Note : Les descriptions sont présentées dans la langue officielle dans laquelle elles ont été soumises.
WO94/09120 PCT/US93/09988
21~B929
RFTROVIRA~ MEDIATED TP~FER
5OF THE ~MAN MULTIPL~ DR~G RE8I8TANCE GBN~
This application is a continuation-in-part of United
States Application Serial No. 07/962,474, filed October
16, 1992, the contents of which are hereby incorporated
by reference.
The invention described herein was made in the course of
work supported by Public Health Service Grants DK-25274
and HL-28381 from the National Institutes of Health. The
United States government therefore has certain rights in
this invention.
Backqround of the Invention
Throughout this application, various references are
referred to within parentheses. Disclosures of these
publications in their entireties are hereby incorporated
by reference into this application to more fully describe
the state of the art to which this invention pertains.
Full bibliographic citation for these references may be
found at the end of each series of experiments in this
application.
The multidrug resistance (MDR-l or MDR) gene is normally
expressed at insignificant levels in normal human bone
marrow cells. The MDR phenotype is mediated through the
expression of a 170,000 Kd plasma trAnc~mbrane
glycoprotein known as p-glycoprotein that functions as an
energy dependent efflux pump for various xenobiotics
including colchicine in vitro, and the vinca alkaloids,
etoposides, anthracyclines and taxol in vivo (1)
(hereinafter referred as MDR-responsive drugs). Studies
of transgenic mice show that insertion of the human MDR
WO94/09120 PCT/US93/09988
2~9~9 -2- ~
gene into the mice, leads to high level expression of
this gene in the bone marrow cells (l, 2). In these
mice, the peripheral white bIood cell (WBC) count is
resistant to the usual marrow suppressive effects of
daunomycin chemotherapy.
Gene therapy in animals, including humans, requires safe
and efficient gene transfer and high level gene
expression. Retroviral vectors have been used
extensively in gene transfer because of their efficient
entry into cells and integration into the host cell's
genome (3-5). Previous studies have indicated that high
titer retroviruses, primarily those containing the
neomycin-resistance gene (neoR) can be used to transduce
mouse bone marrow cells efficiently, resulting in stable,
long-term integration of the transferred gene in the
majority of the bone marrow cells (3-ll). Similar
experiments using the human B-globin gene in irradiated
mice have been less successful (12, 13). In an attempt
to increase the number of transduced cells, and to
provide a potential selection, both in vitro and in vivo,
for the continued selection of transduced cells, we have
used the human multiple drug resistance gene. In studies
with transgenic mice, it has been shown that the
insertion of a human MDR gene leads to the resistance of
mouse bone marrow cells to drugs normally toxic to these
cells tMDR-responsive drugs).
The present invention makes use of a retroviral vector
plasmid containing MDR cDNA to transfer MDR resistance
into mouse erythroleukemia cells (MELC) in culture. When
MELC are exposed to these MDR producer cells, and
selected in the presence of colchicine, MELC clones
WO94/09120 2 1~ ~ 9~ ~ PCT/US93/09988
resistant to colchicine can be isolated, and show high
levels of MDR expression at the RNA and protein levels.
Subsequent exposure of these clones to increasing
concentrations of colchicine results in increased levels
of MDR mRNA and protein expression. These results
indicate that efficient MDR gene transfer and expression
is achievable in erythroid cells in culture using
retroviral gene transfer. The present invention also
makes use of high titer MDR producer cell lines to
transduce murine bone marrow cells with the MDR gene.
After transduction, there is significant integration and
expression of the human MDR gene, both short and long-
term, indicating the success of bone marrow stem cell
infection in live animals in vivo.
The present invention also makes use of high titer
amphotropic MDR producer cell lines to transduce human
bone marrow cells in culture, and to demonstrate
increased MDR protein expression after gene transfer.
2~
WO94/09120 PCT/US93/09988
-4-
Brief Description of the Drawin~
Figure l: Retroviral vector pHaMDR/A containing MDR
cDNA. pHaMDR/A is a Harvey based
retroviral vector containing full length
MDR cDNA ~4.l kb), as previously described
(2, 14). B = BamHI; E = EcoRI; H =
HindIII; S = StuI; and X = XhoI.
Figure 2: Southern blots of untransduced and
transduced MELC cells grown in 2 ng/ml of
colchicine. Each lane contains 5 ~g of
purified total MELC DNA digested with XhoI
restriction endonuclease. XhoI cuts once
inside the proviral genome and gives
distinct bands in transduced MELC clones
resistant to colchicine. Lane l:
Untransduced sensitive MELC. Lanes 2-8:
Transduced colchicine resistant MELC
clones showing evidence of clonal
integration. Single bands are seen in
lanes 3, 4 and 8.
Figure 3: Southern blots of untransduced and
transduced MELC clones. 5 ~g of total DNA
was loaded in each lane after digestion
with NheI which cuts within the LTRs of
the provirus. NheI digestion allows
identification of a single band (arrowA)
in the transduced resistant clones
corresponding to the full length provirus.
Lane l: untransduced MELC with no band at
A and two faint endogenous bands at B.
W094/09120 2 1~ 929 PCT/US93/09988
-5-
Lanes 2-8: Transduced MELC with bands at
A and faint bands at B. Lane 9: MDR
producer fibroblast DNA.
.
Figure 4: Northern blot of untransduced and MDR
transduced MELC. 5~g of total RNA was
loaded in each lane and run in a formamide
gel. Lane l: untransduced MELC. Lane 2:
MDR producer cell RNA. Lanes 3-ll:
Resistant transduced MELC clones selected
and maintained in 2 ng/ml colchicine. The
arrow to the right shows the expected
position of the MDR mRNA. 32p labelled
probes were used. Integrity of RNA was
verified with ethidium bromide stains
(data not shown).
Figure 5: Southern blot of 3 different MELC clones
selected in progressively higher
concentrations of colchicine. Lane l:
untrasduced MELC. Lanes 2: MDR producer
cell DNA. Lanes 3-5: Clone l selected
and maintained in 2 ng/ml colchicine (lane
3) 20 ng/ml colchicine (lane 4) and lO0
ng/ml colchicine (lane 5). Lanes 6-8:
Clone 2 selected and maintained at 2 ng/ml
colchicine (lane 6), 20 ng/ml colchicine
(lane 7) and lO0 ng/ml colchicine (lane
8). Lanes 9-ll: Clone 3 selected and
maintained at 2 ng/ml colchicine (lane 9),
20 ng/ml colchicine (lane lO), and lO0
ng/ml colchicine (lane ll).
WO94/09120 PCT/US93/09988
2~ -6-
Figure 6: Northern blot analysis of the same clones
as shown in Figure 5. Increased MDR mRNA
levels are seen as concentrations of
colchicine increase. Lane l:
untransduced MELC. Lane 2: MDR viral
producer cells. Lanes 3-ll: clone l
(lanes 3-5), clone 2 (lanes 6-8), and
clone 3 (lanes 9-ll) maintained at 2, 20
and lO0 ng/ml colchicine respectively for
each clone. The faster migrating band in
lanes 3 and ~ is not characterized.
Figures 7A, 7B,
7C, 7D,
and 7E: MDR transduced MELC clones were
sequentially grown in media containing
increasing concentrations of colchicine
over a period of 18 weeks. Samples were
labelled with MDR antibody 17Fg (IgG2b
isotype) and fluorescein-conjugated IgG2b
rat anti-mouse secondary antibody as
described below, then analyzed on a FACS
Star Plus (Beckton-Dickinson). Panel A:
Untransduced MELC control shows
insignificant levels of flurescence.
These cells are sensitive to a colchicine
concentration of 2 ng/ml. Panels B-E: A
single representative MDR transduced MELC
clone se~uentially grown in 5 ng/ml, 20
ng/ml, 300 ng/ml and 600 ng/ml colchicine.
Log fluorescence values increase with
increasing concentrations of colchicine
indicating that p-glycoprotein expression
WO94/09120 214~9 2 9 PCT/US93/09988
-7-
increases as MELC are grown in higher
concentrations of colchicine.
Figure 8: Southern blot analysis of GP+E86 MDR
producer clones. DNA was digested with
EcoRI and probed with a 3.4 kb EcoRI cDNA
probe; lanes 1-9: GP+E86 MDR clones; lane
10: GP+E86 negative control; lane 11:
pHaMDR/A positive control.
Figures 9 A
and B: FACS analysis of untransfected and
transfected cell lines. Cells were
stained with the MDR monoclonal antibody
17F9, and then a secondary IgG2b antibody
conjugated to FITC, as described below.
Figure 10: PCR from peripheral blood with MDR-
specific primer. Lanes 1-9 show the
signal obtained from 75~g of mouse
peripheral blood DNA obtained 50 days
post-translation with bone marrow exposed
to producer cell lines expressing MDR (the
arrow at left indicates the expected size
band); lanes PC and Cl contain the same
amount of peripheral blood DNA from
untreated mice; G+ is DNA from 8 x 105
MDR producer cells. PB is a PBR marker
and G is a phiX marker.
Figures llA
and B: FACS analysis of MDR-expressing macrophage-
granulocyte population in MDR-transplanted
mouse bone marrow cells. Bone marrow cells
~ were obtained by flushing the,femurs and tibias
WO94/09120 '~ PCT/US93/09988
~ 5~ -8- ~
of an MDR-transplanted mouse with ~-MEM media.
The red blood cells were lysed, and the
r~;n;~g cell pcpulation stained with the 17F9
MDR monoclonal antibody and a goat anti-mouse,
IgG2b, flourescein-conjugated secondary
antibody, as described below. The macrophage-
granulocyte population was determined by a gate
based upon forward and side scatter, and only
this population is represented. A: Bone marrow
~rom untrnasplanted mouse; B: bone marrow from
transplanted mouse; the distinct population to
the right of the gate shows (vertical line on
the graph) a one log greater MDR fluorsecence,
indicating significantly increased expression
of MDR over endogenous levels. This population
represents over 13% of the gated macrophage-
granulocyte cells.
Figures 12A
and 12B: A, B: Lanes 1-12; amphotropic MDR producer
clones, lane 13; phi X marker, lanes 14-
22; amphotropic MDR producer clones; lane
23; lxPCR negative control; lane 24; MDR
positive control, lane 25; GP+ENV Aml2
packaging cells, lane 26; phi X marker.
Figure 13: PCR of spleen DNA from transplanted mouse
using amphotropic MDR producers. 1: 11:
Phi X size marker; 2-3: negative
controls; 4: spleen DNA from mouse
transplanted with tissue transduced by
retroviral particles produced by the
amphotropic MDR produc~r cell lines, 5:
WO94/09120 2 1 ~ 6 9 2 9 PCT/US93/09988
.
