Note : Les descriptions sont présentées dans la langue officielle dans laquelle elles ont été soumises.
Wo 95/17198 2 1 7 8 7 ~5 PCT/US94/14813
A NOVET. TTT~Tr)R SUPPP~SOR ~li!~TT.'
This application is a continuation-in-part of
U.S. Serial No. 08Jl7o, 586 filed December 20, l993, the
contents of which are hereby incorporated by ref erence into
5 the present disclosure.
.
RA~'T ~'R~Tr--~ OF TT~TT" lNvb ~
This invention is in the f ield of tumor
suppressor genes (anti-~n~-o~PnP~) and relates in general to
products and methods for practicing broad-spectrum tumor
suppressor gene therapy of various human cancers. In
particular, the invention relatea to methods for treating
tumor cells (l) administering vectors comprising a nucleic
acid sequence coding for the novel protein referred to
herein as H-NI~C or (2) administering an effective amount of
l~ a protein coded for by the nucleic acid sequence.
Cancers and tumors are the second most prevalent
cause of death in the United States, causing 450,000 deaths
per year. One in three Americans will develop cancer, and
one in five will die of cancer (Scientific American
Medicine, part 12, I, l, section dated 1987) . While
substantial progress has been made in identifying some of
the likely enviL~ t~l and hereditary causes of cancer,
the statistics for the cancer death rate indicates a need
for substantial; ~ LUV~ t in the therapy for cancer and
related disease~ and disorder.
A number of so-called cancer genes, i.e., genes
that have been implicated in the etiology of cancer, have
been ;rlPnti~;Prl in connection with hereditary forms of
cancer and in a large number of well-studied tumor cells.
3 o Study of cancer genes ~as helped provide some understanding
of the process of tumorigenesi~. While a great deal more
remains to be learned about cancer genes, the presently
WO95117198 21 78745 PCrlUSg~/14813
kAown cancer genes serve as uæe~ul models ~or uAderstanding
tumorigenesis .
Cancer genes are broadly classified into
"oncogenes~ which, when activated, promote tumorigenesis,
5 and "tumor suppressor genes" which, when damaged, fail to
suppress tumorigenesis. While these classifications
provide a useul method for concept~ ;7;n~ tumorigenesis,
it i8 also possible that a particular gene may play
differing roles depending upon the particular allelic orm
10 of that gene, its regulatory ~ , the genetic
background and the tisaue environment in which it is
operating .
One widely considered working hypothesis of
cancer is as follows: (l) Most o all human cancers are
15 genetic diseases and (2) they result rom the expression
and/or failure of expression of speciic genes (i.e. mutant
versions of normal cellular growth regulatory genes or
viral or other Eoreign genes in mammalian cells that cause
inappropriate, untimely, or ectopic expression o other
20 classes of vital growth-regulatory genes.
A simplistic view of the biologic basis for
neoplasia is that there are two major classes of oncogenes.
The first class conE;ists of mutated or otherwise aberrant
alleles of normal cellular genes that are involved in the
2~ control of cellular growth or replication. These genes are
the cellular proto- nroq-onP~. When mutated, they can encode
new cellular fuIlctions that disrupt normal cellular growth
and replicatioA. The consequence of these changes is the
production o~ ;n~nt-y expressed tumor phenotypes. In
30 this model of dr~m;n~ntly expressed oncogenes, a view that
ha3 ~LI 'C i n~ted since the emergence of the concept of the
genetic and mutational basis for neoplasia, it is ;r-~in~fl
that the persistence of a single wild-type allele is not
s11ff;-;~nt to prevent neoplastic changes in the
17198 ~ J1~ a PCT/USg4/14813
devf~ l program or the growth properties o~ the cell.
The genetic events responsible for the activation of these
oncogenes thereore might be envisioned as "single-hit"
events, The activation of tumorigenic activities of the
5 mye oncogene in Burkitt lymphoma, the expression of bcr-abl
rhi ' r~ gene product in patients with chronic myelogenous
leukemia, the activation of the H-ras and K-ras oncogenes
in other tumors represent some of the evidence for the
involvement of such transforming oncogenes in l ;n;t~l
lO human cancer. An approach to genetic-based therapy for
~, ;n~ntly expregged neoplastic disease presumably would
require specif ic shutdown or inactivation of expression of
the responsible gene.
Tumor suppre~EIor gene2~
A more recently discovered family of cancer-
related genes are the so-called tumor-suppressor genes,
sometimes referred to as antioncogenes, growth-suppressor,
or cancer-6uppressor genes. Recent research suggests
strongly that it is losa-of-function rn~lt~t;~nR in this
2 0 class of genes that is likely to be involved in the
devel ~ of a high percentage o human cancers; more
than a dozen good candidate human tumor-suppressor genes
have been identif ied in several human cancers . The - tumor-
suppressor genes involved in the pathogenesis of
25 rF~;nr~hl;~toma (rb), breast, colonic, and other carcinomas
(p53), Wilm' 8 tumors (wt) and colonic carcinoma (dcc) have
been ;~l~ntif;ed and cloned. Some aspects of their role in
human tumorigenesis have been ~l ue; rl~ted .
The retinoblastoma gene (RB) is the prototype
30 tumor suppressor. Mutation of the gene has been found in
a variety of human tumors (Bookstein and Lee, ~'~it. Rev.
Qn~QSL., 2:211-227 (l991); Goodrich and Lee, Bio--~;m.
BiQ~hys. ~tim, 1155:43-61 (1993); Riley et al., Arnll. Rev.
Cell Biol., 10:1-29 (1994) ) . Reintroduction o a single
Wo 95117198 2 1 7 8 7 4 5 PCTNSg~/14813
copy of normal RB into tumor cells suppresses their ability
to form tumors in nude ~mice (Huang et al., Sci~-nre,
242:1563-1566 ~(1988); Sumegi et al., Cell Growth Differ.,
1:247-250 (1990); Bookstein ~, Sci~nce, 247:712-715
(1990); Chen ~L., C.oll rrowth Differ.. 3:119-125 (1992);
Goodrich et al . Csln . Res . . 52 :1968-1973 (1992); T~k~hF-~h;
~, Proc. Natl. ~r~ Sci. US~, 88:5257-5261 (1991)).
In addition, microinjection o~ unphosphorylated Rb protein
into cells early in the Gl phase of the cell cycle blocks
10 progression into S phase, suggesting that Rb protein
participates fundamentally in the regulatory processes of
cell growth (Goodrich ~, ~11, 67:293-3D2 (1991) ) .
These results were further corroborated by recent
observations in lines of ~nr;in,o~red mice Overexpression
15 of Rb protein from a human RB transgene result3 in growth
retardation at the level of the organism (Bignon 5~,
Gen~ Dev. . 7:1654-1662 (1993) ) . Moreover, in mouse
embryos with complete ablation of functional Rb expression
by homozygous inactivation of the RB gene, dev~ is
20 halted 1- tllrely and the embryos die in utero (~ee
i~, 359:288-294 (1992); Jacks ~, ~, 359:295-
300 (1992~; Clarke 8~ al., ~, 359:328-330 (1992) ) .
These experiments provide essential data es~ ~hl i FIh;n~ the
importance of Rb protein in cell growth and differentiation
2 5 in vivo .
The RB gene encodes a nuclear protein which is
phosphorylated on both serine and threonine residues in a
cell cycle ~9~r~nrl~-nt manner (Lee ~Ll.., ~, 329: 642-
645 (1987); Bu~hkovich ~LL., ~11, 58:1097-105 (1989);
Chen ~, S~ll, 58:1193-1198 (1989); DeCaprio et al.,
.1, 58:1085-1095 (1989) ) . During the G1 phase of the
cell cycle when, ~ccor-iinr to microinjection experiments,
the protein is active, Rb exists in a hypophosphorylated
state (Goodrich ~, ~11, 67:293-302 (1991); Goodrich
and ~ee, ~, 360 :177-179 (1992) ) . Hypo~hrsphr,rylated
Rb also exists in the G0 phase. It appears to play a
21 78745 -
Wo 95/17198 PCT/USs4ll48l3
critical role in maintaining cells in this quiescent phase,
where they wait to respond to G~rtPrn;7l signals and make
decisions to enter the cell cycle or to differentiate
~Goodrich and Lee, Biorh;m. Bio7~hys. ArtA.. 1155:43-61
(1993); Pardee, A.B., Sci--nr~, 246:603-608 ~1989) ) .
During later G1, S, and M phases, .~b is
hyperphosphorylated, probably by members of the CDK family
of kinases (Lees ~LL,, T~7-1RO J.. 10:4279-4290 (1991); Lin
et al., E7~1RO J.. 10:857-864 (1991); .~u ~, Mol. Cell.
10 ~i~L, 12:971-980 (1992) ) . Phosphorylation of certain
residues of .~b seems to allow commitment of the cell to
proliferation. The phosphorylation pattern of 7.~b protein
is correlated with its function in growth inhibition, and
therefore a hypothesis currently accepted is that
15 phosphorylation negatively regulates the growth suppressing
function of the protein (.:~ollingsworth ~Ll ., Cul-r . o~; n .
Genet. Dev., 3 :55-62 (1993); Sherr, C. J., Tr~n,7 ~
Biol ., 4:15-18 (1994) ) . Dephosphorylation of the .~b
protein occurs in mid-M phase, and results in reactivation
20 of the protein prior to the next cell cycle. Evidence
strongly suggests that type 1 protein phosphatase is
critical for this r7~Fh~srhnrylation (Alberts ~LL., Proc
Natl. Ar;7-7. Sci. TT.q~, 90:388-392 (1993); Durfee rt al.,
Gen~7 Dev., 7 :555-569 (1993) ) .
The, ler7l1 ;7r ^h.7n;, by which ~b participates
in these cellular activities has not been completely
elucidated. A current model holds that .~b interacts with
many different cellular proteins and may execute its
functions through these complexes. If the function of .~b
protein is to -~;nt;7;n cells at G0/Gl stage, .~b must
~corral" and inactivate other proteins which are active and
essential for entering G1 progression (Lee ~, ~Q~,
LVI:211-217 (1991) ) . This "corral" hypothesis is
consistent with recent observations that an important
growth-onh;7nr;n~ transcriptional factor, E2F-l, is tightly
21 78745
wo 95/17198 PCTIUS94/14813
regulated by Rb in a negative fashion (Helin ~L, ~11,
70:337-350 (1992); Kaelin et al., ~11, 70:351-364 (1992~;
Shan ~, Mol. Cell. Biol.. 12:5620-5631 (1992~; Helin
et al., Mol. f~l1 . siol.. 13:6501-6508 (1993); Shan ~:L.,
5 Mol . Cell . Biol . . 14 :229-309 (1994) ) . The instantly
disclosed protein, H-NUC, binds to the Rb protein and thus
participation in the regulation of mitosis.
The fi l; i91 breast cancer gene, BRCA-l, has been
mapped at chromosome 17 q21-22 by linkage analysis. It iB
10 not clear whether this gene would behave as a tumor
suppressor or ~l i nAn~ oncogene. However, the gene
involved in human familial cancer ~y.~ such as Li-
~raumeni syndrome, p53, apparently acta as the classical
tumor suppressor; similarly, the 1088 of RB gene is
15 associated with hereditary retinoblastoma (Knudson, 1993,
~1~) .
Mult~ple Steps and Oncogenetic Cooperi3tlon
setween these two extre~e pictures of
transforming oncogenes and purely recessive tumor-
20 suppressor genes lie a number of additional - -^hi~n; I
apparently involved in the dev.ol ~ t of neoplastic
changes characteristic of many human tumors. It has been
assumed for many years that most human cancer are likely to
result from multiple interactive genetic de$ects, none of
25 which alone is sufficie~t but all of which are required for
tumor development to occur. ~he true roles of both the
cellular protooncogenes and the growth-regulating tumor-
suppressor genes in neoplasia of I l; i~n cells are
thought to represent a complex set of interactions between
30 these two kinds of genes.
