Note : Les descriptions sont présentées dans la langue officielle dans laquelle elles ont été soumises.
CA 02244800 1998-07-31
W O 97/29771 PCT~B97/00183
IMMUNOGENIC DETOXIFIED MUTANTS OF CHOLERA TOXIN
~ Field of the invention
~ 5 The present invention relates to immunogenic detoxified
proteins of cholera toxin (CT) wherein at least one amino
acid is su~stituted with another amino acid with the result
that, in purified form, the immunogenic detoxified protein
exhibits a residual toxicity greater than 10000 fold lower
than its naturally occuring counterpart and to their use in
vaccines which are useful for the prevention or treatment of
cholera and as mucosal adjuvants for other immunogenic
proteins. The detoxified i~munogenic proteins can be
suitably produced using recombinant DNA techniques by site-
directed mutagenesis of DNA encoding the wild type toxins.
Backqround to the Invention
Cholera is a con~agious disease widely distributed in the
world, in particular in the Third World, where, in certainareas, it is endemic. The serious disorders which develop in
the intestinal system prove fatal in a high percentage of
the recorded cases of the disease.
The etiological agent of cholera is the Gram-negative
microorganism Vibrlo cholerae (V. cholerae) . This colonises
the intestinal tract of individuals who have come into
contact with it through ingestion of contaminated food or
water, and multiplies to very high concentrations. The
principal symptom is severe diarrhoea as a result of which
the patient can lose as much as 10-15 litres of liquids per
day via the faeces. As a result of the severe dehydration
and loss of electrolytes, the patient does not withstand the
infection in 50-60% of cases, and dies. The diarrhoea caused
by V. cholerae is due to the secretion of cholera toxin, CT,
which acts by stimulating the activity of the adenylate
cyclase enzyme so as to induce disturbances at cell level.
CA 02244800 1998-07-31
W O97/29771 PCT~B97/00183
Although cholera can be effectively cured by controlled and
intense rehydration, the distribution of a vaccine is
desirable with a view to complete control and future
eradication of the disease.
At the present time, there exists a vaccination against
cholera, consisting of parenteral administration of killed
bacteria. Although some countries insist on vaccination
against the disease, there are serious doubts as to its real
usefulness, given that the current cellular vaccine protects
against the consequences of the infection in only 50% of the
cases and that the protection is also extremely limited in
duration, to less than 6 months.
In Bangladesh, an experimental trial is in progress ~1990-
92) of an oral vaccine consisting of ~illed bacteria with
the addition of subunit B of cholera toxin, which is known
to be highly immunogenic. This product succeeds in inducing
lasting protection, without special side effects (Holmgren
J., Clemens J., Sack DA., Sanchez J. and Svennerholm AM;
"Oral Immunization against cholera" Curr. Top. Microbiol.
Immunol. (1988), 146, 197-204).
The CT toxin comprises a single A subunit (or protomer A)
responsible for the enzymic activity of the toxin (herein
CT-A) and five identical B subunits (or protomer B) which
are involved in the binding of the toxin to the intestinal
epithelial cells (herein CT-B).
The A subunit penetrates the cell membrane and causes
activation of adenylate cyclase by NAD-dependent ADP-
ribosylation of a GTP-binding protein which controls the
activity of the enzyme. The clinical effect of this is to
cause massive fluid loss into the intestine.
Considerable research has been conducted on cholera toxin.
Its sequence is known and has been described (Mekalanos J.J.
et al Nature 306, page 551 (1983)).
CA 02244800 1998-07-31
W O97/29771 PCTAB97/00183
In view of the potential clinical significance of vaccines
~ ~ against cholera there is a continuing and great interest in
producing a detoxified toxin capable of immunising against
cholera. The techniques of genetic engineering allow
specific mutations to be introduced into the genes encoding
the toxins and the production of the mutated toxins using
now conventional techniques of gene expression and protein
purification.
Kaslow, H.R. et al (Abstract B291 of the 92nd General
Meeting of the American Society for Microbiology, 26-30th
May 1992) describe mutating Asp-9 and ~is-44 and truncating
after amino acid 180 in CT-A which all essentially eliminate
activity. Mutating Arg-9 is said to markedly attenuate
activity. Mutating other amino acid sites had little effect
on toxicity.
Burnette, W.N. et al (Inf. and Immun. 59fll), 4266-4270,
(1991)) describe site-specific mutagenesis of cT-A to
produce an Arg-7-Lys mutation paralleling that of a known
detoxifying mutation in the A subunit of the Bordetella
pertussis toxin. The mutation resulted in the complete
abolition of detectable ADP-ribosyltransferase actLvity.
.
International patent application WO 92/19265 (Burnette,
Kaslow and Amgen Inc.) describes mutations of CT-A at Arg-7,
Asp-9, Arg-ll, His-44, His-70 and Glu-112.
A mutations at Glu-110 has also been described in the
literature (Lobet, Inf. Immun., 2870, l991; Lai, Biochem.
Biophys. Res. Comm. 341 1983; Okamoto J. Bacteriol. 2208,
1988).
It is known that the development of toxicity of the A
subunits of CT requires proteolytic cleavage of A1 and A2
subunits at around amino acid Arg-ls2 (Grant et a7 Inf. &
Immun. (1994) 62(10) 4270-4278).
CA 02244800 1998-07-31
W O97/29771 PCT~B97/00183
Immunogenic detoxified proteins comprising the amino acid
~ ~ sequence of subunit A of a cholera toxin or a fragment
thereof, wherein one or more amino acids at, or in positions
corresponding to Val-53, Ser-63, Val-97, Tyr-104 or Pro-106
are replaced with another amino acid are disclosed in WO
93/13202 (Biocine Sclavo SpA). Optionally the amino acid
sequence may include other mutations such as, for example,
substitutions at one or more of Arg-7, Asp-9, Arg-11, His-
44, Arg-54, Ser-61, His-70, His-107, Glu-110, Glu-112, Ser-
114, Trp-127, Arg-146 or Arg-192. These mutations are
described as ~eing completely detoxified as measured by the
assays described.
A double mutant comprising the amino acid sequence of CT-A
or a fragment thereof is described in UK patent application
9513371.6 (filed 30th June 1995) wherein the amino acids at,
or in positions corresponding to, Ser-63 and Arg-192 are
replaced with another amino acid.
Detoxified mutants of pertussis toxin have been reported to
be useful both for direct intranasal vaccination and as a
mucosal adjuvant for other vaccines (Roberts et al Inf. &
Immun. (1995) 63(6) 2100-2108). Published International
patent application WO 95/17211 (Biocine SpA) describes the
use of detoxified mutants of CT as mucosal adjuvants.
SummarY of the invention
We have discovered that a residual low level of toxicity
provides an improved altered CT for use in a vaccine and/or
a mucosal adjuvant.
Although detoxified in the sense of having a much lower
toxicity than the wild-type protein, these proteins retain
traces of enzymatic activity. The mutation causes a
decrease of in vivo toxicity of at least lOOOO fold and this
makes the protein very useful for human use. In addition to
the immunological and adjuvant properties typical of mutants
CA 02244800 1998-07-31
W O 97/29771 PCTnB97/00183
devoid of enzymatic activity, the mutant protein
surprisingly exhibits an increase in adjuvant activity.
According the present invention, there is provided an
immunogenic detoxified protein comprising the amino acid
sequence of subunit A of a cholera toxin (CT-A) or a
fragment thereof wherein at least one amino acid is
substituted with another amino acid characterised in that,
in purified form, the immunogenic detoxified protein
exhibits a residual toxicity greater than 10000 fold lower
than its naturally occuring counterpart.
The immunogenic detoxified protein according to the present
invention exhibits a carefully selected balance of toxicity
m~;mising the immunogenicity and/or adjuvant effects of the
protein whilst maintaining a sufficiently low toxicity to be
tolerated by the immunised individual.
Preferably the amino acid at, or in a position corresponding
to, Pro-106 is replaced with another amino acid.
That this particular preferred embodiment would exhibit the
claimed features was not predictable ~rom the prior art
which generally teaches that absolute removal of toxicity
was the goal for the development of mutant toxin vaccines
and adjuvants and in particular teaches that this particular
mutated toxin would have no toxicity (see WO 93/13202).
In this specification, references to CT encompass the
various naturally occurring strain variants as well other
variants encompassing changes from the sequences disclosed
herein which do not affect the immunogenicity of the
assembled toxoid.
The amino acid sequences for CT are definitively described
in Domenighini et al Molecular Microbiology (1995) 15(6)
1165-1167.
CA 02244800 l998-07-3l
W O97/29771 PCT~B97/00183
The amino acid substituted for the wild type amino acid may
~ ~ be a naturally occurring amino acid or may be a modified or
synthetic amino acid, provided that the mutant retains the
necessary immunogenic properties and exhibits a greater than
10 000 fold reduction in toxicity relative to the naturally
occuring counterpart. The substitution may involve deletion
or addition of one or more amino acids.
Substitutions which alter the amphotericity and
hydrophilicity whilst retaining the steric effect of the
substituting amino acid as far as possible are generally
preferred.
As used herein, the term l'detoxified" means that the
immunogenic composition exhibits greater than 10 000 fold
reduction in t~xicity relative to its naturally occurring
toxin counterpart. The reduction in toxicity should be
sufficiently low for the protein to be used in an
immunogenic composition in an immunologically effective
amount as a vaccine with causing significant side effects.
As used herein, the term "residual toxicity" means that the
detoxified immunogenic protein retains a measurable
toxicity. More particularly the level of toxicity is
o p t i m i s e d b y b a l a n c i n g i n c r e a s e d
immunogenicity/adiuvanticity against the toxic effects of
administration in a benefit/side effect trade-o~f.
The residual toxicity of the immunogenic composition is
greater than 10 000 fold reduced relative to its natural
occurring counterpart, preferably greater than 30 000 fold
and most preferably greater than 50 000 fold.
The toxicity may be measured in mouse CH0 cells or
preferably by the rabbit ileal loop assay or by evaluation
of the morphological changes induced in Y1 cells.
