Note : Les descriptions sont présentées dans la langue officielle dans laquelle elles ont été soumises.
,o 94/0~680 2 1 ~ 2 8 6 PCr/lJS93/07645
HUMAN INTERLEIJKIN- 13
The present invention relates to compositions and methods for
affecting the human immune system. In particular, it provides
nucleic acids, proteins, and antibodies which regulate immune
system response and development. Diagnostic and therapeutic uses
of these materials are also disclosed.
BACKGROUND OF ~ INVI~TION
For some time, it has been known that the mammalian
0 immune response is based on a series of complex cellular
interactions, called the "immune network." Recent research has
provided new insights into the inner workings of this network.
While it remains clear that much of the response involves !:
network-like interactions of lymphocytes, macrophages,
granulocytes, and other cells, immunologists now generally hold the
opinion that soluble proteins, known as lymphokines, cytokines, or ! :
monokines, play a critical role in controlling these cellular
interactions.
In view of their importance, there is a need to identify and
isolate new lymphokines. --
SUMMARY OF THE INV~1TION
The present invention fills this need by providing one such --
new lymphokine. More particularly, this invention provides human
inte~leukin-13 ~IL-13), and methods for its use.
2s This invention also provides nucleic acids coding for - -
polypeptides themselves and methods for their production and use.
The nucleic acids of the invendon are characterized by ~h=eir--
homology to cloned complementary DNA (cDNA) sequences--eac-losed
herein, and/or by functional assays for IL-l 3 activity applied to the ;
3 o polypeptides, which are typically encoded by these nucleic acids.
WO 94/04680 2 i ~ ~ 8 ~ 0 2 PCI~US93tO7645 ` .
' .
. ''`'
.: .
Methods for modulating or intervening in the control of an immune
response are provided.
The invention is based, in part, on the discovery and cloning of
human cDNAs which are capable of expressing proteins having
IL-13 activity. cDNA clones include human cDNA inserts of plasmid ~-
vectors pB21.2Bf and pA10.66, which contain partial and full length -
sequences, respectively. Equivalent vectors may be constructed by
using polymerase chain reaction (PCR) techniques and the sequences
of the inserts.
0 The present invention provides an isolated nucleic acid -~
comprising a segment homologous to a sequence of human IL-13
disclosed in Tab!e 1. Typically, the segment is at least about 50
nucleotides, and will often encode a protein exhibiting a biological
activity characteristic of a human IL-13, e.g., an amino acid -
sequence of Table 1. In other embodiments, the segment is at least
80% homologous to the coding sequence disclosed in Table 1. In `-~
other embodiments, the nucleic acid will further encode a second `
protein. The invention also encompasses a vector or a cell
containing the nucleic acid.
; ~ Alternatively, the nucleic acid can be a recombinant nucleic
acid ~with~ a segment homologous to a sequence of human IL-13 ;~
disclosed in Table 1. Usually, this will encode a human IL-13 or ;
may encode a fusion protein. The invention also embraces vectors,
e.g., expression vectors? and cells containing the nucleic acid.
2s ~ In alternative embodiments, the invention provides an ~`~
isolated human IL-13 protein or peptide. In-~~`some embodiments, the
protein has a full length sequence di~closod- in ~Table 1, or will be a
mutein thereof, and may include an altered post-translational r~'
modificàtion pattern, e.g., glycosylatiQn variants. Other ! ~'4,
30 embodiments include a fusion protein~ comprising a peptide of
human IL-13, and cells containing such.
In anothcr embodimcnt, the in~on provides a method of
refolding a guanidine denatured moùse-P600 or human IL-13 ~;
protein comprising solubilizing said protein in 6M guanidine at a
3s concentration of about 2.5 mg/ml; diluting the guanidine to about 60
mM over a period of hours in the presence of both reduced and
- .
~ 94~04680 2 1 4 2 8 6 1) P~/US93/0764~
oxidized glutathione; and incubating the~diluted guanidine solution
for at least about 12 hrs.
The invention also provides an antibody which specifically
binds to human IL-13, e.g., a mouse, a monoclonal, or a chimeric
s antibody. It also provides a method of supporting monocyte or B
cell proliferation in a sample, or sustaining viability of said cell, by
contacting the sample with an effective amount of human IL-13,
alone or in combination with another cytokine, e.g., IL-4 or IL-10.
In some embodiments, methods are provided for detecting human
0 IL-13 in a sample by contacting the sample with a binding
composition which recognizes human IL-13 or a nucleic acid which
hybridizes to a nucleic acid encoding a human IL-13. The binding
composition can be a monoclonal antibody, and the sample can be a
blood sample.
In other embodiments, the invention provides methods of
moduladng the growth of a hemopoietic B cell or T cell by contacting
the cell with an effective amount of an IL-13 and ~-4 combination
or antagonists thereto, including an IL-4 antagonist. The `
hemopoietic cell growth can be accompanied by cell differentiation
to antibody producing cells.
The invention further provides methods of modulating
proliferadon of a mycloid precursor cell by contacting the eell with
an~ effective amount of a human IL-13, mouse P600, or agonists or
antagonists thereof. ~ Often the modulating proliferation is
2s accompanied by cell differentiation.
Methods of modulating the immune response to an infection or~
allergen are provided, e.g., by administering an effective amount of ~
a human IL-13, mouse P600, or agonists or antagonists thereof,
including an IL-4 antagonist. And the ihvention provides methods
of sustaining cell viability of a myeloid precursor cell by- contacting
the cell with an effective amount of a human IL-13, a mouse P600,
or an agonist or antagonist thereof, including an IL-4 antagonist-,~ and
combinations with additional cytokines, including IL-4 a-d IL-10.-
wo 94/04680 2 1 4 2 8 6 ~) 4 Pcr/uss3/076~s
DES~ TIQN OF THE INVEN~ON
A11 references cited herein are hereby incorporated in their
entirety by reference.
I. Gen~al
The present invention provides the amino acid se~uence and
DNA sequence of human interleukin molecules having particular
defined properties, both structural and biological, designated herein
as human interleukin-13 (IL-13). This molecule was obtained using ~"~
a mouse gene encoding a related mouse protein designated P600. -~
0 Some of the standard methods are described or referenced,
e.g., in Maniatis et al. (1982) Molecular Cloning, A Laboratory
Manual, Cold Spring ~arbor Laboratory, Cold Spring EIarbor :Press;
~ambrook et al. (1989) Molecular Cloning: A Laboratory Manual, (2d -~
ed.), vols 1-3, CSH Press, NY; Ausubel e~ al., Biology, Greene ,
Publishing Associates, Brooklyn, NY; or Ausubel et al. (1987 and
periodic supplements) Current Protocols in Molecular Biology,
Greene/Wiley, New York.
Isolation of the human gene presented obstacles which
prevented others from succeeding. Earlier attempts to isolate the `
2 o human homolog of the mouse P600 protein using oligonucleotide
probes and primers ended in failure. Difficulties in using such
methods often arise from the inability-- to selec~ probes of sufficient
length which provide a sufficient signal to noise ratio to allow
isolation of correct clones. Moreover,- mar~y mouse cell lines fail to
produce detectable levels of mRNA-for the mouse gene, even using
highly sensitive polymerase chain reaction (PCR) techniques.
Because the homology of the mouse and human genes is
relatively low, about 60%, relatively-long probes ale needed to I ~
provide sufficiently high homology to assure a discernable positive ¦ `
signal by hybridization. But before- isolation of the human gene, it
was impossible to know the degree of homology or to predict which
regions of the target gene exhibit high homology from which the
probe should be selected. In fact, multiple attempts using various
~ 94/04680 2 1 ~ 2 8 6 o PCI`/US93/07645
pro~es, alone or in combina~ion, to isolate the gene from various
libraries ended in failure.
The library from which an intermediate clone of less than full
length was isolated failed to provide the correct clone when
s screened with oligonucleotide or genomic DNA probes. In fact,
clones isolated using the genomic mouse sequence as a probe turned
out to be false positives, i.e., they did not encode the human
equivalent as evaluated by sequencing. At least one other research
group also failed to isolate the gene using a similar approach.
0 A different approach was devised which successfully led to
isolating a human homolog to the mouse P600 gene. Instead of
using oligonucleotide probes of relatively short length, a probe -
corresponding to nearly the full length coding region of the nouse
gene was used. Moreover, the cell type used to make the cDNA
library was quite important. As indicated above, expression of the
mouse gene varied dramatically in different cell types. The human
B21 cdls used to produce the cDNA library which provided the
positive clone described herein turn out to be a cell type which
expresses the human gene at a relatively high level.
2 o However, this fact was not apparent when the earlier
screening was performed. In addition, the positive signal arising
;~ from the hybridization was difficult to distinguish from background.
The hybridization and wash conditions used in the screening were
quite important, and slightly more harsh wash conditions could hàve
easily eliminated any positive signal. See, e.g., Wetmur et al., J.
Molecular Biology 31 :34g (1968).
The initially isolated clone, designated pB21.Bf2, was less than ~
full length. lsolating a full length clone required use of yet another
cDNA library. Thus, the isolation of the full length human clone,
designated pAl0.66 rcquired investment of significant time and ~` l;
resources. After knowing the regions of high homology between- the
mouse and human genes, isolation using oligonucleotide probes~--~f--
reladvely short length would now be relatively straightforwar~~~
The procedure used to isolate the human IL-13 is broadly set
3s forth below. A cDNA library, constructed in a pCD vector,~was
preparcd from RNA isolated from human B21 cells. These cells are
wo 94/04680 Pcr/uss3/0764~
21~286U 6
.
human T cells which, it is now understood, exhibit many of the same
markers as the cells providing the mouse clone. Several
modifications and unusual techniques were utilized to overcome
problems associated with isolating a cDNA clone when probing the .
library with oligonucleotides.
In particular, instead of using oligonucleotide probes of
relatively short length, a near full length double stranded probe of :
about 400 nucleotides was selected. Although previous attempts
using a B21 derived cDNA library had failed, the near full length
o double stranded probe provided faint positive signals. Although ;~
several experienced molecular biologists were highly skeptical that
the faint signals were real, continued pursuit of those signals led to
ultimate success. - ;
The initial human isolate showed homology to the mouse gene,
but lacked part of the amino terminal coding portion. Thus, this
intermediate isolate was less than a full length clone. Attempts to
isolate a full length clone from the B21 derived library failed. 1 `
However, upon selection of another cDNA library, the near full , `
length human probe allowed isolation of the full length human clone.
A complete nucleotide and deduced amino acid sequence of ¦ `
the pA10~66 clone is shown in Table 1. This nucleotide sequence
corresponds to the sequence ~efined by SEQ ID NO: 1. Table 2
compares the gene sequence of Table 1 to a published gene
sequence of the mousè P600 protein. -Table 3 compares the deduced ~
2 5 amino acid sequence of the human IL- 13 and the published mouse ~;
P600 amino acid sequence.
;
l`.
.
. ..
~ 94/n4680 7 2 1 ~ 2 8 6 ~
Table 1: Nucleotide and Amino Acid Sequence~of.huIL-13.
TTCGGCAICC GCTCCTCAAT CCTCTCCTGT lGGcacTGGG CCTC ATG GCG CTT TTG 56
Met Ala Leu Leu
~ '.
TTG ACC ACG GTC ATT GCT CTC ACT TGC CTT GGC GGC m GCC TCC CCA 104.
Leu Thr ~hr Val Ile Ala Leu Thr Cys Leu Gly Gly Phe Ala Ser Pro
5 10 15 20
GGC CCT GTG CCT CCC TCT ACA GCC CTC AGG GAG GTC AIT GAG GA~ CTG 152 ~;
Gly Pro Val Pro Pro Ser Thr Ala Leu Arg Glu L2u Ile Glu Glu Leu
25 30 35
GTC AAC ATC ACC QG AAC CAG A~G GCT CCG CTC TGC A~r GGC AGC ATG 200
Val Asn Ile Thr Gln Asn Gln Lys Ala Pro Leu Cys Asn Gly Ser Me.t
40 45 50
GTA TGG AGC ATC A~C CTG ACA GCT GGC ATG TAC TGT GCA GCC CTG G~A 248
Val Trp Ser Ile Asn Leu mr Ala Gly Met Tyr Cys Ala Ala Leu ~lu
TCC CTG ATC AAC GTG TCA GGC TGC AGT GCC ATC G~G AAG ACC C~G AGG 296
25 Ser Leu Ile Asn Val Ser Gly Cys Ser Ala Ile Glu Lys T~ Gln Arg .
70 75 80
AIG CTG AGC GGA TTC TGC CCG CAC AAG GTC TCA GCT GGG CAG TTT TCC 344
Met Leu Ser Gly Phe Cys Pro His Lys Val Ser Ala Gly Gln Phe Ser
85 90 95 100
AGC TTG CAT GTC CGA GAC ACC AAA ATC G~G GTG GCC CAG TTT GTA AAG 392
Ser Leu Hls Val Arg Asp Thr Lys Ile Glu Val Ala Gln Phe Val Lys
lQ5 ~ 110 115
GAC CTG CTC TTA C~T TTA AAG AAA CTT m CGC GAG GGA CGG TTC AAC 440
Asp Leu Leu Leu His Leu Lys Lys Leu Phe Arg Glu Gly Arg Phe Asn
120 125 130
5~AAa~T~CG AAAGCATC~T T~IIIGCAGA GACAGGACCT GACTATTGAA GTTGCaGA~T 500 -
CAITITTC~T TCTGalGT~A AAAAIGTCTT GGGTAGGCGG GAAGGAGGGT TA~GG~GGGG 560
TAAAATTCCT TA~CTTA~AC CTCAGCCTGT GCTGCCCGTC TTCAGCCTAG CCG~CCTCAG 620 -- ~ ~`
CCTTCCCCTT GCCCAGGGCT C~GCCTGGTG GGCCTCCTCT GTCCAGGGCC CTGAECTCGG 680
TGGACCCAGG GalGACAIGT CCCTA~A~CC CTCCCCTGCC CTAGAGCACA CTGTA~C~T 740 --
ACaGlGGGTG CCCCCCTTGC CaGPCAIGTG GTGGGACAGG G~CCACTTC ALACACAGGC 800
Aa~TGAGGCA GACAGCAGCT CPGGCACACT TCTTCIIGGT CTTAITTAIT ATIGTGIGTT 860
W O 94/04680 PCT/US93tO764~
21~2860 `~ ~
A m AAAlGA GTGT~ l~T CACCG~TGGG GhIlG3GGL~ GPCIGTGGCT GCTGGCPCTT 920 .~`
GGAGCCAAGG GITCAG~G~C TCAGGGCCCC ACCACTAAAG CAGTGG~CCC CAGGA~TCCC 980 ;`
5 TGGT~AI~AG TA~IGIGTAC AGa~SClGC TACCTCACTG GGGTCCTGGG GCCTCGGAGC 1040 .".
CTCA~CCG~G GC~EGGTCAG GPGAGGGGCA GA~CAGCCGC TCCTGTCTGC CAGCCAGCAG 1100
CCaaCTCTC~ GCC~ACG~GT AAITTAIIGT TTTTCCTCGT AITTA~ATAT TA~ATAIGIT 1160
''`
AsCAaAGaGT TAAI~T~TAG AA~GGTACCT TGAACACTGG GGG~GGGGAC AIIG~ACAAG 1220
TrGrTTCaTT GACTAICAAA CTG~AGCCA~ A~ATAAA~TT GGTGa~AEAT AL~UL~AaAA 1280
15 AL~a~ 12 90 `
.
~ 94/04680 2 1 'I ~ 8 6 ~ PCT/US93/07~5
Table 2: Comparison of Human IL-13 and Mouse P600 Nucleic Acid
Seqllences (human abo~e; mouse below).
TTCGG CATCCGCTCC TCAATCCTCT 25
1 1 1
GACAA&CCAG CAGCCTAGGC CAGCCCACAG TTCTACAGCT CCCTGGTTCT 50
CCTGTTGGCA CTGGGCCTCA TGGCGCTTTT GTTGACCACG GTCATTGCTC 75
IIII IIIIII III III~111 1 1 1111 1 111 1 1111
CTCACTGGCT CTGGGCTTCA TGGCGCTCTG GGTGACTGCA GTCCTGGCTC 100
TCACTTGCCT TGGCGGCTTT GCCTCCCCAG 5CC~ ---- CTGTG 113
1111111 111 11 1 111 111111 1 1 11111
TTGCTTGCCT TGGTGGTCTC GCCGCCCCAG GGCCGGTGCC AAGATCTGTG 150
CCTCCCTCTA CAGCCCTCAG GGAGCTCATT GAGGAGCTGG TCAACATCAC 163
III I II IIIIII IIIIIIIII
TCTCTCCCTC TGACCCTTAA GGAGCTTATT GAGGAGCTGA GCAACATCAC 200
CCAGAACCAG AAGGCTCCGC TCTGCAATGG CAGCATGGTA TGGAGCATCA ~13
Il 11111 1 1111 1 1 11111 11 1111111111 Illli I
ACAAGACCAG A---CTCCCC TGTGCAACGG CAGCATGGTA TGGAGTGTGG 247
ACCTGACAGC TGGCATGTAC TGTGCAGCCC TGGAATCCCT GATCAACGTG 263
IIIII I II IIII II I II11 11111 1111 11111 11 11'11 1
ACCTGGCCGC TGGCGGGTTC TGTGTAGCCC TGGATTCCCT GACCAACATC 297
TCAGGCTGCA GTGCCATCGA GAAGACCCAG AGGATGCTGA GCGGATTCTG 313
II IIII IIIIIII I I IIIIIII.11111 11 11 1111
TCCAATTGCA ATGCCATCTA CAGGACCCAG AGGATATTGC ATGGCCTCTG 347
CCCG-CACAAG GTCTCAGCTG GGCAGTTTTC CAGCTTGCAT GTCCGAGACA 363
I I I I I I I I I I I I I I I I I I I I I
TAACCGCAAG GCCCCCACT- --ACGGTCTC CAGC------ CTCCCCGATA 388
CCAAAATCGA GGTGGCCCAG TTTGTAAAGG ACCTGCTCTT ACATTTA~AG 413
1111111111 11 11111 111 111 1 111111 1 1111
CCAAAATCGA AGTAGCCCAC TTTATAACAA AACTGCTCAG CTACACAAAG 438
AAACTTTTTC GCGAGGGACG GTTCAACTGA AACTTCGA~A GCATCATTAT 463
CAACTGTTTC GCCACGGCCC CTTCTAATGA ~ --------- 468
W094/~680 PCT/~S93/07~5
10 , ' ` '
~14286Q ;
TTGCAGAGAC AGGACCTGAC TATTGAAGTT GCAGATTCAT TTTTCTTTCT 513
IIIIII IIII -
5 --GGAGAGAC CATCCCTGGG CATCTCAGCT GTGGACTCAT TTTCCTTTCT 516 -
:.
GATGTCAAAA ATGTCTTGGG -TAGGCGGGA AGGAGGGTTA GGGAGG-GGT 561
111 1 1. Il 111 1111 11 111111111 11111
CACATCAGAC TTTGCTGGGG AGAGGCAGGG AGGAGGGTTG AGGAGGAAGG 566
AAAATTCCTT AGCTTAGACC TCAGCCTGTG CTGCCCGTCT TCAGCCTAGC 611 ~:~
II III IIIII I II IIIIIIII IIIII I II I I `:'
GAGATGCCTC AGCTTTGGCC TCAGCCTGCA CTGCCTGCCT AGTGCTCAG- 615
CGACCTCAGC CTTCCC~TTG CCCAGGGCTC AGCCTGGTGG GCCTCCTCTG 661 `
II III IIIIIII ''':
20 --~ -GGTCTC AGCCTGG--- -~ 628
~ .
. .
~ "
,;
TCCAGGGCCC TGAGCTCGGT GGACCCAGGG ATGACATGTC CCTACACCCC 711
II III I I I IIII I I II I IIII '`~'
--CAACACCC CCACCCC--- --ACCC---- ----CCACCC CCGCCGCCCC 663 :
..
TCCCCTGCCC TAGAGCACAC TGTAGCATTA CAGTGGGTGC CCCCCTTGCC 761
I I I I I I I I I I I 1 1 1 1' 1 1 1 1 1 'I I I I I I I I I '` .
ATCCCATCC~ TACAGAAAAC TGCAGCAAGA CCGTGAGTCC AGCC--~ 707
AGACATGTGG TGGGACAGGG ACCCACTTCA CACACAGGCA ACTGAGGCAG 811
11111 11 1 11 llil 1111 1111111111 ' ,
-----TGTGG ---~ --- -CCTGGTCCA CACA-GGGCA ACTGAGGCAG 74Q
ACAGCAGCTC AGGCACACTT CTTCTTGGTC TTATTTATTA ---TTGTGTG 858
I 11 1 1 1 1 1 1 ~ I I I I I I I I I I I I I I I I I I I I I I I I I I I I
GCAGCAGCTT GAGCACATTT CTTCTTGATC TTATTTATTA TGGTTGTGTG ~90
TTATTTAAAT GAGTGTGTTT GT-CACCGTT GGGGATTGGG GAAGACTGTG --907
I I I I I I I I I I I I I I I I I I I I I I I 1'1 1 1 1 1 1 -=- - -
TTATTTAAAT GAGTCTGTCA GTATCCCGGT GGGGACATGG ----------- 830
`
GCTGCTGGCA CTTGGAGCCA AGGGTTCAGA GACTCAGGGC CCCAGCACTA 957
111 111 1 11 1111 111111 1
---------- TTTGCTGCCT ATG------- CCCTGGGGGC TCCAGCATTG 863
~94/~680 2 1 '~ 2 ~ 6 0 Pcr/us93/~)764g
AAGCAGTGGA CCCCAGGAGT CCCTGGTAAT AAGTACTGTG TACAGAATTC 1007
111111111 1 1 11 11 111111 111 1 111111 1111 11 11 ;
AAGCAGTGG- GCTCTGGGGT CCCTGGCAAT -ATTACTGTA TACATAACTC 911
TGCTACCTCA CTGGGGTCCT GGGGCCTCGG AGCCTCATCC GAGGCAGG-- 1055
1111111111 11 1 11111 1 1111 11 1111111
TGCTACCTCA ~ CT GTAGCCTCCA GGTCTCACCC CAGGCAGGAG 953
--GTCAGGAG AGGGGCAGAA CAGCCGCTCC TGTCTGCCA- GCCAGCAGCC 1102
1 111 1 1 11 1111 11 1 1111 111111111 1 11111 11
ATGGGAGGGG A-GGCCAGAG CA-ACACTCC TGTCTGCCAC GGCAGCAACC 1001
AGCTCTCAGC CAACGAGTAA TTTATTGTTT T-TCCTCGTA TTTAAA-TAT llS0
III IIIIII II I III IIIIIIIII I I II I1 111111 111
AGCCCTCAGC CATGAAATAA CTTATTGTTT TGTTCTTATA TTTAAAGTAT`1051
TAAATATGTT AGCAAAGAGT ---TAATATA TAGAAGGGT- ACCTTGAACA 1`196
111111 11 1111111111 1111111 1 1111 1 111 111 . I
TAAATAGCTT AGCAAAGAGT TAATAATATA TGGAAGAATG GC~TGTTACA 1101
CT-------~ ----- ---GGGGGAG GG----~ --GACATTGA 1215
Il 1111111 11 1 11 111 -- I
CTCAAGGTGA TGTGTAGTGA ATGGGGGGAG GGTGGTGGGT TTGTCACTGA 1151
ACAAGTTGTT TCATTGACTA TCAAACT-GA AGCCAGAAAT AAAGTTGGTG 1264
1111 1 11 111111111 1111111 11 ~ 11 11111 1111`11111 ''.
ACAAACT-TT TCATTGACTG TCAAACTAGA AACCGGAAAT AAAGATGGTG 1200
ACAGATAAAA AA 1276
40 ACAGATAAAA AA 1212 ` `~
'
. 50
wo 94/04~80 PCr/US93/07645
21~286~) 12
Table 3: Companson of Human IL-13 and Mouse P600 Amino Acid :
Sequences (human above; mouse below). Another form of human
IL- 13 has a GLN between amino acids numbered 97 and 98 (position
indicated by 1), caused by alternative mRNA splicing. .
ME~ AI~ LEU LEU LE~ IR THR V~L ILE AI~ LEU THR CYS LEU GLY 15
* * * * * * * * * * ,.
10MET AI~ LEU TRP V~L THR AI~ V~L LEU AI~ LEU AI~ CYS LE~U GLY 15 ".
:,;
GLY PHE ALA SER PRO GLY PRO V~L PRO PRO SER -- -- -- 26
* * * * * * * * , .
15 OE.Y IEU AI~ AI~ PRO GIJY PRO V~L PRO ARG SER VAL SER LEU PRO 30
THR AI~ LEU ARG GLU LE~U ILE GLU GLU IEU ~L ASN ILE THR GL~I 41
* * * * * * ,~ * * * *
20 LE~U THR LEU LYS GLU LEU ILE GLU GLU LEU SER ASN ILE THR GLN 45
ASN ~LN LYS AIA PRO LEU CYS ASN GLY SEP~ MET V~L TRP SER ILE 56
* * * * * * * * * ~ * *
25 ASP GI~N THR -- PRO LEU CYS ASN GLY SER ~T VAL TRP SER V~L 59
ASN LEU THR AI~ GLY MET TYR CYS AI~ AI~ LEU GLU SER LEU ILE 71 , `
* * * * * * * * ~ :
30 ASP LEU AIA AI~ GLY GLY PHE CYS V~L AI~ LEU ASP SER IE:U THR 74
ASN VAL SER GLY CYS 51~R A~ ILE GLU LYS THR GLN ARG ME~T LEU -86
35 A5N TTF SER ASN CYS ASN AI~ IIE TYR ARG THR GLN ARG ILE LEU 89
S~R GLY PHE CYS PRO HIS LYS t~L S~R AI~ GLYIPHE SER SER LEU- 101
.:
HIS GLY LEU CYS ASN ARG LYS ALA PRO THR THR V~L SER SER LEU 104
`:
HIS VAL ARG ASP THR LYS ILE GLU V~L AL~ GIN P Æ V~L LYS ASP 116
* * * * * * * *
PRO - ASP THR LYS TT-F GLU U~L ALA HIS PHE ILE THR LYS 117
LEU LEU LEU HIS LEU LYS LYS LEU PHE ARG GLU GLY ARG PHE ASN-131-
* * * * * * * *
LEU LEU SER TYR THR LYS GLN LEU PHE ARG HIS GLY PRO PHE - 131
.
O 94/0'~680 2 1 1 2 8 6 ~ PCI/U593/07645
The amino acid sequence of the other form of human IL-13
mentioned in the legend to Table 3 is defined in the Sequence
Listing by SEQ ID NO~
As used herein, the term "IL-13" describes a protein
5 comprising a protein or peptide segment having the amino acid
sequence shown in Table 1, or a ~ragment thereof. It also refers to a
polypeptide which functionally affects cells or subcellular
components in a manner similar to the IL-13 allele whose sequence
is provided. It also encompasses allelic and other variants, e.g.,
0 metabolic, of the protein described. Typically, it will bind to its
corresponding biological receptor with high affinity, e.g., at least
about 100 nM, usually better than about 30 nM, preferably better
than about 10 nM, and more preferably at better than about 3 nM.
The term shall also be used herein to refer to related naturally -
occurring forms, e.g., allelic and metabolic variants of the human
protein.
This invention also encompasses proteins or peptides having
substantial amino acid sequence homology with the amino acid
sequence in Table 1, but excluding any protein or peptide which
2 o exhibits substantially the same or lesser amino acid sequence
homology than does the corresponding P600 protein found in the
mouse.
A polypeptide "fragment", or "segment", is a stretch of amino
acid residues of at least about 8 amino acids, generally at least 10
amino acids, more generally at least 12 amino acids, often at least 14
amino acids, more often at least 16 amino acids, typically at least lB
amino acids, more typically at least 20 amino acids, usually at least
22 amino acids, more usually at least 24 amino acids, preferably at
least 26 amino acids, more preferably at least 2~ amino acids, and,
in particularly preferred embodiments, at least about 30 or more
amino acids. Sequences of segments of different proteins can be
compared to one another over appropriate length stretches.
Amino acid sequence homology, or sequence identity, is
determined by optimizing residue matches, if necessary, by ~ ~-
3s in~ôducing gaps as required. See, e.g., Needleham et al., J. Mol. Biol. ~-
WO 94~4680 PCT/US93/07~i45 -.
21~861~ 14 .;-`
:
48:443 (1970); Sankoff et al.,-~chapter one in Time~ Warps, String '
Edi~s, and Macromolecules: The Theory and Practice of Sequence
Comparsiora, 1983, Addison-Wesley, Reading, MA; and software
packages from IntelliGenetics, Mountain View, CA; and the ~--
5 University of Wisconsin Genetics Computer Group, Madison, WI. This
changes when considering conservative substitutions as matches.
Conservative substitutions typically include substitutions
within the following groups: glycine, alanine; valine, isoleucine,
leucine; aspartic acid, glutamic acid; asparagine, glutamine; serine,
0 threonine; lysine, arginine; and phenylalanine, tyrosine. Homologous
amino acid sequences are intended to include natural allelic
variations in the provided sequence. Typical homologous proteins or
peptides will have from 50-100% homology (if gaps can be
introduced), to 60-100% homology (if conservative substitutions are
5 included) with an amino acid sequence segment of Table 1.
Homology will be at least about 50%, generally at least 58%,
more generally at least 63%, often at least 69%, more often at least
75%, typically at least 81%, more typically at least 86%, usually at
least 90%, more usually at least 93%, preferably at least 95%, and
2 o more preferably at least 97%, and in particularly preferred
embodiments, at least 98% or more. The degree of homology will
vary with the length of th¢ compared segments. Homologous
pr~teins or peptides, such as the allelic variants, will share most
biological activities with the embodiment described in- Table 1.
2 5 As used herein, the term "biological activity" is used to
describe, without limitation, inducing characteristic cell~ stimu~ation,
Ig production, cellular differentiation, or cell viability functians, or
more structural properties as receptor binding and cross-reactivity
with antibodies raised against the same or an allelic variant of the
described human IL-13. --
The terms ligand, agonist, antagonist, and analog include
molecules that modulate the characteristic cellulaE res-ponses to
IL-13 or IL-13-like proteins, as well as molecules possessing the
more standard structural binding competition features of ligand-
3s receptor interactions, e.g., where the receptor is a natural receptor
or an antibody. The cellular responses likely are mediated through
.
2 l ~ 2 8 B ~ PCI/US93/0764~ .
binding of IL-13 to cellular receptors. Also, a ligand is a molecule
which serves either as a natural ligand to which said receptor, or an
analogue thereof, binds, or a molecule which is a functional analogue
of the natural ligand.
trhe functional analogue may be a ligand with structural
modifications, or ma~ be a wholly unrelated molecule which has a
molecular shape which interacts with the appropriate ligand binding
determinants. The ligands may serve as agonists or antagonists, see,
e.g., Goodman e~ al., Eds., The Pharmacological Bases of Ther~peutics,
0 1990, Pergamon Press, New York.
II. Activities
The human IL-13 protein has a number of different biQlogical
activities. The human IL-13 is homologous to the mouse ~2600
protein, but has structural differences. For example, the human
IL-13 gene coding sequence has only about 50% homology with the
nucleotide coding sequence of mouse P600. At the amino acid level, ~`
there is about 66% identity.
The mouse P600 molecule had rather minimally defined _
biological activities. In particular, it has the ability to stimulate -~
20 undifferentiated mouse bone marrow cells to undergo early stages
of differentiation. The mouse P600 protein appears to activate both
mouse cells and human cells in th-i$ assay.
- The~ present disclosure also describes new activities which
have boen discovered using the mouse P600 molecule. The
25 ~ difference in ~structure between the human IL-13 and the -
homologous mouse P600 protein introduce some uncertainty about
whether the two proteins will have identical functional properties.
'i However, the handful of identified activities appear to be sharedbctween the homologues. It is likely that many of the activities of
- 30 ~ mouse P600 on mouse cells or human cells will also apply to the
human IL-13. In fact, the cross species activides indica~e that many
structural features are not critical in the function of the molocules. ¦
ln particular, the human IL-i3 exhibits a number of identified
activities when provided to human cells. The Examples section
:
WO 94/04680 PCI`/US93/0764i ;
1 6
21~286~
below describes procedures used to study the effects of human
IL-13 on cell viability, morphology, proliferation, and
differentiation. In particular, human IL-13 affects B cells, PBMC,
and macrophages. On B cells, the cytokine affects proliferation,
5 alone or in combination with other cytokines; sustains cell viability;
affects survival; causes modification of Ig surface markers; has - '
effects specifically on CD40; and affects IgE switching.
On PBMC or macrophages, it induces morphological changes,
causes changes of cell surface markers, affects nitric oxide '
0 production, affects IL-la and II,-6 expression, and affects antibody `'
dependent cell-mediated cytotoxicity (ADCC). Importantly, the
similarity between IL-4 and IL- 13 leads to antagonists of IL- 13
whose structures are based upon similar antagonists of IL-4. These -
ac~ivities can be useful in treating immunological conditions '
characterized by corresponding disfunctions. See, e.g., Merck
Manual, or Paul, Fundamental Immunology.
A. B cells
1. Cofactor/factor Proliferation: Cell Viabilitv
Mouse P600 made from E. coli has the ability to stimulate or '`
costimulate proliferation of large in vivo activated mouse B cells.
The combination of IL-4, soluble anti-CD40, and mouse P600 induces
proliferation of these cells. However, since the large in vivo
activated mouse B cells may contain some monocytes and other cells, -~
- other celIs may be induced to secrete various growth faètor's''which
support the proliferation observed. Thus, the mouse P600
stimulates the B cells, either directly or indirectly, alone or in
!' i ' i c'dmbination with 'other factors. Human IL-13 should exhibit` similar
biological activity. ~
2. Sustaincd Survival of B Cells: Selectivitv~ --
IL-13 enhanced the DNA synthesis of B cells activated through
their antigen receptor. This induction was dose dependent, and was
comparable in effect to IL-10, but less than IL-2 or IL-4. The time
~ 94/04680 1 7 2 i 1 2 ~ 6 o P~/us93/o7645
course of the effect was also different from IL-2 and IL-4.
Similarly, B cells activated through their CD40 receptor were also
affected, again in a dose dependent manner, and comparable to IL-4
and IL-10 effects. The kinetics of the effects exhibited a different
5 time course from IL-4 or IL-10 responses. The combination of
IL-10 and IL-13 exhibited additive effects, but IL-13 did not appear
to increase any IL-4 effects. This suggested, with other data, that `
these two cytokines may share some components in signal
transduction, though other data show some independence of effects.