Wo 95117198 2 1 7 8 7 4 5 PCT/US94/14813
STTMMA~Y OF TTT~ 1 N V ~ )N
This invention i8 based on the discovery of a
nucleic acid molecule ~n~QAin~ a novel protein (H-NUC)
5 having tumor suppression capability. The nucleic acid
molecule has been mapped to the q21-22 region of chromosome
17. The properties of H-NUC (amino acid sequence derived
from the full length cDNA; ability to bind DNA and activate
transcription; reaLld~ly or loss of the coding sequence
10 in some breast tumor cell lines) are all consistent with
the identity of H-NUC as a nuclear protein and tumor
suppressor protein. The newly disclosed full length cDNA
encodes a novel 824 amino acid protein The novel protein
r~ntAinq ten 34-amino acid repeats characteristic of the
15 TPR (tetratrico peptide) protein amily.
Diagnostic methods u3ing the nucleic acid and
protein H-NUC are disclosed. The present invention is also
directed to the administration of wild-type H-NUC tumor
suppressor gene or protein to suppress, eradicate or
20 reverse the neoplastic phenotype in established cancer
cells having no endogenous wild-type H-NUC protein. This
invention ~' ~trated for the first time administration of
wild-type H-NUC gene to estAhl i ~hPd cancer cells to
suppress or reverse the neoplastic ~helloLy~e or properties
25 of established human cancer cells lacking wild-type H-NUC
prote;n. This suppression of the neoplastic phenotype in
turn suppressed or eradicated the abnormal mass of such
cancer cells, i . e . tumors, which in turn can reduce the
burden of such tumors on the animal which in turn can
30 increase the survival of the treated animals. The
neoplastic properties which are monitored and reversed
included the morphology, growth, and most significantly,
the tumorigenicity of cancer cells lacking the normal H-NUC
protein. Thus, the "reduction of the burden of tumor
35 cells" in an animal is a conse~uence of the "suppression of
the neopla~tic phenotype" following the administration of
Wo gS/17198 2 1 7 8 7 ~ 5 PCT/US9V1~813
wild-type X-NUC tumor suppressor gene. "Neoplastic
phenotypel~ i9 understood t~ refer to tlLe phenotypic changes
in cellular characteristics such as morphology, growth rate
(e.g., ~ hl ;n~ time), F~t--r~tir-n density, soft agar colony
5 formation, and tumoricity.
Therefore, the invention provideg H-~UC F.n~n~; n~
vectors and X-~C proteins for use in treatment of tumors
or cancers, and methods of preparing H-NUC proteins and
vectors suitabl~o for use ln methods of treatment.
The invention also provides methods of treatment
for mammals such as humans, as well as methods of treating
abnormally proliferating cells, such as cancer or tumor
cells or suppressing the neoplastic phenotype. Broadly,
the invention contemplates treating abnormally
15 proliferating cells, or mammals having a disease
characterized by abnormally proliferating cells by any
suitable method known to permit a host cells compatible-H-
NUC ~n~-o~linS vector or a H-NUC protein to enter the cells
to be treated so that suppression of proliferation is
2 0 achieved .
In one embodiment, the invention comprises a
method of treating a disease characterized by abnormally
proliferating cells, in a mammal, by administering an
expression vector coding for H-NUC to the mammal having a
25 disease characterized by abnormally proliferating cells,
inserting the expression vector into the :qhn~lrr-l 1 y
proliferating cells, and expressing H-~UC in the abnormally
proliferating cells in an amount effective to suppress
proliferation of those cells, The expression vector is
30 inserted into the abnormally proliferating cells by viral
infection or trlnRr~llctl~n~ liposome-mediated transfection,
polybrene ~ t~-1 transfection, CaP0~ t-~l transfection
and el~:LL.,~oLc~tion. The treatment is repeated as needed.
Wo sstl7lg8 ~ 1 7 ~ J 4 ~ PCT/VS94/14813
In another embodiment, the invention comprises a
method of treating abnormally proliferating cells of a
mammal by inserting a H-NUC onro~; n~ expression vector into
the abnormally proliferating cells and expres6ing H-NUC
5 therein in amounts effective to suppress proliferation of
those cells. The treatment ia repeated as needed.
In another alternative ~mho~l; t, the invention
provides a DNA molecule able to suppress growth of an
abnormally proliferating cell. The DNA molecule encodeR an
lO Rb binding protein comprising a subsequence having at least
609~ homology with nine tetratricopeptide repeats at the-C-
terminal end, provided that the DNA molecule does not also
code for S. ~ '-^ yeast NUC 2, ~qDe~gill~R n1~ nq bimA
and CDC27. An example of such an Rb binding protein is H-
15 NUC protein having an amino acid ser1uence substantiallyaccording to SEQ ID N0. _. In a more preferred
' - ~ , the DNA 1 1 ~rl71~ has the DNA sequence of SEQ ID
N0. l, and is expressed by an expression vector. The
expression vector may be any host cell-compatible vector.
20 The vector i8 preferably selected form the group consisting
of a retroviral vector, a~ adenoviral vector and a
herpesvlral vector.
In another alternative embodiment, the invention
provides a H-~C protein having an amino acid sequence
25 s~lhst~nt;~lly according to SEQ ID ~0. _ and biologically
active f- _ ~R thereof.
In another alterative embodiment, the invention
provides a method of producing a H-NUC protein by the steps
of: inserting a compatible expression vector comprising a
30 H-NUC ~nrr~;n~ gene into a host cell and causing the host
cell to express H-NUC protein.
In another alternative embodiment, the invention
comprises a method of treating abnormally proliferating
Wo 95/17198 2 ~ 7 $ 7 ~ ~ PCr/USs4114813
cells of a mam~al ex vivo by the steps of: removing a
tissue sample in need of treatment from a mammal, the
tisaue sample comprising abnormally proliferating cell3;
contacting the tissue sample in need of treatment with an
5 effective dose of an H-NUC Pn~ lin~ expression vector;
expressing the H-NUC in the abnormally proliferating cells
in amounts effective to suppress proliferation of the
abnormally proliferating cells. The treatment is repeated
as nece3sary; and the treated tissue sample is returned to
lO the original or another mammal. Preferably, the tissue
treated P~ vivo is blood or bone marrow tissue.
In another alternative embodiment, the invention
comprises a method of treating a disease characterized by
abnormal ~-pll~ r pr~ l;fP~ti~n in a mammal by a process
15 comprising the steps of administering H-NUC protein to a
mammal having a disease characterized by abnormally
proliferating cells, such that the H-NUC protein is
inserted into the ;~hnr~ l l y proliferating cells in amounts
effective to suppress abnormal proliferation of the cells.
20 In a preferred embodiment, the H-NUC protein is liposome
encapsulated fQr insertion into cells to be treated. The
treatment is repeated as nPcP~s~y.
In another alternative embodiment,
25 oligonucleotide fragments capable of hybridizing with the
H-NUC gene, and assays utilizing such fragments, are
provided. These oli~n11c~Pt~tides can contain as few as 5
nucleotides, while those consisting of ahout 20 to about 30
oligonucleotides being preferred. These oligonucleotides
30 may optionally be 1 ~hPl 1 e~ with radioisotopes (such as
tritium, 3'phosphorus and 35sulfur), enzymes (e.g., alkaline
phosphatase and horse radish peroxidase), f luorescent
compounds (for example, fluorescein, ~thidium, terbium
chelate) or chemil1 ; n~Pnt compounds (such as the
35 acridinium esters, isoluminol, and the like). These and
other labels, such as the ones discussed in "Non-isotopic
2 1 78745
Wo 95/17198 PCT/US94/14813
11
DNA Probe Techniques", L.J.Kricka, Ed., Academic Press, New
York, 1992, (herein incorporated by reference,) can be used
with the instant oligonucleotides. They may be u3ed in DNA
probe assays in conv~ntion~l formats, such as Southern and
5 northern blotting. Descriptions of such conventional
formats can be found, for example, in "Nucleic Acid
Hybridisation - A Practical Approach", B. D. Hames and S.
J. Higgin3, Bds., IRL Press, Wa3hington, D. C.,1985, herein
incorporated by reference. Preferably these probes
10 capable of hybridizing with the H-NUC gene under stringent
conditions. The oligonucleotides can also be used as
primers in polymerase chain reaction techniques, as those
tf~hn;~l--R are described in, for example, "PCR Technology",
H.A. Ehrlich, Bd., Stockton Press, New York, 1989, and
15 similar references.
~ O~ OF 'I~T~! FI~'TT17T~C:
Figures lA and lB show that similar regions of RB
are required for binding H-NUC and T antigen. Figure lA is
20 a schematic of Gal4-RB fusions used to r~term;nl~ binding
domains. The Gal4 DNA-binding domain (amino acids 1-147)
is fused to various RB mutants. The T/ElA-binding domains
of RB are shown as hatched boxes. Domains affected by
mutation are depicted as spotted boxes. Figure lB 3hows
25 detection o~ interactions between H-NUC and RB mutants -
v vo. Yl53 was cotransformed with the indicated panel of
Gal4-RB mutants and with either the Gal4- (H-NUC) -expression
clone (Gal4- (C-49) ) or YIpPTG10 . Chlorophenyl-red-i~-D-
galactopyranoside colorimetric assay (CPRG) quantitation of
30 J3-galactosidase activity was done in triplicate for each
transformation as described by Durfee et al. ".'~n~q Devel
7:555-569 ~1993), incorporated herein by reference. - - -
_ _
Figures 2A and 2B show that H-NUC binds to
nrhrlgrhr~rylated RB. Figure 2A shows GST and inframe GST
2 ~ 7~
WO 9S/1~198 PCT/US9~/14813
12
fusions with cDNA encoding H-NUC (GST-49l~ and the amino-
terminal 273 amino acids o~ SV40 T antigen (GST-T) were
expresaed in E.--coli. GST and GST-fusions were bound to
glutathione-sepharose beads and washed extensively.
5 Samples were quantitated by rn~ RQ; ~ blue staining of -SDS-
polyacrylamide gels, and equivalent protein amounts were
used in each lane. Shown in Figure 2B are extracts made
from WR2E3 cells that were mixed with bound samples for 30
minutes at room temperature. Followinr~ extengive w~4h;n~R,
lO complexes were separated by SDS-pol~acrylamide gels and
transferred for; Inrhl otting. The amount of RB E~rotein
present and the extent of its phosphorylation in WR2E3
cells was determined by immunoprecipitation with anti-Rb
mAh llD7 antibody (lane l). The blot was probed with anti-
15 RB m~b llD7 and visualized by f luorography .
Figure 3 is the nucleotide (SEQ. I.D. NO.: l) andpredicted amino acid (SEQ. I.D. NO.: 2) sequences of the
full length H-NUC cDNA and protein.
Figures 4A and 4B show that the full length H-NUC
20 encodes a member of the tetratricopeptide repeat (TPR)
family of proteins. Figure 4A shows the location of the
ten 34-residue polypeptide u~it repeats in H-NUC,
S~h;7ns~crl~omyces S. ~ ' nuc2+ and ,~ergilluti n; ~ ;3n~
bimA proteins. Sketch showing location of the ten (0-9)
25 34-residue polypeptide unit repeats (TPR) in nuc2+, H-NUC
and bimA proteins. Unit repeat 3 of the three polypeptides
(intl;rz~tPd by stippled box), termed 34v-repeat, lacks the
conserved motif. Fir,ure 4B iB an alignment of the amino
acid sequences of the 9 TPR unit repeats (l-9) in nuc2+,-H-
3 0 NUC and bimA proteins . Conserved residues are boxed . TPRunit repeat 6 of all three protei~ls cnnt~;nR a glycine in
poaition 6. Gly6 in repeat 6 of nuc2 is thought to be
essential .
2~7~7
Wo 95/17198 4 5 PCTIU594114813
13
Figures 5A and 5B show that C-terminal TPR
repeats of H-NUC bind to the RB protein. Figure 5A is a
schematic of Gal4-H-~UC fusions used to determine binding
domains. The Gal4 tran3activation domain i~ fused to
5 various X-I~UC ~ t; r~n mutants . The TPR unit repeats of -H-
NUC are shown as crosa-hatched boxes Figure 5B shows
detection of interactions between RB and H-NtJC deletion
mutants in vivo. Yl53 was cotransformed with the indicated
panel of Gal4-H-NUC mutants and with either the Gal4-RB2 or
l0 Gal4-HZ09. CPRG quantitation of b-galactosidase activity
was done in triplicate for each transformation.
