Note : Les descriptions sont présentées dans la langue officielle dans laquelle elles ont été soumises.
~ 094/09143 21 ~ 61 1 3 PCT/EP93/02875
Genetic noderation or restoration of plant phenoLy,~
FT~Tn OF THE lN V~N~l~10~
The present invention relates to genetically transformed
plantsO methods for obt~ining genetically transformed plants
and recombinant DNA for use therein. The invention further
relates to a method for restoring a plant phenotype previous-
ly altered due to the expression of a transgene in thatplant.
BACKGROUND ART
T~e European Patent Application 344 029 A2 describes a
method for restoring male-fertility in plants that are male-
sterile due to the expression of a first transgene encoA;ng
R~rn~ in the tapetal cell layer of said plants, which
method comprises the introduction into the same plant of a
secon~ transgene encoding Barstar which is expressed at least
in all those cells wherein the first transgene is expressed.
In the Barnase/Barstar syste~ for altering and restoring
plant phenotype the first transgene, the Barnase gene is
believed to interfere with a large number of endogenous gene
products in a non-specific way, rather than by interaction
with a preselected endogenous gene product. The restoration
of male-fertility i8 based on a direct interaction of Barstar
with Barnase. In general terms, fertility restoration accor-
ding to this system is based on direct interaction of the
restoration gene product with the sterility gene product in
the plant cell. This is one of the best described phenotype
restoration systems known in the art. However, a drawback of
the R~rn~-~e/Barstar system is that its application is limited
to phenotypes which allow disruption of cell structures by
cell death. Phenotypes that re~uire more subtle modification
of plant ce_l functioning, such as alteration of flower
colour, fruit ripening, and the like, are outside the scope
of this system.
Many systems for altering plant phenotypes are based on
inhibition of endogenous plant genes. Examples thereof
include but are not limited to disease-resistance, flower co-
lour, fruit-ripening, male-sterility, and the like. It is an
object of the invention to provide a phenotype restoration or
moderation system that can be used when plant phenotypes have
, .'. ~
WO94/09143 2 i 4 61 l 3 - 2 - PCT/EP93/02 ~
been altered due to the expression of a transgene capable of
inhibiting expression of a particular endogenous gene.
SUMMARY OF THE INVENTION
The present invention provides a process for the resto-
ration of a plant phenotype that is altered due to a first
transgene which when expressed inhibits expression of an
endogenous plant gene, by introducing into said plant, or
progeny thereof, a second transgene which when expressed is
capable of neutralising or partially neutralizing the effect
caused by the first transgene, whereby said second transgene
is expressed at least in those cells involved in the altered
phenotype. Preferred in a process according to the invention
is a second transgene which encodes a protein or polypeptide
gene product that is capable of substituting the function of
the protein or polypeptide product encoded by the said
endogenous gene and wherein the nucleotide sequence identity
of the transcripts encoded by the second transgene and the
first transgene is less than 90%, preferably less than 80%,
yet more preferably said second transgene encodes a protein
or polypeptide gene product that is not identical in amino
acid se~uence to the endogenous gene product and wherein the
nucleotide sequence identity of the transcripts encoded by
the second transgene and the first transgene is less than
75%. According to a special preferred embodiment said second
transgene is obtainable from a different plant species.
The invention further provides a process for the resto-
ration of fertility in a plant that is male-sterile due to a
first transgene which when expressed inhibits expression of
an endogenous plant gene required for pollen development or
functioning, by introducing into said plant a second trans-
gene capable of neutralising the effect caused by the first
transgene, whereby said second transgene is expressed in all
cells in which the first transgene is expressed. Preferred in
a process according to the invention said second transgene
encodes a protein or polypeptide gene product that is capable
of substit~ting the function of the protein or polypeptide
product encoded by the said endogenous gene and wherein the
nucleotide sequence identity of the transcripts encoded by
21~ ~113 PCT/EP93/02875
- 3 -
the second transgene and the first transgene is less than
90~ , preferably less than 80%, more preferably said second
transgene encodes a protein or polypeptide gene product that
is not identical in its amino acid sequence to the endogenous
gene product and wherein the nucleotide sequence identity of
the transcripts encoded by the second transgene and the first
transgene is less than 75%.
According to a special preferred embodiment said second
transgene is obtainable from a different plant species.
According to a special embodiment the process according
to the invention said first transgene is an antisense gene
which when expressed inhibits expression of an endogenous
flavonoid biosynthesis gene and said second transgene encodes
a flavonoid biosynthesis enzyme capable of substituting the
function of the corresponding flavonoid biosynthesis enzyme
encoded by the said endogenous gene. Preferred according to
this embodiment is a first transgene which is an antisense
gene inhibiting expression of an endogenous chalcone synthase
gene and said second transgene encodes a chalcone synthase
- 20 capable of substituting the function of the chalcone synthase
encoded by the said endogenous gene. Especially preferred
first transgenes and second transgenes for the restoration or
moderation of male-fertility are those obtA;n~hle from table
1 in this specification.
Preferred in a process according to the invention is the
process wherein said second transgene is introduced intc the
progeny of said plant by cross-pollination of a parent of
said plant with pollen comprising said second transgene.
The invention further provides a process for ob~;n;ng
fertile hybrid seed of a self-fertilizing plant species,
comprising the steps of cross-pollinating a plant S which is
male-sterile due to a transgene which when expressed inhibits
expression of an endogenous gene required for normal pollen
development or functioning, with a plant R which is male-
fertile and comprises a transgene that encodes a protein orpolypeptide product capable of substituting the function of
the protein or polypeptide product encoded by the said
endogenous gene. Preferred according to this process is a
first transgene which is an antisense chalcone synthase gene,
WO94/09143 214 61 1~ . PCT/EP93/02 ~
the endogenous gene is a chalcone synthase gene, and the
second transgene encodes chalcone synthase, wherein the
nucleic acid sequence identity of the transcripts encoded by
the second transgene and the first transgene is less than
90%, preferably less than 80%, more preferably less than 75%.
The invention also comprises fertile hybrid seed
obtained by a process according to the invention, as well as
plants obtained from fertile hybrid seed, as well as parts of
the plants, such as a bulb, flower, fruit, leaf, pollen, root
or root culture, seed, stalk, tuber or microtuber, and the
like.