More specifically, IL-13 induced expression of various Ig's,
particularly IgE. The target cell population for IL-13 also appears ~
more restricted than for IL-4. Thus, although IL-4 and IL-13 share `-
many biological properties, their signal transduction pathways are
physiologially and mechanistically distinguishable.
3. Modification of~ Ie Production l;
B cells activated by B21 T cell clone, their membranes, or anti-
~CD40 appear to exhibit modified Ig production patterns after
exposure to mouse P600 or human IL-13. The levels of production
of ~various Ig molecule subtypes when human IL-13 is co-
administered to B cells with an inducing agent, e.g., activated B21 T ~'!~.,
cdls, m`embranes from activated B21 T cells, or anti-CD40 andbodies
were increased, partiGularly IgE. The changes in Ig~ production are '`
suggesdve of accelerated differentiation including IgG4 and/or IgE
class switching. Both possibilities are consistent with a ``
2s ~differentiation~effect`caused by mouse P600 or human IL-13. `~;
~` A similar inducdo~i of IgE and IgG4 synthesis by IL-13 was
, ~ observed when B cells were stimulated with CD40-L, as described~
below.
,~. ,.
4. E3ffects on CD40-mediated B Cell Proliferation and
30 Differentiation
The effccts of anti-CD40 andbody or CD40 ligand on B cell
- ~ proliferation were enhanced in the presence of either IL-4 or IL-13. ,
Both cytokines had comparable effects in spite of their significant
WO 94/04680 PCI~tUS93/0764
18
21428~0
sequ`ence divergence. The B cell proliferation was accompanied by
induction of IgM, IgG4, total IgG, and IgE levels. IgA was not
stimulated. The two cytokines appeared to act through different
structural mechanisms as anti-IL-4 antibodies blocked IL-4 effects,
5 but not IL-13 effects. The effects on IgE suggest that IL-13
contributes to IgE production and is an important factor in
controlling IgE mediated allergic reactions.
5. I~E Switchin~
IL-13 induced IgG4 and IgE synthesis by unfractionated
0 peripheral blood mononuclear cells (PBMNC) and highly purified B
cells cultured in the presence of activated CD4+ T cells or their
membranes. IL-13-induced IgG4 and IgE synthesis was IL-4-
independent, since it was not affected by neutralizing anti-IL-4
monoclonal antibody (mAb). Highly purified sIgD+ B cells could also
be induced to produce IgG4 and IgE by IL-13, indicating that the
production of these isotypes reflected IgG4 and IgE switching and
not a selective outgrowth of eommitted B cells.
IL-4 and IL-13, added together at optimal concentrations, had
no additive or synergistic effect, suggesting that common signaling
20 pathways may be involved. This notion is supported by the
observation that IL-13, like IL-4, induced CD23 expression on B cells
and enhanced CD72, surface IgM (sIgM), and class II MHC amigen
expression. In addition, like IL-4, IL-13 induced germline
transcription in highly purified B cells. Collectively, these data
25 indicated that IL-13 is another T cell-derived cytokine that, in
addition to IL-4, ef~lciently directs naive human B cells to switch to
IglG4 and IgE production.
B. PBMC and Macro~hages ~
1. Induction of Mor~holo~ical Chan~e - ~ :-- `
3 o Thè mouse P600 also induced morphological changes in
adherent human peripheral blood mononuclear cells. The treated
cells exhibited significantly different morphology and clusters of
94J04680 2~ 12 PCI`/US93/07~45
small cells. The generic cells rounded up, and there was evidënce of
clonal proliferation, observations which were consistent with
induction of cell proliferation.
2. ModificatioQof Cell Surface Markers
Mouse P600 induced significant changes in the cell surface
markers of adherent cells from peripheral blood. These adherent
cells were mostly monocytes, e.g., macrophage precursors, but also
included more differentiated cell types, dendritic cells, and some B
cells. ~-
Many of the cell surface makers on these adherent cells were
up regulated or down regulated, or their dispersion in expression
level changed. The following markers tended to increase on a per
cell basis: CDllb, CDllc, class II MHC (as measured by binding of
monoclonal antibodies Q5/13 or PdVS.2), CD 23, and CD18. In
contrast, per cell expression of the following decreased: CD32, CD16,
IL-2Ra, and CD14. The homogeneity of per cell expression changed ``
for CD32, and CD14. There was no change for CDlla, CD54, and
CD58. Although in one case there was no change for CD44 and class
I MHC, other experiments indicated increases in expression levels.
2 o These changes in expression level were detectable also at 10
days, and in certain cases exhibited a more dramatic shift, whereas
others showed a lesser shift. Depending on subsets of cells, some
features may have been lost by ten days.
In spite of the sequence divergence of the mouse P600 and the
human IL-13, the two molecules seemed to cause similar changes in `
the adherent human cells. It is likely that activities found for one of
the molecules will be found also by the other. In addition, the
molecules appeared to exhibit cross-species activities, e.g., the
mouse P600 was active on human cells, and the human IL-13 was -~
30 active on mouse cells.
wo 94/04680 2 1 ~ 2 8 ~ ~ 2 0 P~/US93/0764~
3. Nitric Oxide Synthesis
IL- 13 (P600) was assayed by its LPS stimulated inhibi~iory
effect on the production of nitric oxide (NO) by GM-CSF-derived
bone marrow macrophages. IFN-~ induced NO production, while
5 IL-4 or IL- 13 inhibited NO production.
4. Effect on IL-la. IL-6~ IL-10 and TNF~X Production
IL-4 and IL- 13 inhibited the production of IL- 1 a, IL-6, IL- 10,
and TNF-a by LPS-activated human monocytes. The inhibitory
effects of IL-4 and IL- 13 on cytokine production by LPS activated
human monocytes were independent OI IL- 10, since IL-4 and IL- 13
inhibited the production of IL-la, IL-6, and TNF-a in the presence
of neutralizing anti-IL- 10 mAb 1 9Fl .
5. Antibodv-dependent_ Cell-mediated CvtotoxicitY
IL- 13 induced significant changes in the phenotype of
monocytes. Like IL-4, it cnhanced the expression of CDllb, CDllc,
CD18, CD29, CD49e (VLA-5), class II MHC, CD13, and CD23 whereas it
decreased the expression of CD64, CD32, CD16, and CD14 in a dose
dependent manner. IL-13 induced upregulation of class II MHC
antigens and its downregulatory effects on CD64, CD32, and-CD16
20 expression were prevented by IL-10. --
IFN-~ could also partially prevent the IL-13 induced
downregulation of CD64, but not that of CD32 and CD16. However,
IL-13 strongly inhibited spontaneous and IL-10 or IFN-~y induced
antibody dependent cell-mediated cytotoxicity (ADCC) activity of
2 5 hurnan monocytes toward anti-IgD coated Rh+ erythrocytes,
indicating that the cytotoxic activity of monocytes was inhibited.
These results indicated that IL-13 has anti-inflammatory and
immunoregulatory activities. - _
--
94~04680 21 ~ Z 8 6 o PCI/U~i~3/07645
C. IL-4 Anta~onist: Interactions
Observations that the hIL-4.Y124D antagonist competitively
inhibited the biological action on TF-1 cells of both hIL-4 and IL-13
demonstrated a relationship between IL-4R and IL-13R. The ability
of mIL-13 to compete for I~25-hIL-4 binding to T~-l cells
confirmed the commonalty of ~-4R and IL-13R. This relatedness
may also have been expected from the similar biological responses
known to be elicited by hIL-4 and IL-13, and perhaps from the
close linkage of the IL-4 and IL-13 genes in both humans and mice.
0 See~ e.g., Morgan et al., Nucleic Acids Res. 20:5173 (1992), and other
expenments herein. A straightforward explanation of the above
observations would be that IL-4 and IL- 13 act through the same
receptor.
D. Bioloei~al Relevanc~ - j
The mouse P600 protein can sustain or prom~e the
proliferation of large in ~ivo activated B cells. As such, the factor -
appears to be either a stimulatory or costimulatory factor useful in_ ~ `
promoting activated B cell growth. Human IL-13 is therefore
expected to be a useful factor in cLrcumstances where activated B
cell growth is des*ed. -~
These include genetic, developmental, or acquired immune
system deficiencies, e.g., congenital aglobulinemias, immature
infants, or chemotherapy patients. In vitro experiments would be
performed to deeermine what effects IL- 13 possesses . In particular,
2 5 dose response relationships for various immunological assays will be
tested with the compositions of this invention. See, e.g., Coligan et al.,
Current Protocols in ~mmunology, 1991, Greene/Wiley, New York.
Regarding the proliferative response, mouse P600 induces
changes in morphology of the monocyte cells. The monocyte cells ;
consist primarily of macrophage precursors, and similar results
should apply to monocyte equivalents found in organs or tissues
other than the peripheral blood, e.g., the aveolar, intraperitoneal, or
spleen/lymph macrophage precursors. The IL-13 or antagonist, e.g.,
an~ibody or IL-4 antagonist, would be indicated for conditions
`
WO 94~04680 PCI`/US93/0764'
~60 22
where regulation of localized or systemic immune responses is
desired and appropriate. The effec~s on class II MHC are especially
relevant in these contexts.
Besides a growth factor/cofactor activity, human IL-13 also
5 affects differentiation of various cells of the immune system. For
instance, in activated B cells, it accelerates or promotes the
differentiation of Ig producing cells. It induces the B cells to
produce Ig molecules characteristic of later or faster differentiation.
As such, the human IL-13 and mouse P600 appear to be a
0 differentiation factor for B cells.
Thus, Ig production should be regulatable by IL-13, alone or in
combination with other factors. Agonists and antagonists, when
provided in appropriate amounts and schedules, will be useful in
treating or controlling abnormal B cell conditions, or to accelerate or
decelerate B cell differentia~ion when appropriate. j -
Peripheral blood monocytes are also sensitive to the presence
of both human IL-13 and mouse P600. These cells, consisting
primarily of macrophage precursors and more differentiated cell
types, exhibit both a proliPerative response and a differentiation
20 response.
In one context, IL-4 is appropriate in antitumor situations, e.g.,
to stimulate an endogenous response to counter the tumor; IL- 13
should also be a useful therapeutic. In a different context of
proliferative disorder, after radiotherapy or chemotherapy, where
2s the immune funtion is typically compromised, IL-13 would be
useful to restore function by promoting recovery and differentiation~
of the remaining immune funcdon. See, e.g., Moller (ed), "Fc - -
Receptors" in Immunological Reviews 125:1 (1992). Sirnilar
problems exist in transplantation contexts, as well as in other
30 genetic or developmental immunodeficiencies, e.g., in newborn -
infants. See, e.g., Baker et al., N. Eng. J. Med. 327:213 (1992).
In fact, the role of IL-13 in promoting restoration of imm~ne~ --~-
function under these circumstances is supported by the cell marker
changes obser~ed. With respect to cell marker differentiation, the -
35 general trend is that the class II MHC markers are affected. Also,
CD23 is affected. The effects on class II MHC markers indicate that
~94/04680 23 ~1~2~o PCr/uss3/0764s -~
systemic responsiveness to infections can be modulated with IL- 13 ~ ;
or mouse P600, or agonists or antagonists thereof.
The observed decreases in CD32 and CD16 indicated a lowered
receptor for IgG Fc, which would be correlated with a lessened
5 response to infections. If so, an IL-13 antagonis~, or mouse P600
antagonist, would be useful in stimulating an immunoglobulin-
mediated response. This antagonistic activity could lead to
increased Fc~y receptor expression and functional increase in `
opsonization and clearance of infective particles.
0 Antagonists to IL- 13, e.g., antibodies or IL-4 antagonist, would
be indicated for modulating B cell growth and proliferation, perhaps
reflecting excessive humoral responses. Various autoimmune
conditions or hyperimmunoglobulinemias should respond to
treatment with appropriate amounts of antagonists administered
over defined schedules. IL-4 antagonist will be a preferred
antagonist for IE-13 effects. ! ~}
IL-13 mediates changes in CD11 marker expression, which are ; -,
associated with cell adhesion, e.g., cell-cell contacts, Thus, increasing j ~
CD11 should facilitate cellular interaction and the functional results I `
therefrom. See also Springer et al., Leukocyte Adhesion Molecules, ! `
1988, Springer-Verlag, New York.
Like IL-4, IL-13 induces IgG4 and IgE switching and IgG4 and
IgE synthesis. IgE antibodies are major mediators~of allergic `
reactions. Allergen-specific antibodies of the IgE isotype have the
2s specific ability to bind to high affinity Fc receptors for IgE (FcRI) on
~- - mast cells and basophils. Binding of the relevant allergen to these
,
- receptor-bound IgE antibodies results in cross-linking of the
receptor and activation of the mast cells and basophils. This results
in! degranulation of these cells and the release of mediators of
allergic reactions such as histamine, prostaglandins and proteases, ! `~
which cause immediate-type hypersensitivity reactions in the
~- - various target organs, e.g., nose airways, lungs, gut and skin.
In addition, IL-13 like IL-4 induces the expression of the low
affinity receptor for IgE (FcRII, or CD23) on B cells and monocytes,
and the subsequent release of a soluble form of CD23. Soluble CD23 ~`
enhances the production of IgE [see, e.g., Pene et al.7 Eur. J. Immunol. I
wos4/04~so Pcr/uss3/0764s
2142860 24 1 ~
18:929 (1988); Aubry et al., Nature 358:S05 (1992)]. Therefore,
downregulation of IgE synthesis and soluble CD23 production reduce
or inhibit IgE-mediated allergic diseases. IL-4 and/or IL- 13
antagonists such as antibodies, or IL-4 mutant proteins like Y 1 24D
s or similar mutant IL-13 proteins that compete for IL-4/IL-13
receptor binding, would be useful for blocking IgE production.
III. Nucleic Acids ~-
This invention contemplates use of isolated nucleic acid or
fragments which encode this or a closely related protein, or
0 fragments thereof, to encode a biologically active corresponding
polypeptide. In addition, this invention covers isolated or -
recombinant DNA which encodes a biologically active protein ;or
polypeptide having characteristic IL- 13 activity. Typically, the
- nucleic acid is capable of hybridizing, under appropriate conditions,
with a nucleic acid sequence segment shown in Table 1.
Said biologically acdve protein or polypeptide can be a full
length protein, or fragment, and will typically have a segment of
r amino acid sequence highly homologous to one shown in Table 1.
Further, this invention covers the use of isolated or recombinant
nucleic acid, or fragmonts thereof, which encode proteins having
fragments which are homologous to the disclosed IL-13 protein. The
isolated nucleic acids can have the respective regulatory sequences --
in the 5' and 3' flanks, e.g., promoters, enhancers, poly-A addition
signals, and others from the natural gene.
An "isolated" nucleic acid is a nucleic acid, e.g., an RNA, DNA, or ~
a mixed polymer, which is substantially pure, e.g., separated from
other components which naturally accompany a native sequence,
such as ribosomes, polymerases, and flanking genomic sequences --
from the originating species. The term embraces a nucleic acid --
sequence which has been removed from its naturally occurring
environment, and includes recombinant or cloned DNA isolates, - -
which are thereby distinguishable from naturally occurring
compositions, and chemically synthesized analogues or analogues - -
biologically synthesized by heterologous systems. A substantially
94/04680 ~? PCl /US93/07645
25 i~
S~ '~
pure molecule includes isolated forms of t~e molecule, either
completely or substantially pure.
An isolated nucleic acid will generally be a homogeneous
composition of molecules, but will, in some embodiments, contain
heterogeneity, preferably minor. This heterogeneity is typically
found at the polymer ends or portions not critical to a des*ed
biological function or activity.
A "recombinant" nucleic acid is defined either by its method of
production or its struc~ure. In reference to its method of production,
0 e.g., a product made by a process, the process is use of recombinant -
nucleic acid techniques, e.g., involving human intervention in the
nucleotide sequence. Typically this intervention involves in ~itro `;
manipulation, although under certain circumstances it may involve ``
more classical animal breeding t~chniques. .;
Alternatively, it can be a nucleic acid made by generating a
sequence comprising fusion of two fragments which are not ! `
naturally contiguous to each other, but is meant to~xclude products
of nature, e.g., naturally occurring mutants as found in their natural
state. Thus, for example, products made by transforming cells with
2 o any unnaturally occurring vector is encompassed, as are nucleic
acids comprising sequence derived using any synthetic
oligonucleotide process. Such a process is often done to replace a
codon with a redundant codon encoding the same or a conservative
amino acid, while typically introducing or removing a restriction
2s enzyme sequence recognition site.
In still another altern~tive, the process is performed to join
- together nucleic acid segments of desired functions to generate a
single genetic entity comprising a desired combination of functions
- - not found in the commonly available natural forms, e.g., encoding a
30 fusion protein. Restriction enzyme recognition sites are often the
_ target of such artificial manipulations, -but other site specific targets, ;-~- ~ ~--~ e.g., promoters, DNA replication sites, regulation sequences, control
sequences, or other useful features may be incorporated by design.
A similar concept is intended for a recombinant, e.g., fusion,
35 polypeptide. Specifically included` are synthetic nucleic acids which,
by genetic code redundancy, encode similar polypeptides to
WO g4/04680 PCl`/US93/~764"
26
2,3,~2~6~ -
fragments of the interleukins, and fusions of sequences from various
different interleukin or related molecules, e.g., growth factors.
A "fragment" in a nucleic acid context is a con~iguous segment
of at least about 17 nucleotides, generally at least 20 nucleotides,
more generally at least 23 nucleotides, ordinarily at least 26
nucleotides, more ordinarily at least 29 nucleotides, often at least 32
nucleotides, more often at least 35 nucleotides, typically at least 38
nucleotides, more typically at least 41 nucleotides, usually at least
44 nucleotides, more usually at least 47 nucleotides, preferably at
0 least 50 nucleotides, more preferably at least 53 nucleotides, and in I ;
particularly preferred embodiments will be at least 56 or more
nucleotides. Typically, fragments of different genetic sequences can
be compared to one another over appropriate length stretches.
A nucleic acid which codes for an IL-13 will be particularly
useful to identify genes, mRNA, and cDNA species which code for the
IL-13 or closely related proteins, as well as DNAs which code for
allelic or other genetic variants, e.g., from different individuals.
Preferred probes for such screens are those regions of the
interleukin which are conseNed between different allelic variants,
and will preferably be full length or nearly so. In other situations,
allele specific sequences will be more useful.
This invention further covers recombinant nucleic acid `
molecules and fragments ~àving a nucleic acid sequence identical to
or highly homologous to the isolated DNA set forth herein. In
2s particular, the sequences will often be operably linked to DNA
segments which control transcription, translation, and DNA
replication. These àdditional segments typically assist in expression -
of the desired nucleic acid segment.
!~ i ' I Homologous nucleic acid sequences, when compared to one
another or Table 1 sequences, exhibit significant similarity. The
standards for homology in nucleic acids are either measures for
homology general~y used in the art by sequence comp`arison or
based upon hybridization conditions. Comparative hybridization
conditions are described in greater detail below.
3s "Substantial homology" in the nucleic acid sequence
comparison context means either that the segments, or their
680 ~ PCl'tUS93/07645 ~'`
27 ~8~ ~
,, . . ~
complementary strands, when compared, are identical when
optimally aligned, with appropriate nucleotide insertions or ~,-
deletions, in at least about 60% of the nucleotides, generally at least ;
66%, ordinarily at least 71%, often at least 76%, more often at least
80%, usually at least 84%, more usually at least 88%, typically at
least 91%, more typically at least about 93%, preferably at least
about 95%, more preferably at least about 96 to 98% or more, and in ~-~
particular embodiments, as high at about 99% or more of the
nucleotides . --
0 Alternatively, substantial homology exists when the segments
will hybridize under selective hybridizatian conditions, to a strand
or its complement, typically using a sequence derived from Table 1.
Typically, selective hybridization will occur when there is at least .
about 55% homology over a stretch of at least about 14 nucleotides, ` --
more typically at least about 65%, preferably at least about 7S%, and I -
more preferably at least about 90%. See, Kanehisa, Nucleic Acids I `~
Res. 12:203 (1984). . ! ~-
The length of homology comparison, as described, may be over
longer stretches, and in certain embodiments will be over a stretch
20 of at least about 17 nucleotides, generally at least about 20
nucleotides, ordinarily at least about 24 nucleotides, usually at least
about 28 nucleotides, typically at least about 32 nucleotides, more `
-- - typically at least about 40 nucleotides, preferably at least about 50 !.'
~~ nucleotides, and more preferably at least about 75 to 100 or more `
2 5 _nucleotides.
Stringent conditions, in referring to homology in the
- --hybridization context, will be stringent combined conditions of salt, -
temperature, organic solvents, and other parameters typically
controlled inl hybridization reactions. Stringent temperaturel
~ 30 conditions will usually include temperatures in excess of about 30C,
-- -- --_- more usually in excess of about 37C, typically in excess of about
.
45C, more typically in excess of about 55C, preferably in excess of I:
~- - about 65C, and more preferably in excess of about 70C. Stringent
- salt conditions will ordinarily be less than about 1000 mM, usually
35 less than about 500 mM, more usually less than about 400 mM,
typically less than about 300 mM, preferably less than about 200
WO 94/04680 Pcr/uss3/o764
21~2860 28
mM, and more preferably less than about 150 mM. However, the
combination of parameters is much more important than the ;
measure of any single parameter. See, e.g., Wetmur et al., J. Mol.
Biol. 31:349 (1968).
The isolated DNA can be readily modified by nucleotide
substitutions, nucleotide deletions, nucleotide insertions, and
inversions of nucleotide stretches. These modifications result in -
novel DNA sequences which encode this protein, its derivatives, or
proteins having IL- 13 activity. These modified sequences can be
0 used to produce mutant proteins (muteins) or to enhance the -
expression of variant species. Enhanced expression may involve
gene amplification, increased transcription, increased translation,
and other mechanisms. Such mutant I~- 13 derivatives include
predetermined or site-specific mutations of the protein or its
fragments.
"Mutant IL-13" as used herein encompasses a polypeptide
otherwise falling within the homology definition of the human IL-13
as set forth above, but having an amino acid sequence which differs
from that of human IL-13 as found in nature, whether by way of
deletion, substitution, or insertion. In particular, "site specific
mutant lL- 13 " encompasses a protein having substantial homology
with a protein of Table 1, and typically shares most of the biological
activities of the form disclosed herein.
Although site specific mutation sites are predetermined,
2 5 mutants need not be site specific. Human IL- 13 mutagenesis can be
achieved by making amino acid inserdons or deletions in the gene, --
coupled with expression. Substitutions, deletions, insertions, or any
combinations may be generated to arrive at a final construct.
Insertions include amino- or carboxy- tèrminal fusions. Random
mutagenesis can be conducted at a target codon and the expressed- ~
human IL-13 mutants can then be screcned for the desired activity.
Methods for making substitution mutations at predetermined sites ~=- ~~`~
in DNA having a known sequence are well known in the art, e.g., by
M13 primer mutagenesis. See also Sambrook et al. (1989) and
3s Ausubel et al. (1987 and periodic Supplements).
94/04~80 21~ 2 8 6 G pcrtus93/0764~
29
The mutations in the DNA normally should not place eoding
sequences out of reading frames and preferably will not create
complementary regions that could hybridize to produce secondary
mRNA structure such as loops or hairpins.
The phosphoramidite method described by Beaucage et al.,
Tetra. Letts. 22:1859 (1981), will produee suitable synthetic DNA
fragments. A double stranded fragment will often be obtained
either by synthesizing the complementary strand and annealing the
strand together under appropriate conditions or by adding the
0 complementary strand using DNA polymerase with an appropriate
primer sequence.
Polymerase chain reaction (PCR) techniques can often be
applied in mutagenesis. Alternatively, mutagenisis primers are ~-
commonly used methods for generating defined mutations at `
predetermined sites. -
IV. Proteins~ Pe~tides ~-
As described above~ the present invention encompasses the
human IL-13 whose sequence is disclosed in Table I and desc~ibed
above. Allelic and other variants are also contemplated.
"Substantially pure", in the polypeptide context, typieally
means that the protein is free from other c~ntaminating proteins,
~~ nucleic acids, and other biologicals derived from the original source
organism. Purity may be assayed by standard methods, and will
- - ordinarily be at least about 40~o pure, more ordinarily at least about
- --2s- 50% pure, generally at least about 60% pure, more generally at least
about 70% pure, often at least about 75% pure, more often at least
about 80% pure, typically at least about 85% pure, more typically at
~ ~ least about 90% pure, preferably at least about 95% pure, more
- preferably at least about 98% pure, and in most preferred
-~ - 30 embodiments, at least 99% pure. The analysis may be weight or
--- molar percentages, evaluated, e.g., by gel staining,
spectrophotometry, or terminus labelling.
The present invention also provides recombinant proteins, e.g.,
heterologous fusion proteins using segments from this human
WO 94~04680 PCI`/US93/0764'
` `
2 I 4 2 8 6 0
protein. A he~erologous fusion protein is a fusion~of proteins or
segments which are natur~ly not normally fused in the same
manner. Thus, the fusion product of a growth factor with an ~ `
interleukin is a continuous protein molecule having sequences fused
s in a typical peptide linkage, typically made as a single translation `
product and exhibiting properties derived from each source peptide.
A similar concept applies to heterologous nucleic acid sequences.
In addition, new constructs may be made from combining
similar functional or structural domains from other related proteins,
0 e.g., growth factors or other cytokines. For example, receptor-
binding or other segments may be " swapped" between different new
fusion polypeptides or fragments. See, e.g., Cunningham et al.,
Science 243:1330 (1989); and O'Dowd et al., J. Biol. Chem. 263:15985
( 1 988).
Thus, new chimeric polypeptides exhibiting new combinations
- ~ of specificities will result from the functional linkage of - receptor-
binding specificities. For example, the receptor binding domains
from other related ligand molecules may be added or substituted for
other domains of this or related proteins. The resulting protein will
often have hybrid function and properties. For example, a fusion
protein may include a targetting domain which may serve to
provide sequestering of the fusion protein to a particular organ, e.g.,
- ~ a ligand portions which- is specifically bound by spleen cells and
would serve to accumulate in the spleen.
Candidate fusion partners and sequences can be selected from
various sequence data bases, e.g., GenBank, c/o IntelliGenetics, ^ -= -
Mountain View, CA; and BCG, University of Wisconsin Biotechnology
Computing Group, Madison, WI.
f' i ' nDerivativès" of the human IL-13 include amino acid sequence
mutants, glycosylation variants, metabolic derivatives and covalent
or aggregative conjugates with other chemical moieties. Covalent
derivatives can be prepared by linkage of functionalities to groups ~
which are found in the II,-13 amino acid side chains or at the N- or ~ ~ ~
C- termini, e.g., by means which are well known in the art. These
derivatives can include, without limitation, aliphatic esters or
amides of the carboxyl terminus, or of residues containing carboxyl
':
~94/04680 31 21 ~2~G PCI'/US93/0764~
.
:`
side chains, O-acyl derivatives of hydroxyl group-
containing
residues, and N-acyl derivatives of the amino term
inal amino acid or
amino-group containing residues, e.g., lysine or a
rginine. Acyl
groups are selected from the group of alkyl-moieti
es including C3 to
s C18 normal alkyl, thereby forming alkanoyl aroyl species.
In particular, glycosylation alterations are included, e.g., made ~-
by modifying the glycosylation patterns of a polypeptide during its
synthesis and processing, or in further processing steps. Particularly
preferred means for accomplishing this are by exposing the
0 polypeptide to glycosylating enzymes derived from cells which
normally provide such processing, e.g., mammalian glycosylation ¢^
enzymes. Deglycosylation enzymes are also contemplated. Also
embraced are versions of the same primary amino acid sequence -~
which have other minor modifications, including phosphorylated
amino acid residues, e.g., phosphotyrosine, phosphoserine, or
phosphothreonine .
A major group of deri~atives are covalent conjugates of the
interle~lkin or fragments thereof with other proteins of
polypeptides. These denvatives can be synthesized in recombinant
culture such as N- or C-terminal fusions or by the use of agents
known in the art for their usefulness in cross-linking proteins
through reactive side groups. Preferred derivatization sites with
cross-linking agents are at free amino groups, carbohydrate
moieties, and cysteine residues.
2s Fusion polypeptides between the interleukin and other
~- homologous or heterologous proteins are also provided. Homologous
polypeptides may be fusions between different growth factors,
resulting in, for instance, a hybrid protein exhibiting ligand
specificity for multiple different receptors, or a ligand which may
- 30 have broadened or weakened specificity of binding to its receptor.
- _ Likewise, heterologous fusions may be constructed which would
:~` ~ ~ exhibit a combination of properties or activities of the derivative
proteins.
Typical examples are fusions of a`reporter polypeptide, e.g.,
35 luciferase, with a segment or domain of a receptor, e.g., a ligand-
binding segment, so that the presence or location of a desired ligand
WO 94~04680 PCr/US93/0764~
2 ~ 4 2 ~
may be easily determined. See, e.g., Dull et al., U.S. Patent No.
4,859,609. Other gene fusion partners include glutathione-S-
transferase (GST), bacterial B-galactosidase, trpE, Protein A, ~-
lactamase, alpha amylase, alcohol dehydrogenase, and yeast alpha
s mating factor. See, e.g., Godowski et al., Science 241:812 (1988).
The phosphoramidite method' described by Beaucage et al.,
Tetra. Letts. 22:1859 (1981), will produce suitable synthetic DNA
fragments. A double-stranded fragment will often be obtained
either by synthesizing the complementary strand and annealing the
0' strand together under appropriate conditions or by adding the
complementary strand using DNA polymerase with an appropriate
primer sequence.
Such polypeptides may also have amino acid residues which
have been chemically modified by phosphorylation, sulfonation,
15 biotinylation, or the addition or removal of other moieties,
particularly those which have molecular shapes similar to phosphate
groups. In some embodiments, the modifications will be useful
labelling reagents, or serve as purification targets, e.g., affinity
ligands.
20 ~ Fusion proteins will typically be made by either recombinant
~' nucleic acid methods or by synthetic polypeptide methods.
Techniques for nucleic àcid manipulation and expression are
described generally, for example, in Sambrook et al., Molecular
Cloning: A Laboratory ~anual (2d ed.), 1989,Vols. 1-3, Cold Spring
25 Harbor Laboratory; and Ausubel et al. (eds), Current Protocols in
- Molecular Biology, 1987 and periodic supplements, Greene/Wiley,
New York. Techniques for synthesis of polypeptides are described, ~ -~'
for example, in Merrifield, J. Am. Chem. Soc. 85:2149 (1963);
Merrifield, Science 232:34i (1986); and Atherton et al., Solid Phase
30 Peptide Synthesis: A Practical Approach, 1989, IRL Press, Oxford.
This invention also contemplates the use of derivatives of the
human IL-13 other than variations in amino acid sequence or ~~
- ~ ~ glycosylation. Such derivadves may involve covalent or aggregative
associadon with chemical moieties. These derivatives generally fall -'~
35 into three classes: (1) salts, (2) side chain and terminal residue
covalent modifica~ions, and (3) adsorption complexes," for example
~' :~ ' .','.
,.
.
~ 94/04680 PCrlUS93/0764~ ~
33 21~286~
= ,
with cell membranes. Such covalent or aggregative derivatives are
useful as immunogens, as reagents in immunoassays, or in
purification methods such as for affinity purification of a receptor or
other binding molecule, e.g., an antibody. ~- -
For example, the human IL- 13 ligand can be immobilized by
covalent bonding to a solid support such as cyanogen bromide-
activated Sepharose, by methods which are well known in the art, or -;
adsorbed onto polyolefin surfaces, with or without glutaraldehyde
cross-linking, for use in the assay or purification of IL- 13 receptor,
o antibodies, or other similar molecules. The IL-13 can also be
labelled with a detectable group, for example radioiodinated by the
chloramine T procedure, covalently bound to rare earth chelates, or I i
conjugated to another fluorescent moiety for use in diagnostic
assays.
lS The human IL-13 of this invention can be used as an - I
immunogen for the production of antisera or antibodies specific for ¦
the interleukin or any fragments thereof. The purified interleukin
can be used to screen monoclonal antibodies or antigen-binding I ;
fragments prepared by immunization with various forms of impure
2 o preparations containing the protein. In particular, the term
"antibodies" also encompasses antigen binding fragments of natural
antibodies. The purified interleukin can also be used as a reagent to
- -detect any antibodies ~ generated in response to the presence ofelevated levels of expression, or immunological disorders which lead
2s to antibody production to the endogenous cytokine.
- Additionally, IL-13 fragments may also serve as immunogens
to produce the antibodies of the present invention, as described
immediately below. For example, this invention contemplates
- --- - antibodies having binding affinity to or being raised against the
- --30 amino acid sequence shown in Table 1, fragments thereof, or
- homologus peptides. In particular, this invention contemplates ^
antibodies having binding affinity to, or having been raised against,
specific fragments which are predicted to be, or actually are,
- exposed at the exterior protein surface of the native cytokine.
3s The blocking of physiological response to these interleukins ;
may result from the inhibition of binding of the ligand to the
..
.
Wo 94/04680 Pcr/US93/0764
34
21~2860
receptor, likely through competitive inhibition. Thus, in vitro assays
of the present invention will often use antibodies or ligand binding
segments of these antibodies, or fragments attached to solid phase
substrates. These assays will also allow for the diagnostic
determination of the effects of either binding region mutations and
modifications, or ligand mutations and modifications, e.g., ligand
analogues.
This invention also contemplates the use of competitive drug
screening assays, e.g., where neutralizing antibodies to the
0 interleukin or fragments compete with a test compound for binding
to a receptor or antibody. In this manner, the neutralizing
antibodies or fragments can be used to detect the presence of any J
polypeptide which shares one or more binding sites to a receptor
and can also be used to occupy binding sites on a receptor that
5 might otherwise bind an interleukin.
V. Makin~ Nucleic Acids and Protein
DNA which encodes the protein or fragments thereof can be
obtained by chemical synthesis, screening cDNA libraries? or by
screening genomic libraries prepared from a wide variety of cell
20 lines or tissue samples. Natural sequences can be isolated using
standard methods and the sequences provided herein, e.g., in Table l.
