Sélection de la langue

Search

Sommaire du brevet 2212645 

Énoncé de désistement de responsabilité concernant l'information provenant de tiers

Une partie des informations de ce site Web a été fournie par des sources externes. Le gouvernement du Canada n'assume aucune responsabilité concernant la précision, l'actualité ou la fiabilité des informations fournies par les sources externes. Les utilisateurs qui désirent employer cette information devraient consulter directement la source des informations. Le contenu fourni par les sources externes n'est pas assujetti aux exigences sur les langues officielles, la protection des renseignements personnels et l'accessibilité.

Disponibilité de l'Abrégé et des Revendications

L'apparition de différences dans le texte et l'image des Revendications et de l'Abrégé dépend du moment auquel le document est publié. Les textes des Revendications et de l'Abrégé sont affichés :

  • lorsque la demande peut être examinée par le public;
  • lorsque le brevet est émis (délivrance).
(12) Demande de brevet: (11) CA 2212645
(54) Titre français: UTILISATION DE COMPOSES SPECIFIQUES COMPORTANT LCK SH2 POUR LE TRAITEMENT DE MALADIES AUTO-IMMUNES ET DU REJET D'ALLOGREFFES
(54) Titre anglais: USE OF LCK SH2 SPECIFIC COMPOUNDS TO TREAT AUTOIMMUNE DISEASES AND ALLOGRAFT REJECTION
Statut: Réputée abandonnée et au-delà du délai pour le rétablissement - en attente de la réponse à l’avis de communication rejetée
Données bibliographiques
(51) Classification internationale des brevets (CIB):
  • A61K 31/545 (2006.01)
  • A61K 31/12 (2006.01)
  • A61K 31/165 (2006.01)
  • A61K 31/166 (2006.01)
  • A61K 31/19 (2006.01)
  • A61K 31/195 (2006.01)
  • A61K 31/40 (2006.01)
  • A61K 31/437 (2006.01)
  • A61K 31/44 (2006.01)
  • A61K 31/50 (2006.01)
(72) Inventeurs :
  • DUNNINGTON, DAMIEN JOHN (Etats-Unis d'Amérique)
(73) Titulaires :
  • SMITHKLINE BEECHAM CORPORATION
(71) Demandeurs :
  • SMITHKLINE BEECHAM CORPORATION (Etats-Unis d'Amérique)
(74) Agent: GOWLING WLG (CANADA) LLP
(74) Co-agent:
(45) Délivré:
(86) Date de dépôt PCT: 1996-02-09
(87) Mise à la disponibilité du public: 1996-08-15
Licence disponible: S.O.
Cédé au domaine public: S.O.
(25) Langue des documents déposés: Anglais

Traité de coopération en matière de brevets (PCT): Oui
(86) Numéro de la demande PCT: PCT/US1996/001964
(87) Numéro de publication internationale PCT: WO 1996024343
(85) Entrée nationale: 1997-08-08

(30) Données de priorité de la demande:
Numéro de la demande Pays / territoire Date
08/386,381 (Etats-Unis d'Amérique) 1995-02-10
08/400,220 (Etats-Unis d'Amérique) 1995-03-07
08/497,357 (Etats-Unis d'Amérique) 1995-06-30

Abrégés

Abrégé français

Cette invention présente une technique de traitement de maladies auto-immunes consistant à administrer à un patient une quantité thérapeutique utile d'un composé se liant à un domaine SH2 de lck humain avec une affinité de liaison de plus de cinquante fois plus élevée que l'affinité de liaison faisant se lier ce composé à un domaine SH2 du src humain et à un domaine SH2 de fyn humain. Ce composé se lie également à un domaine SH2 de hcp humain, à un domaine SH2 du Gbr2 humain, à un domaine SH2 de SH-PTP2 humain ainsi qu'à un domaine SH2 de p85 humain avec une affinité de liaison de plus de cinquante fois plus faible que l'affinité de liaison faisant se lier ce composé à ce domaine SH2 de lck humain.


Abrégé anglais


Invented is a method of treating autoimmune diseases in a subject which
comprises administering to the subject a therapeutically effective amount of a
compound which binds to a human lck SH2 domain with a binding affinity greater
than fifty-fold higher than the binding affinity with which the compound binds
to a human src SH2 domain and a human fyn SH2 domain, and, binds to a human
hcp SH2 domain, a human Grb2 SH2 domain, a human SH-PTP2 SH2 domain and a
human p85 SH2 domain with a binding affinity which is greater than fifty-fold
lower than the binding affinity with which the compound binds to such lck SH2
domain.

Revendications

Note : Les revendications sont présentées dans la langue officielle dans laquelle elles ont été soumises.


What is claimed is:
1. A method of treating autoimmune diseases in a subject which
comprises administering to the subject a therapeutically effective amount of a
compound which:
a. binds to a human 1ck SH2 domain with a binding affinity which is
greater than fifty-fold higher than the binding affinity with which the compoundbinds to a human src SH2 domain and a human fyn SH2 domain;
b. binds to a human hcp SH2 domain with a binding affinity which is
greater than fifty-fold lower than the binding affinity with which the compound
binds to such 1ck SH2 domain;
c. binds to a human SH-PTP2 SH2 domain with a binding affinity
which is greater than fifty-fold lower than the binding affinity with which the
compound binds to such 1ck SH2 domain;
d. binds to a human p85 SH2 domain with a binding affinity which is
greater than fifty-fold lower than the binding affinity with which the compound
binds to such 1ck SH2 domain; and
e. binds to a human Grb2 SH2 domain with a binding affinity which is
greater than fifty-fold lower than the binding affinity with which the compound
binds to such 1ck SH2 domain.
2. The method of claim 1 which comprises administering to the subject
a therapeutically effective amount of a compound which binds to a human 1ck SH2
domain with a binding affinity which is greater than fifty-fold higher than the
binding affinity with which the compound binds to a human src SH2 domain and a
human fyn SH2 domain.
3. The method of claim 1 which comprises administering to the subject
a therapeutically effective amount of a compound which:
- 64 -

a. binds to a human 1ck SH2 domain with a binding affinity which is greater
than one hundred-fold higher than the binding affinity with which the compound
binds to a human src SH2 domain and a human fyn SH2 domain;
b. binds to a human hcp SH2 domain with a binding affinity which is greater
than one hundred-fold lower than the binding affinity with which the compound
binds to such 1ck SH2 domain;
c. binds to a human SH-PTP2 SH2 domain with a binding affinity which is
greater than one hundred-fold lower than the binding affinity with which the
compound binds to such 1ck SH2 domain;
d. binds to a human p85 SH2 domain with a binding affinity which is greater
than one hundred-fold lower than the binding affinity with which the compound
binds to such 1ck SH2 domain; and
e. binds to a human Grb2 SH2 domain with a binding affinity which is
greater than one hundred-fold lower than the binding affinity with which the
compound binds to such 1ck SH2 domain.
4. The method of claim 3 which comprises administering to the subject
a therapeutically effective amount of a compound which binds to a human 1ck SH2
domain with a binding affinity which is greater than one hundred-fold higher than
the binding affinity with which the compound binds to a human src SH2 domain anda human fyn SH2 domain.
5. A method of inhibiting allograft rejection in a subject which
comprises administering to the subject an allograft rejection inhibiting amount of a
compound which:
a. binds to a human 1ck SH2 domain with a binding affinity which is
greater than fifty-fold higher than the binding affinity with which the compoundbinds to a human src SH2 domain and a human fyn SH2 domain;
b. binds to a human hcp SH2 domain with a binding affinity which is
greater than fifty-fold lower than the binding affinity with which the compound
binds to such 1ck SH2 domain;
- 65 -

c. binds to a human SH-PTP2 SH2 domain with a binding affinity
which is greater than fifty-fold lower than the binding affinity with which the
compound binds to such lck SH2 domain;
d. binds to a human p85 SH2 domain with a binding affinity which is
greater than fifty-fold lower than the binding affinity with which the compound
binds to such lck SH2 domain; and
e. binds to a human Grb2 SH2 domain with a binding affinity which is
greater than fifty-fold lower than the binding affinity with which the compound
binds to such lck SH2 domain.
6. The method of claim 5 which comprises administering to the subject
an allograft rejection inhibiting amount of a compound which binds to a human lck
SH2 domain with a binding affinity which is greater than fifty-fold higher than the
binding affinity with which the compound binds to a human src SH2 domain and a
human fyn SH2 domain.
7. The method of claim 5 which comprises administering to the subject
an allograft rejection inhibiting amount of a compound which:
a. binds to a human lck SH2 domain with a binding affinity which is
greater than one hundred-fold higher than the binding affinity with which the
compound binds to a human src SH2 domain and a human fyn SH2 domain;
b. binds to a human hcp SH2 domain with a binding affinity which is
greater than one hundred-fold lower than the binding affinity with which the
compound binds to such lck SH2 domain;
c. binds to a human SH-PTP2 SH2 domain with a binding affinity
which is greater than one hundred-fold lower than the binding affinity with which
the compound binds to such lck SH2 domain;
d. binds to a human p85 SH2 domain with a binding affinity which is
greater than one hundred-fold lower than the binding affinity with which the
compound binds to such lck SH2 domain; and
- 66 -

e. binds to a human Grb2 SH2 domain with a binding affinity which is
greater than one hundred-fold lower than the binding affinity with which the
compound binds to such 1ck SH2 domain.
8. The method of claim 7 which comprises administering to the subject
an allograft rejection inhibiting amount of a compound which binds to a human 1ck
SH2 domain with a binding affinity greater than one hundred-fold higher than thebinding affinity with which the compound binds to a human src SH2 domain and a
human fyn SH2 domain.
9. A method of inducing immunosuppression in a subject which
comprises administering to the subject an immunosuppression inducing amount of acompound which:
a. binds to a human 1ck SH2 domain with a binding affinity which is
greater than fifty-fold higher than the binding affinity with which the compoundbinds to a human src SH2 domain and a human fyn SH2 domain;
b. binds to a human hcp SH2 domain with a binding affinity which is
greater than fifty-fold lower than the binding affinity with which the compound
binds to such 1ck SH2 domain;
e. binds to a human SH-PTP2 SH2 domain with a binding affinity
which is greater than fifty-fold lower than the binding affinity with which the
compound binds to such 1ck SH2 domain;
d. binds to a human p85 SH2 domain with a binding affinity which is
greater than fifty-fold lower than the binding affinity with which the compound
binds to such 1ck SH2 domain; and
e. binds to a human Grb2 SH2 domain with a binding affinity which is
greater than fifty-fold lower than the binding affinity with which the compound
binds to such 1ck SH2 domain.
10. The method of claim 9 which comprises administering to the subject
an immunosuppression inducing amount of a compound which binds to a human lck
- 67 -

SH2 domain with a binding affinity which is greater than fifty-fold higher than the
binding affinity with which the compound binds to a human src SH2 domain and a
human fyn SH2 domain.
11. The method of claim 9 which comprises administering to the subject
an immunosuppression inducing amount of a compound which:
a. binds to a human 1ck SH2 domain with a binding affinity which is
greater than one hundred-fold higher than the binding affinity with which the
compound binds to a human src SH2 domain and a human fyn SH2 domain;
b. binds to a human hcp SH2 domain with a binding affinity which is
greater than one hundred-fold lower than the binding affinity with which the
compound binds to such 1ck SH2 domain;
c. binds to a human SH-PTP2 SH2 domain with a binding affinity
which is greater than one hundred-fold lower than the binding affinity with which
the compound binds to such 1ck SH2 domain;
d. binds to a human p85 SH2 domain with a binding affinity which is
greater than one hundred-fold lower than the binding affinity with which the
compound binds to such 1ck SH2 domain; and
e. binds to a human Grb2 SH2 domain with a binding affinity which is
greater than one hundred-fold lower than the binding affinity with which the
compound binds to such 1ck SH2 domain.
12. The method of claim 11 which comprises administering to the subject
an immunosuppression inducing amount of a compound which binds to a human 1ck
SH2 domain with a binding affinity which is greater than one hundred-fold higherthan the binding affinity with which the compound binds to a human src SH2
domain and a human fyn SH2 domain.
13. Use of a compound which:
- 68 -

a. binds to a human 1ck SH2 domain with a binding affinity which is
greater than fifty-fold higher than the binding affinity with which the compoundbinds to a human src SH2 domain and a human fyn SH2 domain;
b. binds to a human hcp SH2 domain with a binding affinity which is
greater than fifty-fold lower than the binding affinity with which the compound
binds to such 1ck SH2 domain;
c. binds to a human SH-PTP2 SH2 domain with a binding affinity
which is greater than fifty-fold lower than the binding affinity with which the
compound binds to such 1ck SH2 domain;
d. binds to a human p85 SH2 domain with a binding affinity which is
greater than fifty-fold lower than the binding affinity with which the compound
binds to such 1ck SH2 domain; and
e. binds to a human Grb2 SH2 domain with a binding affinity which is
greater than fifty-fold lower than the binding affinity with which the compound
binds to such 1ck SH2 domain; in the manufacture of a medicament for use in
treating autoimmune diseases.
14. A use according to claim 13 wherein the compound binds to a human
1ck SH2 domain with a binding affinity which is greater than fifty-fold higher than
the binding affinity with which the compound binds to a human src SH2 domain anda human fyn SH2 domain.
15. A use according to claim 13 wherein the compound:
a. binds to a human 1ck SH2 domain with a binding affinity which is
greater than one hundred-fold higher than the binding affinity with which the
compound binds to a human src SH2 domain and a human fyn SH2 domain;
b. binds to a human hcp SH2 domain with a binding affinity which is
greater than one hundred-fold lower than the binding affinity with which the
compound binds to such 1ck SH2 domain;
- 69 -

c. binds to a human SH-PTP2 SH2 domain with a binding affinity
which is greater than one hundred-fold lower than the binding affinity with which
the compound binds to such 1ck SH2 domain;
d. binds to a human p85 SH2 domain with a binding affinity which is
greater than one hundred-fold lower than the binding affinity with which the
compound binds to such 1ck SH2 domain; and
e. binds to a human Grb2 SH2 domain with a binding affinity which is
greater than one hundred-fold lower than the binding affinity with which the
compound binds to such 1ck SH2 domain.
16. A use according to claim 15 wherein the compound binds to a human
1ck SH2 domain with a binding affinity which is greater than one hundred-fold
higher than the binding affinity with which the compound binds to a human src SH2
domain and a human fyn SH2 domain.
17. Use of a compound which:
a. binds to a human 1ck SH2 domain with a binding affinity which is
greater than fifty-fold higher than the binding affinity with which the compoundbinds to a human src SH2 domain and a human fyn SH2 domain;
b. binds to a human hcp SH2 domain with a binding affinity which is
greater than fifty-fold lower than the binding affinity with which the compound
binds to such 1ck SH2 domain;
c. binds to a human SH-PTP2 SH2 domain with a binding affinity
which is greater than fifty-fold lower than the binding affinity with which the
compound binds to such 1ck SH2 domain;
d. binds to a human p85 SH2 domain with a binding affinity which is
greater than fifty-fold lower than the binding affinity with which the compound
binds to such 1ck SH2 domain; and
e. binds to a human Grb2 SH2 domain with a binding affinity which is
greater than fifty-fold lower than the binding affinity with which the compound
- 70 -

binds to such 1ck SH2 domain; in the manufacture of a medicament for use in
inhibiting allograft rejection.
18. A use according to claim 17 wherein the compound binds to a human
1ck SH2 domain with a binding affinity which is greater than fifty-fold higher than
the binding affinity with which the compound binds to a human src SH2 domain anda human fyn SH2 domain.
19. A use according to claim 18 wherein the compound:
a. binds to a human 1ck SH2 domain with a binding affinity which is
greater than one hundred-fold higher than the binding affinity with which the
compound binds to a human src SH2 domain and a human fyn SH2 domain;
b. binds to a human hcp SH2 domain with a binding affinity which is
greater than one hundred-fold lower than the binding affinity with which the
compound binds to such 1ck SH2 domain;
c. binds to a human SH-PTP2 SH2 domain with a binding affinity
which is greater than one hundred-fold lower than the binding affinity with which
the compound binds to such 1ck SH2 domain;
d. binds to a human p85 SH2 domain with a binding affinity which is
greater than one hundred-fold lower than the binding affinity with which the
compound binds to such 1ck SH2 domain; and
e. binds to a human Grb2 SH2 domain with a binding affinity which is
greater than one hundred-fold lower than the binding affinity with which the
compound binds to such 1ck SH2 domain.
20. A use according to claim 19 wherein the compound binds to a human
1ck SH2 domain with a binding affinity greater than one hundred-fold higher thanthe binding affinity with which the compound binds to a human src SH2 domain anda human fyn SH2 domain.
21. Use of a compound which:
- 71 -

a. binds to a human 1ck SH2 domain with a binding affinity which is
greater than fifty-fold higher than the binding affinity with which the compoundbinds to a human src SH2 domain and a human fyn SH2 domain;
b. binds to a human hcp SH2 domain with a binding affinity which is
greater than fifty-fold lower than the binding affinity with which the compound
binds to such 1ck SH2 domain;
c. binds to a human SH-PTP2 SH2 domain with a binding affinity
which is greater than fifty-fold lower than the binding affinity with which the
compound binds to such 1ck SH2 domain;
d. binds to a human p85 SH2 domain with a binding affinity which is
greater than fifty-fold lower than the binding affinity with which the compound
binds to such 1ck SH2 domain; and
e. binds to a human Grb2 SH2 domain with a binding affinity which is
greater than fifty-fold lower than the binding affinity with which the compound
binds to such 1ck SH2 domain; in the manufacture of a medicament for use in
inducing immunosuppression.
22. A use according to claim 21 wherein the compound binds to a human
1ck SH2 domain with a binding affinity which is greater than fifty-fold higher than
the binding affinity with which the compound binds to a human src SH2 domain anda human fyn SH2 domain.
23. A use according to claim 21 wherein the compound:
a. binds to a human 1ck SH2 domain with a binding affinity which is
greater than one hundred-fold higher than the binding affinity with which the
compound binds to a human src SH2 domain and a human fyn SH2 domain;
b. binds to a human hcp SH2 domain with a binding affinity which is
greater than one hundred-fold lower than the binding affinity with which the
compound binds to such 1ck SH2 domain;
- 72 -

c. binds to a human SH-PTP2 SH2 domain with a binding affinity
which is greater than one hundred-fold lower than the binding affinity with which
the compound binds to such lck SH2 domain;
d. binds to a human p85 SH2 domain with a binding affinity which is
greater than one hundred-fold lower than the binding affinity with which the
compound binds to such lck SH2 domain; and
e. binds to a human Grb2 SH2 domain with a binding affinity which is
greater than one hundred-fold lower than the binding affinity with which the
compound binds to such lck SH2 domain.
24. A use according to claim 23 wherein the compound binds to a human
lck SH2 domain with a binding affinity which is greater than one hundred-fold
higher than the binding affinity with which the compound binds to a human src SH2
domain and a human fyn SH2 domain.
- 73 -

Description

Note : Les descriptions sont présentées dans la langue officielle dans laquelle elles ont été soumises.