_g_
positive control and 6-7: PCR controls.
Figure 14: MDR PCR analysis of transduced human bone
marrow cells. The arrow at the right
identifies the expected band. Lanes 1,2,
& 5 are negative controls. Lanes 3 & 4
are positive controls. Lanes 6,7,8, & 9
are MDR-transduced human bone marrow after
1,2,3, & 4 rounds of exposure to MDR
retroviral supernatants, respectively.
Figures 15A
and 15B: FACS of MDR HMNC
MDR transduced human marrow nucleated
cells (HMNC) and untransduced ~MNC were
stained with an MDR monoclonal antibody
17F.9 and then an lgG2b-FITC conjugated
secondary to look at p-glycoprotein
expression.
A. Untransduced HMNC: % of cells to the
right of the gate is 3.44%.
B. MDR transduced HMNC: % of cells to the
right of the gate is 24.9%.
Figure 16: MDR PCR analysis of transduced CD34+
cells. The arrow at the right identifies
the expected band. Lanes 1, 4, & 6 are
negative controls. Lanes 2 ~ 3 are
positive controls. Lanes 5 & 7 are MDR
tranduced CD34+ cells after 9 and 11 days
in culture with growth factors,
respectively.
W O 94/09120 - PC~r/US93/09988
2~.~6~ o- ~
8ummary of the Invention
This invention provides a mammalian retroviral producer
cell which comprises a retroviral packaging cell and a
retroviral vector comprising the human multiple drug
resistance gene. The packaging cell may be an ecotropic
or amphotropic cell. The vector comprising the multiple
drug resistance gene may further comprise a DNA sequence
corresponding to a second mammalian gene which may encode
a non-selectable phenotype, e.g., an insulin, ~-globin or
major histocompatibility gene.
Thi~ invention also provides a method of transducing a
target mammalian cell, e.g., a bone marrow cell,
lymphocyte or tumor cell, with the human multiple drug
resistance gene which comprises transducing the target
cell with retroviral particles produced by the mammalian
retroviral producer cell of this invention. This method
may further comprise transducing the target ~r~lian
cell with a non-selectable mammalian gene.
This invention further provides a method of introducing
the human MDR gene into a mammal which comprises
transducing suitable target cells, e.g., bone marrow
cells, from the mammal with retroviral particles produced
by the producer cell provided herein and then
readministering the cells to the mammal. This method may
further comprise transducing the mammal with a second
mammalian gene.
This invention still further provides methods of treating
a mammal afflicted with a cancer and of treating a mammal
afflicted with a disorder characterized by abnormal
WO94/09120 2 1 ~ 6 ~ ~ ~ PCT/US93/09988
expression of a non-selectable gene which involve
transducing suitable cells from the mammal with the human
MDR gene, contacting the transduced cells with an amount
of an MDR-responsive drug cytotoxic to cells not
expressing the MDR gene and then readministering the
successfully transduced cells to the mammal from which
they were isolated.
~G~æ9 -12- PCT/US93/09988
Detaile~ Doscription of the Invention
This invention provides a mammalian retroviral producer
cell which comprises a retroviral packaging cell and a
retroviral vector comprising the human multiple drug
resistance gene (hereinafter referred to as the MDR
gene). A "mammalian retroviral producer cell" is
constructed by transfecting retroviral packaging cells
with a retroviral vector. The retroviral packaging cell
comprises a plasmid or plasmid containing some, but not
all, of the nucleic acid sequences required for the
production of retroviral particles. The retroviral
vector is a vector which contains those retroviral
nucleic acid sequences necessary for the production of
retroviral particles which are not already in the
retroviral packaging cell. Thus, a "mammalian retroviral
producer cell" is a mammalian cell which contains all
those retroviral nucleic acid sequences necessary for
viral replication and packaging, and is therefore capable
of producing retroviral particles.
These retroviral particles can transduce mammalian cells
so that the retroviral genome integrates into the host
cells genome and is expressed by the host cell. The
retroviral particles produced by the mammalian retroviral
producer cell of this invention thus provide a vehicle
for introducing the MDR gene into recipient mammalian
cells.
With safe and efficient transfer of the MDR gene into
bone marrow cells, two types of experiments can be
performed. First, in patients with cancer not involving
the bone marrow, in which routinely high dose
W O 94/09120 2 1 4 ~ 9 2 ~ PC~r/US93/09988
-13-
chemotherapy is combined with autologous bone marrow
transplantation, the insertion of the MDR gene into bone
marrow cells will provide resistance to otherwise toxic
MDR-responsive chemotherapeutic agents. It has been
shown in MDR transgenic mice, that the administration of
daunomycin results in no change in their white blood cell
counts, while control animals have a marked decrease in
white blood cell counts (2, 15). Bone marrow cells
usually have low levels of MDR; thus, MDR gene insertion
may be a way of providing normal bone marrow cells w~th
MDR expression. This could lead to both resistance of
these cells to the toxic effects of subse~uent
chemotherapy and the generation of an enriched
population of MDR-expressing cells, which eventually
might be increased by exposure to MDR-responsive
chemotherapeutic agents. Amplification of the MDR gene
by drug selection of cells may also contribute to
increased MDR expression (16, 17).
Second, MDR may be used as an in vivo and in vitro
selectable marker which could be used to select for bone
marrow cells containing a nonselectable gene on the same
retroviral vector as the MDR gene. For example, bone
marrow cells containing the B-globin gene could be
selected for, in vivo and in vitro, by resistance to
chemotherapeutic agents if the MDR and B-globin genes
wer~ on the same retroviral vector. This would result in
enrichment of the population of bone marrow cells
containing and expressing both of these genes. Thus, one
could provide a unique in vivo and in vitro selection not
available using other markers such as neoR or dihydroflate
reductase (DHFR) due to their toxicity in man.
O94/09120 ~ -~ t PCT/US93/09988
2~ 469~ -14-
The retroviral producer cell may comprise an ecotropicretroviral packaging cell. An e-~tropic retroviral
packaging cell packages retroviral particles with a
limited range of infectivity, i.e., the particles can
only infect cells from the same, or closely related,
species of animal as the animal from which the packaging
cells were derived. Preferably, the ecotropic retroviral
packaging cell is the ecotropic retroviral packaging cell
designated GP+E86 (ATCC No. CRL 9642). In one embodiment
of this invention, the mammalian retroviral producer cell
comprises the GP+E-86 ecotropic retroviral packaging cell
and the pHaMDR/A retroviral vector (ATCC No. CRL 11164).
The retroviral packaging cell may also be an amphotropic
retroviral packaging cell. Amphotropic cells package
retroviral particles capable of infecting a broader
spectrum of cells than particles produced by an ecotropic
retroviral packaging cell, i.e., the retroviral particles
produced can infect cells derived from animals other than
the animal from which the packaging cell was derived.
Preferably, the amphotropic retroviral packaging cell is
the amphotropic retroviral packaging cell designated
GP+EnvAm12 (ATCC No. CRL 9641). In one embodiment of
this invention, the mammalian retroviral producer cell
comprises the GP+EnvAml2 amphotropic retroviral packaging
cell and the pHaMDR/A retroviral vector (ATCC No. CRL
11165).
The GP+E86 retroviral packaging cell, the GP+envAm12
retroviral packaging cell, the retroviral producer cell
comprising the GP+E86 packaging cell and the pHaMDR/A
retroviral vector (ATCC No. CRL 11164) and the retroviral
producer cell comprising the GP+envAml2 packaging cell
W~94/09120 2 1 ~ 6 ~ 2 ~ Pcr/US93/09988
--15--
and the pHaMDR/A vector (ATCC No. CRL 11165) have been
deposited on October 16, 1992 with the American Type
Culture Collection, 12301 Rockville Pike, Rockville,
Maryland, 20852-1776, and are available under the above-
5 identified ATCC Accession numbers.
The construction of a producer cell as either an
ecotropic or an amphotropic producer cell will be
determined by the nature of the retrovirus whose
10 sequences were used to construct the producer cell. Both
the GP+E86 and the GP+EnvAml2 cells were constructed by
transfecting mouse NIH 3T3 with two plasmids containing
retroviral sequences. Methods of transfecting mammalian
cells with retroviral vector plasmids, e.g., by calcium
15 phosphate transfection or electroporation, are well known
to those skilled in the art. Each of the two plasmids
contain a retroviral 5' LTR and neither contains a
retroviral 3' LTR or a functional retroviral psi
packaging sequence, necessary for packaging of retroviral
20 genomes into retroviral particles. One of the plasmids
contains the env gene from a retrovirus while the other
plasmid contains the gag-pol genes from the same
retrovirus. The GP+E86 ecotropic cell was constructed
with Moloney Murine Leukemia Virus (MoMuLV) nucleic acid
25 sequences. The GP+EnvAml2 amphotropic cell was
constructed using nucleic acid sequences from the 4070A
amphotropic murine leukemia virus.
The retroviral vector may be a plasmid, cosmid, phage or
30 any other type of vector capable of containing retroviral
nucleic acid sequences and suitable for the transfection
of mammalian recipient cells. Presently preffered
retroviral vectors are plasmid-based retroviral vectors.
O94/09120 PCT/US93/09988
~ ~ ~G~ ~g -16-
A retroviral vector useful with either the GP+E86 orGP+EnvAml2 cells, described hereinabove, will contain
retroviral 5' and 3' LTRs from the same or a similar
retrovirus whose nucleic acid sequences were used to
construct the packaging cell, a functional psi packaging
sequence from the same retrovirus and the human MDR gene.
In the presently preferred em~odiment of this invention,
the retroviral vector is the pHaMDR/A vector (see Figure
l). pHaMDR/A is a Harvey virus-based vector comprising
retroviral 5' and 3' LTRs, a psi packaging sequence, the
ampiciliin resistance gene and human MDR cDNA.
The retroviral vector may further comprise a DNA sequence
corresponding to a second mammalian gene. The second
mammalian gene is derived from mammalian cells and
encodes a protein normally expressed in mammalian cells.
The second mammalian gene may be a cDNA sequence operably
linked to a promoter of DNA expression or a genomic DNA
sequence. In one embodiment of this invention, the
second mammalian gene is a gene encoding a non-selectable
phenotype. As used herein, a "non-selectable phenotype"
means the expression of a gene which cannot be selected
for by any of the conventional means, i.e., with drugs,
heat or other conventionally used selection pressures.
A non-selectable phenotype means that systems containing
a mixture of cells, some of which contain cells positive
for the non-selectable phenotype and some of which are
negative, cannot be manipulated by conventional means
such that only cells positive for the non-selectable
phenotype survive the manipulation. Genes encoding a
non-selectable phenotype useful in accordance with the
practice of this invention include insulin, B-globin and
major histocompatibiltiy genes. However, the practice of
W~ 94/09120 172 1 ~ 8 9 2 ~ PCT/US93/09988
this invention is not limited to the insertion of only
these genes into the retroviral vector. Other mammalian
genes suitable for inclusion in a retroviral vector and
insertion into a mammalian cell are also encompassed by
the practice of this invention.
