information to be obtained from a single sample, minimizing the
need for multiple fetal cell samples and thereby increasing the safety to both
mother and fetus and minimizing need for cell purity and sorting.
Differentiation of Maternal Cells from Fetal Cells
Identification of fetal cells or detection of genetic abnormalities
within fetal cells requires their separation and differentiation from maternal
cells. This requirement is especially necessary when the sample of cells is
obtained from maternal peripheral blood containing a low percentage of fetal
cells. Generally, any method which allows for the accurate separation and
identification of fetal cells may be used in the methods of the present
invention. Those skilled in the art will recognize that any method of positive
or negative separation by antibodies may be used to identify and sort fetal
cells. Positive and negative separation by antibodies, as herein used,
includes an antibody binding specifically to fetal cell antigens and not
significantly to maternal cell antigens (positive separation) and an antibody
binding specifically to maternal cell antigens and not significantly to fetal
cell
antigens (negative separation). The antibodies may be coupled to numerous
solid surfaces or supports (substrates, such as containers, columns, wells,
beads, or particles) by physical or chemical bonding. Alternatively, the
antibodies may be coupled to a material which facilitates the selected
separation step. For example, antibodies may be tagged with fluorescent
markers and separated with a cell sorter by standard procedures.
CA 02140278 2004-02-09
-14-
In general, such antibodies are effective when employed In
amotints of about 2 - 20 Ng per million cells to which they are targeted.
That ts, antibodies which recognize and bind to leukocytes are added In the
aforesaid amountm, based on the expected number of leukocytes In the
sample. Alternatively, antibodies which recognize and bind to trophoblasts
are added in the aforesaid amount, based on the expected number of
trophoblasts in the sample.
In a preferred embodiment of the present Invention, negative
separation is employed. A particularly preferred negative separation Is
performed by using antibody to CD45, hereinafter "anti-CD45," which
selectively binds to white blood cells.
The anti-CD45 is desirably bonded to a solid support such as
magnetic beads, which may be introduced into a test tube and shaken with
the sample and then held in position at the side of the test tube by the
application of a magnetic field, while liquid containing the un-bound sample
Is removed. Such beads are available as Anti-CD45 immunomagnetic beads,
Catalog No. 1178, from Amac, Inc., 160B larrabee Road, Wesbrook, ME
04092.
Aiternativeiy, one may obtain immunomagnetic beads from
Calbiochem, 10933 N. Torrey Pines Road, La Jolla, CA, uncoated as catalog
no. 400995, or coated with streptavidin as catalog no. 400996. Such
beads may be coated by the user with antibodies to cell surface antigens
found on cells which are desired to be removed from the fetal cells (when
negative selection is being employed) or on the type of fetal cells which are
desired to be concentrated (when positive selection is being employed).
Another bead which may be coated with antibody is an aqueous suspension
of iron oxide particles coated to provide carboxyl groups, permitting the
covalent attachment of biologically active molecules. Such beads, and a
description of procedure for use, are available as BioMag Carboxyi
Terminated, catalog no. 8-4125, Advanced Magnetics, Inc., Cambridge MA
1617) 497-2070.
* tnade-mark
CA 02140278 2004-02-09
-15-
If desired, white blood ceils may be even more effectively
removed by a combination of antibodies to CD45, CD13 and CD34. Anti-
CD44 can also be inciuded in the mixture to remove contaminating maternal
red blood cells. Addition of anti-CD31 can specifically remove the
contaminating platelets. Such antibodies are available from various sources
such as Amac, Inc. (see above), Becton Dickinson, Franklin Lakes, NJ
07417-1884, and Zymed Laboratories, Inc., 458 Carlton Court, South San
Francisco, CA. See Zymed's 1992 catalog at pages 10-13 and 71-72. See
also W. Knapp, Eourth jr2ternatioBal Vyorkshop and Conference on Human
eukocvtg Differentiation Antigens, Oxford University Press, 1989; and D.F.
Keren, Flow Cvtomgtry in Clinical Diagnosis, pp. 41-87 ASCP Press,
Chicago, 1989.
Fetal cells may alternatively be Isolated from maternal peripheral
blood by either density gradient centrifugation or by flow cytometry. Using
flow cytometry, fetal cells may be identified and sorted, for example, by
first
using either a labeled antibody specific for a fetal cell antigen or by using
a
nucleic-acid-specific probe, e.g., a synthetic oiigonucieotide probe
hybridizable to fetal cell RNA.
Concentration of Fetal Nucleated Red Blood Cells In MaternaJBlood
An example of a separation of fetal nucleated red blood cells
(erythrocyte) is shown in Figure 3, consisting of parts 3A and 38. Each step
Is schematically illustrated by a numbered box, and a component or
container that appears in more than one step Is identified by the same
reference numeral.
In step 10, draw twenty ml of maternal peripheral blood 18,
e.g. into two conventional ten-mi EDTA anti-coagulation blood collection
tubes 12 and 14, e.g. Vacutainer'-tubes. Alternatively, ten ml of umbilical
cord blood is drawn. The blood is transferred into a fifty-mi centrifuge tube
16.
* trade-mark
CA 02140278 2004-02-09
-18-
In step 20, the blood sample 18 Is mixed with fifteen ml of Cell
Buffer A 22 to form a buffered sample 24. (See Exemplary Solutions,
below.) Mix well.
In step 30, fifteen ml of a density-gradient separation reagent
32 having a density of about 1.083, e.g. Histopaque 1083, Is placed in a
fifty-mi conical tube 34, and up to twenty ml of the buffered sample 24 Is
carefully layered on the top of the density separation reagent. The density
separation reagent may have a density from about 1.075 to about 1.095,
preferably between 1.08 and 1.09.
In step 40, the conical tube 34 is centrifuged in a swinging-
bucket rotor 36 at 700 x g for thirty minutes at room temperature. Arrow
38 shows the direction of centrifugal force being applied to tube 34 as
Illustrated. If two containers of blood sample were provided initially, then
prepare and process a second density separation tube for the remaining
twenty mi of diluted blood, repeating steps 30 and 40 as to the second
tube. If the sample Is umbilical cord blood, there would be only one such
tube.
In step 50, aspirate off and discard the top serum/buffer layer
54. Discard this waste. The buffy coat 56 is the interface layer at the top
of the density separation reagent 52, which contains both maternal and fetal
white blood cells, nucleated red blood cells, and erythroblasts. Collect the
buffy coat 56 by pipette 58 and transfer to a fresh fifty-mi conical tube 62.
If more than one tube 34 of density separation material were prepared for a
singie patient, combine all interface layers 56 into a single fifty-ml conical
tube 62.
in step 60, wash the collected cell layer with Cell Buffer A 22
by adding Cell Buffer A to the cells to make the volume forty-five ml.
In step 70, pellet the cells In tube 62 by centrifugation at 1000
rpm for ten minutes at room temperature.
In step 80, resuspend the cells, this time in one ml of Ceii
Buffer B 82.
` trade-mark
WO 94/02646 2~ ~ 0173 PCT/US93/06828
-17-
For step 90, prepare one hundred NI of anti-CD45 magnetic
beads 94 in a 2-ml microcentrifuge tube 92 using aseptic technique as
follows. (This preparation of the beads is not shown diagrammatically.)
Wash the beads by adding 1.4 ml of Cell Buffer A, using a magnet to retain
the beads on the side of the tube. Let the tube sit undisturbed for 5
minutes. Carefully remove the wash solution with a pipette. Remove the
magnet. As shown in the diagram for step 90, add to the tube 92 the
resuspended cells in tube 64 from step 70. Incubate at room temperature
for ten minutes, mixing gently.
In step 100, apply a magnet, such as a magnetic support block
illustrated diagrammatically as magnet 102, to retain the beads 94 against
the side of the tube 92.
In step 110, remove and collect the liquid by pipette 112. The
cell suspension 114 in pipette 112 contains the fetal cells. The cellular
material 118 that remains with the beads 94 primarily contains maternal
leukocytes.
Step 120 diagrammatically represents the transfer of the
pipetting liquid 114 onto a microscope slide 162 from pipette 112. Such a
transfer would generally be done by pipette. Alternatively, the washed fetal
cell suspension may be transferred to a fresh tube (not shown), if
hybridization in suspension is to be performed.
Alternatively, instead of using a bead having, for example, anti-
CD45 bonded thereto (direct negative selection), one may react the
specimen with anti-CD45 in solution and then remove the leucocytes, which
have entered into an antigen-antibody ligand with the anti-CD45, by any
means which separates such an antibody, and particularly by an antibody to
an epitope of the CD45 molecule (indirect negative selection). Where the
anti-CD45 is a mouse antibody, such a ligand-forming antibody may be, for
example a sheep-antimouse IgG antibody bonded to substrate that is
generally solid or otherwise able to facilitate removal of the ligand complex
CA 02140278 2004-02-09
-18-
from solution, such as an antibody-coated magnetic bead, the coated well of
a container, etc.
preuaration of Slides
If slides are to be prepared, they are preferably made by the
conventional cytospin technique. Alternatively they may be prepared as
organosilanated slides.
For cytospun slides, 200 NI of the cell suspension 114 from
step 110 Is cytospun onto each slide for five minutes at 500 rpm. Dip the
cytospun slides in chilled 80% ethanoi/water (v/v) for five minutes. Air dry.
Alternatively, the cytospun slides may be fixed by directly
applying 30 pl of ethanol/methanol (3:1 v/v) onto each slide.
To prepare organosilanated slides, Immerse clean slides for 2
minutes in a freshly prepared 2% (v/v) solution of an organosifane such as 3-
aminopropyitriethoxysiiane (APTO) in acetone. Rinse the slides twice in
water and air dry. For each 20 ml of maternal blood or 10 ml of umbilical
cord blood used as the sample, resuspend the cell pellet in 50 pi of a
fixative
soiution, e.g. 80% ethanol/water or 3:1 ethanol/methanol. Spot 50 NI of
this suspension on a slide and air dry the sample.
Flow Cytometrv
A Coulter Profile ll*flow cytometer may be used to detect
nucleic acids within fetal cells, using a PMT I setting of 1100 and a PMT 3
setting of 900. Color compensation, PMT 1 - PMT 3, may be 15%. An
Epics Elite`system may be used to sort fetal cells out of a specimen, e.g., of
maternal blood.
When fluorescein (generaiiy FITC) is the probe dye, the dye is
first excited with light having a wavelength 488 nm and then the emitted
light is measured. For the emitted light (for LFL1), a 540 bp (40) filter is
used; i.e., only light with a wavelength between 520 nm and 560 nm is
allowed to pass. The filter for LFL3 is a 635 long pass fiiter; i.e., it
allows
any light over 635 nm wavelength to pass.
* trade-mark
WO 94/02646 0 Z79 PCF/US93/06828
-19-
A marker may be used to define the cell as a fetal cell, e.g., a
trophoblast. Various antigens found at the surface of trophoblasts are
known, and antibodies to such antigens are used as markers for
identification and separation of such cells from maternal blood, other
maternal cells or placental tissue. In the instant invention, an antibody to
cytokeratin is a preferred fetal cell marker for trophoblasts. For example,
antibodies to representative fetal cell markers may be used, such as:
(1) cytokeratin, (2),6-subunit of chorionic gonadotrophin, (3) fetal
hemoglobin protein, (4) chorionic somatomammotropin protein (placental
lactogen), (5) pregnancy-specific.8-glycoprotein, and (6) a-fetoprotein.
Various labeled antibodies to cytokeratin are available. These include CAM
5.2 from Becton Dickinson, Catalog No. 92-0005; and anti-cytokeratin 18-
FITC from Sigma Chemical Company, Catalog No. F-4772 (antibody to
cytokeratin 18). Most preferably, the antibody to cytokeratin is labeled with
fluorescent moiety.
Even more preferably, fetal-cell-specific RNA sequences are
used as fetal cell markers. Such sequences are transcripts of, e.g., the fetal
hemoglobin gene, the cytokeratin gene, the 6-subunit of chorionic
gonadotrophin gene, the chorionic somatomammotropin gene (placental
lactogen), the pregnancy-specific,6-glycoprotein genes, the embryonic
hemoglobin gene or the a-fetoprotein gene. The sequences of these genes
and others may be obtained from the Genetic Sequence Data Bank,
GenBank, version 69Ø A DNA probe, or population of probes, embodying
any of these sequences is synthesized as an oligodeoxynucleotide using a
commercial DNA synthesizer such as Model 380B from Applied Biosystems,
Inc.. Foster City, CA, using reagents supplied by that company. Probes may
be comprised of the natural nucleotide bases or known analogs of the natural
nucleotide bases, including those modified to bind labeling moieties.
The novel methods of identifying fetal cells in a specimen using
density gradient centrifugation utilize density gradient medium. Most
preferably, the density gradient medium comprises colloidal
CA 02140278 2004-02-09
-Z0-
.=
poiyvinyipyrrolidone-coated silica (e.g. Percol(-, nycodenz, a nonionic
polysucrose (Ficoi171 either alone or with sodium diatrizoate (Ficoli-Paqueor
Histopaquel, or mixtures thereof. The density of the reagent employed Is
selected to preferentially separate the fetal cells of interest from other
blood
components.