CA 0221264~ 1997-08-08
WO 96124343 PCT/US96/01964
USE OF LCK SH2 SPECIFIC COMPOUNDS TO TREAT
AUTOIMMUNE DISEASES AND ALLOGRAFT REJECTION
BACKGROUND OF THE INVENTION
~ S The src-related, lymphocyte-specific protein tyrosine kinase, pS6'C''(lck), is
physically associated through its unique amino-termin~l domain with the
cytoplasmic tail of CD4 in T lymphocytes. The CD4 associated lck is an essentialcomponent in the T cell activation c~cc~de, and an intact lck SH2 dom~in/CD4
complex is required for functional immnn~ response of T cells to antigen. Inhibition
of the lck SH2 domain/CD4 complex results in T cell-specific immunosuppression.
A number of polypeptide growth factors and hormones m~.tli~te their cellular
effects through a signal tr~nc~luction pa~llw~y. Transduction of signals from the cell
surface receptors for these ligands to intracellular effectors frequently involves
phosphorylation or dephosphorylation of specific protein substrates by regulatory
protein tyrosine kinases (PTK) and phosphatases. Tyrosine phosphorylation may bethe primary, or possibly even the sole, indicator of signal transduction in
multicellular organisms. Receptor-bound and intracellular PTKs regulate cell
proliferation, cell dirr~,re;llLiation and ci~n~lling processes in immnne system cells.
Aberrant protein tyrosine kinase activity has been implicated or is sllcpecte-l
in a number of pathologies such as diabetes, atherosclerosis, psoriases, septic shock,
bone loss, anemia, many cancers and other proliferative diseases. Accordingly,
tyrosine kinases and the signal transduction pathways which they are part of arepotential targets for drug design. For a review, see Levitzki et al. in Science 267,
1782-1788 (1995).
Many of the proteins comprising signal tr~nsduction pathways are present at
low levels and often have opposing activities. The properties of these sign~lling
molecules allow the cell to control transduction by means of the subcellular location
and juxtaposition of effectors as well as by balancing activation with repression such
that a small change in one pathway can achieve a switching effect.
The formation of tr~n~-lucing complexes by juxtaposition of the signalling
molecules through protein-protein interactions are m~ tt-d by specific docking
domain sequence motifs. Src homology 2 (SH2) domains, which are conserved non-
--I--

-
CA 0221264~ 1997-08-08
WO 96/24343 PCT/US96/01964
catalytic sequences of approximately 100 amino acids found in a variety of
.cign~lling molecules such as non-receptor PTKs and kinase target effector molecules
and in oncogenic proteins, play a critical role. The SH2~1Qm~in~ are highly specific
for short phosphotyrosine-cont~ining peptide sequences found in
5 autophosphorylated PTK receptors or intracellular tyrosine kin~ces
Approximately 60 proteins having distinct catalytic or other functional
c~om~in~ yet sharing conserved SH2 domains, conserved sequences of approximately100 amino acids, have been ic~Pntified. It is not known precisely which
physiological responses in the body are controlled by each of these SH2 domains.10 Further, the SH2 domain-ligand/compound interactions are highly specific such that
minor modifications in the structure of the ligand/compound will significantly alter
the selectivity with which the ligand/compound binds to the various SH2 domains.The consequences of non selective antagonism of SH2 domains can be quite
severe. For example, the src SH2 dom~in, the lck SH2 domain and the fyn SH2
15 domain are structurally similar, possessing a high degree of conservation between
the ~lom~in~ Antagonism of the src SH2 domain is indicated as effecting bone
resorption while antagonism of the lck SH2 domain (discussed herein) or the fyn
SH2 domain induces immuno~u~lc:,sion. The inhibition of bone resorption would
be undesirable in long term therapy which requires the induction of
20 immuno~u~plcs~ion.
Furthermore, it would be impractical to assay potential lck SH2 domain
antagonists in binding studies against all 60 known SH2~iom~in~ Presently, thereare no known compounds which selectively interact with the lck SH2-1om~in
It would be desirable to provide methods and compounds which allow the
treatment of ~uLoi"-"llm~ diseases and allograft rejection by antagonizing the lck
SH2 domain but which avoid the production of side effects observed in non-
selective SH2 domain antagonists.
As disclosed herein it has unexpectedly been discovered that selective lck
SH2 domain antagonists can be identified by binding assays against the subset ofSH2 domains consisting of; the src SH2 domain, the lck SH2 domain, the fyn SH2

CA 0221264~ 1997-08-08
WO 96124343 PCT/US96/01964
domain, the ~ 2 SH2 domain, the p85 domain, the Grb2 SH2 domain and the
hcp SH2 domain.
From the binding information described hereinafter, it has unexpectedly been
discovered that compounds which are specific for a human lck SH2 domain with a
5 binding affinity greater than fifty-fold higher than the binding affinity with which
the compound binds to a human src SH2 domain and a human fyn SH2 domain, and
(b) binds to a human hcp SH2 dom~in, a human Grb2 SH2 domain, a human SH-
PTP2 SH2 domain and a human p85 SH2 domain with a binding affinity which is
greater than fifty-fold lower than the binding affinity with which the co.1.~ou1.d
l0 binds to such lck SH2 domain are effective for treating aulo;~ -e diseases and
allograft rejection.
SUMMARY OF THE INVENTION
The present invention provides a method of treating autoimmllne diseases in
15 a subject which comprises ~Amini.~tering to the subject a the.,.pe~.lic~lly effective
amount of a compound which (a) binds to a human lck SH2 domain with a binding
affinity greater than fifty-fold higher than the binding affinity with which thecompound binds to a human src SH2 domain and a human fyn SH2 domain, and (b)
binds to a human hcp SH2 domain, a human Grb2 domain, a human SH-PTP2 SH2
20 domain and a human p85 SH2 domain with a binding affinity which is greater than
fifty-fold lower than the binding affinity with which the compound binds to such lck
SH2 domain.
The present invention also provides a method of inhibiting allograft rejection
in a subject which comprises ~rlmini~tering to the subject an allograft rejection
25 inhibiting amount of a compound which (a) binds to a human lck SH2 domain with a
binding affinity greater than fifty-fold higher than the binding affinity with which
the compound binds to a human src SH2 domain and a human fyn SH2 domain, and
(b) binds to a human hcp SH2 domain, a human Grb2 domain, a human SH-PTP2
~ SH2 domain and a human p85 SH2 domain with a binding affinity which is greater
30 than fifty-fold lower than the binding affinity with which the compound binds to
such lck SH2 domain.

CA 0221264~ 1997-08-08
WO 96/24343 PCT/US96/01964
The present invention also provides a method of inducing
immunosuppression in a subject which comprises ~(1mini.ctering to the subject animmuno~u~plcssion inducing amount of a compound which (a) binds to a human lck
SH2 domain with a binding affinity greater than fifty-fold higher than the binding
affinity with which the compound binds to a human src SH2 domain and a human
fyn SH2 domain, and (b) binds to a human hcp SH2 domain, a human Grb2 domain,
a human SH-PTP2 SH2 domain and a human p85 SH2 domain with a binding
affinity which is greater than fifty-fold lower than the binding affinity with which
the compound binds to such lck SH2 domain.
DETAILED DESCRIPTION OF THE INVENTION
As used herein, the term "~lltoi,.~ . diseases" means any disorder
char~ct.ori7ecl by an overly active imml-ne response or an immllnr. response wrongly
directed against self antigen. The ~iGr~lc;d ~ltnimm1lne disease is rh~l-m~toid
arthritis. Other diseases such as mllltiple sclerosis, systemic lupus erythematosis and
type I diabetes are also inrl~
As used herein, the term "treating" and derivatives thereof means
prophylactic or thel~eulic therapy.
As used herein, the term "compound" means a nonpeptide chrmir~l
compound.
As used herein, unless other wise defined, the term "lck SH2 domain
antagonists" means a compound which (a) binds to a human lck SH2 domain with a
binding affinity greater than fifty-fold higher, preferably greater than one hundred-
fold higher, than the binding affinity with which the compound binds to a human src
SH2 domain and a human fyn SH2 domain, and (b) binds to a human hcp SH2
domain, a human Grb2 SH2, a human SH-PTP2 SH2 domain and a human p85 SH2
domain with a binding affinity which is greater than fifty-fold lower, preferably
greater than one hundred-fold lower, than the binding affinity with which the
compound binds to such lck SH2 ~lom~in
The present invention provides a method of treating autoimmune diseases in
a subject which comprises ~mini~tering to the subject a therapeutically effective
-- 4 --

CA 0221264~ 1997 - 08 - 08
WO 96l24343 PCT/US96/01964
amount of a eompound whieh (a) binds to a human lek SH2 domain with a binding
affinity greater than fifty-fold higher than the binding affinity with whieh theeol.lpoulld binds to a human sre SH2 domain and a human fyn SH2 domain, and (b)
binds to a human hep SH2 tiom~in, a human Grb2 SH2, a human SH-PTP2 SH2
domain and a human p85 SH2 domain with a binding affinity whieh is greater than
fifty-fold lower than the binding affinity with whieh the eompound binds to sueh lek
SH2 domain.
A plcfcllcd aspeet of the invention provides a method of treating
autoimmlln~ diseases in a subjeet whieh eomprises ~iminicte.ring to the subjeet a
therapeutieally effeetive amount of a eompound whieh (a) binds to a human lek SH2
domain with a binding affinity greater than fifty-fold higher than the binding affinity
with whieh the eompound binds to a human sre SH2 domain and a human fyn SH2
domain.
A preferred aspeet of the invention provides a method of treating
au~oi.~ e diseases in a subjeet whieh eomprises ~flmini.ctering to the subjeet athcl~culieally effeetive amount of a eompound whieh (a) binds to a human lek SH2domain with a binding affinity greater than one hundred-fold higher than the binding
affinity with whieh the eolll~oulld binds to a human src SH2 domain and a human
fyn SH2 domain, and (b) binds to a human hep SH2 domain, a human Grb2 SH2, a
human SH-PTP2 SH2 domain and a human p85 SH2 domain with a binding affinity
whieh is greater than one hundred-fold lower than the binding affinity with which
the eompound binds to sueh lek SH2 domain.
A ~lcrcllcd aspect of the invention provides a method of treating
autoimm-m~ ce~ces in a subject which comprises ~flmini.ctt~ring to the subject athel~eulically effeetive amount of a compound which (a) binds to a human lck SH2domain with a binding affinity greater than one hundred-fold higher than the binding
affinity with which the compound binds to a human src SH2 domain and a human
fyn SH2 domain.
The invention also provides a method of inhibiting allograft rejection in a
subject which eomprises ~rlmini.ctering to the subject an allograft rejection inhibiting
amount of a compound which (a) binds to a human lck SH2 domain with a binding

CA 0221264~ 1997-08-08
WO 96124343 PCT/US96/01964
affinity greater than fifty-fold higher, ~lcfeldbly greater than one hundred-fold
higher, than the binding affinity with which the compound binds to a human src SH2
domain and a human fyn SH2 domain, and (b) binds to a human hcp SH2 domain, a
human Grb2 domain, a human SH-PTP2 SH2 domain and a human p85 SH2 domain
with a binding affinity which is greater than fifty-fold lower, preferably greater than
one hundred-fold lower, than the binding affinity with which the compound binds to
such lck SH2 domain.
A ~lcfe~lcd aspect of the invention provides a method of inhibiting allograft
rejection in a subject which comprises ~fiminictering to the subject an allograft
rejection inhibiting amount of a compound which (a) binds to a human lck SH2
domain with a binding affinity greater than fifty-fold higher, preferably greater than
one hundred-fold higher, than the binding affinity with which the compound binds to
a human src SH2 domain and a human fyn SH2 domain.
The invention also provides a method of inducing immunosuppression in a
subject which comprises ~lminictering to the subject an immunosuppression
inducing amount of a compound which (a) binds to a human lck SH2 domain with a
binding affinity greater than fifty-fold higher, preferably greater than one hundred-
fold higher, than the binding affinity with which the compound binds to a human src
SH2 domain and a human fyn SH2 domain, and (b) binds to a human hcp SH2
~ m~in, a human Grb2 domain, a human SH-PTP2 SH2 domain and a human p85
SH2 domain with a binding affinity which is greater than fifty-fold lower, preferably
greater than one hundred-fold lower, than the binding affinity with which the
compound binds to such lck SH2 domain.
A p,efel,cd aspect of the invention provides a method of inducing
immunosuppression in a subject which comrri.ces arlminictering to the subject animmunosuppression inducing amount of a compound which (a) binds to a human lck
SH2 domain with a binding affinity greater than fifty-fold higher, preferably greater
than one hundred-fold higher, than the binding affinity with which the compound
binds to a human src SH2 domain and a human fyn SH2 domain.

CA 0221264~ 1997-08-08
WO 96124343 PCT/US96/01964
The inhibitory activity of compounds at the different human SH2 domains
was determin~cl in vitro using SH2 domains expressed as fusion proteins in E. coli as
further described in detail in Example 11 below.
The data shown in the accompanying Tables 1 and 2 inrlic~te the ability of
5 the stated compounds to antagonize lck SH2 domain. Compounds indicated as
selective lck SH2 domain antagonist from the assays in Example 11 are tested in
known assays for their ability to induce immunosuppressive activity. Preferred
assays include:
1) The IL2 Production Assay - which measures the production of IL2 in T
10 cells in response to various stimuli. The most commonly used T cell is the Jurkat
human T cell line. The Jurkat is stim~ te~l with, a) mitogenic lectin
(phytohem~glutinin or PHA) plus calcium inonophore or plus phorbol esters, or b) T
cell receptor antibody plus phorbol esters. The mea~ulGlllent of IL2 by ELISA
specific for human IL2 inclic~tt-s the level of activity and
2) The Three wav Human Mixed Lymphocvtes Reaction (MLR) - which
mimics of response to foreign antigen. This assay measures the response of
lymphocytes from one individual to the foreign antigens present in blood cells of
another individual. The lymphocytes from the blood of three different donors (3-way response) are mixed together and in~ ub~te~l in complete growth medium for 4 -
20 5 days. The ~letermin~tion cell prolirtlalive response by mP~cllring thymidine
incorporation in~ t~s the level of activity.
Activity in these assays is recognized in the art as correlating with efficacy in
treating autoimm~lnto diseases in vivo. Activity in these assays is also recognized in
the art as correlating with efficacy in inhibiting allograft rejection in vivo. Activity
25 in these assays is also recognized in the art as correlating with efficacy in inducing
immunosuppression in vivo.
The present invention therefore provides a method of inducing
imrnunosuppression, which comprises ~iminictering a quantity of a lck SH2 domainantagonists defined as herein in a quantity effective to induce im~nunosuppression.
30 The drug may be ~iminictered to a patient in need of immunosuppression by anyconventional route of ~riminictration~ including, but not limited to, intravenous,
-- 7 --

CA 0221264~ 1997-08-08
WO 96/24343 PCT/US96/01964
intr~mllccul~r, oral, subcutaneous, intr~lerm~l, and ~alGntGl~l. The quantity
effective to induce immunosuppression is from about 0.001 mg per kg to about 10.0
mg per kg of subject body weight. The selected dose will be an efficacious,
nontoxic quantity selected from about 0.001 mg per kg to about 10.0 mg per kg of5 subject body weight. The sçlPcted dose will be ~-lminictered from about 1-6 times
daily.
The method of in-lucing immllno~up~lGssion disclosed in the present
invention may also be carried out using a ph~rm~reutir~l composition comprising an
lck SH2 domain antagonists defined herein and a ph~rm~reutically acceptable
carrier. The composition may contain between 0.05 mg and 500 mg of a lck SH2
domain antagonist, and may be conctitllt~rl into any form suitable for the mode of
minictration selected. Compositions suitable for oral ~ciminictration include solid
forms, such as pills, c~rsulec, granules, tablets, and powders, and liquid forms, such
as solutions, syrups, elixers, and ~ls~ell:,ions. Forms useful for parenteral
~(1minictration include sterile solutions, emulsions, and suspensions.
The present invention further provides a method of inhibiting allograft
rejection, which compri.ces ~riminictering a quantity of a lck SH2 domain antagonists
defined as herein in a quantity effective to inhibit allograft rejection. The drug may
be ~iminictrred to a patient with a recently impl~nted allograft or in anticipation of
receiving an allograft by any conventional route of s/~lrninictration, including, but not
limited to, intravenous, int ~ sc~ r, oral, subcutaneous, intradermal, and
parenteral. The quantity effective to inhibit allograft rejection is from about 0.001
mg per kg to about 10.0 mg per kg of subject body weight. The selected dose will be
an efficacious, nontoxic quantity selected from about 0.001 mg per kg to about 10.0
mg per kg of subject body weight. The selected dose will be ~Aminictered from
about 1-6 times daily.
The method of inhibiting allograft rejection disclosed in the present invention
may also be carried out using a ph~rrn~reutical composition comprising an lck SH2
domain antagonists defined herein and a ph~rm~reutically acceptable carrier. Thecomposition may contain between 0.05 mg and 500 mg of a lck SH2 domain
antagonist, and may be constituted into any form suitable for the mode of
-- 8 --

CA 0221264~ 1997-08-08
WO 96/24343 PCT/US96/01964
~Aminictration se.lectecl Compositions suitable for oral ~Aminictration include solid
forms, such as pills, capsules, granules, tablets, and powders, and liquid forms, such
as solutions, syrups, elixers, and suspensions. Forms useful for parenteral
aAminictration include sterile solutions, emulsions, and suspensions.
S The drug may otherwise be ~lc;p~,d as a sterile solid composition whichmay be dissolved or sncpçn~le~l at the time of ~Aminictration using sterile water,
saline, or other a~p.~,pliate sterile injectable mP.Aillm Carriers are intPnAe~l to
include nP.cessa~ and inert binders, suspending agents, lubricants, flavorants,
sweeteners, preservatives, dyes and coatings.
Optimal dosages to be ~Aminictered may be readily determined by those
skilled in the art, and will vary with the particular lck SH2 domain antagonist in use,
the strength of the plGp~alion, the mode of ~Aminictration~ and the advancement of
the disease condition. Additional factors depending on the particular patient being
treated will result in a need to adjust dosages, including patient age, weight, diet, and
time of ~Aminictration.
The invention also provides for the use of a lck SH2 domain antagonists in
the m~nnfartllre of a m~AicamP.nt for use in the treatmP.nt of autoi,-,-"ll,-ç tliceace
The invention also provides for the use of a lck SH2 domain antagonists in
the manufacture of a mP.Aic~mPnt for use in inhibiting allograft rejection.
The invention also provides for the use of a lck SH2 domain antagonists in
the m~nllfactllre of a mPAir~mPnt for use in in-lucing immunosuppression.
The invention also provides for a ph~rm~reutic~l composition for use in the
treatment of autoimmnn~. diseases which comprises a lck SH2 domain antagonists.
The invention also provides for a pharm~re-ltic~l composition for use in
inhibiting allograft rejection which comprises a lck SH2 domain antagonists.
The invention also provides for a pharmareutir~l composition for use in
inducing immunosuppression which comprises a lck SH2 domain antagonists.
No unacceptable toxicological effects are expected when the methods of the
invention are utilized in accordance with the present invention.
Without further elaboration, it is believed that one skilled in the art can,
using the preceAing description, utilize the present invention to its fullest extent.
g