This DNA can be expressed irl a wide variety of host cells for - -
the synthesis of a full-length human interleukin or fragments which `
can in turn, for example, be used to generate polyclonal or
2s monoclonal antibodies; for binding studies; for construction and ~ -~
expression of modified agonist/antagonist molecules; and for
strlucture/function studies. Each variant or its fragments can~be
~expressed in host cells that are transformed or transfected with
appropriate expression vectors. These molecules can be
substantially free of protein or cellular contaminants, other than
; thosc derived from thc recombinant host, and therefore are
particularly useful in pharmaceutical compositions when combined
with a pharrnaceutically acceptable carrier and/or diluent. The
I
: :.
~94/04680 35 2~8S;~PCr ~;
human protein, or portions thereof, may be expressed as fusions
with other proteins.
Expression vectors are typically self-replicating DNA or RNA
constructs containing the desired receptor gene or its fragments,
5 usually operably linked to suitable genetic control elements tha~ are
recognized in a suitable host cell. These control elements are
capable of effecting expression within a suitable host. The specific
type of control elements necessary to ef~ect expression will depend
upon the eventual host cell used. -
0 Generally, the genetic control elements can include a
prokaryotic promoter system or a eukaryotic promoter expression
control system, and typically include a transcriptional promoter, an
optional operator to control the onset of transcription, transcription
enhancers to elevate the level of mRNA expression, a sequence that -
encodes a ~uitable ribosome binding site, and sequences that ~ ;;
terminate transcription and translation. Expression vectors also
usually contain an origin of replication that allows the vector to
replicate independently of the host cell.
The vectors of this invention include those which contain DNA
which encodes a protein, as described, or a fragment thereof
encoding a biologically active equivalent polypeptide. The DNA can
be under the control of a viral promoter and can encode a selection
marker. This invention further contemplates use of~such expression
vectors which are capable of expressing eukaryodc cDNA coding for
such a protein in a prokaryodc or eukaryotic host, where the vector
is compatible with the host and where the eukaryotic cDNA coding
for the receptor is inserted into the vector such that growth of the
host containing the vector expresses the cDNA in question.
L' ~ Usually, expression vectors are designed for stable replication
-- - 30 in their host cells or for amplification to greatly increase the total
- _ number of copies of the desirable gene per cell. It is not always~_ ~ necessary to require that an expression vector replicate in a host
cell, e.g., it is possible to effect transient expression of the
interleukin protein or its fragments in various hosts using vectors
35 that do not contain a replication origin that is recognized by the host
.
WO 94/04680 PCI`/US93/~)764
36
21~2860
cell.- It is also possible to use vectors that cause integration of the
human protein or its fragments into the host DNA by reeombination.
Vectors, as used herein, comprise plasmids, viruses,
bacteriophage, integratable DNA fragments, and other vehicles - ~`
which enable the integration of DNA fragments into the genome of
the host. Expression vectors are specialized vectors which contain
genetic control elements that effect expression of operably linked
genes. Plasmids are the most commonly used form of vector but all ~
other forms of vectors ~,vhich serve an equivalent function and ~:
which are, or become, known in the art are suitable for use herein.
See, e.g., Pouwels e~ al., Cloning Vectors: A Laboratory Manual, 1985
and Supplements, Elsevier, N.Y.; and Rodriquez et al. (eds), Vectors~
A Survey of Molecular Cloning Vectors and Their Uses, 1988, ~ ~ :
Buttersworth, Boston. ` - ;
. ~ .
Transformcd cells are cells, preferably mammalian, that have
been transformed or~ transfected with receptor vectors constructed
using recombinant DNA techniques. Transformed host cells usually
express; the ~desired protein or its fragments, but for purposes of
cloning,~ amplifying, and manipulating its DNA, do not need to
20 ~ express the~ subject protein. This invention further contemplates
cul~uling transformed ce!ls in a nutrient medium, thus permitting ,i;
the~ interleukin~ to accumulate in the culture. The protein can be
recovered, ~ei~thèr from,the culture or from the culture medium. ,-
For;~ purposes of this invendon, nucleic sequences are operably ~`
2s ~linked when~lhey are functionally related to each other. For
example, DNA~ for~ a~presequènce or secretory leader is operably
linked~ to a~ polypeptide if it is expressed as a preprotein or ~ ~~
participates in directing the polypeptide to the cell membrane or in
'`; ~ sécredon of th~ polypcptide. A promoter is operably linked to a - -
3 0 ~coding sequence if it controls the transcription of the polypeptide;- a
ribosome binding sitc is operably linked to a coding sequence if it is _ .
` positioned to pennit translation. Usually, opcrably linked means ~ ~
~ . .
condguous and in reading frame, howe~er, certain genetic elements
such às ropressor gcnes are not contiguously linked but still bind to
3~5 operator sequences that in turn control e~pression.
.~.
,~.,
~.
-.
~0 94/04680 ~? PCl`/US93J0764~ ~
~8~
Suitable host cells include prokaryotes, lower eukaryotes, and
higher eukaryotes. Prokaryotes include both gram negative and
gram positive organisms, e.g., E. coli and B. subtilis Lower
eukaryotes include yeasts, e.g., S. cerevisiae and Pichia, and species
5 of the genus Dictyostelium. Higher eukaryotes include established
tissue culture cell lines from animal cells, both of non-mammalian
origin, e.g., insect cells, and birds, and of mammalian origin, e.g.,
human, primates, and rodents. -
Prokaryotic host-vector systems include a wide variety of
0 vectors for many different species. As used herein, E. coli and its
vectors will be used generically to include equivalent vectors used ' `
in other prokaryotes. A representative vector for amplifying DNA is
pBR322 or many of its derivatives. Vectors that can be used to
express the receptor or its fragments include, but are not limited to,
5 such vectors as those containing the lac promoter (pUC-series); trp
promoter (pB~322-trp); Ipp promoter (the pIN-series); lambda-pP
or pR promoters (pOTS); or hybrid promoters such as ptac (pDR540).
See Brosius et al., "Expression Vectors Employing Lambda-, trp-, lac-,
and Ipp-derived Promoters", in Vectors: A Sun/ey of Molecular I:
20 Cloning Vectors and Their Uses, (eds. Rodriguez and Denhardt), 1988,
Buttersworth, Boston, Chapter 10, pp. 205-236.
Lower eukaryotes, e.g., yeasts and Dictyostelium. may be
---~ transformed with IL- 13 sequence containing vectors . For purposes
of this invention, the most common lower eukaryotic host is the
- -- 2s - baker's yeast, Saccharomyces cerevisiae. It will be used to
generically represent lower eukaryotes although a number of other
strains and species are also available. Yeast vectors typically consist
of la replication origin (unless of the integrating type~, a selection
--- gene, a promoter, DNA encoding the receptor or its fragments, and
30 sequences for translation termination, polyadenylation, and
transcription termination.
- - Suitable expression vectors for yeast include such constitutive
promoters as 3-phosphoglycerate kinase and various other
glycolytic enzyme gene promoters or such inducible promoters as
3 5 the alcohol dehydrogenase 2 promoter or metallothionine promoter.
Suitable vectors include derivatives of the following types: self-
wo 94/04680 - Pcr/US93/0764 ~
6~ 38
replicating low copy number (such as the YRp-series), self-
replicating high copy number (such as the YEp-series); integrating
types (such as the YIp-series), or mini-chromosomes (such as the
YCp-series).
s Higher eukaryotic tissue culture cells are normally the
preferred host cells for expression of the functionally active
interleukin protein. In principle, any higher eukaryotic tissue
culture cell line is workable, e.g., insect baculovirus expression
systems, whether from an invertebrate or vertebrate source. ~
0 However, mammalian cells are preferred. Transformation or ;-`
transfection and propagation of such cells has become a routine
procedure. Examples of useful cell lines include HeLa cells, Chinese
hamster ovary (CHO) cell lines, baby rat kidney (BRK) cell lines,
insect cell lines, bird cell lines, and monkey (COS) cell lines.
Expression vectors for such cell lines usually include an origin
of replication, a promoter, a translation initiadon site, RNA splice -
sites (if genomic DNA is used), a polyadenylation site, and a
transcnption termination site. These vectors also usually contain a
selection gene or amplification gene. Suitable expression vectors
may be plasmids, viruses, or retroviruses carrying promoters
derived, e.g., from such sources as from adenovirus, SV40,
parvoviruses, vaccinia virus, or cytomegalovirus. Representative
examples of suitable expression vectors include pCDNA1; pCD, see~
Okayama e~ al., Mol. Cell Biol. 5:1136 (1985); pMClneo PolyA, see
Thomas et al., Cell 51:503 (1987); and a baculovirus vector such as _ `--
pAC 373 or pAC 610. ~
Por secreted proteins, an open reading frame usually encodes a ~
polypeptide that consists of a mature or secreted product covalently
1~, t linked at istiN-terminus to a signal peptide. The signal pepdde is --
cleaved prior to secretion of the mature, or active, polypeptide. The
cleavage site can be predicted with a high degree of accuracy from _
cmpirical rules, e.g., von Heijne, Nucleic Acids Research 14:468~
(1986), and the precise amino acid composition of the signal peptide
does not~ appear to be critical to its function, e.g., Randall et al.
-~ ~ 35 Science 243:1156 (1989); Kaiser e~ al., Science 235:312 (1987).
. ~ .
~094/04680 39 1~8~o PCI/US93/07645
It will often be desired to express these polypeptides in a
system which provides a specific or defined glycosylation pattern.
In this case, the usual pattern will be that provided naturally by the
expression system. However, the pattern will be modifiable by
5 exposing the polypeptide, e.g., an unglycosylated form, to
appropriate glycosylating proteins introduced into a heterologous
expression system. For example, the interleukin gene may be co-
transformed with one or more genes encoding mammalian or other -
glycosylating enzymes. Using this approach, certain mammalian
0 glycosylation pattems will be achievable in prolcaryote or other
cells.
The source of human IL-13 can be a eukaryotic or prokaryotic
host expressing recombinant huI~- 13 DNA, such as is described ~-
above. The source can also be a cell line such as mouse Swiss 3T3
5 fibroblasts, but other mammalian cell lines are also contemplated by
this inven~ion, with the preferred cell line being from the human ~ .
species.
Now that the entire sequence is known, human IL- 13,
fragments, or derivatives thereof can be prepared by conventional
2 o processes for synthesizing peptides. These inciude processes such as
are described in Stewart et al., Solid Phase Peptide Synthesis, 1984,
Pierce Chemical Co., Rockford, IL; Bodanszky e~ al., The Practice of
Peptide Synthesis, 1984, Springer-Verlag, New York; and Bodanszky,
The Principles of Peptide Synthesis, 1984, Springer-Verlag, New
25 York. For example, an azide process, an acid chloride process, an
acid anhydride process, a mixed anhydride process, an active ester
process (for example, p-nitrophenyl ester, N-hydroxysuccinimide
ester, or cyanomethyl ester), a carbodiimidazole process, an
oxidative-reductive process, or a dicyclohexylcarbodiimide
3o (DCCD)/additive process can be used. Solid phase and solution phase
syntheses are both applicable to the foregoing processes.
The IL-13 protein, fragments, or derivatives are suitably
prepared in accordance with the above processes as typically
employed in peptide synthesis, generally either by a so-called
3 5 stepwise process which comprises condensing an amino acid to the
terminal amino acid, one by one in 5equence, or by coupling peptide
WO 94~04680 . PCI`/US9~/0764
6'~ ~
fragments tO the tenninal amino acid. Amino groups that are not
being used in the coupling reaction typically must be protected to
prevent coupling at an incorrect location.
If a solid phase synthesis is adopted, the C-terminal amino
5 acid is bound to an insoluble carrier or support through its carboxyl
group. The insoluble carrier is not particularly limited as long as it -
has a binding capability to a reactive carboxyl group. Examples of
such insoluble carriers include halomethyl resins, such as
chloromethyl resin or bromomethyl resin, hydroxymethyl resins,
10 phenol resins, tert-alkyloxycarbonylhydrazidated resins, and the
like. ` :
An amino group-protected amino acid is bound in sequence
through condensation of its activate~ carboxyl group and the
reactive amino group of the previously formed peptide or chain? to
synthesize the peptide step by step. After synthesi~ing the complete
sequence, the peptide is split off from the insoluble carrier to
produce the peptide. This solid-phase approach is generally
described by Merrifield et al., in J. Am. Chem. Soc. 85:2149 (1963).
The prepared protein and fragments thereof can be isolated ¦ -
2 o and purified from the reaction mixture by means of peptide I ~-
separation, for example, by extraction, precipitation, electrophoresis,
various forms of chromatography, and the like. The interleukin of
this invention can be obtained in varying degrees of purity
depending upon its desired use. Purification can be accomplished by !:
2 s use of the protein purification techniques disclosed herein or by the
use of the antibodies herein described in methods of
immunoabsorbant affinity chromatography. This immunoabsorbant
affinity chromatography is carried out by firs~ linking the antibodies
' ' to a solid suppdrt and then contacting the linked antibodies with
solubilized lysates of appropriate cells, lysates of other cells`
- expressing the interleukin, or lysates or supernatants of cells
producing the protein as a result of DNA techniques, see--berow.
Generally, the puriffed protein will be at least about 40% pure,
ordinarily at least about 50% pure, usually at least about 60% pure,
typically at least about 70% pure, more typically at least about 80%
pure, preferable at least about ~0% pure and more preferably at
~ g4/04680 ~.7 PCI`/US93/07645
41 ~8~ ::
b'
least about 95% pure, and in particular embodiments, 97%-99% or
more. Purity will usually be on a weight basis, ~ut can also be on a
molar basis. Different assays will be applied as appropriate.
VI. Antibodies
Antibodies can be raised to the various human IL-13 proteins
and fragments thereof, both in natu~ally occurring native fo~ms and -
in their recombinant formst the difference being that antibodies to
the active ligand are more likely to recogni~e epitopes which are
only present in the native conformations. Anti-idiotypic antibodies
0 are also contemplated, which would be useful as agonists or
antagonists of a natural receptor or an antibody.
Antibodies, including binding fragments and single cha;in
versions, against predetermined *agments of the protein can be
raised by immunization of animals with conjugates of the fragments
with immunogenic proteins . Monoclonal antibodie~ are prepared
from cells secreting the desired antibody. These antibodies can be
screened for binding to norrnal or defective protein, or screened for
agonistic or antagonistic activity. These monoclonal antibodies will_
usually bind with at least a KD of about 1 mM, more usually at least
about 300 IlM, typically at least about 100 ~lM, more typically at
least about 30 IlM, preferably at least about 10 ~M, and more
preferably at least about 3 ~M or better.
The antibodies, including antigen binding fragments, of this
invention can have significant diagnostic or therapeutic value. They
2s can be potent antagonists that bind to the interleukin and inhibit
binding to the receptor or inhibit the ability of huamn IL-13 to elicit
a,biological response. They also can be useful as non-neutralizing
antibodies and can be coupled to toxins or radionuclides to bind
producing cells, or cells localized to the source of the interleukin.
Further, these antibodies can be conjugated to dNgs or other
therapeudc agents, either directly or indirectly by means of a linker.
The antibodies of this invention can also bç useful in
diagnostic applications. As capture or non-neutralizing antibodies,
they can bind to the interleukin without inhibiting receptor binding.
WO 94/04680 PCr/US93/0764:
42
As neutralizing antibodies, they can be useful in competitive binding
assays. They will also be useful in detecting or quantifying IL- 1 3 . ~;
- Protein fragments may be joined to other materials,
particularly polypeptides, as fused or covalently joined polypeptides
to be used as immunogens. The human IL- 13 and its fragments
may be fused or covalently linked to a variety of immunogens, such
as keyhole limpet hemocyanin, bovine serum albumin, tetanus
toxoid, etc. See Microbiology, Hoeber Medical Divisian, Harper and
Row, 1969; Landsteiner, Specificity of Serological Re~ctions, 1962,
0 Dover Publications, New York; and Williams et al., Methods in
Immunology and Immunochemistry, 1967, Vol. 1, Academic Press,
New York, for descriptions of methods of preparing polyclonal
antisera. A typical method involves hyperimmunization of an
animal with an antigen. The blood of the animal is then collected
shortly after the repeated immunizations and the gamma globulin is ~ `
isolated.
In some instances, it iS desirable tO prepare monoclonal
antibodies from various mammalian hosts, such as mice, rodents,
primates, humans, e~c. Description of techniques for preparing such
monoclonal antibodies may be found in, e.g., Stites et al. (eds), Basic .
and Clinical Immunology (4th ed.), Lange Medical Publications, Los
Altos, CA, and references cited therein; Harlow et al., Ant~bodies:. A ``
Laboratory Manual, 1988, CSH Press; Goding, Monoclonal An~bodies:
Principles and Practice (2d ed), 1986, Academic Press, New York;
2s and particularly in Kohler and Milstein, Nature 256:495 (1975),
which discusses one method of generating monoclonal antibodies. --~
Briefly, this method involves injecting an animal with an - ~-
immunogen. The animal is then sacrificed and cells taken from its
spleen, which are then fused with myeloma cells. The result is a
hybrid cell or "hybridoma" that is capable of reproducing in vitro.
The population of hybridomas is then screened to isolate individual `
clones, each of which secrete a single antibody species to the~~~: ~
immunogen. In this manner, the individual antibody species
obtained are th~ produc~s of immortalized and cloned single B cells
3 5 from the immune animal generated in response to a specific site
recognized on the immunogenic substance.
.~94/04680 ~8~5'o Pcr/US93/0764s
Other suitable techniques involve in Yitro exposure of
lymphocytes to the antigenic p~lypeptides or alternatively ~o
selection of libraries of antibodies in phage or similar vectors. See,
Huse et al., Science 246:1275 (1989); and Ward et al., Natl~re
341:544 (1989). The polypeptides and antibodies of the present
invention may be used with or without modification, including
chimeric or humanized antibodies.
Frequently, the polypeptides and antibodies will be labelled
by joining, either covalently or non-covalently, a substance which
0 provides for a detectable signal. A wide variety of labels and
conjugation techniques are known and are reported extensively in
both the scientific and patent literature. Suitable labels include
radionuclides, enzymes, substrates, cofactors, inhibitors, fluorescent
moieties, chemiluminescent moieties, magnetic particles, and the
like. Patents teaching the use of such labels include U.S. Patent Nos.
3,817,837; 3,850,752; 3,939,350; 3,996,345; 4,277,437; 4,275,149;
and 4,366,241. Also, recombinant or chimeric immunoglobulins may
be produced, see Cabilly, U.S. Patent No. 4,816,567.
The antibodies of this invention can also be used for af~lnity
chromatography in isolating the IL-13. Columns can be prepared ;
where the antibodies are linked to a solid support, e.g., particles,
such as agarose, Sephadex, or the like, where a cell lysate may be
passed through the column, the column~~washed, followed by
increasing concentrations of a mild denaturant, whereby the
purified protein will be released.
The antibodies may also be used to screen expression libraries
for particular expression products. Usually the antibodies used in
such a procedure will be labelled with a moiety allowing easy
'~ detection of presence of antigen by antibody binding.
Antibodies raised against cach human IL-13 will also be used
to raise anti-idiotypic antibodies. These will be useful in detecting
or diagnosing various immunological conditions related to expression
of the protein or cells which express receptors for the protein. They
also will be useful as agonists or antagonists of the interleukin,
3s which may be competitive inhibitors or substitutes for naturally
occurring ligands.
I
W0 94t04680 PCI /US93/0764' : ~:4~ :
~4~,~6~
VII. Use~ of IL-13 Compositions Nu~leic_acids
Both naturally occurring and recombinant forms of the human
Interleukin-13 molecules of this invention are particularly useful in ~
kits and assay methods. For example, these methods would also be ~-
s applied to screening for binding activity to these proteins. Several
methods of automating assays have been developed in recent years
so as to permit screening of tens of thousands of compounds per
year. See, e.g, a BIOMEK automated workstation, Beclcman
Insauments, Palo Alto, California, and Fodor e~ al., Science 251:767
0 (1991). The latter describes means for testing binding by a plurality
of defined polymers synthesized on a solid substrate. The
development of suitable assays to screen for a receptor or
agonist/antagonis~ homologous proteins can be greatly facilitated by
the availability of large amounts of purified, soluble interleukin in ~-~
5 an active state such as is provided by this invention.
Rational dmg design may also be based upon structural
s~udies of the molecular shapes of a receptor or antibody and other -~
effectors or ligands. Effectors may be other proteins which mediate
other functions in response to ligand binding, or other proteins
2 o which normally interact with the receptor. One means for
determining which sites interact with specific other proteins is a
physical structure determination, e.g., x-ray crystallography or 2
dimensional NMR techniques. These will provide guidance as to
which amino acid residues form the molecular contact regions. For a
detailed description of protein structural determination, see,- e.g.,- ` ~~ ~
Blundell et al., Protein Crystallography, (1976) Academic Press, New- ~
York.
Purified interleukin-13 can be coated directly onto platès for
use in the aforementioned receptor screening techniques. Ho~,vever,
non-neutralizing antibodies to these proteins can be used as capture
antibodies to immobilize the respective interleukin on the--soii~
phase, useful, e.g., in diagnostic uses. - ~~ ~
This invention also contemplates use of interleukin-13, ---
fragments thereof, peptides, and their fusion produ~ts in a variety of
diagnostic kits and methods for detecting the presence of the protein I `
94t04680 ;~,;r PCI/US93/07645
8~o
or its receptor. Alternatively, or additionally, antibodies against the-
molecules may be incorporated into the kits and methods. Typically
the kit will have a compartment containing either a defined IL-13
peptide or gene segment or a reagent which recognizes one or the
s other. Typically, recognition reagents, in the case of peptide, would
be a receptor or antibody, or in the case of a gene segment, would be -
a probe.
A preferred kit for determining the concentration of, for
example, IL-13, a sample would typically comprise a labelled
o compound, e.g., receptor or antibody, having known binding affiniey
for IL-13, a source of IL-13 (naturally occurring or recombinant) as
a positive control, and a means for separating the bound from free
labelled compound, for example a solid phase for immobilizing the
IL-13 in the test sample. Compartments containing reagents, and
instructions, will normally be provided.
Antibodies, including antigen binding fragments, specific for
lL.-13 or a` peptide fragment, or receptor fragments~re useful in
diagnostic applications to detect the presence of elevated levels of
IL-13 andjor its fragments. Diagnostic assays may be homogeneous '
2 0 (without a separation step between free reagent and antibody-
antigen complex) or heterogeneous ~with a separation step). Various
commercial assays exist, such as radioimmunoassay (RIA), enzyme-
linked immunosorbent assay (ELISA), enzyme immunoassay (EIA),
enzyme-multiplied immunoassay technique (EMIT?, substrate-
2s labelled~fluorescent immunoassay (SLFIA) and the like.
~- For example, unlabelled antibodies can be employed by using
a~ second antibody which is labelled and which recognizes the
andbody to IL-13 or to a particular fragment thereof. These assays
, ihavd à!so been extensively discussed in the literature. See, e.g.,
30 Harlow et al., Antibodies: A Laboratory Manual, 1988, CSH; and
Coligan ~Ed.), Current Protocols ln Immunology, 1991 and periodic
supplements, Greene/Wiley, New York.
Anti-idiotypic antibodies may have similar use to serve as
agonists or antagonists of IL-13. These should be useful as
3s therapeutic reagents under appropriate circumstances.
WO 94/04680 PCr/US93/0764' ` ~-~
4 6
6 ~ `
Frequently, the reagents for diagnosti~ assays are supplied in
lcits, so as to optimize the sensitivity of the assay. For the subject
invention, depending upon the nature of the assay, the protocol, and
the label, either labelled or unlabelled antibody, or labelled receptor ~;
is provided. This is usually in conjunction with other additives, such `:7''~``~'
as buffers, stabilizers, materials necessary for signal production such
as substrates for enzymes, and the like. Preferably, the kit will also
contain instructions for proper use and disposal of the contents after
use. Typically the kit has compartments for each useful reagent. ~;~
0 Desirably, the reagents are provided as a dry lyophilized powder, i .`~
where the reagents may be reconstituted in an aqueous medium 1 "
having appropriate concentrations for performing the assay. i ;
Any of the constituents of the diagnostic assays may be used
without modification or may be modified in a variety of ways. For -~-
example, labelling may be achieved by covalently or non-covalently
joining a moiety which directly or indirectly provides a detectable
signal. In any of these assays, a test compound, IL-13, or antibodies
thereto can be labelled either directly or indirectly. Possibilities for
direct labelling include label groups: radiolabels such as 125I,
~20 enzymes (U.S. Pat. No. 3,645,090) such as peroxidase and alkaline
phosphatase, and lluorescent labels (U.S. Pat. No. 3,940,475) capable `~
of monitoring` the change in fluorescence intensity, wavelength shift,
or fluorescence polarization. Possibilities for indirect labelling - j ~
- include biotinylation of one constituent followed by binding to `-
2s avidin coupled to one of the above l?bel groups.
There are also numerous methods of separating the bound ~
*om the *ee ligand, or alternatively the bound from the free test
compound. The IL-13 can be immobilized on various matrixes
!; ` followed by washing. Suitable matrices include plastic such as - an -
ELISA plate, filters, and beads. Methods of immobilizing the-
receptor to a matrix include, without limitation, direct adhesion to ! j,,
plastic, use of a capture antibody, chemical coupling, and~~~
biotin-avidin. :
The last step in this approach involves the precipitation of
antibody/antigen complex by any of several methods including
those udlizing, e.g., an organic solvent such as polyethylene glycol or
.
.:) g4/04680 PCI/US93/0764
4 7 ~ !
~ '
a salt such as ammonium sulfate. Other suitable separation
techniques include, without limitation, the fluorescein antibody
magnetizable particle method described in Rattle et al., Clin. Chem.
30:1457 ~1984), and the double antibody magnetic particle
5 separation as described in U.S. Pat. No. 4,659,678.
The methods for linking protein or fragments to various labels `
have been extensively reported in the literature and do not require `
~detailed discussion here. Many of the techniques involve the use of
activated carboxyl groups either through the use of carbodiimide or
0 active esters to form peptide bonds, the formation of thioethers by
rcacdon of a mercapto group with an activated halogen such as
chloroacetyl, or an activated olefin such as maleimide, for linkage, or -
the lil~e. Fusion proteins will also find use in these applicatiqns.
Another diagnostic aspect of this invention involves use of -~
oligonucleotide or polynucleotide sequences taken from the I:
se~uence ~of an IL-13. Thesc sequences can be used as probes for
detecting levels of the IL-13 in patients suspected of having a
proliferative ccll conditions, e.g., cancer. The preparation of both :
RNA and DNA nucleotide sequences, the labelling of the sequences,
20 ~and ~the preferred size of tho sequences has received ample
description and discussion in the literature.
Normally an oligonuc~eotide probe should have àt least about
14 nucleotidos, usually at least about 18 nucleotides, and the
polynucleotide pr:obes~ may be up to several kilobases. Various
2s~ labols may be cmployed, most commonly radionuclides, particularly
32p. However, other tochniqucs may also be employed, such as
using biodn modified nucleotides for introduction into a
polynucleodde. The biotin then serves as the site for binding to
avidin or antibodiés, which may be labelled with a wide variety of
~30 labols, such as radionuclides, fluorcscers, enzymes, or the like.
Altcrnatively, antibodies may be employed which can
:~ ~ recognize specific duplexes, including DNA duplexes, RNA duplexes,-~ ~; DNA-RNA hybrid~ duplexes, or DNA-protein duplexes. The antibodiesin ~turn may be labelled and the assay carried out where the duplex
35 is~bound to a surface, so that upon the formation of duplex on the
- ~ surfacc, thc presence of antibody bound to the duplex can be
" ~
:~:
WO 94/04680 . PCTtUS93/0764!
~ ~q ~ 6~
detected. The use of probes to the novel anti-sense RNA may be
carried out in any conventional techniques such as nucleic acid
hybridization, plus and minus screening, recombinational probing,
hybrid released translation (HRT), and hybrid arrested translation -
s (HART). This also includes amplification techniques such as
polymerase chain reaction (PCR).
Diagnostic kits which also test for the qualitative or
quantitative presence of other markers are also contemplated.
Diagnosis or prognosis may depend on the combination of multiple
indications used as markers. Thus, kits may test for combinations of ,
markers. See, e.g., Viallet et al., Progress in Growth Fac~or Res. 1:89
(1989).
VIII. Therapeutic Utilitv
This invention provides reagents with significant therapeutic
value. The IL-13 (naturally occurring or recombinant), fragments
thereof, and antibodies thereto, along with compounds identified as
having binding affinity to the interleukin or its receptor or
antibodies, should be useful in the treatment of conditions exhibiting
abnormal expression of the interleukin. Such abnormality will ,
20 typically be manifested by immunological disorders. Additionally,
this invention should provide therapeutic value in any disease or
disorder associated with abnormal expression or abnormal ~~ ` -~ `
triggering of response to the interleukin.
Recombinant IL-13 or IL-13 antibodies can be purified and - -
2 5 then administered to a patient. These reagents can be combined for - - -
therapeutic use with additional active ingredients, e.g., in
conventional pharmaceutically acceptable carriers or diluents, along
with physiologically innocuous stabilizers and excipients. These- - ~
combinations can be sterile filtered and placed into dosage forms as
30 by lyophilization in dosage vials or storage in stabilized aqueous_
preparations. This invention also contemplates use of antibodies~~ or-
binding fragments thereof which are not complement binding.
Receptor screening using II,- 13 or fragments thereof can be
performed to identify molecules having binding affinity to the
I
1 ,
94/046~0 PCr/US93/07645
4 9
8s~
interleukin. Subsequent biological assays can then be utilized to
determine if a receptor can provide competitive binding, which can
block intrinsic stimulating activity. Receptor fragments can be used
as a blocker or antagonist in that it blocks the activity of IL-13.
5 Likewise, a compound having intrinsic stimulating activity can
activate the receptor and is thus an agonist in that it simulates the
activity of IL-13. This invention further contemplates the
therapeutic use of antibodies to IL-13 as antagonists.
The quantities of reagents necessary for effective therapy will
o depend upon many different factors, including means of
administration, target site, physiological state of the patient, and
other medicants administered. Thus, treatment dosages should be
titrated to optimize safety and efficacy. Typically, dosages used i n
vitro may provide useful guidance in the amounts useful for in situ
administration of these reagents. Animal testing of effective doses i -
for treatment of particular disorders will provide further predictive
indication of human dosage. Various consideration~ are described,
e.g., in Gilman et al. (eds), The Pharmacological Bases of
Therapeutics, 8th Ed., 1990, Pergamon Press; and Remington's
20 Pharmaceutical Sc~ences, 17th ed., 1990, Mack Publishing Co., Easton,
Penn.
Methods for administration are discussed therein and below,
- e.g., for oral, intravenous, intraperitoneal, or intramuscular
administration, transdermal diffusion, and others. Pharmaceutically
25 acceptable ca~ners will include water, saline, buffers, and other
compounds described, e.g., in the Merck Index, Merck & Co., Rahway,
- New Jersey.
Because of the likely high affinity binding between an IL-13
- and its receptors, low dosages of these reagents would be initially
30 expected to be effective. Thus, dosage ranges would ordinarily be
- expected to be in amounts lower than 1 mM concentrations,
typically less than about 10 ~lM concentrations, usually less than
about 100 nM, preferably less than about 10 pM (picomolar), and
most preferably less than about 1 fM (femtomolar), with an
35 appropriate carrier. Slow release formulations, or slow release
apparatus will often be utilized for continuous administration.
WO 94/04680 PCI /US93/0764
50 ' .
,S6~
IL- 13 or fragments thereof, antibodies or fragments thereof,
antagonists, and agonists, may be administered directly to the host
to be treated or, depending on the size of the compounds, it may be
desirable to conjugate them to carrier proteins such as ovalbumin or `
5 serum albumin prior to their administration. Therapeutic
formulations may be administered in any conventional dosage
formulation . r '~
While it is possible for the active ingredient to be
administered alone, it is preferable to present it as a pharmaceutical
0 formulation. Formulations comprise at least one active ingredient,
as defined above, together with one or more acceptable carriers
thereof. Each carrier must be both pharmaceutically and
physiologically acceptable in the sense of being compatible with the
other ingredients and not injurious to the patient. Formulations
5 include those suitable for oral, rectal, nasal, or parenteral (including
subcutaneous, intramuscular, intravenous and intradermal)
administration.
The formulations may conveniently be presented in unit
dosage form and may be prepared by any methods well known in
2 o the art of pharmacy. The therapy of this invention may be
combined with or used in association with other immunotherapeutic
or immunopreventive agents. -
EXAMPLES
The b~oad scope of this invention is best understood with
25 reference to the following examples, which are not intended to limit
the inventions in any manner. Unless otherwise specified, ~~
percentages givlen below for solids in solid mixtures, liquids in
liquids, and solids in liquids are on a wt/wt, vol/vol and wt/vol
basis, respectively. Unless de~med otherwise, all technical and ~
30 scientific terms used herein have the same meaning as commonly ~
understood by one of ordinary skill in the art to which this ~~~
invention belongs.
$ ~ c ' ~C'~46~: ~ ~
2~an~;, te^nrLiques ~clica3ie t-` ~ _A and IL- !0 mz~; ~e a~ d
~o l:L-13, as desc,i~ed~ e.g.~ in U.S; Patent ~-~. 5,~ 91 (L-4) and
C ~ 0?~.5;.~51 (IL-10).
~. ~
~ pr~xima~y ~ ? D~.~ rra~Tnent d~n~,ed ~ro~. 2
Ps~ru~ re~tncu~n C!lg~:St 0~ the mous~ P60û cn~iA lon~ [3rowil
et a~ ol~ i42:679 (~8~i was iso~ated by po~yacrylam~ac
g-l e~e~opnoresis and su~se~ucnt e1u~io~ a~d ~t~anol
p~cip~a~.ion. T~i~ fragm_n which encompa~ses m~st of the codmg
,e~io~ of thc mouse ?500 _3~iA. u~ a~ioa~iv~ be11eld by
r~nd m primi~1g, iD, ~e pres~n~ o~ ~32PldCTP.
Fi~ter i~ts were prepa~ed following standa~d ?roCe~U~CS Irom
t~n ag~ p~tes each w~th appro~ma~y 5000 c~lo~ies of a B21
cDNA ~ his ~ib~Y was made fr~m cloned hum2n T cells,
dc~i~atcd B'~ 1, which ha~ becn stimu~a~d with ants-~ for 7
~ours ~rior t3 the ~so1a~io~ of thc R~. The -onst~ction of this
~i~rary i:s descnb~d i~ S. ap~icadon Se . 37f453.9~1.