The present invention permits detection of genetic abnormalities
using a minimum number of fetal cells. Fetal cells may be obtained by
amniocentesis, chorionic viili sampling or other standard methods known in
ttie art. In one embodiment of the present invention, however, fetal cells are
Isolated from maternal peripheral blood, avoiding the invasion of the uterine
cavity and thus precluding injury to the mother or fetus. In another
embodiment of the present invention, fetal cells are isolated from a
percutaneous sample of umbilicai cord blood. The sensitivity of the present
method permits drawing a smaller sample of umbilical cord blood. i.e.
preferably 1-2 ml, but optionally as little as 0.2 ml, than would need to be
drawn using conventional fetal cell isolation and detection techniques.
Detection of Genetic Abnofmaiilies
The genetic abnormalities detected by the present invention
may be deletions, additions, amplifications, translocations or rearrangements.
For example, a deletion may be identified by detecting the
absence of hybridizable binding of the probe to a target sequence. To detect
a deletion of a genetic sequence, a population of probes are prepared that
are complementary to the nucleic acid sequence that is present In a normal
fetal cell but absent in an abnormal one. If the probes hybridize to the
sequence in the cell being tested, then the sequence is detected and the cell
is normal as to that sequence. If the probes fail to hybridize to cellular
nucleic acid, then the sequence is not detected in that cell and the cell is
designated as abnormal, provided that a control sequence, such as the X
chromosome, is detected in that cell.
An addition may be identified by detecting binding of a labeled
probe to a polynucleotide repeat segment of a chromosome. To detect an
* trade-mark
WO 94/02646 ~ ~ ~ DZ7,$ PCI'/US93/06828
-21-
addition of a genetic sequence, such as an insertion in a chromosome or a
karyotypic abnormality such as the trisomy of Chromosome 21 which
indicates Down's Syndrome, a population of probes are prepared that are
complementary to the genetic sequence in question. Continuing with the
Down's Syndrome example, if the probes complementary to Chromosome 21
hybridize to three appearances of the Chromosome 21 sequence in the cell,
then three occurrences of the Chromosome 21 sequence will be detected
and indicate the Down's Syndrome trisomic condition. If the detection
means is a fluorescent dye, for example, then three distinct points of
fluorescence visible in each cell will indicate the trisomy condition.
As illustrated in Example 14, when an amplification of a
particular DNA fragment is present, there is an increase in the intensity of
the signal from a labeled probe for the sequence which is subject to
amplification. Using any of a number of image analysis systems, this signal
is quantified and compared to normal controls to determine whether or not a
particular amplification mutation is present.
A translocation or rearrangement may be identified by several
methods. For example, a labeled first probe may be bound to a marker
region of a chromosome that does not translocate. A labeled second probe
is then bound to a second region of the same chromosome (for a
rearrangement) or a second chromosome (for a translocation) and
subsequently binding of the first and second probes is detected.
Alternatively, a translocation may be identified by first binding a labeled
probe to a marker region of a polynucleotide section of a chromosome that
translocates or rearranges. Subsequently, binding of the labeled probe is
detected.
For example, to detect a translocation, a marker for the
chromosome in question is identified, and a population of probes are
prepared that hybridize to it. They are marked with a detectable label, such
as a dye that fluoresces at a particular wavelength. The sequence that
translocates or rearranges in the abnormality being tested for is also
WO 94/02646 PCT/US93/06828
2140278
-22-
identified, and second population of probes are prepared that identify it. The
members of the second population of probes are marked with a
distinguishably different label, such as a dye that fluoresces at a different
wavelength from the first series of labeled probes. In situ hybridization is
performed using both populations of probes, and the results of hybridization
by each of the probe populations are compared. If the first and second
labels are coincident on virtually all cell samples, no translocation has
taken
place. If the first label is found not to coincide with the second label on a
significant fraction of samples, then a translocation or rearrangement has
taken place. See, e.g., F. Speleman, Clinical Genetics 41(4):169-174 (1992);
J. W. Gray, Progress in Clinical & Biol. Res. 372:399-411 (1991).
Hybridization Fixative
Ethanol, e.g. 80% ethanol/water (v/v), is desirably used as a
fixative during preparation of the cells for in situ hybridization. Other
useful
precipitation fixatives include acetic acid, methanol, acetone, and
combinations thereof, for example ethanol/methanol mixture 3:1. Other
useful fixatives will be obvious to one skilled in the art. Fixatives and
hybridization of fixed cells, in general, are discussed in U.S. Patent
No. 5,225,326. Fixatives should provide good preservation of cellular
morphology and preservation and accessibility of antigens, and high
hybridization efficiency. Some salts, e.g. mercuric chloride, sodium chloride,
sodium sulfate, potassium dichromate, potassium phosphate, ammonium
bromide, calcium chloride, sodium acetate, lithium chloride, cesium acetate,
calcium or magnesium acetate, potassium nitrate, potassium dichromate,
sodium chromate, potassium iodide, sodium iodate, sodium thiosulfate, and
extreme temperatures, such as waving a slide over a flame, may also
function as fixatives.
The fixative may contain a compound which fixes the cellular
components by cross-linking these materials together, for example,
paraformaldehyde, glutaraldehyde or formaldehyde. Cross-linking agents,
while preserving ultrastructure, often reduce hybridization efficiency by
CA 02140278 2004-02-09
-23-
forming networks trapping nucleic acids and antigens and rendering them
Inaccessible to probes and antibodies. Some cross-linking agents also
covalently modify nucleic acids, preventing later hybrid formation.
!.lybridiza ion Solution Cog,nRonepi~
The hybridization solution may typicaliy comprise a chaotropic
denaturing agent, a buffer, a pore-forming agent, a hybrid stabilizing agent.
The chaotropic denaturing agents include formamide, urea, thiocyanate,
guanidine, trichloroacetate, tetramethyiamine, perchlorate, and sodium
Iodide. Any buffer which maintains pFi at least between about 6.0 and
about 8.5 and preferably between 7.0 and 8.0 may be utilized.
The pore-forming agent is, for instance, a detergent such as Bri}"
35, Brij 58, sodium dodecyl sulfate, CHAPS, Tweed, Sarkasylor Triton
X-1007 Depending on the location of the target nucleic acid, the
pore-forming agent is chosen to facilitate probe entry through plasma,
nuclear membranes or cellular compartmental structures. For Instance,
0.05% Brij 35 or 0.1 % Triton X-100 wiil permit probe entry through the
plasma membrane but not the nuclear membrane. Alternatively, sodium
deoxycholate will allow probes to traverse the nuclear membrane. Thus, in
order to restrict hybridization to the cytoplasmic nucleic acid targets,
nuclear
membrane pore-forming agents are avoided. Such selective subcellular
localization contributes to ttie specificity and sensitivity of the assay by
eliminating probe hybridization to complementary nuclear sequences when
the target nucleic acid is located in the cytoplasm. Agents other than
detergents, such as fixatives or salts, may serve this function.
Hybrid stabilizing agents such as salts of mono- and divalent
cations are included in ttie hybridization solution to promote formation of
hydrogen bonds between complementary sequences of the probe and its
target nucleic acid. Preferably, sodium chloride at a concentration from 0.15
M to 1 M is used. In order to prevent non-specific binding of nucleic acid
probes, nucleic acids unrelated to the target nucleic acids may desirably be
added to the hybridization soiution.
* trade-mark
CA 02140278 2004-02-09
-24-
Many types of solid supports may be utilized to practice the
invention. Supports which may be utilized include, but are not limited to,
glass, Scotch`tape 13M1, nylon, Gene Screen Plus (New England Nuclear)
and nitrocellulose. Most preferably, glass microscope slides are used. The
use of these supports and the procedures for depositing specimens thereon
is obvious to those of skill in the art. The choice of support material will
depend upon the procedure for visualization of cells and the quantitation
procedure used. Some filter materials are not uniformly thick and, thus,
shrinking and swelling during in situ hybridization procedures is not uniform.
In addition, some supports which autofluoresce will interfere with the
determination of low level fluorescence. Glass microscope slides are most
preferable as a solid support since they have high signal-to-noise ratios and
can be treated to better retain tissue.
In one embodiment of the process, the target cell is immobilized
on a solid surface (especially a glass slide). In another embodiment, the
target cell is suspended in liquid during the entire process and not
immobilized on a solid surface. Use of conventional flow cytometry
instruments is especially facilitated with the present invention.
The process comprises the steps of:
(1) contacting ttie cells with a solution comprising a probe
capable of binding to a target molecule In or on said cells, said contacting
performed in a manner such that the probe binds to said target molecule so
as to make that probe a cell-bound probe, said probe comprising a reporter
group;
(2) contacting the cell with a solution comprising a structural
analogue of the reporter group,
(3) performing one or more steps that will detect the reporter
group on the probe bound to the cell but that will not detect analogue bound
to the cell,
wherein step (1) takes place before step (2-, after step (2), or
during step (2).
* trade-mairk
WO 94/02646 2140Z7g PCT/US93/06828
-25-
Steps (1) and (2) are considered to take place simultaneously if
the probe and the analogue are in the same solution.
Preferably, steps (1) and (2) are performed simultaneously by
including the probe and the analogue in the same solution. In preferred
embodiments, multiple probes for multiple target sequences are
simultaneously hybridized. For example, probes for HbF mRNA and for
human chromosome 21 are desirably included in the contacting step, and the
reporter group on the probes for HbF mRNA is detectably different from the
reporter group on the probes for chromosome 21.
In a subgeneric aspect of the invention, the reporter group is a
cyclic compound. In a further subgeneric aspect of the invention, the cyclic
group comprises an unsaturated bond. In a still narrower subgeneric aspect
of the invention, the cyclic group is an aromatic compound (one or more
benzene rings).
It is preferred that, on a molar basis, the analogue is in excess
as regards the reporter group; it is highly preferred that there be at least
ten
times as much analogue as reporter group.
The analogue competes with the reporter group for non-specific
binding sites. In the case of aurintricarDoxylic acid (ATA) used in
conjunction with a nucleic acid probe, an additional mechanism may involve
ATA binding to the active site of proteins that would bind the reporter group.
It is preferred that the analogue is selected so that it retains
most or all of the structural features of the reporter group. The analogue
may additionally have structural features not present in the probe.
Preferably, the analogue should be able to permeate a cell or
virus. In the case of analogues that are aurin derivatives (rosolic acid
derivatives), it is preferred that the analogues have, in addition to ATA, a
polar functional group such as a-C02, -NH21 OH, or -SO3 group, on an
aromatic group; examples are chromoxane cyanine R and Chrome Azurol S.
A subgroup of preferred analogues are those that block the NH2 groups on
Iysines.
CA 02140278 2004-02-09
-26-
Fluorescent reporter groups are detected by allowing the
reporter group to absorb energy and then emit some of the absorbed energy;
the emitted energy Is then detected.
Chemiluminescent reporter groups are detected by allowing
them to enter Into a reaction, e.g., an enzymatic reaction, that results in
energy in the form of light being emitted.
Other reporter groups, e.g., blotin, are detected because they
can bind to groups such as streptavidin which are bound, directly or
indirectiy, to enzymes, e.g., alkaline phosphatase or horseradish peroxidase
that can catalyze a detectable reaction.
Fluorescent groups with which this process can be used include
fluorescein lor FITC), coumarin, rhodamine, rhodamine derivatives inciuding
Texas Red; and phycoerythrin.
Chemiluminescent groups with which this process can be used
iriciude insoiuminol (or 4-aminophthalhydrazide; see catalogs of Aldrich
Chemical Company or Molecular Probes, Inc.).
In one preferred embodiment of the process, when the reporter
group is fluorescein, step (4) comprises measuring light emitted at
wavelengths between about 520 nm and 560 nm (especially at about
520 nm), most preferably where the absorption wavelengths of step (3) are
less than 520 nm.
A preferred embodiment of the fluorimetric process further
comprises a wash step between the steps numbered (2) and (3). A wash
step can be performed by centrifuging ttie cell out of the solution in which
it
is suspended, then suspending It in a wash solution, and then centrifuging It
out of the wash solution. A wash solution is generally a probe-free solution.
In a particular embodiment of the process, the solution that is
used in step (2) comprises a probe (comprising a reporter group), an
analogue of the reporter group, a free radical scavenger and a fixative.
A fluorescent probe that binds to a target molecule is preferably
one which binds to that target with high specificity. Preferably, a
* trade-mark
WO 94/02646 2140M P(.T/US93/06828
-27-
fluorescent probe is fluorescent dye covalently attached to a nucleic acid
molecule, antibody or other molecule capable of binding specifically to a
target molecule.
If an analogue is added to the cocktail, its preferred
concentration is from 0.01 % to 0.5% w/v (especially about 0.05 to 0.01 %).
In another aspect, the invention is a kit for the detection of
nucleic acids within a fetal cell in a specimen. Such a kit may include the
following:
(1) A solution containing a fixation/hybridization cocktail and
one or more labeled probes. For example and not by way of limitation, this
solution may contain 50 mM guanidinium isothiocyante, 25-40% formamide,
31% PEG, 0.4 M DTT, 15X Ficoll/PVP, 50 2 mM EDTA, 1 mg/mI salmon
sperm DNA, 50 mM Tris-acetate (pH 7-8), about 5% Triton X-100, and
about 20 Ng/mI of a synthetic oligonucleotide probe directly labeled with a
reporter molecule. This solution and the probes would have measurable
predefined and identified characteristics and reactivities with cells and
target
sequences;and
(2) Means and instructions for performing the hybridization
reaction of the present invention.