Figures 6A and 6B show mutation at the essential
glycine of amino acid residue 640 creates a temperature-
sensitive H-NUC mutant that r~;m;n;~h~ binding to RB at
15 nonpermissive temperatures. Figure 6A details the amino
acid substitution in the H-~IJC (640D). The essential
glycine (G) (amino acid 540) of nuc2 was substituted with
aspartic acid (D) in the temperature sensitive mutant.
Thus, the glycine at 640 amino acid residue of H-NUC was
20 changed into aapartic acid (D) . Figure 6B shows
interactions between RB and H-NUC (640D) mutant at 37C.
Yl53 was cotransformed with the Gal4-R32 and with either
Gal4-H-~UC or Gal4-H-NUC(640D). The transformants were
grown in liquid culture at 28C for 24 hour~. The overnight
25 yeast cultures were diluted with fresh medium and grown at
37C. Aliquots of yeast culture were removed at various
time points to determine the yeast growth (OD660) and ~-
galactosidase activity. CPRG quantitation of ~-
galactosidase activity was done in triplicate for each
3 o trans~ormation .
Figures 7A and 7B 8how the production of
antiserum against H-N~C and detection of H-NUC in human
cell lines In Figure 7A, Gst-49l fusion proteins were
used to immunize mice. The preimmune serum (lane l),
35 immune serum (lane Z), immune serum preincubated with Gst
2 1 78~45
Wo 95117198 PCTIUS9~/14813
14
protein (lane 3) and immune serum preincubated with Gst-49l
protein (lane 4) were used for immunoprecipitation. S3s-
l~hPllP-l cell lysate were ~L~ Jdl~ from K-562 cell3. Bqual
amounts of cell lysate were u3ed for immunoprecipitation.
5 The resulting immunoprecipitates were separated on SDS-
polyacrylamide gel electrophoresis. In Figure 7s, S3s-
labelled cell lysate were prepared from CV-l cells. E~qual
amounts of cell lysate were used for i ,~Lecipitation by
preimmune serum (lane l), or immune aerum (lane 2 and 3).
10 The resulting immunoprecipitates were derlatured by boiling
in 200 ,ul of 2% SDS ~-nn~;nin~ solution (lane 3~ and
diluted with 20D Ill of NETN buffer. The immunoprecipitates
were separated on SDS-polyacrylamide gel electrophoresis.
A 90 KD protein as indicated by the arrow was specifically
15 recognized by the immune serum.
Figure 8 shows that H-NUC protein has DNA-binding
activity. Protein lysate o~ K562 metabolically labelled
with S3s-methionine were pas3ed through double-stranded calf
thymus DNA-cellulose column and eluted with increasing
20 concentrations of NaCl. The elutes were; 1nnprecipitated
with either (A) mi~b llD7 to locate the RB protein or (s)
with immune serum renn~ni 7PS H-NUC to locate H-NUC. (C)
Aliquots of elutes were also used to incubate with
glut ~ h i nnP sepharose beads .
Figure 9 shows that the gene erLcoding H-NUC is
located on chromosome 17q21-22.
Figures lOA and lOB are the results of Southern
blotting analysis of breast tumor cell DNA with ~-NUC as
probe. DNA was extracted from cell lines and digested with
~coRI. The blots from the cell lines probed in Figure lOA
are all normal. In Figure lOB, a homozygous deletion of
the ~-NUC gene was apparent in cell li~es T47D and MBl57.
A heterozygous deletion of the gene appeared in cell lines
Wo 95/17198 2 ~ 7 8 7 ~ ~ PCr/llS94/14813
MB231, BT0578-7 and BT549 is suggested by decreased
hybridization to the 14 kbp EcoRI fragment.
Figure 11 shows AC-H-NUC inhibits cell growth in
T-47D breast tumor cells in vitro. The upper left shows
5 MDA-MB-231 cells infected with ACN (MOI 10) for 3 days and
stained with crystal violet. The upper right shows T-47D
cells infected with ACN (MOI 10) . The lower left shows
MDA-MB-231 cells infected with AC-H-NUC rMOI 10). The
lower right shows T-47D cells infected with AC-H-NUC.
10 (+/-) indicates MDA-MB-231 cells are heterozygous for H-
NUC. (-/-~ indicates T-47D cells contain a h~ ,zyy~us
deletion of H-NUC (ref . Lee, W.H. ) . AC-H-NUC i8 a
recombinant human adenovirus ~ntil;n;ng the H-NIJC tumor
suppressor gene under -control of the human CMV promoter.
15 ACN is the same ,~ ~ inr7nt human adenovirus vector without
the H-NUC tumor suppressor gene.
Figure 12 shows AC-H-NUC suppresses T-47D tumor
cell growth in vitro. T47-D (deleted for ~-NUC) and MDA-
MB-231 (heterozygous for H-NUC) breast cancer cells were
20 plated in 96-well plates and treated with AC-H-N~C or ACN
at infection multiplicities of 10 and 100 (guadruplicate).
Cells were permitted to grow for 5 days and 3H-thymidine
incorporated into ~ nucleic acid was used as a
measure of proliferation. Data (mean+SD) for AC-H-NUC are
25 plotted as a percent of the average proliferation of ACN
control at the corresponding MOI.
Figure 13 shows AC-H-NUC suppresses T-47D tumor
growth in nude mice. T-47D human breast cancer cells were
treated ex-vivo with ACN or AC-H-NUC at infection
30 multiplicity of 30 (N=4/group). Appr~Y;r-tely 107 cells
were injected subcutaneously into the flanks of nude mice,
each animal receiving ACN treated cells on one flank and
AC-H-NUC cells on the contralateral flank. Tumor size3
were measured with calipers, and estimates of tumor volume
WO95/17198 2 ~ 787~ PCT/USs~14813
16
were calculated assuming a spherical geometry. Average
(:~SD) tumor volumes are plotted for tumors resulting from
ACN and AC-c;3TSG cells. Average (iSD) volumeE3 of biiateral
tumors from untreated cells are plotted or comparison.
DETATr~n L-~-( K~ lON OF Tr~r! ~ V~ lUrl
This invention provides a novel mammalian protein
designated R-NUC. H-NUC is composed of 824 amino acids
( Figure 3 ) and has a molecular weight of about 95 kD and
has been ~ound to interact with unphosphorylated, full
10 length ret i nn~1 ~.ctoma (R~3) protein. It has also been
discovered that H-NUC derivatives, such as a truncated
version of the H-NUC protein, rnn~;n;ng the last 5iX "TPR"
regions ('~tetratricopeptide, 34-amino acid repeats) in the
C-terminal region, in other words, rnnt~;ninr amino acids
15 numbers 559 through 770, bind the wild-type Rb protein.
t~;nnq to the protein which destroy its-retinnh1~ctoma-
binding function may contribute to the hyperproliferative
pathology which is characteristic of R~3 negative cells,
e.g., breast cancer cells.
H-NUC protein is a human protein and can
therefore be purified from human tissue. "Purified", when
used to ll~qr~; h.o the state of H-NUC protein or nucleic acid
secuence, denotes the protein or D~A encoding H-NUC free of
the other proteins and molecules normally associated with
or occurring with H-NUC protein or DNA encoding H-NUC in
its native environment. As used herein the term "nativen
refers to the form of a D~A, protein, polypeptide, antibody
or a L- _ ~ thereof that is isolated from nature or that
which is without an ;ntF.nt;nnAl amino acid alteration e.g.,
a substitution, ~ t;nn or ~;t;nn. Recovery of purified
95 kd H-~UC protein from SDS gels can be ~r~ ~1; ch~nl using
methods known to the ordinarily skilled artisans, for
example, first react a cell extract rnn~;n;ng H-NUC with
Wo 95/17198 2 1 7 8 7 ~ 5 PCTNS94/14813
17
anti-H-NUC antibody to precipitate as described in more
detail below. Separate the protein antibody complex and
recover the 95 kd H-NUC protein by elution from the SDS gel
as described in Fischer et al., Terhn;~ueg in Prot~in
5 Ch~mictry, ed. T. E. Hugli, Academic Press, Inc., pp. 36-41
(1989), incorporated herein by reference.
As used herein, the term "hyperproliferative
cells" includes but is not limited to cells having the
capacity for autonomous growth, i.e., existing and
lO reproducing independently of normal regulatory merhiqni Pmq,
Hyperproliferative diseases may be categorized as
pathologic, i.e., deviating from normal cells,
characterizing or constituting disea6e, or may be
categorized as non-pathologic, i.e., deviation from normal
15 but not a3sociated with a disease state. Pathologic
hyperproliferative cells are characteristic of the
following di8ease states, thyroid hyperplasia - Grave's
Disease, psoriasis, benign prostatic hypertrophy, Li-
Fraumeni uy~ , cancers including breast cancer,
20 sarcomas and other n~opl~l , bladder cancer, colon cancer,
lung cancer, various l.o~lkPm; ~qc and lymphomas . Examples of
non-pathologic 1 y~e~Iuliferative cells are found, for
instance, in mammary ductal epithelial cells during
devrl t ~ of lactation and also in cells associated with
25 wound repair. Pathologic 1-y~èL~ uliferative cells
characteristically exhibit loss of contact inhibition and
a decline in their ability to selectively adhere which
implies a change in the surface properties of the cell and
a further breakdown in intercellular communication. These
30 changes include stimulation to divide and the ability to
secrete proteolytic enzymes . I~O~ e~Ve~, reintroduction or
supplementation of lost H-NUC function by introduction of
the protein or nucleic acid encoding the protein into a
cell can restore the cell to a non-hyperproliferative
35 state. Malignant proliferation of cells can then be
halted .
wo 95/17198 2 1 7 ~ 7 ~ 5 PCTIUS94/14~13
18
As is known to those of skill in the art, the
term ~protein~ means a linear polymer of amino acids joined
in a specif ic sequence by peptide borLds . As used herein,
the term "amino acid~ refers to ei~her the D or L
5 stereoisomer form of the amino acid, unless otherwise
specifically designated. Also ~n( ~ ed within the scope
of this invention are H-NUC derivatives or e~uivalents such
as X-NHC truncated protein, polypeptide or H-~C peptides,
having the biological activity of purif ied H-NUC protein .
10 "H-NUC derivatives" refers to compounds that depart from
the linear sequence of the ~aturally occurring proteins or
polypeptides, but which have amino acid alterations, i . e .,
substitutions, deletions or insertions 6uch that the
resulting H-N~C derivative retains H-~UC biological
15 activity. "siologicaL activity~ or "biologically active"
shall mean in one aspect having the ability to bind to the
unphosphorylated rf tinnhl ~toma protein p110~. H-NUC
binding to Rb is lost at 37 degrees Celsius if, for
example, the highly conserved glycine ~amino acid 640) is
20 changed to aspartic acid. These H-NUC derivatives can
differ fro~ the native sequences by the deletion,
substitution or insertion of one or more amino acids with
related amino ~cids, for example, ~imilarly charged amino
acids, or the substitution or modification of side chains
25 or functional groups.
It is further understood that limited
modif ications may be made to the primary sequence of EI-NUC
without destroying its biological function, and that only
a portion of the entire primary structure may be required
30 in order to e~fect activity, one aspect of which is the
ability to bind pllO~. The nucleic acid sequence coding
for pllOR~ has been r-hl;~h--~ in Lee, W.-H., et al., Science
235:1394-1399 (1987), incorporated herein by reference.
