Note : Les descriptions sont présentées dans la langue officielle dans laquelle elles ont été soumises.
CA 02216912 1997-11-27
O 96~9437 PCT/U',Sl'~7173
~nMAN G-PROTEIN CEE~O~l~ RE~.~R ~n~ o
This invention relates to newly identified
polynucleotides, polypeptides encoded by such
polynu.leotides, the use of such polynucleotides and
polypeptides, as well as the production of such
polynucleotides and polypeptides. More particularly, the
polypeptide of the present invention is a human 7-
transmembrane receptor which has been putatively identified
as a chemokine receptor, sometimes hereinafter referred to as
"G-Protein Chemokine Receptor" or n~lx.N~1o". The invention
also relates to inhibiting the action of such polypeptides.
It is well established that many medically significant
biological processes are mediated by proteins participating
in signaL transduction pathways that involve G-proteins
and/or second messengers, e.g., cAMP (Lefkowitz, Nature,
351:353-354 (1991)). Herein these proteins are referred to
as proteins participating in pathways with G-proteins or PPG
proteins. Some examples of these ?roteins include the GPC
receptors, such as tho~e for adrenergic agents and ~o~ine
(Kobilka, B.K., et al., PN~S, 84:46-50 (1987); Robilka, 9.K.,
et al., Science 238:650-656 (1987); 9unzow, J.R., et al.,
Nature, 336:783-787 (1g88)), G-proteins themselve~, ef~ector
proteins, e.g., phospholipase C, adenyl cyclase, and
phosphodiesterase, ar.d actuator proteins, e.g., protein
--1--
CA 02216912 1997-11-27
W096~9437 PCT~S95/07173
kinase A and protein kinase C ~Simon, M.I., et al., Science,
252:802-8 (l99l)).
For example, in one form of signal transduction, the
effect of hormone hln~;ng iS activation of an enzyme,
adenylate cyclase, inside the cell. Enzyme activation by
hormones is dependent on the presence of the nucleotide GTP,
and GTP also influences hormone hin~l;ng. A G-protein
connects the hormone receptors to adenylate cyclase. G-
protein was shown to ~Ych~nge GTP for bound GDP when
activated by hon~one receptors. The GTP-carrying form then
binds to an activated adenylate cyclase. Hydrolysis of GTP
to GDP, catalyzed by the G-protein itself, returns the G-
protein to its basal, inactive form. Thus, the G-protein
serves a dual role, as an intermediate that relays the signal
from receptor to effector, and as a clock that controls the
duration of the signal.
The ...~,~Lane protein gene superfamily of G-protein
coupled receptors has been characterized as having seven
putative transmembrane domains. The domains are believed to
represent transmembrane a-helices connected by extracellular
or cytoplasmic loops. G-protein coupled receptors include a
wide range of biologically active receptors, such as hormone,
viral, growth factor and neuroreceptors.
G-protein coupled receptors have been characterized as
including these seven conserved hydroph~bic stretches of
about 20 -to 30 amino acids, connecting at least eight
divergent hydrophilic loops. The G-protein family of coupled
receptors includes doramine receptors which bind to
neuroleptic drugs used for treating psychotic and
neurological disorders. Other examples of members of this
family include calcitonin, adrenergic, endothelin, cAMP,
adenosine, muscarinic, acetylcholine, serotonin, hist~mine,
thrombin, kinin, follicle stimulating honmone, opsins,
endothelial differentiation gene-l receptor and rhodop~ins,
odorant, cytomegalovirus receptors, etc.
CA 02216912 1997-11-27
Wos6/3s437 PCT~S95/07173
G-protein coupled receptors can be intracellularly
coupled by heterotrimeric G-proteins to various intracellular
enzymes, ion ch~nnels and transporters (see, Johnson et al.,
Endoc., Rev., 10:317-331 (1989)). Different G-protein ~-
subunits preferentially stimulate particular effectors to
modulate various biological functions in a cell.
Phosphorylation of cytoplasmic residues of G-protein coupled
receptors have been identified as an important mechanism for
the regulation of G-protein coupling of some G-protein
coupled receptors. G-protein coupled receptors are found in
numerous sites within a mammalian host.
Chemokines, also referred to as intercrine cytokines,
are a subfamily of structurally and functionally related
cytokines. These molecules are 8-10 kd in size. In general,
chemokines ~Yh;h; t 20% to 75% homology at the amino acid
level and are characterized by four conserved cysteine~
residues that form two disulfide bondg. Based on the
arrangement of the first two cysteine residues, chemokines
have been classified into two subfamilies, alpha and beta.
In the alpha subfamily, the first two cysteines are separated
by one amino acid and hence are referred to as the "C-X-C"
subfamily. In the beta subfamily, the two cysteines are in
an adjacent po~ition and are, therefore, referred to as the
"C-C~ subfamily. Thus far, at least nine different members
of this family have been identified in humans.
The intercrine cytokines P}-h;h; t a wide variety of
functions. A hallmark feature is their ability to elicit
chemotactic migration of distinct cell types, including
monocytes, neutrophil8, T lymphocytes, ha~oph;ls and
fibrobla~ts. Many chemokines have proinflammatory activity
and are involved in multiple steps during an inflammatory
reaction. TheQe activities include stimulation of histamlne
release, lysosomal enzyme and leukotriene release, increased
adherence of target immune cells to endothelial cells,
enhanced binding of complement proteins, induced expression
CA 02216912 1997-11-27
W O 96~9437 PCT/U~5/'~7173
of granulocyte adhesion molecules and complement recéptors,
and respiratory bur6t. In addition to their involvement in
inflammation, certain chemokines have been shown to exhibit
other activities. For example, macrophage inflammatory
protein 1 (MIP-1) is able to suppress hematopoietic stem cell
proliferation, platelet factor-4 (PF-4) is a potent inhibitor
of endothelial cell growth, Interleukin-8 ~IL-8) promotes
proliferation of keratinocytes, and GRO is an autocrine
growth factor for melanoma cell~.
In light of the diverse biological activities, it is not
surprising that chemokines have been implicated in a number
of physiological and di6eage condition6, including lymphocyte
trafficking, wound healing, hematopoietic regulation and
immunological disorders such as allergy, asthma and
arthritis.
In accordance with one a6pect of the present invention,
there are provided novel mature receptor polypeptides as well
as biologically active and diagnostically or therapeutically
useful fragments, analogs and derivatives thereof. The
receptor polypeptides of the present invention are of human
origin.
In accordance with another aspect of the present
invention, there are provided isolated nucleic acid molecules
PncoAing the receptor polypeptides of the present invention,
including mRNAs, DNAs, cDNAs, genomic DNA a6 well a6
antisense- analog6 thereof and biologically active and
diagnostically or therapeutically useful fragments thereof.
In accordance with a further aspect of the present
invention, there are provided processes for producing such
receptor polypeptides by recombinant technique6 compri6ing
culturing recombinant prokaryotic and/or eukaryotic ho6t
cells, cont~ining nucleic acid sequences encoAing the
receptor polypeptides of the present invention, under
conditions promoting expre6sion of said polypeptides and
subsequent recovery of said polypeptide6.
CA 02216912 1997-11-27
w096~9437 PCT/U535l~7173
In accordance with yet a further aspect of the present
invention, there are provided antibcdies against such
receptor polypeptides.
In accordance with another aspect of the present
invention there are provided methods of screening for
compounds which bind to and activate or inhibit activation of
- the receptor polypeptides of the present invention.
In accordance with still another embodiment of the
present invention there are provided processes of
~ministering compounds to a host which bind to and activate
the receptor polypeptide of the present invention which are
useful in stimulating haematopoiesis, wound healing,
coagulation, angiogenesi~, to treat solid tumors, chronic
infections, leukemia, T-cell mediated auto-immune diseases,
parasitic infections, psoriasis, and to stimulate growth
factor activity.
In accordance with another aspect of the present
invention there is provided a method of administering the
receptor polypeptides of the present invention via gene
therapy to treat conditions related to undeLex~ession of the
polypeptides or underexpression of a ligand for the receptor
polypeptide.
In accordance with still another embodiment of the
present invention there are provided processes of
~mi ni stering co~ro~nA~ to a host which bind to and inhibit
activation of the receptor polypeptides of the present
invention which are useful in the prevention and/or treatment
of allergy, atherogenesis, anaphylaxis, malignancy, chronic
and acute inflammation, histamine and Ig8-mediated allergic
reactions, prostagl ~nAi n - independent fever, bone marrow
failure, silicosis, sarcoidosis, rheumatoid arthritis, shock
and hyper-eosin~rhilic syndrome.
In accordance with yet another aspect of,the present
invention, there are provided nucleic acid probes comprising
nucleic acid molecules of sufficient length to specifically
CA 02216912 1997-11-27
W096~9437 PCT~S95/07173
structurallv related to the G protein-coupled receptor
family. It cont~inc an open re~ing frame ~nco~in~ a protein
of 352 amino acid residues. The protein exhibits the highest
degree of homology to a human MCP-l receptor with 70.1 %
identity and 82.9 % similarity over a 347 amino acid stretch.
The polynucleotide of the present invention may be in
the form of RNA or in the form of DNA, which DNA includes
cDNA, genomic DNA, and synthetic DNA. The DNA may be double-
stranded or single-stranded, and if single stranded may be
the coAin~ strand or non-co~ing (anti-sense) strand. The
coAing sequence which ~n~oAes the mature polypeptide may be
identical to the ro~i ng sequence shown in Figure l (SBQ ID
NO:l) or that of the deposited clone or may be a different
coding sequence which coding sequence, as a result of the
re~ln~ncy or degeneracy of the genetic code, encodes the-
same mature polypeptide as the DNA of Figure l (SBQ ID NO~
or the deposited cDNA.
The polynucleotide which PncoAP~ for the mature
polypeptide of Figure l or for the mature polypeptide PncoAeA
by the deposited cDNA may include: only the coAing sequence
for the mature polypeptide; the coAing sequence for the
mature polypeptide and additional coding sequence such as a
transmembrane (TM) or intra-cellular domain; the co~ing
sequence for the mature polypeptide (and optionally
additional coAin~ sequence) and non-coAing sequence, such as
introns or non-coAing sequence 5' and/or 3' of the coding
sequence for the mature polypeptide.
Thus, the term "polynucleotide ~ncoAi ng a polypeptide n
encompasses a polynucleotide which includes only coding
sequence for the polypeptide as well as a polynucleotide
which includes additional coding and/or non-coding sequence.
The present invention further relates to variants of the
hereinabove described polynucleotides which ~ncoAe for
fragments, analogs and derivatives of the polypeptide having
the deduced amino acid sequence of Figure l or the
CA 02216912 1997-11-27
W096~9437 PCT~S95/07173
host, e.g. COS-7 cells, is used. The HA tag corresponds to
an epitope derived from the influenza hemagglutinin protein
(Wilson, I., et al., Cell, 37:76, (1984)).
The term "gene" means the segment of DNA involved in
producing a polypeptide chain; it includes regions preceding
and following the co~in~ region (leader and trailer) as well
as intervening sequences (introns) between individual coding
segments (exons).