Alternatively, the kit may also include:
(1) A second detectable reporter system which would react
with the probe or the probe-target hybrid;
(2) Concentrated stock solution(s) to be used directly or to
be diluted sufficiently to form wash solution(s);
(3) Any mechanical components which may be necessary or
useful to practice the present invention such as a solid support (e.g., a
microscope slide), an apparatus to affix cells to said support, or a device to
assist with any incubations or washings of the specimens; and optionally
(4) A photographic film or emulsion with which to record
results of assays carried out with the present invention.
WO 94/02646 PCT/US93/06828
2140273
-28-
Another aspect of the present invention provides a kit for the
detection of fetal hemoglobin within a specimen, without removal of
maternal blood cells. A preferred version of this kit contains a means for
detecting the HbF mRNA of fetal cells. Provided would be media for
mounting slides of capillary blood smears, desirably Slide Mount A, Slide
Mount B and Slide Mounting Solution.
Also provided would be a Wash Concentrate A, Wash
Concentrate B and Fetal Hemoglobin Assay Solution. The concentrates
mentioned herein are diluted in use to approximately the solution
concentrations stated below in Exemplary Solutions.
Another aspect of the present invention would be a kit to enrich
and detect fetal cells within a blood specimen, e.g. maternal or umbilical
cord blood. Such, the kit may contain:
(1) One or more reagents to prepare a density gradient that
concentrates fetal cells; -
(2) Labeled antibodies to detect or separate fetal cells and/or
probes specific for fetal cell mRNA (preferably fetal hemoglobin mRNA); and
(3) Means and instructions for performing fetal cell
enrichment.
Alternatively the kit may contain:
(1) One or more antibodies, desirably bound to a solid support
and preferably bound to magnetic beads, to positively or negatively
concentrate fetal cells within the specimen, preferably including an anti-
CD45 antibody for negative selection of fetal erythrocytes; and
(2) Probes specific for fetal cell mRNA, to detect fetal cells;
and
(3) Means and instructions for performing fetal cell enrichment
using density gradient centrifugation or flow cytometry; and optionally:
(4) One or more reagents to prepare a density gradient that
concentrates fetal cells.
2140278
WO 94/02646 PG'I'/US93/06828
-29-
Advantageously either such of the two kits described
immediately above may also be provided with means for detecting one or
more target nucleic acid sequences within the fetal cells, by further
including:
(2) A second detectable reporter system which would react
with the probe or the probe-target hybrid;
(3) Concentrated stock solution(s) to be used directly or to
be diluted sufficiently to form wash solution(s); and optionally:
(4) Any mechanical components which may be necessary or
useful to practice the present invention such as a solid support (e.g., a
microscope slide), an apparatus to affix cells to said support, or a device to
assist with any incubations or washings of the specimens; and
(5) A photographic film or emulsion with which to record
results of assays carried out with the present invention.
Such a kit would optionally provide reagents and materials for
use in an automated system for the performance of any of the methods of
the present invention.
Table 1 contains the abbreviations and common names for
various compounds and dyes mentioned herein.
CA 02140278 2004-02-09
-30-
TABLE 1
Abbreviations and Common Names of Comnounds and Dyes
Abbreviation
Ql
Common Name Comgound
Tempo* 2,2,6,6-tetramethy[piperidine-N-oxyl (CAS # 2564-
83-21
EDTA ethylene diamine tetraacetic acid
DMF dimethyl formamide
DMSO dimethyl sulfoxide
DTT dithiothreitol
PVP polyvinylpyrrolidone
PEG 4000 polyethylene glycol (ca. 4000 Mol. Wt.)
PBS phosphate-buffered saline solution
ATA aurintricarboxylic acid (CAS # 4431-00-91
CHAPS 3-[(3-cholamidopropyll-dimethylammoniol-l-
propane-sulfonate (CAS # 75621-03-31
photobiotin N-(4-azido-2-nitrophenyl)-N'-(3-
biotinyiaminopropyl)-N'-methyl-l,3-propanediamine
(CAS # 96087-37-51
Ficoll " nonionic polysucrose (Pliarmacia)
Histopaque*1083 aseptically filtered solution containing Ficoll
nonionic polysucrose (type 400) and sodium diatrizoate,
density 1.083
Percoii colloidal PVP-coated silica (CAS # 65455-52-91
Nycodenz' 5-(N-2,3-dihydroxypropyiacetamido)-2,4,6-triiodo-
N,N'-bis(2,3-dihydroxypropyl)isophthalamide (CAS
# 66108-95-01
* trade-mark
CA 02140278 2004-02-09
-31-
Tween * polyoxyethylene sorbitan salts of fatty acids
.
Sarkasy{ N-lauroyisarcosine, sodium salt (CAS+M 7631-98-31
.
Triton X-100. octyl phenoxy polyethylene glycol (a
polyoxyethylene ethert(CAS # 9002-93-11
Brij 35 polyoxyethylene 23 lauryl ether (CAS # 9002-
92-01
Brij*58 polyoxyethylene 20 cetyl ether (CAS # 9004-95-91
Tris tris(hydroxymethyl)aminomethane (CAS i 77-86-11
insoluminol 4-aminophthalhydrazide ICAS 3682-14-21
APTO 3-aminopropyltriethoxysitane (CAS # 919-30-21
DAPI 4',6-diamidino-2-phenylindole hydrochloride
[CAS # 28718-90-31
BCIP 5-bromo-4-chloro-3-indolyl phosphate (CAS #
102185-33-11
" trade-mark
WO 94/02646 PCT/US93/06828
2140278
-32-
Dye abbreviations
Dye Number Actual Dye Name Abbreviation
12 Naphthol Blue Black Naphthol BI. Blk.
13 Palatine Fast Black WAN Palatine F-B WAN
20 Sulforhodamine 101 hydrate [CAS # 60311-02-6]
Sulforhodamine 101
Texas Red Sulforhodamine 101 acid chloride [CAS# 82354-19-6]
Direct Blue 53 Evans Blue [CAS # 314-13-61 --
-- Fluorescein isothiocyanate FITC
Hoechst 33258 2'-[4-hydroxyphenyl]-5-[4-methyl-1-piperazinyl]-
2,5'-bi-1 H-benzimidazole trihydrochloride [CAS #
23491-45-4]
Natural Black 1 Hematoxylin [CAS # 517-28-21
--
Acid Red 91 Eosin B[CAS # 548-24-31
--
Sigma 840-10 Nitroblue Tetrazolium NBT
Exemplary Solutions
The following solutions may be used in the performance
of the present invention.
Cell Buffer A (as diluted for use): 0.8% BSA, 0.1 %
dextrose, 0.1 % sodium azide in PBS.
Cell Buffer B (as diluted for use): 2% BSA, 0.1 %
dextrose, 0.1 % sodium azide in PBS.
Fixation solution: 4 volumes ethanol, 5 volumes of PBS,
1 volume of glacial acetic acid.
Hybridization cocktail: 5 x SSC (0.75 M NaCI, 0.075 M
sodium citrate); 30% formamide (v/v); 3% Triton X-100 (v/v); 0.4
M guanidinium isothiocyanate; 0.16 M sodium phosphate (pH 6); 15 x
Ficoll/PVP; 1 mg/mI sheared salmon or herring sperm DNA; 10 mM
EDTA; 25 mM DTT; 31 % PEG 4000.
~f~J
WO 94/02646 214Fi P(.'T/US93/06828
-33-
For hybridization cocktails used with a nucleic acid probe,
the temperature for the hybridization reaction is within the range of
about 20 C and about 90 C, preferably about 37 C and about 85 C,
and most preferably about 40 C and about 46 C. The time of the
hybridization reaction is between 5 minutes and 16 hours, and
preferably is less than 4 hours. More preferably, the time of the
hybridization reaction is less than 120 minutes, even more preferably
less than 60 minutes. Most preferably, the reaction time is less than
30 minutes.
Wash Solution #1 has the following composition: 0.4 M
guanidinium isothiocyanate; 0.1 % Triton X-100 (v/v); and 0.1 x SSC
in deionized water.
Wash Solution #2 has the following composition: 0.1 %
Triton X-100 (v/v) and 0.1 x SSC in deionized water. (SSC has the
following composition: 0.15 M NaCI, 0.15 M sodium citrate, pH 7Ø
2 x SSC is composed so that upon a 1:1 dilution with water, SSC
would be produced; 10 x SSC is composed so that upon a 1:10
dilution with water, SSC would be produced.)
PBS has the formula, 0.136 M NaCI, 0.003M KCI,
0.008M Na2HP04 = 7H20, 0.001 M KH2PO4.
If a dye-labeled antibody is used as the probe, then the
probe may be dissolved in PBS, possibly supplemented with bovine
serum albumin (BSA), while it is allowed to react with target cells,
preferably at a temperature in the range 4 C to 34 C. The cells need
not be fixed (e.g., when the antibody target is a cell-surface antigen),
or may be fixed after the probe-target incubation is completed, or may
be fixed prior to or during the probe-target incubation.
The mounting solution may be 50% PBS/50% glycerol
(v/v), 0.1 % 1,4-phenylenediamine (as an antifade) and 1 Ng/mI of
Hoechst 33258 or DAPI (dye).
WO 94/02646 PCT/US93/06828
2140278
-34-
Probes
The probes may be DNA or RNA or synthetic analogues
to DNA or RNA. The probe is capable of binding to a complementary
or mirror-image target cellular genetic sequence through one or more
types of chemical bonds, usually through hydrogen bond formation. In
general, the DNA or RNA probes may be composed of the bases
adenosine, uridine, thymidine, guanine, cytosine, or any natural or
artificial chemical derivatives thereof. The phosphate backbone is
linked via ribose or deoxyribose, or an analog or derivative thereof.
Nucleic acid probes can be prepared by a variety of methods known to
those of skill in the art. The probes may be oligonucleotides
synthesized on an Applied Biosystems (A.B.I.) DNA synthesizer Model
380 using the recommended A.B.I. reagents.
In the last stage of the synthesis, an aminohexyl
phosphate linker is desirably attached to the 5' end of the probes for
the fetal-cell-specific marker, and preferably to both the 5' and 3' ends
of the probes for the other sequences to be detected, e.g.
chromosomal sequences. The 5'- or 5',3'- aminohexyl oligonucleotides
are then respectively coupled to a selected dye and purified by HPLC.
However, as illustrated in Examples below, even if only a single
fluorescent label is attached to the probes, fluorescence may be
detected by visual microscopy.
Purified single-stranded DNA probes may alternatively be
produced by the use of single-stranded phage M13 or plasmid
derivatives of this phage, or by reverse transcription of a purified RNA
template.
Detection Systems
Detectable labels may be any molecule which may be
detected. Commonly used detectable labels are radioactive labels
including, but not limited to, 32P, '4C, 1251, 3H and 35S. Biotin labeled
nucleotides can be incorporated into DNA or RNA by nick translation,
WO 94/02646 ct 14(j 273 PCT/US93/06828
-35-
enzymatic, or chemical means. The biotinylated probes are detected
after hybridization using avidin/streptavidin, fluorescent, enzymatic or
colloidal gold conjugates. Nucleic acids may also be labeled with
other fluorescent compounds, with immunodetectable fluorescent
derivatives or with biotin analogues. Nucleic acids may also be
labeled by means of attaching a protein. Nucleic acids cross-linked to
radioactive or fluorescent histone HI, enzymes (alkaline phosphatase
and peroxidases), or single-stranded binding (ssB) protein may also be
used. To increase the sensitivity of detecting the colloidal gold or
peroxidase products, a number of enhancement or amplification
procedures using silver solutions may be used.
An indirect fluorescent immunocytochemical procedure
may also be utilized (Rudkin and Stollar (1977) Nature 265:472; Van
Prooijen, et al (1982) Exp.Cell.Res. 141:397). Polyclonal antibodies
are raised against RNA-DNA hybrids by injecting animals with
poly(rA)-poly(dT). DNA probes are hybridized to cells in situ and
hybrids ae detected by incubation with the antibody to RNA-DNA
hybrids.
Probes may be detectably labeled prior to addition to the
hybridization solution. Alternatively, a detectable label may be
selected which binds to the hybridization product. Probes may be
labeled with any detectable group for use in practicing the invention.
Such detectable group can be any material having a detectable
physical or chemical property. Such detectable labels have been well-
developed in the field of immunoassays, and in general, most any label
useful in such methods can be applied to the present invention.
Particularly useful are enzymatically active groups, such as enzymes
(see Clin. Chem., 22:1243 (1976)), enzyme substrates (see British
Patent Spec. 1,548,741), coenzymes (see U.S. Patents Nos.
4,230,797 and 4,238,565) and enzyme inhibitors (see U.S. Patent
No. 4,134,792); fluorescers (see Clin. Chem., 25:353 (1979);
WO 94/02646 PCT/US93/06828
2140273
-36-
chromophores; luminescers such as chemiluminescers and
bioluminescers (see Clin. Chem., 25:512 (1979)); specifically bindable
ligands; proximal interacting pairs; and radioisotopes such as 3H, 355,
32P, 1251 and 14C.
Probe Size. Pooulation and Concentration
The length of a probe affects its diffusion rate, the rate of
hybrid formation, and the stability of hybrids. According to the
present invention, small probes (15-200 bases, and preferably 15-
100, most preferably 15-30) yield the most sensitive, rapid and stable
system. A mixture of small probes as aforesaid which span the entire
length of the target nucleic acid to be detected are desirably prepared.
For example, if the target nucleic acid were 1000 bases long, up to
about 40 "different" probes of 25 bases would be used in the hybrid
solution to completely cover all regions of the target nucleic acid.