Most preferably the toxicity of the immunogenic composition
CA 02244800 l998-07-3l
W O 97/29771 PCTnB97/00183
is reduced relative to its natural occurring counterpart by
~ about 30 000 fold as measured by the evaluation of the
morphological changes induced in Y1 cells or 10 000 fold as
measured by the rabbit ileal loop assay.
The term "toxoid" as used herein means a genetically
detoxified toxin.
The immunogenic protein may be a CT subunit A toxoid, but is
preferably an assembled toxin molecule comprising a mutated
CT-A subunit and five B subunits of CT. The B subunit may be
a naturally occurring subunit or may i~self be mutated.
The immunogenic protein is preferably a naturally occurring
CT-A suitably modified as described above. However,
conservative amino acid changes may be made which do not
affect the immunogenicity or the toxicity of immunogenic
protein and preferably do not affect the ability of the
immunogenic protein to form complete toxin with B subunit
protein. Also, the immunogenic protein may be a fragment of
CT-A provided that the fragment is immunogenic and non toxic
and contains at least one of the conserved regions
containing one of the mutations according to the invention.
Preferably Pro-106 is replaced with Ser-106.
According to a second aspect of the invention, there is
provided an immunogenic composition for use as a vaccine
comprising an immunogenic detoxified protein of the first
aspect of the invention and a pharmaceutically acceptable
carrier.
The invention also provides a vaccine composition comprising
an immunogenic detoxified protein according to the first
aspect of the invention and a pharmaceutically acceptable
carrier. The vaccine composition may further comprise an
adjuvant. Alternatively, the vaccine composition may
comprise a second antigen capable of raising an
CA 02244800 1998-07-31
W O97/29771 PCT~B97/00183
immunological response to another disease. In such an
~ ~ alternative composition, the immunogenic detoxified protein
acts as a mucosal adjuvant.
According to a third aspect of the invention, there is
provided a method of vaccinating a mammal against Vi~rio
cholerae comprising administering an immunologically
effective amount of an immunogenic detoxified protein
according to the first aspect of the invention. Optionally,
the immunogenic detoxified protein of the invention may act
as an adjuvant for a second immunogenic protein administered
separately, sequentially or with the immunogenic detoxified
protein of the invention.
The immunogenic detoxified proteins of the invention may be
synthesised chemically using conventional peptide synthesis
techniques, but are preferably produced by recombinant DNA
means.
According to a fourth aspect of the invention there is
provided a DNA sequence encoding an immunogenic detoxified
protein according to the first aspect of the invention.
Preferably the DNA se~uence contains a DNA sequence encoding
a complete CT comprising DNA encoding both the detoxified
subunit A and subunit B in a polycistronic unit.
Alternatively, the DNA may encode only the detoxified
subunit A.
According to a fifth aspect of the invention, there is
provided a vector carrying a DNA according to the fourth
aspect of the invention.
According to a sixth aspect of the invention, there is
provided a host cell line transformed with the vector
according to the fifth aspect of the invention.
The host cell may be any host capable of producing CT or but
CA 02244800 1998-07-31
W O 97/29771 PCT~B97/00183
is preferably a bacterium, most suitably E. coli or
V. cholerae suitably engineered to produce the desired
immunogenic detoxified protein.
In a further embodiment of the sixth aspect of the
invention, the host cell may itself provide a protective
species, for example a V.cholerae strain mutated to a
phenotype lacking wild type CT and carrying and expressing
an immunogenic detoxified protein of the first aspect of the
invention.
In a further embodiment of the sixth aspect of the invention
the host cell is capable of expre~sing a chromosomal CT-A
gene according to the first aspect of the invention.
According to a seventh aspect of the invention, there is
provided a process for the production o~ an immunogenic
detoxified protein according to the first aspect of the
invention comprising cu-turing a host cell according to the
sixth aspect of the invention.
According to a eighth aspect of the invention there is
provided a process for the production of DNA according to
the fourth aspect of the invention comprising the steps of
subjecting a DNA encoding a CT-A or a fragment thereof to
site-directed mutagenesis.
According to a ninth aspect of the invention there is
provided a process for the formulation of a vaccine
comprising bringing an immunogenic detoxified protein
according to the first aspect of the invention into
association with a pharmaceutically acceptable carrier and
optionally with an adjuvant.
Industrial ApPlicabilitY
The immunogenic detoxified protein of the invention
constitutes the active component of a vaccine composition
CA 02244800 1998-07-31
WO97/29771 PCT~B97/00183
use~ul for the prevention and treatment of cholera
..
infections. The immunogenic detoxified protein may also ~e
used in a vaccine composition as a mucosal adjuvant. The
compositions are thus applicable for use in the
pharmaceutical industry.
~e~ailed Descri~tion of Embodiments of the Invention
The practice of the present invention will employ, unless
otherwise indicated, conventional techniques of molecular
biology, microbiology, recombinant DNA, and immunology,
which are within the skill of the art. Such techniques are
explained fully in the literature. See e.g., Sambrook, et
al., MOLECULAR CLONING; A LABORATORY MANUAL, SECOND EDITION
(19B9); DNA CLONING, VOLUMES I AND II (D.N Glover ed.
1985~; OLIGONUCLEOTIDE SYNTHESIS (M.J. Gait ed, 1984);
NUCLEIC ACID HYBRIDIZATION (B.D. Hames & S.J. Higgins eds.
1984); TRANSCRIPTION AND TRANSLATION (B.D. Hames & S.J.
Higgins eds. 1984); ANIMAL CELL CULTURE (R.I. Freshney ed.
1986); IMMOBILIZED CELLS AND ENZYMES (IRL Press, 1986); B.
Perbal, A PRACTICAL GUIDE TO MOLECULAR CLONING (1984); the
series, METHODS IN ENZYMOLOGY (Academic Press, Inc.); GENE
TRANSFER VECTORS FOR MAMMALIAN CELLS (~.H. Miller and M.P.
Calos eds. 1987, Cold Spring Harbor Laboratory), Methods in
Enzymology Vol. 154 and Vol. 155 (Wu and Grossman, and Wu,
eds., respectively), Mayer and Walker, eds. (1987),
IMMUNOCHEMICAL METHODS IN CELL AND MOLECULAR BIOLOGY
(Academic Press, London), Scopes, (1987), PROTEIN
PURIFICATION: PRINCIPLES AND PRACTICE, Second Edition
(Springer-Verlag, N.Y.), and HANDBOOK OF EXPERIMENTAL IM-
MUNOLOGY, VOLUMES I-IV (D.M. Weir and C. C. Blackwell eds
1986).
Standard abbreviations for nucleotides and amino acids are
used in this specification. All publications ,patents, and
patent applications cited herein are incorporated by
reference.
CA 02244800 1998-07-31
W O 97129771 PCT~B97/00183
11
In particular, the following amino acid abbreviations are
- - used:
Alanine A Ala Arginine R Arg
5 Asparagine N Asn Aspartic Acid D Asp
Cysteine C Cys Glycine G Gly
Glutamic Acid E Glu Glutamine Q Gln
~istidine H His Isoleucine I Ile
Leucine ~ Leu Lysine K Lys
10 Methionine M Met Phenylalanine F Phe
Proline P Pro Serine S Ser
Threonine T Thr Tryptophan w Trp
Tyrosine Y Tyr Valine V Val
As mentioned a~ove examples of the immunogenic detoxified
protein that can be used in the present invention include
polypeptides with minor amino acid variations from the
natural amino acid sequence of the protein other than at the
sites of mutation specifically mentioned.
A significant advantage of producing the immunogenic
detoxified protein by recombinant DNA techniques rather than
by isolating and purifying a protein from natural sources is
that equivalent quantities of the protein can be produced by
using less starting material than would be required for
isolating the protein from a natural source. Producing the
protein by recombinant techniques also permits the protein
to be isolated in the absence of some molecules normally
present in cells. Indeed, protein compositions entirely
free of any trace of human protein contaminants can readily
be produced because the only human protein produced by the
~ recombinant non-human host is the recombinant protein at
issue. Potential viral agents from natural sources and
viral components pathogenic to humans are also avoided.
Also, genetically detoxified toxin are less likely to revert
to a toxic from than more traditional, chemically detoxified
toxins.
CA 02244800 1998-07-31
W O97/29771 PCT~B97tOO183
12
Pharmaceutically acceptable carriers include any carrier
= that does not itself induce the production of antibodies
harm~ul to the individual receiving the composition.
Suitable carriers are typically large, slowly metabolized
macromolecules such as proteins, polysaccharides, polylactic
acids, polyglycolic acids, polymeric amino acids, amino acid
copolymers, lipid aggregates (such as oil droplets or
liposomes) and inactive virus particles. Such carriers are
well known to those of ordinary skill in the art.
1~ Additionally, these carriers may function as
immunostimulating agents (adjuvants).
Preferred adjuvants to enhance e~fectiveness of the compo-
sition include, but are not limited to: aluminum salts
(alum) such as alumini~m hydroxide, aluminium phosphate,
aluminium sul~ate etc., oil emulsion formulations, with or
without other specific immunostimulating agents such as
muramyl peptides or bacterial cell wall components, such as
for example (1) MF59 (Published International patent
application W0-A-90/14837, containing S% Squalene, 0.5%
Tween~ 80, 0.5% Span~ 85 (optionally containing various
amounts of MTP-PE (see below), although not required)
formulated into submicron particles using a microfluidizer
such as Model llOY micro~luidizer (Microfluidics, Newton, MA
~2164), (2) SAF, containing 10~ squalene, 0.4% Tween 80, 5%
pluronic-blocked polymer L121, and thr-MDP (see ~elow)
either microfluidized into a submicron emulsion or vortexed
to generate a larger particle size emulsion, and (3) RIBI~
adjuvant system (RAS) (Ribi Immunochem, Hamilton, MT)
containing 2~ S~ualene, 0.2% Tween~ 80 and one or more
bacterial cell wall components from the group consisting of
monophosphoryl lipid A (MPL), trehalose dimycolate (TDM~,
and cell wall skeleton (cWS) pre~erably MPLtCWS (Detox~),
muramyl peptides such as N-acetyl-muramyl-L-threonyl-D-
isoglutamine (thr-MDP), N-acetyl-normuramyl-L-alanyl-D-iso-
glutamine (nor-MDP), N-acetylmuramyl-L-alanyl-D-
isoglutaminyl-L-alanine-2-(l'-2'-dipalmitoyl-sn-glycero-3-
hydroxyphosphoryloxy)-ethylamine (MTP-PE) etc., and
-
CA 02244800 1998-07-31
W O97/29771 PCT~B97/00183
cytokines, such as interleukins (IL-1, IL-2 etc) macrophage
- - colony stimulating factor (M-CSF), tumour necrosis factor
(TNF) etc. Additionally, saponin adjuvants, such as
Stimulon~ (Cambridge Bioscience, Worcester, MA) may be used
or particles generated therefrom such as ISCOMS
(immunostimulating complexes). Furthermore, Complete
Freunds Adjuvant (CFA) and Incomplete Freunds Adjuvant (IFA)
may be used. Alum and MF59 are preferred.