Fragments of the full length gene of the present
invention may be used as a hybridization probe for a cDNA
library to isolate the full length cDNA and to isolate other
cDNAs which have a high sequence similarity to the gene or
similar biological activity. Probes of this type preferably
have at least ~0 bases and may contain, for example, 50 or
more bases. The probe may also be used to identify a cDN~
clone corresron~ing to a full length transcript and a genomic,
clone or clones that contain the complete gene including
regulatory and promotor regions, exons, and introns. An
example of a screen comprises isolating the coding region of
the gene by using the known DNA sequence to synthesize an
oligonucleotide probe. Labeled oligonucleotides having a
sequence c~mplementary to that of the gene of the present
invention are used to screen a library of human cDNA, genomic
DNA or mRNA to determine which members of the library the
probe hybridizes to.
The - present invention further relates to
polynucleotides which hybridize to the hereinAhove-described
seqll~nc~s if there is at least 70%, preferably at least 90%,
and more preferably at least 95~ identity between the
se~l~nce~. The present invention particularly relates to
polynucleotides which hybridize under stringent condition~ to
the her~in~hove-described polynucleotides. As herein used,
the term n~tringent conditions" means hybridization will
occur only if there is at least 95% and preferably at least
97% identity between the sequences. The polynucleotides
_g_
CA 02216912 1997-11-27
W096~9437 PCT/U~S/~7173
polypeptide Pnro~e~ by the cDNA of the deposited clone. The
variant of the polynucleotide may be a naturalIy occurring
allelic variant of the polynucleotide or a non-naturally
occurring variant of the polynucleotide.
Thus, the present invention includes polynucleotides
PnroA-ng the same mature polypeptide as shown in Figure 1
~SEQ ID N0:2) or the same mature polypeptide Pnro~e~ by the
cDNA of the deposited clone as well as variants of such
polynucleotides which variants encode for a fragment,
derivative or analog of the polypeptide of Figure 1 (SBQ ID
N0:2) or the polypeptide PnCo~d by the cDNA of the deposited
clone. Such nucleotide variants include deletion variants,
substitution variants and addition or insertion variants.
As herPtnAhove indicated, the polynucleotide may have a
roAi n~ gequence which is a naturally occurring allelic-
variant of the co~i ng sequence shown in ~igure 1 (S~Q ID~
N0:1) or of the coding sequence of the deposited clone. As
known in the art, an allelic variant is an alternate form of
a polynucleotide sequence which may have a substitution,
deletion or addition of one or more nucleotides, which does
not substantially alter the function of the encoded
polypeptide.
The polynucleotides may also PnroAe for a soluble form
of the G-protein chemokine receptor polypeptide which is the
extracellular portion of the polypeptide which has been
cleaved from the TM and intracellular domain of the full-
length polypeptide of the present invention.
The polynucleotides of the present invention may also
have the coding seguence fused in frame to a marker sequence
which allows for purification of the polypeptide of the
present invention. The marker sequence may be a hexa-
histidine tag supplied by a pQE-9 vector to provide for
purification of the mature polypeptide fused to the marker in
the case of a bacterial host, or, for example, the marker
sequence may be a hemagglutinin ~HA) tag when a m~m,m~l ian
-a-
CA 02216912 1997-11-27
w096~9437 PCT/~S35~173
The present invention further relates to a G-protein
chemokine receptor polypeptide which has the deduced amino
acid sequence of Figure 1 (S~Q ID N0:2) or which has the
amino acid sequence encoded by the deposited cDNA, as well as
fragments, analogs and derivatives of such polypeptide.
The tenms "fragment, n nderivativell and "analog" when
referring to the polypeptide of Figure 1 or that encoded by
the deposited cDNA, means a polypeptide which either retains
sub~tantially the same biological function or activity as
such polypeptide, i.e. functions as a G-protein rhemokine
receptor, or retains the ability to bind the ligand or the
receptor even though the polypeptide does not function as a
G-protein chemokine receptor, for example, a ~oluble form of
the receptor. An analog includes a ~lv~Lotein which can be
activated by cleavage of the ~v~otein portion to produce an
active mature polypeptide.
The polypeptide of the present invention may be a
recombinant polypeptide, a natural polypeptide or a ~ynthetic
polypeptide, preferably a recombinant polypeptide.
The fragment, derivative or analog of the polypeptide
of Figure 1 (SBQ ID N0:2) or that encoAe~ by the deposited
cDNA may be ~i) one in which one or more of the amino acid
residues are substituted with a conserved or non-conserved
amino acid residue (preferably a conserved amino acid
residue) and such substituted amino acid residue may or may
not be one encoded by the genetic code, or ~ii) one in which
one or more of the amino acid residues includes a substituent
group, or ~iii) one in which the mature polypeptide is fused
with another compound, such as a compound to increase the
half-life of the polypeptide (for example, polyethylene
glycol), or (iv) one in which the additional amino acids are
fused to the mature polypeptide for purification of the
polypeptide or (v) one in which a fragment of the polypeptide
~ is soluble, i.e. not membrane bound, yet still binds ligands
to the membrane bound receptor. Such fragments, derivatives
-11 -
CA 02216912 1997-11-27
W096/39437 PCT~S95/07173
which hybridize to the herein~hove described polynucléotides
in a preferred embodiment PncoAe polypeptides which either
retain substantially the same biological function or activity
as the mature polypeptide encoded by the cDNAs of Figure 1
(SEQ ID NO:1) or the deposited cDNA(s).
Alternatively, the polynucleotide may have at least 20
bases, preferably 30 bases, and more preferably at least 50
bases which hybridize to a polynucleotide of the present
invention and which has an identity thereto, as herPin~hove
described, and which may or may not retain activity. For
example, such polynucleotides may be employed as probes for
the polynucleotide of SBQ ID NO:1, for example, for recovery
of the polynucleotide or as a diagnostic probe or as a PCR
primer.
Thus, the present invention is directed to
polynucleotides having at least a 70% identity, preferably at
least 90% and more preferably at least a 95% identity to a
polynucleotide which PnCOAP~ the polypeptide of SBQ ID NO:2
as well as fragments thereof, which fragments have at least
30 bases and preferably at least 50 bases and to polypeptides
PncoA~PA by such polynucleotides.
The deposit(s~ referred to herein will be ma;nt~tned
under the terms of the Budapest Treaty on the International
Recognition of the Deposit of Micro-organisms for purposes of
Patent Procedure. These deposits are provided merely as
convenience to those of skill in the art and are not an
admission that a deposit is required under 35 U.S.C. 112.
The sequence of the polynucleotides cont~tnp~ in the
deposited materials, as well as the amino acid sequence of
the polypeptides encoded thereby, are incorporated herein by
reference and are controlling in the event of any conflict
with any description of sequences herein. A license may be
required to make, or sell the deposited materials, and
no such license is hereby granted.
-10 -
CA 02216912 1997-11-27
W096/39437 PCT/U~9SI~7173
hybridize to the polynucleotide sequences of the present
invention.
In accordance with still another aspect of the present
invention, there are provided diagnostic assays for detecting
diseases related to mutations in the nucleic acid sequences
encoding such polypeptides and for detecting an altered level
of the soluble form of the receptor polypeptides.
In accordance with yet a further aspect of the present
invention, there are provided processes for utilizing such
receptor polypeptides, or polynucleotides encoding such
polypeptides, for in vitro purposes related to scientific
research, synthesis of DNA and manufacture of DNA vectors.
These and other aspects of the present invention should
be apparent to those skilled in the art from the teachings
herein.
The following drawings are illustrative of embodiments
of the invention and are not meant to limit the scope of the
invention as encompassed by the claims.
Figure l shows the cDNA sequence and the corresponding
deduced amino acid sequence of the G-protein coupled receptor
of the present invention. The st~n~rd one-letter
abbreviation for amino acids is used. Sequencing was
performed using a 373 Automated DNA sequencer (Applied
Biosystems, Inc.).
Figure 2 illustrates an amino acid alignment of the G-
protein rh~mokine receptor of the present invention and the
human MCP-l receptor.
In accor~ance with an a~pect of the present invention,
there is provided an isolated nucleic acid (polynucleotide)
which encodes for the mature polypeptide having the deduced
amino acid sequence of Figure l (SBQ ID NO:2) or for the
mature polypeptide encoded by the cDNA of the clone deposited
as ATCC Deposit No. on June l, l995.
The polynucleotide of this invention was discovered in
a cDNA library derived from human monocytes. It is
CA 02216912 1997-11-27
W096~9437 PCT~Sss/07173
and analogs are deemed to be within the scope of those
skilled in the art from the teachings herein.
The polypeptides and polynucleotides of the present
invention are preferably provided in an isolated form, and
preferably are purified to hu~oye~leity~
The polypeptides of the present invention include the
polypeptide of SBQ ID NO:2 (in particular the mature
polypeptide) as well as polypeptides which have at least 70%
similarity (preferably a 70% identity) to the polypeptide of
SEQ ID NO:2 and more preferably a 90% s~ rity (more
preferably a 90% identity) to the polypeptide of SEQ ID NO:2
and still more preferably a 95% s~ rity (still more
preferably a 90% identity) to the polypeptide of SEQ ID NO:2
and to portions of such polypeptide with such portion of the
polypeptide generally cont~intng at least 30 amino acids and
more preferably at least 50 amino acids.
As known in the art "Si~il~rity" between two
polypeptides is determined by comparing the amino acid
sequence and conserved amino acid substitutes thereto of the
polypeptide to the sequence of a second polypeptide.
Fragments or portions of the polypeptides of the present
invention may be employed for producing the corresponding
full-length polypeptide by peptide synthesis, therefore, the
fragments may be employed as intermediates for producing the
full-length polypeptides. Fragments or portions of the
polynucleotides of the present invention may be used to
synthesize full-length polynucleotides of the present
invention.
The term "gene n means the segment of DNA involved in
pro~llcing a polypeptide chain; it includes regions preceding
and following the ro~ing region "leader and trailer" as well
as intervening sequences (introns) between individual coding
segments (exons).
The term n isolated" means that the material is removed
from its original environment (e.g., the natural envi.ol~-,ellt
CA 02216912 1997-11-27
W096~9437
PCT/U~S~7173
if it is naturally occurring). For example, a naturally-
occurring polynucleotide or polypeptide present in a li~ing
~n~-l iS not isolated, but the same polynucleotide or
polypeptide, separated from some or all of the coexisting
materials in the natural system, is isolated. Such
polynucleotides could be part of a vector and/or such
polynucleotides or polypeptides could be part of a
composition, and still be isolated in that such vector or
composition is not part of its natural environment.
The polypeptides of the present invention include the
polypeptide of SBQ ID NO:2 (in particular the mature
polypeptide) a~ well as polypeptides which have at lea~t 70%
similarity (preferably at least 70~ identity) to the
polypeptide of S8Q ID NO:2 and more preferably at least 90%
similarity (more preferably at least 90% identity) to the
polypeptide of SBQ ID NO:2 and still more preferably at least
95% similarity (still more preferably at least 95% identity)
to the polypeptide of SEQ ID NO:2 and also include portion~
of such polypeptides with such portion of the polypeptide
generally ~ont~in~ng at least 30 amino acids and more
preferably at least 50 amino acids.
AS known in the art "similarity" between two
polypeptides is determined by comparing the amino acid
sequence and its conserved amino acid substitutes of one
polypeptide to the sequence of a second polypeptide.