The ~ters were hybr~zet overr:Light at 4~ C wi~ thc ~abel~-d
mousc P600 ~agment in ~O'i~ fo~d~, 6X S~PE~ 0.19~ S~S, SX
Den~ardt's solut~ , and 100 ~LgJ~l tR.~A T~e filters w~re wa~hed 3
~i~c~ w~th ~X ~SPE. 0~ o SDS at room tempcrature for 20 m~utes
each, ~wice w~ lX SSPE, Q.1% S~:)S at ~C fcsr I ho~r, ~en e~poscd
to film o~emi~ht. Eight pcsitiYes wer~ ~den~f~ed ~nd picked ~or
fu~er pur~ficauor~. Se~en OI th~se ~rc posiuYe upon ~esore~nmg
S~ clones had ~mHl i~e~s of 1.35 kb and one ail insert o~ oniy
0.6 ~ The 1.35 kb in~crt of on- clo~e~ des~ a~ed p~2!.2~f. was
subcloned into M13 ~d scquenced by the dide~xy method.
S-quc~ce compas~s~on demons~atcd that ehis 1.15 kb ^D~T.A encodes
a hu~ ~omolog cf mouse P60G.
Thc.huIL-13 cD?~A isol~d from thc ~2i lib~-ary was no; ~ull
leng~ as compared ~o the mousc P600 cl?NA. Rcpca~ed a~tempts to
isolate a full-~cn~:h cDNA fro~n the B~ sary wcrc un~uccessr^ul.
Thus, a d~ffe~nt Library was scrccncd wt~h ~ne pB~1.2~f in~rt Lor a
AMEN~ED SY'~T
J 94/04680 PCl`/US93/0764
52 ?~
~. &60
full length clone. A PCR probe was derived from the human cDNA
beginning 50 bp from the 5' end and ending at the stop codon.
A cDNA library was made from a clone of an A10 T cell line.
The same hybridization conditions as described above were used.
The filters were washed once in lX SSPE, 0.05% SDS at room
temperature for 15 minutes and then twice at 55C for 30 min to
one hour. They were exposed to film overnigh~. Several posi~ives
colonies were detected and rescreened. Double s~anded sequence
obtained from the 5' end of several of the cDNA inserts from these
0 positives indicated that they were full-length. One of the 1.3 kb
cDNA inserts, from a clone designated pA10.66, was subcloned into
M13 and sequenced. Its sequence is shown in Table l. The
sequence of the full length clone differed from the se~uence shorter
clone by a single codon, which is present in the full length clone, see
Table 3.
II. l~pression and Pur~ication of Mouse P600 and Human II~-13 Protein
The pB21.2Bf clone, containing a 1.16kb cDNA encoding human
IL-13, lacked the first 23 N-terminal amino acids. The insert was
prepared~ for ligation into an expression vector pGEX-2T by using
PCR to provide unique restriction sites at the 5' BamH1 and 3' EcoR 1
ends. The pGEX-2T vector is designed to produce a fusion protein,
where the distinct protein segments are separated by a readily
cleaveable protease site. The gel purified DNA was ligated into the
_ expression vector pGEX-2T so that when the plasmid is expressed in
- 25 E. coli the protein encoded by the DNA insert produces a fusion
- protein with glutathione-S-transferase with a thrombin cleavage site
in between as described in detail by Smith et al., Gene 67:31 (1988).
~ The resuldng plasmid was transformed into E. coli and successful
- transformants were grown in the presence of IPTG. Expression
~ 30 products of this construct, when grown under inducing conditions,
accumulated in inclusion bodies.
.~ .
:
~94/04680 21~286~ Pcl`/Us93/0764~
Mouse P600 Refoldin~ and Purification
Transformed E. coli cells were grown in media at 37 C and
induced with IPTG at 0.5 OD. The induced cells were grown until
maximal OD was reached either by shake flask or fermentation.
Cells were harvested by centrifugation at 4000 x g at 4C for 30 min
and were frozen at -10C.
Cells were resuspended at room temperature in TE buffer (50
mM Tis-HCI, 10 mM EDTA pH 8 with 1 mM Peflobloc, a protease
inhibitor). Cells were passed through a microfluidizer at 18,000 psi,
collected, and centrifuged at 10,000 x g at 4C for 30 min. Cell
pellets were repeatedly washed in TE buffer and centrifuged until
supernatant was clear. The pellet was solubilized with 6 M
guanidine-HCl, 10 mM Dl~, ~50 mM Tris-HCI pH 9, and 1 mM
Peflobloc and mixed at 4 C for 2 hours.
~The protein concentration was measured by the Bradford
Protein method and typically was approximately 2.~ mg/ml total
protein concentration. The mixture was diluted over a period of
hours~ to 100 f~1d of its unfolding volume into 50 mM Tris-HCl, 150
mM~NaCl, 2 mM reduced glutathione, 1 mM oxidized glutathione, 0.5
M guanidine-HCl, and 10 mM EDTA at pH 9Ø The solution was
mixed at 4C for 24 hours, allowing refolding of disulfide linkages of
the molecule. -
Precipitates were removed by centrifugation at 4000 x g for
30 min~at 4 C or by filtration with a 0.45 ~lm filter. The supernatant
2s was cQncentrated using a Pel1icon and diafilter against 50 mM TRIS-
HCL, 150 mM~ NaCI, 2.5 mM CaCl2. pH 7.5 buffer at 4 C. The
glutathione-S-transferase fusion partner was cleaved by adding
human thrombin at- 10 ng per 50 ~g of fusion protein. The salution~
was mixed at 4C for 18 to 48 h to allow the fusion protein to be
30 ~ cleaved by thrombin. SDS-PAGE gels and TF-l bioassay was used to
~; characterize P600 conformation and activity.
~- ~ Ammonium sulfate was aded to the refolded material at a 25%
saturation rangc after complete thrombin cleavage was observed.
~G~ e~refolded material was adjusted to pH 8.5 with 6N NaOH and
; 35 loaded onto a butyl Toyo Pearl column, equilibrated at pH 8.5 with
wos4/w680 21~286u 54 PCI/US93/0764'
2~% ammonium sulfate, 50 mM TRIS-HCL, 0.05 M NaCl buffer. The
column was washed with equilibration buffer until the A 2 8 0
approached baseline. The colmn was eluted with 50 mM TRIS pH
8.5 buffer for 5 bed volumes. An A280 pool was collected and
5 concentrated in a 5000 molecular weight cutoff Amicon stir cell to a
volume less than 3% of the bed volume of the S200 gel filtration
column.
The S-200 column was equilibrated with depyrogenated
buffer 50 mM NaPi, 150 mM NaCl, and 0.01% Tween-20 pH 6Ø The
0 concentrated S pool was loaded onto the gel filtration column and
fractions were collected and verified for P600 protein content by
SDS-PAGE gels. Practions were pooled based on SDS-PAGE,
concentrated, filtered through 0.22 llm filters and tested by tbe TF-1
bioassay for biological activity. Protein concentration was
5 determined by silver stairling and scan using the Molecular Dynamic
gel scanner.
Endotoxin was measured using the Whittaker colorimetric
Limulus assay and typically was < 10 eu/ml typical preparations
resulted in ~ 95% purity by staining, with a bioactivity of about 1 x
20 lo6 units/ml. Variations on the refolding procedure will be
~- effective, e.g., protein concentrations may vary over some range,
typically a 5^fold difference will also work. The glutathione
concentrations may be varied, and the periods of time for slow -- -
~ dilution and overnight incubations may be titrated. Each of the
-~; 25 refolding parameters described should be titrated where
appropriate. - - - -
Similar procedures were used p~epare and to purify human --
IL-13
III. Activities on B Cells -
; - 30 A. Cofactor/facto~ Proliferation: Cell Viabil~
. .
Mouse P600 functions as a stimulator/costimulator of cell
viability, e.g., mouse P600 made from E. coli can stimulate or
costimulate proliferation of large in ~vivo activated mouse B cells.
) 94/~o 2 1 ~ 2 ~ 6 V PCr/US93/~764~
Decreasing amounts of P600 administered to the cells resulted in
lessened cell growth as determined by 3 H-thymidine incorporation.
To construct a cDNA encoding the extracellular domain of CD40
(designated "soluble CD40"), the following PCR primers containing an
- 5 XhoI site were synthesized on an Applied Biosystems 380A DNA
synthesizer:
sense~ ACAGCTCGAGCCATG-GTGTCTTTGCCTCGGCTGTG-3' and
antisense: S'-GTAGCTCGAGCTCACCGGGACTTTAAACCACAGATG-3'.
These primers were used to produce PCR fragments encoding
0 191 amino acids from the start codon of mouse CD40. PCR fragments
were digested with XhoI and then ligated into XhoI cleaved
mammalian/bacterial expression vector (pME18S). The inserted
fragment was sequenced by the dideoxy sequenceing method to
confirm the sequence.
; Plasmids carrying the soluble CD40 cDNA were transfected into
COS-7 cells by electroporation by standard procedures, See Ausubel
e~ al. (1987 and periodic supplements). Briefly, 0.75 ml of COS-7 cell
suspension in serum free Dulbecco's Minimal Essential (DME)
~`5~ medium~ at 107 cells per ml were incubated with 50 ~11 of 20 llg
20 ~ plasmid ~ at room temperature for 10 min, and subjected to
electroporation ~using a Bio-Rad gene pulser ~60 F, 220 V). Ten
minutes after electroporation, COS-7 cells were cultured in four 10
cm~ dishes for 3 days. For the purification of soluble CD40, medium
was changed to ~phenol red-free RPMI 1640 supplemented with
2s ~HBlOl~ (HA~A Biologics, Alameda, CA) one day after electroporation.
Soluble CD40 was purified by ion exchange chromatography on
anilon exchange columns using standard procedures. The protein
was eluted from the column using a linear NaCl gradients and
analyzed by Western Blotting using a rabbit antiserum against a
30 ~ CD40 pcptide made by standard methods.
~,... . .
Eight woek old female Lewis rats were obtained from Harlan
Sprague-Dawley (Indianapolis, IN). These rats were immunized
intaperitoneally with 10 ~lg of soluble CD40 in complete Freund's
~,
~s~,.. .:., ,~ ,
WO 94/04~80 PCI`/US93/07645
56
21~86~
adjuvant followed by boosts of 10, 10, 10, and 50 ',lg of soluble CD40
in incomplete Freund's adjuvant at 3, 4.5, 6, and 8.5 weeks,
respectively. A final boost in saline was injected at 12 weeks. Test
bleeds were evaluated for anti-CD40 antibody content by ELISA.
Small dense B cells from unstimulated mouse spleens were
prepared as described in Hodgkin et al., Cell. Immunol. 134:14
(1991). Spleens were teased into complete RPMI ~cRPMI) containing
5% fetal calf serum (FCS; J.R. Scientific, Woodland, CA), 5 x 10-5 M
2-mercaptoethanol (Polysciences, Inc., Warrington, PA), 2 mM
0 glutamine (J.R. Sciendfic), and 25 mM HEPES buffer (Irvine
Scientific, Santa Ana, CA), 100 U/ml penicillin, and 100 ~lg/ml
streptomycin (Irvine). Red blood cells were Iysed using 0.83%
ammonium chloride, pH 7.4.
T cells were removed using two successive treatments with
anti-mouse Thy 1.2 mAb (New England Nuclear, Boston, MA) and
anti-L3T4 antibody (RL172.4 hybridoma, a gift from Dr. H.R.
~ ~ MacDonald, Ludwig Insdtute, Epalinges, Switzerland) for 20 min on
t'~ , ice fo!Iowed by complement (1:10 dilution of rabbit low-tox
complement, Cedarlane Laboratory, Ontario, Canada) for 30 min at
37C. Small dense B cells were then isolated by density gradient
` ~ centrifugation using a discontinuous gradient composed of 75%, 65%,
and 50% percoll (Pharmacia' ~ine' Che~nicals, Uppsala, Sweden) at
2500 x g~ for 25 min at 4C.
Cells collected from the interface between 65% and 75% percoll
25 were used in subsequent experiments. Large in vivo activated B
- ~ cells were-collected~ from the 65% and 50% interface. B cells were-
cultured in flat bottomed 96 well tissue culture plates (3072, Falcon
; La~ware) at~ variou$ cell densities in cRPMI, plus additional
stimulants, as indicated. Proliferation was evaluated via a 4 hr - -
30 pulse of 3H-thymidine (Amersham) added at 48 hr after~ culture
initiation. - _-
.
, ~, ,
., i ~ .
``; 35
-
2i~?~ Pcr/uss3/0764
B. Sustained Sùrvival of B Çells: Selectivitv Rea~ents
The anti-CD40 mAb89 and anti-CD23 mAb25 were produced
by standard procedures against the respective antigens, see Vallé e t
al., Eur. J. Immunol. 19:1463 (1989); Bonnefoy et al., J. Immunol.
138:2970 (1987). The CDw32/Fcy RII transfected Ltk-cell line
(CDw32 L cells) was described by Peltz et al., J. Immunol. 141:1891
( 1988). Anti-IgM antibodies coupled to beads (anti-M) were
purchased from Biorad (Richmond, CA).
Cell phenotype was determined using FITC conjugated mAb
0 originating from Becton Dickinson (Mountain View, CA). The
-' neutralizing anti-IL-4 monoclonal antibody was kindly provided by
~Dr. Grassi. The extracellular domain of the 130 kDa IL~ receptor
was derived from COS-7 cells transfected with a plasmid containing
a truncated IL-4 cDNA described by Garrone et al., Eur. J.~lmmunol.
21:1~3~65 (1991). The recombinant protein was purified from
transfected cell culture supernatant by purification nn an IL-4-Affi-
gel ~10 ~column. The anti-130 kDa IL-4 receptor antibody was
generated~ after immunization of mice with the extracellular domain
of ~e IL~ receptor. Cultures were carried out in modified
Iscove's medium.
B Cell Pre~arations and Cell Cultures
B cells~ were isolated from tonsils as described by Defrance et
;al., J. Immunol. 139:1135 (1987). Briefly, after a rosetting step with
sheep red blood ce!ls, non-rosetting cells were further incubated
2s with anti-CD2, anti-CD3, and anti-CD14 mAbs prior to negative
$election perf/ormèd ~ with magnetic beads coated with anti-mouse
' ~ IgG (Dynabeads, Dynal, Oslo, Norway). The isolated populadon
expressed ? 98% CD19 or CD20 ~B cells) and < 1% CD2 (T cells) or
CD14 (monocytes).
30~ ~ Assavs With Anti~en Rece~tor Activated' B Cells
'; B lymphocytes, adjusted at 5 x 105 cells/ml, were stimulated
for 72 hours with insolubilized anti-IgM (5 ,ug/ml). A 16 hour pulse
WO g4/04680 PCI /US93/0764
58
2 ~ Q
with 1 ~lCi (3H)TdR was usually performed at day 3 and 6. [3H]-TdR
uptake was measured by standard liquid scintillation counting
techniques .
CD40 ~ystem
For proliferation assays, 2.5 x 104 purified B cells were
cultured in the presence of 2.5 x 103 irradiated (7000 rad) CDw32 L
cells and 0~5 ~g/ml of anti-CD40 mAb89 in a final volume of 200
For Ig production, B cells were tested at 2.5 x 105 cells/ml.
Supernatants were harvested after 10 days and Ig levels were
0 determined by EL~SA.
Isolation of ~IgD_ and s~- B Cell Populations `~
Purified B lymphocytes were separated using a preparative
magnetic cell separation system (MACS, Becton-Dickinson), according
to the experimental procedure described in detail by Miltenyi et al.,
Cytometry 11:231 (1990). The separation based on sIgD expression
has been described e~rlier by Defrance et al., J. Exptl Med. 175:671
(1992). Purity of the sorted cell populations were > 99% for the
sIgD+ B cell subpopulation, while < 1% of sIgD- B cell subpopulation .
expressed dIgD, as assessed- by fluorescence analysis using a
FACScan.
,CYtokines
.
Purified recombinant hIL-2 ~Amgen, Thousand Oaks, CA, 3 x
1 o6 U/ml), recombinant hIL-4 (Schering-Plough Research Institute,
Bloom~leld, NJ, 1 x 107 U/mg), recombinant hIL-10 (Schering~Plough
2s Research Institute, Bloomfield, NJ, 1 x 107 U/ml) were respective~y~
;~ used at 10 U/ml, 50 U/ml, and 100 nglml. Il,-13 was expressed- asa fusion protein with glutathione-S-transferase using the pGEX-2T
vector (Pharmacia, Uppsala, Swede). -
A DNA fragment encoding hIL-13 residues 24-109 was
prepared by polymerase chain reaction (PCR) and cloned into the
BamHI/EcoRI site of the vector. A DNA fragment encoding mIL-13
residues 19-109 was also prepared and cloned. The human and
94/04680 ~ PCI`/US93/07645
S 9
5~
mouse IL-13 fusion proteins were expressed as insoluble aggregates
in Escherichia coli, extracted by centrifugation, solubilized, and
subjected to a renaturation step, see van Kimmenade et al.? El~r. J.
Biochem. 173:109 (1988).
The refolded IL- 13 was cleaved from the fusion partner by
thrombin, purified by cation exchange (S-Sepharose FPLC,
Pharmacia) and gel filtration (Sephacryl s-200 FPLC, Pharmacia)
chromatography. The gel ~lltration column was calibrated with
protein standards (Bio-Rad). Proteins were quantitated by SDS-
0 PAGE, silver staining (ISS), and scanning densitometry (Molecular
Dynamics) with normalization to chicken egg Iysozyme (Sigma, St.
Louis~ MO). Endotoxin (determined by the Limulus ameobocyte
lysate assay (Whittaker Bioproducts, Inc.) was typically < 1 ey/ml.
IL-13 Enhances the D~A Svnthesis of B Cells Activated Throu~h
Their Antigen Rece~tor
The DNA synthesis of highly purified human B lymphocytes
activated through their antigen receptor with anti-IgM antibody is
enhanced by recombinant cytokines, such as IL-2, IL-4, and IL- 10.
Recombinant murine IL-13 also enhanced, in a dose dependent
fashion, the day 3 DNA synthesis of human tonsilIar B lymphocytes
cultured in the presence of insolubilized anti-IgM antibody. The
- ~ maximum stimulation- was obtained for a concentration of 10-25
nglml~ of murine (or human) IL-13.
The stimulatory effect was lower than that of either IL-2 or
IL-4 but comparable to that of IL-10. As IL-4, but unlike IL-2, t}le
~- co-stimulatory effect of IL- 13 on anti-IgM activated B cells could ~e
observed after 3 days of culture, and decreased to be virtually
undetéctable after 6 days.
,, ~
~13 Acts As Growtb Factor for B Cells Stimulated Throu~h Their
-~ 30 CD40 Antigen
IL-13 was also assayed for its ability to enhance the
proliferation of anti-CD40 activated B cells in comparison with IL-4
and IL-10. Thus, 2.5 x 104 purified tonsillar B lymphocytes were
~"~
~ :~
.., ~
,.
.
.,,~
,-~ ~ . . ...
WO 94~04680 PCr/US93/07645
21~286U 60
cuitured over CDw32 expressing L cells together with 0.5 ,u g/ml of
an anti-CD40 antibody Mab 89 with or without increasing
concentrations of IL-13. [3H]-TdR incorporation was measured at
day 6. Both murine and human IL- 13 strongly enhanced anti-CD40
induced DNA synthesis. Maximum stimulation was reached between
3 and 30 ng/ml IL-13 and plateaued thereafter without
demonstrating any inhibitory effect (even at 1000 ng/ml). Under
these culture conditions, the half maximal stimulation was observed
between 0.03 and 0.3 ng/ml in three independent experiments.
0 The growth stimulatory effects of IL-13 were then compared
to those of IL-4 and IL-10. IL-13 activity was comparable to that of
IL-4 and IL-10 when assayed early in the culture at day 6. The
IL- 13 stimulatory activity was particularly striking at day 9, where
it surpassed that of IL-10 and more notably that of IL-4. IL-13 also
showed stimulatory effects at day 12 and again was more efficient
than either IL-4 or IL-10. Cultures grown in the presence of IL-13
fQrmed extremely tight clumps. Clumps were very difficult to
dissociate and thus rendered extremely inaccurate the enumeration
of viable lymphocytes during cell cultures. Nevertheless, cell
cultures were split every fifth day for up to 25 days, at which time
the number of viable B lymphocytes had increased about 12 fold
(estimated conservatively).
Whether IL-13 could act in concert with IL-4 or ~L-10- for
maximal B cell proliferation was studied. Combination of an optimal
2s concentration of IL-4 and with increasing concentration of IL-13_
resulted in a DNA synthesis which was comparable to that obtained
with IL~, thus indicating the lack of synergy and even additivity
between these two cytokines. In contrast, combination of IL- 13 and
IL-10 resulted in an additivity of their stimulatory effects.--The
additive effects of IL-13 and IL-10 on B cell proliferation- were
observed at all times tested. Taken together, these results indicated
¦~ that IL-13 is a growth factor for human B lymphocytes. -
~ .
-
94/~4680 2 PCr/US93/07645
61 1~2(~o
IL-13 Induces Anti-CD40 Activ~ted B Cells to Secrete I~E
In view of the powerful effects of IL- 13 on the proliferation of
anti-CD40 activated B cells, culture supernatants were analysed for
their immunoglobulin content. Like IL-4 but unlike IL-10, IL-13
5 did not stimulate the production of IgM, IgG, and IgA in day 8
cultures of anti-CD40 activated B cells. However, IL-13 was able to
induce B cells to secrete IgE~ in a dose dependent fashion (Table 4).
IL-13 was comparable to IL-4 in its capacity to induce IgE. The
combination of IL-4 and IL-13 resulted in a production of IgE which
0 was either comparable or slightly enhanced when compared to that
obtained with IL-4 alone. IL-13 unable to induce either resting B
cells or anti-,u activated B cells to secrete IgE.
-~- Table 4: IL-13 Induces Anti-CD40 Activated B Cells to Secrete IgE.
s
cytokine IgG ~llg/ml ) IgA ~llg~ M ~lg/ml ) IgE (ng/ml )
none 1.2 + 0.09 0.4 + 0.04 0.08 + 0.005 < bg
.: IL-4 1. 4 + 0 . 01 0 . 4 + 0 . OOS 0 . 2 + 0 . 005 37 + 1.1
IL--10 lS.0 + 1.9 12.0 + 2 18.0 + 0.6 < bg
IL--13 1.6 + 0.4 0.4 + 0.001 0.2 + 0.0425.2 + 3.3
.
S x 104 purified B cells were cultured for 10 days with 2.5 x 103
irradiated CDw32 L cells with the anti-CD40 mAb89 without or with
50 U/ml IL-4, 100 ng/ml IL-10, 30 n~/ml hIL-13. Ig levels
2 0 represent the mean + SD values of quadruplicate determinations.
Representative of three experiments. (< bg = lower than 150 pg/ml
of IgE.j
, i . .
The IL-13 Tar~et B(~ Sub~ ulation is ~Iore P~icted ~han the II,-4 (~e
2s To further compare the effects of IL-4 and IL-13, B cells
cultured in the CD40 system with either cytokine were phenotyped
after six days of culture. IL-13 is able to induce CD23 expression on
cultured B cells with an intensity comparable to that obtained with
IL-4. However, whereas IL-4 induced > 90'rO of the cultured B cells
. '
WO 94J0468~ PCI /US93/0764:
~ 62
to express CD23, IL-13 induced CD23 only on 40% of the B cell
population. In addition, whereas IL-4 was able to readily induce
- CD23 on both resting and anti-M activated B cells, IL-13 was much
less efficient under these conditions.
s The transferrin receptor expression was also analyzed on B
cells cultured for six days in the CD4~ system with or without IL-4
or IL-13. All B cells expressed transferrin receptors (TfR), but two
populations could be clearly distinguished according to levels of
expression which were designated TfR low and TfR high. In the
0 CD40 system alone, 80% of the B cells were TfR low, and 5% TfR high.
- In cultures grown with IL-13, 55% of the cells were Tf~ low and 40%
were TfR high. In cultures performed with IL-4, 10% of the c~lls
were TfR low and 85% were TfR high.
As sIgD+ B cells consist of naive B cells, whereas sIgD- B cells
consist of a mixture of germinal center B cells and memory B cells,
the reactivity to IL-4, IL-10, an~ IL-13 of sIgD+ and sIgD- B cells
was tested in the CD40 system. Both sIgD~ and sIgD- B cells
~-- proliferated strQngly in response to IL-4 and IL-40, as measured by
(3H)TdR incorporation after six days of culture. In contrast, IL-13
¦; 2 0 preferentially enhanced the anti-CD40 induced DNA synthesis of
sIgD I cells. Furthermore, IL-13 and IL-4 were able to induce both
sIgD+ and sIgD- B cells to secrete IgE.
Taken together, these results indicate that IL-13 acts - -
preferentially on sIgD+ cells and thus acts on a B cell subpopulation
~s more restricted in size than that stimulated by IL-4.
he IL-13 Biolo~ical Effects Are Independent of IL-4 - `~
I
As Ik-13 displays many of the biological effects of IL-4, it was
suspected that it might act either through an induction of IL--4- ^
secretion or through binding to the IL-4 receptor. To address this
question, IL-13-induced B cell proliferation was tested in the-
presence of three different IL-4 antagonists: (1 ) a neutraliz}ng anti-
IL-4 monoclonal antibody; (2) a soluble extracellular domain of the
130 kDa IL-4R [see Garrone e~ al., Eur. J. Immunol. 21:1365 (1991)];
~ and (3) a blocking anti-130 kDa IL-4R monoclonal antibody. These
:
.7/O 94/04680 ~ PCI/US93/0764;
63 '~
o
three antagonists bloeked by 80-90% the effects of IL-4 on the
proliferation of anti-CD40 activated B lymphocytes without affecting
the proliferation induced by IL- 13 . These IL-4 antagonists also
failed to block IL- 13 induced CD23 expression and IgE production,
while they did totally block that induced by IL-4.
Induction of B Cell Proliferation Bv IL-13 or IL-4 and Cos Cells
Expressin~ the Human or M ouse Ç D 40-L
Five x 104 highly purified (> 98% CD2û+) negatively sorted
splenic B cells were co-cultured with 1.6 x 104 irradiated (7,000
0 rad) Cos cells transfected with human or mouse CD40-L or the
empty pJ~ -14 vector as control. IL-13 or IL-4 were added at 400
U/ml. Soluble anti-CD40 mAB89 and the control mAbA4 were used
at 50 ~g/ml. The cultures were harv~sted 3 days later, after
addition of [3H]-Thymidine in the last 16 hours of culture. B cells
were stimulated by any of IL-4, COS supernatants containing either
mouse or human IL-l 3, or combinations of supernatants and IL-4 or
IL-13 .
Biological effects of IL-13 on human B cell growth and
differentiation have been described. IL-13 costimulated with anti-
IgM antibody to induce DNA synthesis but its effects were less
~- conspicuous than those of IL-2 or IL-4. IL-13, as other cytokines,
-~ failed to greatly induce the multiplication of B cells activated
~- through their antigen receptor. However, IL- 13 displayed striking
growth promoting effects on B cells which were cultured in the CD40
2 5 system, which is composed of a fibroblastic cell line expressing the
- human Fc receptor CDw32 and monoclonal antibody to CD40. Under
these condidons, IL- 13 was at least as active as IL-4 and its effects
~ on B cells were long lasting, thus allowing the multiplication of
viable B cells. IL-13 altered the phenotype of activated B cells, as it
: 30 induced B cells to express CD23.
- The IL-13 dependent induction of CD23 on CD40 activated B
cells is not mediated by an anti^CD40 activation, since resting and
anti-IgM activated B cells can also be induced to express CD23 in
response to IL-13. However, the proportion of cells expressing CD23
3s was lower with IL-13 than with IL-4. Likewise, IL-4 induced
WO 94/04680 . PCr/US93/07645
~4~36~
virtually all CD40 activated B cells to express high levels of
transferrin receptors. IL- 13 induced only half the cells to express
- transferrin receptors at high density. This indicated that IL- 13 was
acting on a subpopulation of B cells which was more restncted than
s that affected by IL-4.
Accordingly, when cells were separated according to surface
IgD (sIgD), which distinguishes naive B cells from germinal center
and memory B cells, IL-13 was found to be more effective than IL-4
on sIgD+ B cells. IL-4 was abIe to enhance better than IL-13 the
0 proliferation of sIgD- B cells. The different population target for
IL-13 and IL-4 could be explained by differential IL-13 and I~-4
receptors expression, the demonstration of which will await the
production of labelled IL-13 or of IL-13 receptor specific antibodies.
The lower response of sIgD- B cells is particularly interesting and
15 warrants further analysis. IL-13, as IL-4, poorly enhanced the
-- ~ synthesis of lgG and IgM by B cells cultured in the CD40 system.
Surprisingly, however, IL-13 induced anti-CD40 activated B cells to
produce IgE.
-~ The levels of IgE produced in response to IL-13 were20 comparable to those produced in response to IL-4. IL-4, as well as
IL-13, was able to induce IgE synthesis by anti-CD40 activated B
cells. As a consequence of isotype switching, IL-13, like IL-4, was
able to induce sIgD+ to secrete IgE. As IL-4, IL-13 could not induce - -
resdng B cells to secrete IgE. At first, this IL-13 induced IgE
25 production contrasts with other studies indicating IL-4 as being the
sole inducer of IgE synthesis. However, reccnt studies have ~ -
described assay systems resulting in the secretion of IgE, while IL-4
- ~ was totally blocked by neutralizing antibody. IL-2 has been
l reported to induce secretion by Staphylococcus aureus activated B- ~ 30 cells, whereas IL-4 was ineffective. It may be possible that in these - - studies, IL-13 was responsible for these effects.
` ~ While IL-13 causes many functions similar to IL-4 on B cells,
the present study demonstrates that these effects are independent
of possible inducdon of IL-4 secretion or the use of the 130 kDa
35 IL-4 receptor, e.g., neutralizing anti-IL-4 antibody, blocking soluble
IL-4 receptor, and blocking anti-IL-4 receptor antibody were unable
, .
,
94/04680 2~ P~/US93/07645
65 ~86'/'
to affect the action of IL-13 on B cell proliferation and IgE secretion.
However, it cannot be excluded that IL- 13 may share with IL-4
some common transducer.
Crosslinking studies have shown the binding of IL-4 to 60-70
and 70-80 kDa components unrelated to the 130 kDa molecule. In
this context, it is worth noting that both human and murine IL- 13
act on human B cells with similar ef~leiency, while murine IL-4 is
species specific. The respertive roles of IL-13 and IL-4 in IgE
production can be determined ' more particularly when mice whose
0 IL-4 genes have been knocked out (e.g., IL-4 knock-out mice) are
studied to determine circulating IgE levels.
Finally, it will be important to establish whether human IL-13
is produced only by T cells or if other cell types also produce it.
Furthermore, IL-13 may be involved in abnormal B cell
5 proliferation, as occurs in leukemic and autoimmune diseases. Thus,
agonists or antagonists of IL-13 may be useful in therapeutic
treatment of such conditions.
C Mod~fication of I~rfaoe Markers on Activated ~man BC~lls j
Highly purified B cells were isolated from normal human
2 o spleens obtained from cadaver transplant donors. Splenocytes were
-- - obtained by aseptically squ'ashing spleens though a sterile metal
mesh and' frozen in aliquots for subsequen~ use. Highly purified B
cells (> 98% CD20+) were obtained by negative FACStar Plus Becton
_ Dickinson sorting after staining the splenocytes with the following
~E-conjugated mAb: and-CD3, a~ti-CD4, anti-CD8, anti-CD14, anti-
CD16, and anti-CD56. ~Becton Diclcinson).
Human IL-13 was u$ed at 30 ng/ml final concentration.
- -'- '' Récombinant ' IL-4 (used at 400 U/ml) was provided by Schering
Research (Bloomfield, NJ).
Five thousand highly purified B cells were co-cultured with an
~ -- equal number of T cells from clones B21 or spA3, harvested five
days after stimulation with feeder cells and PHA, in a final volume
- of 0.2 ml of Yssel's medium supplemented with 10% FCS, 10 ~Lg/ml
ultra pure transferrin (Pierce), and 400 U/ml recombinant IL-4.
Cultures were set up in eight replicates in U-bottom 96 well plates
WO 94~04680 PCI`/US93/0764:
~;~ 66
.
(Linbro) and incubated 14 days at 37C in 5% CO2. At the end of the
incubation period, the supernatants from each of the eight wells
were harvested and pooled for isotype determination. In some
cultures, the T cell clones were replaced by 5 ~g of plasma
membranes derived from the T cell clones, or by 50 ~g/ml anti-CD40
'~ mAb 89.
Ig content of the supernatants was determined by ELISA as
described by Gascan et al., Eur. J. Immunol. 22:1133 (1992). Plasma
membranes were prepared from the CD4+ T cell clone B21, also as
0 ~ described therein. The amounts of production of the respective Ig
isotypes were typically highest when B cells were stimulated with
membranes in the presence of IL^4, but IL-13 typically had similar
~- effects. The amount of IgG4 production was particularly hig4, P`
~, though IL-13 seemed to enhance 'the IL-4 effect on IgE production
'15~ after sdmulation w~th T cell clones.
Highly pu~nfied sIgD+ splenic B cells (5000 cells/well) were co-
culturéd with pJE;E14 vector transfected or sorted COS-7 cells (250
cells/well) transfected with and expressing the human (h) or mouse
(m)~CD40-L. IL-13~ (30 ngiml~ and IL-4 (400 Ulml) were added.
2~0~ Ihe ~epddvities~ of the ELISAs (0.2 ng/ml for IgE and IgM, 0.4
;`n~nl~ for lgG4 ànd `total IgG) were determined with c,alibrated Ig
stànda~ds (Bchring,, Marburg, Germany). Both IgG and IgE levels -
were~ mcreased ~by ~-13. - -
D. Effccts of CD4Q Li~and
2s~ Thè humàn CD40 ligand (hCD40-L) was cloned from a cDNA
lîbrary constructed from'an activated CD8+ T-cell clone and two
,cDNA's wcre~dctected ,representing a 2.1 kb and a 1.2 kb clone.
5~ Both~ cDNA clones had identical open reading frames of 261 amino
acids and~ dîffcred only in the length of their 3' untranslated ends, ~~
30 ~ and probably rcpresent the 2.1 kb and 1.2 kb transiently expressed :' -
mRNA ~species~ detected by Northern analysis in an activated CD4+ T- -' --~
~",'~ ccll clone. hCD40-~ transcripts could also be detected in CD4+ and
CD8+- T cell receptor ~TCR) a~ T cells, TCR ~ T cells, natural killer -
cells, monocytes, small intestine, and fetal thymocytes, but not in
.. .... " , _ ,
0 94/04680 ~C~ PCI/U~93/0764~
67 ~ 5.~
purified B cells, fetal liver, fetal bone marrow, brain, kidney, or
heart.