The immunogenic detoxified protein of the invention may used
as an adjuvant for a second antigen in an immunologically
active composition for the treatment or vaccination of the
human or animal body.
The immunogenic compositions (e.g. the antigen,
pharmaceutically acceptable carrier and adjuvant) typically
will contain diluents, such as water, saline, glycerol,
ethanol, etc. Additionally, auxiliary substances, such as
wetting or emulsifying agents, pH buffering substances, and
the like, may be present in such vehicles.
Typically, the immunogenic compositions are prepared as
injectables, either as liquid solutions or suspensions;
solid forms suitable for solution in, or suspension in,
liquid vehicles prior to injection may also be prepared.
The preparation also may be emulsified or encapsulated in
liposomes for enhanced adjuvant effect as discussed above
under pharmaceutically acceptable carriers.
Immunogenic compositions used as vaccines comprise an
immunologically effective amount of the antigenic
polypeptides, as well as any other of the above-mentioned
components, as needed. By "immunologically effective
amount", it is meant that the administration of that amount
to an individual, either in a single dose or as part of a
series, is effective for treatment or prevention. This
amount varies depending upon the health and physical
condition of the individual to be treated, the taxonomic
CA 02244800 l998-07-3l
W O 97/29771 PCT~B97/00183
14
group of individual to be treated (e.g., nonhuman primate,
primate, etc.), the capacity of the individual's immune
system to synthesize antibodies, the degree of protection
desired, the formulation of the vaccine, the treating
doctor's assessment of the medical situation, and other rel-
evant factors. It is expected that the amount will fall in
a relatively broad range that can be determined through
routine trials.
The immunogenic compositions are conventionally administered
parenterally, e.g. by injection either subcutaneously or
intramuscularly. Additional formulations suitable for other
modes of administration include oral and pulmonary
formulations, suppositories and transdermal applications.
lS Dosage treatment may be a single dose schedule or a multiple
dose schedule. The vaccine may be administered in conjunc-
tion with other immunoregulatory agents.
The term "recombinant polynucleotide" as used herein intends
a polynucleotide of genomic, cDNA, semisynthetic, or
synthetic origin which, by virtue of its origin or
manipulation~ is not associated with all or a portion of
a polynucleotide with which it is associated in nature, (2)
is linked to a polynucleotide other than that to which it is
linked in nature, or (3) does not occur in nature.
The term "polynucleotide" as used herein refers to a
polymeric form of nucleotides of any length, either
ribonucleotides or deoxyribonucleotides. This term refers
only to the primary structure of the molecule. Thus, this
term includes double- and single-stranded DNA and RNA. It
also includes known types of modifications, for example,
labels which are known in the art, methylation, "caps",
substitution of one or more of the naturally occurring
nucleotides with an analog, internucleotide modifications
such as, for example, those with uncharged linkages (e.g.,
methyl phosphonates, phosphotriesters, phosphoamidates,
carbamates, etc.) and with charged linkages (e.g.,
CA 02244800 l998-07-3l
W O97/29771 PCT~B97/00183
phosphorothioates, phosphorodithioates, etc.), those
- containing pendant moieties, such as, for example proteins
~ (including for e.g., nucleases, toxins, antibodies, signal
peptides, poly-L-lysine, etc.), those with intercalators
(e.g., acridine, psoralen, etc.), those containing chelators
(e.g., metals, radioactive metals, boron, oxidative metals,
etc.), those containing alkylators, those with modi~ied
linkages (e.g., alpha anomeric nucleic acids, etc.), as well
as unmodified forms of the polynucleotide.
A "replicon" is any genetic element, e.g., a plasmid, a
chromosome, a virus, a cosmid, etc. that behaves as an
autonomous unit of polynucleotide replication within a cell;
i.e., capable of replication under its own control. This
lS may include selectable markers.
A "vector" is a replicon in which another polynucleotide
segment is attached, so as to bring about the replication
and/or expression of the attached segment.
"Control sequence" refers to polynucleotide sequences which
are necessary to effect the expression of coding sequences
to which they are ligated. The nature of such control
sequences differs depending upon the host organism; in
prokaryotes, such control sequences generally include
promoter, ribosomal binding site, and transcription
termination sequence; in eukaryotes, generally, such control
sequences include promoters and transcription termination
se~uence. The term "control sequences" is intended to
include, at a minimum, all components whose presence is
necessary for expression, and may also include additional
components whose presence is advantageous, for example,
leader sequences and fusion partner sequences.
3s "Operably linked" refers to a juxtaposition wherein the
components so described are in a relationship permitting
them to ~unction in their intended manner. A control
sequence "operably linked" to a coding sequence is ligated
CA 02244800 1998-07-31
W O97/29771 PCTnB97/00183
1~
in such a way that expression of the coding sequence is
- - achieved under conditions compatible with the control
sequences.
An "open reading frame" (ORF) is a region of a
polynucleotide sequence which encodes a polypeptide; this
region may represent a portion of a coding se~uence or a
total coding sequence.
A "coding sequence" is a polynucleotide sequence which is
translated into a polypeptide, usually via mRNA, when placed
under the control of appropriate regulatory sequences. The
boundaries of the coding sequence are determined by a
translation start codon at the 5'-terminus and a translation
stop codon at the 3'-terminus. A coding sequence can
include, but is not limited to, cDNA, and recombinant
polynucleotide sequences.
"PCR" re~ers to the techni~ue of polymerase chain reaction
as described in Saiki, et al., Nature 324:163 (1986); and
Scharf et al., Science (1986) 233:1076-1078; and U.S.
4,683,195; and U.S. 4,683,202.
As used herein, x is ''heterologousll with respect to y if x
is not naturally associated with y in the identical manner;
i.e., x is not associated with y in nature or x is not
associated with y in the same manner as is found in nature.
"Homology" refers to the degree of similarity between x and
y. The correspondence between the sequence from one form to
another can be determined by techniques ~nown in the art.
For example, they can be determined by a direct comparison
of the sequence information of the polynucleotide.
Alternatively, homology can be determined by hybridization
of the polynucleotides under conditions which form stable
duplexes between homologous regions (for example, those
which would be used prior to S1 digestion), followed by
digestion with single-stranded specific nuclease(s), fol-
CA 02244800 1998-07-31
W O97/29771 PCT~B97/00183
lowed by size determination of the digested fragments.
.
As used herein, the term "polypeptide" refers to a polymer
of amino acids and does not refer to a specific length of
the product; thus, peptides, oligopeptides, and proteins are
included within the definition of polypeptide. This term
also does not refer to or exclude post expression
modifications of the polypeptide, for example,
glycosylations, acetylations, phosphorylations and the like.
Included within the definition are, for example,
polypeptides containing one or more analogs of an amino acid
(includin~, for example, unnatural amino acids, etc.),
polypeptides with substituted linkages, as well as other
modifications known in the art, both naturally occurring and
non-naturally occurring.
A polypeptide or amino acid sequence "derived from" a
designated nucleic acid sequence refers to a polypeptide
having an amino acid sequence identical to that of a
polypeptide encoded in the sequence, or a portion thereof
wherein the portion consists of at least 3-5 amino acids,
and more preferably at least 8-10 amino acids, and even more
preferably at least 11-15 amino acids, or which is im-
munologically identifiable with a polypeptide encoded in the
sequence. This terminology also includes a polypeptide
expressed from a designated nucleic acid sequence.
The protein may be used for producing antibodies, either
monoclonal or polyclonal, specific to the protein. The
methods for producing these antibodies are known in the art.
"Recombinant host cells", "host cells," "cells," "cell
cultures," and other such terms denote, for example,
microorganisms, insect cells, and mammalian cells, that can
be, or have been, used as recipients for recombinant vector
or other transfer DNA, and include the progeny of the
original cell which has been transformed. It is understood
that the progeny of a single parental cell may not
CA 02244800 l998-07-3l
WO 97/29771 PCT~B97/00183
18
necessarily be completely identical in morphology or in
genomic or total DNA complement as the original parent, due
to natural, accidental, or deliberate mutation. Examples
for mammalian host cells include Chinese hamster ovary (CHO~
and monkey kidney (COS) cells.
Specifically, as used herein, "cell line," refers to a
population of cells capable of continuous or prolonged
growth and division in vitro. Often, cell lines are clonal
populations derived from a single progenitor cell. It is
further known in the art that spontaneous or induced changes
can occur in karyotype during storage or transfer of such
clonal populations. Therefore, cells derived from the cell
line referred to may not be precisely identical to the
ancestral cells or cultures, and the cell line referred to
includes such variants. The term "cell lines" also includes
immortalized cells. Preferably, cell lines include
nonhybrid cell lines or hybridomas to only two cell types.
As used herein, the term "microorganism" includes
prokaryotic and eukaryotic microbial species such as
bacteria and fungi, the latter including yeast and
filamentous fungi.
.
"Transformation", as used herein, refers to the insertion of
an exogenous polynucleotide into a host cell, irrespective
of the method used for the insertion, for example, direct
uptake, transduction, f-mating or electroporation. The
exogenous polynucleotide may be maintained as a
non-integrated vector, for example, a plasmid, or
alternatively, may be integrated into the host genome.