The invention further comprises plants, as well as parts
thereof, which harbour a chimeric gene which when expressed
produces a protein or polypeptide product capable of substi-
tuting the function of a polypeptide or protein encoded by anendogenous gene of said plant, wherein the nucleotide
sequence identity of the transcripts encoded by the transgene
and the endogenous gene is less than 90~, preferably less
than 80%, more preferably less than ?5%.
D:E:SCRIPTION OF THE FIGURES
Figure l. A representation of plasmid MIP289 harbouring
an expression cassette with multiple cloning site, which can
be suitably used to insert foreign genes and antisense genes
for expression in anthers of plant cells; CHI PB: chalcone
isomerase B promoter; NOS tail: transcription termination
signal derived from the nopaline synthase gene of Aqrobacte-
~ium.
Figure 2. Same plasmid as in figure l, wherein the
expression cassette contains a hybrid promoter based on the
35S promoter of cauliflower mosaic virus, and a so-called
anther box (for details of promoter, vide Van der Meer, et
al, 1992, sub)
Figure 3. Crossing scheme for obtaining fully male-
fertile hybrid seed according to the invention; plant S(Ssrr): maternal male-sterile line keterozygous for the
sterility gene which when expressed inhibits expression of an
endogenous plant gene required for pollen development or
functioning; plant R: pollinator line heterozygous for a
~ 094/09143 2 i 4 6113 PCT/EP93/0287~
-- 5 --
restoration transgene capable of neutralising the effect
caused by the first transgene.
Figure 4. Similar crossing as in Figure 3, except for
the pollinator line which is homozygous for the restoration
gene.
J
Figure 5. Binary vector pFBP125. This is a pBIN19 based
vector with an insert comprising a chs gene from Arabido~sis
thaliana between a hybrid promoter fragment comprising the
CaMV 35S RNA promoter in which an anther-box (AB) has been
inserted, and the nos-termination region of Agrobacterium
tumefaciens.
Figure 6. Binary vector pFBP130. This ~s a pBIN19 based
vector with an insert comprising an chs gen~ from Arabido~sis
thaliana between a promoter fragment of the chs-A gene of
Petunia hYbrida and the n~-termination region of Agrobacte-
rium tumefaciens.
Figure 7. Southern analysis of plant DNA of several
petunia lines cont~ining: (a) petunia anti-sense chs con-
struct (T29), (b) ArabidoPsis sense chs gene construct (-
T36004), (c) both constructs (a) and (b) (T38002 and T38007)
and wild-type (W115) p~obed with 32P-labelled Arabido~sis chs
DNA (o/n exposure -80 degr. Celsius). The Arabidopsis chs
genes are clearly visible in T38002 (several strong bands),
T38007 (several strong bands) and T36004 (one strong upper
band), whereas there is only slight cross-hybridizatiQn with
the endogenous petunia chs genes or antisense petunia chs
genes (faint bands in the lanes of T38002, T38007, T29 and
W115 and the antisense gene in T29).
Figure 8. Northern analysis of messenger RNA of the same
plants as in Fig. 7, including now T38005. Probed with
petunia chs DNA; 6 days ~poCllre -80 degr. Celsius). The chs
mRNA are clearly visible in the lanes of T36004 and W11~ as
WO94/09143 21~ 6 I 13 6 PCT/EP93/02 -
expected. In none of the antisense plant lines (T29, T38002,
T38005, T38007) could a petunia mRNA be detected, as could
have been expected as well.
Figure 9. Northern analysis as in Figure 8, except that the
blot was probed with Arabidopsis chs DNA, o/n exposure at -80
degrees Celsius. At o/n exposure the Arabidopsis chs MRNA is
only detected in the lane of T36004. However, upon gross
overexposure some very faint bands could be detected in the
lanes of the double transgenic lines T38002, T38005 and
T38007.
DETAILED DESCRIPTION
The instant invention will be illustrated by outlining
in more detail the findings that are obtained when performing
experiments aimed at restoration of male-fertility in plants
that were made male-sterile by thé expression in the tapetal
cell layers of a chalcone synthase transgene which was placed
in the reverse orientation with respect to the promoter. The
details of the gene constructs and the male-sterile plants
obtained therewith are described in Van der Meer et al.,
(1992, The Plant Cell 4, 253-262).
It was shown that expression of an antisense CHS gene in
the anthers of transgenic plants caused inhibition of normal
pollen functioning as a result of which the plant were unable
to self-pollinate. The transgenic male-sterile plants were
found to be entirely female-fertile and could be made to set
seed by cross-pollination with a male-fertile pollinator
line. It was concluded that the antisense chs plants can be
suitably used for the production of hybrid crops.
In the experiments that underlie the present invention a
male-sterile Petunia hybrida plant S which is transgenic for
an antisense CHS gene from Petunia hybrida under the control
of regulatory sequences that provide for expression of the
transgene in anthers of the plants, is cross-fertilised with
a Petunia hybrida plant R that contains a transgene obtaina-
ble from the chs gene of ArabidoPsis thaliana which is under
the control of regulatory sequences that pro~ide for ex-
pression of the transgene in anthers of the plants.
~ 094/09143 214 6113 - PCT/EP93/02875
Of the pollinator plants R, harbouring only the transge-
ne from Arabidopsis thaliana the majority is not male-sterile
as mi~ht have bee expected from the finding that transgenes
can inhibit the expression of resident genes enco~;ng homolo-
gous gene products. This so-called co-suppressive effect has
been established for a number of genes including a chs
transgene obtainable from Petunia hYbrida and re-introduced
into petunia plants (Napoli C. et al., 1990, The Plant Cell
2, 279-289; Van der Meer I. et al., 1992, Plant Cell 4, 253-
262). It has also been disclosed that expression of a chs
transgene placed in the sense direction under the control of
its promoter gîves rise to male-sterile plants, just as
expression of an antisense chs gene does, provided expression
of the transgenes occurs at least in the tapetal cell layer
of the anthers of the plants (PCT/NL92/00075, which is
herewith incorporated by reference in this specification,
with the proviso ~hat the definitions in that application do
not apply to the description of this invention and the claims
attached thereto at present or after A~çn~ment).
The finding that the introduction of a divergent chs
gene, such as the one from Arabido~sis, does not markedly
inhibit the production of chalcone synthase in the transgenic
plants indicates, that significant co-suppressive effects are
absent if a transgene is selected that encodes a transcript
that is sufficiently divergent from the endogenous gene
transcript.