Another aspect of its hiolo~ l function is the ability of
35 H-NUC to bind DNA. The ability to bind DNA can be
determined by one skilled in the art using the method
Wo 95117198 2 1 7 8 7 ~ 5 PCr/USs4/14813
19
described in Lee, W -H., et al., 2~ (Ilondon) 329:642-
6 4 5 ( 1 9 8 7 ), i ncorpora t ed herein by re f e rence . One
biologically active H-NUC derivative is the protein
comprising the last 6 TPR region3 at the C-terminal end of
5 H-NUC and the fusio~ protein-Gal4-C49, each of which is
described below. The Gall4-C49 derivative has the sequence
shown in Figure 3 from amino acid 559 to the end of the
sequence. The TPR ~ nt~;nin~ derivative has a sequence
shown in Figure 3 from amino acid 559 through 770.
l0 Moreover, fragments of the amino acid sequence shown in
Figure 3, in addition to the previously described Gal4-C49
fusion protein or the TPR derivative, which retain the
function of the entire protein are included within the
definition of H-NUC derivative. These H-NUC derivatives
15 can be generated by restriction enzyme digestion of the
nucleic acid molecule of Eigure 3 and recombinant
expression of the resulting fragments. It is understood
that minor modifications of primary amino acid sequence can
result in proteins which have subst~nti~lly equivalent or
20 enhanced function as compared to the sequence set forth in
Figure 3. These modifications may be deliberate, as
through site-directed mutagenesis, or may be ;~-ciri~nt~l
such as through mutation in hosts which are H-NUC
producers. All of these modifications are included as long
25 as H-~C biological function is retained.
~ Inhibitively active '~ also shall mean ~ragments
and mutants of the H-NUC protein ("muteins") that act in a
~ ~n~nt negative fa3hion thereby inhibiting normal
function of the protein, thereby inhibiting the biological
30 role oE H-NUC which i8 to mediate ho3t cell division and/or
host cell proliferation. These proteins and fragments can
be made by chemical means well known to tho3e of 3kill in
the art. The mutein3 and inhibitively active ~ragment3 are
useful therapeutically to promote hyperproliferation of
35 cells and to generate diagno3tic reagents such a3
Flnt i h~l; e3 .
WO 9S/17198 2 1 7 ~ 7 ~ 5 PCTNS9~/14813
These agents are useful to promote or inhibit the
growth or proli~eration of a cell by contacting the cell,
n vit~o or ~ vivo with ~the agent by methods described
below. Accordingly, thi3 invention also provides a method
5 to inhibit the-yrowth or proliferation of a cell, such as
a hyperproli~erative cell like a brea3t cancer cell, by
contacting the cell with the agent. Also provided are
methods of treating pathologies characterized by
hyperproliferative cell growth, such as breast cancer, by
10 administering to a suitable subject these agents in an
effective rnnrrntration such that cell proliferation is
inhibited. A suitable subject for thi3 method includes but
is not lilTIited to vertebrates, simians, murines, and human
patients .
This invention also provides pharmaceutical
composition3 comprising any of the compo3itions of matter
described above and one or more pharmaceutically acceptable
carriers. Pharmaceutically acceptable carriers are well
known in the art and include aqueous solutions such as
20 physiologically buf~ered saline or other solvents or
vehicles such as glycols, glycerol, vegetable oils (eg.,
olive oil) or iniectable organic esters. A
pharmaceutically acceptable carrier _ can be used to
administer ~-~ac or it3 derivatives to a cell in vitro or
25 to a subject in vivo.
A pharmaceutically acceptable carrier can contain
a physiologically acceptable compound that acts, for
example, to stabilize the protein or polypeptide or to
increase or decrease the absorption o~ the agent. A
30 physiologically acceptable compound can include, for
example, carbohydrates, such as glucose, sucrose or
dextrans, ~ntir~ nt~l such as ascorbic acid or
glutathione, rhi~1~t;nrJ agents, low molecular weight
proteins or other stabilizers or excipients. Other
35 physirlor,;r~1ly acceptable ,,uu~-ds include wetting
21 7~7~5
Wo 95/17198 PCTrUSs4/l48l3
21
agents, emulsifying agents, dispersing agents or
preservatives, which are particularly useful for preventing
the growth or action of microorganisms. Various
preservatives are well known and include, for example,
5 phenol and ascorbic acid. One skilled in the art would
know that the choice of a pharmaceutically acceptable
carrier, including a physiologically acceptable compound,
depends, for example, on the route of administration of the
polypeptide and on the particular physio-chemical
10 characteristics of the specific polypeptide. For example,
a physiologically acceptable c , ~ulld such as aluminum
monosterate or gelatin is particularly useful as a delaying
agent, which prolongs the rate of absorption of a
pharmaceutical composition administered to a subj ect .
15 Further examples of carriers, stabilizer3 or adjuvants can
be found in Martin, ~m;n~tnn~s ph~rm Sci.. 15th Ed. (Mack
Publ. Co., Easton, 1975), incorporated herein by reference.
The pharmaceutical composition also can be incorporated, if
desired, into liposomes, microspheres or other polymer
20 matrices (Gregoriadis, L;~os-~m~ Te~hn~logy, Vol. 1 (CRC
Press, Boca Raton, Florida 1934), which is incorporated
herein by reference). T.;rn8, ~, for example, which
consist of phospholipids or other lipids, are nontoxic,
physiologically acceptable and metabolizable carriers that
25 are relatively simple to make and administer.
Purified EI-NUC (protein) or El-N~C (nucleic acid)
pharmaceutical compositions are useful to inhibit the
growth of a cell, such as a breast cancer cell, by
contacting the cell with the purif ied E~ JC or an active
30 fragment or composition, containing these polypeptides or
proteins .
For the purposes of this invention, the
contacting can be effected ~n vitro, ~x y~ or ;L~ ~Q.
When the cells are inhibited in }.~i~, the contacting is
35 effected by mixing the composition of nucleic acid or
Wo 95/17198 2 ~ ~ 8 7 4 ~ PCrlUS94/14813
22
protein of this invention with the cell culture medium and
then eeding the cells or by directly adding the nucleic
acid composition or protein to the culture medium. Methods
of ~lPtPrmln1n~ an effective amount are well known to those
5 of skill in the art.
This method also is useful to treat or prevent
p~thnl ~; PC associatad with abnormally proliferative cells
in a subject ~}~ ~i~- Thus, when the contacti~y is
effected ~ m, an eective amount o the composition of
lQ this invention is administered to the subj ect in an amount
effective to i~hibit the proliferation of the cells in the
subject. For the purpose of this invention, Usubject''
means any vertebrate, such as an animal, mammal, human, or
rat. This method is especially useul to treat or prevent
15 breast cancer in a patient having non~ nl-tinn~l X-NUC
protein production.
Methods o administering a pharmaceutical are
well k-nown in the art and include but are not limited to
administration orally, intravenously, intr~m~c~ rly or
20 intraperitoneal. Administration can be effected
cnnt; nllnusly or intermittently and will vary with the
subject as is the case with other therapeutic recombinant
proteins (T.~l ~ et al., ~T, IntPrferon Res. 12(2) :103-111
(1992); Aulitzky et al., El~r. J. ~n~er 27 (4) :462-467
(1991); Lantz et al., Cytok;nP 2(6) :402-406 (1990);
Su~eL~w et al., Ph~rm. Re~. 5 (8) :472-476 (1988); Demetri
et al., J. flin Oncol. 7(10:1545-1553 (1989); and
~eMaistre et al., I,an~ 337:1124-1125 ~1991) ) .
Isolated nucleic acid molecules which encode
30 amino acid sequences correspondin~ to the purified
mammalian H-NUC protein, H-NUC derivatives, mutein, active
fragments thereo~, and anti-H-NUC antibody are further
provided by this invention. As used herein, ~'nucleic acid"
shall mean single and double stranded DNA, cDNA and mRN~.
21 ~8745
WO 95/17198 PCT/Uss4/14813
Z3
In one embodiment, this nucleic acid molecule encoding H-
NUC protein and fragments has the sequence or parts thereof
shown in Figure 3. Also included within the scope o~ this
invention are nucleic acid molecules that hybridize under
5 stringent conditions to the nucleic acid molecule or its
complement, for example, the sequence of which is shown in
Figure ~3. Such hybridizing nucleic acid molecules or
probes, can by prepared, for example, by nick translation
of the nucleic acid molecule of Figure 3, in which case the
lO hybridizing nucleic acid molecules can be random fragments
of the molecule, the sequence of which is shown in Figure
3. For methodology for the preparation of such fragments,
see Sambrook et al., Molec~ r Cl-~n;ng A LF~hf~ratory
~nL~Ll Cold Spring Harbor Press, Cold Spring Harbor, N.Y.
15 (1989), incorporated herein by reference. Nucleic acid
f ragments of at least lO nucleotides are useful as
hybridization probes. Isolated nucleic acid fragments also
are useful to generate novel peptides. These peptides, in
turn, are useful as immunogens for the generation of
20 polyclonal and monoclonal antibodies. Methods of preparing
and using the probes and immunogens are well known in the
art .
The nucleic acid sequences also are useful to
inhibit cell division and proliferation of a cell. The
25 nucleic acid molecule i8 inserted into the cell, the cell
is grown under conditions such that the nucleic acid is
encoded to H-NUC protein in an effective r~nr~ntration 80
that the growth of the cell is inhibited. For the
purposes o~ this invention, the nucleic acid can be
3 0 inserted by liposomes or lipidated DNA or by other gene
carriers such as viral vectors as disclosed in Sambrook et
al., ~, incorporated herein by reference. A breast
cancer ce `~ ~ having mutant H-NtJC protein production is a
cell that is benef ited by this method .
Wo 95/17198 2 ~ 7 8 7 4 5 PCr/USs4/14813
24
The treatment of human disease by gene transfer
has now moved from the theoretical to the practical realm.
The f irst human gene therapy trial was begun in September
1990 and involved transfer of the adenosine ~lF.AminAqe (ADA)
5 gene into lymphocytes of a patient having an otherwise
lethal defect in this enzyme, which produces immune
de~iciency. The results of this initial trial have been
very encouraging and have helped to s~ te further
clinical trials (Culver, K.W., Anderson, W.F., slaese,
R.M., Ml~m. Gen~. Ther., l99l 2:I07) .
So far most of the approved gene transfer trials
in humans rely on retroviral vectors for gene transduction.
Retroviral vectors in this context are retroviruses from
which all viral genes have been removed or altered so that
15 no viral proteins are made in cells infected with the
vector Viral replication functions are provided by the
use of retrovirus 'pA~kA~in~' cells that produce all of the
viral proteins but that do not produce infectious viru3.
Introduction of the retroviral vector DNA into packaging
20 cells results in production of virions that carry vector
RNA and can infect target cells, but no further virus
spread occurs after infection. To distinguish this process
from a natural virus infection where the virus c~ n~ to
replicate and spread, the term transduction rather than
25 infection is often used.
For the purpose of illustration only, a delivery
system for insertion of a nucleic acid is a replication-
incompetent retroviral vector. As used herein, the term
"retroviral" includes, but is not limited to, a vector or
30 delivery vehicle having the ability to selectively target
and introduce ehe nucleic acid into dividing cells. As
used herein, the terms "replication-incompetent" is de~ined
as the inability to produce viral proteins, precluding
spread of the vector in the infected host cell.
2 1 78745
Wo 95/17198 PCT/US94114813
Another example of a replication - incompetent
retroviral vector is LNL6 (Miller, A.D. et al.,
BioTe-~hn;~lues 7: saQ-sso (1989) ), incorporated herein by
reference. The methodology of using replication-
5 incompetent retroviruses for retroviral-mediated gene
transfer of gene markers is well est~hl; ~h.od (Correll, P.II.
et al ., PN~.~ TT.~A 86: 8912 (1989); Bordignon, C . et al ., ~i
,~ 86:8912-52 (1989); Culver, K. et al., p~A.~ T~.CZ~ 88:3155
(1991); Rill, D.R. et al., 1L1QS~ 79 (10) :2694-700 (1991) ),
10 each incorporated herein by reference. Clinical
investigations have shown that there are f ew or no adverAe
effects associated with the viral vectors (Anderson,
Science 256:808-13 (1992) ) .
The major advantages of retroviral vectors for
15 gene therapy are the high efficiency of gene transfer into
replicating cells, the precise integration of the
transferred genes into ~ 1 Ar DNA, and the lack of
further spread of the sequences after gene transduction
(Miller, A.D., 1~, 1992, 357:455-460).