By "genomic" is meant a collection or library of DNA
molecules which are derived from restriction fragments that
have been cloned in vectors. This may include all or part
of the genetic material of an organism.
By "cDNA" is meant a complementary DNA se~uence that
CA 02244800 1998-07-31
W O 97/29771 PCT~B97/00183
hybridizes to a complementary strand of DNA.
By "purified" and "isolated" is meant, when referring to a
polypeptide or nucleotide sequence, that the indicated
molecule is present in the substantial absence of other
biological macromolecules of the same type. The term
~'purified" as used herein preferably means at least 75% by
weight, more prefera~ly at least 85% by weight, more
preferably still at least 95% by weight, and most preferably
at least 98% by weight, of biological macromolecules of the
same type present (but water, buffers, and other small
molecules, especially molecules having a molecular weight of
less than 1000, can be present).
once the appropriate coding sequence is isolated, it can be
expressed in a variety of different expression systems; for
example those used with ~mal ian cells, baculoviruses,
bacteria, and yeast.
i. Mammalian Systems
Mammalian expression systems are known in the art. A
mammalian promoter is any DNA sequence capable of binding
mammalian RNA polymerase and initiating the downstream (3')
transcription of a coding sequence (e.g. structural gene)
into mRNA. A promoter will have a transcription initiating
region, which is usually placed proximal to the 5' end of
the coding sequence, and a TATA box, usually located 25-30
base pairs (bp) upstream of the transcription initiation
site. The TATA box is thought to direct RNA polymerase II
to begin RNA synthesis at the correct site. A mammalian
promoter will also contain an upstream promoter element,
usually located within 100 to 200 bp upstream of the TATA
box. An upstream promoter element determines the rate at
which transcription is initiated and can act in either
orientation [Sambrook et al. (1989) "Expression of Cloned
Genes in Mammalian Cells." In Molecular Cloninq: A
LaboratorY Manual, 2nd ed.l.
CA 02244800 1998-07-31
W O97/29771 PCTnB97/00183
Mammalian viral genes are often highly expressed and have a
~ broad host range; therefore sequences encoding mammalian
viral genes provide particularly useful promoter sequences.
Examples include the SV40 early promoter, mouse m~m~ry
tumor virus LTR promoter, adenovirus major late promoter (Ad
MLP), and herpes simplex virus promoter. In addition,
sequences derived from non-viral genes, such as the murine
metallotheionein gene, also provide useful promoter
sequences. Expression may be either constitutive or
regulated (induci~le), depending on the promoter can be
induced with glucocorticoid in hormone-responsive cells.
The presence of an enhancer element (enhancer), combined
with the promoter elements described above, will usually
increase expression levels. An enhancer is a regulatory DNA
se~uence that can stimulate transcription up to 1000-fold
when linked to homologous or heterologous promoters, with
synthesis beginning at the normal RNA start site. Enhancers
are also active when they are placed upstream or downstream
from the transcription initiation site, in either normal or
flipped orientation, or at a distance of more than 1000
nucleotides from the promoter [Maniatis et al. (1987)
Science 236:1237; Alberts et al. (1989) Molecular Bioloqy of
the Cell, 2nd ed.~. Enhancer elements derived from viruses
may be particularly useful, because they usually have a
~roader host range. Examples include the SV40 early gene
enhancer [Dijkema et al (1985) EMB0 J. 4:761] and the
enhancer/promoters derived from the long terminal repeat
(LTR) of the Rous Sarcoma Virus [Gorman et al. (1982b) Proc.
Natl. Acad. Sci. 79:6777~ and from human cytomegalovirus
[Boshart et al. (1985) Cell 41:521]. Additionally, some
enhancers are regulatable and become active only in the
presence of an inducer, such as a hormone or metal ion
[Sassone-Corsi and Borelli (1986) Trends Genet. 2:215;
Maniatis et al. (1987) Science 236:1237].
A DNA molecule may be expressed intracellularly in mammalian
cells. A promoter se~uence may be directly linked with the
CA 02244800 1998-07-31
W O 97~9771 PCT~B97/00183
21
DNA molecule, in which case the first amino acid at the N-
- - terminus of the recombinant protein will always be a
~ methionine, which is encoded by the ATG start codon. If
desired, the N-terminus may be cleaved from the protein by
~ 5 in vitro incubation with cyanogen bromide.
Alternatively, foreign proteins can also be secreted from
the cell into the growth media by creating chimeric DNA
molecules that encodè a fusion protein comprised of a leader
se~uence fragment that provides for secretion of the foreign
protein in mammalian cells. Prefera~ly, there are
processing sites encoded between the leader fragment and the
~oreign gene that can be cleaved either in v1vo or ln vitro.
The leader sequence fragment usually encodes a signal
peptide comprised of hydrophobic amino acids which direct
the secretion of the protein from the cell. The adenovirus
triparite leader is an example of a leader sequence that
provides for secretion of a foreign protein in mammalian
cells.
Usually, transcription termination and polyadenylation
sequences recognized by mammalian cells are regulatory
regions located 3' to the translation stop codon and thus,
together with the promoter elements, flank the coding
sequence. The 3' terminus of the mature mRMA is formed by
site-specific post-transcriptional cleavage and polya-
denylation [Birnstiel et al. (1985) Cell 41:349; Proudfoot
and Whitelaw (1988) "Termination and 3' end processing of
eukaryotic RNA. In TranscriPtion and splicinq (ed. B.D.
Hames and D.M. Glover); Proudfoot (1989) Trends Biochem.
Sci. 14:105]. These sequences direct the transcription of
an mRNA which can be translated into the polypeptide encoded
by the DNA. Examples of transcription
- terminater/polyadenylation signals include those derived
from SV40 [Sambrook et al (1989) "Expression of cloned genes
in cultured mammalian cells." In Molecular Cloninq: A
LaboratorY Manual].
CA 02244800 1998-07-31
WO97/29771 PCT~B97/00183
Some genes may }~e expressed more efficiently when introns
(also called intervening sequences) are present. Several
cDNAs, however, have been efficiently expressed from vectors
that lack splicing signals (also called splice donor and
5 acceptor sites) [see e.g., Gothing and Sambrook (1981)
Nature ~93:620]. ~ntrons are intervening noncoding
sequences within a coding sequence that contain splice donor
and acceptor sites. They are removed by a process called
"splicing," following polyadenylation of the primary
10 transcript [Nevins (1983) Annu. Rev. Biochem. 52:441; Green
(1986) Annu. Rev. Genet. 20:671; Padgett et al. (1986) Annu.
Rev. Biochem. 55:1119; Krainer and Maniatis (1988) "RNA
splicing." In TranscriPtion and sPlicinq (ed. B.D. Hames
and D.M. Glover)].
Usually, the above described components, comprising a
promoter, polyadenylation signal, and transcription
termination sequence are put together into expression
constructs. Enhancers, introns with functional splice donor
20 and acceptor sites, and leader sequences may also be
included in an expression construct, if desired. Expression
constructs are often maintained in a replicon, such as an
extrachromosomal element (e.g., plasmids) capable of stable
maintenance in a host, such as mammalian cells or bacteria.
25 Mammalian replication systems include those derived from
animal viruses, which require trans-acting factors to
replicate. For example, plasmids containing the replication
systems of papovaviruses, such as SV40 [Gluzman (1981) Cell
23:175] or polyomavirus, replicate to extremely high copy
30 number in the presence of the appropriate viral T antigen.
Additional examples of mammalian replicons include those
derived from bovine papillomavirus and Epstein-Barr virus.
Additionally, the replicon may have two replication systems,
thus allowing it to be maintained, for example, in mammalian
35 cells for expression and in a procaryotic host for cloning
and amplification. Examples of such mammalian-bacteria
shuttle vectors include pMT2 [Kaufman et al. (1989) Mol.
Cell. Biol. 9:946 and pHEB0 [Shimizu et al. (1986) Mol.
CA 02244800 1998-07-31
W O97/Z9771 PCTnB97/00183
23
Cell. Biol. 6:1074].
The transformation procedure used depends upon the host to
be transformed. Methods for introduction of heterologous
polynucleotides into mammalian cells are known in the art
and include dextran-mediated transfection, calcium phosphate
precipitation, polybrene mediated transfection, protoplast
fusion, electroporation, encapsulation of the
polynucleotide(s) in liposomes, and direct microinjection of
the DNA into nuclei.
Mammalian cell lines available as hosts for expression are
known in the art and include many immortalized cell lines
available from the American Type Culture Collection (A~CC),
including but not limited to, Chinese hamster ovary (CH0)
cells, HeLa cells, baby hamster kidney (BHK) cells, monkey
kidney cells (COS), human hepatocellular carcinoma cells
(e.g., Hep G2), and a number of other cell lines.
ii. Baculovirus Systems
The polynucleotide encoding the protein can also be inserted
into a suitable insect expression vector, and is operably
linked to the control elements within that vector. Vector
construction employs techniques which are known in the art.
Generally, the components of the expression system include
a transfer vector, usually a bacterial plasmid, which
contains both a fragment of the baculovirus genome, and a
convenient restriction site for insertion of the
heterologous gene or genes to be expressed; a wild type
baculovirus with a sequence homologous to the baculovirus-
specific fragment in the transfer vector (this allows for
the homologous recombination of the heterologous gene in to
the baculovirus genome); and appropriate insect host cells
and growth media.
After inserting the DNA sequence encoding the protein into
CA 02244800 1998-07-31
W O 97/29771 PCTAB97/00183
24
the transfer vector, the vector and the wild type viral
- - genome are transfected into an insect host cell where the
vector and viral genome are allowed to recombine. The
packaged recombinant virus is expressed and recombinant
pla~ues are identified and purified. Materials and methods
for baculovirus/insect cell expression systems are
commercially available in kit form from, inter alia,
Invitrogen, San Diego CA ("MaxBac" kit). These techniques
are generally known to those skilled in the art and fully
described in Summers and Smith, Texas Aqricultu~al
Ex~eriment Station Bulletin No. 1555 (1987) (hereinafter
"Summers and Smith").