The second mammalian gene will be packed by the
retroviral packaging cell into retroviral particles by
virtue of its inclusion in the retroviral vector.
Selection of retroviral packaging cells capable of
producing a sufficiently high titer of retroviral
particles enables the cell to be used in a method of
transducing a recipient cell with the gene of interest.
These recipient mammalian cells can be exposed to MDR-
responsive drugs (e.g., colchicine, anthracyclines,taxol, VP-16, etoposides). Such exposure will result in
the selection of cells sucessfully transduced with the
MDR gene and which express the MDR glcyoprotein on their
surfaces. The selected cells should also contain the
second mammalian gene.
As discused hereinabove, this invention provides a cell
which produces retroviral particles comprising the human
MDR gene. Accordingly, this invention also provides a
method of transducing a target mammalian cell with the
human multiple drug resistance gene, which comprises
culturing the target mammalian cell in the presence of
the mammalian retroviral producer cell provided herein
under conditions permitting production of retroviral
particles by, the producer cell and transduction of the
target mammalian cell by the retroviral particles; and
contacting the target r~mmAlian cells with an MDR-
responsive drug in an amount cytotoxic to cells which do
W094/09120 ~6~9 -18- PCT/US93/0998 ~
not express the multiple drug resistance gene.
"Suitable target cells" are those cells which can be
isolated from a mammal, cultured and then transduced with
retroviral particles produced by the producer cell
provided herein such that they will express genes
contained in the transduced nucleic acid. Such cells
include bone marrrow, lymphocyte or tumor cells.
However, the practice of this invention is not limited to
only these cells, but encompases any mammalian cells with
the above-described properties. Methods of obtaining such
cells from mammals are well known to those of ordinary
skill in the art. For example, bone marrow cells can be
withdrawn from a bone, e.g., the femur of a mammal using
a syringe and placed in a heparinized flask prior to
processing and establishing in culture. Culture
conditions permitting production of retroviral particles
and their transduction of recipient mammalian cells are
also well known to those skilled in the art. Conditions
suitable for using the retroviral producer cell provided
herein to transduce MELC and mouse bone marrow cells are
described below.
As described hereinabove, the method provided by this
invention comprises contacting the target mammalian cells
with an MDR-responsive drug in an amount cytotoxic to
cells which do not express the multiple drug resistance
gene. Thus, the method provided herein involves the
selection of cells based on their expression of the MDR
glycoprotein. This protein functions as an energy-
dependent efflux pump for MDR-responsive drugs so that
the drugs are not cytotoxic to the cells. Accordingly,
an "MDR-responsive drug" is: (1) a drug which is
WO94/09120 2 1 ~ ff ~2~ PCT/US93/09988
--19--
cytotoxic to cells which do not express the MDR
glycoprotein in sufficient amounts to serve as an energy-
dependent efflux pump for the drug and thereby ward off
the cytotxic effects of the drug; and (2) a drug which is
not cytotoxic to cells which express enough of the MDR
glycoprotein on their surfaces to be resistant to the
drug. The MDR-responsive drug may be selected from the
group of MDR-responsive drugs consisting of colchicine,
vinca alkaloids, anthracyclines, etoposides and taxol.
However, other drugs for which the MDR glycoprotein may
serve as an energy-dependent efflux pump are also
encompassed by the practice of this invention.
For the purposes of this method, a "cytotoxic amount" of
an MDR-responsive drug is any amount of the drug which,
when added to a culture of cells transduced with the
human MDR gene, is effective to induce the death of cells
not expressing the gene but which is not toxic to cells
expressing the MDR gene. The determination of cytotoxic
amounts of MDR-responsive drugs will depend upon a number
of factors involving the type of recipient cell
transduced and the particular MDR-responsive drug used.
Such factors are well within the knowledge of one of
ordinary sk~ll in the art or may readily be determined by
routine experimentation. Amounts of colchicine cytotxic
to transduced mouse cells are described below.
The retroviral vector used in accordance with the
practice of this invention may further comprise a second
mammalian gene in addition to the MDR gene. This second
mammalian gene will be packaged into retroviral particles
along with the MDR gene and therefore, recipient cells
transduced with the MDR gene will also be transduced with
W094/091~0 PCT/US93/09988
~ 20-
this second mammalian gene. Accordingly, the method of
transducing a target mammalian cell with the human MDR
gene may further comprise transducing the target cell
with a second mammalian gene.
This invention provides a method of introducing the human
MDR gene into a mammal which comprises isolating suitable
target cells from the mammal; transducing the suitable
target mammalian cells with the human multiple drug
resistance gene according to the method disclosed
hereinabove; and readministering the transduced target
cells to the mammal from which they were isolated.
Presently preferred mammals are the mouse and human.
However, the practice of this invention is not limited to
these mammals, but includes any mammal from which cells
may isolated, transduced and then readministered. As
disclosed hereinabove, target mammalian cells suitable
for use in accordance with the practice of this invention
include, but are not limited to, bone marrow cells,
lymphocytes or tumor cells. The MDR-responsive drug may
be selected from the group of MDR-responsive drugs
consisting of colchicine, vinca alkaloids,
anthracyclines, etoposides and taxol. However, other
drugs for which the MDR glycoprotein may serve as an
energy-dependent efflux pump are also encompassed by the
practice of this invention. Furthermore, the method of
this invention provides a reliable way of introducing a
non-selectable gene, e.g., an insulin, ~-globin or major
histocompatiblity gene, into a mammalian cell. In
addition, the MDR gene may be amplified in a cell by
exposure of the cell to successively higher levels of an
MDR-responsive drug. The non-selectable gene may be
amplified along with the MDR gene since the two genes
W~ 94/09120 2 1 ~ 6 9 2 ~ PCT~us93~Q9988
-21-
were introduced into the cell on the same piece of DNA.
Accordingly, the method of this invention may be used to
introduce a non-selectable gene into a mammalian cell and
to increase the number of copies, by gene amplification,
of the gene being expressed in the cell.
This invention also provides a safe method of introducing
the human MDR gene as compared to other available
methods.
This invention provides a method of treating a ~Arr~l
afflicted with a cancer which comprises introducing the
human MDR gene into the mammal according to the method
provided hereianbove, followed by administering to the
mammal an MDR-responsive drug in an amount cytotoxic to
cancer cells in the mammal. Mammals which may be treated
for cancer according to this practice may be a mouse,
human or any other mammal from which cells can be
isolated and readministered, where those cells can be
transduced with retroviral particles and where the
transduced cells will express the human MDR gene in the
mammal. The types of cancer contemplated for treatment
by the method provided herein are any cancers wherein the
tumor cells are susceptible to MDR-responsive drugs and
include, but are not limited to, lymphomas, leukemias and
sarcomas.
As described hereinabove, an "MDR-responsive drug" is:
(1) a drug which is cytotoxic to cells which do not
express the MDR glycoprotein in sufficient amounts to
serve as an energy-dependent efflux pump for the drug and
thereby ward off the cytotxic effects of the drug; and
(2) a drug which is not cytotoxic to cells which express
WO94/09120 2~ 22- PCT/US93/09988
enough of the MDR glycoprotein on their surfaces to be
resistant to the drug. MDR-responsive drugs useful for
treating mammalian cancers in accordance with the
practice of this invention include anthracyclines, vinca
alkaloids, etoposides and taxol. However, the practice
of this invention is not limited to these drugs, but will
include other drugs which can be administered to mammals,
are cytotoxic to ~m~lian tumors, but which are also not
cytotoxic to cells which express enough of the MDR
glycoprotein on their surfaces to be resistant to the
drug.
For the purpose of the cancer treatment method provided
herein, an "amount of an MDR-responsive drug cytotoxic to
cancer cells in a mammal" is any amount of the the MDR-
drug cytotoxic to cancer cells. The specific amount of
an MDR-responsive drug which will be cytotxic to cancer
cells in a mammal will depend upon a number of factors
regarding the drug, the individual and the cancer. Such
factors are routinely taken into account when
establishing chemotherapeutic protocols for the treatment
of cancers and therefore, the specific amounts of MDR-
responsive drugs cytoxic to cancer cells in accordance
with the practice of this invention are well known to
those of ordinary skill in the art or may readily be
determined by them without undue experimentation.
A problem encountered with the use of these drugs to
treat cancers is that the drugs will induce the death of
the target tumor cells and also of normal cells, e.g.,
bone marrow cells, which have properties similar to those
possessed by the tumor cells which make them susceptible
to the drugs. The method provided herein has the
2~ Pcr/us93/o9988
W~ 94/Ogl20 -23-
advantage of protecting the normal cells against the
action of MDR-responsive drugs by providing the cells
with the MDR glycoprotein prior to their exposure to the
drugs.
This invention provides a method of treating a mammal
afflicted with a disorder characterized by abnormal
expression of a non-selectable gene, which comprises:
isolating suitable target cells from the mammal;
culturing the suitable target cells with the mammalian
retroviral producer cell provided herein, wherein the
retroviral vector comprises the human MDR gene and a
second mammalian gene, under conditions permitting
production of retroviral particles by the producer cell
and transduction of the target cells by the retroviral
particles; contacting the transduced target cells with an
amount of an MDR-responsive drug cytotoxic to cells which
do not express the MDR gene; and readministering the
transduced target cells to the animal from which they
were isolated.
The mammals which may be treated in accordance with the
practice of this invention are mammals from which cells
can be isolated, transduced with retroviral particles and
readministered to the mammal from which they were
isolated. Such mammals include, but are not limited to,
a mouse or human.
"Abnormal expression" of a gene, as used herein, means
expression of the gene either in insufficient amounts of
functional gene product to meet the physiological needs
of the mammal or in amounts of functional product in
excess of the needs of the mammal.
,
PCT/US93/09988
W094/09120
~ 24-
Preferably, if the mammal expresses a gene in
insufficient amounts, the second mammalian gene
introduced into the mammal will be the gene expressed in
insufficient amounts. Cells successfully transduced with
the MDR gene and expressing sufficient amounts of the MDR
protein on their surfaces will be resistant to the
effects of MDR-responsive drugs. Cells not transduced
with the gene, or expressing insufficient amounts of the
MDR protein on their surfaces, will not be resistant.