Fragments or portions of the polypeptides of the present
invention may be employed for producing the corresponding
full-length polypeptide by peptide synthesis; therefore, the
fragments may be employed as intermediates for producing the
full-length polypeptides. ~ragments or portions of the
polynucleotides of the present invention may be used to
synthesize full-length polynucleotides of the present
invention.
The present invention also relates to vectors which
include polynucleotides of the present invention, host cells
CA 02216912 1997-11-27
W096~9437 PCT~S95/07173
which are genetically engineered with vectors of the
invention and the production of polypeptides of the invention
by recombinant techniques.
Host cells are genetically engineered (transduced or
transformed or transfected) with the vectors of this
invention which may be, for example, a cloning vector or an
expression vector. The vector may be, for example, in the
fonm of a plasmid, a viral particle, a phage, etc. The
engineered host cells can be cultured in conventional
nutrient media modified as appropriate for activating
promoters, selecting transformants or amplifying the genes of
the present invention. The culture conditions, such as
temperature, pH and the like, are those previously used with
the host cell selected for expression, and will be apparent
to the ordinarily skilled artisan.
The polynucleotides of the present invention may be
employed for producing polypeptides by reComh;n~nt
techniques. Thus, for example, the polynucleotide may be
included in any one of a variety of expression vectors for
expressing a polypeptide. Such vectors include chromosomal,
nQnchromosomal and synthetic DNA seguences, e.g.,
derivatives of SV40; bacterial plasmids; phage DNA;
baculovirus; yeast plasmids; vectors derived from
combinations of plasmids and phage DNA, viral DNA such as
vaccinia, adenovirus, fowl pox virus, and pseudorabies.
However, any other vector may be uQed as long as it is
replicable and viable in the host.
The appropriate DNA sequence may be inserted into the
vector by a variety of procedures. In general, the DNA
~equence is inserted into an appropriate restriction
Pn~onnrlease site(s) by procedures known in the art. Such
procedures and others are deemed to be within the scope of
those skilled in the art.
The DNA sequence in the expression vector is operatively
linked to an appropriate expression control sequence(s)
CA 02216912 1997-11-27
W096/39437 PCT~Sss/07173
(promoter) to direct mRNA synthesis. As representative
examples of such promoters, there may be mentioned: LTR or
SV40 promoter, the E. coli. lac or trp, the phage 1~mhAA PL
promoter and other promoters known to control expression of
genes in prokaryotic or eukaryotic cells or their viruses.
The expression vector also contains a ribosome h; n~i ng site
for translation initiation and a transcription terminator.
The vector may also include appropriate sequences for
amplifying expression.
In addition, the expression vectors preferably cont~in-
one or more selectable marker genes to provide a phenotypic
trait for selection of transformed host cells such as
dihydrofolate reductase or neomycin resistance for eukaryotic
cell culture, or such a~ tetracycline or ampicillin
resistance in B. coli.
The vector cont~i ni ng the a~ o~riate DNA sequence as
herPin~hove described, as well as an a~ro~riate promoter or
control sequence, may be employed to transform an appropriate
host to permit the host to express the protein.
As representative examples of a~lu~riate hosts, there
may be mentioned: bacterial cells, such as E. coli,
StreptomYces, S~l~onella t~phimurium; fungal cells, such as
yeast; insect cells such as Drosophila and Spodoptera Sf9;
~nir-l cells such as CH0, COS or ~owes mel~n~~-; adenovirus;
plant cells, etc. The selection of an appropriate host is
deemed to.be within the scope of those skilled in the art
from the teachings herein.
More particularly, the present invention also includes
rec~in~nt constructs comprising one or more of the
sequences as broadly described above. The constructs
comprise a vector, such as a plasmid or viral vector, into
which a sequence of the invention has been inserted, in a
forward or reverse orientation. In a preferred aspect of this
embodiment, the construct further comprises regulatory
sequences, including, for example, a promoter, operably
CA 02216912 1997-11-27
w096~9437 PCT~S95/07173
linked to the sequence. Large numbers of suitable vectors
and promoters are known to those of skill in the art, and are
commercially available. The following vectors are provided
by way of example. Bacte~_al: pQE70, pQE60, pQE-9 (Qiagen),
pbs, pD10, phagescript, psiX174, pbluescript SK, pbsks,
pNH8A, pNH16a, pNH18A, pNH46A (Stratagene); ptrc99a, pKR223-
3, pKK233-3, pDR540, pRIT5 (Pharmacia). Eukaryotic: pWLNEO,
pSV2CAT, pOG44, pXT1, pSG (Stratagene) pSV~3, pBPV, pMSG,
pSVL (Pharmacia). However, any other plasmid or vector may
be used as long as they are replicable and viable in the
host.
Promoter regions can be selected from any desired gene
using CAT (chloramphenicol transferase) vectors or other
vectors with selectable markers. Two a~u~riate vectors are
P~K232-8 and PCM7. Particular named bacterial promoters
include lacI, lacZ, T3, T7, gpt, lambda PRI PL and trp.
Eukaryotic promoters include CMV immediate early, HSV
thymidine kinase, early and late SV40, LTRs from retrovirus,
and mouse metallothionein-I. Selection of the a~ riate
vector and promoter is well within the level of ordinary
skill in the art.
In a further embodiment, the present invention relates
to host cells cont~in~n~ the above-described constructs. The
host cell can be a higher eukaryotic cell, such as a
mammalian cell, or a lower eukaryotic cell, such as a yeast
cell, or the host cell can be a prokaryotic cell, such a~ a
bacterial cell. Introduction of the construct into the host
cell can be effected by calcium phosphate transfection, DEA~-
Dextran mediated transfection, or electroporation. (Davis,
L., Dibner, M., Battey, I., Basic Methods in Molecular
Biology, (1986)).
The constructs in host cells can be used in a
conventional ~nn~r to produce the gene product encoded by
the recombinant sequence. Alternatively, the polypeptides of
CA 02216912 1997-11-27
WOs6~s437
PCT~S95/07173
the invention can be synthetically produced by conventional
peptide synthesizers.
Mature proteins can be expressed in ~mm~lian cells,
yeast, bacteria, or other cells under the control of
appropriate promoters. Cell-free translation systems can
also be employed to produce such proteins using RNAs deri~ed
from the DNA constructs of the present invention.
Appropriate cloning and expression vectors for use with
prokaryotic and eukaryotic hosts are described by Sambrook,
et al., Molecular Cloning: A Laboratory ~n~ , Second
Edition, Cold Spring Harbor, N.Y., (1989), the disclosure of
which is hereby incorporated by reference.
Transcription of the DNA PncoAing the polypeptides of
the present invention by higher eukaryotes is increased by
inserting an Pnh~ncer sequence into the vector. Rnh~ncers
are cis-acting elements of DNA, usually about from 10 to 300
bp that act on a promoter to increase its transcription.
Examples including the SV40 Pnh~ncer on the late side of the
replication origin bp 100 to 270, a cytomegalovirus early
pl~..,o~er enhancer, the polyoma enhAncer on the late side of
the replication origin, and adenovirus Pnh~ncers.
Generally, recombinant expression vectors will include
origins of replication and selectable markers permitting
transformation of the host cell, e.g., the ampicillin
resistance yene of E. coli and S. cerevisiae TRP1 gene, and
a promoter derived from a highly-expressed gene to direct
transcription of a downstream structural sequence. Such
o~,~o~ers can be derived from operons encoding glycolytic
enzymes such as 3-phosphoglycerate kinase (PGK), ~-factor,
acid phosphatase, or heat shock proteins, among others. The
heterologous structural sequence is assembled in appropriate
phase with translation initiation and termination sequences,
and preferably, a leader sequence capable of directing
secretion of translated protein into the periplasmic space or
extracellular medium. ~ptionally, the heterologous sequence
-17-
CA 02216912 1997-11-27
W096~9437
PCT~S95/07173
can encode a fusion protein including an N-terminal
identification peptide imparting desired characteristics,
e.g., stabilization or simplified purification of expressed
recombinant product.
Useful expression ~ectors for bacterial use are
constructed by inserting a structural DNA sequence encoding
a desired protein together with suitable translation
initiation and termination signals in operable reading phase
with a functional promoter. The vector will comprise one or
more phenotypic selectable markers and an origin of
replication to ensure maintenance of the vector and to, if
desirable, provide amplification within the host. Suitable
prokaryotic hosts for transformation include E. coli,
Bacillus subtilis, S~ nella ty~h~ rium and various species
within the genera Pseudomonas, Streptomyces, and
Staphylococcus, although others may also be employed as a
matter of choice.
As a representative but nonlimiting example, useful
expression vectors for bacterial use can comprise a
selectable marker and bacterial origin of replication derived
from commercially available plasmids comprising genetic
elements of the well known cloning vector pBR322 (ATCC
37017). Such commercial vectors include, for example,
pKK223-3 (Pharmacia Fine Chemicals, Uppsala, Sweden) and G~M1
(Promega Biotec, Madison, WI, USA). These pBR322 "backbone"
sections are combined with an appropriate promoter and the
structural sequence to be expressed.
Following transformation of a suitable host strain and
growth of the host strain to an appropriate cell density, the
selected promoter is induced by appropriate means (e.g.,
temperature shift or chemical induction) and cells are
cultured for an additional period.
Cells are typically harvested by centrifugation,
disrupted by physical or chemical means, and the resulting
crude extract retained for further purification.
-18-
CA 02216912 1997-11-27
W O 96/39437 PCT/U~7S~7173
Microbial cells employed in expression of proteins can
be disrupted by any convenient method, including freeze-thaw
cycling, sonication, mechanical disruption, or use of cell
lysing agents, such methods are well know to those skilled in
the art.
Various m~mm~l ian cell culture systems can also be
employed to express recombinant protein. Examples of
--mm~lian expression systems include the COS-7 lines of
monkey kidney fibroblasts, described by Gluzman, Cell, 23:175
(1981), and other cell lines capable of expressing a
compatible vector, for example, the C127, 3T3, CH0, HeLa and
~3HK cell lines. ~ lian expression vectors will comprise
an origin of replication, a suitable promoter and Pnh~ncer,
and also any necessary ribosome hi n~i ng site~,
polyadenylation site, splice donor and acceptor sites,
transcriptional termination sequences, and 5~ fl~nking
nontran~cribed seguences. DNA sequences derived from the
SV40 splice, and polyadenylation sites may be used to provide
the required nontranscribed genetic elements.
The G-protein chemokine receptor polypeptides can be
recovered and purified from recombinant cell cultures by
methods including ammonium sulfate or ethanol precipitation,
acid extraction, anion or cation PYch~nge chromatography,
phosphocellulose chromatography, hydrophobic interaction
chromatography, affinity chromatography, hydroxylapatite
chromatography and lectin chromatography. Protein refolding
steps can be used, as necessary, in completing configuration
of the mature protein. Finally, high performance liquid
chromatography (HPLC) can be employed for final purification
~teps.