COS-7 cells transfected with hCD40-L ~COS-7/hCD40-L)
induced human B cell activation as judged by the induction of
5 homotypic aggregates of Epstein-Barr Virus (EBV) transformed, and
normal B cells. In addition, COS-7~CD40-L induced B cell
proliferation, which was further enhanced by IL-4, or IL- 13 . IL- 13,
like IL-4, synergized with the mouse and hCD40-L to induce IgM,
total IgG, IgG4, and IgE, but not IgA production by highly purified B
0 cells.
Anti-IL-4 antibodies inhibited IL-4 and COS-7/h~D40-L
induced Ig production by 13 cells, but had no effect on IL-13 and
COS ~7/hCD40-L induced B cell differentiation, indicating that IL- 13
and hCD40-L induced Ig produc~ion, including isotype switching to
IgE, independently of IL-4. hCD40-L induced B cell differentia~ion
was blocked by soluble CD40, confirming the requirement for
specific engagement of CD40-L. Collectively, these ~ata indicate that
CD40-L and IL-13 expressed by human CD4+ T helper cells are
important components of T and B cell interactions resulting in B cell
2 o proliferation, differentiation, and IgE switching. However, the
distribution of the hCD40-L suggests a broader function of this
- molecule.
- Induction of B cell prolifera~ion and differentiation into Ig
producing cells requires T cell help. Antigen-specific T cell and B
2s_ cell interactions involving binding of the TCR to peptide class II MHC
complexes in the B cells result in T cell activation. Activated T cells
-- deliver both contact and cytokine mediated signals, inducing B cell
proliferation ;and differentiation. Once T cells are activated, they can
interact with any B cell in an antigen independent class II MHC non-
-~ 30 restricted fashion. Lymphokines produced by the activated T helper cells do not only determine the amounts of Ig produced, but they
.
-- - also direct isotype switching.
IL-4 is a B cell growth factor which induces human B cells to
- switch to IgG4 and IgE production, whereas TGF-,B directs IgA35 switching. The human cDNA homologue of P600, a protein produced
by mouse Th2 clones following acdvation, has been recently clone~
WO 94/04680 PCr/US93/0764
21~28~0 ~
and expressed, as described herein. The human IL- 13 protein
induced human monocyte and B cell growth and differentiation and
was designated IL-13. Human IL-13 is a non-glycosylated protein
of 132 amino acids with a molecular mass (Mr) of 10,000 and is
5 produced by T cells. IL-13 has no significant homology with other
cytokines except IL-4, which is -30% homologous. IL-13, like IL-4,
can specifically induce IgG4 and IgE switching in human B cells,
independently of IL-4.
The contact mediated signals delivered by activate T helper
0 cells can be replaced by anti-CD40 mAbs. One of the contact T
helper signals is delivered by the CD40 ligand (CD40-L), a 33 kDa
molecule expressed on activated CD4+ T cells. CD40-L ~ransfectants
induced proliferation of B cells and induced IgE production in the
presence of IL-4. Here is described the isolation of human CD40-L
clones from a cDNA library constructed from an activated CD8+ T- ~
cell clone. The distribution of the human CD40-L, its ability to i
activate B cells, and its role as a co-activation molecule with IL-13
compared with IL-4 to differen~iate B cells were assessed. Cells
transfected with the human CD40-L exhibited induced B cell
2 o aggregation, proliferation, and considerable Ig production, including
IgE synthesis, in the presence of IL-13. ;:.^!
`
.
Rea~ents
. . .
Human rIL-4 was provided by Schering-Plough Research
(Bloomfield, Nl) and human-rIL-13 was provided by W. Dang (DNAX
2s Research Institute, Palo Alto,~CA). The CD40-Ig fusion protein was
~; obtained by fusion of ~the cDNA segments encoding the extracellular
domain of CD40 to cDNA fragments encoding the human IgGl. The
... ..
mAb89 was kind~y~ provided by Dr. J. Banchereau (Schering-Plough,
Dardilly, France). Streptavidin-PE and all antibodies, unless stated
30 otherwise, were from - Becton-Dickinson (Mountain View, CA).
69 f~60
Cell Purification and Culture
B lymphocytes (~98% CD20~) were purified from spleen using
density gradient centrifugation over Ficoll-Hypaque (Pharmacia Fine
Chemicals, Piscataway, NJ), followed by negative cell sorting using a
FACStar Plus (Becton Dickinson). Surface IgD+ positive cells were
sorted directly from the negatively sorted B cell population. The
CD4+ T-cell clone B21 and the CD8~ T-cell clone A10 have been
described by Roncarolo et al., J. Exp. Med. 167:1523 (1988). In co-
culture experiments, various numbers of purified B cells were
0 cultured with different concentrations of COS-7 cells in U-bottom
96-well trays in 0.2 ml.
' After 10 days, 50% of the medium was replenished, and after
14 days the supernatants harvested and assayed for Ig's by ELISA.
COS-7 cells were transiently transfected. For CD40-L staining, COS-7
or B21 cells wcre incubated on ice with 1.4 ~g/ml biotinylated
CD40-Ig ;n PBS, 1% FCS for 20 min, washed twice in ~BS with l~o FCS,
and stained with ll5 dilution of streptavidin-PE, and washed twice
again. Cells specifically expressing CD40-L were sorted using a
~ ~ FACStar Plus (Becton Dickinson) before use.
- 20 ~man and Mouse CD40-L cDNA's
- - Mouse CD40-L DNA provided as a PCR product- by Dr. N. Harada
and Dr; R. Chang (DNAX Research Institute) was subcloned into the
' mammalian expression vector pJFE14. The human CD40-L was
''- ~ cloned by using the mouse CD40-L cDNA as a-probe to screen colony
2s blots of a cDNA library derived from the CD8+ T-cell clone A10. To
make the library, 108 A10 cells were activated for 8 hours with 10
~g/ml con A, harvested, and extracted for RNA. mRNA was purified
using a Pharmacia (Uppsala, Sweden) mRNA- Puriffcation Kit. cDNA
was synthesized and cloned esscntially according_to the
manufacturers instructions using the SuperSc-r~'p`r'~PI'asmid System
(BRL, Grand Island, NY) the only modificadon being the use of
pJFE14 as the vector for cloning. The library contained 106
independent clones with an average insert size of 1.4 kb.
WO 94/0468~ PCI`/US93tO7645
2i~286U
Northern and PCR Analysis
RNA was isolated using RNAzol B (CNNA: Biotech, Friendswood,
TX) according to manufacturer's instructions. RNA from brain, heart,
kidney, and small intestine were from Clontech (Palo Alto, CA).
5 cDNA was synthesized using SuperScript (BRL) and PCR reactions
performed in a GeneAmp PCR System (Perkin-Elmer Cetus,
Emeryville, CA) with 30 cycles of 94C, 55C, and 72C for 0.5 n~in,
0.5 min, and 1 min respectively. Primers for detection of CD40-
~transchpts were 5'-ACA GCA TGA` TCG AAA CAT ACA-3', 5'- TGG CTC
0 ACT TGG CTT GGA TCA GTC-3' and for hypoxanthine
phosphoribosyltransferase (HPRT) transcripts S-TAT C3G~ (~GG~C
T&~ AC~TCI`1~-3',5' - GAGACA AACAT&A~TG~iA ATCC~GA-3'.
Products of PCR reactions were electrophoresed through 1.2%
agarose and transferred by capillary blotting to GeneScreen nylon
5 membranes ~NEN Research Products, Boston, MA) according to
manufacturer's instructions. For Northern analysis RNA was
electrophoresed through 0.85% agarose and transferred to BA-S
nitrocellulose (Schleicher and Schuell, Keone, NH). CD40-L 32p cDNA
probes for Nortihern and Southern blots were made using as a
20 template a L.3 kb EcoRI-XhoI fragment of pJFE14-CD40-1,
conlaining the CD40-L coding region.
Cloning and Characterization of~the Human CD40-I~
To obtain clones of the human CD40-L, a cDNA library derived
from the CD8~ T-cell cIone~ was screened using the mouse C~0-L
25 ~ cDNA as a probe, see Armitage et al., Nature 57:80 (1992).
~-;- Positive clones were present in the library at 0.005% and were
rieptcsented prcdominantly by~ a --2.1 kb length clone, but an
. ~ additional clone of 1.2 kb was detected. Both cDNA's contained an
identical open reading frame of 261 amino acids, which would give
30 riise to a protein with an~lrnniodifiedimolecular mass of 29254. The
2.1 kb and 1.2 kb clones differed only in the length of their 3'
untranslated ends, and presumably represent the two mRNA species
of that size detected by Northern analysis. The nucleotide and
predicted amino acid sequences of the human CD40-L`cloned here
-:
"~:
~0 94~04680 ~ ~, PCl /US93/07645
7 1
were identical to those reported by Hollenbaugh et al., EMBO ~.
11:4313 (1992); and Spriggs et al., J. Exp. Med. 176:1543 (1992).
Using a biotinylated human CD40-Fc fusion protein in
combination with streptavidin-PE, specific expression could be easily
5 detected of human CD40-L on COS-7 cells transiently transfected
with an expression plasmid pJFE14 containing the 2.1 kb human
CD40-L cDNA, but not on control cells transfected with empty pJFE14
vector DNA. The human CD40-Fc reagent reacted also with COS-7
cells transfected with the same expression vector containing the
0 mouse CD40-L cDNA, which is consistent with previous studies,
indicating cross-species binding of human CD40 to mouse CD40-L.
The CD40-L Induces Homotypic Aggre~ation of B Cells and B Cell
Proliferation
B cell activation with antibodies to CD40 results in homotypic
5 aggregation. To determine whether the CD40-L had similar effects?
COS-7 cells expressing the CD40-L were purified by FACS and co-
cultured with purified B cells or JY cells, an EBV transformed B cell
line. Indeed, aggregation of JY cells following incubation with the
COS-7 cells expressing human or mouse CD40-L was observed,
2 o whereas mock-transfected COS-7 cells were ineffective. Similarly,
purified -B cells co-cultured with cells expressing human or mouse
CD40-L displayed marked homotypic aggregations~ whereas B cells
cultured with untransfected COS-7 cells remained disperse.
Consistent with the B cell activation observed microscopica~
2 5 significant proliferation was obtained when purified B cells were -co- ~
cultured with COS-7/human CD40-L or COS-7/mouse CD40-L (see
Table 5). Thisj proliferation was further enhanced in the presence of
IL-4 or IL-13 . The growth promoting effects of IL-4 and IL-13
seem to be comparable under these culture conditions.
~= ~ `
wo 94t04680 PCr/USg3/0764:
72
2I42860
Table 5: Inductivn of B Cell Proliferation by IL-13 or IL-4 and COS
Cells Expressing the Human or Mouse CD40-L
3H TdR Incorporation
(c.p.m. x 10-3)
B 0.1 + 0
B + IL-13 0.1 + 0
B + IL-4 0.2 + 0
B + IL-4 + control mAb O.2 + O
B + IL-4 + anti-CD40 21.2 + 4.1
COS hCD40-L1.1 + 0.2
lS COS mCD40-L1.0 + 0.1
COS 1.4 + 0.2 -
B + COS hCD40-L16.9 + 2.4
B + COS mCD40-L17.5 + 2.1 .
B + COS 1.2 + 0.2
B + IL-4 COS hCD40-L30.7 + 3.8
B + IL-4 COS mC~40-L35.4 + 4.5
: B + IL-4 COS 1.3 + 0.2
B + IL-13 COS hCD40-L22.5 + 3.0
B + IL-13 COS mCD40-L33.8 + 2.8
B + IL-13 COS1.2 + 0.4
3 0
Five x 104 highly purified (> 98% CD20+) nega~ively s~rted splenic B
- cells were co-cultured with 1.6 x 104 irradiated (7,000 rads) COS
cells transfected with human or mouse~ CD40-L or the empty pJPE-14
vector as control. IL-13 or IL-4 were added at 400 U/ml. Soluble
anti-CD40 mAb 89 and the control mAb A4 were used at 50 ~Lg/ml.
The cultures were harvested 3 days later after addition of 3 H
! ~ Thymidine in the last 16 hours- of culture. The values represent
~- means and standard deviations of triplicate cultures.
.
4 0
-, i
' .
~94/04~;80 ,?1~2 PCr/US93/0764;
:
;,
-13 Induces Ig Production bY COS-7/hCD40-L Stimulated B Cells
~ COS-7 cells expressing human or mouse CI)40-L also induced Ig
y production by highly purified naive surface IgD+ human B cells in
~he presence of IL-4 or IL-13 (Table 6). Considerable levels of IgM,
IgG4, total IgG and IgE, but no IgA were produced. There was no
; IgA production, compatible with previous observations which
indicated tha~ IL-4 specifically inhibits IgA synthesis under these
culture conditions. Ig levels induced by IL- 13 were in the same
range as those induced by IL-4.
0 No Ig production was obtained in the presence of mock-
~ansfected COS-7 cells (Table 6). Induc~ion of all Ig isotypes by
COS-7 cells expressing CD40-L was effectively blocked by CD40-Ig
(10 )lg/ml), confirming that specific engagement of the CD40-L is
necessary for induction of B cell differentiation and Ig production.
Inhibition of total IgG production by CD40-Ig could not be measured,
since the Ig portion of the CD40-Ig fusion protein gave a strong
signal in the IgG ELISA.
Ig production, including IgG4 and IgE production, induced by
IL-13 in the presence of COS-7/CD40-L cells was not blocked by
anti-IL-4 mAbs (10 ~g/ml), whereas these mAbs s~ongly blocked
IL-4-induced Ig production in the presence of COS-7/CD40-L ~able
6). These results indicate that IL-13 induces Ig production ~
indepeDdently from IL-4. They also indicate that II.- 13 is another
cytokine that directs naive surface IgD+ human B cells to swltch to
~5 IgG4 and IgE producing cells in ~he presence of a contact-mediated
costimulatory signal delivered by COS-7 cells expressing the mouse
or human CD40-L.
_ :.
WO ~4/04680 PCr/US93tO764
74
21~286u
Table 6: Induction of Ig Synthesis by IL-13 or IL-4 and COS Cells
Expressing CD40-L
IgM IgG IgG4 IgE
~ng/ml)
_
COS hCD40-L 4 t 2 38 + 4 12 ~ I <0.2
COS mCD40-L ~).2 6 + 0 3 + O ~0.2
lL4~COS hCD40-L 87 + 8 195 _ 21 148 + 30 80 + 4
IL-4+COS hCD40-L+CD40-lg 3 + 1 ND* 1.8 + 1.4 2.7 _ 1
lL-4+COS hCD40-~+anti-IL4 8 + 3 28 + 7 5 + 3 4 + 2
IL~+COS mCD40-L 64 + 6 208 + 5 177 + 42 68 + 7
IL ~1 ICOS mCD40-L+CD40-Ig <0.2 ND* ~.4 <0.2
IL-4+COS 0_0 4 + 0 1 + 0 ~0.2
IL-13+COS hCD40-L 51 +-1 151 + 9 127 _9 54 + 7
lL-13+COS mCD4~-L - 31 + 3 100 + 2 55 + ~ 37 + 6
~-13+COS 3 1 3 5 + 0 1 _ 1 <0.2
IL-13+COS hCD40-L+antiIL4 48 + 8 167 + 12 111 + 7 48 + 4
0.2 8 + 1 2 _ O <0.2
IL- 13 c0.2 7 + 0 1 _ 1 ~0.2
IL-4 c0.2 4 + 1 2 + O <0.2
Highly purified sIgD+ splenic B cells (5,000 cells/well) were co-
0 cultured with pJ~k;14 vector transfected or sorted COS-7 cells (2~0
Cells/well) transfected with and expressing the human (h) or mouse
(m) CD40-L. IL-13 (30 ng/ml) and IL-4 (400 U/ml) were added as
indicated. The sensitivitie-s- of`the ELISAs (0.2 ng/ml for IgE and
IgM, 04 ng/ml for IgG4 and total IgG) were determined with
5 calibrated Ig standards (Behring, Marburg, Germany).
~No IgG determination was possibre~as there was detection of the Ig
portion of CD40-Ig fusion protein ~ added.
_
i - Expression and Distribution of th_CD40-L
. .
Resting CD4+ T cell clones expressed no, or very low levels of
CD40-L, as judged by ~indin~ of PE-labelled streptavidin to
biotinylated CD40-Ig bound~~to the T cells. However, significant
expression of the CD40-L was observed on the CD4+ T cell clone B21 `
~ 4 h after activation with PHA. Consistent with its presence on the
<; ~ 25 surface of B21 cells, hCD40-L mRNA was detected by Northern
94~046~0 ~ PCr/USg3/0764
7 5 ~ 86'~,
analysis and by PCR. Low levels of hCD40-L mRNA were expressed
in resting B21 cells. Kine~ic studies indicated that the 2.1 kb and 1.2
kb mRNA species were already maximally expressed within 2 hours
following activation, irrespective of the mode of activation of the T
5 cells.
The expression was somewhat reduced after 4 h. Considerable
reduction in the CD40-L mRNA expression was observed 7 hours
after activation, but appreciable levels of CD4û-L mRNA were still
visible 48 h after activation. Activation of the B21 cells by Ca2+
10 ionophore plus PMA, Con A, anti-CD3 mAbs plus PMA, or PHA plus
PMA, did not result in major quantitative differences, or differences
in the kinetics of the hCD40-L mRNA expression, although it seems
that activation with Ca2+ ionophore plus PMA is slightly more
effective. Distribution of the hCD40-L was analyzed by PCR, using
5 primers complimentary to the coding region of the human CD4~)-L
gene. CD4û-L transcripts were not present in B cells, brain, kidney,
heart, fetal liver, or fetal bone marrow, but could be readily
detected in CD4+ T cell clones, CD8+ T cell clones, a TCR ~ T-cell
clone, purified NK cells, monocytes, fetal thymocytes, and small
20 intestine. Expression of CD40-L in the small intestine may reflect
IL- 13 production by infiltrating MNC.
The human CD40-L cDNA, which was cloned and expressed in
COS-7 cells is very effective in inducing human B cell activation.
- COS-7/hCD40-L induced homotypic aggregation of EBV-transformed
25 and normal B cells and B cell proliferation, similarly as observed
with anti-CD40 mAbs. In addition, differentiation of B ce-lls into Ig
- secreting plasma cells was observed in the presence ~ of IL-4 or
IL-13. The 2.1 kb hCD40-L cDNA was isolated from a CD8~ T cell
cDNA library and appeared to be a full-lsngth clone, which--was by
30 sequence comparison, identical to the 1.8 kb cDNA's ~ dèscribed
earlier. An additional 1.2 kb cDNA clone probably represents a
second mRNA species of that size which was detected-in~ activated T
cells and which apparently encodes the same protein.
The hCD40-L has 80% homology with the corresponding mouse
3s gene. Interestingly, the hCD40-L has also some degree of homology
with TNF-a and TNF-,B. The positioning of the four cysteine residues
WO 94/04680 PCI /US93tO7645
7 6
214286~
..
and the potential extracellular N-linked glycosylation site in the
mouse CD40-L are conserved in the human CD40-L, however the
human protein has an additional cysteine substituted at position
194. The CD40-L is reported to be a type I~ membrane anchored
5 protein and there is a hydrophobic region of the human protein
(amino acids 22-45) representing a potential signal/anchor domain
near the amino terminus. B cell proliferation induced by COS-
7/CD40-L was enhanced by IL-4 or IL-13. IL-4 and IL-13 seemed
to be equally effective, indicating that IL-13, like IL-4, has B cell
0 growth promoting activity. IL-13, like IL-4, also induced Ig
production in cultures of naive surface IgD+ B cells that have been
co-stimulated by COS-7/hCD40-L.
Considerable levels of IgM, IgG4, total IgG, and IgE were
produced under these culture conditions. The profile of Ig
5~ production induced by IL-4 and IL-13 with hCD40-L is similar to
that obtained in the presence of IL-4 and anti-CD40 mAbs. Thus
IL- 13 and IL-4 appear equally potent in inducing both proliferation
and Ig synthesis in B cells. Furthermore, these results indicate that
~ the hCD40-L provides a co-stimulatory signal for IL-4 or IL-13-~ ~ 2 0 induced B cell differentiation, confirming the important role for
~ ~ D40 in B cell activadon and differentiation. Since these
o~ ~ experiments were calTied out with naive sIgD+, these results
confilll. previous obserYa~ions that II,-13, in addition to IL-4, is
another CD4+ T cell derived lymphokine that can direct B cells to
25 switch to IgG4 and IgE producing cells. Ig production, including
~: IgG4 and IgE production,:indùced by IL-13 in the presence of
hCD40-L was not blocked by~anti-IL-4 mAbs, indicating that the
effects of IL-13 are mediated independently of IL-4.
Help provided by the CD40-L transfectants, and the specific
30 blocking of this help by ~D40-Ig, indicated that expression of CD40-L
;~ on CD4+ T cells may be an important component of both antigenicand non-specific T-B ceH~in~eractions, leading to B cell activation and
5'~ differentiadon. These data are compatible with blocking studies
carried out with mAbs against mouse CD40-L, or CD40-Ig, which
3s indicated that CD40-L and CD40 interaction is critical for T cell help
i n the mouse system. It is of importance to note that there is a
,... . .
~''' .
.,.. , ~
;) 94/04C80 ~, PCr/US93/0764~
~0
difference in the consequences of signaling by CD40 and activated
CD4+ 1' cells suggesting that additional T cell surface molecules may
be involved in productive T-B cell interaction. In fact, the
transmembrane form of TNF-a expressed on activated CD4+ T cells is
also associated with T cell induced B cell activation and
differentiation .
Considering these similarities in functions, it is interesting that
the CD40-L and the cell surface form of TNF-a are homologous and
share some structural similarities, as do CD40 and the TNF receptor.
0 The substantial help given to human B cells by the cloned human
and mouse CI~40-I,'s is consistent with previous studiesr
demonstrating that signaling through CD40 is of significant
consequence for B cell survival, activation, and differentiation! The
mouse CD40-L appears as effective as the human CD40-L in
activadng human B cells, which is consistent with the ability of
murine CD40-L to bind human CD40. The similarity of the protein
sequences and the ability of both mouse and human CD40-L to bind
CD40 cross-species indicates this is an important interaction in vi-~o
to be so well conserved.
Human IL-l3 cDNA was isolated form the same CD8+ T-cell
clone library as CD40-L. However, although IL-13 is expressed in
the CD8+ T cells, far more IL-13 is expressed in CD4+ T cells. The
potency of the combination of these two novel molecules for
induction of IgE synthesis, and their abundant co-expression by
CD4+ T cells, together with the prolonged expression of IL-13 mRNA
~ following T cell acdvation may be a mechanism contributing to~ IgE-
- ~ production in vivo and IgE mediated allergic reactions.
l These experiments have focused on the function of CD40-L
expressed on CD4+ T cells as it relates to B cell activation. CD40-L
expression on cells other than CD4+ T cells, including CD8+ T cells
!, from which the gene was cloned, suggests a broader function for the
molecule than in T-B cell interaction. It is likely that CD40-L` ls -
expressed on other cell types, and even CD4+ T cells, which will have
important consequences for their furiction, rather than just
3s providing a one way stimulus to CD40 positive cells such as B cells.
For example CD40-~ and CD4û expression, in thymocytes and thymic
.
WO 94/04680 PCI'/US93/0764
78
21~2860
epithelium may be indicative of'interactions involved in T cell
development.
E. IgE Switchin~ ~
The present series of experiments demonstrated that IL- 13
induced IgG4 and IgE synehesis by human B cells. IL- 13 induced
IgG4 and IgE synthesis by unfractionated peripheral blood
mononuclear cells (PBMNC) and highly purified B cells cultured in
- the presence of activated CD4+ T cells or their membranes. IL-13-
induced IgG4 and IgE synthesis was IL-4-independent, since it was
0 not affected by neutralizing anti-IL-4 monoclonal antibody (mAb).
Highly purified sIgD+ B cells could also be induced to produce IgG4
' and IgE by IL-13, indicating that the production of these isotypes ''`
reflected IgG4 and IgE switching and not a selective outgrowth of
commiteed B cells. IL-4 and IL-13, added together at optimal
concentrations, had no additive or synergistic effect, suggesting that
common signaling pathways may be involved.
` ~ ~ This notion is supported by the observation that IL-13, like
IL-4, induced CD23 expression on B cells and enhanced CD72~ surface
IgM (sIgM), and class II MHC antigen expression. In addition, like
IL-4, IL-13 induced germline transcription in highly purified B `
cells. Collectively, these data indicated that IL-13 is another T cell-
derived cytokine that,`in addieion to IL-4, efficiently directs naive
human B cells to switch to IgG4 and IgE production.
B cells undergo Ig isoty~e switching and differentiation into
2 5 Ig-secreting cells in response to sIgM mediated signals in the
'' presence of coseimulatory factors provided by CD4+ T cells. Antigen-
~, specific T-B cell interactions require binding of the T cell receptor to
pepdde-class II major histocompatibllity complexes (MHC) on B
~ ~- cells, which rosults in T-cell activation and cytokine synthesis. Once
';~` ~ 30 the T cells are activated they''~à~ctivate B cells in an antigen-
independent fashion. ~ ~---
Cytokines are essential for B-cell proliferation and
'differentiation; they not onIy determine Ig secretion quantitatively,
but they also direct Ig isotype switching. IL-4 induces IgG4 and IgE
.,
, ~ .
94/04680 PCI/US93/0764
79
21 ~286~
switching, whereas transforming growth factor-~ (TGF-,B) directs lgA
switching. See, e.g., Van Vlasselaer et~al., J. Immunol. 148:2062
(1992); and Defrance et al., J. Exp. Med. 175:671 (1992). In addition
to cytokines, contact-mediated signals delivered by CD4+ T cells are
required for B cell proliferation and Ig production. Above, the
ligand for CD40, which is expressed on activated CD4+ T cells, was
shown to be one such membrane associated molecule that acts as a
costimulatory signal for IL-4-dependent IgE production by both
murine and human B cells. See, e.g., Armitage et al., Nat~re 357:80
0 ( 1992). Moreover, several cytokines, such as IL-2, IL-5, IL-6, IL-8,
I~-10, IL-12, interferon-a (IFN-a), IFN-~, tumor necrosis factor-a
(TNF-a), and TGF-~ modulate IL-4-induced IgG4 and IgE synthesis.
IL-4 has been thought to be the only cytokine capable of
inducing IgE synthesis. Out of 16 cytokines tested, IL-4 was the
only one inducing germline or productive transcripts or IgE
synthesis. In addition, anti-IL-4 mAbs preferentially inhibit IgE
synthesis induced by IL-4 producing T cell clones without
significantly affecting IgM, IgG, or IgA synthesis. Also in murine
models, anti-IL-4 antibodies strongly inhibit IgE synthesis in vivo
2 0 without affecting the other Ig isotypes. Most importantly, IL-4
deficient mice lack IgE in their sera following nematode infection.
However, a non-IL-4-producing T cell clone induces germline ~
transcription in puriffed B cells indicating that an IL-4-independent
pathway of induction of germline E transcription is operational.
IL-13 induces CD23 exprossion and germline ~ mRNA synthesis and
IgG4 and IgE switching in human B cells. ~ ~ -
Rea~ents
Human recombinant IL-13 was purified as described~~ herein.
Recombinant IL-4, IFN-a, and IFN-~ were provided by- Schering-
Plough Research (Bloomfield, NJ). Fluorescein isothioc~anate (FITC)-
conjugated anti-CD72 mAb and neutralizing anti-TG~ mAb were
purchased from R&D Systems, Inc. (Minneapolis, MN). FITC- and
phycoerythrin (PE)-conjugated mAbs specific for CD~, CD4, CD8,
CD14, CD16, CDl9, CD20, CD23, CD25, (~D56, HLA-DR, and control
. .. .. . .. , .... ........ ... -- .. . ... .... . .. . .. .. . ... . . . . . . .. . .. ..... ..
WO 94/046~0 PCI`/US93/0764
~1~286~
antibodies with irrelevant specificities were obtained from Becton-
Dickinson (Mountain View, CA). FITC- or PE-conjugated mAbs
specific for LFA-1 (L130), LFA-3, ICAM-1 (LB2), B7 (L307), and
class I MHC antigen were kindly provided by Dr. J. Phillips (DNAX).
FITC-conjugated anti-IgD and anti-IgM mAbs were obtained from
Nordic Immunological Laboratories (Tilburg, The Netherlands). The
purified anti-CD40 mAb 89 ~IgG1) described by Banchereau et al.,
Science 251:70 (1991), was a gift of Dr. J. Banchereau (Schering-
Plough France, Dardilly, France). The neutralizing anti-IL-4 mAb
0 25D2.11 was kindly provided by Dr. J. Ab}ams (DNAX).
Cell Pre~arations
Blood samples and spleens were obtained from healthy
volunteers or from patients undergoing splenectomy due to trauma,
respectively. Mononuclear cells were isolated by centrifugation over
Histopaque-1077 (Sigma, St. Louis, MO).
- ~ Purified B cells were obtained by negative sorting using a
-~ ~ fluorescence-activated cell sorter FACStar Plus (Becton-Dickinson) or
~; ~ magnetic beads (Dakopatts, Norway). Briefly, splenic MNC were
washed twice and PE-conjugated mAbs against CD3, CD4, CD8, CDl4,
CD16, and CD56 were added at saturating concentrations and
incubated at 4C for 30 min. The cells were washed twice with PBS.
Cells with the light scatter characteristics of lymphocytes were
gated, and PE- cells were sorted. Alterna~ively, cells stained with
2s mAbs against CD3, CD4, CD8, C~1~, CD1~, and CD56 were incubated
for 30 min at 4C with magnetic beads coated with anti-mouse Ig
mAbs.
~ ; The cells bearing murine Ig were removed using a magnetic
- field. The remaining cells were washed, counted, and used in
further experiments. For isolation of sIgD+ B cells, positive sorting
by FACStar Plus was used. Splenic-MNC were stained with PE-
conjugated mAbs against CD3, CD4, -CD8, CD14, CDl6, and CD56 and
FITC-conjugated anti-IgD mAb, and FITC+, PE- cells were sorted. On
reanalysis, purities of the sorted cell populations were >98%, and
3s that of cells isolated using magnetic beads ~95%.
~ 94/04680 . PCr/US93/0764~
~2~ 6
The CD4+ T cell clone B21 and the CD4+ non-IL-4 producing T
cell clone SP-A3 were cultured according tO Roncarolo et al., J. ~xp.
Med. 167:1523 (19~8). The cells were obtained 4-6 days after they
had been activated by the feeder cell mixture and PHA. In addition,
5 IL-2 (100 U/ml) was added to maintain the activation state of the T
cell clones.
Pre~aration of T Cell Membranes
The membranes of a CD4+ T cell clone were prepared according
0 to Gascan et al., Eur. J. lmmunol. 22:1133 (1992). Briefly, the CD4+ T
cell clone B21 was harvested 12 days after activation with fee~er
' cell mixture and phytohemagglutinin (PHA), the cells were washed
and restimulated with 10 llg/ml of Concanavalin A (Con A) for 7-8 h
at 37 C. During the last 30 min of the Con A s~imulation, 100 ~g/ml
15- of a-methyl-D-mannoside (Sigma, St. Louis, MO) was added. From
~; these cells, membranes were prepared using the m~thod described
by Brian, Proc. Natl. Acad. Sci. USA 85:564 (1988); and Maeda et
al., Biochim. Bi~phys. Acta 731:115 (1983); and they were'stored
under liquid nitrogen (1 x 108 T cell equivalents/ml = 0.2 mg
2 0 protein/ml membrane preparation) until used.
. C~lture Conditions
- ~ Purified B cells were cultured at 5000 cells/well in
~- quadruplicate, in round-bottomed 96-well plates (Linbro, McI,ean,-
VA) at 37C in a humidified atmosphere containing 5% CO2 in 0.2ml -
25 Yssel's medium supplemented with 10% fetal calf serum (FCSj.
Unfractionated PBMNC were cultured at 105 cells/well in 12
replicates. In'coculture experiments, the CD4+ T cell clone SP-A~ '--- ~
was cultured at 5000 cells/well (T:B cell ratio 1:1). After a culture
period of 12 days, Ig levels in the culture supernatants were _--
-~ 30 measured by ELISA. - -
wo 94/04680 Pcr/uss3/0764s
,~ 8 2
Measurement of I~ Production
IgM~ total IgG, IgA, and IgE secretion were determined by
ELISA as described in Pène et al., Proc. Na~l. Acad. Sci. USA ~5:6880
(1988). IgG4 secretion was determined by ELISA as described in
s Punnonen et al., J. lmmunol. 148:3398 (1992). The sensitivities of
IgM, total IgG, and IgA ELISAs were 0.~-1 ng/ml, and the
sensitivities of IgG4 and IgE ELISAs were 0.2 ng/ml.
PhenQty~ic analysis of cultured cells.
0 Purified B cells were cultured as described above and were
harvested and washed twice. FITC- and PE-conjugated mAbs were
a;dded at saturating concentrations and incubated at 4C for 30 min.
FITC- and PE-conjuga~ed mAbs with irrelevant specificities were
used as negative controls. The cells were washed twice with PBS
and cells with the light scatter characteristics of lymphocytes were
analyzed using a FACScan flow cytometer (Becton-Dickinson).
RNA Isolation and Northern AnalYsis
Total RNA was isolated using RNAzol B (CNNA: Biotech,
Friendswood, TX) according to manufacturer's instructions. RNA was
- 20 electrophoresed through 0.85% agarose and transferred to 13A-S
nitTocellulose (Schleicher and Schuell, Keone, NH). 32p cDNA probes
were made by random priming using as templates, an EcoRI/HindIII
fragment of pBSIgE1-4 for germline e,~an~-DNA complementary to
the BglI/SmaI fragment of pH~gA-1 for actin. See Gauchat et al., J.
2s Exp. Med. l72:463 (1990); and Erba et al., Nucleic Acids Res. 14:5275
(1986).