The potential for production of replication-
competent (helper) virus during the production of
retroviral vectors remains a concern, although for
practical purposes this problem has been solved. So far,
all FDA-approved retroviral vectors have been made by using
PA317 amphotropic retrovirus p~rkA~;n~ cells (Miller, A.D.,
and Buttimore, C., Mnlec. Cell Biol., 1986 6:2895-2902) .
Use of vectors having little or no overlap with viral
sequences in the PA317 cells eliminates helper virus
production even by stringent assays that allow for
amplification of such events (Lynch, C.M., and Miller,
A.D., J. Vir~ 1991, 65:3887-3890). other packaging cell
lines are available. For example, cell lines designed for
separating different retroviral coding regions onto
different plasmids should reduce the possibility of helper
35 virus prn~illr~inn by le~ ' ;nAt;nn. Vectors produced by such
Wo 95117198 2 1 7 ~ 7 ~ 5 PCTIIIS9~/14813
26
packaging cel~ lines may also provide an efficient system
for human gene therapy (Miller, A.D., 1992 Nature,-357:455-
4 6 0 ) .
Non-retroviral vectors have been considered or
5 use in genetic therapy. One such alternative is the
adenovirus (Rosenfeld, M.A., et al., 1992, ~11, 68:143-
155; Jaffe, H.A. et al., 1992, Proc. Natl. ~ 1. Sci. US~,
89:6482-6486). Major advantages of adenovirus vectors are
their potential to carry large segments of DNA (36 kb
lO genome), a very high titre (10l1 ml~l), ability to infecting
tissuea i~Li~, ~r~ y in the lung. The most striking
use of this vector so far is to deliver a human cystic
fibrosig ~rAnl ' alle ,nnr~l"-tAn.e regulator (CFTR) gene by
intratracheal instillation to airway epithelium in cotton
15 rat~ (Rosen~eld, M.A., et al., 5~11, 1992, 63:143-155) .
Similarly, herpes viruses may also prove valuable for human
gene therapy (Wolfe, J.H., et al., 1992, Nature Genetics,
1:379-384). Of course, any other suitable viral vector
may be used for genetic therapy with the present invention.
The other gene transfer method that has beerl
approved by the FDA for use in humans i5 the transfer o
plasmid DNA in liposomes directly to human cells in situ
(Nabel, ~.G., et al., 1990 Sci~nee, 249:1285-1288).
Plasmid DNA should be easy to certify for use in human gene
therapy because, unlike retroviral vectors, it can be
purified to homogeneity. In A~;t;nn to l;rn --mediated
DNA transfer, several other physical DNA transfer methods
such as those targeting the DNA to receptors on cells by
complexing the plasmid DNA to proteins have shown promise
iu human gene therapy (Wu, G.Y., et al, 1991 J. Biol.
~hem., 266:14338-~4342; Curiel, D.T., et al., 1991,
Natl. ~e:~l Sci. USA, 88:8850-8854) .
The H-NUC encoding gene of the present invention
may be placed by methods well known to the art into an
21 78745
Wo 95/17198 PCTiUS94/l48l3
27
expression vector such as a plasmid or viral expression
vector. A plasmid expression vector may be introduced into
a tumor cell by calcium phosphate transfection, liposome
(for example, LIPOFECTIN)-mediated transfection, DEA33
5 Dextran-mediated transfection, polybrene-mediated
transfection, electroporation and any other method of
introducing DNA into a cell
A viral expression vector may be introduced into
a target cell in an expressible form by infection or
10 transduction. Such a viral vector ;n~ 7.~7, but is not
limited to: a retrovirus, an adenovirus, a herpes virus
and an avipox virus. 7ilhen H-NUC is expressed in any
abnormally proliferating cell, the cell replication cycle
is arrested, thereby resulting in senescence and cell death
15 and ultimately, reduction in the mass of the abnormal
tissue, i . e ., the tumor or cancer. A vector able to
introduce the gene construct into a target cell and able to
express H-.~UC therein in cell proliferation-suppressing
amounts can be administered by any effective method.
For example, a physiologically d~L~iate
solution ~rmt,7in~n~ an effective c~n~nt~ation of active
vectors can be administered topically, intraocularly,
parenterally, orally, intrananally, intravenously,
intramuscularly, subcut;7n~o7l~ly or by any other effective
2r7 means. In particular, the vector may be directly injected
into a target cancer or tumor tis3ue by a needle in amounts
ef fective to treat the tumor cells of the target tissue .
Alternatively, a cancer or tumor present in a
body cavity such as in the eyes, gastrointestinal tract,
genitourinary tract (e.g., the urinary bladder), p7l1r - ~r
- and bronchial sy~tem and the like can receive a
physiologically d~r ~ ate composition (e .g., a solution
such as a saline or phosphate buf fer, a suspension, or an
n, which ig gterile except for the vector)
Wo95/17198 2~ 787~5 PCr~US94114813
rt~ntAinin~ an effective concentration of active vectors via
direct inj ection with a needle or via a catheter or other
delivery tube placed into the cancer or tumor afflicted
hollow organ Any effective imaging device such a3 X-ray,
~ y~ or fiberoptic v;AIl:3l;7At;~n system may be used to
locate the target ti~sue and guide the needle or catheter
tube .
In another alternative, a physiologically
appropriate solution containing an effective r~m~Pntration
of active vectors can be administered syatemically into the
blood circulation to treat a cancer or tumor which cannot
be directly reached or anatomically isolated.
In yet another alternative, target tumor or
cancer cella can be treated by introducing H-NUC protei~
into the cells by any known method. For example, liposomes
are artif icial membrane vesicles that are available to
deliver drugs, proteins and plasmid vectors both in vitro
or in vivo (Mannino, R.J., et al., 1988, Biote~hni aues,
6:682-690) into target cells (Newton, A.C. and EIuestis,
W.El., 3io--h~mi~try, 1988, 27:4655-4659; Tanswell, A.K. et
al., 1990, Bio~~' ;ca et Bio~hysica Acta. 1044:269-274; and
Ceccoll, J. et al, ~ollrnAl of Investigative r)err-toloqy.
1989, 93 :190-194) . Thus, ~-N[rC protein can be encapsulated
at high ~ff;~ nry with liposome vesicles and delivered
into mammalian cells in vitro or in vivo.
Liposome-~on~ra-ll Ated H-NUC protein may be
administered topically, intraocularly, parenterally,
intranasally, intratracheally, intrabronchially,
intramuscularly, s~hr~ltAnPollYly or by any other effective
means at a dose ~ff;~Arit~Us to treat the abnormally
proliferating cells of the target tissue. The liposornes
may be administered in any physiologically appropriate
composition cr~t~;n;ng an effective c~n~ntration of
encapsulated }~-NUC protein.
21 7~7~5
wo 95/17198 PCTIUS94114813
29
Other vectors are suitable for use in this
invention and will be selectea for efficient delivery of
the nucleic acid ~nr-~rl;n~ the ~I-NUC gene. The nucleic acid
can be DNA, cDNA or RNA.
In a separate embodiment, an isolated nucleic
acid molecule of this invention is operatively linked to a
promoter of RNA transcription. These nucleic acid
molecules are useful for the re, ' ;n~nt production of H-
NUC proteins and polypeptides or as vectors for use in gene
therapy .
This invention also provides a vector having
inserted therein an isolated nucleic acid molecule
described above. For example, suitable vectors can be, but
are not limited to a plasmid, a cosmid, or a viral vector.
For examples of suitable vectors , see Sambrook et al .,
~:a, and Zhu et al., Scier~ 261:209-211 (1993~, each
incoFporated herein by reference. When inserted into a
suitable host cell , e . g ., a procaryotic or a eucaFyotic
cell, H-NUC can be recombinantly produced. Suitable host
cells can include ~ n cells, insect cells, yeast
cells, and bacterial cells. See Sambrook et al., ~a,
incoFporated herein by reference.
A method of producing recombinant H-NUC or its
derivatives by growing the host cells described above undeF
suitable conditions such that the nucleic acid ~n~ ; n~
NUC or its fragment, is expressed, is provided by this
invention. Suitable conditions can be determined using
methods well known to those of skill in the art, see for
example, Sambrook et al., ~a, incoFporated herein by
reference. Proteins and polypeptides produced in this
manner also are provided by this inventio~.
Also provided by this invention is an antibody
capable of specifically foFming a complex with H-NUC
Wo 95/17198 2 l ~ 3 7 ~ ~ PCr/USs~/14813
protein or a fragment thereof. The term "antibody"
includes polyclonal antibodies and monoclonal antibodies.
The antibodies include, but are not limited to mouse, rat,
rabbit or human monoclonal antibodies.
As used herein, a "antibody or polyclonal
antibody" means a protein that is produced in response to
Ini7~t;f~n with an antigen or receptor. The term
"monoclonal antibody" means an immunoglobulin derived from
a single clone of: cells. All monoclonal antibodies derived
from the clone are chemically and structurally identical,
and specific for a single antigenic determinant.
Laboratory methods for producing polyclonal
An~;hn~l;es and monoclonal antibodies are known in the art,
see Harlow and Lane, A~tihorl;es: A L~horatory Miln~ l, Cold
Spring Harbor Laboratory, New York (1988), incorporated
herein by reference. The monoclonal Ant ihr~ 'fl of this
invention can be biologically producêd by introducing H-NUC
or a f ragment thereof into an animal , e . g ., a mouse or a
rabbit. The antibody producing cells in the animal are
isolated and fused with myeloma cells nr~ h-~t~ _ yeloma
cells to produce hybrid cells or hybridomas. Accordingly,
the hybridoma cells r~n~ ; n~ the monoclonal antibodies of
this invention also are provided. Monoclonal ~nt;ho~;es
produced in this manner include, but are not limited to the
monoclonal antibodies described below.
Thus, using the H-NUC protein or derivative
thereof, and well known methods, one of skill in the art
can produce and screen the hybridoma cells and An~;ho~;es
of this invention for Ant;hOrl;f~R having the ability to bind
H-NUC.
This invention also provides biological active
fragments of the polyclonal and monoclonal antibodies
described above. These "antibody f~a~ ~11 retain some
217~74-
Wo 95/17198 PCT/Uss4/l48l3
31
ability to 6electively bind with its antigen or; ln~ n.
Such antibody fragments can include, but are not limited
to:
(1) Fab, the fragment which contains a
5 monovalent antigen-binding _ of an antibody molecule
produced by digestion with the enzyme papain ~o yield an
intact light chain and a portion of one heavy chain;
(2) Fab', the fragment of an antibody molecule
obtained by treating with pepsin, followed by reduction, to
10 yield an intact light chain and a portion of the heavy
chain; two Fab' fragments are obtained per antibody
molecule;
(3) (Fab')z, the fr;~ ' of the antibody that is
obtained by treating with the enzyme pepsin without
15 subsequent r~ ti~n; F(ab')2 is a dimer of two Fab'
fragments held together by two disulfide bonds;
(4) Fv, defined as a genetically engineered
~ ~-nnt~in;n~ the variable region of the light chain
and the variable region of the heavy chain expressed as two
2 0 chains; and
(5) SC~, defined as a genetically ~n~;nf~ ed
molecule c~n~in;n~ the variable region of the light chain,
the variable region of the heavy chain, linked by a
suitable polypeptide linker as a genetically fused single
25 chain molecule.
Methods of making the3e fragments are known in
the art, see fo3:~ example, EIarlow and Lane, ~,
incorporat~d herein by reference.
WO 9~117198 2 1 7 ~ 7 4 5 PCTrUS94114813
Specific examples of ~biologically active
antibody fragment~ include the CDR re~ion~3 of the ~nt;hnfl;~c~
Anti-idiotypic peptides specifically reactive
with the antibodies or biologically active fragments
5 thereof also are provided by this invention. As used
herein, ~anti-idiotypic peptides" are purified antibodies
from one species that are i~jected into a distant species
and recognized as foreign antigens and elicit a strong
humoral immune response. For a -discussion of general
10 methodology, see Harlow and Lane, ~" incorporated
herein by ref erence .