The crossing of male-sterile plant S, which is heterozy-
gous for the sterility gene (Ssrr) with plant R, homozygous
for the restoration gene (ssRR) yields hybrid seed SR of
which 50% contains in addition to the endogenous chs gene and
the ArabidoPsis chs gene in the sense orientation, the
antisense chs gene from Petunia hybrida. Contrary to expecta-
tion, it will be found, that a percentage of the progeny
plants grown from the hybrid seed (50% SsRr; 50% ssRr)
harbouring both the transgenes is again capable of self-
fertilization in spite of the fact that about 50% also
inherited the sterility gene.
To establish the nature of the restored phenotype a
transcript specific primer extension experiment is carried
WO94/09143 PCT/EP93/02 ~
21~611~ 8 -
out on CDNA obtained from young anthers. Attempts to visuali-
ze radioactive extension products corresponding to the first
(pet~nia chs) transgene transcript fails, which can be
expected in view cf the restored phenotype. Applying equal
radio-illumination times it is also impossible to detect the
presence of the endogenous chs gene transcript, whereas an
extension product of about l.4 kb obtained with the primers
represented as SEQIDNO: l and SEQIDNO: 2 corresponding to
Arabido~sis chs transgene transcript can be clearly detected
under these conditions. The corollary of these experiments is
that the endogenous gene transcript and the almost identical
petunia transgene transcript interact, presumably by basepai-
ring, as a consequence whereof these transcripts are not
expressed and probably degraded in the plant nucleus. It is
presumably due to the nucleic acid sequence divergence of the
Arabidopsis transgene with respect to both the endogenous
petunia gene, as well as the petunia transgene, that the
former does not interact with any of the transcripts encoded
by the latter two genes. The nucleic acid sequences of the
Arabido~sis transgene and the Petunia gene transcripts differ
at least 30% in the protein encoding region, presumably even
more if the non-translated regions of the transcript are
taken into account. Hence, the nucleic acid divergence of the
transcript is deemed responsible for its translatability in
the plant cell, thereby producing a fully active chalcone
synthase which substitutes the endogenous chalcone synthase.
As a result male-fertility is restored in a percentage of the
progeny plants despite the fact that about 50% thereof
contain the sterility transgene.
Apparently, the high degree of nucleic acid sequence
identity of the first (petunia) chs transgene antisense
transcript and the endogenous (petunia) chs transcript
favours the interaction of these molecules, probably causing
them to be degraded, while the second chs transgene trans-
cript from Arabido~sis thaliana which is at the most 75%
identical on the nucleic acid level (see Table l), is pro-
duced in sufficient quantities to be translated into a fully
functional (heterologous) chalcone synthase capable of
restoring the plant's altered phenotype. We therefore main-
VO94/09143 21~ 3 9 PCT/EP93/0287~
tain that the restoration of the male-fertility phenotype is
due to complementation on the enzyme level.
This is believed to be the first observation of
partial phenotype restoration, or phenotype moderation, in
plants, wherein the production of an endogenous protein
product is blocked and wherein the function of that protein
product is substituted by a protein product similar (not
necessarily identical) on the amino acid level, but encoded
by a nucleotide sequence which is different on the nucleic
acid level. This finding may have interesting applications in
the genetic modification, restoration, or moderation of plant
phenotypes, in and ou~side the area of hybrid seed produc-
tion. For example, it is now feasible to silence endogenous
enzymes, and substitute such enzymes by enzymes with differ-
ent properties, such as a different substrate specificity,mode of regulation, and the like. Such substitutions may
bring about subtle, yet interesting, changes in the biochemi-
cal pathway in which the endogenous enzyme is involved.
The various aspects of the invention are outlined in
more detail below.
The invention can be worked with any phenotype alterati-
on system that involves an inhibitory gene of the antisense
type, such as described in EP 240 208 A2, directed against an
endogenous gene. Evenly so, it can be worked with an inhibi-
tory gene of the sense type, which work by the as yet notfully understood ~h~ m referred to as co-suppression,
disclosed in Napoli et al., l990, supra. Examples of such
phenotypes include, but are not limited to disease-resis-
tance, drought-resistance, flower colour, fruit ripening, and
the like.
The restoration gene must encode a transcript that is
sufficiently divergent from both the endogenous gene trans-
cript as well as the inhibitory transgene transcript and yet
encodes a protein or polypeptide capable of substituting the
function of the endogenous gene product. Phenotype resto-
ration can be made absolute. Alternatively, phenotype resto-
ration may be made not absolute; in this case it is preferred
to speak of partial phenotype restoration or 'phenotype
moderation'. If absolute phenotype restoration is aimed at,
W094/09143 214 6113 lo - PCT/EP93/02 ~
the di~ergence of the transcript must diverge preferably by
more than 20%, that is the nucleic acid identity of the
restoration transcript with either the inhibitory transgene
transcript or the endogenous gene transcript does not exceed
80~, preferably it does not exceed 75%. Depending on the
level of moderation desired, optimal moderation can be
achieved by making transgenes with different levels of
divergence and selecting the desired phenotype. In case
phenotype restoration is not required to be absolute, or
desired to be not absolute, divergence of the restoration
transgene transcript should not exceed 20%, preferably it
should not exceed 10%. The latter is referred to as phenotype
moderation.
Likewise, phenotype alteration systems that involve
inhibitory genes of the ribozyme type directed as sequence
specific endo-ribonucleases against an endogenous gene trans-
cript, as disclosed in US Patent 4,987,071, may be restored
with a transgene according to the invention, with the proviso
that the restoration gene encodes a transcript that is
lacking the recognition and/or cleavage consensus of the
ribozyme. Phenotype moderation should be possible using this
kind of inhibitory transgenes as well, although manipulating
the recognition and cleavage sequence of the restoration gene
to affect its affinity for the ribozyme may require some
trial and error.
The choice of the restoration gene
As a rule the restoration gene must not give rise to a
transcript that is identical to the endogenous gene trans-
cript. Preferably, the restoration gene transcribed region isas much divergent from the transcribed region of the endoge-
nous gene as possible, while the protein product encoded by
said transcript is identical, or almost identical. It is well
known in the art that each amino acid can be encoded by a
more than one codon; this fact, referred to as the degeneracy
of the genetic code, stems from the fact that there are about
20 different amino acids, which are encoded by triplets of
four different bases, yielding a total of 64 possible codons.