A particularly advantageous configuration of probes is to
prepare a population of probes to a selected target sequence as
follows: A first probe hybridizes to bases 1 to 25 of the sequence. A
second probe hybridizes to bases 31 to 55 of the sequence. A third
probe hybridizes to bases 61 to 85 of the sequence, and so on,
wherein the beginning of each succeeding probe is spaced apart 5
bases from the end of the preceding probe. It has been found that
such a configuration wherein 5 bases are skipped between each 25-
mer probe provides optimal hybridization results and signal, when
employed in hybridizations in accordance with the present invention.
The concentration of the probe affects several parameters
of the in situ hybridization reaction. High concentrations are used to
increase diffusion, to reduce the time of the hybridization reaction, and
to saturate the available cellular sequences. To achieve rapid reaction
rates while maintaining high signal-to-noise ratios, probe
concentrations of 0.005-100 Ng/mI are preferable. Most preferable is
use of probes at a concentration of about 0.01 Ng/mI.
2140278
WO 94/02646 PCT/US93/06828
-37-
Detection of Specific Genetic Abnormalities
Among the genetic abnormalities that may be detected by
the tests of the present invention are Down's Syndrome (trisomy 21),
Turner's Syndrome (XO chromosomes), Klinefelter's Syndrome (XXY
chromosomes), Edward's Syndrome (trisomy 18) and Patau Syndrome
(trisomy 13).
The following examples are offered by way of illustration
and are not intended to limit the invention in any manner.
EXAMPLE 1
The Use of Chromosome-Specific Probes to Determine the
Numerical Status of Specific Chromosomes in Amniocytes
Preparation of Cells
Two ml of amniotic fluid was diluted to 10 ml with PBS
and centrifuged at 1200 rpm for 10 minutes. The resultant cell pellet
was suspended in 1000 NI of ethanol and methanol (v:v, 3:1). Two
hundred NI of sample was deposited on each slide by the cytospin
method.
Preparation of Probes
Several 25-base synthetic oligonucleotide probes were
prepared from each of the DNA sequences listed in Table 2.
TABLE 2
Probe Chromosome GenBank
Designation Detected Locus Name
Alpha-centromeric repeat X HUMSATAX
Atpha-centromeric repeat Y HUMSATB
Alpha-centromeric repeat 18 HUMREPA84
WO 94/02646 PCT/US93/06828
2140278
-38-
Probe Synthesis & Labeling
The oligodeoxynucleotides were synthesized (Applied
Biosystems, Inc. DNA Synthesizer Model 380B) using the
recommended A.B.I. reagents, and in the last stage an aminohexyl
phosphate linker was attached to the 5' end. The 5'-aminohexyl
oligodeoxynucleotides were then coupled to a rhodamine dye from
Molecular Probes, Inc. and purified by Waters HPLC using a baseline
810 chromatography work station.
Hybridization
For the hybridization procedure, the cells were deposited
onto slides. Twenty to 25 NI of a hybridization cocktail consisting of
30% formamide, 5 x SSC, 0.1 M sodium phosphate buffer, pH 7.4,
100 Ng/mI low molecular weight, denatured, salmon or herring sperm
DNA, 10% (v/v) Triton X-100, 10% DMSO, 15 x Ficoll/PVP, 0.4 M
guanidinium isothiocyanate, 10 mM DTT, and 0.025 M EDTA and the
probe, added at a concentration of 20 Ng/mi. Denaturation and
hybridization were carried out simultaneously by placing the slides in
an incubator for 15 minutes at 85 C.
Three separate hybridization solutions were prepared.
The first solution contained a probe for the X chromosome; the
second, a probe for the Y chromosome; the third, a probe for
chromosome 18.
Washing
Washing of the slides after the hybridization reaction is
essential to eliminate background due to non-specific binding of the
probe. Post-hybridization, the slides were placed in a Coplin jar to
which was added 100 ml of the Wash Solution #1. The solution was
agitated and held in this solution for 2 minutes. This wash solution
was removed and Wash Solution #2 was added. This second wash
solution was agitated for 5 seconds and poured off. The washing
procedure with Wash Solution #2 was repeated six times. Then 15 NI
WO 94/02646 214O2 8 PCf/US93/06828
-39-
of Mounting solution, containing 0.1 % 1,4-phenylenediamine (as an
antifade) in 50% glycerol and 1 Ng/mI Hoechst 33258 (counterstain
dye) was added.
Fluorescence Detection
Photomicrographs were taken on an Olympus BH10
microscope with fluorescence capabilities, using Kodak Ektachrome
EES-135 (PS 800/1600) film, exposed, and push processed at 1600
ASA. A 30 to 60 second exposure time was consistently used, so
that direct comparisons could be made between all photomicrographs
taken.
As shown in Figure 1 A, a single point of fluorescence (a
"dot") is visible in the nucleus of male amniocytes when the Y probe
was used. Figure 1A: the top panel is a photograph (40X
magnification) of two Hoechst stained nuclei while the bottom panel is
the fluorescent photograph (100X magnification) of these same two
cells. Figure 1 B shows a female amniocyte with 2 dots visible in the
nuclei when the X probe was used: the top panel is a photograph of a
Hoechst stained nuclei (40X magnification) while the bottom panel is
the photograph of this same cell viewed with fluorescence (100X
magnification). There are two dots in the nucleus when a probe for
chromosome 18 was used (Figure 1C). Figure 1C: the top panel is a
photograph of a Hoechst stained nucleus, while the bottom is a
fluorescent view. Thus, there are the "normal" number of X, Y and
18 chromosomes present in these amniocytes.
EXAMPLE 2
Simultaneous Detection of Numerical Status of X and Y
Chromosomes in Amniocytes and in
Peripheral Blood Mononuclear Cells
Preoaration of Cells
Two ml of amniotic fluid was diluted to 10 ml with PBS
and centrifuged at 1200 rpm for 10 minutes. The resultant cell pellet
WO 94/02646 PCT/US93/06828
2140278
-40-
was suspended in 800 NI of ethanol and methanol (v:v, 3:1). Two
hundred NI of the sample was deposited on each slide by the cytospin
method. In addition, approximately 5,000 peripheral blood
mononuclear cells obtained from a normal male were deposited on a
slide by the cytospin method.
Prenaration of Probes
Several 25-base synthetic oligonucleotide probes were
prepared from each of the DNA sequences listed in Table 3.
TABLE 3
Probe Chromosome GenBank Fluorescent
Designation Detected Locus Label
Name
Alpha-centromeric repeat X HUMSATAX Rhodamine
Alpha-centromeric repeat Y HUMSATB Fluorescein
Probe Svnthesis. & Labeling
The oligodeoxynucleotides were synthesized as aforesaid,
and in the last stage, an aminohexyl phosphate linker was attached to
the 5' end. The 5'-aminohexyl oligodeoxynucleotide probes for each
of the above chromosomes were each coupled to a different
fluorescent dye as indicated in Table 3 above. The fluorescent dyes
were obtained from Molecular Probes, Inc. and purified by a Waters
HPLC using a baseline 810 chromatography work station.
Hvbridization, Washing and Detection
These steps were performed in Example 1.
Results
In this experiment, the X chromosome probe was labeled
with rhodamine while the Y chromosome probe was labeled with
FITC, and both probes were added to the same hybridization cocktail
and taken through the above procedure. In Figure 2A, the top panel is
21-40278 PCT/US93/06828
WO 94/02646
-41-
a photograph of the Hoechst stained nucleus of an amniocyte and the
bottom panel is a photograph of the fluorescence demonstrating one
bright dot (X chromosome) and one bright dot (Y chromosome) in the
nucleus. Figure 2B is a photograph of three additional amniocytes as
photographed in Figure 2A.
Figure 2C demonstrates the results obtained using this
same hybridization cocktail and normal male peripheral blood
mononuclear cells when the photograph is taken through a triple band
(DAPI-FITC-rhodamine) filter set. This photograph again shows one
bright dot and one bright dot for the X and Y chromosomes,
respectively, on the Hoechst stained background. Figure 2D is a
photograph of a pseudo color representation of the cells in Figure 2C
using an image analysis system (BioScan Optimas'", Edmonds,
Washington).
EXAMPLE 3
Use of Chromosome-Specific Probes to Determine the Number of
Chromosomes in Embryos Prepared for In Vitro Fertilization or
in Fetal Cells Obtained From Chorionic Villi
Preparation of Cells
Cells from non-viable embryos prepared for in vitro
fertilization, cells from products of conception, and cells from
chorionic villi, are accessed in a standard fashion, and deposited onto
glass slides.
Preparation Of Probes
Several 25-base synthetic oligonucleotide probes are
prepared from each of the DNA sequences listed below in Table 4.
WO 94/02646 PC,T/US93/06828
2140273
-42-
TABLE 4
Probe Chromosome GenBank Fluorescent
Designation Detected Locus Label
Name
Alpha-centromeric repeat X HUMSATAX Rhodamine
Atpha-centromeric repeat Y HUMSATB Fluorescein
Alpha-centromeric repeat 18 HUMREPA84 Coumarin
Alpha-centromeric repeat 16 HUMASATD Rhodamine
Amyloid 21 HUMAMYB Rhodamine
Collagen type IV 13 HUMCOLI A Fluorescein
Human satellite DNA 1 HUMSAT31 Rhodamine
Human satellite DNA 1 HUMSAT32 Rhodamine
Human satellite DNA 1 HUMSAT33 Rhodamine
Probe Synthesis & Labelin4
The oligodeoxynucleotides are synthesized, and in the
last stage an aminohexyl phosphate linker is attached to the 5' and 3'
ends. The 5',3'-aminohexyl oligodeoxynucleotide probes for each of
the above chromosomes are each coupled to a different fluorescent
dye as indicated in Table 4 above. The fluorescent dyes may be
obtained from Molecular Probes, Inc. and purified by a Waters HPLC.
Hvbridization. Washing and Detection
These steps are performed as in Example 1.
To photograph the four fluorochromes used to label four
of the differently labeled probes, four different filter cubes, having the
appropriate excitation and emission filters, are used on the
microscope. Photographs are then taken sequentially following the
change of each filter cube.
Alternatively, dual- and triple-filter sets available from
Chroma Tech, Inc., of Brattleboro, Vermont; and from Omega, Inc., of
WO 94/02646 214OZ73 PCT/US93/06828
-43-
Brattleboro, Vermont may be used to allow the operator to photograph
two or three different colors simultaneously (as demonstrated in
Example 2 above). A color tv camera may optionally be used.
A single probe may be detected within a single cell as by
the procedure used in Example 1. Two probes may be detected and
viewed and photographed by the procedure used in Example 2. Three
or more may be detected if reporter molecules fluorescing at
differently detectable wavelengths are used. As many different
probes may be differentiated as the number of different fluorescent
dyes can be distinguished by the available light filter systems.
In the foregoing examples, when the fetal cell has a
normal male karyotype, there is a single point of orange fluorescence
(a "dot") in the nucleus of the fetal cell when the X probe is used; a
single green dot when the Y probe is used; while there were two blue
dots when a probe for chromosome 18 were used; two red dots when
a probe for chromosome 16 is used; two orange dots when a probe
for chromosome 21 is used; and 2 green dots when the probe for
chromosome 13 is used, and two orange dots when a probe for
chromosome 1 is used. These are the results for a male fetus with
the "normal" number of chromosomes present.
EXAMPLE 4
Detection of Fetal Cells by DNA Probes
A. Enrichment of Fetal Trophoblasts Circulating in Maternal Blood
Using a Sorting Flow Cytometer and Fetal Cell Identification Probes
Preoaration of Cells
Isolated white blood cells from a pregnant woman are
used in the following example. The cells are washed with nuclease-
free PBS and placed in a single cell suspension at a concentration that
results in clearly separated cells. The cells are spun down to a pellet
and the supernatant decanted. The cells are resuspended in 0.5%
paraformaldehyde and left for 12-16 hours at 4 C. After fixation, the
WO 94/02646 PC1'/US93/06828
214OZ`3
-44-
cells are spun to remove the paraformaidehyde and then washed once
in PBS and resuspended in 2 x SSC. The cells are used immediately.
Preparation of Probes
A. Genetic Testing Probes
For a negative control probe, a 25-base sequence from
the nitrogen reductase (NR) gene sequence is used (Table 5). For a
positive control probe, a 25-base sequence from the 28S gene is used
(Table 5).
The genetic testing probes are oligodeoxynucleotides
complementary to regions of human chromosomes X, Y, 13, 16, 18
and 21. The details of selection, preparation and labeling of these
probes are included in Table 6 below.
B. Fetal cell identification probes.
The fetal cell identification probes (Table 6B) are
accessed via the Genetic Sequence Data Bank, GenBank, version 69.0
and prepared from the following gene sequences:
(1) fetal hemoglobin gene,
(2) cytokeratin gene,
(3) fl-subunit of chorionic gonadotrophin,
(4) chorionic somatomammotropin gene (human
placental lactogen),
(5) a-fetoprotein gene, and
(6) pregnancy-specific glycoprotein genes.
The aforesaid sequences are cut into 25-mer
oligodeoxynucleotides and synthesized by a DNA synthesizer as
aforesaid, and in the last stage an aminohexyl phosphate linker is
attached to the 5'-end of each oligonucleotide. The 5'-aminohexyl
oligodeoxynucleotides are then coupled to the fluorescent dye FITC
and purified by column chromatography and HPLC.