CA 0221264~ 1997-08-08
WO 96124343 PCT/US96/01964
The following Examples are, therefore, to be construed as merely illustrative and not
a limitation of the scope of the present invention in any way.
Experimental Details
As used herein, unless otherwise intlic~t~l, the symbol ~ means ~C.
L-3,5-Dibromotyrosine can be prepared by rnethods known in the art, for
ex~mple as described in "Thyoid Hormones and Analogues. I. Synthesis, Physical
Plu~c~Lies and Theoretical Calculations" E. C. Jorgensen, H~rmnn~l Proteins and
Peptides, Vol. VI, 1978, Academic Press, N.Y. and references cited therein.
L-3,5-dibromo-N-trifluoroacetyl-tyrosine methyl ester (for use in Example 2
(e) and in Example 2B (b)) can be prepared according to the following procedure.L-3,5-Dibromotyrosine (500 g) was suspended in methanol (5 liters) and dry
hydrogen chloride passed through the stirred suspension for 5 hours. The reaction
l-u~lu~c was ~va~oldt~d to dryness, the residue suspended in water (4 liters), and the
pH adjusted to 6 with 40% sodium hydroxide. The precipitate was collected and
washed with water to give L-3,5-dibromotyrosine methyl ester (467 g, 90%), m.p.
201~-203~. The ester (768 g) was suspended in chlo,~,fc"", (2.7 liters) and ethyl
acetate (2.7 liters), then trifluoroacetic anhydride (565 g) was added over 0.5 hour,
keeping the tCllll cldlule below 35~. The mixture was left overnight, then water (2
liters) was added and the pH adjusted to 7 by the addition of saturated sodium
bicarbonate solution. The organic layer was removed, washed with water, dried with
anhydrous m~gnt~cillm sulphate and ~va~uldt~d. The residue was recryst~ ed from
aqueous methanol to give L-3,5-dibromo-N-trifluoroacetyl-tyrosine methyl ester
(786 g, 81%), m.p. 136~-7~.
Scheme 1 as used in Example 6 below
~C02H ~CO2 Kaiser oxime resin CONHR"
RHN~- ~ RHN~ --~ R'COHN~
1: R=H 3: R=Boc
2: R=Boc 4: R=H 6
5: R=COR'
- 10-

CA 0221264~ 1997-08-08
WO 96124343 PCT/US96/01964
The amino group of 4-tran~-aminomethyl-cyclohexyl-carboxylic acid 1 is
protected with a standard protective group such as with a Boc group (Boc anhydride,
NaOH, H2O, dioxane) to form 2, then is coupled to Kaiser oxime resin (Kaiser, E.T.;
et al JAm Chem Soc 1985, 107, 7087-7092) using a coupllng reagent such as DCC
5 to form 3. The amine is then deprotected under standard conditions (25% TFA,
methylene chloride) to form 4, then is acylated with standard conditions (such as
with HBTU, NMM in DMF or DCC or DIC in DMF or NMP) to form 5. The
compound is then cleaved from the resin with various amines to form the final
desired product 6.
Colllpoullds 1 to 10 are prepared according ~o Fl~mpl~s 1 to 10 which
follow.
Example 1
Preparation of 7-rD.L-a-Amino-a-(4-carboxyphenyl)acetamidol-3-r2-(5-methyl-
1~3.4-thi~ 7l 1yl)thiomethyll~-cephem-4-carboxylic Acid (Compound 1)
NH2 H
HO~o~N;~S~,~S
O CO2H N - N
a) 4-Hydroxymethylb~-n7~1-1ehyde
To a solution of 1,4-ben7tqnlo~1ie~rboxaldehyde (50.0 g, 0.373 mole) in dry
tetrahydrofuran (200 mT ) under nitrogen in an ice bath was added dropwise lithium
tri(tert-butoxy)~ minllm hydride (104.0 g, 0.410 mole) in 500 mL of
tetrahydrofuran. After stirring for one half hour in an ice bath, the reaction mixture
was poured into 2 L of ice cold 2 N hydrochloric acid. The aqueous solution was
extracted with four 800 mL portions of ether. The combined ether layers were
washed with sodium bicarbonate solution, brine and dried. Evaporation of the
solvent afforded 46 g of crude material that was purified by chromatography
(alumina, ether elution) to provide the title compound as a crystalline material (17.6
g, 35%): mp 44.5-46 ~C
b) 5-(4-Hydroxymethyphenyl)hydantoin

CA 0221264~ 1997-08-08
WO 96/24343 PCT/US96/01964
To a stirred rnixture of 4-hydroxymethylber~7:lldehyde (10.0 g, 73.5 mmol)
and ammonium carbonate (17.1 g, 150 mmol) in 110 rnL of 60% aqueous ethanol
heated to 50 ~C there was added sodium cyanide (4.0 g, 81 mmol) in 10 mL of
water. The llu~lult; was stirred and heated at 50-60 ~C for 3 h and then at 85 ~C for
5 one hour. After cooling in an ice bath, the pH of the solution was adjusted to 6 by
addition of concentrated hydrochloric acid. Upon overnight cooling, the solid which
had precipitated was filtered, washed with water and dried to provide the title
compound (11.0 g, 72%): mp 189-196 ~C.
c) 4-Hydroxymethyphenylglycine
A mixture of compound of Example l(b) (10.9 g, 53 mmol) and barium
hydroxide octahydrate (25.5 g, 81 mmol) in 125 mL of water was stirred under
reflux for 18 h. The reaction mixture was cooled and acidified to pH 1 with
concentrated sulfuric acid; the barium sulfate was filtered and the pH of the filtrate
brought to 6 with lead carbonate. After filtration of the lead sulfate, the filtrate was
saturated with hydrogen sulfide and the lead sulfide filtered. The aqueous solution
was then concentrated to 100 mL by ~eotroping with ethanol under reduced
pl~S:iul~ to provide, after cooling, the title compound (5.2 g, 54%): mp 230-231 ~C.
d) N-tert-Butoxycarbonyl-4-hydroxymethyphenylglycine
To a solution of 4-hydroxymethyphenylglycine (8.0 g, 44 mmol) and
triethylamine (8.8 g, 87 mmol) in 160 mL of water was added tert-butoxycarbonyl
azide (6.95 g, 49 mmol) in 120 mL of tetrahydrofuran. After stirring overnight at
room t~ el~Lule, the reaction ll~ib~lule was washed twice with 200 mL potions ofether. The aqueous layer was covered with ether and acidified to pH 3-3.5 with 3 N
hydrochloric acid in an ice bath. The acidic solution was extracted with ether and the
combined organic extrats washed with brine, dried and evaporated. The resulting oil
was triturated with chloroform-hexane and the solid filtered off to provide the title
compound (7.7 g, 63%): mp 139-141.5 ~C.
e) N-tert-Butoxycarbonyl-4-hydroxymethyphenylglycine Methyl Ester
To a solution of compound of Example l(e) (5.6 g, 20 mmol) was added
dimethyl sulfate (3.1 g, 24 mmol) and diisopropyl arnine (5.2 g, 40 mmol) in
methanol (10 mL). The mixture was refluxed for 20 min and was then treated with 2
N aqueous hydrochloric acid. The aqueous solutin was extracted with ethyl acetate
three times and the combined organic extracts washed with 5% aqueous sodium
bicarbonate and brine. Evaporation of the solvent provided the title compound as an
oil (3.2 g, 55%).
f) N-tert-Butoxycarbonyl-4-carboxyphenylglycine Methyl Ester
- 12-

CA 0221264~ 1997-08-08
WO 96124343 PCT/US96/01964
A solution of the compourld of Exarnple l(e) (0.62 g, 2.1 mmol) in 50 ml of
acetone was treated with excess Jones reagent (8N chromic acid) at 25~ C. The
reaction mixture was stirred at room te~ .dtule for 2 hours. The green solid wasfiltered off and excess CrO3 was decomposed by isopropyl alcohol. The filtrate was
5 dried over anhydrous sodium sulfate and treated with activated charcoal. Solid was
filtered off and the filtrate was eva~oldL~d to dryness to yield 0.38 g of titlecompound as white solid: mp 126-128 ~C.
g) l,l-Dimethylethyl N,N'-Bis(l-methylethyl)~ "i.,.i~l~te
The title compound was prepared by reaction of neat N,N'-
diisopropylcarbo-iiimi~lP (1.0 equiv) with 2-methyl-2-propanol (1.15 equiv~ in the
presence of CuCl (0.01 equiv) for 1 day at room tenl~ldLulG, according to the
procedure of Santini et al. ( J. Org. Chem. 1994, 59, 2261).
h) N-tert-Butoxycarbonyl-4-(tert-butoxycarbonyl)phenylglycine Methyl
Ester
A solution of the compound of Example l(f) (1.0 g, 3.2 mmol) and 1,1-
dimethylethyl N,N'-bis(1-methylethyl)carb~mimifl~te (1.3 mg, 6.5 mmol) of in drydichlor~-m~oth~r~e was stirred at room telll~ dLulc over night. Di-isopropylurea was
filtered off and the excess 1,1-dimethylethyl N,N'-bis(1-methylethyl)c~l ~ imicl~
was decomposed with water. Layers were separated and the dichloromethane
20 solution was washed with 5% aqueous sodium bicarbonate and brine and dried over
anhydrous sodium sulfate. Solvent was evd~ldL~d off and the residue was treated
with diethyl ether. Additional di-isopru~ylul~a was filtered off and the organicfiltrate was ev~pol~Lted to yield the title compound as an oil (870 mg, 74%).
i) N-tert-Butoxycarbonyl-4-(tert-buLo,~yc~l,..l,yl)phenylglycine
A solution of the compound of Example l(h) (760 mg, 2.1 mmol) in 18 rnL
of 5% aqueous sodium bicarbonate, 18 rnL of 5% aqueous sodium carbonate and 36
mL of m.-th~nol was stirred ovenight at room temperature for 5 hours. The reaction
mixture was diluted with water, washed with ethyl acetate and the aqueous solution
was covered with fresh ethyl acetate and acidified to pH 2 with 3N HCl. Layers
were separated and the aqueous solution was extraced with ethyl acetate 2 more
times. Ethyl acetate solutions were dried over anhydrous sodium sulfate and
evaporated to yield title compound as a white solid (600 mg, 82%): mp 77-79 ~C.
j) tert-Butyl 7-Amino-3-[2-(5-methyl-1,3,4-thi~ 7olyl)thiomethyl]~3-
cephem~-carboxylate .
A solution of tert-butyl 7-aminocephalosporanate (prepared from 7-
aminocephalosporanic acid by reaction with isobutylene and sulfuric acid in 1,2-dimethoxyethane, according to the procedure of Blacklock et al., J. Org. Chem.
- 13 -

CA 0221264~ 1997-08-08
WO 96124343 PCT/US96/01964
1989, 54, 3907), sodium bicarbonate and 2-mercapto-5-methyl-1,3,4-thi~ 7ole in
phosphate buffer (pH 6.4) is stirred for 6 h a~ 60 ~C. The reaction ~ lule is worked
up by extraction with aqueous hydrochloric acidlethyl acetate to provide the title
compound.
k) tert-Butyl 7-[D,L-a-(tert-Butoxycarbonylamino)-a-[4-(tert-
butoxycarbonyl)phenyl]]~ et~mido-3-[2-(5-methyl-1,3,4-thi~ 37Olyl)thiomethyl]~3-cephem-4-carboxylate
A mixture of N-tert-butoxycarbonyl4-(tert-butoxycarbonyl)phenylglycine of
Example l(i) (351 mg, 1 mmol), tert-butyl 7-amino-3-[2-(5-methyl-1,3,4-
thi~ 7olyl)thiomethyl]~3-cephem4-carboxylate of Example l(j) (368 mg, 1 mmol)
and DCC (212 mg, 1 mmol) in dry dichloromtoth~nl~ was stirred at room te~ eldlù
for 3 hours. The dicyclohexylurea was filtered off and the filtrate was evaporated to
dryness. The residue was dissolved in ethyl acetate and the ethyl acetate solution
was washed with 5% aqueous sodium bicarbonate, 2.5% sulfuric acid, 5% aqueous
sodium bicarbonate, brine and dried over anhydrous sodium sulfate. The solvent was
evaporated to yield 0.6 g of crude product. pllrifi~tion by silica gel
chromatography (elution with 30:70 ethyl acetate / ben_ene) provided the title
compound (430 mg, 61%): mp 110-112 ~C.
1) 7-[D,L-a-Amino-a-(4-carb~ ~y~hel~yl)~- et~mido]-3-[2-(5-methyl-
1,3,4-thi:~Ai~7O1yl)thiomethyl]~3-cephem4-carboxylic Acid
A solution of the compound of Example l(k) (400 mg, 0.57 mmol) was
stirred in 7.2 mL of trifluoroacetic acid and 0.8 mL of thiophenol. The reactionmixture was stirred at 0 ~C for 30 minntes and at room tt;lll~eldLulc for 1 hour. The
solvents were evaporated off in a 40~ C water bath and the residue was lfiLul dl~d
with diethyl ether three times; the solid product was dissolved in small amounts of
methanol and the product was precipitated by addition of diethyl ether to afford the
title compound (300 mg): mp 170-175 ~C.
Example 2
Preparation of L-3,5-Dibromo-3'-(6-oxo-3(1 H)-pyrida7inylmethyl)-thyronine
(Compound 2)
- 14

= ~
CA 0221264~ 1997-08-08
WO 96/24343 PCTIUS96/01964
Br
~ ~ NH~
HO~ Br CO2H
N~N O
H
(a) o-Methoxyphenylacetonitrile (23.64 g) and 3,6-dichloropyridazine
(23.93 g) were dissolved in dry dimethylform~mide (50 ml) and sodium hydride
(16.23 g of a 50% dispersion in oil) was slowly added in portions to the stirred5 solution over 2 hours. The mixture was poured on to excess crushed ice and
extracted with dichlolo...t~tl.~n~ The organic layer was removed and washed withwater, dried with anhydrous m~gn~ciurn sulphate, charcoaled and evaporated to
dryness. The residue cryst~ ed from dichloromethane/petroleum spirit to give 1-
(6-chloro-3-pyridazinyl)-1-(2-methoxyphenyl)-acetonitrile (35.5 g 85%), m.p. 91~-
10 92~.
(b) This nitrile (33.5 g) was dissolved in concentrated hydrochloric acid
(200 ml), acetic acid (100 ml) and water (100 ml) and the solution refluxed withstirring. After 6 hours the solvents were evaporated and the residue recrystallised
from ethyl acetate/petroleum spirit to give 2-(6-oxo-3(1H)-pyridazinylmethyl)-
anisole (21.4 g, 77%), m.p. 142~-3~.
(c) This pyridazinone (15.7 g) was dissolved in phosphorous oxychloride
(22 ml) and the solution heated with stirring at 55~ (oil bath) for 1 hour. The cooled
ll~i~Lul'e was slowly poured onto crushed ice, and extracted with dichloromethane.
The organic layer was separated and washed with saturated sodium bicarbonate
solution, dried with anhydrous magnesium sulphate and evaporated. The residue
was combined with a smaller batch (from 2.16 g of the pyridazinone) and extracted
several times with boiling petroleum spirit (60~-80~). The combined extracts were
charcoaled and evaporated to give 2-(6-chloro-3-pyridazinylmethyl)-anisole (16.95
g, 87%), m.p. 63~.
(d) To a stirred suspension of iodine tristrifluoroacetate (prepared by
tre~tn-~nt of iodine (2.54 g) with fuming nitric acid (5 ml) in acetic anhydride and
trifluoroacetic acid) in trifluoroacetic anhydride (25 ml) at -15~ was added the above
chloropyridazine (9.39 g) in trifluoroacetic acid (20 ml) and trifluoroacetic
anhydride (25 ml), keeping the telllpc,dLu~e below -15~. The mixture was stirred at
- 15 -

CA 0221264~ 1997-08-08
WO 96124343 PCT/US96/01964
room temperature overnight, concentrated, then a solution of sodium acetate (25 g)
and sodium perchlorate (lS g) in water (200 ml) was added. The mixture was
extracted with chloroform, the organic solution dried with anhydrous m~gnPcium
sulphate, then concentrated to 50 ml and poured into stirred ether (250 ml). TheS precipitate was collected and dried to give crude 4,4'-dimethoxy-3,3'-bis-(6-chloro-
3-pyridazinyl-methyl)-diphenyl iodonium perchlorate (14 g). lH NMR ~(DMSO-d6)
3.80 (3H, s,--OCH3), 4.20 (2H, s,~H2Ar), 7.05 (lH, m, Ar-SH), 7.65 (2H, m,
PyH) and 8.00 (2H, m, Ar-2,6H).
(e) The above iodonium salt (12.45 g), L-3,5-dibromo-N-trifluoroacetyl
tyrosine methyl ester (8.98 g), triethylamine (4.05 g) and copper bronze (1.0 g) were
stirred in dichlor mPth~nP (50 ml) for 18 hours. The mixture was filtered, washed
with aqueous acetic acid, 2N sodium hydroxide, then water, then dried with
anhydrous m~gnecillm sulph~te and evaporated. The residue was combined with a
smaller batch (from 0.72 g of the iodonium salt) and purified by column
lS chromatography on silica gel (400 g). Elution with ethyl acetate/petroleum spirit
(60~-80~) [1:3] gaveL-3,5-dibromo-3'-(6-chloro-3-pyridazinylmethyl)-O-methyl-N-
trifluoroacetyl-1-thyronine methyl ester (4.0 g) as a tan coloured froth. lH NMR~(CDCl3) 3.06 (2H, m, ArCH2CH), 3.84 and 3.93(6H, 2s,--OCH3), 4.19(2H, s,
ArCH2Py), 4.75(1H, m, ArCH2CH), 6.62(3H, m, ArH), 7.17(2H, m, PyH) and
7.23(2H, s, ArH).
(f) The above dibromo compound (3.27 g) was dissolved in acetic acid
(20 ml) cont~ining sodium acetate (0.79 g). The solution was refluxed for 1.25
hours, sllfficient water (approximately 2 ml) added to dissolve the precipitatedsodium chloride, and the solution evaporated to dryness. The residue was
partitioned between water and ethyl acetate, the organic layer removed and washed
with saturated sodium bicarbonate, then dried with anhydrous m~gnPcium sulphate
and evaporated to dryness. The residue was cryst~lliced from ethyl
acetate/petroleum spirit (60~-80~) to give L-3,5-dibromo-O-methyl-3'-(6-oxo-3(1H)-
pyridazinylmethyl)-N-trifluoro-
acetylthyronine methyl ester (2.52 g, 79%), m.p. 176~-8~.
(g) This pyridazinone (2.45 g) was dissolved in dry dichlorom.oth~ne (40
ml) and cooled with stirring at 0~. Boron tribromide (6.46 g) in dichloromethane (3
ml) was added. A red-brown precipitate formed. The mixture was stirred at room
temperature for l.S hours, then crushed ice was added. The mixture was filtered, the
precipitate cnllçctecl and dissolved in 2N sodium hydroxide (30 ml). The solution
was heated on a steam bath for 15 minlltPc, acetic acid was then added to pHS, and
the mixture cooled. The resulting precipitate was collected, washed and dried to
- 16-