Prior to inserting the DNA sequence encoding the protein
into the baculovirus genome, the above described components,
comprising a promoter, leader (if desired), coding sequence
of interest, and transcription termination sequence, are
usually assembled into an intermediate transplacement
construct (transfer vector). This construct may contain a
single gene and operably linked regulatory elements;
multiple genes, each with its owned set of operably linked
regulatory elements; or multiple genes, regulated by the
same set of regulatory elements. Intermediate
transplacement constructs are often maintained in a
replicon, such as an extrachromosomal element (e.g.,
plasmids) capable of stable maintenance in a host, such as
a bacterium. The replicon will have a replication system,
thus allowing it to be maintained in a suitable host for
cloning and amplification.
Currently, the most commonly used trans~er vector for
introducing foreign genes into AcNPV is pAc373. Many other
vectors, known to those of skill in the art, have also been
designed. These include, for example, pVL985 (which alters
the polyhedrin start codon from ATG to ATT, and which
introduces a BamHI cloning site 32 basepairs downstream from
the ATT; see Luckow and Summers, ViroloqY (1989) 17:31.
CA 02244800 l998-07-3l
WO 97/29771 PCT~B97/00183
The plasmid usually also contains the polyhedrin
~ polyadenylation signal (Miller et al. (1988) Ann. Rev.
Microbiol., 42:177) and a procaryotic ampicillin-resistance
(am~) gene and origin of replication for selection and
propagation in E. coli.
Baculovirus transfer vectors usually contain a baculovirus
promoter. A baculovirus promoter is any DNA seguence
capable of binding a baculovirus RNA polymerase and
initiating the downstream (5' to 3') transcription of a
coding sequence (e~g. structural gene) into mRNA. A
promoter will have a transcription initiation region which
is usually p}aced proximal to the 5' end of the coding
sequence. This transcription initiation region usually
includes an RNA polymerase binding site and a transcription
initiation site. A baculovirus transfer vector may also
have a second domain called an enhancer, which, if present,
is usually distal to the structural gene. Expression may be
either regulated or constitutive.
Structural genes, abundantly transcribed at late times in a
viral infection cycle, provide particularly useful promoter
sequences. Examples include sequences derived from the gene
encoding the viral polyhedron protein, Friesen et al.,
2S (1986) "The Regulation of Baculovirus Gene E~pression," in:
The Molecular BioloqY of Baculoviruses (ed. Walter
Doerfler); EPO Publ. Nos. 127 839 and 155 476; and the gene
encoding the plO protein, Vlak et al., (1988), J. Gen.
Virol. 69:765.
DNA encoding suitable signal sequences can be derived from
genes for secreted insect or baculovirus proteins, such as
the baculovirus polyhedrin gene (Carbonell et al. (1988)
Gene, 73:409). Alternatively, since the signals for
mammalian cell posttranslational modifications (such as
signal peptide cleavage, proteolytic cleavage, and
phosphorylation) appear to be recognized by insect cells,
and the signals required for secretion and nuclear
CA 02244800 1998-07-31
W O 97129771 PCT~B97/00183
26
accumulation also appear to be conserved between the
- - invertebrate cells and vertebrate cells, leaders of non-
insect origin, such as those derived from genes encoding
human cY-interferon, Maeda et a~., (1985), Nature 315:592;
human gastrin-releasing peptide, Lebacq-Verheyden et al.,
(1988), Molec. Cell. Biol. 8:3129; human IL-2, Smith et al.,
(1985) Proc. Nat'l Acad. Sci. USA, 82:8404; mouse IL-3,
(Miyajima et al., (1987) Gene 58:273; and human
glucocerebrosidase, Martin et al. (1988) DNA, 7:99, can also
be used to provide for secretion in insects.
A recombinant polypeptide or polyprotein may be expressed
intracellularly or, if it is expressed with the proper
regulatory sequences, it can be secreted. Good
intracellular expression of nonfused foreign proteins
usually requires heterologous genes that ideally have a
short leader sequence containing suitable translation
initiation signals preceding an ATG start signal. If
desired, methionine at the N-terminus may be cleaved from
the mature protein by in vitro incubation with cyanogen
bromide.
Alternatively, recombinant polyproteins or proteins which
are not naturally secreted can be secreted from the insect
cell by creating chimeric DNA molecules that encode a fusion
protein comprised of a leader sequence fragment that
provides for secretion of the foreign protein in insects.
The leader sequence fragment usually encodes a signal
peptide comprised of hydrophobic amino acids which direct
the translocation of the protein into the endoplasmic
reticulum.
After insertion of the DNA sequence and/or the gene encoding
the expression product precursor of the protein, an insect
cell host is co-transformed with the heterologous DNA of the
transfer vector and the genomic DNA of wild type baculovirus
-- usually by co-transfection. The promoter and
transcription termination sequence of the construct will
CA 02244800 l998-07-3l
w o97ng771 PCT~B97/00183
usually comprise a 2-5kb section of the baculovirus genome.
~ ~ Methods for introducing heterologous ~NA into the desired
site in the baculovirus virus are known in the art. (See
Summers and Smith su~ra; Ju et al. (1987); Smith et al.,
Mol. Cell. Biol. (1983) 3:2156; and Luckow and Summers
(1989)). For example, the insertion can be into a gene such
as the polyhedrin gene, by homologous double crossover
recombination; insertion can also be into a restriction
enzyme site engineered into the desired baculovirus gene.
Miller et al., (1989), BioessaYs 4:91.The DNA sequence, when
cloned in place of the polyhedrin gene in the expression
vector, is flanked both 5' and 3' by polyhedrin-specific
sequences and is positioned downstream of the polyhedrin
promoter.
~he newly formed baculovirus expression vector is
subsequently packaged into an infectious recombinant
baculovirus. Homologous recombination occurs at low
frequency (between about 1% and about 5%); thus, the
majority of the virus produced after cotransfection is still
wild-type virus. Therefore, a method is necessary to
identify recombinant viruses. An advantage of the
expression system is a visual screen allowing recombinant
viruses to be distinguished. The polyhedrin protein, which
is produced by the native virus, is produced at very high
- levels in the nuclei of infected cells at late times after
viral infection. Accumulated polyhedrin protein forms
occlusion bodies that also contain em~edded particles.
These occlusion bodies, up to 15 ~m in size, are highly
refractile, giving them a bright shiny appearance that is
readily visualized under the light microscope. Cells
infected with recombinant viruses lack occlusion bodies. ~o
distinguish recombinant virus from wild-type virus, the
transfection supernatant is plaqued onto a monolayer of
insect cells by techniques known to those skilled in the
art. Namely, the plaques are screened under the light
~icroscope for the presence (indicative of wild-type virus)
or absence (indicative of recombinant virus) of occlusion
CA 02244800 1998-07-31
WO 97/29771 PCT~B97/0~183
bodies. "Current Protocols in Microbiology" Vol. 2 (Ausubel
et al. eds) at 16.8 (Supp. 10, 1990); Summers and Smith,
~supra; Miller et al. (1989).
Recom~inant baculovirus expression vectors have been
dèveloped for infection into several insect cells. ~or
example, recombinant baculoviruses have been developed for,
inter alia: Aedes aeqYPti , Autoqrapha californica, ~ombyx
_~Ei~ Drosophila melanoqaster, Spodo~tera fruai~erda, and
Tricho~lusia ni (~CT Pub. No. W0 89/046699; Carbonell et
al., (1985~ J. Virol. 56:153; Wright (1986) Nature 321:718;
Smith et al., (1983) Mol. Cell. Biol. 3:2156; and see
generally, Fraser, et al. (1989) In Vitro Cell. Dev. Biol.
25:22~).
Cells and cell culture media are commercially available for
both direct and fusion expression of heterologous
polypeptides in a baculovirus/expression system; cell
culture technology is generally known to those skilled in
the art. See e.q., Summers and Smith supra.
The modified insect cel}s may then be grown in an
appropriate nutrient medium, which allows for stable
maintenance of the plasmid(s) present in the modified insect
host. Where the expression product gene is under inducible
control, the host may be grown to high density, and
expression induced. Alternatively, where expression is
constitutive, the product will be continuously expressed
into the medium and the nutrient medium must be continuously
circulated, while removing the product of interest and
augmenting depleted nutrients. The product may be purified
by such techniques as chromatography, e.g., HPLC, affinity
chromatography, ion exchange chromatography, etc.;
electrophoresis; density gradient centrifugation; solvent
extraction, or the like. As appropriate, the product may ~e
further purified, as required, so as to remove substantially
any insect proteins which are also secreted in the medium or
result from lysis of insect cells, so as to provide a
CA 02244800 1998-07-31
W O 97/Z9771 PCTAB97/00183
29
product which is at least substantially free of host debris,
- ~ e.g., proteins, lipids and polysaccharides.
In order to obtain protein expression, recombinant host
cells derived from the transformants are incubated under
conditions which allow expression of the recombinant protein
encoding sequence. These conditions will vary, dependent
upon the host cell selected. However, the conditions are
readily ascertaina~le to those of ordinary skill in the art,
based upon what is known in ~he art.
iii. Bacterial Systems
Bacterial expression techniques are known in the art. A
bacterial promoter is any DNA sequence capable of binding
bacterial RNA polymerase and initiating the downstream (3")
transcription of a coding sequence (e.g. structural gene)
into mRNA. A promoter will have a transcription initiation
region which is usually placed proximal to the 5' end of the
coding sequence. This transcription initiation region
usually includes an RNA polymerase binding site and a
transcription initiation site. A bacterial promoter may
also have a second domain called an operator, that may
overlap an ad~acent RNA polymerase binding site at which RNA
synthesis begins. The operator permits negative regulated
(inducible) transcription, as a gene repressor protein may
bind the operator and thereby inhibit transcription of a
specific gene. Constitutive expression may occur in the
absence of negative regulatory elements, such as the
operator. In addition, positive regulation may be achieved
by a gene activator protein binding sequence, which, if
present is usually proximal (5') to the RNA polymerase
binding sequence. An example of a gene activator protein is
the catabolite activator protein (C~P), which helps initiate
transcription of the lac operon in Escherichia col i fE.
coli~ [Raibaud et al. (1984) Annu. Rev. Genet. 18:173].