The polypeptides of the present invention may be a
naturally purified product, or a product of chemical
synthetic procedures, or produced by recombinan~ techniques
from a prokaryotic or eukaryotic host (for example, by
bacterial, yeast, higher plant, insect and m~m~lian cells in
-19 -
CA 02216912 1997-11-27
w096~9437 pcT~s9s/o7l73
culture). Depending upon the host employed in a recombinant
production procedure, the polypeptides of the present
invention may be glycosylated or may be non-glycosylated.
Polypeptides of the invention may also include an initial
methionine amino acid residue.
The polynucleotides and polypeptides of the present
invention may be employed as research reagents and materials
for discovery of treatments and diagnostics to human disease.
The G-protein chemokine receptors of the present
invent.ion may be employed in a process for screening for
compounds which activate (agonists) or inhibit activation
(antagonists) of the receptor polypeptide of the present
invention .
In general, such screening procedures involve providing
o~liate cells which express the receptor polypeptide of
the present invention on the surface thereof. Such cells
include cells from mammals, yeast, drosophila or E. Coli. In
particular, a polynucleotide Pnco~ing the receptor of the
present invention is employed to transfect cells to thereby
express the G-protein chemokine receptor. The expressed
receptor is then contacted with a test compound to observe
hin~ing, stimulation or inhibition of a functional response.
One such screening procedure involves the use of
melAnophore~ which are transfected to express the G-protein
chemokine receptor of the present invention. Such a
screening.technique is described in PCT WO 92/01810 published
~ebruary 6, 1992.
Thus, for example, such assay may be employed for
screening for a compound which inhihits activation of the
receptor polypeptide of the present invention by contacting
the melAnsrhore cells which encode the receptor with both the
receptor ligand and a compound to be screened. Inhibition of
the signal generated by the ligand indicates that a compound
is a potential antagonist for the receptor, i.e., inhibits
activation of the receptor.
-20-
CA 02216912 1997-11-27
W096~9437 PCT~S95/07173
The screen may be employed for determining a compound
which activates the receptor by contacting such cells with
compounds to be screened and determining whether such
compound generates a signal, i.e., activates the receptor.
Other screening techniques include the use of cells
which express the G-protein ch~mokine receptor (for example,
transfected CHO cells) in a system which measures
extracellular pH changes caused by receptor activation, for
example, as described in Science, volume 246, pages 181-296
(October 19~9). For example, c~--~ounds may be contacted with
a cell which expresses the receptor polypeptide of the
present invention and a second messenger response, e.g.
signal transduction or pH changes, may be measured to
determine whether the potential ~..~ound activates or
inhibits the receptor.
Another such screening technique involves intro~-lctng,
RNA encoding the G-protein chemokine receptor into xenopus
oocytes to transiently express the receptor. The receptor
oocytes may then be contacted with the receptor ligand and a
compound to be screened, followed by detection of inhibition
or activation of a calcium signal in the case of screening
for co~pounds which are thought to i nht hi t activation of the
receptor.
Another screening technique involves expressing the G-
protein chemokine receptor in which the receptor is linked to
a phospholipase C or D. As representative examples of such
cells, there may be mentioned endothelial cells, smooth
muscle cells, embryonic kidney cells, etc. The screening may
be accomplished as hereinabove described by detecting
activation of the receptor or inhibition of activation of the
receptor from the phospholipase second signal.
Another method involves screening for compounds which
inhibit activation of the receptor polypeptide of the present
invention antagonists by determining inhibition hinrltng of
labeled ligand to cells which have the receptor on the
CA 02216912 1997-11-27
O 96~9437 PCT/U',~0~173
surface thereof. Such a method involves transfecting a
eukaryotic cell with DNA encoding the G-protein chPmokine
receptor such that the cell expresses the receptor on its
surface and contacting the cell with a compound in the
presence of a labeled form of a known ligand. The ligand can
be labeled, e.g., by radioactivity. The amount of labeled
ligand bound to the receptors is measured, e.g., by measuring
radioactivity of the receptors. Tf the compound binds to the
receptor as determined by a reduction of labeled ligand which
binds to the receptors, the binding of labeled ligand to the
receptor is inh; h; ted.
An antibody may antagonize a G-protein ch~m~kine
receptor of the present invention, or in some cases an
oligopeptide, which bind to the G-protein chemokine receptor
but does not elicit a second messenger response such that the
activity of the G-protein ~hP~okine receptors is prevented.
Antibodies include anti-idiotypic antibodies which recognize
unique determinants generally associated with the antigen-
hin~ing gite of an antibody. Potential antagonist compounds
also include proteins which are closely related to the ligand
of the G-protein chPmokine receptors, i.e. a fragment of the
ligand, which have lost biological function and when binding
to the G-protein chemokine receptor elicit no response.
An antisense construct prepared through the use of
antisense technology, may be used to control gene expression
through triple-helix formation or antisense DNA or RNA, both
of which methods are based on hin~ing of a polynucleotide to
DNA or RNA. For example, the 5~ coding portion of the
polynucleotide sequence, which encodes for the mature
polypeptides of the present invention, is used to design an
antisen~e RNA oligonucleotide of from about 10 to 40 base
pairs in length. A DNA oligonucleotide is designed to be
complementary to a region of the gene involved in
transcription (triple helix -see Lee et al., Nucl. Acids
Res., 6:3073 (1979); Cooney et al, Science, 241:456 (1988);
CA 02216912 1997-11-27
W096~9437
PCT~S95/07173
and Dervan et al., Science, 251: 1360 (1991)), tnereby
preventing transcription and the production of G-protein
chemokine receptor. The antisense RNA oligonucleotide
hybridizes to the mRNA in vi~o and blocks translation of mRN~
molecules into G-protein coupled receptor (antisense - Okano,
J. Neurochem., 56:560 (1991); Oligodeoxynucleotides as
Antisense Inhibitors of Gene Bxpression, CRC Press, Boca
Raton, FL (1988)). The oligonucleotides described above can
also be delivered to cells such that the antisense RNA or DNA
may be expressed in vi~o to inhibit production of G-protein
rhPm~kine receptor.
A small molecule which binds to the G-protein chemokine
receptor, making it inaccessible to ligands such that normal
biological activity is ~Leve~lted, for example small peptides
or peptide-like molecules, may also be used to inh; h~ t
activation of the receptor polypeptide of the present
invention.
A soluble form of the G-protein chemokine receptor, e.g.
a fragment of the receptors, may be used to inh;hit
activation of the receptor by h~ nrling to the ligand to a
polypeptide of the present invention and preventing the
ligand from interacting with membrane bound G-protein
chemokine receptors.
The compounds which bind to and activate the G-protein
rh~m~kine receptors of the present invention may be employed
to stimul~te haematopoiesis, wound healing, coagulation,
angiogenesis, to treat solid tumors, chronic infections,
leukemia, T-cell mediated auto-immNne diseases, parasitic
infections, psoriasis, and to stimulate growth factor
activity.
The compounds which bind to and inhibit the G-protein
chemokine receptors of the present invention may be employed
to treat allergy, atherogenesis, anaphylaxis, malignancy,
chronic and acute inflammation, hist~ine and IgE-mediated
allergic reactions, prostaglandin-independent fever, bone
CA 02216912 1997-11-27
w096~9437 PCT~S95/07173
marrow failure, silicosis, sarcoidosis, rheumatoid arth_itis,
shock and hyper-eosinophilic syndrome.
The compounds may be employed in co~hin~tion with a
suitable pharmaceutical carrier. Such compositions comprise
a therapeutically effective amount of the compound and a
pharmaceutically acceptable carrier or excipient. Such a
carrier includes but is not limited to saline, buffered
saline, dextrose, water, glycerol, ethanol, and combinations
thereof. The formulation should suit the mode of
j ni stration-
The invention also provides a pharmaceutical pack or kitcomprising one or more cont~iners filled with one or more of
the ingredients of the pharmaceutical compositions of the
invention. Associated with such csnt~iner~s) can be a notice
in the form prescribed by a governmental agency regulating
the manufacture, use or sale of pharmaceuticals or biological
products, which notice reflects approval by the agency of
manufacture, use or sale for human administration. In
addition, the compounds of the present invention may be
employed in conjunction with other therapeutic compounds.
The pharmaceutical compositions may be ~*mj ni stered in
a co.~v~ient ~-nner such as by the topical, inL a~ous,
intraperiton~al, intramuscular, subcutaneous, intranasal or
intradermal (applicable?) routes. The pharmaceutical
compositions are ~ministered in an amount which is effective
for treating and/or prophylaxis of the specific indication.
In general, the pharmaceutical compositions will be
~i ni stered in an amount of at least about lO ~g/kg body
weight and in most cases they will be ~ini stered in an
amount not in excess of about 8 mg/~g body weight per day.
In most cases, the dosage is from about lO ~g/kg to about l
mg/kg body weight daily, taking into account the routes of
stration, symptoms, etc. (CONFIR~ nOS~S)
The G-protein rh~mokine receptor polypeptides and
antagonists or agonists which are polypeptides, may also be
-24-
CA 02216912 1997-11-27
W096~9437
PCT~Sss/07173
employed in accordance with the present invention by
expression of such polypeptides in vivo, which is often
referred to as "gene therapy.~
Thus, for example, cells from a patient may be
engineered with a polynucleotide ~DNA or RNA) encoding a
polypeptide ex vivo, with the engineered cells then being
provided to a patient to be treated with the polypeptide.
Such methods are well-known in the art. For example, cells
may be engineered by procedures known in the art by use of a
retroviral particle cont~inin~ RNA encoding a polypeptide of
the present invention.
Similarly, cells may be engineered in vivo for
expression of a polypeptide in vivo by, for example,
procedures known in the art. As known in the art, a producer
cell for producing a retroviral particle cont~inin~ RNA
PnC~Aing the polypeptide of the present invention may be
inistered to a patient for engineering cells in vivo and
expression of the polypeptide in vivo. These and other
methods for administering a polypeptide of the present
invention by such method should be apparent to those skilled
in the art from the teachings of the present invention. For
example, the expression vehicle for engineering cells may be
other than a retrovirus, for example, an adenovirus which may
be u~ed to engineer cells in vivo after combination with a
suitable delivery vehicle.
RetrQviruses from which the retroviral plasmid vectors
hereinabove mentioned may be derived include, but are not
limited to, Moloney Murine Leukemia Virus, spleen necrosis
virus, retroviruses such as Rous Sarcoma Virus, Harvey
Sarcoma Virus, avian leukosis virus, gibbon ape leukemia
virus, human im~ moAPficiency virus, adenoviru~,
Myeloproliferative Sarcoma Virus, and mammary tumor virus.
In one embodiment, the retroviral plasmid vector is derived
from Moloney Murine Leukemia Virus.
-25-
CA 02216912 1997-11-27
wos6~9437
PcT~ss5/07173
The vector includes one Qr more promoters. Suitable
promoters which may be employed include, but are not limited
to, the retroviral LTR; the SV40 promoter; and the human
cytomegalovirus (CMV) promoter described in Miller, et al.,
Biotechniques, Vol. 7, No. 9, 980-990 (1989), or any other
promoter (e.g., cellular promoters such as eukaryotic
cellular promoters including, but not limited to, the
histone, pol III, and ~-actin promoters). Other viral
promoters which may be employed include, but are not limited
to, adenovirus promoters, thymidine kinase (TK) promoters,
and B19 parvovirus promoters. The selection of a suitable
promoter will be apparent to those skilled in the art from
the teachings contained herein.