WO 94/02646 14 0 278 PCT/US93/06828
-45-
TABLE 5
Control Probes
Probe Sequence
Designation
28S ATCGAGTAGTGGTATTTCACCGGC SEQ ID NO:1:
NR TACGCTCGATCCAGCTATCAGCCGT SEQ ID NO:2:
TABLE 6A
Genetic Testing Probes
Probe Chromosome GenBank Fluorescent
Designation Detected Locus Label
Name
Alpha-centromeric repeat X HUMSATAX Rhodamine
Alpha-centromeric repeat Y HUMSATB Rhodamine
Alpha-centromeric repeat 18 HUMREPA84 Rhodamine
Collagen type IV 13 HUMCOLI A Rhodamine
Amyloid 21 HUMAMYB Rhodamine
Fragile X X mut. Fluorescein
The Fragile X condition, an amplification, is detected by
the probe of SEa ID NO :3:, which is further exemplified below in
Example 14.
WO 94/02646 PCT/US93/06828
2140r?3
-46-
TABLE 6B
Fetal Cell Identification Probes
Probe GenBank Fluorescent
Designation Locus Label
Name
Fetal Hemoglobin HUMGLBN Fluorescein
Human Cytokeratin HUMCYTOK Fluorescein
HCG HUMCG3B Fluorescein
HCG HUMCG6BA Fluorescein
HCG HUMCG7B2 Fluorescein
HCG HUMCGB Fluorescein
Human Somatomammotropin HUMCS1,3 Fluorescein
Alpha Fetoprotein HUMAFP Fluorescein
Pregnancy-specific a-glycoprotein Fluorescein
Transferrin Receptor HUMTFRR Rhodamine
Embryonic Hemoglobin e chain CY5
Embryonic Hemoglobin Cchain CY3
Hybridization
For the hybridization procedure using the fetal cell
identification probes, to pelleted cells is added 50 NI of a hybridization
cocktail consisting of 30% formamide, 5 x SSC, 0.16 M sodium
phosphate buffer, pH 7.4, 1 Ng/NI sheared DNA, 3% (v/v) Triton X-
100, 5% PEG 4000, 25 mM DTT, 0.4 M guanidinium isothiocyanate,
15 x Ficoll/PVP, and the probe (a mixture of the fetal cell identification
probes) added at a concentration of 2.5 Ng/mI. Hybridizations are
carried out in a humidified environment at 42 C for 30 minutes.
Washin4
Post-hybridization, the cells are placed in a 15-mI conical
tube to which is added 10 ml of Wash Solution #1. The solution is
agitated until the cells are a single-cell suspension and then spun at
250 x g for 5 minutes. The supernatant is removed and 10 ml of
WO 94/02646 2140278 PCT/US93/06828
-47-
Wash Solution #2 is added to the pellet. The second wash solution is
agitated until the cells are a single-cell suspension. The cells are again
spun at 250 x g for 5 minutes. The supernatant is removed and the
cell pellet resuspended in 0.2 ml of a counterstain solution of PBS
containing 0.0025% Evans Blue.
Flow Cytometer Use and Interoretation
The cells are analyzed on a Epics Elite sorting flow
cytometer (Coulter Instruments). The instrument uses a 488 nm
argon laser, a 525 nm band pass for FL1 and a 635 nm long pass
filter for the counterstain. For each sample analyzed, the sample
containing the negative probe is analyzed first and the quad-stats are
set so that less than 0.05% of the cells fall in the upper-right
quadrant. Next, the sample hybridized with the positive probe is
analyzed under the same parameters as the sample sorted with the
negative probe. Cells that fall in the upper right quadrant are collected
and are hybridized to determine fetal genetic characteristics.
Results
In this experiment, NR is used as a negative control probe
while the fetal cell identification probes are the positive probes, and
would identify the fetal cells that circulate in maternal blood. The
fetal cells would, in turn, be "sorted" as described above then
deposited onto glass slides. The fetal cells would then be analyzed
with the genetic testing probes as described in Examples 1 and 2.
B. Detection of mRNA to Fetal Hemoglobin
To further illustrate and exemplify a probe population
prepared for use with the present invention, the following details are
provided for the first entry in Table 6B. SEQ ID N0:4: is a 443-
nucleotide sequence of three fragments taken from GenBank for the
HUMGLBN gene. Bases 1 to 91 of SEQ ID N0:4: are from 2179 to
2269 of HUMGLBN. Bases 92 to 314 of SEQ ID N0:4: are from 2393
to 2615 of HUMGLBN. Bases 315 to 443 are from 3502 to 3630 of
WO 94/02646 PCT/US93/06828
21~OP, 73
-48-
HUMGLBN. The population of DNA probes complementary to the
target mRNA that is transcribed in the cell from SEQ ID N0:4: is
prepared in accordance with the teachings herein.
More specifically, the sequences of the members of the
population of probes are provided as SEQ ID NO:5: through SEQ ID
NO:21:, each of which is a 25-mer oligonucleotide of DNA which is
complementary to the mRNA target, which is transcribed from the
genetic locus named above and more specifically exemplified as SEQ
ID NO:4:. Each such probe is synthesized and labelled at 5' with FITC
as described herein.
Figure 5 is a photomicrograph showing fetal nucleated
red blood cells enriched within a maternal peripheral blood sample
prepared in accordance with the procedure of Figure 3 and hybridized
to the probe population described above. Cells with gray nuclei and
distinctive morphology are fetal nucleated red blood cells. - Cells
lacking nuclei are fetal erythrocytes or fetal reticulocytes which still
contain fetal hemoglobin mRNA.
C. Optional Detection of Multiple RNAs to Increase Specificitv of Fetal
Cell Identification
As stated above, there are situations where fetal cells
express two or more particular RNAs in the same cell while maternal
cells from the same specimen source do not contain both RNA species
in the same cell. Multiple mRNA or hnRNA species are detected
simultaneously in the same cell when only the unique set of RNAs is
present, so that a specific signal is detected, which uniquely identifies
fetal cells.
Prior to use, cells in suspension are washed with chilled
PBS and mixed thoroughly to ensure a single-cell suspension.
In the present Example, the combination of RNAs which
is targeted is human chorionic gonadotropin (HCG) and transferrin
receptor (TR). Although either of these genes is expressed in certain
WO 94/02646 21 4DZ78 PCT/US93/06828
-49-
types of maternal cells, the cells which normally express these genes
do not circulate in the bloodstream, and no single type of maternal cell
expresses both of the genes. However, fetal trophoblasts express
both of these genes simultaneously in the same cell.
One or more 25-mer oligonucleotide DNA probes for the
sequences for HCG identified in Table 6B is prepared and labeled with
fluorescein. One or more 25-mer oligonucleotide DNA probes for the
sequence for TR identified in Table 6B is prepared, labeled with
rhodamine.
A sample of maternal peripheral blood is washed with
chilled PBS and mixed thorougly to ensure a single-cell suspension
placed as a smear on a microscope slide. A hybridization is performed
as stated above, with probes for HCG and TR.
The signal produced in the fetal trophoblast cells is an
additive combination of the green from fluorescein and the red from
rhodamine, to yield a 2x signal, which appears yellow-orange.
EXAMPLE 5
The Use Of Synthetic Oligonucleotides As Probes For
Both Strands Of DNA As Targets For Hybridization
Oligomers prepared to both strands of a DNA target
produce about twice the signal when compared to the signal produced
when probe is made to only one strand of the DNA. In addition, the
ability to hybridize to both DNA strands allows simultaneous
quantitation of the amount of DNA and RNA within individual cells.
Preparation of Cells
The H9 cell line (ATCC No. 8543) is used in the following
experiment. Cultured cells are washed with nuclease-free PBS and
placed in a single-cell suspension at a concentration that results in
clearly separated cells. The cells are spun down to a pellet and the
supernatant decanted. The cells are resuspended in 40% ethanol,
WO 94/02646 PCT/US93/06828
2140273
-50-
50% PBS, and 10% glacial acetic acid. The cells are used
immediately.
TABLE 7
Probe GenBank Fluorescent Molecular
Designation Locus Label Probes, Inc.
Name Cat. #
HIV - sense strand HUMHB102 FITC 1-3
HIV - antisense strand HUMHB102 rhodamine derivative T488
Probe Synthesis, & Labeling
The aforementioned HIV sequences are cut into 30-base
oligonucleotides and synthesized as phosphorothioate oligonucleotides
using DNA synthesizers (Applied Biosystem DNA Synthesizer, Model
380B) and using the recommended A.B.I. reagents. The
polysulfurized oligonucleotides are then coupled to a fluorescent dye
and purified by column chromatography and HPLC. A 30-base
oligonucleotide from the nitrogen reductase gene serves as the
negative control probe.
Hybridization
For the hybridization procedure, to pelleted cells is added
50 NI of an hybridization cocktail consisting of 30% formamide, 5 x
SSC, 0.16 M sodium phosphate buffer, pH 7.4, 1 Ng/NI sheared DNA,
3% (v/v) Triton X-100, 5% PEG 4000, 25 mM DTT, 0.4 M
guanidinium isothiocyanate, 15 x Ficoll/PVP, and the probe added at a
concentration of 2.5 Ng/mI. Hybridizations are carried out in a
humidified environment at 42 C for 30 minutes.
Washin4
Post-hybridization, the cells are placed in a 15 ml conical
tube to which is added 10 ml of a wash solution, consisting of 0.1 x
SSC, 0.4 M guanidinium isothiocyanate, and 0.1 % Triton X-100
WO 94/02646 214Q2`8 PCT/US93/06828
-51-
(Wash Solution #1) at a temperature of 42 C. The solution is
agitated until the cells are a single-cell suspension and then spun at
250 x g for 5 minutes. The supernatant is removed and to the pellet is
added 10 ml of Wash Solution #2 at a temperature of 42 C. The
solution is agitated until the cells are a single cell suspension. The
cells are spun at 250 x g for 5 minutes. The supernatant is removed
and the cell pellet resuspended in 0.2 ml counterstain solution
consisting of 0.0025% Evans Blue in PBS.
Flow Cvtometer Use and Interoretation
The cells are analyzed on a FACSTAR instrument (Becton
Dickinson). The instrument uses a 5-watt argon laser coupled to a
dye head, a 525 nm band pass filter for FL1 and a 584 nm band pass
filter for the Rhodamine. For each sample analyzed, the sample
containing the negative probe is analyzed first and the guad-stats are
set so that less than 0.01 % of the cells fall in the upper-right quadrant
or lower-right quadrant. Next, the sample treated with the HIV probes
is analyzed under the same parameters as the sample analyzed with
the negative probe. Since the quad-stats are set correctly and the two
samples have been handled identically, any number of cells (above
0.01 %) recorded in the upper right quadrant are scored as positive for
both strands and/or mRNA. Any number of cells (above 0.01 %) that
are recorded in the lower right quadrant are scored positive for DNA
only.
WO 94/02646 PCT/US93/06828
2140278
-52-
EXAMPLE 6
Separation of Fetal Cells from Maternal Blood and the
Use of Fetal-Cell-Specific Antibodies and DNA Probes
to Positively Identify the Fetal Cells
Seoaration of Fetal Cells From Maternal Peripheral Blood
Percoll Stock and gradient solution was prepared in
adherence to the manufacturer's (Pharmacia, Uppsala, Sweden)
recommendations by mixing 9 parts of Percoll with 1 part 1.5 M
NaCI. The density gradient Percoll solutions were prepared according
to Table 8.
TABLE 8
Percoll Stock
Solution 0.15 M NaCI Total Volume
Density
1.065 5.15 ml 4.85 ml 10 ml
1.075 6.00 ml 4.00 ml 10 ml
1.085 6.83 ml 3.17 ml 10 mI
1.100 8.09 ml 1.91 ml 10 ml
To concentrate circulating fetal cells, 10 ml of maternal
peripheral blood from a woman in the first trimester of pregnancy was
overlaid in a 50- mi conical tube on a Percoll discontinuous density
gradient consisting of 10 ml each of gradient solutions with densities
of 1.100, 1.085, 1.075 and 1.065 g/ml from the bottom of the tube
to the top, respectively. The gradient was centrifuged at 360xg for
30 minutes at room temperature. This procedure fractionated the
blood in several layers. The first and second layers from the top of
WO 94/02646 21 40273 PCT/US93/06828
-53-
the gradient contained most of the circulating fetal trophoblasts.
These layers were collected, diluted with PBS to a volume of 50 ml
and centrifuged at 500xg for 5 minutes at room temperature. The
pellet, enriched with fetal cells, was washed twice with PBS and
centrifuged as above, fixed with 75% chilled ethanol and used for
fetal cell identification and genetic disorder testing as described below.
As shown in Figure 4, maternal blood cells were desirably
fractionated into several bands using a four-layer Percoll discontinuous
density gradient (Tube A, B). Bands 1 and 2 from the top of Tube B
were withdrawn and then added to PBS (Tube C) and centrifuged for
5 minutes at 500xg. The cells were resuspended in PBS and
centrifuged as above twice more. The pellet was resuspended in
chilled 75% ethanol at a concentration at 106 cells/mI and used the
same day or stored at 20 C.
Positive Identification of Fetal Cells
A. By Direct Immunofluorescence
About 108 ethanol-fixed maternal blood cells enriched
with fetal cells were microcentrifuged at 1500 rpm for 5 minutes at
room temperature. The pellet was resuspended in 1 ml of buffer A
(8.01 g NaCI, 0.20 g KCI, 1.44 g Na2HPO41 1000 ml distilled,
deionized water) containing 5% fetal calf serum (buffer A/FCS) and
microcentrifuged as stated above.