Regulated expressiOn may therefore be either positive or
negative, thereby either enhancing or reducing
CA 02244800 1998-07-31
W O97/29771 PCT~B97/OU183
transcription.
Sequences encoding metabolic pathway enzymes provide
particularly useful promoter sequences. Examples include
promoter sequences derived from sugar metabolizing enzymes,
such as galactose, lactose (lac) [Chang et al. (1977) Nature
198:1056], and maltose. Additional examples include
promoter sequences derived from biosynthetic enzymes such as
tryptophan (tr~) tGoeddel et al. (1980) Nuc. Acids Res.
8:4057; Yelverton et al . (1981) Nucl. Acids Res. 9:731; U.S.
Patent No. 4,738,921; EPO Publ. Nos. 036 776 and 121 775].
The g-laotamase (bla) promoter system [Weissmann (1981) "The
cloning of interferon and other mistakes." In Interferon 3
(ed. I. Gresser)], bacteriophage lambda PL [Shimatake et al.
(1981) Nature 292:128] and T5 [U.S. Patent No. 4,689,406]
promoter systems also provide useful promoter sequences.
In addition, synthetic promoters which do not occur in
nature also function as bacterial promoters. For example,
transcription activation sequences of one bacterial or
bacteriophage promoter may be joined with the operon
sequences of another bacterial or bacteriophage promoter,
creating a synthetic hybrid promoter [U.S. Patent
No. 4,551,433]. For example, the tac promoter is a hybrid
tr~ promoter comprised of both tr~ promoter and lac
operon sequences that is regulated by the lac repressor
[Amann et al. (1983) Gene 25:167; de Boer et al. (1983)
Proc. Natl. Acad. Sci. 80:21]. Furthermore, a bacterial
promoter can include naturally occurring promoters of non-
bacterial origin that have the ability to bind bacterial RNA
polymerase and initiate transcription. A naturally
occurring promoter of non-bacterial origin can also be
coupled with a compatible RNA polymerase to produce high
levels of expression of some genes in prokaryotes. The
bacteriophase T7 RNA polymerase/promoter system is an
example of a coupled promoter system [Studier et al. (1986)
J. MQ1 . Biol. 189:113; Tabor et al. (1985) Proc Natl. Acad.
Sci. 82:1074]. In addition, a hybrid promoter can also be
CA 02244800 1998-07-31
W O 97/29771 PCT~B97/00183
comprised of a bacteriophage promoter and an E. coli
~ ~ operator region (EP0 Publ. No. 267 851).
In addition to a functioning promoter sequence, an efficient
ribosome binding site is also useful for the expression of
foreign genes in prokaryotes. In E. coli, the ribosome
binding site is called the Shine-Dalgarno (SD) sequence and
includes an initiation codon (ATG) and a sequence 3-9
nucleotides in length located 3-11 nucleotides upstream of
the initiation codon [Shine et al. (1975) Nature 254:34~.
The SD sequence is thought to promote binding of mRNA to the
ribosome by the pairing of bases between the SD sequence and
the 3' and of E. coli 16S rRNA ~Steitz et al. (1979)
"Genetic signals and nucleotide sequences in messenger RNA."
In Biological Requlation and Development: Gene Ex~ression
(ed. R.F. Goldberger)]. To express eukaryotic genes and
prokaryotic genes with weak ribosome-binding site [Sambrook
et al. (1989) "Expression of cloned genes in Escherichia
coli." In Molecular Cloninq: A ~aboratorY Manual].
A DNA molecule may be expressed intracellularly. A promoter
sequence may be directly linked with the DNA molecule, in
which case the first amino acid at the N terminus will
always be a methionine, which is encoded by the ATG start
codon. If desired, methionine at the N-terminus may be
cleaved from the protein by n vitro incubation with
cyanogen bromide or by either n vivo on n vitro incubation
with a bacterial methionine N-terminal peptidase (EP0 Publ.
No. 219 237).
Fusion proteins provide an alternative to direct expression.
Usually, a DNA sequence encoding the N-terminal portion of
an endogenous bacterial protein, or other stable protein, is
fused to the 5' end of heterologous coding sequences. Upon
expression, this construct will provide a fusion of the two
amino acid sequences. For example, the bacteriophage lambda
cell gene can be linked at the 5' terminus of a foreign gene
and expressed in bacteria. The resulting fusion protein
CA 02244800 l998-07-3l
W O97/29771 PCT~B97/00183
32
preferably retains a site ~or a processing enzyme (factor
~ Xa) to cleave the bacteriophage protein from the foreign
gene [Nagai et al. (1984) Nature 309:810]. Fusion proteins
can also be made with sequences from the lacZ [Jia et al.
(1987) Gene 60:1973, trPE [Allen et al. (1987) J.
Biotechnol. 5:93; Makoff et al . (1989) J. Gen. Microbiol.
135:11], and Chev [EPO Publ. No. 324 647] genes. The DNA
sequence at the iunction of the two amino acid sequences may
or may not encode a cleavable site. Another example is a
ubiquitin fusion protein. Such a fusion protein is made
with the ubiquitin region that preferably retains a site for
a processing enzyme (e.g. ubiquitin specific processing-
protease) to cleave the ubiquitin from the foreign protein.
Through this method, native foreign protein can be isolated
[Miller et al. (1989) Bio/Technoloqy 7:698].
Alternatively, foreign proteins can also be secreted from
the cell by creating chimeric DNA molecules that encode a
fusion protein comprised of a signal peptide sequence
fragment that provides for secretion of the foreign protein
in bacteria [U.S. Patent No. 4,336,336]. The signal
sequence fragment usually encodes a signal peptide comprised
of hydrophobic amino acids which direct the secretion of the
protein from the cell. The protein is either secreted into
Z5 the growth media (gram-positive bacteria) or into the
periplasmic space, located between the inner and outer
membrane of the cell (gram-negative bacteria). Preferably
there are processing sites, which can be cleaved either in
vivo or n vitro encoded between the signal peptide fragment
and the foreign gene.
DNA encoding suitable signal sequences can be derived from
genes for secreted bacterial proteins, such as the E. coli
outer membrane protein gene (omPA) [Masui et al. (1983), in:
~xPerimental ManiPulatiOn of Gene ExPression; Ghrayeb et al.
(1984) EM~O ~ 3:24373 and the E. coli alkaline phosphatase
signal sequence (PhoA) [Oka et al. (~985) Proc. Natl. Acad.
Sci. 82:7212]. As an additional example, the signal
CA 02244800 1998-07-31
WO97/29771 PCT~B97/00183
33
sequence of the alpha-amylase gene from various Bacillus
~ ~ strains can ~e used to secrete heterologous proteins from B.
subtilis [Palva et al. (1982) Proc. Natl. Acad. Sci. USA
79: 5582; E~O Publ. No. 244 042].
Usually, transcription termination sequences recognized by
bacteria are regulatory regions located 3' to the
translation stop codon, and thus together with the promoter
flank the coding sequence. These sequences direct the
transcription of an mRNA which can be translated into the
polypeptide encoded by the DNA. Transcription termination
sequences frequently include DNA sequences of about 50
nucleotides capable of forming stem loop structures that aid
in terminating transcription. Examples include
transcription termination sequences derived ~rom genes with
strong promoters, such as the t~p gene in E. coli as well as
other biosynthetic genes.
Usually, the above described components, comprising a
promoter, signal sequence (if desired), coding sequence of
interest, and transcription termination sequence, are put
together into expression constructs. Expression constructs
are often maintained in a replicon, such as an
extrachromosomal element (e.g., plasmids) capable of stable
maintenance in a host, such as bacteria. The replicon will
have a replication system, thus allowing it to be maintained
in a procaryotic host either for expression or for cloning
and amplification. In addition, a repllcon may be either a
high or low copy number plasmid. A high copy number plasmid
will generally have a copy number ranging from about 5 to
about 200, and usually about lO to about l50. A host
containing a high copy number plasmid will preferably
contain at least about lO, and more preferably at least
about 20 plasmids. Either a high or low copy number vector
may be selected, depending upon the effect of the vector and
the foreign protein on the host.
Alternatively, the expression constructs can be integrated
CA 02244800 l998-07-3l
W O97/29771 PCT~B97/00183
34
into the bacterial genome with an integrating vector.
~ Integrating vectors usually contain at least one sequence
homologous to the bacterial chromosome that allows the
vector to integrate. Integrations appear to result from
recombinations between homologous DNA in the vector and the
bacterial chromosome. For example, integrating vectors
constructed with DNA from various Bacillus strains integrate
into the Bacillus chromosome (EP0 Publ. No. 127 328).
Integrating vectors may also be comprised of bacteriophage
or transposon sequences.
Usually, extrachromosomal and integrating expression
constructs may contain selectable markers to allow for the
selection of bacterial strains that have been transformed.
Selectable markers can be expressed in the bacterial host
and may include genes which render bacteria resistant to
drugs such as ampicillin, chloramphenicol, erythromycin,
kanamycin (neomycin), and tetracycline ~Davies et al. (1978)
Annu. Rev.Microbiol. 32:469~. Selectable markers may also
include biosynthetic genes, such as those in the histidine,
tryptophan, and leucine biosynthetic pathways.
Alternatively, some of the above described components can be
put together in transformation vectors. Transformation
vectors are usually comprised of a selectable market that is
either maintained in a replicon or developed into an
integrating vector, as described above.
Expression and transformation vectors, either extra-
chromosomal replicons or integrating vectors, have beendeveloped for transformation into many bacteria. For
example, expression vectors have been developed for, inter
alia, the following bacteria: Bacillus subtilis tPalva et
al. (1982) Proc. Natl. Acad. Sci. USA 79:5582; EPo Publ.