Exposure of a population of cells to an MDR-responsive
drug will therefore result in the selection of cells
transduced with, and expressing, the MDR gene. The
second mammalian gene may, but is not required to be, an
insulin, B-globin or major histocompatibility gene. For
example, if a patient suffers from a blood disorder,
e.g., sickle cell anemia or B-thalassemia, characterized
by insufficient expression of functional B-globin due to
a defect in the B-globin gene, cells from the patient's
bone marrow may be isolated and transduced with a
functional ~-globin gene. The transduced bone marrow
cells are then exposed to an MDR-responsive drug,
resulting in the selection of those cells transduced with
the MDR gene and expressing the MDR protein on their
surfaces. These cells should also have been transduced
with the second mammalian gene. The successfully
transduced cells are reintroduced into the mammal from
which the cells were isolated. The method provided
herein thereby results in expression of the transduced B-
globin gene and provision to the mammal of functional
hemoglobin. This method may also be practiced with a
mammal and an insulin gene to restore functional
expression of insulin, and thereby treat the mammal's
diabetes. Other disorders characterized by abnormal
W~ 94/09120 2 1 ~ 92~CT/US93/o9988
-25-
expression of a gene, where such abnormal expression can
be corrected by the expresssion of a transduced gene may
also be treated according to the method provided by this
invention. Knowledge of disorders which can be treated
by supplying a functional gene product in the correct
amount are well known to those skilled in the art.
As disclosed hereinabove, "abnormal" gene expression may
also be overexpression of the gene product. The
treatment of disorders characterized by overexpression of
a gene according to the method provided herein may
include the use of a retroviral vector containing the
human MDR gene and a second DNA sequence. The second DNA
sequence may encode antisense RNA sequence. The
antisense RNA sequence will be complementary to an RNA
sequence in the messenger RNA synthesized by the gene
which is overexpressed. The antisense sequence will
therefore be able to block translation of the messenger
RNA, thereby lowering the amount of functional product
expressed. The DNA sequence encoding the antisense RNA
sequence will be operably linked to a promoter of DNA
expression. This promoter may be a selectable or
otherwise controllable promoter. Use of such a promoter
will allow for regulation of the syntheis of the
antisense RNA sequence such that only the necessary
amount is made. The antisense RNA may then be made in
amounts sufficient to correct the overexpression of the
gene but not to the extent that the gene then synthesizes
an insufficient amount of product. One type of
controllable promoter will be a promoter which is
regulated by a drug. Expression of a DNA operably linked
to such a promoter may then be controlled in a mammal by
controlling the amount of drug administered to the
WO94/09120 ~9 PCT/US93/09988
~ 26-
mammal.
The method provided by this invention comprises
contacting target mammalian cells transduced with the
human MDR gene and a second mammalian gene with an MDR-
responsive drug and then readministering the cells to the
mammal from which they were isolated. The method may
further comprise determining which of the target cells
successfully transduced with the MDR gene express the
product of the second gene with which the cells were
transduced. The population of cells readministered to
the mammal will thereby be enriched for cells expressiong
both the MDR gene and the second mammalian gene.
This invention provides a method of introducing the human
MDR gene into a mammal, e.g., a mouse or human, which
comprises isolating suitable target cells from the
mammal; culturing the target cells in the presence of the
mammalian retroviral producer cell under conditions
permitting production of retroviral particles by the
retroviral producer cell and transduction of the target
cells by the retroviral particles; administering the
target cells to the mammal from which they were isolated;
and administering to the mammal an MDR-responsive drug in
an amount cytotoxic to cells which do not express the
human MDR gene at a suitable interval of time after
administration of the target cells to the mammal. The
target cells may, but are not required to, be bone marrow
cells, lymphocytes or tumor cells. The method provided
by this invention may further comprise introducing a non-
selectable gene into the mammal.
As disclosed hereinabove, methods of isolating and
2 ~ 4 6 9 29 P,~/US93,09988
WO94/09120
-27-
administering suitable target cells to mammals, e.g., by
withdrawing or injecting bone marrow cells from the
femur, are well known to those of ordinary skill in the
art. Culture conditions permitting production of
retroviral particles by the retroviral producer cell and
transduction of the cultured target cells by the
retroviral particles are also well known to those of
ordinary skill in the art. Conditions suitable for the
culture and transduction of MELC and mouse bone marrow
cells are described below.
As disclosed hereinabove, an MDR-responsive drug is (1)
a drug which is cytotoxic to cells which do not express
the MDR glycoprotein in sufficient amounts to serve as an
energy-dependent efflux pump for the drug and thereby
ward off the cytotxic effects of the drug; and (2) a drug
which is not cytotoxic to cells which express enough of
the MDR glycoprotein on their surfaces to be resistant to
the drug. For the purposes of the method of the method
provided herein, a "cytotoxic amount" of an MDR-
responsive drug is any amount of the drug which, when
added to a culture of cells transduced with the human MDR
gene, is effective to induce the death of cells not
expressing the gene but which is not toxic to cells
expressing the MDR gene. The determination of cytotoxic
amounts of MDR-responsive drugs will depend upon a number
of factors involving the type of recipient cell
transduced and the particular MDR-responsuve drug used.
Such factors are well within the lnowledge of one of
ordinary skill in the art or may readily be determined by
routine experimentation.
.
Furthermore, a "suitable interval" of time between
WO94/09120 ~ PCT/US93/09988~
~S9~9 -28-
readministration of target cells transduced with the
human MDR gene and administration of an MDR-responsive
drug is any amount of time sufficient to allow for
establishment of the cells such that the cells will be
resistant to the MDR-responsive drugs. MDR-responsive
drugs useful in accordance with the practice of this
invention must be safe for administration to mammals.
Examples of such MDR-responsive drugs include, but are
not limited to, anthracyclines, vinca alkaloids,
etoposides and taxol. The suitable interval of time will
depend upon a number of factor regarding the mammal
treated, the target cells isolated and the MDR-responsive
drug administered, which are well known to one of
ordinary skill in the art or may readily be determined by
routine experimentation.
This invention will be better understood from the
Experimental Details which follow. However, one skilled
in the art will readily appreciate that the specific
methods and results discussed are merely illustrative of
the invention as described more fully in the claims which
follow thereafter.
~ 2 ~ PC~r/US93/09988
W ~ 94/09120
-29-
erimental Det~ il8
F~rst sQries of ea~Periments
Materials and Methods:
MPR Retroviral Producer Lines
Ecotro~ic Producer Cells:
Five x 105 GP+E86 packaging cells were transfected using
calcium phosphate coprecipitation with 10 ~g of the
retroviral vector pHaMDR/A plasmid (Figure 1) (14, 18).
Transfected cells were selected in Dulbecco Modified
Essential Media (DME) with 10% fetal calf serum (FCS) and
1% Penicillin-Streptomycin (Sigma) containing 60 ng of
colchicine/ml for 14 days. Forty eight colchicine-
resistant clones were isolated in MDR-transfected cells
while none were seen in transfected cells. The resistant
cells were grown and titered for viral production on NIH
3T3 cells. Titering was performed as follows: one ml of
undiluted viral supernatant was used at sequential
dilutions (with media) between 1:1 and 1:10~. The
supernatant was layered on 5 x 104 naive 3T3 fibroblasts.
Eight ~g/ml of polybrene was added and the cells
incubated at 37 and 5% C02 for 2 hours; 5 ml of media was
added after 2 hours. 48 hours later, the cells were
trypsinized and transferred to 100 mm tissue culture
dishes and single colonies counted at 14 days. Titers
were determined in duplicate using colchicine selection
(60 ng/ml) (2, 14).
Genomic DNA was made from the ten clones with the highest
titer. DNA was digested with EcoRI, separated on a 1%
agarose gel and transferred by the Southern blot method.
W O 94/09120 - ~ PC~r/US93/09988 ~
~ 9 -30-
Blots were probed with a 3.4 kb EcoRI fragment of the
human MDR cDNA labelled with 32p by nick translation.
.
GP+E86 and GP+E86-pHaMDR/A cells were trypsinized and
transferred to petri dishes for 18 hours in HXM
(hypoxanthine-xanthine myvophenolic acid) media to
recover. The cells were analyzed by FACS (fluorescence-
activated cell sorting) to quantiate the amount of MDR
glycoprotein expressed on the cell surface. The cells
were stained with the MDR monoclonal antibody 17F9
(l~g/106 cells) for 20 minutes on ice. 17F9 (Dr. David
Ring, Cetus Corporation) recognizes an external epitope
of the MDR glycoprotein (19). The cells were again
washed with lXPBS-3%FCS and rec~spended in 300~1 lXPBS-
3%FCS. Analysis was performed on a FACS (Becton-
Dickson).
AmPhotro~ic Producer Cells:
Amphotropic packaging cells were transduced with virus
from the highest titer ecotropic MDR producer line.
GP+EnvAml2 (17) (titer = 5 x 104) were seeded in a 6 cm
dish. Twenty hours later, the viral supernatant from
semi-confluent ecotropic producer cells was harvested,
passed through a .45 micron filter and 0.5 ml applied to
amphotropic cells. Polybrene (8 ~g/ml) was added to
supernatants to enhance transduction. After two hours at
37C, 4.5 ml of media was added to cells. Forty eight
hours later, the cells were trypsinized and divided among
96 wells in media containing 60 ng/ml of colchicine.
After four weeks, 24 clones were removed and transferred
to 6-cm dishes.
W~ 94J09120 2 1 ~ 6 9 2 9 PC~r/US93/09988
-31-
Clones were analyzed for the presence of the MDR vector
by PCR analysis using MDR-specific primers (21). DNA
lysates were prepared from transduced clones (22). PCR
was carried out with 25 ~l of lysate, one unit of
AmpliTaq polymerase, .2~M dNTPs, 20 micromolar primers
and PCR buffer (Perkin Elmer) in a final volume of 50 ~Ll.
Reactions were amplified for 35 cycles; each cycle
included 30 seconds of denaturation at 94C, 30 seconds
of annealing at 55C and one minute of extension at 72C.
Ten ~l of each reaction was ex~;ned on a 4% agarose-
NuSieve gel for the presence of the amplified 167 bp
product (see Figure 12).
Titers of colony forming units (CFUs) for each
amphotropic producer clone were determined as follows.
NIH 3T3 cells ( 5 x 104 ) were seeded in a 6 cm dish.
Twenty hours later, the viral supernatants from clones of
semi-conlfuent amphotropic MDR producers were passed
through 0.45 micron filters and 1 ml of supernatant was
applied to the cells. Forty eight hours later, the cells
were trypsinized and plated onto a 10 cm dish in media
containing 60 ng/ml colchicine. Cells were counted 10-14
days later. Titers ranged from 0 - 1.5 x 104 CFU/ml of
viral supernatant.
Infection of MELC Cells:
MELC were infected with undiluted supernatant from the
highest titer producer line (5 x 104 viral particles/ml)
(14, 23). Five x 105 non-adherent MELC in log phase were
plated in 60 mm dishes and exposed to 5 ml of the viral
supernatants with the addition of polybrene 8 ug/ml.