This wash step was repeated. The final pellet was
resuspended in 100 NI of buffer A/FCS containing 1 NI of anti-human
cytokeratin 18-FITC (Sigma Chemical Company Catalog No. F-4772;
mouse host, IgG class 1, clone CY-90) and incubated in the dark for
1-2 hours while mixing gently on an end-to-end mixer. The reaction
mixture was then washed 3 times with 1 ml buffer A/FCS as above
and the pellet was cytospun on glass slides at 700 rpm for 7 minutes.
Fetal cells were scored using fluorescence microscopy .
WO 94/02646 P(.'I'/US93/06828
2140273 -54-
Figures 6A and 6B show a representation of these fetal
cells stained with anti-human cytokeratin 18-FITC in maternal
peripheral blood as described above.
B. Indirect lmmunofluorescence Labeling
As an alternative to the direct immunofluorescence
described above, an indirect immunofluorescence method can be used.
The procedure was the same as the direct method
(described above), except the cells were first incubated in a 1:200
dilution of anti-human cytokeratin (CAM 5.2 from Becton Dickinson
Catalogue No. 92-0005) in buffer A/FCS for 40 minutes and washed
free of the primary antibody. The cells were then labeled with the
secondary antibody tagged with FITC (anti-mouse tgG + IgM from
goat); (Boehringer Mannheim Biochemicals Catalog No. 605-25) for 30
minutes and washed from the residual antibody as described above.
The cells were scored as above.
C. Sequential Use of Y Chromosome DNA Probe on Fetal Cells
Previously Stained with Anti-Cytokeratin Antibody to Detect
Fetal Cells and Perform Genetic Testing in Maternal Blood
Preoaration of Cells
An additional slide stained with the anti-cytokeratin
antibody as described above was taken through the hybridization
procedure as described below.
Preoaration of Probes
The Y chromosome probes were synthetic
oligodeoxynucleotides complementary to regions of human
chromosome Y. The details regarding the preparation and labeling of
these probes are included in Example 1 and in Table 2.
WO 94/02646 2.140278 PC.'1'/US93/06828
-55-
Hybridization
For the hybridization procedure, 20 ul of a hybridization
cocktail was added to the slide. The cocktail contained PEG, 25%
formamide, 5 x SSC, 1 mg/mI salmon sperm DNA, 15x Ficoll/PVP,
0.4M guanidinium isothiocyanate, 50 mM DTT, 5% Triton X-100, 50
mM EDTA, 50 mM Na2PO4, and the Y chromosome probe at a
concentration of 20 Ng/ml. A coverslip was applied and the slide was
incubated at 85 C for 15 minutes in an incubator.
WashinQ
After hybridization, the slides were placed in a Coplin jar
to which was added 100 ml of Wash Solution #1. The jar was
agitated until the coverslip fell off, and the slide was held in this
solution for 2 minutes. This wash solution was removed and Wash
Solution #2 was added. This second wash solution was agitated for 1
minute and poured off, and this last wash was repeated 6 times.
Following the washes, 8,ul of Mounting solution was added. The slide
was coverslipped and viewed under the fluorescence microscope.
Fluorescence Detection
Slides were screened under 40 x objectives using an
Olympus BH10 microscope with fluorescence capabilities.
Figure 7 shows a cytokeratin-stained fetal cell (brightly
stained cytoplasm) within maternal peripheral blood. The cell has one
Y chromosome within its nucleus that has stained positive following
hybridization with the rhodamine labeled Y chromosome probe.
EXAMPLE 7
Isolation of Trophoblasts from Placenta and Detection of
Chromosomes X, Y and 18 Within Their Nuclei
Trophoblasts were isolated from term placental tissue by
a modified procedure of Wang et. al., American Journal of
Reproductive Immunology 16:8-14 (1988).
WO 94/02646 PCT/US93/06828
21.402-78
-56-
The trophoblasts were then fixed with 75% chilled
ethanol, stained with anti-cytokeratin antibodies as described above
(Example 6) and subsequently hybridized to Y, X and 18 chromosome-
specific probes also as described above in Example 6.
The origin of the probes for chromosome X, Y and 18
was described in Example 1.
The DNA probes were all labeled with a rhodamine
derivative as described in Example 1.
Hybridization, washing and detection was carried out as
described in Example 1.
Figure 8A shows the results with the X-chromosome
probe; 8B, the Y-chromosome probe; and 8C, the chromosome-18-
specific probe. The cytoplasm is stained strongly with the FITC
labeled anticytokeratin antibody. The nuclei in 8A and 8B contain
strong single points of light indicating the presence of singae X and Y
chromosomes. The nuclei in 8C contain two strong points of light
indicating the presence of two chromosomes 18s.
EXAMPLE 8
Use of Fetal-Cell-Specific DNA Probes to Detect Fetal-Cell-Specific
mRNA in Cells Obtained from Amniotic Fluid and/or Placenta
Preparation of Cells
Cells from amniotic fluid were prepared as described
above (Example 1) and cells from placenta were prepared as described
above (Example 7).
Slides containing normal peripheral mononuclear blood
cells were also prepared as described in Example 2
Preparation of Probes
The fetal cell identification probes were accessed via the
Genetic Sequence Data Bank, GenBank, version 69.0 and prepared
from the following gene sequences in Table 9:
WO 94/02646 2140273 PCT/US93/06828
-57-
TABLE 9
Probe GenBank Fluorescent
Designation Locus Name Label
Human Cytokeratin HUMCYTOK Fluorescein or Rhodamine
HCG beta-subunit HUMCG3B Fluorescein or Rhodamine
Alpha Fetoprotein HUMAFP Fluorescein or Rhodamine
The aforementioned sequences were cut into several 39-
base -oligonucleotides and synthesized as phosphorothioate
oligonucleotides using DNA synthesizers (Applied Biosystems DNA
Synthesizer, Model 380B) and using the recommended A.B.I.
reagents. The polysulfurized oligonucleotides were then coupled to a
FITC (Molecular Probes, Inc. Catalogue No. 1-2) or rhodamine
(Catalogue No. T488) and purified by column chromatography and
HPLC. As a negative control probe, the HIV probes described in
Example 10 were used.
Hybridization
For the hybridization procedure, 20 NI of a hybridization
cocktail was added to each slide. The cocktail consisted of 31 % PEG,
25% formamide, 5 x SSC, 1 mg/mI salmon sperm DNA, 15 x
Ficoll/PVP, 0.4M guanidinium isothiocyanate, 50 mM DTT, 5% Triton
X-100, 50 mM EDTA, 50 mM Na2PO4, and probe at a concentration of
20 Ng/mI. A coverslip was applied to each slide and was incubated
for 30 minutes at 42 C.
Washing
After hybridization, the slides were placed in a Coplin jar
to which was added 100 ml of Wash Solution #1. The jar was
agitated until the coverslip fell off, and the slide was held in this
solution for 2 minutes. This wash solution was removed, and Wash
Solution #2 was added. This second wash solution was agitated for 1
WO 94/02646 21402M PCT/US93/06828
-58-
minute and poured off, and this last wash was repeated 6 times.
Following the washes, 8 NI of mounting solution was added. The slide
was coverslipped and viewed under a fluorescent microscope.
Fluorescence Detection
Photomicrographs were taken on an Olympus BH10
microscope with fluorescence capabilities, using Kodak Ektachrome
EES-135 (PS 800/1600) film, exposed, and push processed at 1600
ASA. A 20-second exposure time was consistently used, so that
direct comparisons could be made between all photomicrographs
taken.
In each of the cells in the figures below, the bright light
(in color photographs, it is orange) from both the nuclei and cytoplasm
represent a positive signal. The unstained cells in the photos (in color
photographs, it is a red color due to the counterstain) represent
maternal cells that are negative for the presence of the fetal cell
identification probes.
As a negative control, the HIV probes were hybridized to
these amniocytes and trophoblasts and there was no bright
hybridization signal.
All of the fetal cell identification probes as well as the
HIV probes were used in separate hybridization experiments using
normal white blood cells and these cells had no bright hybridization
signal indicating that they were all appropriately negative.
Figure 9A shows the results when using the cytokeratin
probes to analyze amniocytes (top panel) and trophoblasts (bottom
panel).
Figure 9B shows the results when using the HCG probes
to analyze amniocytes (top panel) and trophoblasts (bottom panel).
Figure 9C shows the results when using the a-fetoprotein
probes to analyze amniocytes (top panel) and trophoblasts (bottom
panel).
WO 94/02646 21402( 8 PCT/US93/06828
-59-
EXAMPLE 9
Use of Anti-Cytokeratin Antibodies and Flow Cytometry
to Detect Fetal Trophoblasts Obtained from Placental Tissue
Preaaration of Cells
Placental trophoblasts were isolated from term placenta
and were fixed in 75% chilled ethanol as described in Example 2. The
fixed cells were stained with anti-cytokeratin and isotope-control
antibodies, both labeled with FITC as stated in Example 6 and
analyzed by flow cytometry.
Flow Cytometer Use and Interpretation
The cells were analyzed on a Profile II system (Coulter
Instruments). The instrument uses a 488 nm argon laser, a 525 nm
band pass filter for FL1. For each sample tested, the sample
containing the isotope control antibody was analyzed first and the
quad-stats were set so that less than 0.2% of the cells fell in the
upper-right quadrant. Next, the sample challenged with the anti-
cytokeratin antibody was analyzed under the same parameters as the
sample challenged with the isotope-control antibody. Since the quad-
stats had been set correctly and the two samples had been handled
identically, the amount of cells above 0.2% that were recorded in the
upper right quadrant were scored as positive.
EXAMPLE 10
Use of HIV DNA Probes to Detect HIV mRNA in
Placental Fetal Trophoblasts or Amniocytes
Preparation of Cells
Trophoblasts are isolated from term placental tissue by a
modified procedure as described in Example 7. Amniocytes are
obtained through amniocentesis. The H9 HIV cell line and peripheral
blood polymorphonuclear cells served as positive and negative
controls, respectively. These cells are washed with nuclease-free PBS
and are placed in a single-cell suspension at a concentration resulting
WO 94/02646 PCT/US93/06828
2140273
-60-
in clearly separated cells. The cells are spun down to a pellet and the
supernatant decanted. The cells are resuspended in 0.5 %
paraformaldehyde and left for 12-16 hours at 4 C. After fixation, the
cells are spun to remove the fixative and then washed once in PBS
and resuspended in 2 x SSC. The cells are used immediately.
Preparation of Probes
A negative control probe, sequences for human
papillomavirus (HPV) type 16 and HPV type 18 (Table 10) were
obtained from the published sequences and were accessed via the
Genetic Sequence Data Bank, GenBank, version 69Ø
TABLE 10
Probe GenBank Fluorescent
Designation Locus Name Label
HPV 16 PPH16 Fluorescein
HPV 18 PPH18 Fluorescein
HIV HUMBH102 Fluorescein
Twenty separate HPV probes (10 for HPV type 16 and
10 for type HPV 18) and 180 HIV probes are synthesized by cutting
the HIV sequences into several 39-base oligonucleotides and
synthesized as phosphorothioate oligonucleotides using DNA
synthesizers (Applied Biosystems DNA Synthesizer, Model 380B) and
using the recommended A.B.I. reagents. The phosphorothioate
oligonucleotides are then coupled to FITC and purified by column
chromatography and HPLC.
Hybridization
For the hybridization procedure, to pelleted cells was
added 50 NI of an hybridization cocktail consisting of 30% formamide,
5 x SSC, 0.16M sodium phosphate buffer, pH 7.0, 1,ug/NI sheared
DNA, 3% (v/v) Triton X-100, 5% PEG 4000, 25 mM DTT, 0.4M
guanidinium isothiocyanate, 15 x Ficoll/PVP, and the probe added at a
WO 94/02646 2140279 PCT/US93/06828
-61-
concentration of 2.5 Ng/mI. Hybridizations were carried out in a
humidified environment at 42 C for 30 minutes.
Washing
Post-hybridization, the cells were placed in a 15 ml
conical tube to which was added 10 ml of Wash Solution #1 (heated
to 42 C). The solution was agitated until the cells were a single-cell
suspension and then spun at 250 x g for 5 minutes. The supernatant
was removed and to the pellet was added 10 ml of Wash Solution #2
(heated to 42 C). The second wash solution was agitated until the
cells were a single-cell suspension. The cells were spun at 250 x g for
5 minutes. The supernatant was removed and the cell pellet
resuspended in 0.2 ml of a PBS counterstain solution containing
0.0025% Evans Blue.
Flow Cytometer Use and Interpretation
The cells were analyzed on a Profile II system as
aforesaid. The instrument uses a 488 nm argon laser, a 525 nm band
pass filter for FL1 and a 635 nm band pass filter for the counterstain.
For each sample analyzed, the sample containing the negative probe
was analyzed first and the quad-stats were set so that less than
0.01 % of the cells fell in the u.pper-right quadrant. Next, the sample
analyzed with the positive probe was analyzed under the exact same
parameters as the sample analyzed with the negative probe. Since the
quad-stats had been set correctly and the two samples had been
handled identically, cells (above 0.01 %) recorded in the upper right
quadrant were scored as positive.
EXAMPLE 11
Synthesis of Multiple-Reporter Labeled Oligonucleotides
To obtain maximum sensitivity, a preferred embodiment
of the present invention employs oligonucleotide probes that are
labeled with multiple reporter moieties, such as fluorescent moieties.