Three codons comprise stop signals for translation, so that
~ 094/09143 2 14 6 113 PCT/EP93/02875
in actual fact 61 codon specify about 20 amino acids. Roughly
spoken, every third base may be changed in a coding region
without affecting the amino acid sequence of the protein.
This means that the transcribed region of a restoration gene
can at least diverge 33% from the endogenous gene. But, since
a gene transcript generally comprises non-translated regions
flanking the coding region on both sides, even further
nucleic acid divergence may be achieved in order to avoid
interaction of the restoration gene transcript with the
endogenous gene transcript or the first transgene transcript.
Furthermore, still greater divergence may be achieved if
one takes into account the fact that two prôteins may differ
in their amino acid sequence, while ret~;n;ng their physiolo-
gical activity in the plant cell. Although it is not esta-
blished to what extent this may be, it may be assumed thatproteins which have conservative amino acid replacements in
10% of their amino acids, will st^ill be capable of performing
their physiological role. Alto~ether, it will be clear to
~omeone skilled in the art that a restoration gene according
to the present invention need not be more identical to its
endogenous counterpart than about 40-50% on the nucleic acid
level.
Some aspects of the invention will be further illustra-
ted with male-sterility as exemplifying phenotype.
Obtention of a male-sterile maternal line S
Any male-sterile plant phenotype that is due to expres-
sion of an inhibitory gene of one of the types mentioned in
the preceding paragraphs can be restored by a restoration
gene according to the invention.
Typical examples of how genes can be identified that are
essential for pollen development or pollen functioning is
given inter alia in KO89/10396 and KO90/08828. Once such
genes are isolated they can be expressed or overexpressed in
the sense or antisense orientation in those cells required
for pollen development or functioning. In order to achieve
expression in those cells that are necessary for pollen
development, genes are placed under the control of promoters
that are expressed in stamen cells (including filaments and
W O 94/09143 2 ~ 4 6113 - 12 - PC~r/EP93/02 ~
anthers), or more specifically in anthers, or even more
specifically in tapetal cell layers thereof. A distinction
should be made to sterility genes that are disruptive to
general plant cell functioning or viability on the one hand,
and genes that disrupt plant metabolism to the extent that it
disrupt pollen development or functioning without drastically
affecting plant viability on the other hand. The antisense
chalcone synthase gene is one of the latter category; conse-
quently, it is not necessary for the latter type sterility
gene to be expressed exclusively in stamen cells through the
use of stamen-specific promoters. Sterility genes of the
former type, i.e. the general plant cell disrupters, must not
be effective inside plant structures essential for survival
of the plant. Methods for isolating promoters that provide
for proper expression patterns of these genes are also
described in both WO89/10396 and WO90/08828, which are
herewith deemed incorporated by reference.
For reasons of illustration the maternal male-sterile
line is represented as being heterozygous for the sterility
gene. However, it will be clear that fully fertile hybrid
seed can be obtained also if the maternal line is homozygous
for the sterility gene. International Patent Application
PCT/NL92/00075, discloses a method for obtaining homozygous
male-sterile plants, by selfing male-sterile plants harbou-
ring one copy of an antisense chs gene, whereby the pollenthat are arrested in their development are made to germinate
on pistils in the presence of flavonoids. The seed obtained
from this selfing can be grown into homozygous male-sterile
maternal plant lines, which can optionally be propagated n
~itro first, and then used as such in hybrid seed production
by cross-pollination with a pollinator line, which may be
heterozygous or homozygous for the restoration gene according
to the invention.
Plant transformation
Introduction of sterility genes, herbicide resistance
genes or restoration genes into plants, is achieved by a any
one of the following techniques, the choice of which is not
critical to the present invention.
~ 0 94/09143 21~ 6 1 13 ~ PC~r/EP93/02875
13
Generally, useful methods are the calcium/polyethylene
glycol method for protoplasts (Krens, F.A. et al., 1982,
Nature 296, 72-74; Negrutiu I. et al, June 1987, Plant Mol.
Biol. 8, 363-373), electroporation of protoplasts (Shillito
R.D. et al., 1985 Bio/Technol. 3, 1099-1102), microinjection
into plant material (Crossway A. et ~1., 1986, Mol. Gen.
Genet. 202, 179-185), (DNA or RNA-coated) particle bombard-
ment of various plant material (Klein T.M. et al., 1987,
Nature 327, 70), infection with viruses and the like.
Preferred according to the invention is the use of
Aqrobacterium-mediated DNA transfer. Especially preferred is
the use of the so-called binary vector technology as disclo-
sed in EP-A 120 516 and U.S. Patent 4,940,838).
Subsequently, receptive plant cells or are selected for
the presence of one or more markers which are encoded by
plant expressible genes co-transferred with the plant expres-
sible gene according to the invention, whereafter the trans-
formed material is regenerated into a whole plant. Alternati-
ve~r, pollen cells are transformed, for instance by coated-
particle acceleration, and used to pollinate receptiveplants.
Although considered somewhat more recalcitrant towards
genetic transformation, monocotyledonous plants are amenable
to transformation and fertile transgenic plants can be
regenerated from transformed cells. Presently, preferred
methods for transformation of monocots are microprojectile
bombardment of explants or suspension cells, and direct DNA
uptake or electrop. ~ation (Shimamoto, et al, 1989, Nature
338, 274-276). Transgenic maize plants have been obtained by
introducing the strePtomYces hvqroscoPicus bar-gene, which
encodes phosphinothricin acetyltransferase (an enzyme which
inactivates the herbicide phosphinothricin), into embryogenic
cells of a maize suspension culture by microprojectile
bombardment (Gordon-Kamm et al, 1990, Plant Cell, 2, 603-
618). The introduction of genetic material into aleuroneprotoplasts of other monocot crops such as wheat and barley
has been reported (Lee, 1989, Plant Mol. Biol. 13, 21-30~.
Wheat plants have been regenerated from embryogenic suspensi-
on culture by selecting only the aged compact and nodular
WO94/09143 214 ~113 - 14 - PCT/EP93/02 ~
embryogenic callus tissues for the establishment of the
embryogenic suspension cultures (Vasil I., et al, 1990,
Bio/Technol. 8, 429-434). Herbicide resistant fertile wheat
plants were obtained by microprojectile bombardment of
regenerable embryogenic callus (Vasil V. et al, 1992, Bi-
o/technol. 10, 667-674).The combination with transformation -
systems for these crops enables the application of the
present invention to monocots.