CA 0221264~ 1997-08-08
WO 96124343 PCT/US96101964
give L-3,5-dibromo-3'-(6-oxo-3(1H)-pyridazinylmethyl)-thyronine (1.74 g, 88%),
m.p. 278~-9~ (dec.).
.Alt~rn~tively, instead of using the perchlorate salt prepared in (d) for reaction
step (e), the iodonium trifluoro~-et~tt~ salt can be used which is plepal~,d as follows:
Iodine (159 g) was suspended in trifluoroacetic anhydride (1 liter) and stirred
under nitrogen whilst fuming nitric acid (350 ml) was added over 1.5 hours, keeping
the tc;~ eldLulc between 36~ and 40~. Trifluoroacetic anhydride (300 ml) was then
added and the "li~Lùle m~int~in.-d at 40~ under a stream of nitrogen until all nitrogen
oxides were removed, then allowed to stand at room lelll~ldlul~ ovçrnight The
solvent was then removed under reduced ~l~S~ul~ and the residual solvent removedby azeotroping with trifluoroacetic anh~dride (2 X 300 ml). The pale yellow
residual solid was then suspended in trifluoroacetic anhydride (1.2 liters) withstirring and was cooled to -20~. A solution of 2-(6-chloro-3-
pyrida~h,yl",ethyl)anisole (600 g) in triflouoracetic acid ( 1.2 liters) was then added
dropwise, m~ g the telll~ldLul~ between -10~ and -20~. The mixture was
stirred at -10~ for 1 hour and at room tc~ )e,dLul~ ovçrnight then the solvent
removed under reduced pressure and the residue poured into a solution of sodium
sulphate (3.5 kg) in water (20 liters) with stirring. The pH of this llu~Lùle was
adjusted to approximately pH 2 using dilute aqueous sodium hydroxide, then
extracted with dichlorom~th~np (2 X 3 liters, 1 x 2 liters), the organic extracts
co"lbined, dried (MgSO4), filtered, and reduced in volume to 2 liters, then added to
vigorously stirred diethyl ether (12 liters). The dark grey precipitated solid was
filtered off, washed with ether, and dried in a vacuum oven at 40~ for 6 hours to give
4,4'-~lim-othoxy-3,3'-bis-(6-chloro-3-pyridazinylmethyl) diphenyl iodonium
trifluoroacetate (8.14 g, 90%), m.p. 145~-147~.
Further reaction of this salt using procedures analogous to those described in
2(e), (f) and (g) above gives the required L-3,5-dibromo-3'-(6-oxo-3(1H)-
pyridazinyl-methyl)thyronine .
Example 2A
dtion of L-3 5-Dibromo-3'-(6-oxo-3( 1 H)-pyridazinylmethyl)thyronine
(Compound 2)
(a) 2-(6-Chloro-3-pyridazinylmethyl)anisole (prepared as described in
Example 2(c)(2.35 g) was dissolved in dry dichloromethane (20 ml) and cooled with
stirring to -50~. Boron tribromide (3 ml) was then added dropwise, and the solution
was allowed to warm to room temperature. After 0.5 hours the orange reaction
mixture was poured into ice/water (200 ml) and acetone added to dissolve the
- 17-

CA 0221264~ 1997-08-08
WO 96/24343 PCT/US96/01964
precipitated solid. The mixture was eYtr~- tt~A with dichloromPth~ne, the organic
extracts were separated, washed with water, dried, and evaporated. The residue was
recrystallised from ethyl acetate and petroleum spirit to give 2-(6-chloro-3-
pyridazinylmethyl)-phenol (1.75 g, 80%), m.p. 132~-132.5~. Anal. Found: C, 59.61;
H, 4.13; N, 12.47; Cl, 16.09; C,lH9ClN2O Requires: C, 59.87; H, 4.11; N, 12.70; Cl,
16.07%.
(b) To a stirred solution of this phenol (2.4 g) and urea (14 g) in 75%
aqueous sulphuric acid (100 ml) t-butanol (17 ml) was added slowly. The mixture
was stirred well and further quantities of t-butanol were added after 4 hours (18 ml),
24 hours (5 ml), and 28 hours (20 ml). After 120 hours the mixture was poured into
water, the organic phase separated and discarded and the aqueous phase extractedthoroughly with ether. The combined ether extracts were washed with saturated
brine, then dried and evd~ d~d. The residue was recryst~lliced from ether and
petroleum spirit to give 2,4-di-t-butyl-6-(6-chloro-3-pyridazinylmethyl)phenol (3.43
g, 94%), m.p. 143.0~-143.5~. Anal. Found: C, 68.32; H, 7.51; N, 8.36; Cl, 10.89;C,9H25ClN2O. Requires: C, 68.56; H, 7.57; N, 8.41; Cl, 10.65%).
(c) A solution of this phenol (1.95 g), L-3,5-dibromo-N-trifluoroacetyl
tyrosine methyl ester (3.24 g) in dietheyl ether (100 ml) was stirred under argon at
room ~e~ ,ldtul~; and then treated with active m~ng7~n~se dioxide (3 X S g). After 4
hours the mixture was filtered, and ~ ,." tetrachloride (5 ml) added. After 2
minutes the dark solution was treated with water and extracted well with ethyl
acetate. The organic extracts were combined, waslled with saturated brine, dried and
evaporated. The residue was chromatographed on silica gel with petroleum spirit
and ether as eluant to give L-3,5-dibromo-5'-t-butyl-3'-(6-chloro-3-
pyridazinylmethyl)-N-trifluoroacetyl thyronine methyl ester (2.31 g, 55%), m.p.
84~-86~.
(d) A solution of this dibromothyronine (2.76 g) and anhydrous sodium
acetate (0.78 g) in acetic acid (25 ml) was heated at reflux for 10 hours, then cooled
and poured into ice-water. The precipitated solid was filtered off, dissolved in ethyl
acetate, dried, and evaporated to give L-3,5-dibromo-5'-t-butyl-3'-(6-oxo-3(1H)-pyridazinylmethyl)-N-trifluoroacetylthyronine methyl ester, (2.4 g, 55%), m.p.
112~-115~.
(e) A solution of this pyridazinone (0.200 g) and Hbr (1 ml) in glacial
acetic acid (20 ml) was heated at reflux for three days. The solution was then
cooled, diluted with water, basified with aqueous 2N sodium hydroxide solution and
brought to pH 6 by addition of acetic acid. The precipitated solid was filtered,washed, and dried to give L-3,5-dibromo-3'-(6-oxo-3(1H)-
- 18-
.

CA 0221264~ 1997-08-08
WO 96/24343 PCT/US96/01964
pyridazinylmethyl)thyronine (0.100 g, 65%), m.p. 245~-247~ (dec.),
spectroscopically identical with that previously isolated (Example 2(g)).
Example 2B
Preparation of L-3.5-I:)ibromo-3'-(6-oxo-3(1H-pyridazinylmethyl)-thyronine
(Compound 2)
(a) To a solution of iodine fri~trifl~loroacetate (prepared by tre~tment of
iodine (10.0 g) with fuming nitric acid (20.95 ml) in acetic anhydride and
trifluoroacetic acid) in acetic anhydride (50 ml), cooled to -10~, was added dropwise
a solution of 2-methoxybenzyl cyanide (30.0 g) in trifluoroacetic acid (60 ml) and
acetic anhydride (30 ml). The te~ dlulG of the ll~x~Luie was m~int~in~-~l below 0~
during the addition then allowed to stand at room tem~e,dlule overnight. The
mixture was then poured into a well-stirred ice-cold solution of sodium acetate (100
g) and sodium perchlorate (13.0 g) in water (600 ml). The solid which precipitated
was filtered off, washed with water and diethyl ether to give 3,3'-dicyanomethyl-
4,4i-dimethoxy-diphenyl iodonium perchlorate as a fine buff solid (23.6 g, 57%),m.p. 183~4~ (from methanol/diethyl ether).
(b) A solution of this iodonium salt (22.6 g), L-3,5-dibromo-N-
trifluoroacetyl-tyrosine methyl ester, triethylamine (6.1 g) in dichlorom.oth~ne (300
ml) was treated with copper bron~ (1 g) and the ~ lulc stirred at room telll~eldture
for 20 hours. The mixture was then filtered and the filtrate washed with 2N aqueous
hydrochloric acid ( 2 X 200 ml), water (2 X 200 ml), and 2N aqueous sodium
hydroxide solution (3 X 200 ml), then the organic solution was dried over
m~gnt~sillm sulphate and evaporated under reduced pressure. The oily residue wasdissolved in dichlorometh~ne (30 ml) and poured into petroleum spirit. A solid
precipitated which was filtered off and recryst~ e~l from
dichlorom.oth~n~/petroleum spirit to give L-3,5-dibromo-3'-cyanomethyl-O-methyl-N-trifluoroacetylthyronine methyl ester as a colourless crystalline solid, m.p.
148~-149~. The mother liquors were chromatographed on silica gel to give furtherq~-~ntities of this compound (total = 8.05 g, 31%).
(c) To a solution of this dibromolhyl~ ille (120 mg) and 3,6-
dichloropyridazine (31 mg) in dry dimethylf~-rm~mide (2 ml), sodium hydride (30
mg of a 50% suspension in oil) was added and the reaction mixture allowed to stand
at room telll~eldLule for S0 min. It was then treated with ice, and the aqueous
mixture extracted with dichloromPthzlne, the organic solution washed with saturated
brine, then dried and evaporated. The residue was chromatographed on a preparative
silica gel chromatography plate from which 3,5-dibromo-3'-(1-(6-chloro-3-
- 19-

CA 0221264~ 1997-08-08
WO 96124343 PCT/US96/01964
pyridazinyl)-l-cyanomethyl)-O-mcthyl-N-trifluoroacetylLllyl~ ine methyl ester (5mg) was isolated. lH NMR ~(CDCl3) 3.12 (lH, m), 3.27 (lH, m), 3.79 (3H, s), 3.86(3H,s),4.86(1H,m),5.80(1H,s),6.72(1H,dd),6.83 (lH,d),7.04(1H,d),7.15
(lH, broad m), 7.37 (2H, s), 7.50 (2H, dd).
Elaboration of this interm~ t~ by standard methods gives the title
compound.
Example 3
~l cpal aLion of 8.8-Ethylenedioxy-2.3 ~7.8.9.10-hexahydro~-methyl- 1 H-
benzorblthienor2.3-blpyrazolor3~4-dlpyridin-3-one (Co~ ou~d 3)
H~ r
CO~O
S N CH3
a) Ethyl 2-Cyano-2-(4,4,-ethylenedioxycyclohexylidene)acetate
To a llli~Lulc of 1,4 cycloh.o.x~n~-linne monoethylene ketal (25 g, 0.160 mol)
and ethyl cyanoacetate (18 g, 0.160 mol) in toluene (400 mL) was added dropwise
diethylamine (25 g, 0.337 mol) at room telll~ dLulc. The reaction mixture was
heated at reflux overnight (using a Dean Stark a~dLus). The ~lu~Lu~e was cooled
and partitioned with ethyl acetate and saturated aqueous sodium bicarbonate (3x).
The organic extracts were dried over sodium sulfate, filtered, concentrated in vacuo
and ~cc~y~L;1lli7e~l from ethanol to yield the title compound as an white solid (15.8 g,
45%): mp 80-81 ~C; lH NMR (400 MHz, CDC13) ~ 4.28 (q, J = 7.2 Hz, 2 H), 4.00
(s,4H),3.18(t,J=6.5Hz,2H),2.85(t,J=6.5Hz,2H), 1.89(t,J=6.5Hz,2H),
1.82 (t, J= 6.5 Hz, 2 H), 1.35 (t, J= 7.1 Hz, 3 H).
b) Ethyl 2-Amino-6,6-ethylenedioxy-4,5,6,7-
tetrahydrobenzo[b]thiophene-3-carboxylate
To a suspension of compound of F.x~mpl~ 3(a) (10 g, 45.6 mmol), sulfur (1.6
g, 50.2 mmol) in ethanol (164 mL) at 0 ~C, was added dropwise a solution of
diethylamine (3.6 g, 50.2 mmol) in ethanol (26 mL). The resulting solution stirred
at 0 ~C for 1 h, then at room temperature for 3.5 h. The reaction mixture was
quenched with ethyl acetate and partitioned with saturated aqueous ammonium
chloride solution. The aqueous phase was extracted with ethyl acetate, and the
organic extracts were washed with brine. The combined organic extracts were dried
over sodium sulfate, filtered, concentrated in vacuo and chromatographed (silica gel,
- 20 -

CA 0221264~ 1997-08-08
WO 96124343 PCT/US96101964
gradient 5 to 10% CH2C12:EtOAc~ to yield the title compound as an oil (11.3 g,
87%). lH NMR (400 MHz, CDC13) o 4.25 (q, J = 7.1 Hz, 2 H), 4.02(s, 4 H), 2.92 (t,
J=6.5Hz,2H),2.74(s,2H), 1.90(t,J=6.6Hz,2H), 1.33(t,J=7.1,3H).
c) Ethyl 7,7-Ethylenedioxy-4-hydroxy-2-methyl-5,6,7,8-
tetrahydrobenzo[b]thieno[2,3--b]pyridine-2-carboxylate
To a solution of compound of Example 3(b) (11.2 g, 39.5 mmol) in toluene
(307 mL) at room te~ Glature was added ethyl 3-ethoxycrotonate (12.4 g, 78.6
mmol) and c~mphQrsulfonic acid (0.78 g, 3.4 rnmol). The reaction mixture was
heated at reflux for 3.5 h using a Dean Stark trap. The llfi~lulè was then cooled, and
to it was added dropwise a freshly prepared solution of 1 M sodium ethoxide (49
rnL). Once the addition was complete the reaction mixture was heated at reflux for 3
h. The llli~lulc was cooled and the precipitate was filtered. The salt was dissolved
in methanol (60 mL), to it was added water (500 mL) and acetic acid (2 mL) to yield
the title compound as a yellow solid (10.4 g, 76%): mp 94-95 ~C; lH NMR (400
MHz, CDC13) o 4.48 (q, J = 7.1 Hz, 2 H), 4.06(s,4 H), 3.26 (t, J = 6.5 Hz, 2 H), 3.02
(s, 2 H), 2.81 (s, 3 H), 2.02 (t, J = 6.5, 2 H), 1.47(t, J = 7.1 Hz, 3 H); MS (ESI) m/z
350 [M + H]+; Anal. Calcd. for C17HlgNO5S; C, 58.44; H, 5.48; N, 4.01; Found: C,58.34; H, 5.46; N, 3.86.
d) Ethyl 7,7-Ethylenedioxy4-trifluoromethylsulfonyloxy-2-methyl-
5,6,7,8-tetrahydrobenzo[b]thieno[2,3--b]pyridine-3-carboxylate
To a solution of colllyoulld of F.x~Tnple 3(c) (5.0 g, 14.3 mmol) in pyridine
(50 mL) was added dropwise triflic anhydride (4.0 g, 14.2 mmol). The reaction
~Lule stirred at 0 ~C for 4 h until complete. The reaction mixture was washed
with aqueous copper sulfate solution (3x) followed by water (2x), and brine (2x).
The organic layer ev~oldted, dried over anhydrous sodium sulfate and concentrated
in vacuo. Puri~lcation by flash chromatography (silica gel, 1: 1 hexane: ethyl acetate)
yielded the title compound as a light yellow solid (3.7 g, 54%): mp 133-134 ~C; lH
NMR (400 MHz, CDC13) o 4.43 (q, J = 7.2 Hz, 2 H), 4.06(s, 4 H), 3.16 (t, J = 6.5Hz, 2 H), 3.10 (s, 2 H), 2.77 (s, 3 H), 2.03 (t, J = 6.8 Hz, 2 H), 1.41 (t, J = 7.1 Hz, 3
H); MS (ESI) m/z 482 [M + H]+; Anal. Calcd- for Cl8Hl8F3NO7S2; C, 44.90; H~
3.77; N, 2.91; Found: C, 45.03; H, 3.62; N, 2.89.
e) 8,8-Ethylenedioxy-2,3,7,8,9,10-hexahydro-4-methyl- 1 H-
benzo[b]thieno[2,3-b]pyrazolo[3,4-d]pyridin-3-one
To a solution of compound of Example 3(d) (2.4 g, 5.0 mmol) in methanol
(40 mL) at room temperature was added hydrazine monohydrate (4.1 g, 82.3 mmol).
The reaction mixturê was heated at reflux for 3 h. The mixture was cooled then
partitioned between pH 7 aqueous buffer and ethyl acetate. The organic layer was - 21 -

CA 022l264~ l997-08-08
WO 96124343 PCT/US96/01964
dried over anhydrous sodium sulfate, filtered, concentrated in vacuo and
recyst~ 7çd from methanol/ethyl a~etate to yield the title compound as a light
yellow solid (0.99 g, 60%). lH NMR (400 MHz, d4-MeOH) o 4.05 (s, 4 H), 3.15 (t,
J=6.5Hz,2H),3.04(s,2H),2.82(s,3H),2.06(t,J=6.5Hz,2H); MS(ESI)m/z
318 [M + H]+; Anal. Calcd. for ClsHlsN3O3SØ25 H2O: C, 55.97; H, 4.85; N,
13.05; Found: C, 55.85; H, 4.75; N, 13.30.
Example 4
Pl ~y~ dlion of 4-r4-(4-Methylbenzoyl)benzoyllphenylacetaldehyde
(Colllpol"ld 4)
OHC ~ -- ~ ~ CH3
a) Methyl 4-(4-methylbenzoyl)ben7o~t~
A solution of methyl terephthaloyl chloride (6.2 g, 31 mmol) in 250 mL of
toluene was treated with ~ minllm chloride (8.0 g, 60 mmol) at 0~C under an argon
atmosphere. The stirring ll~ UlC was warmed to 35~C for 0.5 h. and then added
slowly to 100 g of ice, followed by 150 mL of ethyl acetate, 50 mL of conc. HCI,and 50 mL of water. The phases were separated, and the aqueous portion was
extracted twice with 100 mL of ethyl acetate. The combined organic portionswere
washed with water (2 x 75 mL) and brine (1 x 75 mL), dried over m~nçsillm
sulfate, filtered, and concentrated to a white solid. Recryst:~11i7~tion from ethyl
acetate and hexane afforded 6.0 g (79%) of the title compound as white needles.
mp. 117-118~C; lH NMR (400 MHz, CDC13) ;~ 8.15 (d, J = 8.35 Hz, 2H), 7.83 (d, J
= 8.30 Hz, 2H), 7.73 (d, J =.8.18 Hz, 2H), 7.31 (d, J = 8.04 Hz, 2H), 3.98 (s, 3H),
2.46 (s, 3H); MS (ESI) m/z 255 (M+H)+.
b) 4-(4-Methylbenzoyl)benzoic acid
A stirring solution of methyl 4-(4-methylbenzoyl)benzoate (5.00 g, 20.0
mmol in 150 rnL of 2: 1 THF: water at 65~C was treated with lithium hydroxide
monohydrate (2.0 g, 48 mmol). After a period of 0.5 h the cloudy reaction mixture
was allowed to cool to room temperature and treated with ethyl acetate (300 mL)
and 10% HCl (aq.). The organic phase was separated, washed with water (2 x 50
mL) and brine (1 x 50 mL), dried over magnesium sulfate, filtered, and concentrated
to a white foam. IH NMR (400 MHz, CDC13) o 8.22(d, J = 8.34 Hz, 2H), 7.81 (d, J
= 8.31 Hz, 2H), 7.73 (d, J =.8.15 Hz, 2H), 7.31 (d, J = 8.00 Hz, 2H), 2.46 (s, 3H).
- 22 -