IL-13 Induces CD23 E3x~ression on Purified B Cells
The effect of IL-13 on the expression of a vanety of B cell
surface antigens was investigated by FACS analysis~ Incubation of
purified B cells with IL-13 (200 U/ml) resulted in strong induction
of CD23 expression on a proportion (about 20%) of the B cells. IL-13
also upregulated class II MHC antigen, sIgM, and CD72 expression on
;) 94/04680 ~ - PCI /US93/07645
83 `~
O
B cells. These effects of IL-13 were similar to those observed by
IL-4. CD23 expression was already detectable after a culture period
of 24 h, but maximal responses were observed after 72 h of culture.
The expression of CDl9, CD20, CD25, CD40~ class I MHC antigen, B7,
5 ICAM-1, LFA-l, and LFA-3 were not significantly modified by L-13.
IL-13 Induces IgE Svnthesis bv PBMNC.
Beeause CD23 expression on B cells has been associated with
IgE synthesis, IL-l 3 was tested for induction of IgE synthesis by
human PBMNC. As shown in Table 7, IL-13 induced IgE synthesis
0 by unfractionated PBMNC in a dose-dependent manner in the
absence of e~cogenous IL-4. In addition, strong IgG4 production in
response to IL-13 was observed.
Neutralizing anti-IL-4 mAbs failed to inhibit IL- 1 3-induced
IgE synthesis, whereas IL-4-induced IgE production was virtually
completely blocked, indicating that IL- 1 3-induced IgE synthesis was
not mediated through induction of IL-4 production by PBMNC. See
Table 8. Similarly to IL-4, maximal induction of IgE synthesis by
13 was usually obtained at concentrations of 50 U/ml. The mean
level of IgE produced in response to IL-13 was somewhat lower (63
20 ng/ml, n=6) than that induced by IL-4 (169 ng/ml, n=6). No
additive or synergistic effects were observed when both IL-4 and
~- IL- 13 were used at saturating concentrations. ~ ~
,~ .
Table 7: Induction of IgE and IgG4 Synthesis By IL-13 -- ~~ ~ -
~- 2s
IgE ~ng/ml) IgG4 (ng/nlll
- ! _ . .
Medium <0.2 31:~14 ~ -
IL-13 62il 7 413+138
3o -~
, .
:
~,
W094/04680 21~28~ 84 PCI/US~3/0764~
.
Table ~: Induction of IgE Synthesis By IL-4 and IL-13; Effect of
Anti-IL-4 mAbs
I~E $vnthesis (n~/ml)
Medium <0.2
IL-13 (05 U/ml~ <0.2
IL-13 (5 U/ml) 13 + 3
0 IL-13 (50 U/ml) 35il 3
IL-13 (500 U/ml~ 3 2+1 0
IL-13 ~500 U/ml)+anti-IL-4 mAb 2 6 + 5
I~E Svnthesis (n~/ml)
Medium ~0.2
IL-4 (05 U/ml) <0.2
IL-4 ~5 U/ml) 6 + 3
2 0 IL-4 (50 U/ml) 6 8 +: 13
IL-4 ~500 U/ml) 71+1 1
IL-4 ~500 U/ml)+IL-13 ~SOOU/ml) 7 ~ i 1 0
- : IL-4 (500 U/ml)+anti-IL-4 mAb 4 +1
25 IL-13 Induces I~G4 and I~E Switching in B Cell~
The ability of IL-13 to induce IgG4 and IgE synthesis by
purified B cells was also tested. - It- was thereby found that IL 13
~:induced IgG4 and IgE synthesis b-y highly purified B cells cultured in
-the presence of membranes of an activated CD4+ T cell clone. Also in
~o ~is culture system the levels of IL-13-induced IgG4 and IgE!
production were generally lou~er than those induced by IL-4. The
.~. difference was in the same rangë as observed in the cultures of
unfracdonated PBMNC. IL-13- al~o induced significant levels of IgM
~;and total IgG producdon, but~~no- IgA synthesis was observed~
3s . In this aspect IL-13 has properties similar to IL-4, which
generally inhibits IgA synthesis. See van Vlasselaer et al., J.
Immunol. 148:1674 (1992). These results show that IL-13 induces
8 5 PCr/US93/0764~
IgG4 and IgE synthesis by human B cells in the absence of IL-4, and
indicate that IL-13 acts directly on B cells to induce IgG4 and IgE
synthesis. Furthermore, these results strongly suggest that IL- 13
induces Ig isotype switching to IgG4 and IgE in an IL-4-independent t
manner.
To confirm that IgE synthesis observed in above experiments
was due to Ig isotype switching and not to an outgrowth of a few
IgE-committed B cells, the effects of IL-13 on naive sIgD+ B cells
were studied. Culturing of highly purified sIgD+ B cells with the
0 activated, non-IL-4 producing T cell clone SP-A3 in the presence of
IL-13 resulted in induction of IgE synthesis. In addition, IL-13
enhanced IgG4. synthesis induced by this non-IL-4 prodùcing T cell
clone alone. As was demonstrated for PBMNC, IL-13-induced IgG4
and IgE synthesis could not be inhibited by anti-I~-4 mAbs.
Inducdon of Germline Transcription bv IL-13
~ . ,
So far, IL-4 has been the only cytokine known to induce
germline transcription in B cells. Since switching to E by IL-4 is
preceded by the induction of germline RNA synthesis, it was `
hypothesized that IL-13 would induce germline transcription as
well. Indeed, when highly purified B cells were cultured in the :-
presence of IL-13 and anti-CD40 mAbs, germline mR~A synthesis,
at levels comparable to that in the presence of I~-4 and anti-CD40
mAbs, was detected after a culture period of five days ~see Tables 9
and 10). Since and-CD40 mAbs alone did not induce germline
transcription in B cells, these results indicated that IL-13 is another
T cell-derived cytokine that, like IL~, could induce germline E
transcripts in B cells. In addition, these results confirmed the
correlation between germline transcription and subs`equent~
switching to IgE synthesis. ` ~
.
WO 94~4680 PCI'/US~3/0764
8 6
2l~æ8~D
Table 9~ 13 Induces Ig Synthesis By Fetal BM Cells Cultured In
The Presence of Anti-CD40 mAbs
IgM I~ G4 I~E
Medium <1 ~1 <0.2 <0.2
anti-CD40 (10 ~g/ml) <1 d c().2 <0.2
0 anti-CD40 (10 ~lg/ml)
+IL- 13 (400 U/ml) 5 + 2 1 0 + 3 2 + 2 l + 1
Table 10: IL-13 Induces Ig Synthesis By CD19+, sIgM+ Immature B
Cells and CDl9+, sIgM- Pre-B Cells
Sorted CD19+, sIgM+ fetal B cells:
2 0 ~ ~ 4 Ig~
Medium <1 <1 <0.2 <0.2
B 21 <1 <1 <0.2 <0.2
B21~IL-13 <l <1 ~0.2 <0.2
B21+IL-7 <1- <1 <0.2 <0.2
B21~IL-7+IL-13 8-+ 2 - --- 2 3 + 6 6 i 2 2 + 1
B21+IL-7+IL-13
~anti-IL-4 mAb 7 + 2 2 1 ~: 4 2 + 1 2 + 1
Sorted CD19~, sIgM+ fetal B cells: ~ -
I~M ~ I~G4 I~E
Medium <1- - -- <1 <0.2 <0.2
B21 <1 <1 ~0.2 <0.2
B21+IL-13 <1 . <1 <0.2 <0.2
B2 1 +IL-7 <1 <1 <0.2 <0.2
B21~IL-7+IL-13 ~ + 1 6 + 1 2 + 1 1 + 13s B21+IL-7+IL-13
+anti-IL-4 mAb 6_1 3 +2 l + 1 2 1
-O 94~04680 2 1 'I 2 8 6 U Pcr/US93~0764;
Effect of IL-12 on IL-13 Plus Anti-CD40-induced I~E Svnthesis.
Ten thousand highly purified B cells were cultured in the
presence of anti-CD40 monoclonal antibodies (20 ~ug/ml) and IL- 13
5 (400 U/ml) or IL-4 (400 U/ml). COS supernatant containing IL-12
or mock COS supernatant was added, and IgE was measured by
ELISA after 14 days of culture. IL-12 decreased the IL-13 effect,
while increasing the IL-4 effect.
IL-4 has been considered the only cytokine to induce IgE
0 switching in human or murine B cells. This was based on studies
showing that anti-IL-4 mAbs preferentially block IgE synthesis both
in vitro and in ~ivo, and on the observation that no circulatory IgE
could be detected in mice, in which the IL-4 gene had been
disrupted. It was found, however, that IL- 13 -induced IgE synthesi~
is ir~dependent of lL-4, since IL-13 induced IgG4 and IgE synthesis
in cultures of highly purified B cells in the absence of exogenous
IL-4. In addition, anti-IL-4 rnAbs, which efficiently blocked IL-4-
induced IgE synthesis, failed to affect IL-13-induced IgE production.
MoreovEr, IL-13-induced IgG4 and IgE synthesis, like that induced '
20 by IL-4, reflects Ig isotype switching and is not due to a selective
outgrowth of a few B cells committed to IgG4 or IgE synthesis, since
IL-13 also induced IgG4 and IgE synthesis by naive,-sorted sIgD+ B
.
cells.
~;~ Switching to IgE by IL-13 was preceded by induction of
2s germline E mRNA synthesis, but costimulatory signals provide~ by
activated T cells were required for induction of IgE production.- This
is consistent with studies showing that IL-4-induced switching to
-~ ;jin' both murine and human B cells is preceded by the induction of
germline RNA synthesis, and that co-stimulatory signals~~provided
30 by activated CD4+ T-cell clones or anti-CD40 mAbs are required for
the inducdon of praductive mRNA transcripts and IgE-~ynthesis by
4. Although their exact role remains ~o be determined,- it- has
been suggested that` germline transcripts play an- important role in
the -switch process.
,.-
wo g4/04680 Pcr/uss3/o764
~a 8 8
Despite the fact that IL-4 has been considered to be the only
cytokine tO induce germline transcription in B cells, an IL-4-
independent pathway of induction of germline tranSrIiptiOn iS
operational, since a non-IL-4 producing T cell clone was also capable
5 of inducing strong germline E RNA synthesis. It is likely that IL-13
produced by the non-IL-4 producing T cell clones is responsible for
the IL-4-independent induction of ge~nline ~ mRNA in B cells. The
present findings may also explain why induction of IgE synthesis by
IL-4 producing T-cell clones was never completely inhibited by
0 anti-IL-4 mAbs. A combination of IL-4 and IL-13 antagonists may
be quite effective in blocking the switching process, each present at
lower levels, e.g., below threshold levels for adverse side effects.
No additive or synergistic effects on IgE synthesis were
observed when IL-4 and IL-l 3 were added together at optimal
5 concentrations, suggesting that IL-4 and IL-13 may use common
signaling pathways for induction of IgG4 and IgE switching. Indeed,
recent studies have shown that receptors for IL- 13 and IL^4 share a
common subunit that functions in signal transduction. However,
IL-13 did not bind to cells bearing the 130 kDa IL-4 receptor
2 o indicating that IL-13 does not act through this IL-4 binding protein.
The commonality between IL- 13 and IL-4 was further
supported by the observation that IL- 13, like IL-4, induced CD23
expression on purified~ B~cells. Similarly to IL-4, IL-13 also
upregulated expression of class II MHC antigen, sIgM, and CD72,
25 which is the ligand for CD5. Although the exact role of CI)23 in the
regulation of IgE synthesis-remain`s to be determined, a strong
correlation between CD23- exprëssion and induction of IgE synthesis
was observed and soluble forms of CD23 were found to enhance IgE
synthesis. Since IL-13 induced significant expression of CD23 within
30 24 h, these data also indicated that CD23 expression preceded
IL- 1 3-induced e switching, thereby confirming the correlation
between induction of C~23 expression and subsequent IgE synthesis.
Despite the similarities between IL-4 and IL- 13 in their
effects on B cells, the functions of IL-4 and IL-13 are not identical.
35 The levels of IgG4 and IgE produced in response to IL-13 were
generally lower than those induced by IL-4. Moreover, preliminary
94/04680 8 9 ~ PCI`/US93/0764~
results indicated that IL- 13, ~in contrast to IL-4, does not act on T
cells or T-cell clones. IL-13 has no obvious T cell growth promoting
activity and appears not to induce CD8a expression on CD4+ T-cell
clones, which may be due to lack of functional IL-13 receptors on T
5 cells. The activation state of T cells was essential for their ability to
deliver co-stimulatory signals required for B cell proliferation and
differentiation. Therefore, the lack of T cell activation inducing
effect of IL-13 may partially explain why maximal IgG4 and IgE
synthesis by PBMNC in response to IL- 13 was lower than that
0 induced by IL-4.
These data seem to be incompatible with the finding that IL-4
deficient mice have no detectable circulatory IgE following
nematode infections. However, it is not clear whether IL- 13 also
induces IgE synthesis by murine B cells. Preliminary data showed
5 that IL- 13 was produced for much longer periods than IL-4
following T cell activation, suggesting an important role for IL-13 in
the regulation of enhanced IgE synthesis in allergic individuals.
IV. Activities on PBMC and Macro~ha~es
A. Induction of Mor~hological Change in Non-adberent Human
2 0 PBMC
- Peripheral blood mononuclear cells (PBMNC) ~ were isolated
from normal health human donors by centrifugation over Ficoll-
Hypaque. Total PBMNC (1 x 108 cells) were incubated for 30
minutes at 37C in 10 mm tissue culture dishes. Nonadherent cells
25 were removed by extensive washing of the dish with phosphate
buf~ered saline (PBS). Adherent cells were incubated in Yssels's
medium Yssel et al., J. Immunol. Me~hods 72:219 (1974) with 1%
human AB serum alone, or with mouse P600 derived from E. coli (lot
- 560-137-1; used at a concentration of 30 ng/ml), as described
30 above. Alternatively, COS-7 denved mouse P600 -or-- human IL-13
~ was used at a final dilution of 1/20. Cells were`o~served at regular
- intervals .
:
WO 94/04680 PCI`/US93/0764
s~
B. Modification of Cell Surface Mark'ers on Non-adherent Cells
Five or ten days after nonadherence selection as described
above~ the resulting cells were analyzed for expression of cell
surface markers by fluorescence activated cell sorting (FACS), e.g., as
described in Shapiro, Practical Flow Cytometry (2nd Ed.), 1988, Alan
Liss, New York. Exemplary antibodies for recognizing each marker'
are: CDlla ~LFA-1; SFN-L7, from DNAX, Palo Alto, CA], CDllb ~Bear1,
see Spits et al., Eur. J. Immunol. 14:229 (1984)1, CDllc [plS0; NGH
93, see Visser et al., Blood 74:320 (1989)]; CD54 [ICAM; LB2, see
0 Azuma et al.~ J. Expt'l Med. 175:353 (1992)], Class I MHC [W6/32,
from Sera Labs, see also Barnstable et al., Cell 14:9 (1978)]; Class II
MHC [Q5/13, see Quaranta et al., J. Immrlnol. 125:1421 (1980)]; Class
II MHC [PdV5.2, see Koning et al., Human Immunol. 9:221 (1984)];
Class II MHC (DQ; SPV-L3), CD58 [LFA-3; TS 2/9, see Krensky et al., J.
Immunol. 132:2180 (1984)], CD32 [IV.3, see Looney e~ al., J.
Immunol. 136:1641 (1986)], CD16 [granulocyte-l, see Huizinga et al.,
Nature 333:667 (1988)]; or Leu lla, Becton Dickinson, Mountain
View, CA); CD23 (gp25, from DNAX, Palo Alto, CA), IL-2Ra ~7G7; or
'~ BB10, see Herve et al., Blood 75:1017 (1990)], CD44 [NkI-Pl; see
' 20 Vennegoor et al., J. Immunol. 148:1093 (1992)], CD14 (LeuM3,
Becton Dickinson), and CD18 and B7 [L130 and L307; both described
in Azuma et al., J. lmmunol. 149:1115 (1992)3.
Mouse P600 matèrial''from either COS-7 supernatants or E. coli
- ~ inclusion bodies were cornpared to COS-7 supernatants of human IL-13.
2 s
C. Nitric Oxide Svnthèsis
:
IL- 13 (P600) was assayed by its inhibitiory effect on the
` production of nitric oxid~ ~NO) by GM-CSF-derived bone marrow
macrophages. '`The ~macrophages were derived by 9- 12 days culture
in RPMI containing GM-CSF and purified by retention of adherent,
: GM-CSF-responsive~fractior~. Cells were 99+% pure, as determined
-' by FACS analysis using two color staining.
Macrophages were activated to produce NO by stimulation
with LPS at 3 ,ug/ml in the appropriate experiments, either with or
without prior stimulation with cytokines, as indicated. The
,
~ 94~04680 ~ P~/US93/07645
1~860
macrophages were incubated for 16 h with the cytokines (if used)
16 h prior to treatment with I,PS. Supernatants were taken at the
indicated times relative to LPS addition, i.e., 0 h is the time of
addition of LPS.
Supernatants were assayed for NO production by the standard
Griess assay for nitrites. See, e.g., Coligan, Current Protocols in
Immunology, (1991 and periodic supplements) GreenelWiley, New
York. Addition of cytokines after addition of LPS to the macrophage
cultures or at the time of LPS addition has been tested; under these
0 conditions, none of the cytokines tested (including IL-13) had
significant effects. Other macrophages were also tested, but since
they generally produced lower levels of NO, they were not used as
extensively for bioassay.
Table 11, part A shows NO production from GM-CSF-treated
bone marrow derived macrophages after treatment for 16 h with
designated cytokines. Note that I~N-y induced NO production, while
IL-4 or IL-13 inhibited NO production. L-NMMA is a specific
~ inhibitor of NO production. Parts B and C are similar experiments- ~ titrated over different ranges of P600 amounts. In each case, the
IL-13 decreased the producdon of NO.
~:
.' .
, .
WO 94~04680 ~ PCT/US93/0764'
.
Table 11: NO from GM-CSF-de~ved Macrophages (nM)
Treatment 0 hours 24 hours 48 hours
mëdium 1.551 3.638 3.103
+ LPS ~ ~N-~ 3.852 10.057 9.57t;
+ LPS + ~-4 1.016 1.016 3.798
+ LPS ~ L-N~A 0.963 0.802 0.000
+ LPS ~ nL-13 0.856 0.802 0.32:L
+ ~PS 0.963 4.708 5.189
B _
medium 0.000 0.144 0.190
LPS 0.193 4.826 8.253
LPS + L-N~A 0.144 0.482 0.145
LPS + n~N7 0.917 11.872 14.189
LPS + IlL-4 0.000 4.633 7.095
LPS + P600 (25 ng/ml)- - 0.000 2.992 4.537
LPS + P600 (50 ng/ml) - 0.000 3.282 4.730
LPS + P600 (100 ng/ml) 0.261 3.137 4.488
C - . _. . ,
medium -0.705 - 2.512 2.757
LPS 0.766 2.390 2.665
LPS + D~N-y 2.359 10.509 15.319
LPS +L-NM~A -- 0-.643 0.735 0.950
LPS ~ IL-13 (400 pg/ml) 0.306 1.225 1.562
LPS + ~-13 (2 ng/ml) 0.674 1.225 1.593
LPS ~ DL-13 (10 n~n~ - -0.643 1.164 1.532
LPS + rL-13 (50 ng/mI~ - - 0.613 1.072 1.409
LPS + IL-13 (250 ng/ml) 0.613 1.134 1.409
.
~) 94/0'~6X0 PCI`/US93/0764~
S
D. ~LI~
s II~-13 inhibi~s the production of IL-la. -6~IL-10. and TNFa by
LPS activated human monocvtes
Peripheral blood mononuclear cells were isolated from normal
healthy donors by centrifugation over ~icoll-Hypa~ue. Total PBMNC
~100 x 106 cells/100 mm tissue culture dish) were incubated for 30 ~
min at 37 C and subsequently nonadherent cells were removed by
extensive washing of the tissue cultu~e dish with PBS. Adherent
cells were incubated in Yssels medium with 1% human AB serum in
the absence or presence LPS (E. coli 0127:B8, I)ifco, Detroit, MI) in
combination with IL-4 (50 ng/ml), IL-13 (50 ng/ml), or IL-10 (100
- U/ml). In addition, cells were activated by LPS in combination with
IL-4 or IL-13 in the presence. of neutralizing anti-IL-10 mAb 19Fl
(10 ~g/ml). Supernatants were collec~ed after 12 hrs and
production of IL-la, IL-6, IL-10, and TNF-a was measured by
cytokine-specific ELISA. Table 12 shows the- results of these studies.
3 0
- ~ - -- .,
- 35
W094/04680 'b~"~ PCI/U593/0764'
Table 12: Ef~ect of IL-13 on the Produ~tion of IL-la, IL-6, IL-10,
and TN~-a by LPS Activated Human Monocytes.
IL-la IL-6 IL-10 TNF-a
s fnglml) (ng/ml) (n~/ml! (ng/ml
Medium 0 0 0 0
LPS 8.1 54.4 35.4 2.2
LPS + rL-4 1.7 33.1 30 0.7
LPS + IL-13 2 35.4 22 0.5
LPS + IL-10 - O 8.6 ND O
LPS + aIL-10 mAb 12 101 ND 10.6
LPS + aIL-10 mAb + IL-4 3.7 ~9.5 ND 1.2
LPS + aIL-10 mAb + II,-4 5.4 79.5 ND 1.5
These results indicated that IL-4 and IL-13 inhibited the
production of IL-la, IL-6, IL-10, and INl~-a by LPS activated human
monocytes. IL-10 also inhibited the production of IL-l~, IL-6, and
TNF-a by LPS activated human monocytes. IL-10 was produced by
~; human monocytes and inhibited IL-la, IL-6, and TNP-a in an
20 autoregulatory fashion. Addition of IL-10 neutralizing mAb l9F1
showed that endogenously produced IL-10 also inhibited the
producdon of IL-la, IL-6, and~ TNF-a. The inhibitory effects of
IL-4 and IL- 13 on cytokine production by LPS activated human
monocytes were inde~endent of IL-10 since IL-4 and IL-13
25 inhibited the producdon of II~-la-,-IL-6, and TNF-a in the presence of
neutralizing anti-IL-10 mAb l9F1.
_,,,
E. Antibodv De~end~nt Cell-mediated Cvtotoxicity tADCC!
The present experiments investigate the effects of IL- 13 alone
30 or in combination wi-th IL-4, IFN-y, or IL-10 on human monocytes.
IL- 13 induced significant changes in the phenotype of monocytes.
Lilce IL-4, i~ enhanced the expression of CDllb, CDllc, CD18, CD29,
CD49e (VLA-5), class II MHC, CD13, and CD23 whereas it decreased
J 94/04680 ~? PCI /US93/07645
95 , ~S~ '
the expression of CD64, CD32, CD16, and CD14 in~a dose-dependent
manner. IL- 13 induced upregulation of class II MHC antigens and
its downregulatory effects on CD64, CD32, and CD16 expression were
prevented by IL- 10. IFN-y could also partially prevent the IL- 13
5 induced downregulation of CD64, but not that of CD32 and CD16.
However, IL-13 strongly inhibited spontaneous and IL-10 or IF'N-
~induced antibody dependent cell-mediated cytotoxicity (ADCC)
activity of human monocytes toward anti-IgD coated Rh+
erythrocytes, indicating that the cytotoxic activity of monocytes was
0 inhibited.
Furthermore, IL-13 inhibited production of IL-la, IL-l~, IL-6,
IL-8, IL-10, IL-12 P35, IL-12 P40j GM-CSF, G-CSF, IFN-a and TNF-a
by monocytes activated with LPS. In contrast, IL-13 enhanced the
production of IL-lRA by these cells. Similar results on cytokine
5 production were observed or have been obtained for IL-4. Thus
IL-13 shares most of its activities on human monocytes with IL-4,
but no additive or synergistic effects of IL-4 and IL-13 on human
monocytes were observed suggesting that these cytokines may
share common receptor components. Taken together, these results
20 indicate that IL- 13 has anti-inflammatory and immunoregulatory
activities.
Activated T cells secrete a number of biologically active
poly~eptides, which regulate the proliferation, differentiation and
function of cells participating in immune responses against antigens.
2s T cells producing IL-2, IL-3, IL-4, IL-5, IL-6, IL-10, IFN-y, GM-CSF,
and TNP/LT simultaneously following antigenic or polyclonal- -
stimulation have been described in both mouse and man. --These T
helper cells were designated ThO cells in order to distinguish them
from the more specialized Thl and Th2 subsets. Murine Th1 cells
30 produce IL-2, I~N-y, TNF/LT, IL-3, and GM-CS~ which supports their
function as regulatory and effector cells in cellular imrnune
- responses such as delayed type hypersensitivity (Dl~-~)~--whereas Th2
cells produce IL-4, IL-5, IL-6, IL-10, IL-3, and GM-CSP- which makes
them suitable for providing help to B cells in the production of
35 immunoglobulins of different isotypes.
, -:
." ~ .
,,,.,, I
, I
WO 94/04680 - PCI /US93/0764'
5~ 96
In man, T cell clones with restricted cytokine production
profiles have also been isolated from patients with inflammatory or
allergic diseases. Although these types of clones resembled murine
Thl and Th2 clones, there were some differences. Depending on
s their mode of activation, Thl clones generally could still produce low
quantities of IL-4 whereas Th2 clones were able to produce low to
normal quantities of IFN-~. However, a clear imbalance in the
production ratios of IL-4 and IFN-~ by Th2 clones was observed
following antigenic stimulation. Therefore human T cell clones were
0 defined which produce high levels of I~ and no, or low levels of
IL-4 Thl "like" cells and T cell clones which produce no, or low
levels of IFN-y and high levels of IL-4 Th2 "like" cells.
Furthermore, IL-10 which is exclusively produced by ThO and Th2 T
cell subsets in the mouse, is produced by ThO, Thl "like", and Th2
"like!' subsets in man.
The present invention makes available a new cytokine, human
IL-13, which is related to the mouse P600 protein. Both human
IL-13 and mouse P600 proteins were biologically active and
affected ~human monocyte and B cell functions.
The biological activities of mouse and human IL-13 on human
monocytes were further characterized and compared to those of
IL-4, IL-lO, and lFN-~, other cytokines with stimulatory of
inhibitory actions on human- monocytes. IL-13 induced dramatic
c hanges` in the phenotype ~of- human monocytes and inhibited the
25 ~ production of IL-la, IL-l~, IL-6, IL-8, IL-lO, GM-CSF, G-CSF, and
TNF-a following acdvatron by-LPS, whereas it induced the
production of IL-lRA. ~l~ese results indicate that IL 13 has anti-
inflammatory activities and may play an important regulatory role
in ! immune responses. -- -
i; ~ .
- ~; 30 Isolation and Culture of-Human Monocvtes i-
;~ Human monocytes were isolated from peripheral blood of
healthy donors by centrifugation over Ficolll-Hypaque and
-~ adherence to plastic. -Briefly, lOO x 106 PBMNC were plated on a
100 mm tissue culture dish in Yssel's medium sùpplemented with
. ,
~ ~4/04680 ~,~ PCr/US93/0764~
86,~
human serum albumin (HSA) and 1% pooled human AB+ serum and
incubated at 37 C for 30 min. This culture medium was endo~oxin
free as determined by the Limulus arnoebocyte lysate assay ~< 0.2
ng/ml of endotoxin). Subsequently, nonadheren~ cells were
5 removed by extensive washing and cultured in Yssel's medium with
HSA and 1% pooled human AB serum as indicated. Alternatively,
highly purified human peripheral blood monocytes were obtained
from 500 ml blood of normal donors by centrifugal elutriation.
Mononuclear cells were isolated by density centrifugation in a
0 blood component separator, followed by fractionation into
lymphocytes and monocytes. The monocyte preparation was > 95%
pure, as judged by nonspecific esterase staining and contained more
than 98% viable cells. These monocytes were cultured in Yssel's
medium with HSA and 1% pooled human AB+ serum at a
concen~ation of 4 x 106 cellslml in teflon bags (Jansen MNL, St
Niklaas, Belgium), which prevented adhesion of these cells. After
culture for the times indicated, monocytes were collected and
analyzed for cell surface expression by indirect immunofluorescence
or analyzed for Iymphokine gene expression by Northern and PCR
2 o analysis. In addition, monocyte culture supernatants were collected
for determination of IL-la, IL-1~, IL-6, IL-8, IL-10~ TN~-a, GM-CSF,
G-CSF, and IL-lRA production following activation of these cells by
LPS (E. coli 0127:B8) (Difco, Detroit, MI) at 1 ~lg/ml. The viability of
the cells after culture always exceeded 95% as determined by
25 trypan blue exclusion.
Rea~en~ ~ ~
Recombinant human and mouse IL-13 were expressed in E.
coli as insoluble aggregates of glutathione-S-transferase`-fusion
proteins, extracted by centrifugation, solubilized, and subjected to
30 renaturation prior to digestion with thrombin to remo~ the N-
terminal fusion part. Subsequently, proteins were purif-ied by cation
exchange and gel filtration chromatography, which resulted in active
human and mouse IL-13. Purified human r-IL-l~, r-IL-4, and r-
WO 94~M680 ~ PCI/US93/0764:
~ 1 98
2~42860
IFN-~ were provided by Schering-Plough Research Institute
(Bloomfield, NJ).
The neutralizing anti-IL-4 mAb 25D2 [Chretien et al., J.
~mmunol. Metfiods, 117:67 (1989)], and anti-IL-10 mAb l9F1
[Abrams et al., Immunol. Rev. 125:5 (1992)], were described
previously. The following mAbs were used for immunofluorescence
studies on the expression of cell surface markers: SPV-L7 [CDlla;
Spits et al., Hybridoma 2:423 (1983)], Bear-l [CDllb; Keizer et al.,
Eur. J. Immunol. 15:1142 (1985)], CLB FcR gran-1 [CD16; Klaassen et
al., J. Immunol. 144:599 (1990)], gp25 [CD23; Bonnefoy et al., J.
Immunol. 138:29?0 (1987)], IV.3 [CD32; Looney et al., J. Immunol.
136:1641 (1986)], 32.2 ~CD64; Anderson et al., J. Biol. Chem.
261:12856 (1986)], Q5/13 [HLA-DR/DP; Quaranta et al., J. Immunol.
125:1421 (1980)~, PdV5.2 [HLA-DR/DP/DQ; Koning et al., Hum.
Immunol. 9:221 (1984)], SAM-l [VLA-5, CD49e; Keizer et al., ~ur. J.
Immunol. 17:1317 (1987)], CD29 (Ts2/16; a kind gift of C. Figdor,
Amsterdam), L307 [B7; Azuma et al., J. Immunol. 149:1115 (1992)],
IOM13 (CD13; purchased from AMAC, Inc., Westbrook, ME); Leu-M3
(CD14), LeulS (CDllc), and L130 (CD18) were obtained from Becton-
20 Dickinson (San Jose, CA).
Probes
Oligonucleotides used~for Southem analysis of IL-la, IL-1~
IL-6, IL-8, IL-10, TNP-a, GM-CSF, G-CSF, and ~-actin PCR products
have been described by de Waal Malefyt et al., J. Exp. Med.
2s 174:1209 (1991). ~~ -- -
The following oligonuclotides were used to detect
' ! j ' ,,
IFN-a: 5'-TTCTGGCTGTGAGGAAATACT-3' (nt 360-378),
~L-lRA: 5'-GTCAATTTAGAAGAAAAGATAGATGTGG-3' (nt 207-234),
IL-12 P35: 5'-AATGGGAGTTGCCTGGCCTC-3' (nt 488-507),
, ~
30 IL-12 P40: 5'-TAAGACClTrCTAAGATGCGAGGCC-3' (nt 417-441), and
94/04680 ~ PCI'/US93J07645
TGF~ S-CGAGCCTGAGGCCGACrACTACGCCAAGGAGGTCACC-CGC-3
(nt 1131-1170).
mRNA isolation and Northern analvsis
Total RNA was isolated from 20 x 106 monocytes by a
- 5 guanidinium thiocya~iate-CsCl procedure. For northern analysis,
10 llg total RNA per san~ple was separated according to size on l~o
agarose gels containing 6.6% formaldehyde, transferred to Nytran
nylon membranes (Schleicher 8c Schuell, Keene, NH), and hybridized
~; with probes, labelled to high specific activity (> 108 cpm/mg) by a
10 hexamer labelling technique. Filters were hybridized, washed under
stringent conditions, and developed.
PCR Analvsis
~ ~ One microgram of total RNA was reverse transcribed using
- oligo (dT)12 18 as primer (Boehringer Mannheim, Indianapolis, IN)
5 and~ AMV reverse transcriptase (Boehringer Mannhei~) in a 20 ~11
reaclion volume. Two microliters of reverse transcript (equivalent
to ~100~ng of total RNA) was used directly for each amplification
reaction.~ ~ Conditions for PCR were as follows: in a 50 ~Ll reaction
volume, 25 nmol of each primer, 125 IlM each of dGTP, dATP, dCTP,
20 ` `and dl~P (Ph~armacia, UpQsala, Sweden), 50 mM KCl, 10 mM Tris-
-~ ~ HC~, pH 8.3, 1.5 mM Mg12, 1 mglml gelatin, 100 ~lg/ml non-
` acetylated~B-SA, and l unit Vent D~A polymerase (New England
Biolabs, Beverly, MA).
Primers used~to amplify IL-la, IL-l~, IL-6, I~-8~ , ~a,
2s ~ GM-CSF, G-CSF, and ,g-acdn hàve been described previoùsly by de
Waal Malefyt e~ al., J. Exp. Med. 174:1209 (1991). The following
'''~!' '' ~p~mers werefalso~used: I~N-a sense primer: 5'- ~` i
-- ~ GCTGAAACCATCCCTGTC-3' (nt 161-178), IFN-a andsense primer: !
ç-- ~ ~ 5'-CTGCTCTGACAACCTCCCAG-3' (nt 450-430), IL lRA sense primer:
~- 30 5'-GCAAGCClTCAGAATCTGGGATG-3' (nt 118-14~ IL--lRA antisense
f" ~
primer: 5'-GATGTTAACTGCCTCCAGC~GGAGTC-3' (nt 3i4-319), IL-12
P35 sense primer: 5'-CTTCACCACTCCCAAAACCTG-3' (nt 281-302),
IL-12 P35 antisense primer: 5'-AGCTCGTCACTCTGTCAATAG-3' (nt
813-792), IL-12 P40 sense primer: 5'-CATTCGCTCCTGCTGCTTCAC-3'
.:
~,
WO 94/04680 PCI`/US93/0764
10~
2 1 ~ 2 8 6 ~ !