This Example describes the preparation of such probes.
WO 94/02646 PCT/US93/06828
2140278
-62-
Two hundred Ng of dried oligonucleotide is dissolved in
100 NI of 250 mM Tris buffer pH 7.4, to form a first solution. One
mg of iodoacetamido-fluorescein is combined with 100 NI of dry DMF
to create a 200-NI reaction mixture. The two solutions are mixed
together and shaken overnight. This results in an oligonucleotide to
acetamido-fluorescein ratio of 1:5 in the reaction mixture. One mg of
iodoacetamido-fluorescein is again combined with 100 NI of DMF, and
this 100 NI is combined with the 200 NI of reaction mixture. Another
100 NI of 250 mM Tris buffer is added to the 400 NI of reaction
mixture and the reaction is allowed to continue for another 6 hours.
The labeled oligonucleotide is precipitated with ethanol and 3 M
sodium acetate. This crude material is then loaded on to a PD-10
column to remove free dye. The desired fractions are collected. The
liquid phase is then removed under vacuum. The crude material is
then purified by high performance liquid chromatography (HPLC).
EXAMPLE 12
Probes for Both Strands of a DNA Target
The procedure of the Examples above may be modified as
follows:
(1) Four hundred sixteen (416) separate probes (208
for type 16 and 208 for type 18) each designed as 30-bases in length,
are synthesized. However, in addition to making probes corresponding
to those 416 separate oligonucleotides that together comprise probes
for one strand of each of the two HPV targets, one also makes 416
additional oligonucleotide probes for the second strand of both of the
two HPV targets. The probes for the first strand will be "out of
phase" relative to the second strand probes as regards how they map
on a map of the HPV genome. As a result, one-half (15 nucleotides)
of each first strand probe will be complementary (in nucleotide
sequence) to one-half of one second strand probe and the other half
(15 nucleotides) of that first strand probe will be complementary to a
WO 94/02646 2140278 PCT/US93/06828
-63-
portion of another second strand probe. Staggering of the probes
means that, because of the shortness of the overlap (10 nucleotides),
probes of the first strand will not hybridize significantly to probes of
the second strand. On the other hand, about twice as much
hybridization is detected as compared to the situation where only
probes corresponding to one strand are used.
(2) Probes are made as phosphorothioate
oligonucleotides, each 30-mer having four sulfur atoms, using an
Applied Biosystem (ABI) DNA Synthesizer, Model 380B and the
recommended A.B.I. reagents. The sulfur atoms are located as
follows: one is at the extreme 5' end of the probe, a second is
between the 7th and 8th nucleosides (counting from the 5' end), the
third is between the 22nd and 23rd nucleosides, and the fourth is
between the 29th and 30th nucleosides. The sulfur atoms of the
polysulfurized oligonucleotides are then coupled to a fluorescent dye,
iodoacetamido-fluorescein, as follows (smaller amounts can be
synthesized by adjusting the volumes): 200 Ng of dried oligonucleotide
is dissolved in 100 NI of 250 mM Tris buffer, pH 7.4 to form a first
solution. Then 1 mg of iodoacetamido-fluorescein is combined with
100 NI of dry dimethylformamide (i.e., 100 percent DMF) in a second
solution. The two solutions are mixed together and shaken overnight.
After the overnight incubation, the labeled oligonucleotide is
precipitated with ethanol and 3 M sodium acetate. This crude material
is then loaded on to a PD-10 column to remove free dye. The desired
fractions are then collected. The liquid phase is then removed under
vacuum. The crude material is then purified with HPLC (high
performance liquid chromatography).
(3) Negative control probes are constructed in analogy
to steps (1) and (2).
(4) The hybridization cocktail is modified as follows:
1.5% PEG is used instead of 31 % PEG, 30% formamide is used
WO 94/02646 PCT/US93/06828
2140278
-64-
instead of 21 % formamide, 10% DMSO (10% v/v) is included, and
5% (v/v) of vitamin E is included. Also instead of adding 50 NI of the
hybridization cocktail to the slide, 40 NI of the cocktail is added to 5 NI
of squalene plus 5 NI of pyrrolidinone and the combined 50 NI is added
to the slide. It can be useful to add 5 NI of 1 M (1 molar) DTT and 5
NI of Proteinase K (1 mg/mI) solution per 100 NI of hybridization
cocktail and run the hybridization reaction at, for example, 42 C for 5
minutes, then at 95 C for 5 minutes, and then at 42 C for 2 minutes.
It can also be useful to add about 0.05% or 0.10% aurintricarboxylic
acid (ATA) in the hybridization cocktail.
(5) Instead of adding 8 NI of antifade/Hoechst to the
slide, 8 NI of the following solution is added: 9 volumes of solution A
plus 1 volume of solution B where solution A is 0.01 % 1,4
diphenylamine (antifade) plus nuclear stain Hoechst (#33258; 1 Ng/mI)
plus 0.0025% Evans Blue in 50% (v/v) glycerol plus 50% (v/v) 1 x
PBS (0.136 M NaCI, 0.003 M KCI, 0.008 M Na2HPO41 0.001 M
KH2PO4) and solution B is dodecyl alcohol.
EXAMPLE 13
The Use of DNA Probes and In Situ Hybridization to Determine
the Presence of the Philadelphia Chromosome
Preparation of Cells
White blood cells from peripheral blood or bone marrow
from patients with chronic myelogenous leukemia are deposited onto
glass slide by the cytospin method.
Preparation of Probes
Several 25-base synthetic oligonucleotide probes are
prepared from the DNA sequence listed in the table below.
WO 94/02646 21402` 8 PC.'T/US93/06828
-65-
TABLE 11
Probe Chromosome GenBank
Designation Detected LocusName
BCR 22 HUMBCR
Probe Synthesis and Labeling
The oligodeoxynucleotides are synthesized and labeled as
described in Example 1.
Hybridization
For the hybridization procedure, the cells are deposited
onto slides. 20 to 25 NI of a hybridization cocktail consisting of 31 %
PEG, 30% formamide, 5x SSC, 0.1 M sodium phosphate buffer, pH
7.4, 100 Ng/mI low molecular weight, denatured, salmon or herring
sperm DNA, 10% (v/v) Triton X-100, 10% DMSO, 15 x Ficoll/PVP,
0.4 M guanidinium isothiocyanate, 10 mM DTT, and 0.025 M EDTA
and the probe added at a concentration of 20 ug/mI is applied.
A coverslip is applied and the slide is heated to 95 C for
5 minutes, allowed to cool to 42 C. and incubated for 25 minutes at
that temperature.
Washing and Detection
Washing and detection are done as described in
Example 1.
Chronic myelogenous leukemia is associated with a
characteristic chromosomal translocation between chromosomes 9
and 22, resulting in the so-called Philadelphia Chromosome, 22q +.
[See: Rowley, JD: A new consistent chromosomal abnormality in
myelogenous leukemia identified by quinacrine fluorescence and
Giemsa staining. Nature 243:290 (1973); Heisterkamp N, et al.:
Structural organization of the bcr gene and its role in the Ph
translocation. Nature 315:758 (1985)]
WO 94/02646 P(,T/US93/06828
2140273
-66-
Because the probes for the bcr gene are prepared such
that they span the break point cluster region to include both the 5'
and the 3' ends of the gene, when a translocation occurs there are
three points of light ("dots") within the cell. One bright dot would
represent the unaffected chromosome and two less intense dots
would represent the un-translocated 5' bcr gene while the second less
intense dot would represent that 3' end of the bcr gene that
translocated to Chromosome 9.
In an alternative format, sequences from the c-abl gene
that translocate to Chromosome 22 are accessed and prepared as
described above. These sequences are labeled with a second
fluorescent moiety and added to the hybridization solution. Now
when a translocation occurs, one positive signal (representing the 5'
end of the bcr gene still on Chromosome 22) would appear in one
color (e.g., green) and adjacent to another positive signal (representing
the c-abl gene that translocated to Chromosome 22) which would
appear in a second color (e.g., red).
EXAMPLE 14
Detection of the Fragile X Chromosome in Amniocytes and in
Peripheral Blood Mononuclear Cells
Preoaration of Cells
Two ml of Amniotic fluid is diluted to 10 ml with PBS and
centrifuged at 1200 rpm for 10 minutes. The resultant cell pellet is
suspended in 800 NI of ethanol and methanol (v:v, 3:1). 200 ,ul of the
sample is deposited on each slide by the cytospin method. In
addition, approximately 5,000 peripheral blood mononuclear cells
obtained from a normal male are deposited onto a glass slide by the
cytospin method.
Preparation of Probes
A 25-base synthetic oligonucleotide consisting of SEQ ID
NO:3: is synthesized and labeled as described in Example 1.
WO 94/02646 2140278 PCT/US93/06828
-67-
Hybridization, Washina and Detection
Hybridization, washing and detection are done as
described in Examples 1 and 13.
The Fragile X syndrome is caused by mutations that
increase the size of a specific DNA fragment (containing a lengthy
CGG repeat) of the X chromosome (in Xq27.3). See, e.g., Francois
Rousseau, M.D. et al., N Engi J Med, 325:1673-1681 (1991).
Following the aforesaid procedure, when an amplification
of the CGG DNA fragment is present, there is an increase in the
intensity of the signal. Using any of a number of image analysis
systems, this signal is quantified and compared to normal controls to
determine whether or not a Fragile X chromosome, i.e., an
amplification of CGG, is present. Such image analysis systems include,
for example: ACAS 570 from Meridian Instruments, Okemos, MI; and
instruments from Perseptive Systems, Inc., League City, TX; and
Applied Imaging, Santa Clara, CA.
EXAMPLE 15
Concentration of Fetal Nucleated Red Blood Cells Within Maternal
Blood Using Direct Negative Selection Method
A sample consisting of 20 ml of maternal peripheral blood
is diluted to 35 ml with buffer solution A and overlaid on top of 15 ml
Histopaque-1083 in a 50-m1 conical tube. The tube is centrifuged at
700 x g for 30 minutes, and the interphase layer is collected into a
fresh 50-m1 conical tube, the volume then being brought up to 40 ml
with buffer A. The conical tube is then centrifuged for 10 minutes at
1000 rpm (200 x g). The cell pellet is re-suspended in 1 ml of buffer
solution B and mixed with pre-washed immunomagnetic beads coated
with anti-CD45. The bead/cell mixture is allowed to react for 10
minutes, during which the unwanted leucocytes are reacted to the
beads while nucleated red blood cells (NRBCs) stay in the solution. A
magnetic particle concentrator is applied to the side of the reaction
WO 94/02646 PCT/US93/06828
2140278
-68-
tube. The magnetic beads and material complexed thereto collect on
the side of the reaction tube adjacent to the magnet. The supernatant
fluid, containing NRBCs, is then poured off, cytospun, fixed for 5
minutes in 80% ethanol and used for in situ hybridization.
EXAMPLE 16
Concentration of Fetal Nucleated Red Blood Cells Within Maternal
Blood Using Alternate Direct Negative Selection Method
The procedure of Example 15 is performed, but with the
following modification: Instead of using immunomagnetic beads
coated with anti-CD45, a cocktail containing immunomagnetic beads
coated with monoclonal antibodies against various components of
maternal blood (but not fetal erythrocytes) is used to effectively
remove the non-fetal cells as well as platelets from the specimen,
leaving behind the fetal target cells.
Antibody Selection -
To determine whether a particular antibody or mixture of
antibodies would be suitable for use in accordance with the present
invention, the following procedure may be performed:
Perform a density separation on a sample of umbilical
cord blood as in Example 4. Resuspend the buffy coat in 1 ml of
Buffer Solution B. Prepare a control slide by cytospinning 50 NI of this
cell suspension and fixing by dipping slide in 3:1 ethanol/methanol.
Prepare a test slide by removing a sample of 1 x 106 cells from the
aforesaid buffy coat resuspension and adding 20 /,rg of the antibody to
be tested, coupled to magnetic beads. Prepare the cells as described
in Example 6. Perform microscopic examination of slides as in
Example 6 and determine the ratio of fetal nucleated red blood cells to
total cells on each slide. If the ratio for the test slide is between 75%
and 125% of the corresponding ratio for the control slide, the
antibody is considered acceptable. For example, an acceptable result
~ ~ ~ 0278 PC'T/US93/06828
WO 94/02646
-69-
would be a control slide having 5 NRBCs per 10,000 cells and the
corresponding test slide having 4 NRBCs per 10,000 cells.
EXAMPLE 17
Concentration of Fetal Nucleated Red Blood Cells Within Maternal
Blood Using Indirect Negative Selection Method
A 20-mi sample of maternal peripheral blood is diluted to
36 ml with buffer solution A and overlaid on the top of 15 ml of
Histopaque 1083 in a 50-m1 conical tube. The tube is centrifuged at
700 x g for 30 minutes, and the interphase layer (buffy coat) is
collected into a fresh conical tube. The volume is then brought up to
40 ml with buffer solution A and the tube is centrifuged for 10
minutes at 200 x g. The cell pellet is re-suspended in a solution
containing monoclonal antibody. The monoclonal antibody is anti-
CD45 or a mixture of monoclonal antibodies selected from the group
consisting of anti-CD45, anti-CD34, anti-CD12, anti-CD31, and anti-
CD44 in a 1-mi reaction volume. The cells are allowed to react with
the antibody for 30 minutes at 4 C. The mixture is then
microcentrifuged at 500 rpm for 5 minutes, and the supernatant is
aspirated off. The cell pellet is washed with 1400 ml of the reaction
buffer (buffer solution A), and the pellet is re-suspended in 1 ml buffer
solution B. The cell suspension is then mixed with pre-washed bends
coated with sheep anti-mouse IgG, and the mixture is allowed to react
for 10 minutes during which most of the non-wanted cells (leucocytes
and erthyrocytes) react with the beads, forming cell/bead complexes.