CA 0221264~ 1997-08-08
WO 96124343 PCT/US96/01964
c) 4-t4-(4-Methylbenzoyl)benzoyl]anisole
A solution of compound of Example 4(b) in 250 mL of toluene was treated
with oxalyl chloride (21.8 g, 0.17 mol). The resulting mixture was heated to reflux
for 2 h, then concentldtt;d and allowed to stand overnight at 0.5 mrn Hg and 25~C.
5 This solid was then dissolved in 100 mL of anisole and treated with ~luminum
chloride (11.2 g, 84 mmol) at 0~C. The ll~i~lul~; was heated to 70~C for 1 h and then
added slowly to 100 g of ice, followed by 150 ml of ethyl acetate, 50 mL of conc.
HCl, and 50 rnL of water. The phases were separated and the aqueous portion was
extracted with 100 mL of ethyl acetate. The combined organic extracts were washed
with water (2 x 75 ml) and brine (1 x 75 ml), dried over m~.. e~ sulfate,
filtered, and concentrated to a white solid. Recryst~lli7~tion from ethyl acetate and
hexane yielded 4.6 g (70%) of the title compound. mp. 167-169~C; lH NMR (400
MHz, CDCl3) ;j .7.8-7.9 (m, 6H), 7.77 (d, J = 8.06 Hz, 2H), 7.32 (d, J = 8.01 Hz,
2H), 7.0 (d, J = 8.74 Hz, 2H), 3.92 (s, 3H), 2.47 (s, 3H); MS (ESI) 7n/z 331 (M+H)+.
d) 4-[4-(4-Methylbenzoyl)benzoyl~phenol
A solution of compound of Example 4(c) (700 mg, 2.12 mmol) in 20 ml of
dichlorometh~ne was treated with ~lllminllm chloride (1.0 g, 7.5 mmol) and 7.0 rnL
of 1.0 M boron trichloride solution in dichlorom~th:~ne and heated to reflux for 1 h.
The ll~ Ule was then diluted with 100 mL of dichlorom~th~n.- and washed with
10% HCl (aq) (1 x 25 mL), water (1 x 25 ml), and brine (1 x 25 rnL). The organicphase was dried over m~gnt~ lm sulfate, filtered, and concentrated to a dark residue
which was subjected to flash chromatography (silica gel, elution with 1: 1 ethylacetate: hexane) to yield 550 mg (82%) of the title compound. IH NMR (400 MHz,
CDC13) o .7.8-7.9 (m, 6H), 7.77 (d, J = 8.05 Hz, 2H), 7.32 (d, J = 8.01 Hz, 2H), 6.93
(d, J = 8.6 Hz, 2H), 2.47 (s, 3H).
e) 4-t4-(4-Methylbenzoyl)benzoyl]phenyl trifluoromethylsulfonate
A solution of compound of Fx~mple 4(d) (320 mg, 1.0 mmol) in THF (20
mL) was treated with sodium hydride (40 mg, 1.67 mmol) and N-
phenyltrifluorom~-th~neslllfonimide (500 mg, 1.40 mmol) at 0 ~C. The reaction
mixture was allowed to warm up to room temperature and was then stirred for 18 h.
room temperature. The reaction was then partitioned between ethyl acetate and
brine; layers were separated and the organic extract was dried over m:~gnecium
sulfate and evaporated. Purifi~tion by flash chromatography (silica gel, 80:20
hexane: ethyl acetate) afforded the title compound (300 mg, 66%) . mp. 180- 181 ~C;
lH NMR (400 MHz, CDC13) o 7.96 (d, J = 8.6 Hz, 2 H), 7.89 (s, 4 H), 7.76 (d, J =8.1 Hz, 2 H), 7.45 (d, J= 8.6 Hz, 2 H), 7.33 (d, J= 8.1 Hz, 2 H), 2.47 (s, 3 H). f) 4-[4-(4-Methylbenzoyl)benzoyl]phenylacetaldehyde
- 23 -

CA 0221264~ 1997-08-08
WO 96/24343 PCT/US96/01964
To a solution of compound of Example 4(e) (445 mg, 1.0 mmol) in DMF (10
mL) was added allyltributyltin (0.35 mL, 1.12 mmol),
bis(triphenylphosphine)palladium(II) chloride (55 mg, 0.077 mmol) and lithium
chloride (125 mg, 2.95 mmol). The reaction mixture was heated to 90 ~C for 1 h, and
5 then allowed to cool to room te~ eld~ulc before being partitioned between ethyl
acetate and brine. The organic layer was dried over m~gnPsium sulfate and
concentrated to a residue con~i.cting of the desired product, 3-[4-[4-(4-
methylbenzoyl)benzoyl]phenyl]-1-propene, and tin-cont~ining by-products. This
material was subjected to flash chromatography (silica gel, elution with 95:5
10 hexane: ethyl acetate) which removed most, but not all, of the tin i~ ufllies. A
second chromatography (gradient 5% to lQ% ethyl acetate in hexane) yielded 100
mg (30%) of clean olefin, which was then dissolved in dichloromethane/methanol
(3: 1, 16 rnL) at -78 ~C. Ozone was bubbled through this solution for 5 min. Thereaction was quenched with five drops of dimethyl sulfide and stirring continued for
15 30 min at -78 ~C. The solvent was e~/~oldt~d and the res-llting m~teri~l purified by
flash chromatography (silica gel, elution with gradient 85:15 to 75:25 hexane: ethyl
acetate) to yield the title compound (40 mg, 40%). mp. 188-190~C; IH NMR (400
MHz, CDCl3) ~ 9.83 (s, 1 H), 7.88 (s, 4 H), 7.86 (d, J = 8.1 Hz, 2 H), 4.03 (s, 4 H),
3.73(s,3H),3.76(t,J=6.0Hz,2H),3.00(s,2H),2.80(s,3H),2.03(t,J=6.0
20 Hz, 2 H); MS (ESI) m/z 343 (M+H)+.
Exarnple 5
Preparation of 1 ~4-Dimethyl-8.8-ethylenedioxy-2.3.7.8.9.10-hexahydro- 1 H-
benzorblthienor2.3-blpyrazolor3~4-dlpyridin-3-one (Compound 5)
H3C H
~0
S N CH3
1,4-Dimethyl-8,8-ethylenedioxy-2,3,7,8,9,10-hexahydro-lH-benzo[b]thieno[2,3-
b]pyrazolo[3,4-d]pyridin-3-one
A solution of compound of Example 3(d) (0.4 g, 0.83 mmol) in methanol
(6.7 mL) at room telllpeldlule was treated with methylhydrazine (0.16 g, 3.45 mmol)
30 and the mixture is heated at reflux for 2 h. The mixture was cooled and the
precipitate, cont~ining 150 mg of the 2,4-dimethyl regioisomer, filtered. The filtrate
was evaporatewd and purified by flash chromatography (silica gel, elution with
- 24-

CA 0221264~ 1997-08-08
WO 9G124343 PCT/US96/01964
80:20:5 ethyl acetate m.-th~nol:acetic acid) to provide the title compound as a yellow
solid (22 mg). IH NMR (400 MHz, CDC13) o 4.03 (s, 4 H), 3.73 (s, 3 H), 3.76 (t, J
=6.0Hz,2H),3.00(s,2H),2.80(s,3H),2.03 (t,J=6.0Hz,2H);MS (ESI)m/z
332 (M+H)+.
Example 6
P~ )~dlion of 4-carboxy-benzophenone-4-carboxamido-trans4-methyl-cyclohexyl-
N-hexyl carboxamide (Compound 6)
o o
HOzC ~b~N_O- H~
a) N-t-butyloxy carbonyl-trans-4-aminomethyl cyclohexyl carboxylic
acid
Aqueous sodium hydroxide (lN, 100 ml, 100 mmol) was added to a solution
of 4-trans-aminomethyl-cyclohexyl-carboxylic acid (9.0g, 60 mmol), in dioxane
(100 ml), water (100 ml) at 0 degrees C. Boc anhydride (15.9 g, 66 mmol) was
15 added and the reaction was warmed to rt and stirred overnight. The solution was
concentrated to 50 ml, then was diluted with EtOAc (100 ml) and acidified to pH 2
with adqueous KHSO4 (lN). The organic layer was then extracted with water (100
ml) two times, and the organics were concentrated in vacuo. The solid was
recryct~lli7~cl from EtOAc/ hexanes to yield 9.2g + 3.4g (second crop) of a white
solid. (80% yield). MS (ES) m/e 242 [M+H]~.
b) N-t-butyloxy carbonyl-trans-4-aminomethyl cyclohexyl (Kaiser
oxime resin) carboxylate
Kaiser oxime resin (20 g, 0.7 mmol/g loading, Advanced Chem Tech) was
added to a solution of N-t-butyloxy carbonyl-trans-4-aminomethyl cyclohexyl
carboxylic acid (5.0 g, 20 mmol) and DCC (4.4 g, 20 mmol) in methylene chloride
(200 ml) and was gentle mixed at rt overnight. The solid was filtered and collected,
then washed with methylene chloride (S x 100 ml). Then the resin was resuspendedin methylene chloride (200 ml), and N-t-butyloxy carbonyl-trans-4-aminomethyl
cyclohexyl carboxylic acid (5.0 g, 20 mmol) and DCC (4.4 g, 20 mmol) were added
and the reaction was gently mixed overnight at rt. The solid was filtered and
collected, then washed with methylene chloride (5 x 100 ml), then was dried
overnight under vacuum. IR (KBr, crn~')=1820, 1771, 1520.
c) trans-4-aminomethyl cyclohexyl (Kaiser oxime resin) carboxylate
- 25 -

CA 0221264~ 1997-08-08
WO 96/24343 PCTIUS96/01964
N-t-butyloxy carbonyl-trans-4-aminomethyl cyclohexyl (Kaiser oxime resin)
carboxylate (20 g) was suspended in methylene chloride (100 ml) and TFA (25 ml)
was added. The reaction was gently mixed for 0.5 h, then the solid was filtered and
collected, then was washed with with methylene chloride (5 x 100 ml), then was
dried overnight under vacuum. IR (KBr, cm~l)=3150, 1770, 1526
d) 4-carboxy-benzophenone-4-carboxamido-trans-4-methyl-cyclohexyl-
(Kaiser oxime resin) carboxylate
Trans-4-~minnm.othyl cyclohexyl (Kaiser oxime resin) carboxylate (200 mg)
was suspended in DMF (3.0 ml) and N-methyl morpholine (0.2 ml) and 4, 4'-
benzophenone dicarboxylic acid (190 mg, 0.7 mmol) and HBTU (265 mg, 0.7
mmol) was added and the reaction was gently mixed for 3 h. The solid was filtered
and collected, then was washed with with DMF (3 x 20 ml), then water (3 x 20 ml),
then was resuspended in DMF (3.0 ml) and N-methyl morpholine (0.1 ml) and 4,4'-
benzophenone dicarboxylic acid (0.35 mmol) and HBTU (0.35 mmol) was added
and the reaction was gently mixed for 3 h. The solid was filtered and collected, then
was washed with with DMF (3 x 20 ml), then water (3 x 20 ml), then methylene
chloride (5 x 20 ml), then was dried under vacuum.
e) 4-carboxy-benzophenone-4-carboxamido-trans-4-methyl-cyclohexyl-
N-hexyl carboxamide
4-carboxy-benzophenone-4-carboxamido-trans-4-methyl-cyclohexyl-(Kaiser
oxime resin) carboxylate (200 mg) was suspended in methylene chloride (3.0 ml)
and hexyl amine (0.3 mmol) was added. The reaction was gently mixed for 3 h thenwas filtered, and the filtrate was concentrated in vacuo to yield the title compound:
MS (ES) m/e 493 [M+H]~.
Example 7
P.c~aldtion of 4-nitro-ben7zlrnirlQ-trans-4-methyl-cyclohexyl-N-hexyl carboxamide
(Compound 7)
02N ~ N O H
4-nitro-ben7~rnido-trans-4-methyl-cyclohexyl-N-hexyl carboxamide
Following the procedure of Example 6(a)-(e), except substituting 4-nitro
benzoic acid for and 4, 4'-benzophenone dicarboxylic acid, the title compound was
prepared: MS (ES) m/e 390 [M+H]'. t
- 26 -

CA 02212645 1997-08-08
WO 96124343 PCT/US96/01964
Example 8
Plel)al ation of 4-~- et~mido-benzarnido-trans-4-methyl-cyclohexyl-N- 1 -(arnino-R-2-
(methoxy methyl)-pyrrolidine) carboxamide (Compound 8)
O ~HN~C¦~ H r2
o
Following the procedure of Example 6(a)-(e), except ~ub~liLuLillg 4-
acetamido- benzoic acid for and 4, 4'-benzophenone dicarboxylic acid and R- 1-
arnino-2-(methoxy methyl)- pyrrolidine (RAMP) for hexyl arnine, the title
compound was prepared: MS (ES) m/e 331 [M+H]~.
Example 9
;~;~dLion of 4-formyl-E-çinll~mi(lo-trans-4-methyl-cyclohexyl-N-(propyl)
carboxarnide (Colllyoulld 9)
OHC~N~ N--~
Following the procedure of Example 6(a)-(e), except substituting 4-forrnyl
cinn~mi~. acid for and 4, 4'-benzophenone dicarboxylic acid and propyl amine forhexyl amine, the title compound was prepared: MS (ES) m/e 357 [M+H]~.
Example 10
20Plc~dtion of 2.3.7.8.9~10-Hexahydro-4-methyl-lH-benzorblthienor2~3-
blpyrazolor3~4-dlpyridin-3-one (Compound 10)
C~CH"
a) Ethyl 4-Hydroxy-2-methyl-5,6,7,8-tetrahydrobenzo[b]thieno[2,3--
b]pyridine-2-carboxylate
25A solution of ethyl 2-amino-4,5,6,7-tetrahydrobenzo[b]thiophene-3-
carboxylate (8.9 g, 39 mmol) and ethyl 3-ethoxycrotonate (12.4 g, 78 mmol) in
toluene (300 mL) was treated with camphorsulfonic acid (0.78 g, 3.4 mmol) and the
- 27 -

CA 0221264~ 1997-08-08
WO 96124343 PCT/US96/01964
reaction mixture was heated at reflux for 3 h using a Dean Stark trap. The mixture
was then cooled to room tt;~ eldtule and was subsequently treatedwith a freshly
prepared 1 M solution of sodium ethoxide (48 mL, 48 mmol). After addition was
complete the reaction llli~lul'~ was heated at reflux for 3 h. The mixture was cooled,
S conc~ dl~d and the residue dissolved in ethyl acetate. Acetic acid (2 mL) was
added, solvent ~v~o-dl~d and resulting solid triturated with methanol to yield the
title compound as an off-white solid (8.4 g, 74%): mp 140 ~C; IH NMR (400 MHz,
CDC13) o 4.48 (q, J = 7.2 Hz, 2 H), 3.04 (br s, 2 H), 2.81 (s, 3 H), 2.80 (br s, 2 H),
1.87 (br s, 4 H), 1.47 (t, J = 7.2 Hz, 3 H);; Anal. Calcd. for C1sH17NO3S: C, 61.83;
H, 5.88; N, 4.81; Found: C, 61.69; H, 5.81; N, 4.73.
b) Ethyl 4-Chloro-2-methyl-5,6,7,8-tctrahydrobenzotb]thieno[2,3--
b]pyridine-2-carboxylate
A solution of compound of Example lO(a) (3.0 g, 27.4 mmol) in phosphorus
oxychloride (100 mL) was refluxed for 3.5 hours. The phosphorus oxychloride was
15 removed under vacuum and the residual oil was dissolved in ethyl acetate, washed
with 5% aqueous sodium bicarbonate and dried over anhydrous sodium sulfate.
Evaporation of the solvent provided the title compound as a crystalline solid (8.5 g,
95%): mp 65-66 ~C; lH NMR (400 MHz, CDC13) o 4.47 (q, J = 7.1 Hz, 2 H), 3.10
(brs,2H),2.85(brs,2H),2.60(s,3H), 1.89(brs,4H), 1.43(t,J=7.1 Hz,3H);
Anal. Calcd. for ClsH16ClNO2SØ125 H2O: C, 57.73; H, 5.25; N, 4.49; Found: C,
57.69; H, 5.08; N, 4.30.
c) 2,3,7,8,9,10-Hexahydro-4-methyl- lH-benzo[b]thieno~2,3-
b]pyrazolo[3,4-d]pyridin-3-one
A solution of compound of Example lO(b) (2.0 g, 6.4 mmol) in
methanol (50 mL) was treated with hydrazine monohydrate (10 mL) and the
resulting llli~lu.c; was heated at reflux for 16 h. The reaction was poured overdiluted aqueous hydrochloric acid and the title compound precipitated as a
yellow solid (1.8 g). lH NMR (400 MHz, d4-MeOH) ~ 3.01 (br s, 2 H), 3.00 (s,
3 H), 2.92 (br s, 2 H), 2.00 (br s, 4 H); Anal. Calcd. for Cl3Hl3N3OS.HClØ25
H2O: C, 52.00; H, 4.87; N, 13.99; Found: C, 51.92; H, 5.01; N, 13.70.
Example 11-Protocol for the Determination of the Potency of SH2 Domain
Antagonists
The inhibitory activity of compounds at the different human SH2 domains
35 was determined in vitro using SH2 domains expressed as fusion proteins in E. coli.
The SH2 domains used herein were the human forms of the src SH2 domain, Grb2
- 28 -