Monocotyledonous plants, including commercially impor-
tant crops such as corn are also ~en~hle to DNA transfer byAqrobacterium strains (Gould J, Michael D, Hasegawa O, Ulian
EC, Peterson G, Smith RH, (1991) Plant. Physiol. 95, 426-
434).
~arker qenes
Suitable marker genes that can be used to select or
screen for transformed cells, can be selected from any one of
the following non-limitative list: neomycin phosphotransphe-
rase genes conferring resistance to kanamycin (EP-B 131 623),
the hygromycin resistance gene (EP 186 425 A2) the
Glutathione-S-transferase gene from rat liver conferring
resistance to glutathione derived herbicides (EP-A 256 223),
glutamine synthetase conferring upon overexpression resistan-
ce to glutamine synthetase inhibitors such as phosphinothri-
cin (W087/OS327), the acetyl transferase gene from Streptomy-
ces viridochromogenes conferring resistance to the selective
agent phosphinothricin (EP-A 275 957), the gene encoding a 5-
enolch;k;~te-3-phosphate synthase (EPSPS) conferring tole-
rance to N-phosphonomethylglycine, the kar gene conferring
resistance against Bialaphos (e.q. W091/02071), and the like.
The actual choice of the marker is not crucial as long as it
is functional (i.e. selective) in combination with the plant
cells of choice.
The marker gene and the gene of interest do not necessa-
rily have to be linked, since co-transformation of unlinked
genes (U.S. Patent 4,399,216) is also an efficient process in
plant transformation.
Gene exPression
~094/09143 2 1 4 6 113 15 - PCT/EP93/02875
The expression pattern reauired for the restoration gene
depends on the expression pattern of the inhibitory transge-
ne. The latter in its turn is dependent on the phenotype
alteration aimed at. Thus, for modifying the fruit ripening
phenotype in a plant, an inhibitory gene bringing about said
alteration must at least be expressed in the fruits of said
plant. Restoration or moderation can be achieved by an
expression pattern that comprises at least the expression
pattern of the inhibitory transgene.
Multiple transqenic Plants
To obtain transgenic plants harbouring more than one
gene a number of alternatives are available, the actual
choice of which is not material to the present invention:
~. the use of one recombinant polynucleotide, ~ ~ a plasmid,
with a number of modified genes physically coupled to one
selection marker gene.
B. Cross-pollination of transgenic plants which are already
capable of expressing one or more chimeric genes coupled to a
gene encoding a selection marker, with pollen from a trans-
genic plant which contains one or more gene constructions
coupled to another selection marker. Afterwards the seed,
which is obtained by this crossing, is selected on the basis
of the presence of the two markers. The plants obtained from
the selected seeds can afterwards be used for further cros-
sing.
C. The use of a number of various recombinant polynucleoti-
des, e.a. plasmids, each having one or more chimeric genes
and one other selection marker. If the frequency of cotrans-
formation is high, then selection on the basis of only onemarker is sufficient. In other cases, the selection on the
basis of more than one marker is preferred.
D. Consecutive transformations of transgenic plants with new,
additional genes and selection marker genes.
E. Combinations of the above mentioned strategies.
The actual strategy is not critical with respect to the
described invention.
selection of hybrid seed
WO94/09143 2 ~ 4 6 113 PCT/EP93/02 ~
- 16 -
It is known in the art that, the need to separate hybrid
seed from non-hybrid seed can be avoided if the self-pollina-
tors can be destroyed, for example by using an antibiotic,
preferably a herbi~ide. This requires that the maternal male-
sterile line is resistant to this antibiotic or herbicide dueto the presence of transgene coding therefor.
The herbicide resistance gene may be introduced into the
maternal line simultaneously with the sterility gene accor-
ding to the invention by genetic transformation with a multi-
gene construct. However, the herbicide resistance gene may beintroduced into the maternal line after the introduction of
the sterility gene.
It may be advantageous to introduce the herbicide
resistance trait into the plant intended to use as maternal
parent line prior to the introduction of the sterility gene.
This simplifies the creation of plants that are homozygous
for the herbicide resistance phenotype which may be advanta-
geous. Then, plants provided subsequently with the sterility
gene, may be cross-pollinated with a pollinator plant contai-
ning a restoration gene according to the invention. Suitable
herbicides can be selected from any one listed under the
heading marker genes.
Advantaqes and industrial aPPlication
The process according to the invention is particularly
useful for the production of hybrid progeny that is fully
male-fertile.
In a conventional process of producing hybrids from
self-fertilising crops a transgenic (heterozygous) nuclear
male-sterile plant line S (Ssrr) may be crossed with a male-
fertile plant line R (ssrr) to yield hybrids that are 50~
fertile (ssrr) and 50% sterile (Ssrr). Consequently, if ~-uch
hybrid crops were grown in the field directly, 50% of the
acreage would consist of plants that must be cross-fertilised
in order to set seed, which may have significant yield
reducing effects for those crops that rely on the setting of
fruit or seed for their commercial value. Examples of such
crops include but are not limited to cereals and oil seed
rape.
~0 94/09143 21~ 6113 PC~r/EP93/02875
- 17 -
Thus, the present invention is especially suitable for
the hybridization of naturally self-fertilizing crops by
crossing a maternal line which is male-sterile due to the
expression of a first transgene capable of inhibiting expres-
sion of an endogenous plant gene essential to normal pollenfunctioning, and a pollinator line containing a second
transgene capable of neutralising the effect caused by the
first transgene. Although 50% of the hybrid progeny is
heterozygous for the sterility gene, the presence of the
restoration or moderation gene ensures fertility of the
progeny that is closer to that of the wild type lines.
The specific advantages of this hybridization system
reside in the fact that it can be used in combination with
any sterility system that makes use of transgenes inhibitory
to endogenous genes. As a consequence the phenotype can be
determined predominantly by the nature of the gene product,
rather than the specificity of the expression pattern.
All references cited in this specification are indicati-
ve of the level of skill in the art to which the invention
pertains. All publications, whether patents or otherwise,
referred to previously or later in this specification are
herein incorporated by reference as if each of them was
individually incorporated by reference.