After 48 hours, infected MELC were recovered and placed
W O 94/09120 ' PC~r/US93/09988
~ 9 -32-
in selection media containing 2 ng/ml of colchicine in 96
well tissue culture dishes. Half the volume of media was
replaced every 3 days. Resistant clones were identified
by a change in media color and inspection under an
inverted microscope. Individual MELC clones resistant to
colchicine were isolated by serial dilutions on 96 well
plates (23, 24). These clones were grown, and every 2
weeks the cells were resuspended in media containing 2 to
2. 5 times the previous concentration of colchicine, to a
maximum of 600 ng/ml of colchicine.
DNA Analysis:
Southern blotting (25) was performed after extraction of
genomic DNA from normal and transduced MELC lines.
Guanidine isothiacyanate (GIT) was added to 3 x 107 cells
and cesium chloride (CsC1) gradient centrifugation was
performed at 32,000 rpm x 21 x 19 hr. DNA was
precipitated with 95% cold ethanol after addition of NaC1
to 0.3 M. Resuspended DNA was digested with proteinase K
at 1 mg/ml, then extracted with phenol and choroform-
isoamyl alcohol; DNA was quantified by W absorption at
260 A. DNA was digested with XhoI which cuts once
within the provirus to determine the number of
integration sites, and with NheI which cuts in the LTRs
to determine the presence and relative intensity of the
inserted retroviral vector.
RNA Analysis:
RNA obtained after GIT and CsCl gradients was resuspended
in DEPC treated HzO and analyzed. Gels containing 1.2%
agarose, 1% formaldehyde and lx MOPS were prepared; each
well was loaded with 5 ~g total RNA in 6% formaldehyde
and 50% formamide in a volume of 25 ~1 and mixed with 5
~ 94/091~0 2 1 ~ 6 ~ 2 9 PCT/Us93/09988
-33-
~1 running dye. Gels were run at constant voltage, 5V/cm
for 3 hours in 10x MOPS running buffer. Overnight
transfer to nitrocellulose and subsequent procedures were
done as described (22, 23). Ethidium bromide staining
was used to determine the integrity of the RNA by
inspection of the gels. Radioactive probes for
hybridizations were prepared by EcoRI digestion of an MDR
plasmid containing 1.2 kb of the MDR cDNA clone (2, 14);
this fragment representing the 5' end of the MDR cDNA was
isolated and labeled by nick translation with 32p.
Fluorescence Cell Sortinq (FACS) Analvsis:
The MDR monoclonal IgG2b antibody 17F9 was used to
determine the amount of MDR on the surface of parental
untransduced MELC and MDR-transduced MELC clones. MELC
grown in log phase were washed twice by spinning at 400g
x 10 minutes and resuspended in lx PBS. Cells were
resuspended in Ab 17F9 (1 ~g/106 cells) and incubated for
20 minutes on ice. Suspensions were washed with ice cold
lx PBS, 3% FCS, 0.2% NaN3, pH 7.4 and centrifuged at 400g
for 10 min at 4C. Cells were then resuspended and
incubated with fluorescein conjugated rat anti-mouse
IgG2b (1 ~g x 106 cells) for 20 minutes on ice.
Suspensions were again washed with lx PBS, 3%FCS, 9.2%
NaN3 and the pellet resuspended in 400 ~l. Samples were
analyzed for linear mean fluorescence on a FACS Star Plus
(Beckton-Dickinson).
Safety Testing:
Filtered unailuted supernatants from transduced MELC
clones were tested for the presence of intact free
recombinant MDR retrovirus after varying times in culture
(4-14 weeks) by exposure to naive 3T3 cells. The
W O 94/09120 ~- =' PC~r/US93/09988
2 ~ 4 6 ~ ~ 9 -34-
appearance of colchicine resistance in these 3T3 cells
was used to determine whether intact recombinant
retrovirus was generated.
Bone Marrow TransPlantation:
Marrow was harvested from the hind legs of 12 week old
C57BL/6J mice forty eight hours after administration of
5-fluorouracil (500 mg/kg of body weight). Aliquots of
harvested bone marrow (3 X 106 cells) were cocultured by
layering them onto 100 ml sized plates of semiconfluent
GP+E86 producer cells containing the MDR gene (5).
Cocultures were incubated for 24-48 hours in 10 ml of
~MEM media containing 15% fetal calf serum, 15% WEHI
conditioned medium, 1% Pen/Strep (Gibco Labs), polybrene
(2 ,ug/ml) and Il-6 (200 U/ml). In some experiments, stem
cell factor (SCGF; K. Zsebo, Amgen) was used. The
unattached bone marrow cells were aspirated and
concentrated by centrifugation at 800 g for 10 minutes,
then counted in a hematocytometer using acetic acid and
trypan blue to determine the number of viable nucleated
cells. Finally, aliquots of 1-2 x 106 viable nucleated
cells in 0.5 ml or less of ~MEM media were collected in
1 cc tuberculin syringes and kept at room temperature, in
preparation for injection into irradiated mice (usually
less than six hours after removal). Recipient C57BL/6J
mice (6-12 weeks old) were irradiated with 975 rad from
a gamma source; donor marrow as then infused slowly
through the central tail vein of the recipients (5).
Recipient mice were maintained in sterile cages and
continued on a regimen with tetracycline started three
days prior to irradiation and transplantation. These
conditions were maintained for a minimum of two weeks
post-transplantation.
94/0912~ 2I ~ ~ ~ 2 ~ PCT/US93/09988
-35-
GP+EnvAml2pHaMDR/A clone 21, with a titer of 1.5 x 10~,
was used to infect mouse bone marrow cells, which were
then injected into lethally irradiated mice as described
above. Five mice were sacrificed at twelve days post-
5 transplantation and spleen DNA was isolated. The spleen
DNA was subjected to PCR analysis, conducted as described
above.
AnalYsis of TransPlanted Mice:
For the detection of the MDR gene in live recipient mice,
- polymerase chain reaction (PCR) analysis was used with
the appropriate MDR cDNA probes (21). Seventy five
microliters of peripheral blood were obtained from the
recipients' tail veins and collected in microhematocrit
capillary tubes. The tubes were then spun for about four
minutes in a microhematocrit centrifuge to obtain the
"buffy coat" containing nucleated white blood cells
(WBCs). These buffy coat cells were treated with a lysis
buffer to remove contaminated red blood cells and then
incubated with proteinase K (.06 mg/ml) at 55C for one
hour, followed by 95C for ten minutes (to inactivate the
proteinase K). Both salt/ethanol-precipitated DNA, or
DNA lysate directly, were used in the MDR PCR reaction.
PCR was carried out with 25 ~1 of DNA solution containing
one unit of AmpliTaq polymerase and the appropriate
reaction kits (Perkin Elmer/Cetus) in a final volume of
50 ~1. We used 35 PCR cycles; each cycle included 15
seconds of denaturation at 94C, 15 seconds of annealing
at 55C and .one minute of extension/synthesis at 72C.
MDR-specific sequences were amplified using the sense-
strand primer CCCATCATTGCAATAGCAGC (residues 2596-2615;
SEQ ID. N0.: 1) and the antisense-strand primer
WO94/09120 ;`- PCT/US93/09988
2~ ~6~ 36-
GTTCAAACTTCTGCTCCTGA (recidues 2733-2752; SEQ ID. NO.: 2)
which yield a 167 bp product (21). Ten ~l of the PCR
product was e~;ned on a 4% agarose-NuSieve gel for the
presence of the expected band.
Bone marrow cells from sacrificed recipients were
obtained by flushing the femurs and tibias of mice with
~MEM media. Red blood cells were lysed for 30 seconds
with cold dH2O, following which isotonicity was restored
with 3.5% NaCl. The remaining population of nucleated
cells was stained with the MDR monoclonal antibody 17F9
(l ~g/lO6cells), following the above-described procedure.
W ~ 94/09120 2 1 4 ~ ~ 2 9 PC~r/US93/09988
-37-
~erimental Results:
Transfer of the MDR qene into MELC:
Uninfected MELC plated on 96 well plates with 2 ng/ml
colchicine yielded no resistant clones. By contrast
clones were isolated using transduced MELC. In one
experiment, 4 wells showed growth at 14 days. Subsequent
limiting dilution and growth led to the isolation of a
single colchicine resistant clone. Southern blot
analysis confirmed clonality by showing a single
integration of the MDR gene (Figure 2). Other clones
were subsequently isolated by limiting dilution. Some of
the clones show either multiple viral insertions or the
presence of multiple resistant clones in the same culture
well (Figures 2 and 3).
~xpression of the MDR gene:
RNA analysis of these resistant clones by Northern blots
show significant levels of MDR mRNA in comparison to
untransduced MELC (Figure 4). Four of the ME~C clones
(#1,2,3,5) growing in media containing 2 ng/ml colchicine
were analyzed by FACs for their MDR expression (Table 1,
see below). Linear mean fluorescence values of these
clones were 7. 63 to 19.45 times above the low level
fluorescence seen with untransduced MELC grown in
nonselective media (Table 1). These values indicate
significant expression of MDR p-glycoprotein on the
surface of the cells.
WO94/09120 PCT/US93/09988
-38-
,9
TABLB 1
Effects of Increased ConcentrAtion~ of Colchicine
on P-glycoprotein ExpreQsion on the 8urface of MDR
Tr~nsduced MELC
Linear Mean Fluorescence
Fold Increase
Unstained IqG-FITC MDR-FITCin ExPression
Controls 1.48,2.00 1.59,3.77 1.46,3.12 1.00,1.00
15Clone 1
2ng/ml 1.89 2.13 27.96 8.95
lOng/ml 1.32 1.50 22.57 15.44
300ng/ml 2.41 2.97 84.55 27.20
20Clone 2
2ng/ml 1.66 2.43 38.87 12.44
5ng/ml 1.65 1.84 15.51 10.61
300ng/ml 2.14 3.36 102.1 32.69
25Clone 3
2ng/ml 1.88 2.18 23.54 7.53
lOng/ml 1.63 1.97 20.14 13.78
300ng/ml 2.02 2.85 80.88 25.89
30Clone 5
5ng/ml 1.91 2.07 28.42 19.45
20ng/ml 1.32 1.58 45.24 30.96
300ng/ml 2.60 3.16103.31 33.08
600ng/ml 2.13 2.90151.00 48.35
After exposure to progressively higher concentrations of
colchicine ranging from 5 to 600 ng/ml, several highly
resistant MELC clones were obtained. The high resistance
levels of these cell lines as compared to the parental
cell lines we show to correlate with 1) amplification of
the MDR gene tFigure 5); 2) increased MDR mRNA (Figure
6); and 3) increased expression of MDR glycoprotein on
the cell surface (Figure 7, Table 1). The increment in
the intensity of the DNA bands observed in Southern blots
2I ~ ~ 29 Pcr/US93,09988
WO94/09120
-39-
of MELC maintained at greater concentrations of
colchicine is due to an increase in the number of copies
of the MDR gene since the total amount of DNA in each
well is the same (5 ~g) an increase in the proportion of
MDR mRNA is evidenced by the increased intensity of the
bands in Northern blots. FACS analysis indicates a
progressive increase in linear fluorescence of clones
exposed to greater concentrations of colchicine. Clones
1, 2 and 3 showed 3.0, 2.6 and 3.5 times greater
expression o~ p-glycoprotein on the cell surface as they
were subjected to increasing amounts of colchicine from
2 ng/ml to 300 ng/ml. Clone 5 was sequentially subjected
to up to 600 ng/ml colchicine and expression of p-
glycoprotein on MELC increased with each higher
concentration (Table 1, Figure 7).