Also l~n ,-Rsed by this invention are proteins
or polypeptides that have been recombinantly produced,
biochemically synthesized, chemically synthesized or
l~ chemically modified, that retain the ability to bind H-NUC
or a f ragment thereof, as the corresponding native
polyclonal or mnnn~-l nn:~l antibody. The ability to ~ind
with an antigen or; n~rl is determined by antigen-
binding assays known in the art such as antibody capture
20 assays. See for example, Harlow and Lane, ~,
incorporated herein by reference.
In one: ~ '; , an antibody or nucleic acid is
linked to a detectable agent, useful to detect the H-NUC
protein and fragments in a sample using standard
25 immunochemical techniques such as; nh; ~tochemistry as
~ ;h~ by Harlow and Lane, ~_, incorporated herein by
reference or as discussed in "Principles and Practice of
T --f2,3~yg~, eds. C.~J. Price and D.J. Newman, Stockton
Pre6s, New York, (l99l), herein incul~u, ~ted by reference.
In a separate embodiment, the antibody is
administered to bind to H-NUC and alter its function within
the cell. ~ The antibody is administered by methods well
known to those of skill in the art and in an effective
-
2~ 45
Wo 95/17198 PCrlUS94/14813
33
concentration such that H-NUC function is restored The
antibody also can be used therapeutically to inhibit cell
growth or proliferation by binding to H-NUC which has lost
its ability to bind to retinoblastoma protein. This
5 antibody binds to H-NUC causing it to refold into an active
conf iguration . In other words, the agent restores the
native biological activity of H-NUC.
The An~ihn~iP~ and nucleic acid molecules of this
invention are useful to detect and determine the presence
lO or absence o H-NUC protein or alternatively, an altered-H-
NUC gene in a cell or a sample taken from a patient. In
this way, breast cancer or susceptibility to breast cancer
can be diagnosed.
The above-identified proteins, polypeptides,
15 nucleic acids, ~nt;hr~ and ~ thereof are useful
for the preparation of medicaments for therapy, as outlined
above .
The invention will now be described in greater
detail by reference to the oIlowing examples. These
20 examples are ;nt-nr~ to illustrate but not limit the
invention .
T. M~rm.c ~ ?T~cuI,Ts
Using the yeast two-hybrid system, 25 clones have
been isolated that interact with the C-terminal region of
25 RB (p56-R~3) . One of these is the clone C49. (Durfee :~
al ., ~en~ Dev~l ., 7: 555-569 (1993) ) . The C-terminal
portion o RB protein has two n~c~n~;guous domains
required for binding to the oncoproteins of several DNA
tumor viruses and a C-terminal region associated with DNA-
30 binding activity. Here, one of the R~3-associated proteins
has been characterized which has primary sequences and
WO 95/17198 2 1 7 ~ ~ ~ 5 PCT/US94/14813
34
bio~AhPrn; rAl properties similar to t~iose o the nuc2 protein
of S. A yeast and bimA of the AA,pergi~ R genus of
f ungi . Mutation of these latter two genes in lower
eucaryotic cells arrests the cell3 in metaphase, pointing
5 to an important role f or these proteins in the normal
process of mitosis. These two proteins contain novel,
repeating amino acids in motifs of 34 residues, so-called
TRP motifs. The function of these repeats is not known,
but it has been postulated that they form amphipathic
lO alpha-helices that could, in principle, direct protein-
protein interactions. The protein reported here is the
firDt human TRP protein iDolated and reported.
Screening of cDNA libraries and so~luencing ~nalysis.
For isolation of iull length H-N[JC cDNAs, a 1.5
15 Kb BglII fragmènt of C-49, ;Aol-t~ as deccribed above
using the method of Dur~ee S~LL. id., was labeled by nick
translation and used to screen a human fibrobla3t cDNA
library by plaque hybridization. The cDNA inserts were
51lh~Al~n_~l intc ~coRI 5ite of the pBSK+ vector (Stratagene,
20 San Diego, Ca.) to fAr;l;tAte DNA sequencing. Sequencing
was performed by using dideoxy-NlrPs and Seqn~-nAAe 2 . O
according to the manufacturer's specifications (US
Biochemicals) . Sequence analysis and homology searches
were performed using DNASTAR software ~DNASTAR, Inc.,
25 Madison, WI) .
Construction of GST fuaions, protein preplr~tion and ~n
~52 binding.
To construct GST-491, the plasmid C-49 was
digested with BglII and the l. 3 Kb insert fragment
30 subcloned into the BamE~I site of pGEX-3X (Pharmacia,
Piscataway, N.J. ) . GST-T was made by cutting Y62-25-2 with
HindIII, blunt ending with Klenow, and subcloning the 823bp
fragment into pGE:X-3X cut with SmaI. Expression of GST
2 1 7~7~5
WO 95/17198 PCTNS94/14813
fusion proteins in E. coli (Smith and Johnson, ~:n~, 67: 31-
40 (1988) ) was induced with 0.1 mM IPTG. Cells were
centrifuged at lOK for 5 minute~, Rnd the resultant pellet
resuspended in Lysis 250 buffer (250 mM NaCl, 5 mM EDTA, 50
5 mM Tris (pH 8.0), 0.1~ NP40, 1 mM phenylmethylsulfonyl
fluoride (PMSF), 8 ~g leupeptin, 8 llg antipain) . 4 mg
lysozyme was added, and the cells held at 4C for 30 minutes
and the cells lysed by sonication. Cell debris waa removed
by centrifugation (10 K for 30 minutes) and the supernatant
10 added to glutathione coated beads.
The in vi~o binding assay was performed as
follows. Extracts made from 2X106 2E3 cells (Chen et al.,
1992, in~a, incorporated herein by reference) were
in~l1h~te-1 with beads cnntA;n;ng 2-3 llg of GST or GST fusion
15 protein~ in Lysis 150 buffer (50 mM Tris (pH 7.4), 150 mM
NaCl, 5 mM EDTA, O.lg~ NP-40, 50 mM NaF, 1 mM PMSF, l /lg
leupeptin per ml, l ~g Ant;rA;n per ml) for 30 minute3 at
room temperature. Complexes were washed extensively with
ly5i8 150 buffer, boiled in loading buffer, and run on 7.5~
SDS-PAGE gels. Gels were tran3ferred to immobilon
membranes and; f~hlotted with an anti-RB monoclonal
antibody, llD7. Following addition of an i31kAl;n~_
rh~ h~t~e-conjugated 8e~ dr y antibody, bound RB protein
was visualized with 5-bromo-4-chloro-3-indoly1rh~ sphAte
25 toll-;~;n;- and nitro blue t~trA~olium (BCIP, NBT; Promega,
Madison, WI ) .
Antibody productlon and prot~in ~ nt~ f~ ~ ~tion.
Using methods well known to those of skill in the
art, anti-H-NUC ~nt;hn~ were produced. Harlow and Lane,
30 ~ntihodies: A LAhorat~y MAn1~Al Cold Spring Harbor
~aboratory (1988), incorporated herein by reference.
Briefly, about 100 ~lg of GST-491 fusion protein was used to
immunize mice and boost for three times. Sera were
collected from the i ; ~d mice and used directly for the
Wo95/17198 21 78745 PCrlUSs~l14813
immunoprecipitation experiment About lX107 cells from each
cell line were metabolically labelled with (35S)-me~h;nn;n~
for 2 hours and subsequently lysed in ice-cold Lysis 250
buffer. The clarified lysate was incubated with various
5 ~nt;h ~ r at 4C for l hour, then protein A E~o~h~nse beads
were added and incubated for another 30 minutes at 4C.
After washing extensively with lysis buffer, the beads were
boiled in SDS sample buffer a7ld the immunoprecipitates were
separated with 7 . 5% SDS-PAG~. For double
lO immunoprecipitation, the resulting immune complexes were
boiled in 200 ~l dissociation buffer I (20 mM Tris-Cl, pH
7 . 4, 50 mM NaCl, 1% SDS and 5 mM DTT) to denature the
proteins. The denatured proteins were diluted with 200 ,ul
dissociation buffer II (20 rnM Tris-Cl, pH 7.4, 50 mM NaCl,
15 l96 NP40 and l9r Na-deoxycholate) and re-immunoprecipitated
with antibodies
Cell frnctionatio~ ~LOCeil~ e8.
The procedures to separate r ' ~11e, nuclear, and
cytoplasmic fractions were adapted from Lee, H.-W., et al ,
20 Nat~re, (1987) ~:a, incorporated herein by reference.
All three fractions were then assayed for FB protein and-H-
NUC content by immunoprecipitation as described above and
aliquotes of each f7-A~t;~nq were also incubated with
glutathione beads to verify the composition of each
2 5 f raction .
DNA binding Assay.
About lx107 K562 human chronic myelogenous
leukemia cells (ATCC) were labeled with 3ss-meth;nninl~ then
lysed in Lysis 250 buffer. Lysates were clarified by
30 centrifugation and diluted with 2 volumes of loading bu$fer
(10 mM KH2PO~, pH 6.2, 1 mM MgCl~, 0.5~ NP40, l mM DTT, lO9
glycerol). The diluted extract was then applied to a DNA-
c~ qf~ column (native calf thymus DNA, Pharmacia,
~7~7~
Wo 95/17198 PCTNS94/14813
37
Piscataway, NJ), which was inr~hAt.o~l for 1 hour at 40C withgentle shaking. The column was next washed with 5 bed
volumes of loading buffer and then eluted with the same
buffer cnntA;n;n~ increasing ~nnrl~ntrationS of NaCl.
5 Fractions were analyzed by immunoprecipitation with either
anti-RB antibody or anti-H-NUC antibody as described above.
Aliquotes of each fractions also were incubated with
glutathione beads to detect the glutathione transferase.
H-NUC Yeast Expression Pl~id; Deletion Mutants
The DNA fragments derived from H-NUC cDNA were
Al-h~lnnPrl into pSE1107 (Durfee ~, 1993 ~a): Clone
491 is the original one isolated by the yeast two-hybrid
screening . H-NUC was constructed by insertion of 3 . 3kb
XhoI Ll__ ' into a i ';f;~d pSE1107 to create an in-frame
15 fusion protein. RV (-nntA;n~ the N-terminal XhoI-EcoRV
fragment. BR208, BR207, B5 and B6 are the Sau3A partial
digestion products. The Gal4 fusion protein derived from
these constructs will contain aa: 1-824 for H-~UC, aa:
559-824 for 491, aa: -1-663 for RV, aa: 699-824 for BR2-8,
20 aa: 797-824 for BR2-7, aa: 559-796 for B5, and aa: 597-
796 for B6, respectively. The ts mutant was generated by
replacing the ~siI fragment of H-NUC with the annealed
primers. The primero were as follows:
Primer 1:
25 TGGTAT~.A~'t'TA~.AATGATTTATTA~A--'rAA.'AAAAATTCAGCCTTG~At'.AAATGCA
Primer 2:
TTTCTGCAAGGCTGAAl l l L L ~ l l ~ , LAATA~ATCA l l ~ ~ATACCATGCA
All the constructs have been verified by DNA sequence
3 0 analysis .
21 787~5
Wo 95/17198 PCI'/US94114813
38
YeaEit tran~formation and Qua~titation Or 1~-gal~cto~:id ~e
tivi ty .
Yeast transformation was carried out by using the
LiOAC method as described E~reviously (Durfee et al., 1993,
5 ~), incorporated herein by reference After
transformation, cells were plated on synthetic dropout
medium lacking tryptophan and leucine to select f or the
pre~ence of plasmids. Following 2 to 3 days of growth at
30C, single colonies from each transformation were
10 inoculated into the appropriate selecting media. 2 . 5 ml
cultures were grown in the appropriate ~ rtin~ media to
OD60~ 1. 0-1 2 ~ells were then prepared and permeabilized
as described (Guarente, L., Meth~ F.n7.ymol. 101:181-191
(1983) ) incorporated herein by reference. For quantitation
15 using chlorophenyl-red-~-D-galactopyranoside (CP~G;
Boehringer r-nnh~;m) standard conditions were used (Durfee,
1993, ~), incorporated herein by reference.