The complexes are then removed from the reaction by a magnetic
particle concentrator, which collects the complexes on the side of the
reaction tube. The supernatant containing NRBC's is directly loaded
on cytospin to make slides. The slides are fixed with 80% ethanol
and used for fluorescent in situ hybridization.
CA 02140278 2007-10-16
-70-
EXAMPLE 18
Detection of Feta! Nticleated Red Blood Cel{s Enriched from Maternal
Blood and Simultaneous Detection of Chromosome Abnormalities
Slides prepared in accordance with Examples 15, 16 and
17 are hybridized on slides in a single step using probes for fetal
hemoglobin mRNA as in Example 3 and probes for human chrosomes
as in Example 4.
A fetal nucleated red blood cell that was hybridized simultaneously
to DNA probes specific to fetal hemoglobin mRNA as described in Example 4,
part B and to probes for human chromosomes X and Y as described in
Example 4, part A was obtained. A greenish cytoplasm indicates that the cell
is
a fetal nucleated red blood cell, due to signal from fluorescein-labeled probe
for
HbF mRNA. A green dot within the nucleus is a signal for X chromosome, from
fluorescein-labeled probes for X. A red dot within the nucleus is a signal for
Y
chromosome, from rhodamine-labeled probes for Y.
EXAMPt-E 19
Detection of Fetal Nucleated Red Blood Cells Enriched From Maternal
Blood Using Indirect Immunof{uorescence Techniques
An alternative procedure for detecting fetal cells is to
perform ttie procedure of Exarriple 18, rYiodified as follows: Iristead of
using DNA probes to fetal hemoglobin mRNA, monoclonal antibody
against fetal hemofllobin protein (Accurate Chemical, cat. no. IRXG-
11149) is useci. Enric:hed cells are fixed in 2% paraformaldehyde for
two ttours, wastieci free of fixative and reacted witti a 1:100 dilution
of anti-HbF antibody for 30 min. The amount of antibody added is 2-
20 Ng per million fetal erythrocyte cells in the sample. The excess
antibody is rernoved by washing the cells twice with PBS. Next the
cells are stained for 30 min. with a 1:100 dilution of a monocional
antibody that selectively binds to the anti-HbF antibody (Etiro-Path,
Ltd.) and that is tagged with alkaline phosphatase. Excess antibody is
2140273 WO 94/02646 PCT/US93/06828
-71-
removed by washing with PBS, and Vector Red as a substrate (Vector
Chemical Co.) is added to the cells. In a later step, excess substrate
is washed off. The cells are cytospun on glass slides and used for in
situ hybridization, as in Example 18.
EXAMPLE 20
Enrichment of Fetal Cells Within Maternal Blood
By Lysing Maternal Erythrocytes
Maternal blood specimens are treated with 0.075 M KCI
for 15 min at 37 C. This treatment selectively lyses maternal
erythrocytes, leaving intact all nucleated cells present in the sample.
The lysate is then contacted with beads coated with anti-CD45 or,
more generally, with one or more antibodies against cell surface
antigens of maternal blood cells. The mixture is aliowed to react. The
beads along with cells ligated thereto are then removed from the
mixture with a magnetic particle collector. The remaining liquid,
containing primarily fetal nucleated erythrocytes, is used to make
cytospun slides as described hereinabove. This procedure may be
performed entirely in an automated device.
The foregoing description of the preferred embodiments
of the invention has been presented for purposes of illustration and
description. It is not intended to be exhaustive or to limit the
invention to the precise form disclosed, and obviously many
modifications and variations are possible in light of the above
teaching. The embodiments were chosen and described in order to
best explain the principles of the invention and its practical application
to thereby enable others skilled in the art to best utilize the invention
in various embodiments and with various modifications as are suited
to the particular use contemplated. It is intended that the scope of
the invention be defined by the claims appended hereto.
CA 02140278 2004-02-09
~= - ~ .
-72-
SEQUENCE LISTING
(1) GENERAL INFORMATIONs
(i) APPLICANT: Aegari, Morteza
Prashad, Nagindra
Cubbage, Michael. Lee
Ju, Shyh-chan
Slick, Mark
Bresser, Joel
(ii) TITLE OF INVENTION: Enriching and Identifying Fetal
Celle In Maternal Blood For In Situ
Hybridization
(iii) NUMBER OF SEQUENCESs 21
(iv) CORRESPONDENCE ADDRESS:
(A) ADDRESSEE: James F. Weller, Attorney-at-Law
(B) STREETt One Riverway, Suite 1560
(C) CITY: Houston
(D) STATEs Texas
(E) COUNTRYs USA
(F) ZIPt 77056
(v) COMPUTER READABLE FORMs
(A) MEDIUM TYPE: Floppy disk
(B) COMPUTER: IBN PC compatible
(C) OPERATING SYSTEM: PC-DOS/MS-DOS
(0) SOFTWAREs WordPerfect 5.1
(vi) CURRENT APPLICATION DATA:
(A) APPLICATION NUMBER:
(B) FILING DATEs 7-19-93
(C) CLASSIFICATION:
(viii) ATTORNEY/AGENT INFORMATION:
(A) NAME: Weiler, James F.
(8) REGISTRATION NUMBERs 16,040
(C) REFERENCE/DOCKET NUMBER: D-5507 CIP PCT
(ix) TELECOMMUNICATION INFORMATION:
(A) TELEPHONE: 713-626-8646
(B) TELEFAX: 713-963-5853
(2) INFORMATION FOR SEQ ID NO:1:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTHt 24 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGYt linear
(ii) MOLECULE TYPE: DNA (genomic)
(iii) HYPOTHETICALs NO
CA 02140278 2004-02-09
-73-
(iv) ANTI-SENSEt NO
(xi) SEQUENCE DESCRIPTIONt SEQ IO NO:lt
ATCGAGTAGT GGTATTTCAC CGGC 24.
(2) INFORMATION FOR SEQ ID NOt2t
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 25 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULS TYPE: DNA (genomic)
(iii) HYPOTHETICALs NO
(iv) ANTI-SENSEs NO
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:2:
TACGCTCGAT CCAGCTATCA GCCGT 2S
(2) INFORMATION FOR SEQ ID NO:3:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 25 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPEt DNA (genomic)
(iii) HYPOTHETICAL: NO
(iv) ANTI-SENSEt NO
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:3:
CGGCGGCGGC GGCGGCGGCG GCGGC 25
(2) INFORMATION FOR SEQ ID NOS4:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTHs 443 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: DNA (genomic)
(iii) HYPOTHETICAL: N
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:4:
ATGGGTCATT TCACAGAGGA GGACAAGGCT ACTATCACAA GCCTGTGGGG CAAGGTGAAT 60
GTGGAAGATC CTGGAGGAGA AACCCTGGGA AGCTCCTGGT TGTCTACCCA TGGACCCAGA 120
GGTTCTTTGA CAGCTTTGGC AACCTGTCCT CTGCCTCTGC CATCATGGGC AACCCCAAAG 180
TCAAGGCACA TGGCAAGAAG GTGCTGACTT CCTTGGGAOA TGCCATAAAG CACCTGGATG 240
CA 02140278 2004-02-09
-74-
ATCTCAAGGG CACCTTTGCC CAGCTGAGTG AACTGCACTG TGACAAGCTG CATGTGGATC 300
CTGAGAACTT CAAGCTCCTG GGAAATGTGC TGGTGACCGT TTTGGCAATC CATTTCGGCA 360
AAGAATTCAC CCCTGAGGTG CAGGCTTCCT GGCAGAAGAT GGTGACTGGA GTGGCCAGTO 420
CCCTGTCCTC CAGATACCAC TGA 443
(2) INFORMATION FOR SEQ ID NOt5t
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTHs 25 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGYs linear
(ii) MOLECULE TYPE: cDNA to mRNA
(iii) HYPOTHETICAL: N
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:5:
TCAGTGGTAT CTCGAGGACA GGGCA 2g
(2) INFORMATION FOR SEQ ID NOt6:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 25 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPEt cDNA to mRNA
(iii) HYPOTHETICAL: N
(xi) SEQUENCE DESCRIPTIONs SEQ ID NO:6:
CTGGCCACTC CAGTCACCAT CTTCT 25
(2) INFORMATION FOR SEQ ID NO:7:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 25 base pairs
(B) TYPEt nucleic acid
(C) STRANDEDNESSs single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPEt cDNA to mRNA
(iii) HYPOTHETICAL: N
(xi) SEQUENCE DESCRIPTIONt SEQ ID NO:?:
GCCAGGAAGC CTGCACCTCA GGGGT 25
(2) INFORMATION FOR SEQ ID NOsS:
(i) SEQUENCE CHARACTERISTICSs
(A) LENGTHs 25 base pairs
(B) TYPE: nucleic acid
CA 02140278 2004-02-09
-75-
(C) STRANDEDNESSt single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: cDNA to mRNA
(iii) HYPOTHETICAL: N
(xi) SEQUENCE DESCRIPTION: SEQ ID N0:8:
G1IATTCTTTG CCGAAATGGA TTGCC , 2'6.
(2) INFORN,ATION FOR SEQ ID N019:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 25 baee pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: cDNA to mRNA
(iii) HYPOTHETICAL: N
(xi) SEQUENCE DESCRIPTION: SEQ ID N0:9:
AAAACGGTCA CCAGCACATT TCCCA 2S_
(2) INFORHATION FOR SEQ ID N0:10:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 25 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: cDNA to mRNA
(iii) HYPOTHETICAL: N
(xi) SEQUENCE DESCRIPTIONt SEQ ID NO:10:
GGAGCTTGAA GTTCTCAGGA TCCAC ZS
(2) INFORMATION FOR SEQ ID NO:llt
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 25 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGYt linear
(ii) MOLECULE TYPEt cDNA to mRNA
(iii) HYPOTHETICAL: N
(xi) SEQUENCE DESCRIPTION: SEQ ID N0:11:
ATGCAGCTTG TCACAGTGCA GTTCA 2S_
CA 02140278 2004-02-09
_76-
(2) INFORMATION FOR SEQ ID NO:12:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTHt 25 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: cDNA to mRNA
(iii) HYPOTHETICAL: N
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:12:
CTCAGCTGGG CAAAGGTGCC CTTGA 25
(2) INFORMATION FOR SEQ ID N0:13:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 25 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESSs single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: cDNA to mRNA
(iii) HYPOTHETICAL: N
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:13:
GATCATCCAG GTGCTTTATG GCATC 25'
(2) INFORMATION FOR SEQ ID N0:14:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 25 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: cDNA to mRNA
(iii) HYPOTHETICAL: N
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:14:
TCCCAAGGAA GTCAGCACCT TCTTG 25
(2) INFORMATION FOR SEQ ID NO:15:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 25 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: cDNA to mRNA
(iii) HYPOTHETICAL: N
CA 02140278 2004-02-09
.77_
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:15s
CCATGTGCCT TGACTTTGGG GTTGC 25
(2) INFORMATION FOR SEQ ID NOs16s
(i) SEQUENCE CHARACTERISTICSs
(A) LENGTH: 25 baee paire
(B) TYPE: nucleic acid
(C) STRANDEDNESS: =ingle
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: cDNA to mRNA
(iii) HYPOTHETICAL: N
(xi) SEQUENCE DESCRIPTIONs SEQ ID NO:16z
CCATGATGGC AGAGGCAGAG GACAG 3S
(2) INFORMATION FOR SEQ ID NO:17:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 25 base paire
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGYt linear
(ii) MOLECULE TYPE: cDNA to mRNA
(iii) HYPOTHETICAL: N
(xi) SEQUENCE DESCRIPTIONs SEQ ID NO:17:
GTTGCCAAAG CTGTCAAAGA ACCTC 25
(2) INFORMATION FOR SEQ ID NO:18t
(i) SEQUENCE CFiARACTERISTICS:
(A) LENGTH: 25 baee pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: cDtiA to mRNA
(iii) HYPOTHETICALs N
(xi) SEQUENCE DESCRIPTION: SEQ ID.N0:18s
TGGGTCCATG GGTAGACAAC CAGGA 25
(2) INFORMATION FOR SEQ ID NO:19:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTHt 25 base pairs
(8) TYPEs nucleic acid
CA 02140278 2004-02-09
.76.
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
MOLECULE TYPE: cDNA to mRNA
(iil) HYPOTHETICALs N
(xi) SEQUENCE DESCRIPTION: SEQ ID NOt19s
GCTTCCCAGO GTTTCTCCTC CAGCA 25
(2) INFORMATION FOR SEQ ID NO:20t
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 25 baee pairs
(B) TYPEt nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: cDNA to mRNA
(iii) HYPOTHETICAL: N
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:20:
TCTTCCACAT TCACCTTGCC CCACA ZS
(2) INFORMATION FOR SEQ ID NO:21:
(i) SEQUENCE CHARACTERISTICS:
.(A) LENGTH: 25 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPEs cDNA to mRNA
(iii) HYPOTHETICALs N
(xi) SEQUENCE DESCRIPTION: SEQ TD NO:21s
GGCTTGTGAT AGTAGCCTTG TCCTC 2S