SafetY testinq of MELC Clones:
Transduced MELC were checked periodically for the
presence and secretion of wild type MDR-containing
retroviruses by exposure of native 3T3 cells for 48 hours
to MELC supernatants from clones grown for 4, 8 and 14
weeks. The absence of colchicine resistant 3T3 colonies
after 14 days in selection media with 60 ng/ml of
colchicine as described (18) indicates the absence of
wild type recombinant virus in transduced MELC.
The High Level Producer Cell Line:
The high level producer ecotropic cell line was
characterized by Southern blot (Figure 8), showing that
there was significant integration of the human MDR gene
into the genome of these cells. The high level of
expression of the MDR P-glycoprotein on the surface of
these cells was demonstrated by FACS analysis, conducted
WO94/09120 2~ 469~ -40- PCT/US93/09988
as described above (see Figure 9). Other antibodies,
which recognize internal epitopes of the MDR protein and
were used to quantitate MDR protein expression, gave high
background staining levels with cells that had not been
transduced with the human MDR gene.
~PR Gene Transfer and Ex~ression In Live Mice:
Several different batches of irradiated mice transduced
with bone marrow containing the human MDR gene were
analyzed both for their content of the MDR gene and for
expression of the integrated gene over time. Table 2
(see below) shows results from all of the mice analyzed.
Over 90% of the mice analyzed between 14 and 50 days post
translation contained the MDR gene, as demonstrated by
MDR PCR analysis of tail vein blood (see Figure l0 and
Table 2). MDR analysis by PCR was continued in some of
these animals for up to eight months. In the animals
surviving to eight months, approximately 20% contained
high MDR levels (Table 2).
Z 1 4 6 9 2 9 Pcr/US93/o9988
WQ94/09120
~ -41-
-
TABLE 2
PCR An~ly8i8 of Mice Tr~n~duced ~ith the Hum~n MDR ~ene
No. of S
Age Cells Hours of C PCR
Mouse (weeks) x lo6 Coculture F I II m
Ex~eriment 1
1 8 l.S 24 - + +
2 8 l.S 24 - + +
3 8 l.S 24 - + + +
4 8 1.5 24 - + +
8 1.5 24 - + +
6 8 1.5 24 - + + +
lS 7 8 1.5 24 - + + +
8 8 1.5 24 - +
9 8 1.5 24 - + +
Experiment 2
12 1.7 48 - n.t. +
11 12 1.7 48 - n.t. +
12 12 1.7 48 - n.t. +
13 12 1.7 48 - n.t. +
14 12 1.7 48 - n.t. +
12 1.7 48 - n.t. +
Ex~eriment 3
16 8 1.5 48 + + + +
17 8 1.5 48 + +
18 8 3 48 + +
19 8 6 48 - + +
8 6 48 - + +
Experiment 4
21 6 3 48 + n.t. +
22 6 3 48 + n . t.
23 6 1.5 48 + n.t.
24 6 1.5 48 + n.t. + +
6 6 48 + n.t. + +
26 6 6 48 + n.t.
27 6 6 48 - n. t .
PCT/US93/09988
WO94/09120
~69~9 -42-
At eight months some of the animals were sacrificed, and
the marrow analyzed for the content and expression of the
human MDR gene by PCR, Southern blot and FACS analysis.
Southern blot analysis from one of these animals
demonstrated significant content of the MDR gene in the
bone marrow cells. FACS analysis of the bone marrow
cells of this mouse was performed using conditions which
excluded long lived lymphocytes from the sort procedure
by size and morphology. The cells analyzed were
predominantly granulocytes. In this mouse a distinct
population representing approximately 14% of the total
nonlymphocyte granulocyte pool contained significantly
increased levels of MDR protein (Figure 5). The results
indicate that in this animal, bone marrow stem cells were
clearly transduced since mature granulocytes containing
high levels of MDR protein were present as long as eight
months post transplantation. This occurred even without
further selection by exposure to MDR-responsive drugs
such as taxol and daunomycin which has been shown in
transgenic animals to increase MDR expression. Figure 12
shows the results of the PCR analysis of spleen DNA from
mice infected by the producer cell GP+EnvAml2pHaMDR/a.
A 167 bp product has been amplified in all the spleen DNA
samples from the transplanted mice and not in the control
samples, indicating that the mice have been successfully
transplanted with MDR transduced marrow.
WO94/09120 ~1 4 6 g 2 9` PcT/us93/o9988
-43-
Experimental Discussion:
Retrovirally mediated gene transfer is an efficient
mechanism to both stably transduce target cells and
produce significant expression of the transduced genes.
In these experiments we have shown that human MDR cDNA is
capable of transducing the MDR phenotype into MELC
initially sensitive to colchicine. The transduced MELC
clones show integration of the full sized retroviral gene
construct and expression of intact human MDR mRNA. FACS
analysis using an MDR monoclonal antibody (17F9 Ab) is
able to clearly distinguish between untransduced and
transduced clones. There is some variability of baseline
mRNA expression and mean fluorescence of FACS among
individual clones maintained in 2 ng/ml of colchicine.
This may be due to integration of the MDR gene into
different sites of chromosomal DNA.
Resistant MELC clones subjected to higher concentrations
of colchicine increase their level of MDR genes, mRNA,
and protein expression. Because we see greater intensity
bands on Southern blots and increased mRNA levels in the
same clones, we believe these are due to DNA
amplification as demonstrated by others (16, 17).
Howe~er, the contribution of other mechanisms such as an
increase in the transcription rate, or decreased rates of
MRNA or protein degradation cannot be excluded. The use
of the 17F9 monoclonal antibody directed against an
external epitope of the human MDR glycoprotein allows us
to distinguish accurate~y between resistant and sensitive
MELC. This antibody recognizing an external epitope of
MDR has a distinct advantage over other antibodies
recognizing internal epitopes since the latter require
permeabilizing the cells (27).
WO94/09120 ~ PCT/US93/09988
2~69~ ~44~
The absence of any contaminating intact helper
recombinant retrovirus in our experiments show that even
with amplification of the transduced MDR gene, the
retroviral producer lines used are safe. This reaffirms
the results previously obtained using our packaging lines
(18, 20). Thus, this system offers the promise of safe
and efficient retroviral gene transfer into erythroid
cells and high level expression of genes such as MDR.
In two experiments, MELC were fluorescently labelled with
MDR monoclonal antibody 17F9 and analyzed on a FACS Star
Plus (Becton Dickinson). Linear mean fluorescence was
determined and shown above. Two negative control samples
of untransduced MELC were analyzed by FACS and the values
from both samples are listed above. These untransduced
MELC controls are sensitive to media containing 2 ng/ml
of colchicine. All other samples were grown in
colchicine-containing media, the concentrations being
given above. Column 1 samples were not labelled with
antibody and the linear means represent low level
autofluorescence of the MELC samples. Column 2 samples
were labelled only with a fluorescein (FITC) conjugated
rat anti-mouse IgG2b secondary antibody. Linear mean
values indicate a low level of non-specific binding of
this secondary antibody to MELC. Column 3 samples were
labelled with the MDR 17F9 (IgG2b isotype) and the
fluorescein conjugated secondary antibody. Linear mean
values indicate significant increases in p-glycoprotein
expression on the cell surface of MELC. Column 4
represents ratios of MDR MELC clones linear mean values
to untransduced MELC control linear means. These ratios
indicate the increase in MDR expression on the MELC
clones over those of untransduced MELC, as well as the
2 1 ~ 6 9 2 9 Pcr/US93/09988
WO94/09120
-45-
increase in expression of individual clones subject to
increasing concentrations of colchicine.
There has been some concern about the efficiency of gene
transfer into bone marrow stem cells, especially in
experiments involving the human beta globin gene (16,
17). We have shown that a human gene (MDR) cDNA,
contained in retroviral vector, in an appropriately high
titer producer cell line clearly leads to relatively
efficient and long term transduction of mouse bone marrow
cells. These results do not quite match those obtained
using a neoR containing retrovirus (14, 18, l9, 23-26).
However, this may be due to the relative differences in
retroviral titer between MDR producer cells (lO5) and neoR
producer cells (lO~, lO7).
The data presented herein indicate that bone marrow stem
cell infection is possible with appropriate retroviral
vectors and producer lines containing human genes. The
use of l) long term bone marrow culture to provide
repeated infection by retrovirus; 2) isolated stem cells
to provide higher virus to cell ratios, and 3) growth
factors leading to stem cell proliferaticn in these
population are additional steps that can be used to
increase retroviral gene transfer (5, 6). In the case of
isolated bone marrow populations, containing the majority
of hematopoietic stem cells, it has already been shown
that the presence of growth factors, primarily stem cell
factor and IL3 and IL6, causes an increase in the number
of proliferating stem cells available for retroviral gene
transfer (7, 8). The use of in vitro or in vivo
selection of transduced bone marrow cells expressing high
levels of MDR is possible by exposure of the cells to MDR
WO94/09120 ~ 9 PCT/ US93/09988
21~G9 -46-
responsive chemotherapeutic agents.
The use of MDR in patients with advanced cancer
undergoing autologous bone marrow transplantation in
association with high does chemotherapy appears to be a
feasible first clinical trial of this therapeutic
modality. Subsequent experiments using the MDR gene as
a selectable marker would be done in order to permit the
appropriate transfer and expression of a nonselectable
gene such as the human beta globin gene into patients
with sickle cell anemia or thalassemia. The focus would
be curing these patients by enriching their bone marrow
population for cells containing and expressing the human
beta globin gene. If this strategy was successful, then
this methodology could be applied to other genetic
diseases in which the gene of interest is not selectable.
WO94/09120 2 1 ~ ~ 9 2 9 PCT/US93/09988
-47-
References of the preceding sections:
1. Gottesman, M. and Pastan, I.: The Multidrug
Transporter, A Double-Edged Sword. J. Biol. Chem.