CA 0221264~ 1997-08-08
WO 96124343 PCT/US96/01964
SH2 domain, lck SH2 domain, fyn SH2 dom:~in, SH-PTP2 SH2 domain, p85 SH2
domain and hcp SH2 domain.
The fusion proteins cons~ining the src, lck and hcp SH2 domains were
expressed as the general sequence: DETl-DET2-spacer-ek-SH2, where DET1,
5 DET2, spacer, ek and SH2 are as described below. DET1 ("defined epitope tag 1")
(SEQ ID NO: 1) is an 11 amino acid sequence found in the Human
Irnmunodeficiency Virus Type 1 (HIV-l) envelope protein gpl20 (or gpl60).
Monoclonal antibodies to various epitopes of HIV-l gpl20 (or gpl60) are known inthe art, see, for example U.S. Patent 5,166,050. One plcfellc;d çx~mple is
monoclonal antibody 178.1 (see, e.g., Thiriart et al., J. Irllmunol.~ 143:1832-1836
(1989)), which was prepared by i.,.. ,.i~ ion of mice with a yeast-expressed HIV-l
gpl60 molecule from strain BH10 (Ratner et al., Nature, 313:277-284 (1985)). This
tag was used for detection of expression (by Western blot), for purific~tion of the
protein (by affinity chromatography), and for configllring assays in which the fusion
protein was captured or immobilized using the 178.1 antibody. DET2 is a hexa-
histidine sequence tag (SEQ ID NO: 2) which binds to nickel-cont~ining resins and
was used for pnrific:~tion purposes. Spacer (SEQ ID NO: 3) was utilized to design a
BarnH1 restriction site at the intlir~tr~l position of the construct. The term -ek-
refers to a recognition sequence (SEQ ID NO: 4) for the enterokinase protease which
20 provides for the optional removal of the tags from the SH2 domain, thus producing
an SH2 domain that contaills no extraneous amino acids. SH2 domains which
contain no extraneous amino acids are preferable to tagged protein for
crystallography studies. SH2 refers to the SH2 ~om~ins of different proteins.
The DNA sequence encoding each DETl-DET2-spacer-ek-SH2 was
25 designed such that the indicated restriction sites (BarnHl and XbaI) flank the spacer-
ek-SH2 region, thereby allowing different spacer-ek-SH2 contructs to be readily
substituted into any one of the vectors described in Procedures 2 or 3 below to create
a DETl-DET2-spacer-ek-SH2 tagged protein. The DNA sequence encoding each
DET1-DET2-spacer-ek-SH2 constructs was also ~irsj~n.o~ such that the entire tagged
30 SH2 domain can be moved as an NdeI-XbaI fragment into any expression vector
cont~ining an NdeI site at an ~plo~liate distance downstream of E. coli
- 29 -

CA 0221264~ 1997-08-08
WO 96/24343 PCTtUS96/01964
transcription and translation regulatory sequences and a downstream cloning sitecompatible with XbaI. Although any suitable vector would yield similar results(e.g.,
pET-1 la; Novagen, Inc.), the vector used in the instant experiments was E. coliexpression vector pEAlKnRBS3. This vector is a derivative of the series of vectors
5 described in Sh~t7m~n, A, Gross, M, and Rosenberg, M, 1990, "Expression using
vectors with phage lambda regulatory sequences", In: Current Protocols in Molecular
Biology (F.A. Ausubel et al, eds.), pp. 16.3.1 -16.3.11, Greene Publishing and
Wiley-Interscience, N.Y. (hereinafter F.A. Ausubel et al.). The specific vector
pEAlKnRBS3 is described in Bergsma et al, 1991, J. Biol. Chem. 266:23204-
23214.
The procedures below describe the expression of chicken src, human src,human lck and human hcp SH2 domains. First, the chicL-~n src SH2 domain was
expressed as DETl-DET2-spacer-SH2. Then, the others were inserted into this
vector in place of chicken src to express proteins in the form DETl-DET2-spacer-
15 ek-spacer-SH2.
Procedure 1: Cloning and Expression of chicl~t n src SH2 domain cont~ining tags
DET1 and DET2 (DETl-DET2-spacer-SH2).
A DNA sequence encoding the tagged protein DETl-DET2-spacer-SH2 was
20 PCR ~mplified from a cDNA clone c~-nt~ining the chicken src gene (pSH; Levy et al
1986. Proc. Natl. Acad. Sci. USA 83:4228) by methods well known to those skilledin the art by using the following ~
25 TTCCATATGAAAAGTATTCGTATTCAGCGTGGCCCGGGCCGTCACCACCA
CCACCACCACGGGATCCCCGCTGAAGAGTGGTAC l~l T 3' (SEQ ID NO: 17)
The llnclerlined sites are an NdeI recognition site (5') and a BamHI
recognition site (3').
5 ' GGAATTCTAGATTACTAGGACGTGGGGCAGACGTT 3 ' (SEQ ID NO: 18)
- 30-
,-- ~

CA 0221264~ 1997-08-08
WO 96124343 P~T/US96/01964
The lln-3erlint-d region is an XbaI recognition site.
The PCR product was digested with NdeI and XbaI, followed by isolation of
the digested fragment on an agarose gel. The fragment was ligated into NdeI-XbaI-
5 digested pEAlKnRBS3 vector (Bergsma et al, supra) that had been agarose gelpurified as a 6.5 kbp fr~gm~nt The ligation reaction was used to transform E. coli
MM294cI+ (F.A. Ausubel et al., supra). A pl~cmi~l cont~ining an insertion of thecorrect fragment was i~1entified and confirm~ocl by DNA sequencing. The result~nt
plasmid encodes DETl-DET2-spacer-SH2 under the control of the phage lamda PL
10 promoter and regulatory system. Plasmid DNA was purified from MM294cI+ and
used to transform E. coli strain AR120. In this host strain, expression of the phage
promoter can be in~l~7cecl by addition of nalidixic acid to the growing culture as
described in F.A. Ausubel et al, supra. N~litlixir acid induction of AR120
co~ g this plasmid, followed by analysis of the cellular proteins on an SDS-
15 polyacrylamide gel stained with Coom~cci~ Blue (F.A. Ausubel et al., supra),resulted in a~pe~ce of a protein band with an a~el t molecular weight of
15,000; this band was not seen in llnin~lnce-l cells or in intlllce~l cells cont~ining
pEAlKnRBS3 lacking the PCR amplified fr~gm~nt Western blotting confirmed
that the inclllce~ protein band reacted with the anti-DET1 monoclonal antibody
178.1.
Procedure 2: Cloning, expression and purific ~tion of human src SH2 domain
cont~ining tags and an enterokinase proteolytic cleavage site (DET1-DET2-spacer-ek-src SH2).
A DNA sequence encoding protein ek-src SH2 was PCR amplified from a
cDNA clone cont~ininp the human src gene (c-src SH2 DNA sequence identical to
that described in Takeya,T. and Hanafusa, H, 1983 Cell 32:881-890) using the
following primers:
A
30 5' CGGGATCCTGGACGACGACGACAAAGCTGAGGAGTGGTATTTT 3'
(SEQ ID NO: 19)

CA 0221264~ 1997-08-08
WO 96124343 PCT/US96/01964
The underlined site is a Ba~HI recognition site.
5' GGAATTCTAGACTATTAGGACGTGGGGCACACGGT 3' (SEQ ID NO: 20)
The un~llorlin~l region is an XbaI recognition site.
The PCR product was digested with BamHI and XbaI, followed by isolation
of the digested fragment on an agarose gel. The fragment was ligated into BamHI-10 XbaI-digested expression vector co-~t~;r i--g the tagged chic~n src gene DETl-
DET2-spacer-SH2 described in Procedure 1 above. In that vector, the BamHI site is
located between the coding regions for DET2 and SH2, and the XbaI site is located
after the 3' end of the SH2 coding region. The ligation reaction was used to
transform E. coli MM294cI'. The construct DETl-DET2-spacer-ek-src SH2 was
15 confirmlod by DNA seqllen~ing (SEQ ID NO: 5) and in-lllced in E. coli strain AR120
as described in Procedure 1 above. A Coomassie-Blue-stained, Western-blot-
positive intlut~e~l protein band with an al~l,~cnt molecular weight of 16,000 was
observed after n~ lixic acid induction.
Cells were lysed at neutral pH by sonication in the presance of Iysozyme.
20 After centrifugation, the soluble extract was chromatographed on a Ni~NTA
column. After washing the column with equilibration buffer (Tris buffer pH 8
cont~ining 0.5 M NaCl) and the same buffer cont~ining 15 mM imitl~7O1e, the
protein was eluted in highly purified form with 25 mM imicl~7O1e in equilibration
buffer. The SH2 dom~in, purified in this fashion, was found to bind with high
25 affinity in a specific, saturable fashion to the ~lo~liate pY peptide in the "Binding
Assays" described below, demonstrating that the tag did not interfere with function.
This expressed fusion protein, DETl-DET2-spacer-ek-src SH2, was utilized in the
"Binding Assays" described below in order to deterrnine the specificity of
compounds to selectively inhibit the human src SH2 domain.
- 32 -

CA 0221264~ 1997-08-08
WO 96/24343 PCT/US96/0196"
Procedure 3: Cloning and expression of human lck SH2 domain cont~ining tags and
an enterokinase proteolytic cleavage site (DETl-DET2-spacer-ek-lck SH2).
A DNA sequence encoding protein ek-lck SH2 was PCR ~mplified from a
cDNA clone cont~ g the human lck gene (Genbank accession number M3688 1 )
S using the following ~JlhllCl~i
S' CGGGATCCTGGACGACGACGACAAAGAGCCCGAACCCTGGTTCTT 3 '
(SEQ ID NO: 21)
The underlined site is a BamHI recognition site.
S' GCTCTAGACTATTACTGGGGCTTCTGGGTCTG 3' (SEQ ID NO: 22)
The lln~l~rlinto.d region is an XbaI recognition site.
The PCR product was digested with BamHI and XbaI, followed by isolation
of the digested fragment on an agarose gel. The fragment was ligated into BamHI-XbaI-digested expression vector col.~ )g the tagged chic~ n src gene DET1-
DET2-spacer-SH2 described in Procedure 1 above. In that vector, the BamHI site is
located in between the coding regions for DET2 and SH2, and the XbaI site is
20 located after the 3' end of the SH2 coding region. Thus, the ek-lck SH2 sequence
replaced the src SH2 sequence in the above vector. The ligation reaction was used
to transform E. coli MM294cI'. The construct con1~inin~ DET1-DET2-spacer-ek-
lck SH2 was confirm~A by DNA seq--en~in~ (SEQ ID NO: 6) and ind~lce~l in E. colistrain AR120 as described in Procedure 1 above. A Coomassie-Blue-stained,
25 Western-blot-positive in(lllcecl protein band with an ~p~cnt molecular weight of
17,000 was observed after nalidixic acid induction.
Cells were lysed at neutral pH by sonication in the presance of lysozyme.
After centrifugation, the soluble extract was chromatographed on a Ni~NTA
column. After washing the column with equilibration buffer (Tris buffer pH 8
30 contz~ining 0.5 M NaCl) and the same buffer cont~inin~ 15 mM imidazole, the
protein was eluted in highly purified form with 25 mM imicl~7ole in equilibration

-
CA 0221264~ 1997-08-08
WO 96124343 PCT/US96/01964
buffer. The SH2 ~lQm~in, purified in this fashion, was found to bind with high
affinity in a specific, saturable fashion to the ~p~ iate pY peptide in the "Binding
Assays" described below, demonstrating that the tag did not interfere with function.
This expressed fusion protein, DETl-DET2-spacer-ek-lck SH2, was utilized in the
S "Binding Assays" described below in order to ~ termine the specificity of
compounds to selectively inhibit the human lck SH2 domain.
Procedure 4: Cloning and expression of human hcp SH2 domain cont~ining tags
and an enterokinase proteolytic cleavage site (DET1-DET2-spacer-ek-hcp SH2).
A DNA sequence encoding protein ek-hcp SH2 (hcp SH2 DNA sequence
identical to that described in Shen, S-H. Nature (1991) 352: 736-739) was reverse
transcriptase-PCR amplified from human fetal liver RNA. RNA isolation used Tri-
Reagent (Molecular Research Center Inc.) and the Reverse Transcriptase system
(GIBCO-BRL) according to the m~nllf~cture's instructions. PCR was carried out
using the following primers:
5' GAAGATCTTGGACGACGACGACAAATCCCGTGGGTGGTTTCAC
3'(SEQ ID NO: 23)
The lln~l-rlined site is a BglII recognition site.
S' GCTCTAGACTATTAACTAGTGGGATCGGAGCA 3' (SEQ ID NO: 24)
The lln~l~rlined region is an XbaI recognition site.
The PCR product was digested with BglII and XbaI, followed by isolation of
the digested fragment on an agarose gel. The fragment was ligated into BamHI-
XbaI-digested expression vector cont~ining the tagged human src gene DET1-
DET2-spacer-ek-src SH2 described in Procedure 2 above. In that vector, the
BamHI site is located in between the coding regions for DET2 and ek, and the XbaI
site is located after the 3' end of the SH2 coding region. Thus, the ek-hcp SH2
sequence replaced the ek-src SH2 sequence in the above vector. The ligation
- 34-
_

CA 0221264~ 1997-08-08
WO 96124343 PCT/US96/01964
reaction was used to transform _ coli MM294cI+. The construct contz~ining DET1-
DET2-spacer-ek-hcp SH2 was confirrned by DNA sequencing (SEQ ID NO: 7) and
used to transform ~ coli GI698 (Invitrogen Corporation, San Diego, CA). Induction
of the phage lambda promoter was inrillced by addition of tryptophan to the culture
S mt--lium to 10 mg/ml, per the manufacture's instructions. A Coomassie-Blue-
stained, Western-blot-positive in~ ecl protein band with an apparent molecular
weight of 15,000 was observed after tryptophan induction of cells growing at 30~ C.
Cells were lysed at neutral pH by sonication in the presance of lysozyme.
After centrifugation, the insoluble pellet was solubilized with 8 M urea in Tris buffer
10 pH 8 and bound onto a Ni+~NTA colurnn. The resin was washed with equilibration
buffer (Tris buffer pH 8 co~ i..ing 0.5 M NaCl, 8 M urea and S rnM BME) and the
sarne buffer c~nt~ g 15 mM imitl~7ole. The protein was refolded on the column
during the removal of urea in the presence of 5 mM BME and the purified refoldedprotein eluted with 30~ mM imid~ole in Tris buffer pH 8. The SH2 rlom~in~
15 purified in this fashion, was found to bind with high affinity in a specific, saturable
fashion to the ~ u~liate pY peptide in the "Binding Assays" described below,
demonstrating that the tag did not hltc.rclc with function and that the protein was
refolded ~uccçs~fully. This expressed fusion protein, DET1-DET2-spacer-ek-hcp
SH2, was utilized in the "Binding Assays" described below in order to deterrnine the
20 specificity of compounds to selectively inhibit the human hcp SH2 domain.
Fusion proteins having the structure GST-X-SH2 were prepared as described
in the GST gene fusion kit system available from Pharmacia (New Jersey). GST is
the tagging sequence glutathione s-transferase epitope (SEQ ID NO: 8) for fyn, Grb2
25 and SH-PTP2 and is the tagging sequence glutathione s-transferase epitope (SEQ ID
NO: 9) for p85. SH2 refers to the SH2 domains of fyn, Grb2, p85 and SH-PTP2
which were expressed and purified using glutathione Sepharose 4B (Pharmacia)
according to "Current Protocols in Molecular Biology", ed. FM Ausubel et al., pub.
John Wiley and Sons, Inc., (1995), p 16.7.1. X is an ~plu~liate linker, preferably of
30 6 to 21 base pairs, used to keep the SH2 construct in frame and complement cloning.
As such, the sequence of X is not critical. One skilled in the art can readily construct
- 35 -

CA 0221264~ 1997-08-08
WO 96124343 PCT/US96/01964
the applupliate linker. The DNA sequence encoding each GST-X-SH2 fusion
protein was designed such that the in-lic~tçd restriction sites (BamH1 and EcoRI)
flank the SH2 region. The vector used in the instant experim~3nt~ was the E. coli
expression vector pGEX-2T (Ph~l~n:~ri~) for fyn, Grb2 and SH-PTP2, and pGEX-3X
(Pharmacia) for p85. Each of these vectors result in SH2 constructs having
additional C-te.rmin~l amino acids as described below.
The sequence encoding the SH2 domain of human fyn (amino acids 143-
252) (Yamamoto, T. et al. Proc. Natl. Acad. Sci. USA 83, 5459-5463 (1986)) was
cloned into the BamHI and EcoRI sites of the expression vector pGEX-2T. The
SH2 domain including the additional C-terrnin~l amino acids leucine-threonine-
asparagine-serine-serine (SEQ ID NO: 10) was cloned by PCR techniques known to
those skilled in the art to yield the expressed fusion protein GST-X-fyn. This
expressed fusion protein was then utilized in the "Binding Assays" described below
in order to determine the specificity of compounds to selectively inhibit the human
fyn SH2 domain.
Human p85 SH2 domain: The sequence encoding the SH2 domain of human
p85 (amino acids 321-440) (Skolnik, E. et al., Cell 65, 83-90 (1991)) was clonedinto the BamHI and EcoRI sites of the expression vector pGEX-3X. The SH2
domain including the additional C-terrnin~l amino acids asparagine-serine-serine(SEQ ID NO: l l)was cloned by PCR techniques known to those skilled in the art to
yield the expressed fusion protein GST-X-p85. This expressed fusion protein was
then utilized in the "Binding Assays" described below in order to ~letermine thespecificity of compounds to selectively inhibit the human p85 SH2 domain.
Human SH-PTP2 SH2 domain: The sequence encoding the SH2 domain of
human SH-PTP2 (arnino acids 1-106))(Bastien, L. et al., Biochem. Biophys. Res.
Commun. 196, 124-133 (1993)) was cloned into the BamHI and EcoRI sites of the
expression vector pGEX-2T. The SH2 domain including the additional C-terminal
amino acids gl~lt~mine-phenyl~l~nine-isoleucine-valine-threonine-aspartate (SEQ ID
NO: 12) was cloned by PCR techniques known to those skilled in the art to yield the
expressed fusion protein GST-X-SH-PTP2. This expressed fusion protein was then
- 36 -

CA 0221264~ 1997-08-08
WO 96/24343 PCT/US96/01964
utilized in the "Binding Assays" described below in order to ~lPtt-rmine the
specificity of compounds to selectively inhibit the human SH-PTP2 SH2 domain.
Human Grb2 SH2 domain: The sequence encoding the SH2 domain of
human Grb2 (amino acids 58-159) (Lowenctein, E. et al., Cell 70, 431-442 (1992))~ 5 was cloned into the BamHI and EcoRI sites of the expression vector pGEX-2T. The
SH2 domain inrlu-ling the additional C-t~-rmin~l amino acids isoleucine-hicti~lin~-
arginine-aspartate (SEQ ID NO: 25) was cloned by PCR techniques known to those
skilled in the art to yield the expressed fusion protein GST-X-Grb2. A six
nucleotide linker was used and resulted in the amino acids glycine and serine
between the GST and SH2 domain. This expressed fusion protein was then utilized
in the "Binding Assays" described below in order to ~lrlr~ 111;11~, the specificity of
compounds to selectively inhibit the human Grb2 SH2 ~lom~in
Binding Assays: The potency of compounds at the SH2 rlom~inC was determined
based on the ability of such compound to selectively inhibit such SH2 domain from
binding to its respective specific pY peptide.
The binding assays for the SH2 domains and pY peptides were performed in
an ELISA-based 96 well plate assay. In Millipore 96 well filter plates, hydrophilic
Durapore(~) (pore size 0.65um Cat. No. MADVN6550), was added 2 ul (50%
suspension) of Protein-G Sepharose (available from Pharmacia of N.J. Cat. No. 17-
0618-01) and either 2 ul of 2 mg/ml of MAB 178.1 (for gp 120/SH2 domain fusion
proteins src, lck and hcp) or 0.25 ul of anti-GST polyclonal antisera (available from
Pharmacia of N.J.) (for GST/SH2 domain fusion proteins fyn, Grb2, p85 and SH-
PTP2). 10 pmol of the subject SH2 domain fusion protein were added to their
respective wells. The volume was brought to 100 ul with TBS-T (tris buffered saline
plus 0.05% tween-20), inrub~te~ and shaken at room trmperature for 1 hr. then
washed lx with TBS-T (4~C). 90 ul of TBS-T were then added to each well.
Specific pY biotinylated peptides were diluted to a concentration of 1.0 uM in TBS-
T (these peptides can be obtained from Bachem Bioscience of Pennsylvania,
Genosys Biotechnologies of Texas and California Peptide Research of California).10 ul was aliquoted per well to yield a final concentration of 0.1 uM (approx. the Kd
- 37 -