Nos. 036 259 and 063 953; PCT Publ. No. W0 84/04541],
Escherichia coli [Shimatake et al. (1981) Nature 292:128;
Amann et al. (1985) Gene 40:183; Studier et al. (1986) J.
Mol. ~iol. 189:113; EP0 Publ. Nos. 036 776, 136 829 and 136
-
CA 02244800 1998-07-31
W O 97/29771 PCT~B97/~0183
907], Streptococcus cremoris tPowell et al. (1988) A~pl.
~ ~ Environ. Microbiol. 54:655]; Streptococcus lividans [Powell
et al. (1988) Appl. Environ. Microbiol. 54:655],~
Streptomyces lividans [U.S. Patent No. 4,745,0563.
~ 5
Methods of introducing exogenous DNA into bacterial hosts
are well-known in the art, and usually include either the
transformation of bacteria treated with CaC12 or other
agents, such as divalent cations and DMS0. DNA can also be
introduced into bacterial cells ~y electroporation.
Transformation procedures usually vary with the bacterial
species to be transformed. See e.g., [Masson et al. (1989)
FEMS Microbiol. Lett. 60:273; Palva et al. (1982) Proc.
~atl. Acad. sci. USA 79:5582; EPO Publ. Nos. 036 259 and 063
953; PCT Publ~ No. W0 84/04541, Bacillus], tMiller et al.
(1988) Proc. Natl. Acad. Sci. 85:856; Wang et al. (1990~ J.
Bacteriol. 172:949, Campylobacter], [Cohen et al. (1973)
Proc. Natl. Acad. Sci. 69:2110; Dower et al. ~1988) Nucleic
Acids Res. 16:6127; Kushner t1978) "An improved method for
transformation of Escherichia coli with ColEl-derived
plasmids. In Genetic Enqineerinq: Proceedinqs of the
International Svm~osium on Genetic Enqineerinq (eds. H.W.
Boyer and S. Nicosia); Mandel et al. (1970) J. Mol. Biol.
53:159; Taketo (1988) Biochim. Bio~hvs. Acta 949:318;
Escherichia]/ ~Chassy et al. (1987) FEMS Microbiol. Lett.
44:173 ~actobacillus]; ~Fiedler et al. (1988) Anal. Biochem
~70:38, Pseudomonas]; tAugustin et al. (1990) FEMS
Microbiol. Lett. 66:203, Staphylococcus], [Barany et al
(1980) J. Bacteriol. 144:698; Harlander (1987)
"Transformation of Streptococcus lactis by electroporation,
in: Stre~tococcal Genetics (ed. J. Ferretti and R. curtiss
III); Perry et al. (1981) Infec. Immun. 32:1295; Powell et
al. (1988) APP1. Environ. Microbiol. 54:655; Somkuti et al.
(1987) Proc. 4th Evr. Cona. Biotechnoloqy 1:412,
Streptococcus].
iv. Yeast Expression
CA 02244800 1998-07-31
W O97129771 PCT~B97/00183
36
Yeast expression systems are also known to one of ordinary
~ ~ skill in the art. A yeast promoter is any DNA sequence
capable of binding yeast RNA polymerase and initiating the
downstream (3') transcription of a coding sequence (e.g.
structural gene) into mRNA. A promoter will have a
transcription initiation region which is usually placed
proximal to the 5' end of the coding sequence. This
transcription initiation region usually includes an RNA
polymerase ~inding site ~the "TATA Box") and a transcription
initiation site. A yeast promoter may also have a second
domain called an upstream activator sequence (UAS), which,
if present, is usually distal to the structural gene. The
UAS permits regulated (inducible) expression. Constitutive
expression occurs in the absence of a UAS. Regulated
expression may be either positive or negative, thereby
either enhancing or reducing transcription.
Yeast is a fermenting organism with an active metabolic
pathway, therefore sequences encoding enzymes in the
metabolic pathway provide particu~arly useful promoter
sequences. Examples include alcohol dehydrogenase (ADH)
(EPO Publ. No. 284 044), enolase, glucokinase, glucose-6-
phosphate isomerase, glyceraldehyde-3-phosphate-
dehydrogenase (GAP or GAPDH), hexokinase,
phosphofructokinase, 3-phosphoglycerate mutase, and pyruvate
kinase (PyK) (EPO Publ. No. 329 203); The yeast PHO5 gene,
encoding acid phosphatase, also provides useful promoter
sequences tMyanohara et al. (1983) Proc. Natl. Acad. Sci.
USA 80:1].
In addition, synthetic promoters which do not occur in
nature also function as yeast promoters. For example, UAS
sequences of one yeast promoter may be joined with the
transcription activation region of another yeast promoter,
creating a synthetic hybrid promoter. Examples of such
hybrid promoters include the ADH regulatory sequence linked
to the GAP transcription activation region (U.S. Patent Nos.
4,876,197 and 4,880,734). Other examples of hybrid
CA 02244800 1998-07-31
W O97/29771 PCT~B97/00183
37
promoters include promoters which consist of the regulatory
sequences of either the ADH2, GAL4, GA~10, OR PH05 genes,
combined with the transcriptional activation region of a
glycolytic enzyme gene such as GAP or PyK (EPO Publ. No. 164
556~. Furthermore, a yeast promoter can include naturally
occurring promoters of non-yeast origin that have the
ability to bind yeast RNA polymerase and initiate
transcription. Examples of such promoters include, inter
alia, [Cohen et al. (1980) Proc. Natl. Acad. Sci. USA
77:1078; Henikoff et al. (1981) Nature 283:835; Hollenberg
çt al. (1981) Curr. To~ics Microbiol. Immunol. 96:119;
Hollenberg et al. (1979) "The Expression of Bacterial
Antibiotic Resistance Genes i the Yeast Saccharomyces
cerevisiae," in: Plasmids of Medical Environmental and
Commercial Im~ortance (eds. K>N> Timmis and A. Puhler);
Mercerau-Puigalon et al. (1980) Gene 11:163; Panthier et al.
(1980) Curr. Genet. 2:109;].
A DNA molecule may be expressed intracellularly in yeast.
A promoter sequence may be directly linked with the DNA
molecule, in which case the first amino acid at the N-
terminus of the recombinant protein will always be a
methionine, which is encoded by the ATG start codon. If
desired, methionine at the N-terminus may be cleaved from
the protein by n vitro incubation with cyanogen bromide.
Fusion proteins provide an alternative for yeast expression
systems, as well as in mammalian, baculovirus, and bacterial
expression systems. Usually, a DNA sequence encoding the N-
terminal portion of an endogenous yeast protein, or otherstable protein, is fused to the 5' end of heterologous
coding sequences. Upon expression, this construct will
provide a fusion of the two amino acid sequences. For
example, the yeast or human superoxide dismutase (SOD) gene,
can be linked at the 5' terminus of a foreign gene and
expressed in yeast. The DNA sequence at the junction of the
two amino acid sequences may or may not encode a cleavable
site. See e.g., EPO Publ. No. 196 056. Another example is
CA 02244800 1998-07-31
W O 97/29771 PCT~B97/00183
38
a ubiquitin fusion protein. Such a fusion protein is made
~ ' with the ubiquitin region that preferably retains a site for
a processing enzyme (e.g. ubiquitin-specific processing
protease) to cleave the u~iquitin from the foreign protein.
Through this method, therefore, native foreign protein can
be isolated (see, e.g., PCT Publ. No. WO 88/024066).
Alternatively, foreign proteins can also be secreted from
the cell into the growth media by creating chimPric DNA
molecules that encode a fusion protein comprised of a leader
sequence fragment that provide for secretion in yeast of the
foreign protein. Preferably, there are processing sites
encoded between the leader fragment and the foreign gene
that can be cleaved either in vivo or in vitro. The leader
se~uence fragment usually encodes a signal peptide comprised
of hydrophobic amino acids which direct the secretion of the
protein from the cell.
DNA encoding suitable signal sequences can be derived from
genes for secreted yeast proteins, such as the yeast
invertase gene (EPO Publ. No. 012 873; JPO Publ. No.
62,096,086~ and the A-factor gene (U.S. Patent No.
4,588,684). AlternatiVely, leaders of non-yeast origin,
such as an interferon leader, exist that also provide for
secretion in yeast (EPO Publ. No. 060 057).
A preferred class of secretion leaders are those that employ
a fragment of the yeast alpha-factor gene, which contains
both a "pre" signal sequence, and a "pro" region. The types
of alpha-factor fragments that can be employed include the
full-length pre-pro alpha factor leader (about 83 amino acid
residues) as well as truncated alpha-factor leaders (usually
about 25 to about 50 amino acid residues) (U.S. Patent Nos.
4,546,083 and 4,870,008; EPO Publ. No. 324 274). Additional
leaders employing an alpha-factor leader fragment that
provides for secretion include hybrid alpha-factor leaders
made with a presequence of a first yeast, but a pro-region
from a second yeast alphafactor. (See e.g., PCT Publ. No.
CA 02244800 1998-07-31
W O 97/29771 PCT~B97/00183
39
WO 89/02463.)
Usually, transcription termination sequences recognized by
yeast are regulatory regions located 3' to the translation
stop codon, and thus together with the promoter flank the
coding sequence. These sequences direct the transcription
of an mRNA which can be translated into the polypeptide
encoded by the DNA. Examples o~ transcription ~erminator
sequence and other yeast-recognized termination sequences,
such as those coding for glycolytic enzymes.
Usually, the above described components, comprising a
promoter, leader (if desired), coding sequence of interest,
and transcription termination sequence, are put together
into expression constructs. Expression constructs are often
maintained in a replicon, such as an extrachromosomal
element (e.g., plasmids) capable of stable maintenance in a
host, such as yeast or bacteria. The replicon may have two
replication systems, thus allowing it to be maintained, for
example, in yeast for expression and in a procaryotic host
for cloning and amplification. Examples of such yeast-
bacteria shuttle vectors include YEp24 [Botstein et al.
(1979) Gene 8:17-24], pCl/1 [Brake et al. (1984) Proc. Natl.
Acad. Sci USA 81:4642-4646], and YRpl7 [Stinchcomb et al.