263: 12163, 1988.
2. Galski, H., Sullivan, M., Willingham, M.C., Chin,
K., Gottesman, M. and Pastan, I.: Expression of a
Human Multidrug Resistance cDNA (MDR1) in the Bone
Marrow of Transgenic Mice: Resistance to
Daunomycin-Induced Leukopenia. Mol. Cell Biol. 9:
4357, 1983.
3. Mann, R., Mulligan, R.C. and Baltimore, D. Cell, 33:
153-59, 1983.
4. Cone, R. and Mulligan, R.C. Proc. Natl. Acad. Sci.,
81: 6349-53, 1984.
5. Hesdorffer, C., Ward M., Markowitz, D. and Bank, A.
DNA & Cell Biol., 9: 717-23, 1990.
6. Miller, A.D. Blood, 76: 271-78, 1990.
7. Joyner, A., Keller, G., Phillips, R.A. and
Bernstein, A. Nature, 305: 556-58, 1983.
8. Miller, A.D., Jolly, D., Friedman, T. and Verma, I.
Science, 225: 630-32, 1984.
9. Williams, D., et al. Nature, 310: 476-80, 1984.
10. Dick, J.E., et al. Cell, 42: 75-9, 1985.
~ PCT/US93/09988
WO94/09120
9 -48-
11. Keller, G., Paige, C., Gilboa, E. and Wagner, E.F.
Nature, 318: 149-55, 1985.
12. Dzierzack, A.E., Papayannopoulou, T. and Mulligan,
R.C. Nature, 331: 35-41, 1988.
13. Bender, M.A., Gelinas, R.E. and Miller A.D. Mol.
Cell Biol., 8: 1725-35, 1988.
14. Pastan, I., Gottesman, M., Ueda, K., Lovelace, E.,
Rutherford, A. and Willingham, M.: A Retrovirus
Carrying an MDRl cDNA Confers Multidrug Resistance
and Polarized Expression of P-glycoprotein in MDCK
Cells. Proc. Natl. Acad. Sci. 85: 4486, 1988.
15. Pastan, I. and Gottesman, M. Ann. Rev. Med., 42:
277-86, 1991.
16. Shen, D, Fojo, A., Robinson, I.B., Richert, I.V.,
Pastan, I. and Gottesman, M.: Human Multidrug
Resistant Cell Lines: Increased MDRl Expression Can
Precede Gene Amplification. Science, 232: 643,
1986.
17. Germann , A., Gottesman, M. and Pastan, I.:
Expression of a Multidrug Resistance-Adenosine
Deaminase Fusion Gene. J. Biol. Chem. 264: 7418,
1989.
18. Markowitz, D., Goff, S. and Bank A.: A Safe
Packaging Line for Gene Transfer: Separating Viral
Genes on Two Different Plasmids. J. Virol. 62:
1120, 1988.
WO94/09120 ~1 4 6 9 2 9 PCT/US93/09988
-49-
19. Aihara, M., Aihara, Y., Schmidt-Wolf, G., Schmidt-
Wolf, I., Sikic, B.I., Blume, K.G. and Chao, N.J.:
A Com~ined Approach for Purging Multidrug-Resistant
Leukemic Cell Lines in Bone Marrow Using a
Monoclonal Antibody and Chemotherapy. Blood 77:
2079, 1991.
20. Markowitz, D., Goff, S. and Bank, A.: Construction
and Use of a Safe and Efficient Amphotropic
Packaging Cell Line. Viroloqy 167: 400, 1988.
21. Noonan, K.E., et al. Proc. Natl. Acad. Sci., 87:
7160-64, 1990.
22. Higuchi, R.: Perkin Elmer/Cetus Newsletter.
Amplifications 2: 1, 1989.
23. Lerner, N., Brigham, S., Goff, S. and Bank, A.:
Human B-Globin Gene Expression After Gene Transfer
Using Retroviral Vectors. DNA 6: 573, 1987.
24. Rund, D., Dobkin, C. and Bank, A.: Regulated
Expression of Amplified Human B-Globin Genes. Blood
70: 733, 1987.
25. Al~Ch~l, F.M., et al: Current Protocols in Molecular
Bioloqy. John Wiley and Sons, 1989.
26. Sanbrook, J., Fritsch, E.F. and Maniatis, T.:
Molecular Clonning, 2nd Ed., Cold Spring Harbor
Laboratory, vol. 1, 1989.
27. Kartner, N., Evernden-Porelle, D., Bradley, G. and
WO94/09120 PCT/US93/09988
2 ~69~ -50-
Ling, V.: Detection of P-glycoprotein in Multidrug-
Resistant Cell Lines by Monoclonal Antibodies.
Nature 316: 820, 1985.
28. Herzig, G: Autologuous Bone Marrow Transplant in
Solid Tumors. Hematol. 9: 1-24, 1981.
29. Peters, W.P., Shall, E.J., Jones, R.B., Olsen, G.A.,
Bast, R.C., Gockerman, J.P. and Moore, J.O.: High-
Dose Combination Alkylating Agents With Bone Marrow
Support as Initial Treatment for Metastatic Breast
Cancer. J. Clin. Oncol. 6: 1368, 1988.
30. Podda, S., Himelstein, A., de la Flor-Weiss, E.,
Richardson, C., Deloherty, T., Ward, M. and Bank,
A.: Transfer of the MDR Gene into Irradiated Mice
Using Retroviral Vectors. Blood 78: 208A, 1991.
31. Sorrentino, B.P., Brandt, S., Gott~s~n, M., Pastan,
I., Bodine, D. and Nienhius, A.W.: Positive
Selection In Vivo for Hematopoietic Cells Expressing
the Multidrug Resistance Gene Following Retroviral-
Mediated Gene Transfer. Blood 78: l91A, 1991.
5 32. Markowitz, D., Goff, S. and Bank, A.: A Safe
Packaging Line For Gene Transfer. J Virol, 62:
1120-25, 1988.
33. Gros, P., Ben-Neriah, Y., Croop, J. and Housman, D.
Nature, 323: 728-31, 1986.
34. Bernstein, I.D., Andrews, R.G. and Zsebo, K.M.
Blood, 77: 2316-21, 1990.
WO94/09120 2 1 4 6 g 2 ~ PCT/US93/09988
35. Migliaccio, G., et al. Proc. Natl. Acad. Sci., 88:
7420-24, 1991.
36. Bodine, D.M., Karlsson, S. and Nienhuis, A.W. Proc.
Natl. Acad. Sci., 86: 8897-8901, 1989.
37. Luskey, B.D., et al. In: Sixth Cooley's Anemia
symPosium (A. Bank ed.). Annals of the New York
Academy of Sciences, vol. 612, pp398-406, 1990.
WO94/09120 PCT/US93/09988
2~ 469~9 -52-
8econ~ 8eries of ExPeriments
Applicants have transduce~ human bone marrow cells
obtained from marrow harvests for future autologous bone
marrow transplantation (ABMT) with applicants' highest
titer (5 X 10~ particles/ml) amphotropic producer line,
A12M1 retrovirus (Figure 14-16). Supernatants from A12M1
have been used instead of co-culture with MDR producer
cells to avoid potential contamination of the bone marrow
with the producer cells, an undesirable side-effect in
clinical use. In one set of experiments, applicants have
cultured Ficoll-separated nucleated bone marrow cells
(NBMC) from whole marrow for 24 hours with media
containing 10% fetal calf serum, 10 units/ml IL-3, 200
units/ml IL-6, and 50 units/ml human SCF (a gift from
AMGEN) (Ward et al. Transfer and expression of the MDR
gene in CD34~ cells. ASH abstract 1993; 1). The NBMC were
then exposed to A12M1 supernatants for 4-8 hours, 3-4 X,
over 48 hours to optimize retroviral transfer by
providing an excess virus over cells (usually 2-4 X 107
viral particles/10~ cells). PCR with MDR primers from
different exons yields a unique 157 basepair band
transduced integrated MDR cDNA; the endogenous human MDR
gene containing exons gives either no signal or a band of
larger size. A positive MDR PCR signal was obtained
after A12M1 supernatants are exposed to human bone marrow
(Figure 14). In addition, applicants have shown that
increasing the number of changes the supernatant
increases the PCR signal as excess virus is needed (1)
(Figure 14). By analysis of BFU-E from transduced
marrows, 10-50% of colonies contain and express MDR as
assayed by: 1) MDR PCR of individual colonies; and 2)
Resistance of colonies to 50 ng/ml of colchicine-
21~6~
WO94/09120 PCT/US93/09988
-53-
resistant. In other experiments, six of 12 and five of
12 individual BFU-E were MDR PCR-positive after
transduction. Applicants have also demonstrated that 20-
25% of human marrow cells transduced with MDR express the
MDR protein at increased levels by FACS analysis (Figure
15). Applicants have also used CD34+ cells and can show
MDR transduction in these cells as well (1) (Figure 16).
In more recent experiments, applicants have shown that
fibrinectin plates serve as an excellent substrate for
the maintenance of CD34+ transduction (Ward, Richardson,
Hesdorfer and Bank, Blood, abstract, submitted August,
1993, to be published November, 1993). In these studies,
CD34+ cells are grown on fibrinectin plates Collaborative
Research) for 48 hrs in the presence of IL-3, IL-6 and
SCF and are transduced with A12Ml supernatants twice over
the next 24 hrs. At this time, 10 to 50% of BFU-E plated
are MDR PCR positive. The transduced cells are then
expressed to G-SCF and GM-CSF for and additional 3-7
days. In two experiments, FACS analysis at this time
shows 5 and 9% of the expanded cell population have
increased levels of MDR; the signal of MDR PCR is also
increased at this time.
GP+envAM-12 packaging cells have been shown to be safe by
their use with the IL-2 gene in human melanoma cells in
culture (2), and ADA gene in monkey marrow transfer
experiments (3), and in applicants' studies with MDR of
A12Ml cells (4, 5). Reverse transcriptase assays, Mus
dunni co-culture studies, utilization of supernatants on
naive 3T3 cells, have been used in these experiments.
The GP+envAM12 packaging cells have been approved by the
RAC and FDA for use with the IL-2 gene to treat patients
W O 94/09120 ~4~g~9 -54- PC~r/US93/09988
with malignant melanoma (2). The RAC approved the use of
A12M1 supernatants in June 1993.
Applicants have used several different assays to test for
intact retroviruses in supernatants of the applicants'
MDR amphotropic producer cells (A12M1) to be used in the
proposed protocol. A 3T3 amplification assay with A12M1
supernatants has consistently been negative by reverse
transcriptase. The supernatants of transduced human bone
marrow cells is also negative. In addition, applicants
have grown A12M1 cells in co-culture with Mus dunni cells
and assayed the supernatants by the S+L- assay and shown
that there is no helper virus by this sensitive assay.