CA 0221264~ 1997 - 08 - 08
WO 96/24343 PcTrus96lol964
for each SH2 domain/peptide pair~ and a final volume of 100 ul. The assay plateswere incubated until equilibrium binding was ~tt~inçcl (3 hr at 4~C with .ch~king)
The assay plates were washed 2 X per well TBS-T (4~C), then 100 ul of SABC
(Strepavidin biotinylated horseradish peroxidase complex, available from the Zymed
corporation of California cat. no. 93-0043, 1 drop reagent A (~Ll~L~vidin) and 1drop of reagent B (AH-biotin conjugated-horseradish peroxidase) per 10 ml of TBS-
T, incubated at 37~C for 30 minutes, then cooled to 4~C) was added per well, then
incubated at 4~C for 30-60 minutes. The plates were then washed 4 X with TBS-T
(4~C) (250 ul/well)/wash). 100 ul of 1 mg/ml OPD (o-phenylt1i~min~, Sigma
Chemical Corporation, St. Louis Missouri) in Citrate Buffer was added per well. To
stop development, 100 ul of 10% sulfuric acid was added per well. 150 ul from each
well was then removed from the assay plate and placed in an ELISA plate. The A4,.,.
of each ELISA plate was then det~rmin.o~
Determination of (IC5") for Table I
Each control or compound was assayed in duplicate. The duplicates were
averaged and the background subtracted and the m~xim~l values with no inhibitionwere taken from the plate, then all other data points were expressed as a percent of
the m~xim~l value (or as % control). These % control data values were graphed inK~leitl~graph for Macintosh (Synergy Software). The curves on these graphs were
nonlin~r curve fitted with the following equation F(x)=Emax/(l+(kd/conc)~slope),wherein the kd term represents the IC50 for each of the curves.
Determin~tion of (Ki) for Table II
The Ki for respective compounds is calculated via the following equation
(see reference). This expanded equation must be used under the conditions of this
assay, due to the fact that the pY biotinylated peptide is not in vast excess
concentration (100X) over the SH2 domain fusion protein. The IC50 is an
extrapolated value from a nonlinear curve fit using Kaleidagraph. Rtot and *D are
known values for reagents input into the assay. KD generally must be
- 38 -

CA 0221264~ 1997-08-08
WO 96124343 PCT/US96/01964
exp~.rim~nt~lly dete~ ined for each combination of SH2 domain fusion protein and
pY biotinylated peptide.
KI=(ICso- ,
5 Rtot+Rtotl2((*D/(KD+*D))+(KD/(KD+*D+Rtot/2)))t( 1 +*D/KD+Rtot/KD((KD+*D
/2)/(KD+*D)))
KI=(uM)KDof coll~t;LiLol
ICso=(uM) ICso for inhibitor, derived via no~lin~.~r curve fit of coll.petiLion
10 selectivity assay data for each SH2 domain
Rtot=(uM)total SH2 domain concentration within 1 assay (microtitre plate) well
*D=(uM)conce~lL dLion of specific pY and biotinylated peptide for each SH2 domain
KD=(uM)KD value for the specific pY and biotinylated peptide for each SH2
domain
15 IC50 is the concentration of inhibitor at which the response or signal is inhibited by
50%
KD is the dissociation constant for a ligand in a receptor/ligand interaction, normally
equaling the concentration of ligand which is at 1/2 Vmax on a saturation binding
20 curve>
The pY peptide ligands used in the above Binding Assays are as follows:
Biotinylated pY peptide ligand cont~ining an aminocaproic acid (Aca) linker used25 for src, lck, and fyn SH2 dom~in~
Glu-Pro-Gln-pTyr-Glu-Glu-Ile-Pro-Ile-Tyr-Leu (SEQ ID NO: 13)
Biotinylated pY peptide ligand cont~ining an aminocaproic acid (Aca) linker used30 for p85 SH2
- 39 -

CA 0221264~ 1997-08-08
WO 96/24343 PCT/US96/0196'1
Asp-Gly-Gly-pTyr-Met-Asp-Met-~Ser-Lys-Asp-Glu (SEQ ID NO: 14)
Biotinylated pY peptide ligand cont~ining an aminocaproic acid (Aca) linker usedfor SH-PTP2 SH2
Glu-Asn-Gly-Leu-Asn-pTyr-Ile-Asp-Leu-Asp-Leu (SEQ ID NO: 15)
Biotinylated pY peptide ligand cont5Jining an aminocaproic acid (Aca) linker used
for hcp SH2
Thr-Pro-Pro-His-Leu-Lys-pTyr-Phe-Tyr-Phe-Val-Val-Ser-Asp-Ser-Gly (SEQ ID
NO: 16)
Biotinylated pY peptide ligand colll~;,,ill~ an aminocaproic acid (Aca) linker used
15 for Grb2 SH2
Leu-Pro-Val-Pro-Glu-pTyr-Ile-Asn-Gln-Ser-Val (SEQ ID NO: 26)
Results of Binding Assays:
20 Tables I and II illustrate the cross reactivity of SH2 antagonists at the in~ tPcl SH2
domains. From the results disclosed in these tables colllpoullds which have binding
affinities/inhibitory concentrations which are greater than fifty-fold higher at the lck
SH2 domain than the binding affinities/inhibitory concentrations at other SH2
domains can be readily identifiP-l
- 40 -

-
CA 02212645 1997-08-08
PCT/US96/01964
WO 96124343
Table I
CROSS REACTIVITY OF Src SH2 DOMAIN ANTAGONISTS AT CLONED
HUMAN SH2 DOMAINS (IC~")
- Compound Src Lck Fyn SH- p85Grb2 Hcp
PTP2
6 uM 6 uM NI NI NI NI X
2 NI NI NI NI NI NI 0.9 uM
3 16.1 uM22.9 uM NI NI NI NI 1.2 uM
4 40 uM 163 uM NI X NI NI 30 uM
63 uM 100 uM NI NI NI NI 0.1 uM
6 20 uM NI NI X NI NI X
7 7.4 uM 383 uM NI NI NI NI NI
8 16 uM 126 uM NI NI NI NI >100 uM
9 131 uM 200 uM NI NI NI NI 12 uM
X X NI NI NI NI 1.2 uM
NI-No inhibition observed out to 300uM
X-not tested
- 41 -

CA 02212645 1997-08-08
WO 96124343 PCT/US96/01964
Table II
CROSS REACTIVITY OF Src SH2 DOMAIN ANTAGONISTS AT CLONED
HUMAN SH2 DOMAINS (Ki)
CompoundSrc Lck Fyn SH- p85Grb2 Hcp
PTP2
7 uM X NI NI NI NI X
2 NI NI NI NI NI NI X
3 6 uM 11 uM NI NI NI NI X
4 40 uM163 uM NI XX NI NI X
28 uM149 uM NI NI NI NI X
6 13 uM 50 uM NI NI NI NI X
7 20 uM320 uM NI Nl NI NI X
8 12 uM360 uM NI NI NI 330 X
9 55 uM146 uM NI NI NI NI X
XX XX NI NI NI NI X
NI-No inhibition observed below 1000 uM
X-not calculated
XX-not tested
s
While the ~lcfel~cd embo-lim~nt~ of the invention are illustrated by the
above, it is to be understood that the invention is not limited to the precise
instructions herein disclosed and that the right to all modifications coming within the
scope of the following claims is reserved.
- 42 -

CA 022l264~ l997-08-08
W 096/24343 PCTrUS96/01964
SEQUENCE LISTING
(1) GENERAL INFORMATION
(i) APPLICANT: ~UN - NlN~'l'ON, DAMIEN
(ii) TITLE OF THE lNv~llON: USE OF LCK SH2 SPECIFIC
0 COMPOUNDS TO TREAT AUTOIMMUNE DISEASES AND ALLOGRAFT REJECTION
(iii) NUMBER OF SEQUENCES: 26
(iv) CORRESPO~ ~ ADDRESS:
(A) ADDRESSEE: SmithKline Beecham Corporation
(B) STREET: 709 Swe~el~n~ Road
(C) CITY: King o~ Prussia
(D) STATE: PA
(E) COUNTRY: USA
(F) ZIP: 19406
(v) COMPUTER READABLE FORM:
(A) MEDIUM TYPE: Diskette
(B) COMPUTER: IBM Compatible
(C) OPERATING SYSTEM: DOS
(D) SOFTWARE: FastSEQ Version 1.5
(vi) CURRENT APPLICATION DATA:
(A) APPLICATION NUMBER:
(B) FILING DAT~:
(C) CLASSIFICATION:
(vii) PRIOR APPLICATION DATA:
(A) APPLICATION NUMBER: 08/386,381
(B) FILING DATE: 10-FEB-1995

CA 022l264~ l997-08-08
W 096l24343 PCT/US96/01964
(A) APPLICATION NU~BER: 08/400,220
(B) FILING DATE: 07-MAR-1995
(A) APPLICATION NUMBER: 08/497,357
(B) FILING DATE: 30-Jun-1995
(viii) A~ OKN~Y/AGENT INFORMATION:
(A) NAME: Dustman, Wayne J
(B) REGISTRATION NUMBER: 33,870
(C) REFERENCE/DOCKET NUMBER: P50323-2L1
(ix) TELECOMMUNICATION INFORMATION:
(A) TELEPHONE: 610-270-5023
(B) TELEFAX:
(C) TELEX:
(2) INFORMATION FOR SEQ ID NO:1:
( i ) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 11 amino acids
(B) TYPE: amino acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: peptide
(iii) HYPOTHETICAL: NO
(iv) ANTISENSE: NO
(v) FRAGMENT TYPE: internal
(vi) ORIGINAL SOURCE:
(ix) FEATURE:
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:1:
Lys Ser Ile Arg Ile Gln Arg Gly Pro Gly Arg
1 5 10
--44 --

CA 0221264~ 1997-08-08
W 096l24343 PCTrUS96/01964
(2) INFORMATION FCR SEQ ID NO:2:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 6 amino acids
(B) TYPE: amino acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: peptide
0 (iii) HYPOTHETICAL: NO
(iv) ANTISENSE: NO
(v) FRAGMENT TYPE: internal
(vi) ORIGINAL SOURCE:
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:2:
His His His His His His
l 5
(2) INFORMATION FOR SEQ ID NO:3:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 3 amino acids
(B) TYPE: amino acid
(c) sTRANn~nNF~s: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: peptide
(iii) HYPOTHETICAL: NO
(iv) ANTISENSE: NO
(v) FRAGMENT TYPE: internal
(vi) ORIGINAL SOURCE:
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:3:
Gly Ile Leu
-45-

CA 0221264~ 1997-08-08
W 096l24343 PCTrUS96/01964
(2) INFORMATION FOR SEQ ID NO:4:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 5 amino acids
(8) TYPE: amino acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: peptide
(iii) HYPOTHETICAL: NO
(iv) ANTISENSE: NO
(v) FRAGMENT TYPE: internal
(vi) ORIGINAL SOURCE:
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:4:
Asp Asp Asp Asp Lys
l 5
(2) INFORMATION FOR SEQ ID NO:5:
(i) ~QU~N~ CHARACTERISTICS:
(A) LENGTH: 130 amino acids
(B) TYPE: amino acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: peptide
(iii) HYPOTHETICAL: NO
(iv) ANTISENSE: NO
(v) FRAGMENT TYPE: internal
(vi) ORIGINAL SOURCE:
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:5:
Met Lys Ser Ile Arg Ile Gln Arg Gly Pro Gly Arg His His His His
-46-

CA 022l264~ l997-08-08
W 096/24343 PCT~US96/01964
1 5 10 15
His His Gly Ile Leu Asp Asp Asp Asp Lys Ala Glu Glu Trp Tyr Phe
Gly Lys Ile Thr Arg Arg Glu Ser Glu Arg Leu Leu Leu Asn Ala Glu
35 40 45
Asn Pro Arg Gly Thr Phe Leu Val Arg Glu Ser Glu Thr Thr Lys Gly
Ala Tyr Cys Leu Ser Val Ser Asp Phe Asp Asn Ala Lys Gly Leu Asn
Val Lys His Tyr Lys Ile Arg Lys Leu Asp Ser Gly Gly Phe Tyr Ile
Thr Ser Arg Thr Gln Phe Asn Ser Leu Gln Gln Leu Val Ala Tyr Tyr
100 105 110
Ser Lys His Ala Asp Gly Leu Cys His Arg Leu Thr Thr Val Cys Pro
115 120 125
Thr Ser
130
(2) INFORMATION FOR SEQ ID NO:6:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 134 amino acids
(B) TYPE: amino acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: peptide
(iii) HYPOTHETICAL: NO
(iv) ANTISENSE: NO
(v) FRAGMENT TYPE: internal
(vi) ORIGINAL SOURCE:
(xi) ~:Qu~:N~: DESCRIPTION: SEQ ID NO:6:
Met Lys Ser Ile Arg Ile Gln Arg Gly Pro Gly Arg His His His His
1 5 10 15
His His Gly Ile Leu Asp Asp Asp Asp Lys Glu Pro Glu Pro Trp Phe
-47-

CA 022l264~ l997-08-08
W 096/24343 PCTrUS96/01964
Phe Lys Asn Leu Ser Arg Lys Asp Ala Glu Arg Gln Leu Leu Ala Pro
Gly Asn Thr His Gly Ser Phe Leu Ile Arg Glu Ser Glu Ser Thr Ala
50 55 60
Gly Ser Phe Ser Leu Ser Val Arg Asp Phe Asp Gln Asn Gln Gly Glu
Val Val Lys His Tyr Lys Ile Arg Asn Leu Asp Asn Gly Gly Phe Tyr
Ile Ser Pro Arg Ile Thr Phe Pro Gly Leu His Glu Leu Val Arg His
100 105 110
Tyr Thr Asn Ala Ser Asp Gly Leu Cys Thr Arg Leu Ser Arg Pro Cys
115 120 125
Gln Thr Gln Lys Pro Gln
130
(2) INFORMATION FOR SEQ ID NO:7:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 133 amino acids
(B) TYPE: amino acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: peptide
(iii) HYPOTHETICAL: NO
(iv) ANTISENSE: NO
(v) FRAGMENT TYPE: internal
(vi) ORIGINAL SOURCE:
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:7:
Met Lys Ser Ile Arg Ile Gln Arg Gly Pro Gly Arg His His His His
1 5 10 15
His His Gly Ile Leu Asp Asp Asp Asp Lys Ser Arg Gly Trp Phe His
Arg Asp Leu Ser Gly Leu Asp Ala Glu Thr Leu Leu Lys Gly Arg Gly
-48-

CA 022l264~ l997-08-08
W 096/24343 PCTrUS96/01964
, 40 45
Val His Gly Ser Phe Leu Ala Arg Pro Ser Arg Lys Asn Gln Gly Asp
5S 60
Phe Ser Leu Ser Val Arg Val Gly Asp Gln Val Thr His Ile Arg Ile
65 70 75 80
Gln Asn Ser Gly Asp Phe Tyr Asp Leu Tyr Gly Gly Glu Lys Phe Ala
Thr Leu Thr Glu Leu Val Glu Tyr Tyr Thr Gln Gln Gln Gly Val Leu
100 105 110
Gln Asp Arg Asp Gly Thr Ile Ile His Leu Lys Tyr Pro Leu Asn Cys
115 120 125
Ser Asp Pro Thr Ser
130
(2) INFORMATION FOR SEQ ID NO:8:
i ) ~Q~N~ CHARACTERISTICS:
(A) LENGTH: 224 amino acids
(B) TYPE: amino acid
(c) STR~NnFl~NF.. SS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: peptide
(iii) HYPOTHETICAL: NO
( iv) ANTISENSE: NO
(v) FRAGMENT TYPE: internal
(vi) ORIGINAL SOURCE:
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:8:
Met Ser Pro Ile Leu Gly Tyr Trp Lys Ile Lys Gly Leu Val Gln Pro
1 5 10 15
Thr Arg Leu Leu Leu Glu Tyr Leu Glu Glu Lys Tyr Glu Glu His Leu
20 25 30
Tyr Glu Arg Asp Glu Gly Asp Lys Trp Arg Asn Lys Lys Phe Glu Leu
35 40 45
Gly Leu Glu Phe Pro Asn Leu Pro Tyr Tyr Ile Asp Gly Asp Val Lys
-49-

CA 022l264~ l997-08-08
W 096/24343 PCT/US96/01964
55= 60
Leu Thr Gln Ser Met Ala Ile Ile Arg Tyr Ile Ala Asp Lys His Asn
Met Leu Gly Gly Cys Pro Lys Glu Arg Ala Glu Ile Ser Met Leu Glu
85 90 95
Gly Ala Val Leu Asp Ile Arg Tyr Gly Val Ser Arg Ile Ala Tyr Ser
100 105 110
Lys Asp Phe Glu Thr Leu Lys Val Asp Phe Leu Ser Lys Leu Pro Glu
115 120 125
Met Leu Lys Met Phe Glu Asp Arg Leu Cys His Lys Thr Tyr Leu Asn
130 135 140
Gly Asp His Val Thr His Pro Asp Phe Met Leu Tyr Asp Ala Leu Asp
145 150 155 160
Val Val Leu Tyr Met Asp Pro Met Cys Leu Asp Ala Phe Pro Lys Leu
165 170 175
Val Cys Phe Lys Lys Arg Ile Glu Ala Ile Pro Gln Ile Asp Lys Tyr
180 185 190
Leu Lys Ser Ser Lys Tyr Ile Ala Trp Pro Leu Gln Gly Trp Gln Ala
195 200 205
20 Thr Phe Gly Gly Gly Asp His Pro Pro Lys Ser Asp Leu Val Pro Arg
210 215 220
(2) INFORMATION FOR SEQ ID NO:9:
( i ) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 225 amino acids
(B) TYPE: amino acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: peptide
(iii) HYPOTHETICAL: NO
(iv) ANTISENSE: NO
(v) FRAGMENT TYPE: internal
(vi ) ORIGINAL SOURCE:
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:9:
- 50 -