(nt 337-358),IL-12 P40 antisense primer: 5'-
TACTCCTTGTTGTCCCCTCTG-3' (nt 603-582), TGF-~l sense pnmer
5'-ACCGGGTGGCCGGGGAGAGTGC-3' (nt 1097-1118), TGF-~l ~tisense
primer: 5'-GCCGGTTGCTGAGGTATCGCCAGG-3' (nt 1399-1376).
Reactions were incubated in a Perkin-Elmer/Cetus DNA
Thermal cycler 9600 for 25 cycles (denaturation 30s at 94C,
annealing 30 s at 55C, extension 60 s at 72C). Forty microliter of
each reaction was loaded on 1% agarose gels in TAE buffer and PCR
products. were visualized by ethidium bromide staining.
Subsequently, gels were denatured in 0.5 M NaOH, 1.5 M NaCl,
neutralized in 1 M ammonium acetate, and transferred to Nytran
nylon membranes. Membranes were pre-hybridized in 6 x SSC, 1%
SDS, 10 x Denhardt's solution (0.2% Ficoll, 0.2% polyvinylpy~olidone,
0.2% BSA, pentax fraction V), and 200 llg/ml E. coli tRNA
(Boehringer, Mannheim, I:RG) for 4 h at 55C.
Oligonucleotide probes (200 ng), speci~lc for a sequence
internal to the primers used in the amplification, were labelled at
the 5' end by T4 polynucleotide kinase (New England Biolabs) and
~-32P-ATP (Amersham, Arlington Heights, IL). Probes were
separated from non-incorporated nucleotides by passage over a Nick
column (Pharmacia, Uppsala, Sweden) and added to the
hybridization mix. Following hybridization for 12 hrs at 55C,
fflters were washed in 0.1 x.SSC (1 x SSC: 150 mM NaCI, 15 mM Na-
citrate pH = 7.0), 1% SDS at room temperature, and exposed to Kodak
XAR-5 films for 1-2 hrs. In addition, signals were quanti~led on a
Molecular Dynamics phos~2ho~-i'mager (Molecular Dynamics,
Sunnyvale,CA) . -
Lymphokine Determinations
The production of :cytokines by monocytes was determined inculture supernatants by - ~ytokine specific ELISA's. The cytokine
specific ELISA's'and~'thëir'sensitivities wcre the following:.IL-la,
Endogen (Boston, MA) (50 pg/ml); TNF-a, Endogen (Boston, MA)
(10 pg/ml); IL-1~,-Cistron (Pine Brook, NJ) (20 pg/ml); IL-6,
Genzyme (Boston, MA) (0.313 ng/ml); IL-8, R&D Systems
O 94/04680 ~? ~ PCI/US93/07645
lol ~6
(Minneapolis, MN) (4.7 pg/ml); G-CSF, R&D Systems (Minneapolis,
MN) (7.2 pg/ml); IL-lRA, R&D Systems (Minneapolis, MN) (12.5
pg/ml); GM-CSF, Bacchetta et al., J. Immunol. 144:902 (1990), (~0
pg/ml); and IL- 10 (75 pgJml) . '~
s Immunofluorescence_AnalYsis
Cells ( 105 ) were incubated in V bottom microtiter plates (Flow
Laboratories, McLean, VA) with 10 ~l of purifiled mAb (1 mg/ml)
for 30 min at 4 C. After two washes with PBS con~aining 0.02 mM
sodium azide and 1% BSA (Sigma, St Louis, MO), the cells were
0 incubated with 1/40 dilution of FITC labelled F(ab')2 fragments of
goat anti-mouse antibody (TAGO, Inc. Burlingame, CA) for 30 min at
4 C. After three additional washes, the labelled cell samples; were
analyzed by flow microfluometry on a FACScan (Becton Dickinson,
Sunnyvale, CA.).
5 Antibody De~endent Cell-mediated Cvtotoxicitv fADCC~
ADCC activity of cultured human monocytes against antibody
coated rhesus positive human erythrocytes was performed as
previously described by de Velde e~ al., J. Immunol. 149:4048
( 1 992).
20 IL-13 and II~-4 Induce Identical Cbanges in the Expression-of Cel~
~face Anti~ens bv Human Monocvtes
Both mouse and human IL-13 induced expression of-C~3~
- (FcRII) and upregulated the expression of class II MHC antigens on human monocytes. The effects of IL-13 on the expression of a
25 larger panel of cell surface antigens was investigated. IL-13
affected the expression of multiple cell surface molecules belonging
to different supergene families. IL-13 enhanced the expression of
several members of the integrin superfamily of adhesion- mohecules.
The expression of a subunits CDllb (C3bi receptor, Mac-1), CDll`c
30 (gplS0,95), and VLA-5 (FNR), as well as their respective ~ subunits
CD18 (~2) and CD29 (~1, VLA-b) were upregulated by IL-13. The
expression of other members of this family, including CDlla ~FA-1).
WO 94/04680 PCl`/US93tO764`
: 102
2~ 6~) '
VLA-2 (CD49b), VLA-3, VLA-4 (CD49d), VLA-6 (CD49f), ~3 (CD61),
and ~4 was not significantly affected by IL- 13 .
II,-13 enhanced the expression of class II MHC antigens. The
expression of HLA-DR, HLA-DP and HLA-DQ was upregulated by
s IL-13. Expression of other members of the Immunoglobulin
superfamily including class I MHC, CDl la (LFA-l), CD54 (ICAM-1),
ICAM-2, and CD58 (LFA-3) was not dramatically affected by IL-13.
IL-13 modulated the expression of the various Fc receptors on
monoeytes. The expression of CD64 (Fc~RI), CD32 ~Fc~RII), and CD16
o (FcyRIII) on human monocytes was strongly downregulated by
IL-13. In conaast, IL-13 induced the expression of CD23 (FcRII).
In addition, IL- 13 upregulated the expression of CD 13
(Aminopeptidase N) and downregulated the expression of CD14. No
major effect of IL-13 was detected on the expression of CD25,
CD33, and CD44.
IL-4 induced upregulation of CDllb, CDllc, CD18, VLA-5,
CD29, class II MHC, CD13, and CD23, and inhibited the expression of
CD16, CD32, CD64, and CD14 on human monocytes to the same extent
as did IL-13. Taken together, these results indicated that the IL-13
2 o induced changes in the expression of cell surface molecules were
similar to those induced by IL-4. Incubation of monocytes with ~;
saturating concentrations of both IL-4 and IL-13 did not result in
changes in the phenotype a~ compared to those induced by either
~; cytokine alone.
No additive or synergistic activities of IL-13 and IL-4 on the
expression of the various ce~l- surface molecules were detected under
these conditions. There is no evidence that monocytes are able to
produce IL^4. However, to exclude the possibility that IL-13 acted
through the induction of IL-4 b~ monocytes or by a few
contaminating T cells, monocytes were incubated in the presence of
IL-13 and a neutralizing anti-IL-4 mAb.
As shown in Table l~, the induction of CD23, downregulation
of CD14, and upregulation of class II MHC by IL-13 was not affected
by the anti-IL-4 mAb. The anti-I~-4 mAb, however, was effective
since it completely inhibited the effects of IL-4 in control
; experiments. Thus, IL- 13 acts independeritly of IL-4.
3 94~04680 ~;? PCI`/US93/07~45
103
b~
. _ _
Table 13 ~ 13 Acts Independently of IL-4.
mAb Medium IL-13 IL-13 IL-4 II.-4
+ aIL-4 + aIL-4
control 3 * 5 6 5 3
MHC class II 443 1904 1845 2084 220
CD23 3 99 7 9 8 9 8
CD14 222 97 83 80 444
5 Monocytes were incubated with medium, IL- 13 (50 ng/ml) or IL-4
(4Q0 U/ml) in the absence or presence of neutralizing anti-IL-4
mAb 25D2 (10 ~Lg/ml) at 37 C for 120 h and expression of HLA-
DR/DP (QS/13), CD23 (gp2~)9 and CD14 (Leu-M3) was determined by
indirect immunofluorescence.
0 * Mean Fluorescence Intensity (channel num~er)
IL-13 induced changes in expression of cell ~face markers
were dose-dependent as shown for the modulation of CDllb, CD18,
CD16, CD32, CD64, CD23, class II MHC, CD13, and CD14 expression
5 (Table 14). Generally, incubation of human monocytes with 5 pg/ml
IL-13 was insufficient to induce changes in the expression of these
cell surface markers, whereas 0.5 ng/ml IL- 13 resulted in
significa~t changes in phenotype, comparable to those induced- by
0.~ nglml IL-4. Maximal responses were. induced by S0 nglml
20 IL~13, which were again in the sarne range as those induced by 50
ng/ml of IL-4, indicating that IL-4 and IL-13 were equally effective.
.
WO 94/04680 PCI`/US93/0764
2 1 ~ 2 8 10 4
Table 14~ 13 Induces Changes in Cell Surface Phenotype of
Monocytes in a Dose Dependent Manner.
mAB IL- 13 (pg/ml) IL-4 (U/ml)
0 5 500 50000 4 4Q0
control 3 * 3 3 4 3 3
CDllb 59 54 102 139 102 168
CD18 7 1 54 79 108 99 127
CD16 25 20 20 lS 20 13
CD32 50 48 44 40 43 39
CD64 57 50 36 26 31 17
CD23 4 4 1 2 56 7 67
MHC class II 355 386 586 607 609 908
~D13 26 26 113 121 57 102
CD14 110 110 75 37 86 16
S
Monocytes were incubated with medium, IL- 13 (5 pg/ml, ~00
pg/ml, or 50,000 pg/ml) or IL-4 (4 U/ml, or 400 U/ml) at 37C for
120 h and ~he expression of cell surface antigens was determined by
indirect immunofluorescence.
* Mean Fluorescence Intensity (channel number)
.
10 Downre~ulates IL-13 Induced Class II MHC Expression on
Human MonocYtes
.
To compare the effects of IL-13 with those of other cytokines
which modulate the cell surface phenotype, monocytes were
f iincubated with IL-10 or IFN-y in the absence or presence of IL-13
and the expression of cell surface antigens was analyzed. IL-lO or
IFN-~ alone did not dramatically affect the expression of CDllb,
CDl lc, CD18, CD13, CD23, C~ 9,- and VLA-5. In addition, IL-10 or
IFN-~ did not noticeably affect the IL-13 induced increase in
expression of these markers. IL-10 or I~ had also no observed
effect on the expression of CDl4 and the IL-13 induced inhibition of
CD14 expression.
.
04680 Pcr/US93/0764
105
However, IL-10 downregulated not nly the constitutive class
II expression on monocytes~ but also inhibited strongly ~he IL- 13
induced class II MHC expression. Similar data were obtained when
highly purified monocytes isolated by elutriation and cultured in
5 teflon bags were used (Table 15) Increased expression of class II
MHC antigens was observed following incubation of monocytes in
medium alone, which was completely prevented by IL- 10. m-IL- 13,
h-IL-13, IL-4, and II:N-y all induced high levels of class II MHC
expression which were blocked by IL-10 (Table 1~). Class II MHC
0 expression induced by IFN-~ was further enhanced by IL-13. IFN-y
slightly upregulated expression of B7. Taken together, these results
indicate that IL-13, IL-10, and I~N-^y independently modulate the
expression of cell monocyte surface antigens.
. - ~
Table 15: IL-10 Inhibits Constitutive and IL-13, IL-4, and IFN-y
Induced MHC Class II Expression on Human Monocytes. -
Incubation IL-10 (200 U/ml)
control 4C 69* nd**
medium 37C 1 5 0 4 6
mIL-13 212 73
hIL-13 ~ 197 8 1
IL-4 407
IFN-y 3 4 7 3 6
.
Elutriated monocytes were incubated in medium at 4C or 37C,
mIL-13 (50 ng/ml), hIL-13 (50 ng/ml), IL-4 (400 U/ml) or IFN-~y
(100 U/ml) in the absence or presence of IL-10 (200 U/ml) in teflon
bags for 48 h and expression of HLA-DR/DP was determined-by
indirect immunoflourescence.
2s * Mean ~luorescence Intensity (channel number) ~--
** Not done
WO 94/04680 PCI'/US93/07645
~,~.42~6~ 1~6
IL-13 Inhibits Monoçvte Fc~R Cell Surface Expression and
Cvtotoxicitv
IFN-y, IL-4, and IL-10 are able to modulate the expression of
Fc~RI ~CD64), Fc~RII (CD32), and Fc~RIII (CD16) on human
s monocytes. I~ and IL-10 enhanced the expression of CD64
whereas IL-4 downregulates the expression of CD64, CD32, and
CD16. Adding combinations of these cytokines to monocytes showed
that I~-10 was able to prevent the IL-4 induced downregulation in
cell surface expression of all three Fc~R and that IFN-y partially
0 restored the downregulatory effects of IL-4 on CD64 expression.
IL-10 prevented IL-13 induced downregulation of CD64, CD32, and
CD16. In addition, IFN-~ could partially rescue IL-13 induced
downregulation of CD64, but did not affect the IL-13 induced
downregulation of CD32 and CD16.
` 15 The level of ADCC activity of human monocytes has been
shown to ~correlate with the expression of FcyRI. The effects of IL-13
on the functional activity of Fc~RI on monocytes was determined by
their ability to lyse anti-D opsonized human Rh+ erythrocytes~ Both
human and mouse IL-13 were able to inhibit ADCC activity of
20 monocytes cultured in medium alone. On the other hand, ADCC
activity was enhanced when monocytes were cultured in the
presence of IPN-y or IL-10. IL-13 significantly inhibited these
effects of IPN-y and IL-10 despite the~fact that~ y and IL-10
partially or completely reversed the inhibition of Fc~RI expression,
~2s indicating that IL-13 affected the Fc7R mediate~ cytotoxicity also
by othcr mechanisms. -- -
- ~ IL-13 Inhibits Production of Pro-inflammatorv Cvtokines and
~' Hemo~oietic Growth Factors But InducqS l~ R~,.
~ ~ .
To determine the effects of IL-13 on the production of
30 cytokines by human monocytes, monocytes- w-ere activated by LPS
and cytokine producdon was determined` in the culture supernatants
~ ~ after 6 and 24 hours by cytokine specific ELISA's. Activation of
'5''~:',~''; ~ monocytes by LPS resulted in the production of IL-la, IL-1,B, IL-6,
9' ~ 8, IL-10, GM-CSF, G-CSF, TNF-a, and I~-lRA. Significant levels of
~:) 94f04680 PCl'/US93/07645
107 ~?~
IL-la, IL-l~, IL-6, IL-8, TNF-a, and IL-lRA were present at 6 h
after activation, whereas the production of IL-10, G-CSF, and GM-CSF
was detected at 24 h. At 6 and 24 h after activation, IL-13, IL-4,
and IL-10 inhibited the production of IL-la, IL-l~, IL-6, IL-8,
5 IL-10, TNF-a, G-CSF, and GM-CSF, but enhanced the production of
IL-lRA.
IL- 13 affected the morphology, phenotype, function, and
cytokine production of monocytes. Incubation of monocytes with
IL- 13 induced strong adherence of these cells to plastic substrates
0 and their morphology changed to a dendritic appearance. In
addition, homot~pic aggregates of cells were observed. The finding
that IL-13 upregulated the expression of CDllb, CDllc, CD18, YLA-
5, and CD29, which are members of the integrin superfamiliy, is
compatible with the observed aggregation and ehanges in
morphology, since CDllb/CD18 and CDllc/CD18 heterodimers are
involved in cell-cell interactions, homotypic aggregation, adhesion to
artificial substrates, and bind fibrinogen.
In addition, the aS~l integrin VLA-5/CI)29 is the receptor for
fibronectin, which is an abundant extracellular matrix protein
20 involYed in adhesion processes. IL-13 did not induce changes in the
expression of other molecules involved in adhesion or cell-cell
interaction, e.g., CDlla, VLA-2, VLA3, VLA-4, VLA-6, ~3, ~4, ICAM-
1, ICAM-2, LPA-3? MEL-14, and CD44 but it remains possible that
other cell surface structures are involved in the IL- 13 induced
2s changes in morphology and adherence.
IL- 13 upregulated the expression of class II MHC antigens on
human monocytes. The expression of HLA-DR, HLA-DP, and ~A-DQ
was significantly increased by IL-13. IL-10 inhibited constitutive
and IL-4 and I~N-^y induced class II MHC expression on human
30 monocytes. IL-10 thus inhibits IL-13 induced class II MHC
expression, which further supports the general immunosuppressive
activities of IL-10. ~~
The expression of the various Fc receptors for IgG and IgE on
monocytes was influenced by several cytokines. CD64 (Fc~RI)
35 expression was upregulated by IFN-y and IL-10 and inhibited by
IL-4. Furthermore, IFN-y and IL-10 ~ere able to prevent the
WO 94~04680 PCI~/US93/0764i
~ 4~ 60 108
downregulation of CD64 induced by IL-4. ~Iere it was shown that
IL-13 inhibited the constitutive e~pression of CD64 and that this
inhibition could also be prevented by IL-10 and IFN-y. The
expression of CD54 has been shown to correlate with ADCC activity
of monocytes.
Spontaneous or IL-10- or IFN-~-induced FcyRI mediated
cytotoxicity of monocytes towards IgD coated rhesus positive
erythrocytes was strongly inhibited by IL-13 indicating that IL-13
not only affected the phenotype but also the function of human
0 monocytes. Although IL-10 could prevent the IL-13 induced
downregulation of CD64 expression, ADCC activity was still inhibited.
This supports the notion that ADCC activity is determined by factors
other than just the levels of CD64 expression.
IL-13 also affected the expression of ~c~RII and Fc~RIII. IL-L3
lS downregulated the expression of CD32 and CD16 in a dose
dependent manner. However, IL-10, but not IFN-y, could block the
IL-13 induced downregulation of CD32 and CD16 on monocytes.
¦ These results indicated that the level of Fc receptor expression was
highly regulated by cytokines.
The only cytokine known to induce the low affinity Fc receptor
for IgE (CD23) on monocytes was IL-4. However, IL-13 also
induced the expression of CD23 on monocytes. It was demonstrated
j~ ~` that the IL-13 induced~expression of CD23 could be partially
suppressed by I~N-y. It was also shown that IL-13 could induce
25 ~production of ~IgE by PBMC. In addition, IL-13 could initiate
germline e transcription in purified sIgM+ B c~lls and switching to
IgE production when a second signal provided by T cell clones, T cell
membranes, or CD40 ligand was present. The production of IgE is
regulàted by number of cytokines, including solubh CD23, which
n have either enhancing or inhibitory effects. The effects` of IL-13 and
IFN-~ on the expression of CD23 by human monocytes fit well within
this concept.
r
,: ., ,, ~ ,
~ ~ I
r~./
~ .''';
~ 94/04680 PCl'/US93/0764~
109
~'
o
VI. Activities of IL-4 Anta~eonist: Interactions
IL-4 and IL- 13 are two cytokines secreted by activated T cells
which have similar effects on monocytes and B cells. A mutant form
of human interleukin-4 (hIL-4) competitively antagonizes both hIL-
s 4 and human interleukin- 13 (hIL- 13). The amino acid sequences of
IL-4 and IL-13 are about 30% homologous and circular dichroism
spectroscopy (CD) shows that both proteins have a highly a-helical
structure. IL-l 3 competitively inhibits hIL-4-binding to functional
human IL-4 receptors (called hIL-4R) expressed oo a hIL-4-
0 responsive cell line, but not to the cloned IL-4R ligand-binding
protein expressed on heterologous cells. hIL-4 has about a S0-fold
lower affinity for the IL-4R ligand-binding protein than for the
functional IL-4R, while the mutant hIL-4 antagonist protein binds to `
both receptor types with the lower affinity. ~he above results
demonstra~e that IL-4 and I~-13 share a receptor component that is
~`~ important for signal transduction. In addition, these data establish
that IL-4R is a complex of at least two components one of which is a
novel affinity-converting subunit that is critical for cellular signal
transduction.
~ IL-13 is one of a number of protein hormones called cytokines-
- - that are secreted by activated T cells. Human Il,-13 elicits
morphological and cell-surface phenotype changes on human -
monocytes and also facilitates growth and immunoglobulin (Ig) ~~
producdon by human B cells. All these biological effects are also
25 ~ elicited by hIL-4, another protein hormone secreted by activated T
- ~ ~ cells.
The biological actions of IL-4 are mediated by a cell surface
~, Ireceptor that binds IL-4 with high specificity and affinity.
- ~Dissociation constant or Kd ~ 10-1 M. See Harada et aa. in Spits et
al. (eds), IL-4: Structure and Function, 1992, CRC Press, Boca Raton, - - .
pp. 33-54.] Human and mouse IL-4R have been characterized by _ -:
cDNA cloning which defined a 130 kDa glycoprotein (herein referred ----
o as IL-4R ligand-binding protein) with a single transmembrane
span. The extracellular domain sequence of IL-4R ligand-binding
WO 94/046~0 PCI'/US93/0764i
8 llo
protein is structurally homologous to the extracellular domains of
other cytokine receptor proteins.
Several of these other proteins participate in heteromeric
interactions where one subunit by itself binds the ligand at a
s relatively low affinity and the other subunit(s) contribute additionalbinding affinity and often are important for signaling. However, the
extracellular domain of the IL-4R ligand-binding protein alone
appears to bind IL-4 at the high affinity that characterizes IL-4R on
various IL-4-responsive cells. Although the intracellular domain is
0 unimportant for binding, it is important for signal transduction.
The structural homologies between many of the cytolcine
receptors is mirrored by structural homologies between their
ligands. Por example, IL-4, interleukin-2 (IL-2), Growth Hormone,
Macrophage Colony-Simulating Factor (M-CSF), and Granulocyte
Macrophage Colony-Stimulaeing Factor (GM-CSF) are not related at
- the sequence level, yet all have a similar compact-core-bundle
structure of four antiparallel a-helices. See, e.g., Diederichs et al.,
Science 254:1779 (1991); Bazan, Science S7:410 (1992); McKay,
Sclence 257:412 (1992); and Powers et al., Science 256:1673 (1992).
2 0 In mouse IL-2, exhaustive mutational analyses led èo the discovery
that substitution of a residue (Glnl41 to Asp) at the C-terminus of
the fourth a-helix results in loss of receptor-activation, but retention
of~most receptor-binding. This mutant protein is a potent and
specific competitive antagonist of IL-2 biological actioni
2 5 Based on the structural homology between IL-2 and IL-4, the
importance of residues of hIL-4 that might be analogous to~~nIL-2
Glnl41 was investigated. In these experiments, substitution of a
- residue (Tyrl24 with Asp) at the C-terminus of the fourth a-helix of
human IL-4 (hIL-4) specifically abrogates IL-4R activation and
renders the protein a competitive antagonist of IL-4 biological
action. This property of hIL-4.Tyrl24 to Asp (called hIL-4.Y124D)
has been described independently. See Kruse et a~;-,-EMBQ J. 11:3237
(1992). This mutant hIL-4 antagonist is defectivë in interaction
with a previously unknown second subunit of the functional IL-4R.
In addition, the hIL-4 antagonist blocks many IL-13 biological
' ~ actions.
;, .
, ' '
, ~, .
. ~,.: .
,.~
~..
94/04680 PCl`/US93/0764
111 ~?
~0
Muta~enesis of hIL-4
Based on mutagenesis studies of mIL-2 [Zurawski et al., EMBO
J. 9:3899 (1990); Zurawski et al., EMBO J. 11:3905 (1992)], the
shared structural frameworks of hI~-2 and hIL-4 [Bazan, Science
257:410 (1992); McKay, Science 257:412 (1992); Powers et al.,
: Science 256: 1673 (1992)], and assu~ning evolutionary conservation
of functionally important residues, hIL-4 residues E114, K117, and
Y124 were selected as those most likely to be speci~lcally involved
in receptor activation. Substitution mutagenesis a~ these positions
- 10 used a synthetically reconstructed hIL-4 coding region inserted in
the pTacRBS Escherichia coli expression plasmid [Zurawski et al., J. `
Immunol. 137:3354 (1986)]. Double-stranded synthetic
oligonucleotides (synthesizer and reagents, Applied Biosystems)
corresponding to the sequence between SalI and HindIII -recognition
sites in the C-terminal coding region and containing equimolar
amounts of each deoxynucleotide at the codon selected for
~; ra~ndomized substitution were ligated to SalI and HindIII digested
pTac-hIL-4 plasmid.
Recombinant plasmids were recovered by transformation and
the DNA sequence (Sequenase 2.0 kit, US Biochemical Corp.) of their
SalI-HindlII intervals were determined. Partially pure mutant hlL-4
proteins were preparod~ as described for mIL-2 proteins ~Zurawski
et al., EMBO J. 8:2583 (1989)], except that the refolding buffer
contained~ reduced and oxidized glutathione, and assayed using TF-1
~ ~ 2s cells. It was found that substitutions at Y124 resulted in proteins
-~ ~ that were; partial agonists and that the Y124D substitution had the
most drastic defect in cellular activation. During the course of this
work similar ob$ervations ~ere made by Kruse et al., supra, who
~ also showed that hIL-4.Y124D and hIL-4 have similar affinities for
- - 30 hIL-4R.
For production of pure hIL-4.Y124D, the pTrpC11-hIL-4 E. coli
expression plasmid was subjected to PCR (Geneamp kit, Perkin Elmer
Cetus) using the oligonucleotides:
~; CTCCAAGAACACAACTGAGAAGGAAACCIT (proximal to the single;~ 35 PstI res~ctionsiteinthecodingregionjand
"j: ~:
,
.,~,
`',
WO 94/04680 PCr/US93/0764
112
~4~8~
TTGAl~AAGCTlTCAaCI'CGAACAClTI`GAAT~ CI`C (a Hindm
recognition site precedes the underlined part which corresponds to
the C-terminal coding region containing a GAT codon for residue
124~. The PCR product and pTrpCl 1-hIL-4 plasmid were cleaved ~ -
with PstI and ~indIII, ligated, and pTrpC11-hIL-4Y124D plasmid
was recovered and validated by transformation and sequence
analysis using previously described methods [Zurawski et al., EMBO
J. 8:2583 (1989)]. Corresponding changes in hIL-13 at those
positions should also have IL- 13 antagonistic effects.
Purification of Proteins `~`
E. coli-derived hIL-4 ~van Kimmenade e~ al., Eur. J. Biochem.
-~ 15 173:109 (1988)], human interleukin-la (hIL-la; Kronheim et al.,
Bio/Technology 4:1078 (1986), and mIL-13 were purified as
described above. hII,-4Y124D was prepared from E. coli K12 cells
(strain CQ21) harboring the pTrpC1 1-hIL-4.Y142I) plasmid grown
overnight at 37C in 12 liters of L-Broth containing 50 ,ug/ml
ampicillin in a G S3 rotatory shaker (New Brunswick Scientific) at
200 rpm. The cells were ~iarvested ~y centrifugation in a RC-3
centrifuge (all rotors SoNall) at 4,500 rpm, 10 min, 4C. The pellets- -
- were resuspended in 450 ml of TE buffer (50 mM Tris-HCl pH 8,
1 mM EDTA) by shaking at 200 rpm for 15 min. Cells were ruptured
2s by 4 passes through an ice-cooled Microfluidizer model 110 cell ~ ~ ~--
disrupter (Microfluidics).
Inclusion bodies were collected by centrifugation in a GS-3
~, i
rotor at 9,000 rpm, 40 min, 4C. The pellet was then washed by - -
resuspension in 450 ml of TE and Triton X-100 was added to a ~lnal
` 30 concentration of 0.5%. Samples were kept at room temperature for- _
~ 30 min and were then pelleted in a GS~ rotor at 8,500 rpm, 10 min,; ~
- ~ ~ 4 C. The inclusion bodies were resuspended in 60 ml 5 M
~- ~ guanidine-HCl in PBS (120 mM NaCl, 2.7 mM KCl, 10 mM NaPi pH
7.4), 2 mM reduced glutathione, 0.2 mM oxidized glutathione and
,,.,-, ~ i
.
.
.
~:) 94~0468~ PCl`/US93J07645
113
~86o
any remaining insoluble material was removed by centrifugation in
a SS-34 rotor at 20,000 rpm, 30 min, 4C.
The supernatant was diluted 10-fold into the same buffer
without guanidine hydrochloride and stirred gently overnight at 4C
to permit refolding and oxidization. Concentration and exchange into
100 ml 50 mM Na Acetate pH 5.0 was then performed using a
Millipore Pellicon apparatus (Millipore) equipped with a tangential
flow ultrafiltration cassette with a size exclusion of 10 kDa. The
sample was subjected to anion exchange chromatography (CM
o sepharose 16/100 column, Pharmacia) in the same buffer with
elution via a 0-0.7 M NaCl gradient. Fractions containing hIL-4
protein were pooled and subjected to reverse phase chromatography
(Poros R 10/100 column, Perseptive Biosystems) with elution via a
gradient of 0-50% acetonitrile in 0.1% trifluoroacetic acid/water.
Fractions containing hIL-4 were lyophilized, dissolved in 50 mM Na `
Acetate pH 5.0, and quantified by densitometry (Molecular
~- ~ Dynamics) of stained SDS-PAGE with chicken egg lysozyme (Sigma)
as a standard.
;; ~ Cell Proliferation Assays
-~
Colorimetric cell proliferation assays used the human TF-l cell
- line at 30,000 cells per well for 3 days and were performed as
described by Mosmann, J. Immunol~ Methods 65:SS (1983). Cells
were assayed in RPMI medium with L-glutamine and 10% fetal
bovine serum (JRH Biosciences), 0.5 mM ,B-mercaptoethanol (Sigma).
; ~~ ~- 2s Cells were maintained in the above medium containing 1 nM hGM-
- -~ CSF (Schering-Plough).
PHA blasts were prepared by incubation of 106 peripheral
--i - blood mononuclear cells per ml with o.i mg/ml
s~--- phytohaemagglutinin (Wellcome Diagnostics) in Yssel's medium ~see
- ~ 30 Yssel e~ al., J. Immunol. Me~hods 72:219 (1984)~, supplemented with
- ~ 1% human AB+ serum in 24-well Linbro plates (Flow Laboratories)
- and were used in the proliferative assay after six days of incubation.
SP-B21 is a CD4+ cloned T cell line with unknown antigen specificity
and was cultured as previously described [Spits et al., J. Immunol.
. ~
"
:
WO 94/04680 PCl'/US93/0764'
114
2~2~'6
128:95 (1982)]. Proliferative responses of both PHA blasts and
~: SP-B21 cells were determined at 5 x 104 cells per well and were
pe*ormed and developed colorimetrically after three days as
described for TF-1 cells.
Li~and E~in~i~
Procedures for preparation of cells, separation of bound from
free ligand, ~computer analysis, and quantitation have been
described in Zurawski et :al., Eh~BO J. 11:3905 (1992). Ba/F3 cells
expressing ~ ~ surface hIL-4R-S protein (hIL-4R ligand-binding protein
0 deleted for most of the~intracellular domain) were grown as for TF-l
cells~ except that mouse interleukin-3 (IL-3, 100 U/ml) replaced
hGM-CSF and. 50 ~Lg/ml gentamycin sulphate (Sigma) and 800 ~lg/ml
~; Neomycin G418 (Schering-Plough) were added. .
l2~5I-:radiolabelling of E. :coli-derived hIL-4 and binding
s~ conditions~were~as~ dos~ribed in Harada et al., J. Biol. Chem.
.2,6, ~:~752 ~ (199~
Circular~ Dichroism S~ectrosco~y
Secondary ~structural features of hIL-4, hIL-la, and mIL-13
~"~ proteins were~e`x.amined: on a J720 spectrophotometer with the 450
20~ W~ xeno.n ~l~np~ data analysis software (Jasco). The sample`s ~ ,
a~inst~'~20~:mM~-~NaPi, pH 7. Proteid concentrations of ~~
.~ ~ were re-determined by UV absorptIoD scanning on a
Lambda: :~6~ spec:trophotometer ~ Perkin-Elmer). ~ Tho absorption -~
mal~imum ~a`t 280~ nm~:was ~used to calculate the amount of protein
~; , s us1ng~ theoret}ZZZcal extinction coeffictents based on known molecular ~ ~'
,wçigh.ts~and ~Zéxpccted~,~residue abs.orption contributions. Samples Z `
were diluted t o 0.2~ ~mg/ml in a 0.2 mm path length cell. - ~'
lypical: scan paran~eters for the near UV range were a ''
~"~ conlinoous~ wavelength~ scan at 10 mdeg sensitivity, 0.1 nm step = ~ ' -
30 -~rcsolution~at a~scan:speed of 50 nm/min with a time constant of 2 s.~ - ~~~
Z~
Four;: ~accumulations/,scàn were averaged for an increased signal to
noisc ratio. Phosphate~ buffer blanks were Nn and subtracted out~
04680 ~ Pc~r/US93/07645
115 60
from subsequent protein scans and the spectra were noise-reduced
using J700 data analysis software.
Mutant hIL-4 Anta~onist Bloçks IL 13 Action on TF 1 Cells !~.
In a search for mutant hIL-4 antagonists, it was noted that an
s Asp substitution at residue Tyrl24 of hIL-4 resulted in loss of
receptor-activation wiehout significant loss of receptor-binding. As
expected from these properties, hIL-4.Y124D was a competitive
antagonist of the action of native hIL-4 on TF-1 cells. TF-1 is a
human pre-myeloid erythroleukemic cell line that shows a growth
0 response to vanous human protein hormones, such as GM-CSF,
interleukin-3 (IL-3), interleukin-6 (IL-6), IL-4, and both human and
mouse IL-13. The maximal responses of T~-l cells to these factors
varies widely, but the maximal biological responses of IL-4 and
IL-13 are similar. hIL~.Y124D had no effect on the TF-1 responses
15 to GM-CSF, IL-3, or IL-6. In contrast, hIL-4.Y124D was a potent
antagonist of both mIL-13 and hIL-13 action on TF-~ cells.
hIL-4.Y12AD was equipotent against hIL-4, mIL-13, and hI~-13
activities on TF-1 cells and inhibited in a dose-dependent manner.
IL-13_Com~etitivelv InhibitsllIL-4 Bindin~ to 1~-1 Cells
Since hIL-4.Y124D antagonizes hIL-4 via competitive
inhibition of hIL-4 binding to IL-4R, a similar mechanism was
hypothesized for its action against IL-13. Such a mode of
hIL-4.Y124D action against IL-13 would imply commonalty between
~ ~ ~ IL~R and IL-13R. This was tested by comparing the abilities of
- ~ 25 hIL-4 and mIL-13 to competitively displace 125I-hIL-4 binding to
TFrl cells. hIL-4 fully competed 125I-hIL-4 binding to T~-l cells
~~ ~ with the concentration required for 50% inhibition (or IC50) - 2 x
~ 10-12 M. mIL-13 also competed 125I-hIL-4 binding. However,
compared to hIL-4, it could not completely displace 125I-hIL-4
~ ~ - 30 binding (~ 70% of the binding was displaced) and its IC50 value
(2 x 10-1 M) was higher.