The nucleic acid sequence encoding the polypeptide of
the present invention is under the control of a suitable
promoter. Suitable promotcrs which may be employed include,
but are not limited to, adenoviral promoters, such as the
adenoviral major late promoter; or hetorologous promoters,
such as the cytomegalovirus (CMV) promoter; the respiratory
syncytial virus (RSV) promoter; inducible promoters, such as
the MMT promoter, the metallothionein promoter; heat shock
promoter~; the albumin promoter; the ApoAI promoter; human
globin promoters; viral thymidine kinase promoters, such as
the Herpe~ Simplex thymidine kinase promoter; retroviral LTRs
(including the modified retroviral LTRs hereinabove
described); the ~-actin promoter; and human growth hormone
promoters. The promoter also may be the native promoter
which controls the genes encoding the polypeptides.
The retroviral plasmid vector is employed to transduce
packaging cell lines to form producer cell lines. Examples
of packaging cells which may be transfected include, but are
not limited to, the PE501, PA317, ~-2, ~-AM, PA12, T19-14X,
VT-19-17-H2, ~CRE, ~CRIP, GP+E-~6, GP+envAml2, and DAN cell
lines as described in Miller, Human Gene Thera~Y, Vol. 1,
pgs. S-14 (1990), which is incorporated herein by reference
-26-
CA 02216912 1997-11-27
W096~9437 PCT~S95/07173
in its entirety. The vector may transduce the packaging
cells through any means known in the art. Such means
include, but are not limited to, electroporation, the use of
liposomes, and CaP04 precipitation. In one alternative, the
retroviral plasmid vector may be encapsulated into a
lipo~ome, or coupled to a lipid, and then ~ministered to a
host.
The producer cell line generates infectious retroviral
vector particles which include the nucleic acid sequence(s)
encoding the polypeptides. Such retroviral vector particles
then may be employed, to transduce eukaryotic cells, either
in vitro or in ~ivo. The transduced eukaryotic cells will
express the nucleic acid sequence(s~ encoding the
polypeptide. Eukaryotic cells which may be transduced
include, but are not limited to, embryonic stem cells,
embryonic carcinoma cells, as well as hematopoietic stem
cells, hepatocytes, fibroblasts, myoblasts, keratinocytes,
endothPliAl cells, and bronch;Al epithelial cells.
The present invention also provide~ a method for
determining whether a ligand not known to be cArAhle of
hi nrling to a G-protein chem~kine receptor can bind to such
receptor which comprises contacting a mammalian cell which
expre~se~ a G-protein chemokine receptor with the ligand
under conditions permitting hin~li ng of ligands to the G-
protein chemokine receptor, detecting the presence of a
ligand which binds to the receptor and thereby determining
whether the ligand binds to the G-protein chemokine receptor.
The systems herPin~hove described for determining agonist~
and/or antagonists may also be employed for determining
ligands which bind to the receptor.
This invention also provides a method of detecting
expression of a G-protein che~okine receptor polypeptide of
the present invention on the surface of a cell by detecting
the presence of mRNA coding for the receptor which comprises
obtAining total mRNA from the cell and contacting the mRNA so
-27-
CA 02216912 1997-11-27
w096~9437
PCT~S95/07173
obtained with a nucleic acid probe comprising a nucleic acid
molecule of at least 10 nucleotides capable of specifically
hybridizing with a sequence included within the sequence of
a nucleic acid molecule encoding the receptor under
hybridizing conditions, detecting the presence of mRNA
hybridized to the probe, and thereby detecting the expression
of the receptor by the cell.
The present invention also provides a method for
identifying receptors related to the receptor polypeptides of
the present invention. These related receptors may be
identified by homology to a G-protien che~okine receptor
polypeptide of the present invention, by low stringency cross
hybridization, or by identifying receptors that interact with
related natural or synthetic ligands and or elicit similar
behaviors after genetic or pharmacological blockade of the
chemokine receptor polypeptides of the present invention.
~ ragments of the genes may be used as a hybridization
probe for a cDNA library to isolate other genes which have a
high sequence similarity to the genes of the present
invention, or which have similar biological activity. Probes
of this type are at least 20 bases, preferably at least 30
ba~es and most preferably at least 50 bases or more. The
probe may also be used to identify a cDNA clone corresponding
to a full length transcript and a genomic clone or clones
that cont~ i n the complete gene of the present invention
including regulatory and promoter regions, exons and introns.
An example of a screen of this type cumprises isolating the
coding region of the gene by using the known DNA sequence to
synthesize an oligonucleotide probe. Labeled
oligonucleotides having a sequence complementary to that of
the gene~ of the present invention are used to screen a
library of human cDNA, genomic DNA or mRNA to determine which
members of the library the probe hybridizes to.
The present invention also contemplates the use of the
genes of the present invention as a diagnostic, for example,
-28-
CA 02216912 1997-11-27
W O 96~9437
PCTAUS95/07173
some diseases result from inherited defective genes. These
genes can be detected by comparing the sequences of the
defective gene with that of a normal one. Subsequently, one
can verify that a "mutant" gene is associated with abnormal
receptor activity. In addition, one can insert mutant
receptor genes into a suitable vector for expression in a
functional assay system (e.g., colorimetric assay, expression
on MacConkey plates, complementation experiments, in a
receptor deficient strain of HEK293 cells) as yet another
means to verify or identify mutations. Once "mutant" genes
have been identified, one can then screen population for
carriers of the "mutant" receptor gene.
Individuals carrying mutations in the gene of the
present invention may be detected at the DNA level by a
variety of techniques. Nucleic acids used for diagnosis may
be ob~ine~ from a patient's cells, including but not limited
to such as from blood, urine, saliva, tissue biopsy and
autopsy material. The genomic DNA may be used directly for
detection or may be amplified enzymatically by using PCR
~Saiki, et al., Nature, 324:163-166 1986) prior to analysis.
RNA or cDNA may al~o be used for the same purpose. As an
example, PCR primers complimentary to the nucleic acid of the
instant invention can be used to identify and analyze
mutations in the gene of the present invention. For example,
deletions and insertions can be detected by a change in size
of the amplified product in comparison to the normal
genotype. Point mutations can be identified by hybridizing
amplified DNA to radio labeled RNA of the invention or
alternatively, radio labeled antisense DNA sequences of the
invention. Perfectly matched sequences can be distinguished
from mismatched duplexes by RNase A digestion or by
differences in melting temperatures. Such a diagnostic would
be particularly useful for prenatal or even neonatal testing.
Sequence differences between the reference gene and
"mutants~ may be revealed by the direct DNA sequencing
-29-
CA 02216912 1997-11-27
W O 96~9437
PCT~S95/07173
method. In addition, cloned DNA se~ments may be used as
probes to detect specific DNA segments. The sensitivity of
this method is greatly enhanced when combined with PCR. For
example, a sequence primer is used with double stranded PCR
product or a single stranded template molecule generated by
a modified PCR. The sequence detenmination is performed by
conventional procedures with radio labeled nucleotide or b
an automatic se~1encing procedure with fluorescent-tags.
Genetic testing based on DNA sequence differences may be
achieved by detection of alterations in the electrophoretic
mobility of DNA fragments in gels with or without denaturing
agents. Sequences changes at specific locations may also be
revealed by nucleus protection assays, such RNase and S1
protection or the chemical cleavage method (e.g. Cotton, et
al., PNAS USA, 85:4397-4401 1985).
In addition, some diseases are a result of, or are
characterized by changes in gene expression which can be
detected by changes in the mRNA. Alternatively, the genes of
the present invention can be used as a reference to identify
individuals expressing a decrease of functions associated
with receptors of this type.
The present invention also relates to a diagnostic assay
for detecting altered levels of soluble forms of the G-proein
chemokine receptor polypeptides of the present invention in
various tissues. Assays used to detect levels of the soluble
receptor polypeptides in a sample derived from a host are
well known to those of skill in the art and include
radioi~nmo~says, competitive-hi n~i ng assays, Western blot
analysis and preferably as ELISA assay.
An ELISA assay initially comprises preparing an antibody
specific to antigens of the G-protein chemokine receptor
polypeptides, preferably a monoclonal antibody. In addition
a reporter antibody is prepared against the monoclonal
antibody. To the reporter antibody is attached a detectable
reagent such as radioactivity, fluorescence or in this
-30-
CA 02216912 1997-11-27
W096~9437
PCT~S95/07173
example a horseradish peroxidase enzyme. A sample is now
removed from a host and incubated on a solid support, e.g. a
polystyrene dish, that binds the proteins in the sample. Any
free protein binding sites on the dish are then covered by
incubating with a non-specific protein such as bovine serum
albumin. Next, the monoclonal antibody is incubated in the
dish during which time the monoclonal antibodies attach to
any G-protein ch~mokine receptor proteins attached to the
polystyrene dish. All unbound monoclonal antibody-is washed
ou' with bu~fer. The reporter antibody linked to horseradish
peroxidase is now placed in the dish resulting in binding of
the Le~o~Ler antibody to any monoclonal antibody bound to G-
protein chemokine receptor proteins. Unattached reporter
antibody is then washed out. Peroxidase substrates are then
added to the dish and the amount of color developed in a
given time period is a measu~...e-~t of the amount of G-protein
chemokine receptor proteins present in a given volume of
patient sample when compared against a st~n~rd curve.
The sequences of the present invention are also valuable
for chromosome identification. The sequence is specifically
targeted to and can hybridize with a particular location on
an individual human chromosome. Moreover, there is a current
need for identifying particular sites on the chromosome. Few
chromosome marking reagents based on actual sequence data
(repeat polymorphisms) are presently available for marking
chromosomal location. The mapping of DNAs to chromosomes
according to the present invention is an important first step
in correlating those sequences with genes associated with
disease.
Briefly, sequences can be mapped to chromosomes by
preparing PCR primers (preferably 15-25 bp) from the cDNA.
Computer analysis of the cDNA is used to rapidly select
primers that do not span more than one exon in the genomic
DN~, thus complicating the amplification process. These
primers are then used for PCR screening of somatic cell
CA 02216912 1997-11-27
W096~9437
PCT~S95/07173
hybrids containing individual human chromosomes. Only those
hybrids cont~ining the human gene corresponding to the primer
will yield an amplified fragment.
PCR mapping of somatic cell hybrids is a rapid procedure
for assigning a particular DNA to a particular chromosome.
Using the present invention with the same oligonucleotide
primers, sublocalization can be achieved with panels of
fragments from specific chromosomes or pools of large genomic
clones in an analogous ~Anner. Other mapping strategies that
can similarly be used to map to its chromosome include in
situ hybridization, prescreening with labeled flow-sorted
chromosomes and preselection by hybridization to construct
chromosome specific-cDNA libraries.
Fluorescence in situ hybridization (FISH) of a cDNA
clone to a metAphA~e chromosomal spread can be used to
provide a precise chromosomal location in one step. This
technique can be used with cDNA as short as 50 or 60 bases.
~or a review of this technique, see Verma et al., Human
rhromosomes: a ~mlAl of Basic Techniques, Pe~yd~ Press,
New York (1988).