I}-NUC bind~ to l-h~_~"h~- ylated Rs ln a region ~ ilar to
thc SV40 T-llntigon binding region.
A panel o~ deletion mutants of R;3 protein were
constructed. These mutants had originally been used to
delineate the T-binding domain, and were subcloned into
plasmids C~n~;n;n~ a Gal-4 D~A-binding domain, pAS1, as
described previously (Durfee et al., 1993, ~),
incorporated herein by re~erence. Two of these D~A
constructs, a Gal-4 activation domain-C-49 fusion
expressing plasmid (the nr;g;n;~l cloned C-49) and YI
pPTGl0, an indicator plasmid r~n~zl;n;n~ beta-galactosidase,
were used to co-transform yeast strain Yl53 (Durfee ~,
1993, ~a) . The expression level of each of the RB
fusion proteins was measured by Western blot analysis using
the methods of Sambrook et al ., M- le~ r Clon;ng: A
T.~horatory M~n~ l, Cold Spring ~arbor Press , Cold Spring
Harbor, N.Y. (1989), incorporated herein by reference, and
21 78745
WO 95/17198 PCT/US94~14813
39
did not vary more than 2 to 3-fold. The resulting
transformants were then assayed for beta-galactosidase
activity as described above. A8 shown in Figure 1, binding
of the C-~9 fusion protein to Gal-4-R~3 is ~i;m;n;~h~d by
5 many of the same mutations of the RB protein, including the
amino acid 706 Cys to Phe point mutation which eliminates
SV 4Q T-antigen binding. There is one exception; C-49 is
unable to bind the Ssp mutant, which lacks the C-terminal
160 amino acids of the R3 protein, whereas T-antigen can
10 bind, albeit with reduced affinity. The M1 deletion (amino
acids 612-632), which deletes part of the linker region
between the two binding 311i-~ in~l, is the only mutant able
to bind both H-NUC and T-antigen. Clearly, a similar but
not identical region of the RB protein is required for
15 binding both T-antigen and C-49.
Next, the ability of the C-49 fusion protein to
bind to pllO~ i n vitro was ~Y~mi n~d . The amino acid
sequence of pllORB is disclosed in Lee, W.-H., et al.,
~i~as~ 235:1394-1399 (1987), incorporated herein by
20 reference. The 1.3 kb cDNA clone (Figure 3) was expre3sed
as a glutathione S-transferase (GST) fusion protein in ~
~21i (Smith and Johnson, 5i~n~ 67:31-40 (1988), incorporated
herein by reference). Glutathione beads ~ t~;n;n~ equal
amounts of GST-C-49 protein and two additional controls,
25 GST alone and GST-T antigen (Figure 2A) were incubated with
whole cell extracts from a human retinoblastoma cell line
(WERI RB27) that haa been reconstituted with the RB gene
(Chen et al., C~ rowth D;ffer. 3:119-125 (1992)). In
standard culture conditions, these WERI (RB+) cell3 express
30 different isoforms of RB protein, repr.o~ntin3 different
phosphorylation states, as shown in Flgure 2B (lane 2).
Following extensive washing, proteins binding to the beads
were analyzed by SDS-PAGE and Western blotting according to
the methods disclosed in Sambrook et al, ~,
35 incorporated herein by reference. The blot shown was
probed with an anti-RB antibody, llD7 (Shan et al., ~QL
217 ~5
Wo 95/17198 8 7 PCT/ITS94/14813
Cell. Biol. 12~5620-5631 (l992), incorporated herein by
reference) . Under these coIlditions, H-NUC was able to bind
only unphosphorylated pllO~ with an affinity similar to
that o~ Gst-T, which served as a positive control. GST
5 alone does not bind to any Rb protein (see Figure lA, lanes
2 -4 ) . These results indicate that the E~-NUC protein is
able to complex with only the unphosphorylated, native,
full length Rs protein.
Full length cDNA and lt8 Eleqll~nC'6~.
To more thoroughly characterize the new protein,
the 1. 3 kb cDNA was used as a probe to screen a human
fibroblast cDNA library. From the dozen clones isolated,
the longest cDNA clone, some 3.3 kb, was completely
sequenced. The open reading ~rame encodes a protein o~ 824
15 amino acids (Figure 3) . The protein has 35% overall
homology to two known proteins, S. ~o~e yeast nuc2 and
ARr,-~illu~ n;~ bimA. Both lower eucaryotic proteins
are known to be involved in mitosis, since temperature-
sensitive mutants of these two genes arrest cells in
20 metaphase. The Nuc2 and bimA proteins contain ten 34-amino
acid repeata organized such that one i8 at the N-terminal
region and nine are cluatered at the C-terminal region, as
shown in Figure 4. Similar repeat arrangement also is
~ound in the novel Rs-asaociated protein. If only the nine
25 repeat regions o~ the three proteins are compared, the
sequence identity is 60% (Figure 4B) . The sequences
between the first and second repeats o~ nuc2 and bimA,
however, have very low homology. This poor homology also
holds true for the protein from clone C-49. Based on the
30 sequence homology, the isolated clone is likely the human
homolog of yeaat Nuc2 and Aspergillus bimA. Therefore, the
C-49 clone was designated H-NUC.
2 ~ 7~745
Wo 95/17198 PCT/USs4/l4813
41
C-term;n~l repeatg 0~ H-NUC bind to RB protein.
This H-NUC protein r~r nt~linc~ neither the known-L-
X- C-X-E motif, which T-antigen and adenoviru6 E:lA use to
bind R3, nor- the 18-amino acid sequence of E:2F that has
5 been shown to be important for binding R~3. This finding
suggests that the H-NUC protein may use a different motif
to bind R;3. To help define such a binding motif, serial
deletion mutants were constructed, each ~nnt~;n~nS
different regions of the H-N~C cDNA, and expressed Gal-4
lO fusion proteins, as shown in Figure 5. An in vivo binding
assay, the yeast two-hybrid system previously described,
(Durfee, 1993, ~), was used to determine the region of
the protein ~r~nt~ining the binding motif. The full length
protein and the original clone (cf~nt~inin~ six repeats)
15 bind to RB equally well. The N-terminal region r-~nt~inin~
the first repeat, however, fails to bind to RB. Deletion
mutants derived from different portions of the original
clone all fail to interact with RB. These data suggest
that H-NUC can bind to RB in a novel manner, perhaps by
20 using a larger region of the protein with a specific
secondary structure.
Changing amino acid 640 Gly to Asp creates a temperature-
sen~itive II-NIJC mutant th~t r~min~ "~~~ bindlng to RB at
n.. .l._, .; n~1ve temper~ture2~.
To help confirm that the binding of H-~C to R3
is physiologically significant, a single point mutation at
amino acid 640 (Gly to Asp) was created by site-directed
mutagenesis of the H-NUC p~otein. A similar change of
Gly504 to Asp in nuc2 i9 responsible for the temperature-
sensitive phenotype that arrests, t~ph~r~e progression of
S.; ' - yeast (Hirano, T., Y- Hiraoka and M. Yanagida. ~;L
t'e11 Biol 106:1171-1183 (1988) ) . Since the residue Gly i5
conserved in the H-NUC protein, as well as the yeast
homolog, creation of a Gly to Asp mutation would test
Wo 9511~198 2 1 7 8 7 ~ 5 PCTIUS94114813
42
whether the H-~C protein i3 defective in binding to RB at
nonpermi3sive ~emperatures. As shown in Figure 6, the H-
NUC protein containing the Gly-640 mutation fails to
interact with RB when yeast is growing at 37C
(nonpermissive temperature), but retai~s its ability to
bind to R~3 when yeast is growing at 22C (permissive
temperature) . ~ This data demonstrates a link between the
temperature sensitive (ts) phenotype of presumed metaphase
arrest to the Rb-binding property.
Preparation of El-NIJC antibody and id~nt-~f;~tion o~ El-NUC
protein .
To allow identification of this novel H-NUC
protein in protein gels and Western blots, mouse antibodies
to it were prepared. Gst-C-49 was expressed in E. coli,
(Smith and .Johnson, 1988, 13l~, and Shan et al., 1992,
~r~, each incorporated herein by reference) purlfied
using glutathione beads, and used as an antigen to induce
an antibody response in mice. Serum cnnt~;n;n~ polyclonal
anti-H-~UC antibody was then harvested. After the antibody
was available, an erythrolPllk~m;~ cell line (K562)
metabolically labeled with 35S-r th;nn;nf~ was used to
prepare cell lysates, which were ; nprecipitated with
polyclonal antibody, as described previously. As shown in
Figure 6A, a specif ic protein with molecular weight of
about 95 kd was precipitated by the immune serum (lane 2)
but not by preimmune 3erum . The complex f alls apart in
gels. Only a 95 kDa protein is seen because of specific
labelling of ~C562 protein with 35S-metl~inn;nF~. This 95 kd
protein also was detected when using the GST protein for
competition in; no~recipitationl demonstrating that the
polyclonal antibody does not recognize GST alone. On the
other hand, the original antigen is able to compete with
endogenous cellular protein, and the 95 kd band becomes
undetectable (lanes 3 & 4) . The P~r~C; f; ~ Y of thi s;
35 antibody was further confirmed when the primary
21 78745
o 9~/17198 PCT/USs4/l48l3
43
immunopreclpitates were denatured and re-
L ~-ipitated- As shown in Figure 6B (lane 3~, the 95
kd protein ~ s the only band detected, and the background i6
clean. All ; Innl n~ical evidence suggests, then, that the
595 kd protein is the H-NUC gene product.
H-N~C protein ha~ DNA-}linding activity.
About lX107 cells were labeled with 35s_
methionine, then lysed in Lysis 250 buffer (250mM NaCl, 5mM
EDTA, 50mM Tris (pH 8.0), 0.1% NP40, lmM
10 phenylmethylsulfonyl fluoride (PMSF), 8 ug/ml of leupeptin
and 8 ug/ml of antipain~ . Lysates were clarif ied by
centrigugation and diluted with 2 volumes of loading buffer
(lOmM KH,PO~, pH6.2, lmM MgCl2, 0.5% NP40, lmM DTT, 10
glycerol). The diluted extract was then applied to a DNA-
15 cellulo6e column (native calf thymus DNA, phiqrr-ri~,
Poscatawas, NJ) as previously described, and the mixture
was incubated for 1 hour at 4 degrees C with gentle
shaking. The column was washed with 5 bed volumes of
loading bu~fer and then eluted with the same buffer
20 rnnt~in;n~ increasing rnnrpntrations of NaCl.
Fractions of each of the eluent~ were analyzed by
immuno-precipitation (as described above) with antibodies
against r~t;nnhl~toma protein (llD7, Figure 7A), H-NUC
(Figure 7B), or GST beads (Figure 7C). Aliquots of each
25 fraction were also incubated with gll~t~th;nn~ beads to
detect glutathione transferease. RB protein has DNA-
binding activity and serves as a positive control. The-H-
NUC protein has similar D~A-binding activity, while
gl~lt~th;nnr transferase alone has no such activity.
30 Sequence homology analysis argues that the DNA-binding
region of H-NUC is located outside the ~RP region.
Wo gS/17198 ~ l 7 ~ PCT/US94114813
~I-NITC is mapped to the ch~ 17q21-22.
In situ hybr;~l;7~t;~n of the 3H-labeled, 3.3 kb-H-
NUC cD~A probe to human chromosomes showed specif ic
hF~l; n~ at the q21-22 region of ChL~ 17, as shown in
~igure 9. 0 :the 320 grains from 150 cells scored, 42
(13.19c) were found to be at 17q21-22. No other sites were
labeled above background. secause a portion of the probe
used ~-~mt~;nF~ a sequence homologous to its pseudogene,
multiple hybridizations to the short arm3 of acrocentric
chromosomes were detected in every cell ~y~m;npd and were
excluded from the analysia. Similar mapping results were
obtained by the somatic cell-hybrid method, which also maps
H-NUC to chromosome 17. The location of H-~UC is
interesting because the ~Am; l; ~l breast cancer gene has
been mapped to the same region and
Tumor Suppressor Activity of H-NUC.