WO 94~04680 PCI/US93/0764
116
9 ~ ~2'~
IL-13 Does Not Bind to the IL-4R Ligand-bindin~ Protein
A possible basis for the commonalty between IL-4R and
IL-13R is that they are the same. This was tested by comparing the
abilities of hIL-4 and mI~-13 to competitively displace Il 25-hIL-4
5 binding to a derivative of the cloned hIL-4R ligand-binding protein
expressed on mouse pro-B Ba/F3 cells. Ba/~3 hIL-4R-S cells were
used, which have a large number of binding sites/cell ~- 2000) in
the form of a hIL-4R ligand-binding protein deleted for most of
the cytoplasmic domain. See Harada et al., J. Biol. C~em. 267:22752
0 (1992). Although hIL-4 fully competed 125I-hIL-4 binding to
Ba/P3 hIL-4R-S cells with ICso z 2 x 10-1 M, even high levels of
mIL-13 (10-6 M) did not compete.
Some hIB-4-responsive Cell T~es Do Not Respond to IL-13
The earliest characterizations of the biological àctivities of
5 IL- 13 have shown concordance between cellular responses to IL-4
and IL-13, as described herein. Human peripheral blood
mononuclear cells ~PBMNC) activated with phytohaemagglutinin
(PHA) and certain human T cell cloned cell lines such as SP-B21
proliferate in response to hIL-4. Both these hIL-4-responsive cell
20 types did not proliferate in response to hIL-13.
The Binding Properties of hIL-4.Y124D and hIL-4
The binding of hIL-4 to Ba/F3 hIL-4R-S cells ~=1.6x10~10M~ - -
~` carresponded closely to that previously characterized for the high ~ ~
affinity IL-4R (Kd z 10-1 M). Human lymphoma Raji cells have -~ ~
~- ~ 25 high affinity binding sites for hIL-4 (Kd z 10-1 M; see ~ruse et al.,
supra, and hIL-4.Y124D protein binds to these cells with only a 3-
` ~ ~ fold reduced affinity compared to hIL-4. hIL-4.Y124D bound ~
-- ~ 3.5-fold less avidly to the hIL-4 binding sites expressed on Ba/~3 = ~
hIL-4R-S cells. ~ ~ i
T~-l cells bound hIL-4 with an apparent affinity that was
~50-fold higher than the "high affinity" binding of hIL4 to Ba/F3 ~
hIL-4R-S cells. This is surprising beca~se although comparisons
. .
,
". ~
~) 94/04680 PCl`/US93/0764
1 1 7
were done in parallel and used identical conditians and reagents,
these two cell types have been reported to have similar numbers of
- binding sites and affinities for hIL-4 as defined by equilibrium
binding studies. In contrast to the different binding affinities of
hIL-4 seen by competitive displacement binding studies,
hIL-4.Y124D bound equally to both TF-l and Ba/F3 hIL-4R-S cells.
In other experiments, hIL-4.Y124D was.used as the labelled ligand
and the results were analogous
IL-4 and IL-13 are Structural Homolo~ues
0 The commonalty between IL-4R and IL-13R prompted a close
examination of the sequence relatedness of IL-4 and IL-13. Only
the sequences of the mature human and mouse IL-4 and IL- 13
proteins were examined, while assuming that known disulfide
linkages for IL-4 are preserved for IL-13. There was significant,
although low (-30%) sequence homology between IL-4 and IL-13.
~he significance of this observation was increased when the known
structural features of hIL-4 were considered. All of the 25 residues
that contribute to the hIL-4 hydrophobic structural core were
conseNed or had conservative hydrophobic replacements in IL- 13 .
2 o Extensive insertion/deletion differences between IL-4 and IL- 13
were, with one exception~ confined to loops that connect the four
-~ - a-helices or two short ~-strands. The exception was a shortened
a-helîx C, although all the a-helix C residues that contribute to the
structural core were retained in IL-13.
Mouse IL-13, unlike the ~-stranded hIL-la, had a CD
- - - absorption spectrum characteristic of a highly a-helical protein such
as hIL-4 ~see Johnson, Ann. Rev. Biophys. Chem. 17:146 (1988)].
- The similarity in the two cytokines allow for modifications to
-; either cytokine to effect similar properties on the other. Thus,
-~: 30 insight into the mechanism of IL-4 antagonist with its receptor will
-- likely be useful in modulating IL-13 with its receptor. In particular,
-~ the present study provides locations in the IL- 13 molecule which
would be expected to lead to IL-13 antagonists~ Moreover, the
described IL-4 receptor would be expected to be modifiable while
WO 94/04680 PCr/US93/0764
retaining its IL- 13 antagonist activity. This would suggest that
shortening of the IL-4 antagonist would be useful while retaining its
antagonist function. In particular, specific regions of the cytokine
are suggested as useful to modify to achieve the desired biological
activity.
IL-13 and IL-4 Rece~tors_ are Functionallv Related
The observation that the hIL-4.Y124D antagonist
competitively inhibits the biological action on TF-l cells of both
hIL-4 and IL-13 demonstrates a relationship between IL-4R and
0 IL-13R. The ability of mIL-13 to compete for 125I-hIL-4 binding
to TF-l cells confirmed the commonalty of IL-4R and IL-13R. This
relatedness may also have been expected from the similar biological
responses known to be elicited by hIL-4 and IL- 13 and perhaps
~; from the close linkage of the IL-4 and IL-13 genes in both humans
and mice. See, e.g., Morgan et al., Nucleic Acids Res. 20:5173 (1992),
- and other experiments herein. A straightforward explanation ` of the
above observations would be that IL-4 and IL-13 act through the
same receptor.
~, ,
However, some cell types responded to IL-4 and not to IL-13.
20 - ~ This is prima facie evidence that IL-4R and IL-13R are different
entitie~s.; ~This does not exclude the possibility that IL-13 is a weak
partial agonist of IL-4 and that only a subset of IL~R-bearing cells --
can ~ efficiently amplify signals generated by IL-13 binding to IL-4R.
- ~; Three lines of evidence helped in resolving the conundrum involving
Y ~ 2s IL4R and ~ IL-13R.
Firs~ly, IL-13 failed to compete for I125-hlL-4 binding to cells
~ ~ bearing only the hIL-4R ligand-binding protein. This result
- ~ ~ demonstrated that the hIL-4R ligand-binding protein is, itself, not ~-~
the IL-13R. Secondly, two T cell types responded to hIL-4, but not - -~-~
to hIL-13. If hIL-13 is a partial agonist acting via hIL~R, then ~ ----
hIL-13 should competitively antagonize the action of hIL-4 on these ~- -
cells. This is not the case in one hIL-4-responsive T-cell system
~ ~ that has been tested. Thirdly, if hL-13 is à partial agonist acting
5 ~ via hIL-4R, then hIL-13 should be capable of fully competing hIL-4
.,., ~ .
,,;"~
, ,, ~ .
.,.
,,
~ 94/04680 ~? PCI /US93/0764~
1 1 9 ir5~
6'o
binding to all cell types bearing hIL-4R. However, IL-13 only
partially competed for binding of 125I^hIL-4 to TF-1 cells.
The conclusion from the above three lines of evidence is that
IL-13 is not a partial agonist of IL-4 and that IL-4R and IL-13R a~e
5 different. On TF-1 cells, mIL-13 competed hIL-4 binding and
hIL-A.Y124D antagonized the action of IL-13. These data compel a
further conclusion that IL-4R and IL-13R have a functionally
important receptor component in common. This conclusion is
contrary to a consensus that the IL-4R ligand-binding protein itself
0 has all of the functional properties of IL-4R. IL-4R complexity is
suggested by studies that find proteins associated with the IL-4R
1 igand-binding protein. Also, kinetic studies of soluble natural
mouse IL-4R ligand-binding proteins indicated that membrane-
bound functional IL-4R/IL-4 complexes were more stable than
5 soluble IL-4R/IL-4.
Functional IL-4R Contains an Additional Subunit(s) that Enhances
Affinitv.~ Hel~s Transduce the Signal. and is Shared with IL-13R
Two results from receptor-binding analyses show that IL-41~ i
on TF-l cells are complex and can exist in a higher affinity state
2 o t han thought ~ previously. Firstly, the apparent affinity of hIL-4 for
4R on 'rF-1 cclls was -50-fold greater than for the cloned
- hIL-4R lîgand-binding protcin on Ba/F3 IL-4R-S cells. The~hIL-4
inding sitcs- on BalE:3 IL-4R-S cells were the typical 'high affinity'
IL-4R that are presont on many cell types. Dissociation constant
25 ~--estimates for binding of hIL-4 to hIL-4R commonly vary somewhat,
bot--fall within a 5-fold range of Kd-10-1 M.
Because the experiments were parallel, replicated
independently,l used the same reagents and cells with similar IL-4R 3
: numbers, and gave analogous results using a different labelled
.. , ~ , ..
3Q_ ligand, the "higher affinity" hIL-4 binding detected on IF-l cells
should be significant. Secondly, while it bound with only a slightly
- reduced affinity to IL-4R ligand-binding protein expressed on Ba/F3
~- celIs, hIL-4.YI24D bound to IL-4R on TF-l cells with an affinity ~50-
fold less than did hIL-4. In essence, this result provided an internal
35 control to confirm the "higher af~lnity" hIL-4 binding detected on
` ~
, ~
WO 94J04680 PCI`/US93/0764
120
U
TF-l cells. Since the hIL-4R ligand-binding protein cDNA was cloned
from T~- 1 cells, it is unlikely that an unusual IL-4R ligand-binding
protein accounts for the above results.
A model that does account for the above observations is that
5 functional IL-4R on TF-l cells are a complex between the IL-4R
ligand-binding protein and an additional component (or
components) that enhances the affinity of the IL-4R ligand-binding
protein for IL-4. This additional component(s) also associates with
an IL-13 ligand-binding protein present only on a subset of IL-4-
0 responsive cells to form IL-13R. Furthermore, interaction of hIL-4
Tyrl24 residue with this component is essential for productive
signal transduction.
Nevertheless, hIL-4.Y124D, which fails to elicit this productive
signal transduction, maintains an association between the IL-4
;5 ligand-binding protein and this additional component(s); In this
mo~el. hIL-4.Y124D antagonizes hIL-4 action by competing for IL-4
binding~ sités, but antagonizes IL-13 action by sequestering the
addidonaI component(s) from the IL-13R complex by forming a non-
prodyctive hIL-4R/hlL-4.Y124D complex.
20 Past Failures tO Co~rectly Define IL-4R and Pro~osed Tests of the
New Model
. , ;
TWQ: factors may have contributed to past failures to recognize
`, t he ~'higher af&ity' state of IL-4R that were detected on TF-l cells.
Firstly, the integrity of the hIL-4 Tyrl24 residue is now known to
25 ~be vîtal~for this 'higher affinity' binding (this is also the case for the
-: ~ analogous Tyrll9 residue of mIL-4 where substitution with Asp
-~ resulted in a potent competitive antagonist of mIL-4 biological'action~. Thei standard procedure for radio-labelling IL-4; was`via
s~-~ iodination of Tyr residues. There are only two Tyr residues in
30 hIL-4, thus it is probable that labelling hIL-4 converted Tyrl24 to
iodotyrosine.
Indeed, hlL-4.Y124D labelled with the Bolton-Hunter reagent
bound about 3-fold less efficiently than hIL-4. It is possible that
hIL-4.Y124iodoTyr has a reduced affinity for functional IL4R and
35 that affinity constants derived using this reagent in direct-binding
~, ~
94/04680 ~ PCI /US93/0764
1 2 1
~0
experiments have underestimated the actual affinity of IL-4R for
IL-4. This was not an issue in the experiments which used
hIL-4.Y 1 24iodoTyr as the labelled-ligand and native hIL-4 as a
'cold' competitor. A second factor that may have hindered the
discovery of two affinity states for IL-4R is that the difference
between the two affinities is only -50-fold. Thus, if cells have a
mixture of IL-4R in both states, or if the 'lower affinity' state
predominates, then two affinities may be impossible to recognize
separately using conventional methods. The hIL-4R subunit-specific
- 10 defect of hIL-4.Y124D is a powerful new reagent for dissection of
hIL-4R complexity.
The notion that IL-4-responsive cell types vary in IL-4R
composition is being tested. Other direct tests of this model will
require molecular characterization of the IL- 1 3R ligand binding
s protein by binding analyses, cross-linking studies, and cloning.
However, the reagents to permit direct characterization of IL- 1 3R
. have not yet been developed. The very low affinity (~- 3x10-8M)
IL-4-binding sites that have been detected on human lymphocytes
may be a property of an additional IL-4R component.
¦~ 20 Common Subunits in Other Cytokine Receptors
~ , ,
-- - The molecular nature of the functionally important receptor
c~mponent in common bet~veen IL-4R and IL-13R is unclear. The
- above model to account for our data is based on the existence of
- other affinity-modulating proteins that are obligatory components
2s share~~between several functional cytokine' receptors. Such shared
components have been discovered in receptors for IL-6, alcostatin-M,
leukemia inhibitory factor, and ciliary neurotrophic factor, which all
' share'~~gp130 [see Kishimoto et al., Science 258:593 (1992)], as well as
- for ' human IL-3, interleulcin-5 (IL-5), and GM-CSF receptors, which
all_share the ~c protein [Miyajima et al., Trends ln Biochemical
: Sciences -17:378 (1992)].
This shared ~c receptor subunit accounts for the observed
~ ~ - cross-competition of IL-3, IL-~, and GM-CSF binding to certain cell
;: types. When assayed on TF-l cells, hIL-4.Y124D did not antagonize
WO 94/04680 PCI'/US93J0764'
122
,6~
the biological activities of hIL-6, mouse leukemia inhibitory factor,
hIL-3, or hGM-CSF, and neither hI~-6 or hGM-CSF competed for
hIL-4 binding. Therefore, gpl30 or the ~c protein are not likely
candidates for the additional IL-4R component, nor the component
5 shared between IL-4R and IL- 1 3R.
On the basis of their common genetic locations/structures and
relation in protein structure,`it has been proposed that IL-4, IL-3,
IL-S, and GM-CSF form a protein family. See Boulay et al., J. Biol.
Chem. 267:20525 (1992). The biological data regarding commonalty
0 between IL-4 and IL-13 show that IL-13 also belongs to this family.
However, the available data support a clear functional separation
between the receptors for IL-4/IL-13 and IL-3/IL-5/GM-CSF. For
example, no effects of hIL-4.Y124D on IL-3 or GM-CSF responses on .!'
TF-l were noted. Also, in T~-l cells the pattern of intracellular
lS tyrosine-phosphorylation that is elicited by - IL-~/GM-C~F is
different from that elicited by IL-4.
Im~cations of Jointb Anta~onia ing IL-4 and IL- 13 Res~onses I n Vrvo
The ability of the hIL-4.Y124D antagonist to act against both
hIL-4 and hIL-13 biological responses should provoke a reappraisal
of the therapeutic potential of hIL-4.Y124D. These results show
that, unlike soluble IL-4R ligand-binding protein or anti-IL-4
antibodies, hIL-4.Y124D is not a specific antagonist of hIL-4 action.
Inhibitory IL-4 variants have been suggested as potentially useful
drugs in the treatment of IgE-mediated discases. The possibility
~-; 25 exists for antagonizing~ both hIL-4 and hIL-13 responses by
hIL-4.Y124D treatmeni for various disease states. The structural
homology between IL-4 and IL-13 and sharing of receptor
subunit(s) between IL-4R and IL- 1 3R suggest that particular IL- 13
residues within a-helix D are specifically important for receptor
signaling and that substitutions in these residues may result in :
- IL-13 variants that are antagonists. These results also predict that
such IL- 13 antagonists will be effective antagonists against IL-4-
responses on cell types that also respond to IL-13.
~, ~
~; Antagonistic Effect on Other IL-13 Activities
. ~ ~
, - . I
94/04680 PCrtUS93/07645
123 ~
~0
Results with cocultures of highly purified B cells and activated
T cell clones with 400 U/ml IL-4 showed inhibition of IgE synthesis
by the IL-4 antagonist used at 10 ~g/ml. See Tables 16 and 17. The
assay was as described abo~e for IgE synthesis. '-
0 Table 16: Induction of IgESynthesis by Ik4, I~- 13 and IL~4-Mutant Protein
1 .
IgE SYnthesis (n~/ml)
.
~Medium <0.2
-~ 15 IL-4 (200 U/ml) 173+45
13 (200 U/ml) 110+42
IL-4-Antagonist (Y. 1~4, 1 mg/ml) 13+6
Mock-control c0.2
2 ~
Table 17~ 4-Mutant Protein Inhibits IL-4-Induoed IgE~ynthesis by PBMC
~, . .
E Svnthesis (n~/ml~
, :. - - - -
2s Medium <0.2
- II~-4- (50 U/ml) 265_49
-- - -- IL-4 (50 U/ml)+Y.124 (0.003 mg/ml) 108+60
- ~ ~ IL-4 (50 U/ml)+Y.124 (0.03 mg/ml) 12+54 (50 U/ml)+Y.124 (0.3 mg/ml) 12+3
o---IL~ (50 U/ml)+Y.124 (3 mg/ml) 5+2
- ~IL-4 (50 U/ml)+Mock-control 194_46
~" -
Il,-4 antagonists like Y124 also effectively inhibited the
proliferation of purified human B cells stimulated by anti--CD40
WO 94/1)4680 PCI /US93/0764'
~Q~ 124
mAbs in the presence of either II,-4 or IL- 13 . IL- 13 antagonists
may have similar effects. Thus, administration of IL-4 and IL- 13
antagonists may provide the preferred mehtod not only to inhibit
IgE syn~hesis, but also to prevent the expansion of IgE producing
cells.
VII. Antibodies tQ Human IL- 13
Ra~ polyclonal antiserum was raised against E. coli-derived
human IL-13 by standard procedures. See, e.g., Harlow & Lane
0 (1989) or Coligan (1991 and supplements). Serum from these rats
was useful in immunoprecipitating 3 5 S-methionine labelled
supernatants of C0S7 cells expressing IL-13.
Monoclonal antibodies against hIL-13 were produced using
standard methods. Rats were immunized with E. coli-produced
hIL-13. The neutralizing capability of four different monoclonal
antibodies were tested on TF- 1 cells stimulated with COS-producèd
hIL-13 or E. coli-produced hIL-13. The TF-1 cells (5,000 cellslwell~
were incubated for 72 hours with 1:100 dilution of COS-produced
hIL-13 or 5 ng/ml E. coli-produced hII.-13, with dilutions for
supernatants containing rat anti-hIL-13 Monoclonal antibody. After
72 hours, cell viability was determined by alamar blue staining.
To determine which monoclonal antibodies from the above
spleen-hybridoma fusions bind to hIL-13 produced from COS or E.
coli, an ind*ect ELISA was pe~formed. PVC microtier plates were
coated for 2 hours with either 0.5 ~g/ml E. coli-produced hI~-13 or
a 1:15 dilution of COS produced hIL-13 in PBS at 37 C. A standa~d
ELISA protocol was used. Specific binding was observed in both
cases.
Many modifications and variations of this invention can be
made without departing from its spirit and scope, as will become
apparent to those skilled in the art. The specific embodiments
described herein are offered by way of example only, and the
invention is to be limited only by the terms of the appended claims.
~) 94/04680 PCr/US93/07645
125 ~
~0
SE~QUENCE LISTIN~
( 1 ) GENERAL INFORMATION:
~.
5 (ij APPLICANT:
(A) NAME: Schering Corporation
(B) STREET: One Giralda Farms
(C) CITY: Madison
(D) STATE: New Jersey
- 10 (E)COUNTRY: U.S.A.
(F) POSTAL CODE (ZIP): 07940-1000
(G) TELEPHONE: 201-82~-7375
(H) TELEFAX: 201-822-7039
(I) TELEX: 219165
(ii) TITLE OF INVENTION: Human Interleukin-13
(iii~ NUMBER OF SEQUENOES: 6
2 o (iv) COMPUTER READABLE ~ORM:
(A) MEDIUM TYPE: Floppy disk
(B) COMPUTER: Apple Macintosh
(C~ OPERA~G SYSTEM: Macintosh 6Ø5 - j
(D) SOPTWARE: Microsoft Word 5.1a
2s
(v) CURRENT APPLICATION DATA:
(A) APPLICATION NUMBER:
(B) FILING DATE:
. . .
- 30 (vi) PRIOR APPLICATION DATA:
(A) APPLICATION NUMBER: US 08/012543
~- ~ (B) FILING DATE: 01-FEB-1993
(vi) P}~IOR APPLICATION DATA:
(A) APPLICATION NUMBER: US 08/010977
(B) FILING DATE: 29-JAN-1993
:
WO 94/04680 PCr/US93/~764
1 2 6
6~
(vi) PRIOR APPLICATION DATA:
(A) APPLICATION NUMBER: US 07/933416
(B) EILING DATE: 21-AIJG-1992
(2) ~ORMATION FOR SEQ ID NO. 1:
(i) SEQUENCE CHARACI'ERISTICS:
(A) ~ F~NGTH: 1290 base pairs
0 (B) TYPE: nucleic acid
(C) STRA~EDNESS: double
(D) TOPOLOGY: linear
(xi) SEQVENOE DESCRIPIION: SEQ ID N.O:l:
:.
TCC GCrCCTC~ ccTcTccrGT T~Gc~crGGG CCTC ~rG GCG cTr TTG 56
. M~t Ala Leu Leu
TTG ACC ACG GTC ATT GCT CTC A~r TGC CTT GGC GGC T~ GCC TCC CCA 104
Leu Thr mr Val Ile Ala Leu mr Cys Leu Gly Gly Phe Ala Ser Pro
. 5 10 15 20
GCC CCT GTG CCT CCC TCT A~ GCC CTC AGG GAG CTC ATT GAG GAG CTG 152
~- Gly Pro Val Pro Pro Ser Thr Ala Leu Arg Glu Leu Ile Glu Glu Leu 25 30 35
GTC AAC AIC ACC CAG A~C CAG AAG GCr CCG crc TGC A~r GGC Af~C ATG 200
Val Asn Ile Thr Gln Asn Gln Lys Ala Pro Leu Cys Asn Gly Ser ~et
40 -. 45 50
GT~ TGG A~;C ATC AAC CTG ACA GCT GGC ATG TAC TGr GCA GCC crG G~A 248
- Val Trp Ser Ile Asn Leu rhr Ala Gly Met Tyr Cys Ala Ala Leu Glu 55 60 6S
TCC CTG ATC AAC GTG TCA GGC TGC AGT GCC ArC GAG AAG ACC CAG AGG 296
Ser Leu Ile Asn Val Ser Gly Cys Ser Ala Ile Glu Lys Thr Gln Arg
70 75 80
ATG CTG AGC GGA TTC TGC CCG CAC AA~; GrC TCA GCr GSG CAG m TCC 344
~bt Leu Ser Gly Phe Cys Pro His Lys Val Ser Ala Gly Gln Phe Ser
85 90 95 100
~- A~;C TTG CAT GTC CGA GAC ACC AAA ATC GAG GTG GCC CAG m GTA A~G 392 ~- I
- Ser Leu His Val Arg Asp Ihr Lys Ile Glu Val Ala Gln Phe Val Lys
1~5 110 115
GAC CTG CTC TTA QT TTA AAG A~A CTT m CGC G~G GGA CGG TTC A~C 440
Asp Leu Leu Leu His Leu Lys Lys Leu Phe Arg Glu Gly Arg Phe Asn
120 125 130
~94~04680 ~ P~T/US93tO764
127 ~ ~
TGPaACTTCG PP2~CA3C~ TAITTGCaGA GACPGGACCT GACTATTGAA GTTGCAEPIT 500
CAIITTTCTT TCTGAIGTCA AAaA~GTCTT GGGTAGGCGG GAAGGA~GGT TA{GGAGGGG 560
TAAAAITCCT TA~CTTAGAC CTCACCCTGT GCTGCCCGTC TTCh~CCTAC CCGACCTCAG 620
CCTTCCCCTT GCC ~ CASCCTGGTG GGCCTCCTCT GTCCAGGGCC CTGAECTCGG 680
TGGACCCAGG GalGaC~GT CCCTACACCC CTCCCCTGCC CTh~ASCACA CTGT ~ T 740
A~AGTGGGTG CCCCTTGC CAGACA5GTG GTGGGACAGG G~CCCACTTC ACACP~AGGC 800
AaCTGaGGCA GACaGCAGCT CAGGCACACT TCTTCTTGGT CTTATTTATT ATTGTGTGTT 860
A m AA~G~ GTGTGTTTGT CACCGTT~&G G~IIGGGC-AA GACTGTa~CT GCTGGCACTT 920
GGA~CCAAGG GTTChGAGAC TCAGGGCCCC AGCACTAAAG C~GTGGACCC CAGCi~GTCC~ 980
TGGTA~TAAG ThCTGTGTAC h-~AATTCTGC TACCTCACTG GGGTCCTGGG GCCTCGGA~C 1040
CIC~ICCG~G GCAGGGTCAG GaCa3GGGC~ GAA~AGCCGC TCCTGTCTGC CAGCCAGCAG 1100
CCAGCTCTC~ GCCA~CG~GT A~TTTA~TGT TTTTCCTCGT ATTTA~ATAT TAAATATGTT 1160
hGCaAAG~GT TAA~ATATAG AAGGGTACCT TGAA~C~GG GGG~GGGGAC ~TGA~AAG 1220
TlGTll Q IT GACTa~CAAA ~ CCAG AAATAAAGTT GGTGACPGaT APaAA~AAAA 1280
~ 1290
(2) INFORMATION FOR SEQ ID NO:2
- 35 (i) SEQIJENOE OE~AFL~C~ERISTICS:
(A) LENGTH: 132 amino acids
(B) TYPE: amino acid
(D) TOPOLOGY: linear
(ii) MOLECULE TY~E: protein
,
- ~ ~ (xi) SEQUENC]E D~SCRIPIION: SEQ ID NO:2:
- Met Ala Leu Leu Leu Thr Thr Val Ile Ala Leu Thr Cys Leu Gly Gly
. . 45 1 5 10 15
~:~ Phe Ala Ser Pro Gly Pro Val Pro Pro Ser Thr Ala Leu Arg Glu Leu
20 25 30
Ile Glu Glu Leu Val Asn Ile m r Gln Asn Gln Lys Ala Pro Leu Cys
W O 94/04680 PCT/US93/0764j
~ 6~ 128
Asn Gly Ser Met Val Trp Ser Ile Asn Leu Thr Ala Gly M~t Tyr Cys
Ala Ala Leu Glu Ser Leu Ile Asn Val Ser Gly Cys Ser Ala Ile Glu
Lys Thr Gln Arg M~t Leu Ser Gly Phe Cys Pro His Lys Val Ser Ala
Gly Gln Phe Ser Ser Leu His Val Arg Asp Thr Lys Ile Glu Val Ala
100 105 110
Gln Phe Val Lys Asp Leu Leu Leu His Leu Lys Lys Leu Phe Axg Glu
115 120 i25
Gly Arg Phe Asn
130
(2) INFORMATION FOR SEQ ID NO:3:
~i) SEQUENOE CHARACI~ERISTICS:
~A) LENGTH: 1212 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: double
(D) TOPOLOGY: linear
(xi) SEQ~CE DESCRIPIION: SEQ ID NO:3:
G~CC~G C~GCCTA~;GC CAGCCCACAG TT~TACAGCT CC~ C5~ 60
~GGGClSC ATG GCG CTC TGG GTG ACT GC~ OEC CTG GCI CTT GCT TGC 108
Mbt Ala Leu Trp Val Thr Ala Val Leu Ala Leu Ala Cys
1 S 10
CTT GGT GGT CTC GCC GCC CCA GGG CCG GIY~ cca AE;A TCT GrG TCT crc 156
Leu Gly Gly Leu Ala Ala Pro Gly Pro Val Pro Arg Ser Val Ser Leu
15 20 25
c~r CTG ACC CTT AAG G~G CTT ATT GAG GAG CTG AGC AAC ATC A~A QA204
Pro Leu Thr Leu Lys Glu Leu Ile Glu Glu Leu Ser Asn Ile Thr Gln --:
30 35 40 45
G~C C~; ACT CCC CTG TGC A~C GGC AGC ATG GTA TGG AGT GTG. GAC CTC, 252 _ .
Asp Gln Thr Pro Leu Cys Asn Gly Ser Met Val Trp Ser Val Asp Leu
50 55 60
GCC GCr GGC GGG ITC TGT GTA GCC CrG GAT TCC CTG ACC AhC ATC TCC300
50 Ala Ala Gly Gly Phe Cys Val Ala Leu Asp Ser Leu ThL Asn Ile Ser
. 75
94/~4680 PCT/US93/0764
129
~ o
AAT TGC AAT GCC ATC TAC A~G ACC CAG AGG A~A TTG CA~ GGC CTC TGT 348
Asn Cys Asn Ala Ile Tyr Arg Thr Gln Arg Ile Leu His Gly Leu Cys
AhC CGC AAG GCC CCC ACT ACG GTC TCC A~C CTC CCC GAT ACC AAA ATC 396
Asn Arg Lys Ala Pro Thr Thr Val Ser Ser Leu Pro Asp mr Lys Ile
100 105
GAA GIA GCC CAC m ATA A~ AAA CTG CTC AGC TAC A~A A~G Q A CTG 444
Glu Val Ala His Phe Ile Thr Lys Leu Leu Ser Tyr Thr Lys Gln Leu
110 115 120 125
m CGC CAC GGC CCC TTC TAaI~AGGAG AG~CC~TCCC TGGGCA~CI~ 492Phe Axg His Gly Pro Phe .
130
AGCTGTGGaC TCATTTTCCT TTCTCALAIC AG~CTTTGCT GGGGAA~GC AGGGAEGaGG 552
;~
GTTGaGG~GG A~GGG~GAIG CCTCA~CTTT GGCCTCAGCC TGCA¢TGCCT GCCTACTGCT 612
CAGGr~DCTC~ GCCTG-~CAAC A~CCCCACCC CACCCCCA~C CCCGCCGCCC CA~CCCATCC 672.
CTA~AGAAA~ CTGCAGCAAG A~CGTGAGTC CA~CCT&TGG CCTGGTCCAC A~AGGGCAAC 732
: 25
TGAGGCAGGC AGChGCTDGA GrACAlllCT TCTTGATCTT A m ATTAIG ~'ll~l~l~ll 792
A~ITAAA~GA GTCTGTCAGT AICCCGGTGG Gr~AC~TGGTT TGCTGCC~T GCCCTGGGGG 852
~-30 CTCC~CA~T GAAGCAGTGG GCTCTGGGGT CCCTGGCAAT A~TAfTGTAT ACATAA2TCT 912
: GCTACCTCAS TGTACCCTCC AGGTCTCACC CCAGGrAGGA GATGr~GAGGG GAGGCC~G~G 972
CAACACTCCT GICTGCCA~G GCaGCAACCA GCCCTC~GCC AlYaAATAAC TTAII~ T-1032 ~--
3S
GTl~-lATAT TTAAAGTATT AAAI~GC~TA GCaAAGaG~T AATAATA~AT GGAAEAATGG 1092
CCTGTTaC~C TCA~GGTG~T &~GTA~IG~A TGGGGG~-aGG GTGGTGr~GTT TGTCACTGAA-li52-
CAAACTITTC ATTGACTGTC AAACTA~AAA CCGG~AA~AA AGATGGTGAC A~A~AAAAAA 1212
(2) INFORMATION FOR SEQ ID NO:4:
(i) SEQUENOE CHARACTERISTICS: i;
(A) LENGTH: 131 amino acids
(B) TYPE: amino acid ~- - ~~~~~ ~~
(D) TOPOLOGY: linear
: (ii) MOLECULE TYPE: protein
~' 50
(xi3 SEQUENCE DESCRIPIION: SEQ II) N~:4:
W O 94/04680 PCT/US93/~764
130
~ 4 ~6~
Met Ala Leu Trp Val Thr Ala Val Leu Ala Leu Ala Cys Leu Gly Gly
1 5 10 15
`.
Leu Ala Ala Pro Gly Pro Val Pro Arg Ser Val Ser Leu Pro Leu Thr
20 25 30
Leu Lys Glu Leu Ile Glu Glu Leu Ser Asn Ile Thr Gln Asp Gln mr
35 40 45
Pro Leu Cys Asn Gly Ser Met Val Trp Ser Val Asp Leu Ala Ala Gly
Gly Phe Cys Val Ala Leu Asp Ser Leu Thr Asn Ile Ser Asn Cys Asn
Ala Ile Tyr Arg Thr Gln Arg Ile Leu His Gly Leu Cys Asn Arg I.ys
- Ala Pro Thr Thr Val Ser Ser Leu Pro Asp Thr Lys Ile Glu Val Ala
100 105 110
Hi~ Phe Ile Thr Lys Leu Leu Ser Tyr Thr Lys Gln Leu Phe Arg His
~5 115 120 125
Gly Pro Phe
130
(2) INFORMATION FOR SEQ ID NO:5:
(i) SEQU~CE C~ERISTICS:
- ~ (A) LENGTH: 35 base pairs
(B) TYPE: nucleic acid
(C~ STRANDEDNESS: single
(D) TOPOLOGY: linear
(xi) SEQUENOE DESCRIPTION: SEQ ID NO:5:
ACAGCTCGAG CCATGGTGTC TTTGCCTCGG CTGTG 35
(2) INFORMATION FOR SEQ ID NO:6:
(i) SEQU~OE CHARACIERISTICS:
4s (A) LENGTH: 36 base pairs
(B) TYPE: nucleic acid
~C~ STRANDEDNESS: single
(D) TOPOLOGY: linear
- - ~o
(~i) SE~ ~D~SC~P~O~-: S~Q ~) YO:c:
~v~^~t~ ~ 3 6
;
. ~ .
.:
'
r.. ~
' ', ~ ~ ' '
,., ~ , - : - .
.
. ,~ ~ . .
:
.,; ~.
~ ~ , _ .. ...
'.5'~
~j "": '
A~lENDED S'rlE~
~'
.,~