The latter assay has also been repeated by
Microbiological Associates and shown to be negative (see
below).
Mus dunni assay:
The mus dunni assay was performed in the following
manner. Two hundred thousand mus dunni cells were plated
in a tissue culture dish with five ml McCoys' media, ten
percent fetal calf solution and five percent penicillin
and streptomycin. The following day, two hundred
thousand producer cells were irradiated with 3500 rads
and plated onto the mus dunni cells.
Cells were split one to ten weekly for five weeks. After
this period of time, supernatants from the cultures were
retrieved and frozen prior to further testing. This
supernatant was called Sup-1. The S+L- assay was also
performed by Microbiological Associates (Sup-1), and
similarly using PG4 cells in the experiments shown in the
following Table 3.
WO94J091202 I 4 0 9 ~ ~ PCT/US93/09988
-55-
~ 3
Summary of Safety Data
Supernatant tested AssaY Result
Amphotropic 4070A stL- 2.0-3. Ox107
foci
GP+EnvAml2 S~L- negative
GP+EnvAm12 MDR producer S+L- negative
Mus Dunni S+L- negative
Mus Dunni cocultured w/
irradiated MDR producers S+L- negative
Blood plasma from untrans-
planted mouse S+L- negative
Blood plasma from ampho-
tropic MDR mouse trans-
plant S+L- negative
3T3 RT negative
GP+EnvAml2 RT positive
GP+EnvAml2 MDR producer RT positive
Mus Dunni RT negative
Mus Dunni cocultured w/
irridated MDR producers RT negative
Blood plasma from untrans-
planted mouse RT negative
Blood plasma from ampho-
tropic MDR mouse trans-
plant RT negative
The data below are derived from a report by the
Microbiological Associate Inc.
The test article, SUP-1, defined above, was tested for
the presence of murine retroviruses ~y the feline S+L-
WO94/09120 PCT/US93/09988
~69~ -56- ~
focus assay. No foci was observed in any of the plates
exposed to the test article indicating that no murine
retrovirus was detected using the S+L- assay described in
this report.
Feline S+L- (PG-4) cells are susceptible to infection with
many strains of mammalian retroviruses including such
viruses as murine xenotropic viruses, mink cell focus
forming viruses and some primate and feline leukemia
viruses. The broad range of susceptibility of the feline
S+L- cell, therefore, provides a sensitive assay for those
retroviruses.
8TUDY INFORMaTION
Title: In Vitro Detection of Murine Retroviruses
by Feline S+L- Focus Assay
Study Number: ZH431.009200
Test Article: SUP-1 was received at Microbiological
Associates, Inc. on 05/04/93.
Determination of the stability, purity and
concentration of the test article is the
responsibility of the sponsor.
Control Articles:
Positive Control: Murine amphotropic virus (4070A)
Lot No.: AL011293
Source: Microbivlogical Associates,
Inc.
W~ 94/09120 2 1 ~ 6 9 ~ ~ Pc~r/US93/09988
Negative Control: McCoy's 5A medium
Lot No.: RV041493H
Source: M i c r o b i o l o g i c a l
Associates, Inc.
Vehicle Control: None
Test System: Feline S+L- cells
Passage No.: 15
Source: Source: National Cancer Institute
Bethesda, Maryland
Testing Facility: Biotechnology Dervices Division
Microbiological Assocaites, Inc.
Life Sciences Center
9900 Blackwell Road
Rockville, Maryland 20850
Study Completion See Study Director's Signature Date,
in the "Approvals" Section.
M~,~8
Objective:
The study objective is to determine whether retroviruses
are present in the test article as determined by the
development of foci in feline S+L- cells.
Methods:
8+L- Ass~y:
The S+L- cel~s were maintained and infected for the focus
assay according to SOP OPBT0775 as follows: cells were
inoculated with 0.2 ml of test or control material
following a 30 minute pretreatment with DEAE-dextran.
W O 94/09120 PC~r/US93/09988
2 ~ 4 6 ~ ~ 9 -58-
After approximately 2 hours adsorption, inocula were
removed and cultures overlaid with culture medium.
Plates were refed as necessary and maintained until foci
developed in the positive control.
Positive control for 8+L- Focus Fos~ning Activity:
The Type C retrovirus used as a positive control was
murine amphotropic virus (4070A) propogated in NIH/3T3
cells at Microbiological Associates, Inc.
RE8ULT8
The test article was test undiluted (0.2 ml per plate) on
S+L- cells. Positive control plates infected with
amphotropic virus and unifected negative control plates
were run in parallel with the test article.
Microscopic examination of the plates of feline S+L- cells
treated with SUP-1 revealed no foci indicating the
absence of murine retorvirus detectible by the S+L- focus
assay, see Table 4.
No foci were observed in the negative control and the
positive control had a focus count within two standard
deviations of the mean titer of the positive control lot.
CONCL~8ION8: The test article, SUP-1, was tested for the
presence of murine retrovirus by the feline S+L- focus
assay. No foci were observed in any of the plates
exposed to the test article indicating that no murine
retrovirus was detected using the S+L- assay described in
this report.
WO 94/09120 ~ PCr/US93/09988
--59--
TABLF 4
S+L- Focus Assay
on SUP-1
Sample Dilution Foci/Mean Foci/ FFU/ml*
(0.2 ml/plate) Plate Plate
Test Article None 0,0,0,0,00 o
Positive 2x10-5 37,65,4545 l.lx107
Control 40,38
lX10-5 20,14,20,18 g.Ox106
19,18
5x10-6 18,13,15,14 1.4x107
12,14
2.5x10-6 8,6,6,12,4 7 lX107
Negative
Control None 0,0,0,0,00 0
25 * FFU/ml = (Mean #foci/plate) x Volume/Plate x Dilution
W O 94J09120 PC~r/US93/09988
~6~9 -60- ~
T~BLE OF MDR-1 TRAN8D~CTION
OF CDR34+ ~EPARTATED C~LL8
~ c~r.~. TYPE # PLATED BFU-El CFU-G~2 Fo~
NO.1 FICOLLED 2.5X105 45 2
CD34+ 2.5X104 125 15 +
NO. 2FICOLLED 2.5X105 56 15
CD34+ 2.4X104 204 49 +
NO. 3FICOLLED 2.5Xl05 186 18
CD34+ 2.5Xl04 118 15 +
NO. 4FICOLLED 2.5X105 410 24
CD34+ 2.5X104 221 31 +
NO. 5FICOLLED 2.5X105 141 11
CD34+ 2.5X104 131 31 +
NO. 6FICOLLED 2.5X105 320 30
CD34+ 2.5X104 1395 1g3 +
NO. 7FICOLLED 2.5Xl05 593 21
CORD CD34+ 2.5Xl04 1327 76
24 HRS 989 40
48 HRS 1026 78 +
72 HRS 852 72 +
NO. 8FICOLED 34+ 2.5X105 490 18
CORD CD34+ 2.5X104 440 48
24 HRS 410 46
48 HRS 347 32 +
72 HRS 290 38 +
96 HRS 194 22 +
EXPERIMENTS 1-6 CD34+ Cells exposed to 72 hours incubation
with A12M1 viral supernatant.
EXPERIMENTS-7,8 CD34+ cells exposed to 24-96 hours
incubation with viral supernatant.
1BFU-E colonies obtained
2CFU-GEMM colonies obtained
3MDR-PCR result to indicate transduction of cells by A12M~.
viral supernatant.
WO94/09120 2 1 ~ ~ ~ 2 g PCT/US93/09988
-61-
References of the Second Series of Experiments:
1. Ward, M., Hesdorffer, C., Smith, L., de la Flor-
Weiss, E., Podda, S., Richardson, C., Gottesman, M.,
Pastan, I., Bank, A., Blood Suppl., 80:239A, 1992,
(Abstract)
2. Gansbacher, H., Zier, K., Cronin, K., et al. Blood,
80:2817-2825, 1992.
3. Bodine, D., Moritz, T., Luskey, B., et al. Blood
Suppl., 80:72A, 1992 (Abstract)
4. Podda, S., Ward, M., Himelstein, A., Richardson, C.,
de la Flor-Weiss, E., Smith, L., Gottesman, M.,
Pastan, I., Bank, A., Proc. Natl. Acad. Sci.,
U.S.A., 89:9676-9680, 1992.
5. de la Flor-Weiss, E., Richardson, C., Ward, M.,
Himelstein, A., Smith, L., Podda, S., Gottesman, M.,
Pastan, I., Bank, A., Blood, 80:3106-3111, 1992.
PC~r/US93/09988
W O 94/09120
-62-
9~9
SEQUENCE LISTING
(1) GENERAL INFORMATION:
(i) APPLICANTS: Arthur Bank, et al.
(ii) TITLE OF INVENTION: RETROVIRAL MEDIATED TRANSFER
OF THE HUMAN MULTIPLE DRUG
RESISTANCE GENE
(iii) NUMBER OF SEQUENCES: 2
(iv) CORRESPONDENCE ADDRESS:
(A` ADDRESSEE: Cooper & Dunham
(B STREET: 30 Rockefeller Plaza
(C CITY: New York
(D, STATE: New York
(E) COUNTRY: USA
~F) ZIP: 10112
(v) COMPUTER READABLE FORM:
(A) MEDIUM TYPE: Floppy disk
(B) COh~ul~K: IBM PC compatible
(C) OPERATING SYSTEM: PC-DOS/MS-DOS
(D) SOFTWARE: PatentIn Release ~1.24
(vi) CURRENT APPLICATION DATA:
(A) APPLICATION NUMBER: Not Yet Known
(B) FILING DATE:
(C) CLASSIFICATION:
(viii) ATTORNEY/AGENT INFORMATION:
(A) NAME: White, John P.
(B) REGISTRATION NUMBER: 28,678
(C) REFERENCE/DOCKET NUMBER: 41074-A-PCT/JPW/AKC
(ix) TELECOMMUNICATION INFORMATION:
(A) TELEPHONE: (212) 9?7-9550
(B) TELEFAX: (212) 977-9809
(C) TELEX: 422523 COOP UI
(2) INFORMATION FOR SEQ ID NO:l:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: base pairs
(B) TYPE: nucleic acid
WO94/09120 2~89~ PCT/US93/09988
-63-
(C) STRANDEDNESS: single
(D) TOPOLOGY: unknown
(ii) MOLECULE TYPE: DNA
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:l:
CCCATCATTG CAATAGCAGC 20
(2) INFORMATION FOR SEQ ID NO:2:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: unknown
(ii) MOLECULE TYPE: DNA
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:2:
GTTCAAACTT CTGCTCCTGA 20