The tumor suppressor activity of H-NUC was
assessed in both ; n vitl^o cell culture conditions and in
nude mouse animal models. The cells lines used to a33ess
H-NUC tumor suppres30r activity were MDA-Ms-231 which
contains one functional allele of ~-~UC and T-47D which is
a homozygous mutant of the E~-NUC locus.
Briefly, the effect of H-NUC on the proliferation
of the above two cell line3 was assessed following
expression of ~-NUC using a adenoviral expression vector.
ACN is a control adenoviral vector lacking a cDNA insert
while AC-H-NUC is an adenoviral vector expres3ing H-NUC
under the control of the human CMV promoter.
Adenoviral Vector C~lnt~;n;n~ ~-NIJC.
To construct the adenoviral expression vector, a
2520 base pair ~ nt:~;n;n~ the ~ull length cDNA ~or
Wo95117198 2 1 ~B~45 PCTIU594/14813
H-NUC was amplified by PCR from Quick Clone double-stranded
placental cDNA (Clontech) . The primers used for
amplification of H-NUC added a Kpn I restriction site at
the 5 ' end of the fragment and a Xho I site at the 3 ' end
5 to allow for directional cloning into the multiple cloning
site of pBluescript II KS+ (5 prime oligo
5 ' CGCGGTACCATGACGGTGCTGCAGGAA3 '; 3 prime oligo
5 'ATLL~Ll~AGCAGAAGTTAA~ATTCATC3 ' ) . The PCR cycles were as
follows: 1 cycle at 94 degrees Celsius 1 min; 30 cycles at
10 94 degrees Cel8ius 1 min, 53 degrees Celsius 11/2 min, 72
degrees Celsius 2 min; and 1 cycle at 72 degrees Celsius 7
min. Clones were screened for the ability to produce a 95
KD protein in the TnT Coupled Reticulocyte Lysate System
(Promega). The T3 promoter in the Bluescript vector allows
15 for transcription and translation of the H-NUC coding
sequence by rabbit reticulocytes. One microgram of mini-
lysate DNA was added per T~T Reticulocyte reaction and
incubated for 1 hour at 30 degrees Celsius. Ten
microliters of the reaction was mixed with loading buffer
20 and run on a 10~ polyacrylamide gel (Novex) for 1 1/2 hour
at 165 V. The gel was dried down and exposed to film
overnight. Four clones making full-length protein were
sequenced. The H-NUC insert was recovered from the vector
following digestion with Kpn I and Hind II and subcloned
25 into the KpnI-BgIII sites of pAdCMVb-vector (BgIII was
filled-in to create a blunt end). All four clones
rnnt~inf~fl some mutations therefore, a clone rnnt~in;n~ the
correct wild-type sequence was created by ligating
fragments from two clones.
To construct recombinant adenovirus, the above
plasmids were linearized with Nru I and co-transfected with
the large fragment of a Cla I digested dl309 mutants (Jones
and Shenk, S~ , 17:683-689 (1979) ) which is incorporated
herein by reference, using CaPO~ transfection kit
(Stratagene). Viral plaques were isolated and recombinants
identified by both restriction digest analysis and PCR
Wo 95/17198 2 ~ 7 ~ 7 ~ ~ PCT/US94114813
46
using primers agai~st H-NUC cDNA sequence. Recombinant
virus was further purified by limiting dilution, and virus
particles were purif ied and titered by standard methods
(Graham and van der Erb, Virology, 52 :456-457 (1973);
5 Graham and Prevec, ~nir~ t1nn of adenovirus vectors. In:
Methn~lc in Molecul~r Biology Vol 7: GeneTr;~n~fer ~n~l
k~7ression Protocols, Murray E.J. (ed.) The EIumana Press
Inc., Clifton N.J., 7:109-128 (l991)), both of which are
incorporated herein by ref erence .
To ensure that the H-NUC vector above expressed
a protein of the appropriate size, T-47 D cells are
inf ected with either the control or the H-N~C containing
re'_ ' ;n:ln~ adenoviruses for a period of 24 hours at
increasing multiplicities of infection (MOI~ of plaque
15 forming units of virus/cell. Cells are then washed once
with PBS and harvested in lysis buffer (50mM Tris-Hcl Ph
7.5, 250 Mm NaCl, 0.19~ NP40, 50mM NaF, 5mM EDTA, 10ug/ml
aprotinin, 10 ug/ml leupeptin, and lmM PMSF). Cellular
proteins are separated by 10~ SDS-PAGE and transferred to
20 nitrnc.olll-ln~. Mem.branes are ;n~llh~tF.~ with an anti-H-NUC
antibody followed by sheep anti-mouse IgG con~ugated with
horseradish peroxidase. Accurate expression of H-NUC
protein is visualized by ~h~m; ll.m;n~o~cence (ECL kit,
Amersham) on Kodak XAR-5 film.
25 Tn Vitro.
Breast tumor cells lines, MDA-MB-231 and T-47D,
were seeded at lx106 cells per 100 mm plate in Kaighn's
F12/DME medium (Irvine Scientific) Sllrr'~ ted with 1056
FBS and 0 . 2 IU insulin (Sigma), for T-47D cells . The
30 plates were in~ llhaterl overnight at 37C in 796 CO2. The
following day, the cells were refed with 10 mls. of growth
medium and infected with either ACN control viral lysate
(MOI 10) or with AC-H-NUC viral lysate (MOI 10) and allowed
to incubate at 37C. After 3 days, the medium was removed
~g 78~
Wo95/17198 PCT/US94/14813
47
and the cells fixed with a 1:5 acetic acid-methanol
solution. The cells were stained with a 209~ methanol-0.596
crystal violet solution for 30 minutes and rinsed with tap
water to remove excess stain.
Infection of T-47D cells with AC-H-NUC resulted
in growth inhibition of these cells by the expressed H-NUC
protein (Figure 11) . A visual observation of AC-H-N~rC
infected T-47D cells stained with crystal violet show a
reduced number of cells (approximately 50~) when compared
to the ACN control cells. In addition, a change in T-47D
cell morphology occurred. The cells appeared to become
~.. ,,1, q~.l, loging their normal growth characteristics. No
change was apparent when T-47D cells were rh~ n~ed with
control ACN virus. In contrast, the heterozygous cells,
15 MDA-MB-231, did not appear to be affected by either ACN or
AC-X-NUC in vitro .
Thymidine incorporation was also used to assess
the effects of H-NUC on cell proliferation. Briefly,
approximately 3x103 MDA-MB-231 and T-47D cells were plated
20 in each well of a 96-well plate (Costar) and allowed to
incubate overnight (37C, 79~ CO,) . Serial dilutions of ACN
or AC-H-NUC were made in DME:F12/159~ FBS/1~ glutamine, and
cells were infected at multiplicity of infection (MOI) of
10 and 100 (4 replicate wells at each MOI) with each
25 adenovirus. One-half of the cell medium volume was changed
24 hours after infection and every 48 hours until harvest.
At 13 hours prior to harvest, 1 /LCi of 3H-thymidine
(Amersham) was added to each well. Cells were harvested
onto glass-fiber filters 5 days after infection, and 3H-
30 thymidine incorporated into ~ r nucleic acid wasdetected using liquid sc;nt;11;1~ion (TopCount, Packard
Instruments) . Cell proliferation (cpm/well) at each MOI
was expressed as a percentage of the average proIiferation
of untreated control cells.
WO 95/17198 2 1 7 ~ 7 ~ 5 PCT/US94/14813
48
The results obtained showed that the
proliferation of MDA~ 231 cells (heterozygous for H-NUC)
was similar af ter treatment with either ACN or AC-X-NT,7C
(See Figure 12) . In contrast, a specific re3ponse to AC-H-
5 NUC was observed for T-47D cells (deleted for H-NUC) that
waa enhanced at higher MOI. These date demon3trate an
anti-rrnl; f~r~tive effect of adenovirus-mediated gene
transfer of the H-NUC gene on H-NUC altered cella.
l!:X Vlvo Gene Th~rnpy.
To asaess the effect of H-NUC expreasion on
tumorigenicity, the above tumor cell lines were tested for
their ability to produce tumors in nude mouse models.
Approximately 2x107 T-47D cells were plated into T225
flasks, and cells were treated with sucrose buffer
15 containing ACN or AC-H-NUC at MOI of 3 or 30. Following
overnight infections, cells were harvested and
approximately 107 cells were injected subc~t~n~o~ly into
the left and ri~ht flanks of BALB/c nude mice (4/group)
that had previously received subcutaneous pellets of 17~:-
20 estradiol. One flank was injected with ACN-treated cells,
while the contralateral flank was injected with AC-H-NUC
cells, each mouse serving as its own control. Animals
receiving bilateral injections of untreated cell3 served as
an ~ l;tinn~l control for tumor growth. Tumor dimensions
25 (length, width, height) and body weights were then measured
twice per week. Tumor volumes were estimated for each
animal assuming a spherical geometry with radius equal to
one-half the average of the mea3ured tumor dimensions.
3 0 The results of this experiment are 3hown in
Figure 13 and reveal a significant reduction in tumor
growth of the cells expressing H-NUC. Briefly, twenty-one
days after inoculation of cells, tumors were measurable on
both sides of all animals. Tumors that arose from cells
Wo 95/17198 2 ~ 7 B 7 4 ~ PCT/llSs4/14813
49
treated with AC-H-NUC (MOI=30) were smaller than
contralateral tumors from cells treated with ACN (MOI=30~
in 4 of 4 mice Average tumor 6ize from AG-H-NUC treated
cells (MOI=30) Y in~1 3maller than that of the ACN
5 treated cells (MOI=30) for the 21-day period (See Figure
3 ) . These data further indicate the tumor suppressor
activity of the H-NUC protein disclosed herein.
In Vivs Tumor Suppre~sion H-I~C.
Human breast cancer cell line T-47D cells are
l0 injected subcutaneously into female BALB/c athymic nude
mice. Tumors are allowed to develop for 32 days. At this
point, a single injection of either ACN (control) or AC-H-
NUC (c~ntAinin~ H-NUC gene) adenovirus vector is injected
into the peritumoral space ~uLLvu~-ding the tumor. Tumors
15 are then excised at either Day 2 or Day 7 following the
adenovirus injection, and poly-A+ RNA is isolated from each
tumor. Reverse transcriptase-PCR using H-NUC specific
primers, are then used to detect H-NUC RNA in the treated
tumors. Amplification with actin primers aerves as a
20 control for the RT-PCR reaction while a plasmid ~nnt:~;nin~
the recombinant- (H-NUC) se~uence serve~ as a positive
control of the recombinant- (H-NUC) specif ic band .
In a separate experiment, T-47D cells are
injected into the subc11tAn~o1~ space on the right flank of
25 mice, and tumors are allowed to grow for 2 weeks. Mice
receive peritumoral injections o~ buffer or recombinant
virus twice weekly for a total of 8 doses. Tumor growth is
monitored throughout treatment in the control animals
receiving ACN and buffer and those animals receiving AC-H-
30 NUC. Body weight and survival time is also monitored.
Wo 9S117198 2 ~ ~ ~ 7 4 5 PCT/US94114813
~xpre~ion o~ exogcneous II-N~C l" breast cancer cell line
T-47D cells.
Breast cancer cells from breast cancer cell line
T-47D which ~~nnt~;nc no endogeneous H-NUC, because of
5 homozygous mutation of its gene, provides a clean
background for functional studies of H-NUC. T-47D cells
are inf ected with comparable titers of either AC-H-NUC or
control ACN v~ctor. Most colonies are indlvidually
prop=~at~ into mass cultures.
Infected cells were me~=hnl;-~lly labeled with 35S
and used to prepare cell lysates to evaluate the amount of
protein produced. AC-AH-NUC; n~ cted cultureg are ~
to control cells in terms of morphology, growth rate (e.g.,
doubling time), saturation density, soft-agar colony
15 formation and tumorigenicity in nude mice are determined.
Although the invention has been described with
reference to the presently-preferred embodiment, it should
be understood that various modif ications can be made
without departing from the spirit of the invention.
20 Accordingly, the inverLtion is limited only by the following
claims .