The Examples given below are just given for purpo-
ses of illustration and do not intend in any way to limit the
scope of the invention.
EXAMPLE 1
Construction of a chiPB/as-chs and a chalcone isomerase B
promoter chs qene construct (chiPB/chs-At~
The chiPB/as-chs construct comprises a chs cDNA fragment
from Petunia hybrida fused in the antisense orientation to a
chalcone isomerase B promoter fragment. The chiPB/chs-At
construct comprises a chs cDNA fragment from Arabidopsis
thaliana fused in the sense orientation to a chalcone
isomerase B promoter fragment.
A 1.7 kb promoter fragment from the anther-specific
chiPB promoter (Tunen, A.J. Van., Mur, L.A., Brouns, G.A.,
Rienstra, J.D., Koes, R.E. and Mol, J.N.M., 1990, The Plant
W094/09143 214 6113 1 PCT/EP93/02 ~
- 18 -
Cell 2, 393-401) and a 0.2 kb NOS tail isolated from plasmid
pBI101.1 (Jefferson, R.A., Kavanagh, T.A., and Bevan, M.W.
(1987). EMBO J. 6, 3901-3907) are cloned into the plasmid
pUC19 (Messing, J., 1978, Recombinant DNA Technical Bulletin
NIH Publication No. 79-99, 2, 43-48) yielding the recombinant
plasmid MIP289 (Figure 1).
A 1.4 kb BamHI chs fragment is isolated from plasmid
pTS21 (Van der Meer et al., 1992, su~ra) and cloned into
plasmid MIP289 digested with BamHI. A clone with the chs
fragment in an antisense orientation is selected on the basis
of the asymmetric SstI restriction enzyme site. Subseguently,
this fragment is subcloned as a HindIII/EcoRI fragment into
the binary vector Binl9 (Bevan, M. (1984) Nucl. Acid Res. l~,
8711-8712) yielding plasmid pAS8.
To isolate a full size Arabidopsis chs cDNA, single
stranded cDNA is synthesized on 10 ~g RNA isolated from young
Arabido~sis thaliana ecotype Landsberg erecta flower buds, by
priming with an 17-mer oligo-dT primer (Maniatis, T., Fritsc-
h, E.F., and Sambrook, J. (1982). Molecular Cloning: A
Laboratory Manual (Cold Spring Harbour, NY: Cold S~ring
Harbour Laboratory). A set of two additional primers based on
(Feinbaum, R.L., and Ausubel, F.M. (1988). Mol. Cel. Biol. 8,
1985-1992) with the sequence based on the 5' region (primer I
2 SEQIDNO: l; GCGGATCCGTATACTATA~GGTGATGG) and 3' region
(primer II = SEQIDNO: 2; GAGGATCCTTAGAGAGGAACGCTGTGCAAGAC) of
the Arabidopsis chs gene are used for the initial polymerase
chain reaction (PCR) analysis. The PCR reaction is performed
in 100 ~l PCR buffer (10 mM Tris, pH 8.3, 50mM KC1, 2.5 mM
MgC12) containing 50 pmole primers, and 200 ~M of each deoxy-
nucleotide triphosphate. Amplification involved 30 cycles ofa st~n~rd cycle for homologous primers. Amplified CDNA is
fractionated on a 1% agarose gel and z 1.4 kb band is iso-
lated and subcloned as a BamHI fragment (sites present in the
5' and 3' primers) in pAS8 after digestion with BamHI to
remove the petunia chs CDNA. The orientation and proper
cloning of the ArabidoPsis chs CDNA into PAS8/BamHI is
checked by a detailed restriction enzyme analysis and
sequence analysis; the correct plasmid is called pAS9.
~ 094/09143 2 14 6 113 PCT/EP93/0287S
-- 19 --
Example 2
Transformation of tobacco plants
~ he plasmids pAS8 and pAS9 are transferred from E. coli
JM83 (Messing et al, 1978, su~ra) to Agrobacterium tumefa-
ciens strain LBA 4404 (Hoekema A. et al., lg83, Nature 303:179-180) by triparental mating (Rogers, S.G., and Fraley,
R.T., 1985, Science 227, 1229-1231), using a strain contai-
ning plasmid pRK2013 (Ditta et al., 1980, Proc. Nat. Ac. Sci.
USA, 12, 7347-7351). Transformed tobacco plants are obtained
by the st~n~rd leaf-disc transformation method (Horsch et
al., 1985, Science 227, 1229-1231). After cultivation with
the A. tumefaciens strains harbouring either pAS8 or pAS9,
the tobacco leaf discs are grown on MS plates conta;ning 3
~g/ml kinetin, 500 ~g carbenicillin and 200 ~g kanamycin.
Plants obtained are checked for transformation on th~ basis
of resistance for kanamycin and by Southern blot ana~ysis
using an ~ fragment as a probe. After shoot and root
induction plants are put on soil and transferred to the
greenhouse. Plants are grown under in the greenhouse at 21-C
at a 16 hours light, 8 hours dark regime.
ExamPle 3
Analysis of transqenic plants expressinq the antisense chs
construct
25Transgenic tobacco plants cont~in;ng the ~h;m~ric pAS8
gene construct (Petunia antisense chs) are investigated for
fertility by self-pollination. At least one plant is almost
completely sterile and shows a seed set of less than 1% in
selfings. Furthermore the pollen grains of this plant are
morphologically aberrant, as was also published by Van der
Meer et al. (1991) and are not able to germinate in an ia
vitro germination assay. This plant is designated Sl and
contains only one copy of construct pAS8 in its genome.
35Exam~le 4
~nalYsis of transqenic ~lants expressinq the chimeric Arabi-
do~sis chs construct
From a number of 15 transgenic tobacco plants containing
plasmid pAS9, one plant expressing the Arabidopsis chs cDNA
WO94/09143 2 1 ~ 6 1 1~ - 20 - PCT/EP93/02 ~
in young anthers is selected by RNAse protection experiments
using RNA isolated from young anthers. This plant is designa-
ted Rl.