Once a seguence has been mapped to a precise chromosomal
location, the physical position of the sequence on the
chromosome can be correlated with genetic map data. Such
data are found, for example, in V. McXusick, M~n~Plidn
Inheritance in Man (available on line through Johns Hopkins
University Welch Medical Library). The relationship between
genes and diseases that have been mapped to the same
chromosomal region are then identified through linkage
analysis (coinheritance of physically adjacent genes).
Next, it is necessary to determine the differences in
the cDNA or genomic sequence between affected and unaffected
individuals. If a mutation is observed in some or all of the
affected individuals but not in any normal individuals, then
the mutation is likely to be the causative agent of the
disease.
-32-
CA 02216912 1997-11-27
wo 96/39437
PCT/US95/07173
With current resolution of physical mapping and genetic
mapping techniques, a cDNA precisely localized to a
chromosomal region associated with the disease could be one
of between 50 and 500 potential causative cenes. (This
assumes 1 megabase mapping resolution and one gene per 20
kb).
The polypeptides, their fragments or other derivatives,
or analogs thereof, or cells expressing them can be used as
an immunogen to produce antibodies thereto. These antibodies
can be, for example, polyclonal or monoclonal antibodies.
The present invention also includes chimeric, single chain,
and hl-m-nized antibodies, as well as Fab fragments, or the
product of an Fab expression library. Various procedures
known in the art may be used for the production of such
antibodies and fragments.
Antibodies generated against the polypeptides
corresponding to a sequence of the present invention can be
obtained by direct injection of the polypeptides into an
animal or by ~inisterinc the polypeptides to an Ani~-l,
preferably a nonhuman. The antibody so obt~ine~l will then
bind the polypeptides itself. In this manner, even a
sequence encoding only a fragment of the polypeptides can be
used to generate antibodies hi n~li ng the whole native
polypeptides. Such antibodies can then be used to isolate
the polypeptide from tissue expressing that polypeptide.
For preparation of monoclonal antibodies, any technique
which provides antibodies produced by continuous cell line
cultures can be used. Examples include the hybridoma
technique (Kohler and Milstein, 1975, Nature, 256:495-497),
the trioma technique, the human B-cell hybridoma technique
(Rozbor et al., 1983, Immunology Today 4:72), and the ~BV-
hybridoma technique to produce human monoclonal antibodies
(Cole, et al., 1985, in Monoclonal Antibodies and Cancer
Therapy, Alan R. Liss, Inc., pp. 77-96).
CA 02216912 1997-11-27
W096~9437
PCT~S95/07173
Techniques described fo- the production of single chain
antibodies (U.S. Patent 4,946,778) can be adapted to produce
single chain antibodies to immllnogenic polypeptide products
of this invention. Also, trans-enic mice may be used to
express hl~m~nized antibodies tO iT"mlmogenic polypeptide
products of this invention.
The present invention will be further described with
reference to the following examples; however, it is to be
understood that the present invention is not limited to such
examples. All parts or amounts, unless otherwise specified,
are by weight.
In order to facilitate underst~n~ing of the following
examples certain frequently occur.ing methods and/or tenms
will be described.
"Plasmids~l are designated by a lower case p preceded
and/or followed by capital letters and/or numbers. The
starting plasmids herein are either commercially available,
publicly available on an unrestricted basis, or can be
constructed from available plasmids in accord with published
procedures. In addition, equivalent plasmids to those
described are known in the art and will be apparent to the
ordinarily skilled artisan.
"Digestion~ of DNA refers to catalytic cleavage of the
DNA with a restriction enzyme that acts only at certain
sequences in the DNA. The various restriction enzymes used
herein are commercially available and their reaction
conditions, cofactors and other requirements were used as
would be known to the ordinarily skilled artisan. For
analytical purposes, typically l ~g of plasmid or DNA
fragment is used with about 2 units of enzyme in about 20 ~l
of buffer solution. For the ~urpose of isolating DNA
fragments for plasmid construction, typically 5 to 50 ~g of
DNA are digested with 20 to 2sO units of enzyme in a larger
volume. Appropriate buffers and substrate amounts for
particular restriction enzymes are specified by the
-34-
CA 02216912 1997-11-27
w096~9437
PCT~Sgs/07173
manufacturer. Incubation times of about l hour at 37 C are
ordinarily used, but may vary in accordance with the
supplier's instructions. After digestion the reaction is
electrophoresed directly on a polyacrylamide gel to isolate
the desired fragment.
Size separation of the cleaved fragments is performed
using 8 percent polyacrylamide gel described by Goeddel, D.
et al ., Nucleic Acids Res., 8:4057 (1980).
"Oligonucleotides" refers to either a single stranded
polydeoxynucleotide or two complementary polydeoxynucleotide
strands which may be chemically synthesized. Such synthetic
oligonucleotides have no 5' phosphate and thus will not
ligate to another oligonucleotide without adding a phosphate
with an ATP in the presence of a kinase. A synthetic
oligonucleotide will ligate to a fragment that has not been
dephosphorylated.
"Ligation" refers to the process of forming
phosphodiester bonds between two double stranded nucleic acid
fragments (Maniatis, T., et al., Id., p. 146). Unless
otherwise provided, ligation may be accomplished using known
buffers and conditions with lO units to T4 DN~ liga~e
( n ligase") per 0.5 ~g of approximately equimolar amounts of
the DNA fragments to be ligated.
Unless otherwise stated, transformation was performed as
described in the method of Graham, F. and Van der Eb, A.,
Virology,.52:4S6-457 ~1973).
ExamDle 1
Bacterial ExPression and Purification of HDGNRlO
The DN~ sequence encoding for HDGNRlO, ATCC # _ is
initially amplified using PCR oligonucleotide primers
correspon~ing to the 5~ and sequences of the procesged
HDOENR10 protein (minus the signal peptide sequence) and the
vector sequences 3' to the HDGNRlO gene. Additional
nucleotides corresponding to HDGNRlO were added to the 5' and
3' sequences respectively. The 5l oligonucleotide primer has
-35-
CA 02216912 1997-11-27
W096/39437
PCT~S95/07173
the sequence 5' CGGAATTCCTCCATGGATT~TCAA~l~l~A 3' contains an
BcoRI restriction enzyme site followed by 18 nucleotides of
HDGNR10 coding sequence starting from the presumed terminal
amino acid of the processed protein codon. The 3' sequence
5' CGGAAGCTTCGTCACAAGCCCACAGATAT 3' contains complementary
sequences to c HindIII site and is followed by 18 nucleotides
of HDGNR10 coding sequence. The restriction enzyme sites
correspond to the restriction enzyme sites on the bacterial
expression vector pQE-9 (Qiagen, Inc. 9259 Eton Avenue,
Chat~worth, CA, 91311). pQE-9 encodes antibiotic resistance
(Ampr), a bacterial origin of replication (ori), an IPTG-
regulatable promoter operator (P/O), a ribosome bin~ing site
(~3S), a 6-His tag and restriction enzyme sites. pQE-9 was
then digested with EcoRI and HindIII. The amplified
sequences were ligated into pQE-9 and were inserted in frame
with the sequence encoding for the histidine tag and the
RBS. The ligation mixture was then used to transform E. coli
strain M15/rep 4 (Qiagen, Inc.) by the procedure described in
Sa,.~Look, J. et al., Molecular Cloning: A Laboratory ~nt~
Cold Spring Laboratory Press, (1989). M15/rep4 contains
multiple copies of the plasmid pREP4, which expresses the
lacI repressor and also confers kanamycin resistance (Kan').
Transformants are identified by their ability to grow on LB
plates and ampicillin/kanamycin resistant colonies were
selected. Plasmid DNA was isolated and confirmed by
restriction analysis. Clones containing the desired
constructs were grown Gvernight (0/N) in liquid culture in LB
media supplemented with both Amp (100 ug/ml) and Kan (25
ug/ml). The O/N culture is used to inoculate a large culture
at a ratio of 1:100 to 1:250. The cells were grown to an
optical density 600 (O.D.~) of between 0.4 and 0.6. IPTG
(nI~o~lo~yl-B-D-thiogalacto pyranoside") was then added to a
final concentration of 1 mM. IPTG induces by inactivating
the lacI repressor, clearing the ?/O leading tO increased
gene expression. Cells were grown an extra 3 to 4 hours.
-36-
CA 02216912 1997-11-27
W O 96/39437
PCTAUS95/07173
Cells were then harvested by centrifugation. The cell.pellet
was solubilized in the chaotropic agent 6 Molar Guanidine
HCl. After clarification, solubilized HDGNR10 was purified
from this solution by chromatography on a Nickel-Chelate
- column under conditions that allow for tight binding by
proteins cont~ining the 6-His tag. Hochuli, E. et al., J.
Chromatography 411:177-184 (1984). HDGNR10 was eluted from
the column in 6 molar guanidine HCl pH 5.0 and for the
purpose of renaturation adjusted to 3 molar guanidine HCl,
lOOmM sodium phosphate, 10 mmolar glutathione (reduced) and
2 mmolar glutathione (oxidized). After incubation in this
solution for 12 hours the protein was dialyzed to 10 mmolar
sodium phosphate.
~xample 2
ExDression of Recombinant HDGNR10 in COS cells
The expression of plasmid, HDGNR10 HA is derived from a
vector pcDNAI/Amp (Invitrogen) containing: 1) SV40 origin of
replication, 2) ampicillin resistance gene, 3) E.coli
replication origin, 4) CMV promoter followed by a polylinker
region, a S~40 intron and polyadenylation site. A DN~
fragment encoding the entire HDGNR10 precursor and a HA tag
fused in frame to its 3' end was cloned into the polylinker
region of the vector, therefore, the recom~inant protein
expression is directed under the CMV promoter. The HA tag
correspond to an epitope derived from the influenza
hemagglutinin protein as previously described (I. Wilson, H.
Niman, R. Heighten, A Cherenson, M. Connolly, and R. Lerner,
1984, Cell 37, 767). The infusion of HA tag to the target
protein allows easy detection of the reCom~nAnt protein with
an antibody that recognizes the HA epitope.
The plasmid construction strategy is described as
follows:
- The DNA sequence encoding fo- HDGNR10, ATCC # _ , was
constructed by PCR using two primers: the S' primer 5~ GTCC
.
-37-
CA 02216912 1997-11-27
W096~9437
PCT~S95/07173
AAGCTTGCCACCATG&ATTATCAAGTGTCA 3' and contains a HindIII site
followed by 18 nucleotides of HDGNR10 coding sequence
starting from the initiation codon; the 3' seguence 5'
CTAGCTCGAGTCAAGCGTA~~ A~ ATG~GTAGCACAAGCCCACAGATATTTC
3~ contains complementary sequences to an XhoI site,
translation stop codon, HA tag and the last 18 nucleotides of
the HDGNR10 coding sequence ~not including the stop codon).