CA 022l264~ l997-08-08
W 096/24343 PCTAUS96/01964
Met Ser Pro Ile Leu Gly Tyr Trp Lys Ile Lys Gly Leu Val Gln Pro
1 5 10 15
Thr Arg Leu Leu Leu Glu Tyr Leu Glu Glu Lys Tyr Glu Glu His Leu
20 25 30
Tyr Glu Arg Asp Glu Gly Asp Lys Trp Arg Asn Lys Lys Phe Glu Leu
35 40 45
Gly Leu Glu Phe Pro Asn Leu Pro Tyr Tyr Ile Asp Gly Asp Val Lys
50 55 60
10 Leu Thr Gln Ser Met Ala Ile Ile Arg Tyr Ile Ala Asp Lys His Asn
65 70 75 80
Met Leu Gly Gly Cys Pro Lys Glu Arg Ala Glu Ile Ser Met Leu Glu
85 90 95
Gly Ala Val Leu Asp Ile Arg Tyr Gly Val Ser Arg Ile Ala Tyr Ser
100 105 110
Lys Asp Phe Glu Thr Leu Lys Val Asp Phe Leu Ser Lys Leu Pro Glu
115 120 125
Met Leu Lys Met Phe Glu Asp Arg Leu Cys His Lys Thr Tyr Leu Asn
130 135 140
20 Gly Asp His Val Thr His Pro Asp Phe Met Leu Tyr Asp Ala Leu Asp
145 150 155 160
Val Val Leu Tyr Met Asp Pro Met Cys Leu Asp Ala Phe Pro Lys Leu
165 170 175
Val Cys Phe Lys Lys Arg Ile Glu Ala Ile Pro Gln Ile Asp Lys Tyr
2~ 180 185 190
Leu Lys Ser Ser Lys Tyr Ile Ala Trp Pro Leu Gln Gly Trp Gln Ala
195 200 205
Thr Phe Gly Gly Gly Asp His Pro Pro Lys Ser Asp Leu Ile Glu Gly
210 215 220
30 Arg
225
(2) INFORMATION FOR SEQ ID NO:10:
r
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 117 amino acids
(B) TYPE: amino acid

CA 022l264~ l997-08-08
W 096l24343 PCT~US96/01964
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: peptide
(iii) HYPOTHETICAL: NO
(iv) ANTISENSE: NO
(v) FRAGMENT TYPE: internal
(vi) ORIGINAL SOURCE:
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:10:
Ser Ile Gln Ala Glu Glu Trp Tyr Phe Gly Lys Leu Gly Arg Lys Asp
1 5 10 15
Ala Glu Arg Gln Leu Leu Ser Phe Gly Asn Pro Arg Gly Thr Phe Leu
20 25 30
Ile Arg Glu Ser Glu Thr Thr Lys Gly Ala Tyr Ser Leu Ser Ile Arg
35 40 45
Asp Trp Asp Asp Met Lys Gly Asp His Val Lys His Tyr Lys Ile Arg
50 55 60
Lys Leu Asp Asn Gly Gly Tyr Tyr Ile Thr Thr Arg Ala Gln Phe Glu
65 70 75 80
Thr Leu Gln Gln Leu Val Gln His Tyr Ser Glu Arg Glu Arg Ala Ala
85 90 95
Gly Leu Cys Cys Arg Leu Val Val Pro Cys His Lys Gly Met Pro Arg
100 105 110
Leu Thr Asn Ser Ser
115
(2) INFORMATION FOR SEQ ID NO:11:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 123 amino acids
(B) TYPE: amino acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: peptide
-52-

CA 022l264~ l997-08-08
W 096l24343 PCTAUS96/01964
(iii) HYPOTHETICAL: NO
(iv) ANTISENSE: NO
(v) FRAGMENT TYPE: internal
(vi) ORIGINAL SOURCE:
(xi) ~Qu~N~ DESCRIPTION: SEQ ID NO:11:
Gly Met Asn Asn Asn Met Ser Leu Gln Asn Ala Glu Trp Tyr Trp Gly
1 5 10 15
Asp Ile Ser Arg Glu Glu Val Asn Glu Lys Leu Arg Asp Thr Ala Asp
Gly Thr Phe Leu Val Arg Asp Ala Ser Thr Lys Met His Gly Asp Tyr
Thr Leu Thr Leu Arg Lys Gly Gly Asn Asn Lys Leu Ile Lys Ile Phe
50 55 60
His Arg Asp Gly Lys Tyr Gly Phe Ser Asp Pro Leu Thr Phe Ser Ser
Val Val Glu Leu Ile Asn His Tyr Arg Asn Glu Ser Leu Ala Gln Tyr
20 Asn Pro Lys Leu Asp Val Lys Leu Leu Tyr Pro Val Ser Lys Tyr Gln
100 105 110
Gln Asp Gln Val Val Lys Glu Asp Asn Ser Ser
115 120
( 2) INFORMATION FOR SEQ ID NO:12:
(i) ~OU~N~ CHARACTERISTICS:
(A) LENGTH: 112 amino acids
(B) TYPE: amino acid
(c) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: peptide
(iii) HYPOTHETICAL: NO
( iv) ANTISENSE: NO
(v) FRAGMENT TYPE: internal
(vi) ORIGINAL SOURCE:
- 53 -

CA 022l264~ l997-08-08
W 096/24343 PCTrUS96/01964
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:12:
Met Thr Ser Arg Arg Trp Phe His Pro Asn Ile Thr Gly Val Glu Ala
5 1 5 . 10 15
Glu Asn Leu Leu Leu Thr Arg Gly Val Asp Gly Ser Phe Leu Ala Arg
Pro Ser Lys Ser Asn Pro Gly Asp Phe Thr Leu Ser Val Arg Arg Asn
0 Gly Ala Val Thr His Ile Lys Ile Gln Asn Thr Gly Asp Tyr Tyr Asp
Leu Tyr Gly Gly Glu Lys Phe Ala Thr Leu Ala Glu Leu Val Gln Tyr
Tyr Met Glu His His Gly Gln Leu Lys Glu Lys Asn Gly Asp Val Ile
85 90 95
Glu Leu Lys Tyr Pro Leu Asn Cys Ala Asp Gln Phe Ile Val Thr Asp
100 105 110
(2) INFORMATION FOR SEQ ID NO:13:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 19 amino acids
(B) TYPE: amino acid
(C) STRANDEDNESS: single
( D) TOPOLOGY: linear
(ii) MOLECULE TYPE: peptide
(iii) HYPOTHETICAL: NO
(iv) ANTISENSE: NO
(v) FRAGMENT TYPE: internal
(vi) ORIGINAL SOURCE:
(ix) FEATURE:
(A) NAME/KEY: Other
( B) LOCATION: 4.. 4
(D) OTHER INFORMATION: phosphorylated tyrosine residue
-54-

CA 022l264~ l997-08-08
W 096l24343 PCTrUS96/01964
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:13:
Glu Pro Gln Tyr Glu Glu Ile Pro Ile Tyr Leu
1 5 10 15
(2) INFORMATION FOR SEQ ID NO:14:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 19 amino acids
(B~ TYPE: amino acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: peptide
(iii) HYPOTHETICAL: NO
(iv) ANTISENSE: NO
(v) FRAGMENT TYPE: internal
(vi) ORIGINAL SOURCE:
(ix) FEATURE:
(A) NAME/KEY: Other
(B) LOCATION: 4.. 4
(D) OTHER INFORMATION: phosphorylated tyrosine residue
(xi) ~Q~ DESCRIPTION: SEQ ID NO:14:
Asp Gly Gly Tyr Met Asp Met Ser Lys Asp Glu
1 5 10 15
(2) INFORMATION FOR SEQ ID NO:15:
-

-
CA 022l264~ l997-08-08
W 096/24343 PCTrUS96/0l96
(i) ~QU~ CHARACTERISTICS:
(A) LENGTH: 19 amino acids
(B) TYPE: amino acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: peptide
(iii) HYPOTHETICAL: NO
(iv) ANTISENSE: NO
0 (v) FRAGMENT TYPE: internal
(vi) ORIGINAL SOURCE:
(ix) FEATURE:
(A) NAME/KEY: Other
(B) LOCATION: 6.. 6
(D) OTHER INFORMATION: phosphorylated tyrosine residue
(xi) ~:Qu~N~_~ DESCRIPTION: SEQ ID NO:15:
20 Glu Asn Gly Leu Asn Tyr Ile Asp Leu Asp Leu
1 5 10 15
(2) INFORMATION FOR SEQ ID NO:16:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 23 amino acids
(B) TYPE: amino acid
(C) sTR~NnFnN~s single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: peptide
(iii) HYPOTHETICAL: NO
(iv) ANTISENSE: NO
(v) FRAGMENT TYPE: internal
-56-
~ . , .

CA 022l264~ l997-08-08
W 096/24343 PCTrUS96/01964
(vi) ORIGINAL SOURCE:
(ix) FEATURE:
(A) NAME/KEY: Other
(B) LOCATION: 7.. 7
(D) OTHER INFORMATION: phosphorylated tyrosine residue
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:16:
Thr Pro Pro His Leu Lys Tyr Phe Tyr Phe Val Val Ser Asp Ser
1 5 10 15
Gly
(2) INFORMATION FOR SEQ ID NO:17:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 87 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: cDNA
(iii) HYPOTHETICAL: NO
(iv) ANTISENSE: NO
(v) FRAGMENT TYPE:
(vi) ORIGINAL SOURCE:
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:17:
TTCCATATGA AAAGTATTCG TATTCAGCGT GGCCCGGGCC GTCACCACCA CCACCACCAC
GGGATCCCCG CTGAAGAGTG GTACTTT
87
(2) INFORMATION FOR SEQ ID NO:18:
-57-

CA 022l264~ l997-08-08
W 096/24343 PCTAJS96/01964
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 38 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: cDNA
(iii) HYPOTHETICAL: NO
0 (iv) ANTISENSE: NO
(v) FRAGMENT TYPE:
(vi) ORIGINAL SOURCE:
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:18:
GGAATTCTAG ATTACTAGGA CGTGGGGCAG ACGTT
38
(2) INFORMATION FOR SEQ ID NO:l9:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 46 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: cDNA
(iii) HYPOTHETICAL: NO
(iv) ANTISENSE: NO
( v ) FRAGMENT TYPE:
(vi) ORIGINAL SOURCE:
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:19:
CGGGATCCTG GACGACGACG ACAAAGCTGA GGAGTGGTAT TTT
46
-58-

CA 022l264~ l997-08-08
W 096/24343 PCTrUS96/01964
(2) INFORMATION EOR SEQ ID NO:20:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 38 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: cDNA
0 (iii) HYPOTHETICAL: NO
(iv) ANTISENSE: NO
(v) FRAGMENT TYPE:
(vi) ORIGINAL SOURCE:
(xi) ~Qu~ DESCRIPTION: SEQ ID NO:20:
GGAATTCTAG ACTATTAGGA CGTGGGGCAC ACGGT
38
( 2) INFORMATION FOR SEQ ID NO:21:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 48 base pairs
(B) TYPE: nucleic acid
(c) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: cDNA
(iii) HYPOTHETICAL: NO
(iv) ANTISENSE: NO
(v) FRAGMENT TYPE:
(vi) ORIGINAL SOURCE:
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:21:
CGGGATCCTG GACGACGACG ACAAAGAGCC CGAACCCTGG TTCTT
48
-59-

CA 0221264~ 1997-08-08
WO 96124343 PCT/US96/01964
(2) INFORMATION FOR SEQ ID NO:22:
(i) ~Ou~:N~ CHARACTERISTICS:
(A) LENGTH: 35 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: cDNA
(iii) HYPOTHETICAL: NO
(iv) ANTISENSE: NO
(v) FRAGMENT TYPE:
(vi) ORIGINAL SOURCE:
(xi) ~Qu~N~ DESCRIPTION: SEQ ID NO:22:
GCTCTAGACT ATTACTGGGG ~ GGGTC TG
(2) INFORMATION FOR SEQ ID NO:23:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 46 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: cDNA
(iii) HYPOTHETICAL: NO
(iv) ANTISENSE: NO
(v) FRAGMENT TYPE:
(vi) ORIGINAL SOURCE:
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:23:
-60-

CA 0221264~ 1997-08-08
W 096l24343 PCT~US96/01964
GAAGATCTTG GACGACGACG ACAAATCCCG TGGGTGGTTT CAC
46
(2) INFORMATION FOR SEQ ID NO:24:
S
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 35 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: cDNA
(iii) HYPOTHETICAL: NO
(iv) ANTISENSE: NO
( v ) FRAGMENT TYPE:
(vi) ORIGINAL SOURCE:
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:24:
GCTCTAGACT ATTAACTAGT GGGATCGGAG CA
(2) INFORMATION FOR SEQ ID NO:25:
( i ) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 106 amino acids
(B) TYPE: amino acid
(C) sTR~NnF~NF~s: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: peptide
(iii) HYPOTHETICAL: NO
(iv) ANTISENSE: NO
(v) FRAGMENT TYPE: internal
(vi) ORIGINAL SOURCE:
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:25:
-61-

CA 0221264~ 1997-08-08
W 096/24343 PCTrUS96/01964
His Pro Trp Phe Phe Gly Lys Ile Pro Arg Ala Lys Ala Glu Glu Met
l 5 l0 l5
Leu Ser Lys Gln Arg His Asp Gly Ala Phe Leu Ile Arg Glu Ser Glu
20 25 30
Ser Ala Pro Gly Asp Phe Ser Leu Ser Val Lys Phe Gly Asn Asp Val
Gln His Phe Lys Val Leu Arg Asp Gly Ala Gly Lys Tyr Phe Leu Trp
Val Val Lys Phe Asn Ser Leu Asn Glu Leu Val Asp Tyr His Arg Ser
Thr Ser Val Ser Arg Asn Gln Gln Ile Phe Leu Arg Asp Ile Glu Gln
85 90 95
Val Pro Gln Gln Pro Thr Ile His Arg Asp
l00 105
(2) INFORMATION FOR SEQ ID NO:26:
~ Qu~ CHARACTERISTICS:
(A) LENGTH: ll amino acids
(B) TYPE: amino acid
(C) STR~ Nn~nNF..~ single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: peptide
(iii) HYPOTHETICAL: NO
(iv) ANTISENSE: NO
(v) FRAGMENT TYPE: internal
(vi) ORIGINAL SOURCE:
(ix) FEATURE:
(A) NAME/KEY: Other
(B) LOCATION: 6...6
(D) OTHER INFORMATION: phosphorylated tyrosine r
esidue
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:26:
-62-

CA 02212645 1997-08-08
WO 96l24343 PCTIUS96/01964
Leu Pro Val Pro Glu Tyr Ile Asn Gln Ser Val
- 63 -

Dessin représentatif

Désolé, le dessin représentatif concernant le document de brevet no 2212645 est introuvable.

États administratifs

2024-08-01 : Dans le cadre de la transition vers les Brevets de nouvelle génération (BNG), la base de données sur les brevets canadiens (BDBC) contient désormais un Historique d'événement plus détaillé, qui reproduit le Journal des événements de notre nouvelle solution interne.

Veuillez noter que les événements débutant par « Inactive : » se réfèrent à des événements qui ne sont plus utilisés dans notre nouvelle solution interne.

Pour une meilleure compréhension de l'état de la demande ou brevet qui figure sur cette page, la rubrique Mise en garde , et les descriptions de Brevet , Historique d'événement , Taxes périodiques et Historique des paiements devraient être consultées.

Historique d'événement

Description Date
Inactive : CIB de MCD 2006-03-12
Inactive : CIB de MCD 2006-03-12
Inactive : CIB de MCD 2006-03-12
Demande non rétablie avant l'échéance 2002-02-11
Le délai pour l'annulation est expiré 2002-02-11
Réputée abandonnée - omission de répondre à un avis sur les taxes pour le maintien en état 2001-02-09
Inactive : CIB attribuée 1997-11-26
Inactive : CIB attribuée 1997-11-26
Inactive : CIB attribuée 1997-11-26
Inactive : CIB attribuée 1997-11-26
Inactive : CIB en 1re position 1997-11-26
Inactive : CIB attribuée 1997-11-26
Inactive : CIB attribuée 1997-11-26
Inactive : CIB attribuée 1997-11-26
Lettre envoyée 1997-10-17
Inactive : Notice - Entrée phase nat. - Pas de RE 1997-10-17
Demande reçue - PCT 1997-10-15
Demande publiée (accessible au public) 1996-08-15

Historique d'abandonnement

Date d'abandonnement Raison Date de rétablissement
2001-02-09

Taxes périodiques

Le dernier paiement a été reçu le 1999-12-14

Avis : Si le paiement en totalité n'a pas été reçu au plus tard à la date indiquée, une taxe supplémentaire peut être imposée, soit une des taxes suivantes :

  • taxe de rétablissement ;
  • taxe pour paiement en souffrance ; ou
  • taxe additionnelle pour le renversement d'une péremption réputée.

Veuillez vous référer à la page web des taxes sur les brevets de l'OPIC pour voir tous les montants actuels des taxes.

Historique des taxes

Type de taxes Anniversaire Échéance Date payée
Enregistrement d'un document 1997-08-08
Taxe nationale de base - générale 1997-08-08
TM (demande, 2e anniv.) - générale 02 1998-02-09 1997-12-31
TM (demande, 3e anniv.) - générale 03 1999-02-09 1998-12-22
TM (demande, 4e anniv.) - générale 04 2000-02-09 1999-12-14
Titulaires au dossier

Les titulaires actuels et antérieures au dossier sont affichés en ordre alphabétique.

Titulaires actuels au dossier
SMITHKLINE BEECHAM CORPORATION
Titulaires antérieures au dossier
DAMIEN JOHN DUNNINGTON
Les propriétaires antérieurs qui ne figurent pas dans la liste des « Propriétaires au dossier » apparaîtront dans d'autres documents au dossier.
Documents

Pour visionner les fichiers sélectionnés, entrer le code reCAPTCHA :



Pour visualiser une image, cliquer sur un lien dans la colonne description du document. Pour télécharger l'image (les images), cliquer l'une ou plusieurs cases à cocher dans la première colonne et ensuite cliquer sur le bouton "Télécharger sélection en format PDF (archive Zip)" ou le bouton "Télécharger sélection (en un fichier PDF fusionné)".

Liste des documents de brevet publiés et non publiés sur la BDBC .

Si vous avez des difficultés à accéder au contenu, veuillez communiquer avec le Centre de services à la clientèle au 1-866-997-1936, ou envoyer un courriel au Centre de service à la clientèle de l'OPIC.


Description du
Document 
Date
(aaaa-mm-jj) 
Nombre de pages   Taille de l'image (Ko) 
Description 1997-08-08 63 2 400
Abrégé 1997-08-08 1 51
Revendications 1997-08-08 10 380
Page couverture 1997-12-09 1 46
Rappel de taxe de maintien due 1997-10-15 1 111
Avis d'entree dans la phase nationale 1997-10-17 1 193
Courtoisie - Certificat d'enregistrement (document(s) connexe(s)) 1997-10-17 1 116
Courtoisie - Lettre d'abandon (taxe de maintien en état) 2001-03-12 1 182
PCT 1997-08-08 7 261