Exam~le 5
Crossing of Sl and Rl restores fertility
A cross is made between Sl (genotype Ssrr) and Rl
(genotype ssRr) and the offspring of this cross is grown to
mature plants. Based on their genotype four classes of plants
can be distinguished: Ssrr, SsRr, ssRr, and ssrr (see also
Figure 2). It can be observed that plants containing the
restoration gene, i.e. the ArabidoPsis chs gene (SsRr) are
able to set seed after self-pollination despite the presence
of a sterility gene (Ss). Light-microscopical analysis shows
that these plants have pollen that are morphologically normal
whereas Ssrr plants have aberrant pollen. All plants contai-
ning both the sterility gene construct pAS8 and the restora-
tion gene construct pAS9 show restoration of fertility as can
be demonstrated by self-pollination experiments. In a control
cross between Sl and an untransformed tobacco plant only 50%
of the offspring is able to set seed after self-pollination
as can be expected on the basis of the fact that Sl has a
copy of construct pAS8 integrated in its genome.
EXAMPLE 6
The following table provides data about chalcone
synthase genes from various plant species and the nucleic
acid identity of the amino acid coding regions: reference
sequence is Petunia hybrida U30 chalcone synthase gene. Best
match is given at a minimum sequence of lO00 bp.
TABLE l
Comparison of NA sequence identity of chs genes
35 sou-ce qene desiqnation identity (%)
P. nYbr_da V30 chs lO0
P. lY~r_~a c~s~ 98
P. ny~r ~a c~sJ 82
P. nY~r_~a c~sH 79
40 P. nYJr ~a c~sD 77
P. ~y~r La c~sF 7~
P. ~Y~r ~a c~sG 76
~094/09143 214 ~ PCT/EP93/02875
- 21 -
. esculentum TCHSl 83
L. es-ulentum TCHS2 83
P. sa- vum PSCHSl 76
P. sa_ vum PSCHS2 74
5 P. sa__vum PSCHS3 73
Soybean CHS gene 3 74
G. max CHS gene 2 73
Parsley CHSl 72
M. incana CHSy 71
10 A. thaliana Atchs 71
Mustard SasCHS3 72
Mustard SasCHSsg 70
Mustard SasCHS1 69
Antirrhinum maius AmCHS 74
15 Pinus s~lvestris PsCHSs 70
Hordeum vulqare X58339 68
Zea maYs Zmc2cs 67
Zea mays Zmwpcs 67
Boldface: gene fragments that are used as sterility and
restoration gene respectively, in this disclosure.
Other suitable combinations of sterility genes and restora-
tion genes can be selected from this table.
~XAMPLE 7
Partial fertility restoration in male-sterile ~lants bY re-
transforming male-sterile ~lants with a diverqent restoration
gene construct
Petunia W115 plants were transformed with a sterility
gene construct comprising the promoter region of the petunia
chs gene linked to the coding region of the petunia chs gene
in antisense orientation. This gene construct, designated
VIP176 (Krol A.R. van der et al., 1990, Plant Molecular
Biology 14, 457-466) was used to transform the petunia line
W115 and a self-sterile plant was selected and designated
T17002. This self-sterile flavonoid depleted plant, T17002,
was cross-pollinated with a W115 plant and among the progeny
a plant was selected, which was kanamycin sensitive but still
self-sterile and depleted for flavonoids; this plant was
designated T29. This sterile, kanamycin sensitive plant, T29,
- was used for a second transformation with pFBP125 (PCaMv35sAB/
CHSAt, yielding the 39000 plants~ not discussed further) or pFBP130
(PCHS pet/CHSAt rendering the 38000 plants, see below).
This approach was successful as 7 transgenic 38000
plants were obtained which contain both the sterility gene
WO94/09143 214 6 1~ PCT/EP93/02
- 22 -
construct (chs-antisense from petunia) as well as the restor-
ation construct (sense-chs from Arabidopsis). Of these plants
5 had flavonol production in the corolla; 2 out these 5
plants were male-fertile (inter alia T38005).
In order to obtain data about the functionality of the
Arabidopsis CHS-enzyme in petunia plants, W115 plants were
transformed with ~grobacterium strains harbouring pFBP125
(yielding the 36000 plants, see below). Of 15 transformed
plants, 4 plants over-produced flavonols as compared to wild-
type (W115) (inter alia T36004, see Table 2).
Plant lines were tested for the presence of the con-
structs by Southern analysis. Expression of the genes was
verified by Northern analysis.
Table 2 summarizes the results for 6 petunia lines: from
top to bottom are given Southern data, obtained by probing
with petunia chs probes and Arabidopsis chs probes: Northern
data, obtained by probing with both aforementioned probes,
corolla pigmentation (flavonol staining); and fertility
determination. The genetic backgrounds of the petunia lines
are as follows: W115 - wild-type petunia plants (non-trans-
genic); T29 - Pc~M~5sAB-antisense petunia chs (transgenic for
sterility gene); T38002, T38005, T38002 - Pchs-antisense
petunia çhs + Pchs-A.thaliana chs (transgenic for sterility
gene and restoration gene); T36004 ~ PCaM~5SAB A- thalian
(transgenic for the restoration gene only).
As indicated in the table lines W115, which is 100%
fertile, and T29, which is entirely unable to self-pollinate,
performed as expected (see PCT/NL92/00075). The double-
transgenic lines T38002, T38005 and T38007, which contain
both the sterility gene and the fertility gene, had only a
partially restored fertility; for T38005 seed-set was about
10-20% of the wild-type W115. These data correspond well with
the presence of only slight amounts of flavonols (see below~.
Moreover, the presence of flavonols was dependent on the
presence of the ArabidoPsis chs gene, as was confirmed by
Southern data using the Arabidopsis chs PCR fragment as a
probe. The ArabidoPsis chs probe was only weakly capable of
cross-hybridizing with the petunia chs gene and vlce versa
(Fig. 7).
~146113
094/09143 PCT/EP93/0287
- 23 -
The Northern data on mRNA of corolla's corresponded with
the Southern data, except that the Arabi~-~sis chs-messenger
RNA of plant lines T38002, T38005 and T38007, when probed
with the Arabidopsis chs-probe, could only be detected after
gross over-exposure; this is probably due to weak expression
of the Pchs-Arabidopsis chs gene construct in corolla's. The
Northern data for lines T38002, T38005 and T38007 seem in
accordance with production of low amounts of flavonoles in
these lines, which, in turn, might explain the fact that the
sterility was restored only partially (only 10-20~ seed set
for T38005 as compared to W115). In order to restore fertil-
ity it is necessary that the restoration gene construct (such
as in pFBP125 and pFBP130) is expressed in either the male
reproductive organs or the female reproductive organs or in
both. Although expression of the restoration gene in corol-
la's provides an initial indication of fertility restoration
it will be necessary to establish expression of the Arabido~-
sis gene in either of the reproductive organs. We anticipate
that the T38005 plant expresses the ArabidoPsis gene in
either of the reproductive organs, and Northern analysis is
in progress to confirm this.