Therefore, the PCR product contains a HindIII site HDGNR10
coding seguence followed by HA tag fused in frame, a
translation termination stop codon next to the HA tag, and an
XhoI site. The PCR amplified DNA fragment and the vector,
pcDNAItAmp, were digested with HindIII and XhoI restriction
enzyme and ligated. The ligation mixture was transfonmed
into E. coli strain SURE (available from Stratagene Cloning
Systems, 11099 North Torrey Pines Road, La Jolla, CA 92037)
the transformed culture was plated on ampicillin media
plates and resistant colonies were selected. Plasmid DNA was
isolated from transformants and ~mi ned by restriction
analysis for the presence of the correct fragment. ~or
expression of the recombinant HDGNR10, COS cells were
transfected with the expression vector by DBAE-DEXTRAN
method. (J. Sa,.L~ook, E. Fritsch, T. Maniatis, Molecular
Cloning: A Laboratory ~nl~l, Cold Spring Laboratory Pre~s,
(1989)). The expression of the HDGNR10 HA protein was
detected by radiolabelling and ~ noprecipitation method.
(E. Harlo~, D. Lane, Antibodies: A Laboratory ~nll~l, Cold
Spring Harbor Laboratory Press, (1988)). Cells were labelled
for 8 hours with 35S-cysteine two days post transfection.
Culture media were then collected and cells were lysed with
deteryent (RIPA buffer (150 ~M NaCl, 1% NP-40, 0.1% SDS, 1%
NP-40, 0.5% DOC, 50mM Tris, pH 7.5). (Wilson, I. et al., Id.
37:767 (1984)). Both cell lysate and culture media were
precipitated with a HA specific monoclonal antibody.
Proteins precipitated were analyzed on 15% SDS-PAGE gels.
-38-
CA 02216912 1997-11-27
W096/39437 PCT~S95/07173
Exam~le 3
Cloninq and ex~ression of HDGNR10 usinq the baculovirus
ex~ression s~stem
The DNA sequence encoding the full length HDGNR10
protein, ATCC # , was amplified using PCR
oligonucleotide primers corresponding to the 5' and 3'
sequences of the gene:
The 5' primer has the sequence 5' CGGGATCCCTCCATGGATTAT
CAA~l~l~A 3' and contains a BamHI restriction enzyme site
followed by 4 nucleotides resembling an efficient signal for
the initiation of translation in eukaryotic cells (J. Mol.
Biol. 1987, 196, 947-950, Kozak, M.), and just behind the
first 18 nucleotides of the HDGNR10 gene (the initiation
codon for translation is "ATG").
The 3' primer has the sequence 5' CGGGATCCCGCT
CACAAGCCCACAGATAT 3' and contains the cleavage site for the
restriction endonuclease BamHI and 18 nucleotides
complementary to the 3' non-translated sequence of the
HDGNR10 gene. The amplified sequences were isolated from a
1% agarose gel using a commercially available kit
(nGeneclean," BIO 101 Inc., La Jolla, Ca.). The fragment was
then digested with the ~n~Qnt~clease BamHI and purified as
described above. This fragment is designated F2.
The vector pRG1 (modification of pVL941 vector,
discussed below) is used for the expression of the HDGNR10
protein using the baculovirus expression system (for review
see: Summers, M.D. and Smith, G.E. 1987, A manual of methods
for baculovirus vectors and insect cell culture procedures,
Texas Agricultural Experimer.~al Station Bulletin No. 1555).
This expression vector contains the strong polyhedrin
promoter of the Autographa californica nuclear polyhedrosis
virus (AcMNPV) followed by the recognition sites for the
restriction en~m1clease BamHI. The polyadenylation site of
- the simian virus (S~)40 is used for efficient
polyadenylation. For an easy select~on of recombinant
-39-
CA 02216912 1997-11-27
w096~9437
PCT~Sss/07173
viruses the beta-galactosidase gene from E.coli is inserted
in the same orientation as the polyhedrin promoter followed
by the polyadenylation signal of the polyhedrin gene. The
polyhedrin sequences are flanked at both sides by viral
sequences for the cell-mediated homologous recombination of
co-transfected wild-type viral DNA. Many other baculovirus
vectors could be used in place of pRG1 such as pAc373, pVL941
and pAcIM1 (Luckow, V.A. and Summers, M.D., Virology, 170:31-
39).
The plasmid was digested with the restriction enzyme
BamHI and then ~erhosphorylated using calf intestinal
phosphatase by procedures known in the art. The DNA was then
isolated from a 1% agarose gel as described above. This
vector DNA is designated V2.
Fragment F2 and the dephosphorylated plasmid V2 were
ligated with T4 DNA ligase. E.coli HB101 cel~s were then
transfonmed and bacteria identified that contained the
plasmid (pBacHDGNR10) with the HDGNR10 gene using the enzyme
BamHI. The sequence of the cloned fragment was confirmed by
DNA sequencing.
S ~g of the plasmid pBacHDGNR10 were co-transfected with
1.0 ~g of a commercially available linearized baculovirus
("BaculoGold~ baculovirus DNA", Pharmingen, San Diego, CA.)
using the lipofection method (Felgner et al. Proc. Natl.
Acad. Sci. USA, 84:7413-7417 (1987)).
l~g of BaculoGold~ virus DNA and S ~g of the plasmid
pBacHDGNR10 were mixed in a sterile well of a microtiter
plate contAining 50 ~l of serum free Grace~s medium (Life
Technologies Inc., Gaithersburg, MD). Afterwards 10 ~l
Lipofectin plus 90 ~l Grace's mediu~ were added, mixed and
incubated for 15 minutes at room _emperature. Then the
transfection mixture was added drop wise to the Sf9 insect
cells (ATCC CRL 1711) seeded in a 35 mm tissue culture plate
with 1 ml Grace~ medium without serum. The plate was rocked
back and forth to mix the newly added solution. The plate
-40-
CA 02216912 1997-11-27
W096/39437 PCT~S95/07173
was then incubated for 5 hours at 27~C. After 5 hours the
transfection solution was removed from the plate and l ml of
Grace's insect medium supplemented with 10% fetal calf serum
was added. The plate was put back into an incu~ator and
cultivation continued at 27~C for four days.
After four days the supernatant was collected and a
plaque assay performed similar as described by Summers and
Smith (supra). As a modification an agarose gel with "Blue
Gal" (Life Technologies Inc., Gai'hersburg) was used which
allows an easy isolation of blue stained plaques. (A
detailed description of a "plaque assay" can also be found in
the user~s guide for insect cell culture and baculovirology
distributed by Life Technologies Inc., Gaithersburg, page 9-
10) .
Four days after the serial dilution, the viruses were
added to the cells, blue stained plaques were picked with the
tip of an Eppendorf pipette. The agar cont~ining the
recombinant viruses was then resuspended in an Eppendorf tube
cont~ining 200 ~l of Grace's medium. The agar was removed by
a brief centrifugation and the supernatant containing the
recombinant baculoviruses was used to infect Sf9 cells seeded
in 35 mm dishes. Four days later the supernatants of the~e
culture dishes were harvested and then stored at 4~C.
Sf9 cells were grown in Grace's medium supplemented with
10% heat-inactivated F8S. The cells were infected with the
recombinant baculovirus V-HDGNRl0 at a multiplicity of
infection (MOI) of 2. Six hours later the medium was removed
and replaced with SF900 II medium minus methionine and
cy~teine (Life Technologies Inc., Gaithersburg). 42 hours
later 5 ~Ci of 35S-methionine and 5 ~Ci 35S cysteine (Amersham)
were added. The cells were further incubated for 16 hours
before they were harvested by centrifugation and the labelled
proteins visualized by SDS-PAGE and autoradiography.
Example 4
--~1--
CA 02216912 1997-11-27
W O 96~9437
PCT/U~,S/~7173
Ex~ression via Gene TherapY
Fibroblasts are obtained from a subject by skin biopsy.
The resulting tissue is placed in tissue-culture medium and
separated into small pieces. Small chunks of the tissue are
placed on a wet surface of a tissue culture flask,
approximately ten pieces are placed in each flask. The flask
is turned upside down, closed tight and left at room
temperature over night. After 24 hours at room temperature,
the flask is inverted and the chunks of tissue remain fixed
to the bottom of the flask and fresh media (e.g., Ham's F12
media, with 10% FBS, penicillin and streptomycin, is added.
This is then incubated at 37~C for approximately one week.
At this time, fresh media is added and subsequently changed
every several days. After an additional two weeks in
culture, a monolayer of fibroblasts emerge. The monolayer is
trypsinized and scaled into larger flasks.
pMV-7 (Kirschmeier, P.T. et al, DNA, 7:219-25 (1988)
flanked by the long terminal repeats of the Moloney murine
sarcoma virus, is digested with EcoRI and HindIII and
subsequently treated with calf intestinal phosphatase. The
linear vector is fractionated on agarose gel and purified,
using glass beads.
The cDNA encoding a polypeptide of the present invention
is amplified using PCR primers which correspond to the 5' and
3' end sequences respectively. The 5' primer ccntains an
EcoRI site. and the 3' primer contains a HindIII site. Equal
quantities of the Moloney murine sarcoma virus linear
backbone and the EcoRI and HindIII fragment are added
together, in the presence of T4 DNA ligase. The resulting
mixture is maintained under conditior.s appropriate for
ligation of the two fragments. The ligation mixture is used
to transform bacteria B 101, which are then plated onto agar-
containing kanamycin for the purpose of confirming that the
vector had the gene of interest properly inserted.
-42-
CA 02216912 1997-11-27
w096~9437
PCT~S95/07173
The amphotropic pA317 or GP+aml2 packaging cells are
grown in tissue culture to confluent density in Dulbecco's
Modified Eagles Medium (DMEM) with 10% calf serum (CS),
penicillin and streptomycin. The MSV vector cont~ining the
gene is then added to the media and the packaging cells are
transduced with the vector. The packaging cells now produce
infectious viral particles cont~ining the gene (the packaging
cells are now referred to as producer cells).
Fresh media is added to the transduced producer cells,
and subsequently, the media is harvested from a 10 cm plate
of confluent producer cells. The spent media, containing the
infectious viral particles, is filtered through a millipore
filter to remove detached producer cells and this media is
then used to infect fibroblas~ cells. Media is removed from
a sub-confluent plate of fibroblasts and quickly replaced
with the media from the producer cells. This media is
removed and replaced with fresh media. If the titer of virus
is high, then virtually all fibroblasts will be infected and
no selection is required. If the titer is very low, then it
is necessary to use a retroviral vector that has a selectable
marker, such as neo or his.
The engineered fibroblasts are then injec~ed into the
host, either alone or after having been grown to confluence
on cytodex 3 microcarrier beads. The fibroblasts now produce
the protein product.
Numerous modifications and variations of the present
invention are possible in light of the above teachings and,
therefore, within the scope of the appended claims, the
invention may be practiced otherwise than as particularly
described.
-43-
CA 02216912 1997-11-27
W096~9437
PCT~S95/07173
SEQUENCE LISTING
(l) GENERAL INFORMATION:
(i) APPLICANT: Li, ET AL.
(ii) TITLE OF INv~NllON: Human G-Protein Chemokine
Receptor
(iii) NUMBER OF SEQUENCES:
(iv) CORRESPONDENCE ADDRESS:
(A) ADDRESSEE: CARELLA, BYRNE, BAIN, GILFILLAN,
CECCHI, STEWART & OLSTEIN
(B) STREET: 6 BECKER FARM ROAD
(C) CITY: ROSELAND
(D) STATE: NEW JERSEY
(E) C'OUN1KY: USA
(F) ZIP: 07Go8
(v) CO~U1~K READABLE rOR~i:
(A) MEDIUM TYPE: 3.5 INCH DISKETTE
(B) COM~ul~;K: IBM PS/2
(C) OPERATING SYSTEM: MS-DOS
(D) SOFTWARE: ~-ORD PE~F~CT 5.l
(vi) CURRENT APPLICATION DATA:
(A) APPLICATION NUMBER:
(B) FILING DATE: concurrently
(C) CLASSIFICATION:
(vii) ATTORNEY/AGh~T INFORMATION:
(A) NAME: FERRA~G, GREGORY D.
~B) REGISTRATION NUMBER: 36,134
(C) REFE~REN OE /DûCXET ~JMBER: 325800-
(viii) TELECOMMUNICATION INFORMATION:
(A) TELhPHONE: 20~-994-1700
(B) TELEFAX: 201-394-1744
(2) INFORMATION FOR SEQ ID NO:l:
(i) SEQUENCr. CHARACTEP~ISI'I.S
(A) LENC:TH: 1414 BA~;E ~AIRS
(B) TY~E: NUCLEIC ACIB
(C) STRANDEDNESS: SINGLE
(~) TO~OLOGY: LINEAR
(ii) MOLECULr. TYPE: ~DNA
(xi) SEQUEN-E DESCRIPTION SrQ ,D NO:l:
GTGAGATGG. GCTTTCATGA A~TCCC:CI~. ~A~GAGCC~A GCTCTCCATC TAG-GGACAG 60
-44-
CA 02216912 1997-11-27
W O 96/39437
PCTAUS9S/07173
GGAAGCTAGC AGCAAACCTT CC~ ~ACTA CGAAACTTCA TTG-TTGGCC CAAAAGAGAG 120
TTAATTCAAT GTAGACATCT ATGTAGGCAA TTAAAAACCT ATTGATGTAT AAAPr~5 m 130
GCATTCATGG AGGGCAACTA AATACATTCT AGGAC'ATTAT AAAAGATCAC TTTTTATTTA 240~GCACAGGGT GGAACAAG ATG GAT TAT CAA GTG TCA AGT CCA ATC TAT GAC 291
Met Asp Tyr Gln Val Ser Ser Pro Ile Tyr Asp
ATC AAT TAT TAT ACA TCG GAG CCC TGC CCA AAA ATC AAT GTG AAG CAA 339
Ile Asn Tyr Tyr Thr Ser Glu Pro Cys Pro Lys Ile Asn Val Lys Gln
ATC GCA GCC CGC CTC CTG CCT CCG CTC TAC TCA CTG GTG -TC ATC TT, 387
Ile Ala Ala Arg Leu Leu Pro Pro Leu Tyr Ser Leu Val Phe Ile Phe
GGT TTT GTG GGC AAC ATG CTG GTC ATC CTC ATC CTG ATA AAC TGC CAA 435
Gly Phe Val Gly Asn Met Leu Val I1E Leu Ile Leu Iie Asn Cys Gln
AGG CTG GAG AGC ATG ACT GAC ATC TAC CTG CTC AAC CTG GCC ATC TCT 483
Arg Leu Glu Ser Met Thr Asp I~e Tyr Leu Leu Asn Leu Ala Ile Ser
GAC CTG TTT TTC CTT CTT ACT GTC CCC TTC TGG GCT CAC TAT GCT GCC 531
Asp Leu Phe Phe Leu Leu Thr Vai Pro Phe Trp Ala His ~yr Ala Ala
GCC CAG TGG GAC TTT GGA AAT ACA ATG rrGT CAA CTC TTG ACA GGG CTC 579Ala Gln Trp Asp Phe Gly Asn Thr Met Cys Leu Leu Thr Gly Leu Tyr
TAT TTT ATA GGC TTC TTC TCT GGA ATC TTC TTC ATC ATC CTC CTG ACA 627
Phe Ile Gly Phe Phe Ser Gly Ile Phe Phe Ile Ile Gln Leu Leu Thr
ATC GAT AGG TAC CTG GCT ATC GTC CAT GCT GTG TTT GCT TTA AAA GCC 675
Ile Asp Arg Tyr Leu Ala Ile Val H_s Ala Val Phe Ala Leu Lys Ala
AGG ACG GTC ACC r~-l GGG GTG GTG ACA AGT GTG ATC ACT ''GG GTG GTG 723
Arg Thr VaL Thr Phe Gly Val Val Thr Ser Val Ile Thr Trp Val Val
GCT GTG TTT GCG ' CT CTC CCA GGA ATC ATC TTT ACC AGA TCT CAA AAA 771Ala Val Phe Ala Ser Leu Pro Gly Ile Ile Phe Tnr Arg Ser Gln Lys
GAA GGT CTT CAT TAC ACC TGC AGC TCT CAT T~T CCA TAC AGT CAG TAT 819
Glu Gly Leu His Tyr Thr cys Ser Ser His Phe Pro I~r Ser Gln Tyr
CAA TTC TGG AAG AAT TTC CAG ACA TT~ AAG A-.A G.C ATC '..G GGG CTG 867
Gln Phe Trp Lys Asn Phe Gln Thr ~eu Lys i_e Val ,ie Leu Gly Leu
GTC CTG CCG,CTG CTT GTC ATG G.C A._ TGC TA- TCG GGA ATC CTA AAA 915
Val Leu Pro Leu Leu Val Met Val ,ie Cys Tyr Ser Giy Ile Leu Lys
ACT CTG CTT CGG TGT CGA AAT ~A~ AAC- AAG AGG CAC AGG GC'. GT~ AGG 963
Thr Leu Leu Arg Cys Arg Asn G;u Lys Lys Arg H1s Arg Ala Val Arg
CTT ATC TTC ACC ATC ATG A-T G'~T T~'.' 1-1-. C'~C TTC 'GG GCT CCC TAC 1011
Leu Ile Phe Thr Ile Met Iie Val '.~r Phe ~eu ~he .:-p Ala Pro Tyr
AAC ATT GTC CTT CTC CTG AAC ACC TTC ~AG ~A TTC L~ GGC CTG AAT lOS9
Asn Ile Val Leu Leu Leu Asn Tnr 2ne Gln G-u Pne Phe Gly Leu Asn
AAT TGC AGT AGC ''CT AAC AGG TTG G~C CAA G~ ATG Gi~G GTG ACA GAG 1107
Asn Cys Ser Ser Ser Asn Arg Leu ~sF G~n A~a Met Gin Val Thr Glu
ACT CTT GGG ATG ACG CAC TGC TGC A" C AAC C;'C ATC ATC TA'; GCC TTT 1155
Thr Leu Gly Met Thr His Cys Cy5 I_e Asn ~ro Iie lle I~r Ala Phe
-45-
CA 022l69l2 l997-ll-27
W O 96/39437
PCTAUS95/07173
GTC GGG GAG AAG ~C AGA AAC TAC CTC TTA GTC TTC TTC CAA AAG CAC . 1203
Val Gly Glu Lys Phe Arg Asn Tyr Leu Leu Val Phe Phe Gln Lys Hls
ATT GCC AAA CGC TTC TGC AAA TGC TGT TCT ATT TTC CAG CAA GAG GCT 1251
Ile Ala Lys Arg Phe Cys Lys Cys Cys Ser Ile Phe Gin Gln Glu ~la
CCC GAG CGA GCA AGC TCA G~T TAC ACC CGA TCC ACT GGG GAG CAG GAA 1299
Pro Glu Arg Ala Ser Ser Val Tyr Thr Arg Ser Thr Gly Glu Gln Glu
ATA TCT GTG GGC TT5 TGACAC5GAC TCAAGTGGGC TGGTGACCCA GTCAGAGTTG 1354
Ile Ser Val Gly Leu
TGCACATGGC TTAGl~ l~A TACACAGCC~ GGG~-lGG5GG l~GGGl~GAA GAG~l--l-l-~-l 1414
(2) INFORMATION FOR SEQ ID NO:2:
(i) S~Qu~CE CHARACTERISTICS
(A) LENGTH: AMINO ACIDS
~L) TYPE: AMINO ACID
(C) STRANDEDNESS:
(D) TOPOLOGY: LINEAR
(ii) MOLECULE TYPE: EROTEIN
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:2:
~et Asp Tyr Gln Val Ser Ser Pro Ile Tyr Asp Ile Asn Tyr Tyr
15~hr Ser Glu Pro Cys Pro Lys Ile Asn Val Lys Gln Ile Ala Ala
30~rg Leu Leu Ero Pro Leu Tyr Ser Leu Val Phe Ile Phe Gly Phe
45~al Gly Asn Met Leu Val Ile Leu Ile Leu Ile Asn Cys Gln Arg
60~eu Glu Ser Met Thr Asp Ile Tyr Leu Leu Asn Leu Ala Ile Ser
75~fip Leu Phe Phe Leu Leu .hr Val Pro Phe Trp Ala His Tyr Ala
90~la Ala Gln Trp Asp Pne Gly Asn Thr Met Cys Leu Leu Thr Gly
100 105~eu Tyr Phe Ile Gly Pne Phe Ser Gly Ile Phe Phe Ile Ile Gln
110 11~ 120~eu Leu Thr Ile Asp Arg ~yr ~eu Ala Ile Val ~is Ala Val Phe
125 13C 135~la Leu Lys Ala Arg Thr Val '.h-; Phe Gly Val Val Thr Ser Val
140 14, 150~le Thr Trp Val Val Ala Val Phe ~la Ser Le~ Pro Gly Ile Ile
155 160 165~he Thr Arg Ser Gln Lys G.u Gly Leu Xis Tyr Thr cys Ser Ser
170 1/5 180~is Phe Pro Tyr Ser Gln Tyr Gln Phe Tr~ Lys ~sn Phe Gln Thr
185 l9C 195~eu Lys lle Val Ile LeL Gly Le-~ Val Le-~ Pro Leu Le~ Val Met
2~G 2G5 210
-4~-
CA 02216912 1997-11-27
WO 96/39437
PCT/US95/07173
al Ile Cys Tyr Ser Gly Ile Leu Lys Thr Leu Leu Arg Cys Arg
215 220 225
~sn Glu Lys Lys Arg His Arg Ala Val Arg Leu Ile Phe Thr Ile
230 235 240
~et Ile Val Tyr Phe Leu Phe Trp Ala Pro Tyr Asn Ile Val Leu
245 250 255
~eu Leu Asn Thr Phe Gln Glu Phe Phe Gly Leu Asn Asn Cys Ser
260 265 270
~er Ser Asn Arg Leu Asp Gln Ala Met Gln Val Thr Glu Thr Leu
275 280 285
~ly Met Thr His Cys Cys I;e Asn Pro Ile Ile Tyr Ala Phe Val
290 295 300
~ly Glu Lys Phe Arg Asn Tyr Leu Leu Val Phe Phe Gln Lys His
305 310 315
~le Ala Lys Arg Phe Cys Lys C~ys Cys Ser Ile Phe Gln Gln Glu
32~ 3,-5 330
~la Pro Glu Arg Ala Ser Ser Jal Tyr rh~~ Arg Ser Thr Gly Glu
335 340 345
~ln Glu Ile Ser Val Gly Leu
350