The proper functioning of the Arabidopsis CHS-enzyme was
established by comparing flavonol production in W115 with
T36004, which contains, in addition to its endogenous chs-
gene, copies of the Arabidopsis chs-gene. As is indicated,
corolla's of T36004 produced far more flavonols (+++ - dark
orange, after staining for flavonols) than W115 corolla's (+
= pale orange). As expected, male-sterile line T29 did not
produce detectable amounts of flavonols (- = purely white
corolla's), whereas the corolla's of T38002, T38005, which
was partially fertility-restored, and T38007 produced slight
amounts of flavonols in the corolla (+/- = beige or very pale
orange).
The high flavonol levels observed in corolla's of T36004
correspond well with the Northern data obtained for that
plant line, indicating abundant levels of the Arabidopsis
chs-messenger RNA in these lines (see Fig. 9). It is, there-
fore, clear that the ArabidoPsis CHS-enzyme is fully func-
tional in petunia plants and, in principle, capable of
WO94/09143 2 14 6113 PCT/EP93/02 ~
- 24 -
substituting the function of endogenous CHS.
DePosited microorganisms
On October 14, 1993, two E. coli JM101 strains, one
harbouring pFBP125, and one harbouring pFBP130 have been
deposited at the Centraal Bureau voor Schimmelcultures,
Baarn, The Netherlands, under accession number CBS 543.93 and
CBS 544.93, respectively.
~0 94/09143 2 14 6 1 13 25 - PCI/EP93/02875
o a~
O UJ 1) ~
O ~ J
a) U
+ + ~ ,~ U ~ U~
~ X
~ O O
O U~
,v '~ t ' V o V ~1
+ ~ I ~ U h~ CU¦ ~C E3'
t
U ~ Ci ~ C ~C~ U ~
~ CC o~C" ~ e~C ~,
(~ ) UJ a~
+ + I I I I I ~ U~ ~ ~ ~ ) "C
C~ Ul 1
In u ,,,~ P-~ ~
a) d~ 0 h 3 s ;~
+ I + I + ~ .A ~
:~ - . t t
,~ ~ h _ UJ ~ S 4 ~ ~
- S -- h '~ r "~ ~J
.. . _ ~ S ~ ~ ~ r ~ ~ ~ ~ U~ 0
. = ~ . , ~ 0 ~ U R
~) ~ r-l t IV ~ ~ U. 0 ~ ~ Cl
::" .::',.. ,'~ U ~ * ~; ~ K ~ ~1 ~ .C 1~ 0 c
~ 4 t .~
W O 94/09143 P ~ /EP93/02 ~
2146113 - 26 -
SEQUENOE IISTING
(1) GENERAL INFORM~IION:
(i) APPIIC~NT:
(A) NAME: MOGæN Tnt~rn~tiona1 N.V.
(B) ST~EET: Einsteinweg 97
(C) crrY: T~
(D) SI~E: Zuid-~
(E) C~UN~ : me N~thPrl ;~
(F) P0SIAL CODE (ZIP): NLr2333 CB
(G) T~TFP~NE: (0)31.71.258282
(H) ~ FAX: (0)31.71.221471
(ii) TTTIE OF INVENTION: Genetic Re~ lin~ of P1ant Phenntypes
(iii) N~MBER OF SEQUENCES: 2
(iv) CX/E~IrER REanPBLE FORM:
(A) MEDIUM IYPE: F1cppy disk
(B) CXPD~IrER: IBM PC cr~tihl~
(C) OPERAIING SYSTEM: PC-DOS/MS-D06
(D) SOFIW~RE: PatentIn ~PlPA~P #1.0, Version #1.25 (EPO)
(2) INFoRMaIICN FOR SEQ ID NO: 1:
(i) SEQUEN OE CH~RA~~ sllCS:
(A) IENGTff: 28 base pairs
(B) T~PE: ~lr-lP;c acid
(C) SIl~n~NE95: single
(D) T0~0L0GY: linear
~ ;ul~: T~PE: cDNA to mRN~
(iii) H~u~ l~L: YES
(~i) ORIGIN~L SoURCE:
(A) CEr~ 3M: Ar~h;~ç;ç th~ nA
(B) STRAIN: l~ y erecta
(F) ~l~l.c~u~ T~PE: Flawer budç
(X) F~JRT,Tt'~TT(l~ l~p~CN:
(A) A~ ~S: Feinbaum, R L
All~lhPl, F M
(B) TITIE: ~11~ r ;~kional re~ t;~n of the Ar~h;~r~;ç
th~ na rh~l~nne synth~ce gene
(C) JOURN~L: MD1. Cell. Biol.
(D) VOLUME: 8
(F) PAGES: 1985-1992
(G) n~IE: 1988
(xi) SE ~ CE DES~x~ uN: SEQ ID NO: 1:
28
(2) INECRMPIION FOR SEQ ID NO: 2:
VO 94/09143 21~ 6 113 PCI/EP93/0287S
-- 27 --
(i) SEX~ENOE C~RA~
(A) LENG~I: 32 hase pairs
(B) T~E: ~ rlP;r- acid
(C) s~s c; ~1
(D) IOPOIOGY: liT~ear
(ii) ~TF~T~ q~YPE: clNA to ~NA
(iii) ~Y~ L: YES
(vi) ORIG~L Sa~ROE:
(A) OR~N~: Ar~h;~ th;~l ;~rla
(B) STR~ y erecta
(F) ~l~u~; T~: flaWP~ ~c
(A) A~ ;: Feiriba~n, R L
A l~lhPl, F M
(B) mlE: Tr~lll~ riptional regulation of the Ar~h;tlff ~ic
thA~ a rh~lr~e synthase
(C) J wFa~L: Mol. Cell. Biol.
(D) VolDME 8
(F) PAGES: 1985-1992
(G) n~IE: 1g88
(xi) ~u~ DES~xl~ll~: SEQ ID NO: 2:
Ga~XPDrOCTT pr.Ar.~rr.~C ~ A~G AC 32