(1982) J. Mol. Biol. 158:157~. In addition, a replicon may
be either a high or low copy number plasmid. A high copy
number plasmid will generally have a copy number ranging
from about 5 to about 200, and usually about 10 to about
150. A host containing a high copy number plasmid will
preferably have at least about 10, and more preferably at
least about 20. Enter a high or low copy number vector may
be selected, depending upon the effect of the vector and the
foreign protein on the host. See e.g., Brake et al., su~ra.
r
Alternatively, the expression constructs can be integrated
into the yeast genome with an integrating vector.
Integrating vectors usually contain at least one sequence
homologous to a yeast chromosome that allows the vector to
CA 02244800 l998-07-3l
W O 97/29771 PCT~B97/00183
integrate, and preferably contain two homologous sequences
flanking the expression construct. Integrations appear to
result from recombinations between homologous DNA in the
vector and the yeast chromosome [Orr-Weaver et al. (1983)
5 Methods in EnzYmol. 101:228--245]. An integrating vector may
be directed to a specific locus in yeast by selecting the
appropriate homologous sequence for inclusion in the vector.
See Orr-Weaver et al., supra. One or more expression
construct may integrate, possibly affecting levels of
recombinant protein produced [Rine et al. (1983) Proc. Natl.
Acad. Sci. USA 80:6750]. The chromosomal sequences included
in the vector can occur either as a single segment in the
vector, which results in the integration of the entire
vector, or two segments homologous to adjacent segments in
the chromosome and flanking the expression construct in the
vector, which can result in the stable integration o~ only
the expression construct.
Usually, extrachromosomal and integrating expression
constructs may contain selectable markers to allow for the
selection of yeast strains that have been transformed.
Selectable markers may include biosynthetic genes that can
be expressed in the yeast host, such as ADE2, HIS4, LEU2,
TR~1, and A~G7, and the G418 resistance gene, which confer
resistance in yeast cells to tunicamycin and G418,
respectively. In addition, a suitable selectable marker may
also provide yeast with the ability to grow in the presence
of toxic compounds, such as metal. For example, the
presence of CUP1 allows yeast to grow in the presence o~
copper ions [Butt et al. (1987) Microbiol, Rev. 51:351~.
Alternatively, some o~ the above described components can be
put together into transformation vectors. Transformation
vectors are usually comprised o~ a selectable marker that is
either maintained in a replicon or developed into an
integrating vector, as described above.
Expression and transformation vectors, either
CA 02244800 1998-07-31
W O 97129771 PCT~B97/00183
41
extrachromosomal replicons or integrating vectors, have been
developed for transformation into many yeasts. For example,
expression vectors have been developed for, inter alia, the
following yeasts:Candida albicans ~Kurtz, et al. (1986) Mol.
Cell. Biol. 6:142], Candida maltose [Kunze, et al. (1985) J.
Basic Microbiol. 25:141]. Hansenula polymorpha [Gleeson, et
al. (1986) J. Gen- Microbiol. 132:34Sg; Roggenkamp et al.
(1986~ Mol. Gen. Genet- 202:302], Kluyveromyces fragilis
CDas, et al. (1984) J. Bacteriol. 158:1165], Xluyveromyces
lactis [De Louvencourt et al. (1983) J. Bacteriol. 154:737;
Van den Berg et al. (1990) Bio/Technoloqv 8:135], Pichia
guillerimondii ~Kunze et al. (1985) J. Basic Microbiol.
25:141], Pichia pastoris [Cregg, et al. (1985) Mol. Cell.
Biol. 5:3376; U.S. Patent Nos. 4,837,148 and 4,929,555~,
Saccharomyces cerevisiae [Hinnen et al. (1978) Proc. Natl.
Acad. Sci. USA 75:1929; Ito et al. (1983) J. Bacteriol.
153:163], Schizosaccharomyces pombe [Beach and Nurse (1981~
Nature 300:706], and Yarrowia lipolytica [Davidow, et al.
(1985) Curr. Genet. 10:380471 Gaillardin, et al. (1985)
Curr. Genet. 10:49].
Methods of introducing exogenous DNA into yeast hosts are
well-known in the art, and usually include either the
transformation of spheroplasts or of intact yeast cells
treated with alkali cations. Transformation procedures
usually vary with the yeast species to be transformed. See
e.g., [Kurtz et al. (1986) Mol. Cell~ Biol. 6:142; Kunze et
al. (1985) J. Basic Microbiol. 25:141; Candida]; ~Gleeson et
al. (1986) J. Gen. Microbiol. 132:3459; Roggenkamp et al.
(1986) Mol. Gen. Genet. 202:302; Hansenula]; [Das et al.
(1984) J. Bacteriol. 158:1165; De Louvencourt et al. (1983)
J. Bacteriol. 154:1165; Van den Berg et al. (19gO)
Bio/Technoloqy 8:135; Kluyveromyces]; [Cregg et al. ~1985)
Mol. Cell. Biol. 5:3376; Kunze et al. (1985) J. Basic
Microbiol. 25:141; U.S. Patent Nos. 4,837,148 and 4,929,555;
Pichia]; [Hinnen et al. (1978) Proc. Natl. Acad. Sci. USA
75;1929; Ito et al. (1983) ~. Bacteriol. 153:163
Saccharomycesl; ~Beach and Nurse (19813 Nature 300:706;
CA 02244800 1998-07-31
W O 97/29771 rCT~B97/00183
42
Schizosaccharomyces]; [Davidow et al. (1985) Curr. Genet.
10:39i Gaillardin et al. (1985) Curr. Genet. 10:49;
Yarrowia].
1 Preparation of CT-S106 mutant
1.1 Source of CT DNA
A 1.1 kb XbaI-~indIII fragment of pJM17 plasmid (Pearson et
lOal . (1982) PNAS USA 79: 2976--2980), containing the ctxAB
gene, was amplified by the polymerase chain reaction (PCR)
using the following oligonucleotide primers:
5 GGCAGATTCTAGACCTCCTGATGAAATAAA3 (ctxA)
and
155TGAAGTTTGGCGAAGCTTCTTAATTTGCCATACTAATTGCG3 (ctxB).
~The 5' XbaI site corresponds to the site in pJM17 and the
3' HindIII site was created by the PCR procedure). The
amplified XbaI-HindIII fragment was subcloned in pEMBL 19
vector (Dente et al. (1983) NAR 11: 1645-1655), generating
the pEMBL19-CT vector which was used for site-directed
mutagenesis (Zoller et al . ( 1982) NAR 10:6487).
1.2 Methods of mutation
Site-directed mutagenesis was performed according to the
method of Zoller (see above) on single-stranded DNA of
pEMBL19-CT plasmid. The oligonucleotide used:
5 GGCATACAGTAGCCATCCAGA3 (oligoCT-S106)
m~tates the codon for ProlO6 to a Ser codon.
1.3 Expression and purification of the CT-S106 mutant.
The mutated XbaI-~indIII fragment containing the S106
mutation (ProlO6-Ser) was subcloned under the control of CT
promoter into pGEM-3 vector (Promega, Madison, USA),
generating the pGEM/CT-S106 vector. V. chol erae 0395-NT
strains were transformed with pGEM/CT-S106 plasmid ~y
CA 02244800 1998-07-31
W O 97/29771 PCT~B97/00183
electroporation (Sambrook et al. (1989~ Molecular cloning -
A laboratory manual. Cold spring Harbor Laboratory Press,
Cold Spring Harbor, NY). The mutant protein was purified
from the culture supernatant of V. cholerae strain and
S purified.
After culturing transformed V. cholerae in Syncase modified
medium (Lebens et al . (1993) Biotechnology 11: 1574-1578),
the culture was centrifuged and the secreted soluble CT-S106
10 protein was precipitated from the culture supernatant by
adding 2.5 g/l sodium hexametaphosphate and then adjusting
to pH 4.5 with concentrated HCl (Rappaport et al . (1974)
Infect. Immun. 9: 294) . After centrifuging, the resulting
precipitate was re-dissolved in 0.1 M sodium phosphate, pH
15 8, dialyzed against 10 mM sodium phosphate, pEI 7 (Mekalanos
et al . (1988) Methods Enzymol . 165 : 169-175), and loaded on
a CM-Sepharose column (Pharmacia LKB, Uppsala, Sweden). The
column was eluted first with 20 mM sodium phosphate buffer,
pH 7.5, and then with 40 mM sodium phosphate buffer, pH 7.5.
2 Properties of the CT-S106 mutant
2.1 Toxicity
25 Toxic activity on Yl cells.
The morphological change caused by CT on Yl adrenal cells
(Donta et al. (1973) Science 183:334) was used to detect the
toxic activity of the CT-Sl06 mutant. 25,u1 of medium
(nutrient mixture Ham's F-lO supplemented with 2mM
30 glutamine, 50mg gentamycin, 1.596 horse serum) was added to
each well of the microtitre plate. 25,u1 of protein solution,
containing 80pg of wild-type CT or 18.75,ug of CT-S106, was
added in the first well and then twelve serial 1:2 dilutions
were made (till 1:4096). 50,000 cells were added to each
35 well (200,~1 volume) and then the plate was incubated at 37~C
in a humidified atmosphere of 95% air, 5% C02. The results
were recorded after 48hr of incubation by visual inspection
of the wells using an inverted microscope.
CA 02244800 1998-07-31
W O97/29771 PCT~B97/00183
Wild-type CT was toxic until the 1:4 dilution and was non-
toxic from the 1:8 dilution; CT-S106 was toxic until 1:32
dilution, and was non-toxic from 1:64 dilution.
CT is therefore toxic at concentrations of lOpg/well and
greater, and non-toxic at concentrations of 5pg/well and
below; CT-S106 is toxic at concentrations of 0.6~g/well and
greater, and non-toxic at 0.3~g/well and below. This
represents a 30,000x reduction in toxicity.
Rabbit ileal loop assay.
New Zealand adult rabbits (ca. 2.5 kg) were used for the
assay. The rabbits were starved for 24 hrs before the
experiment. Before the operation, the rabbits were
anaesthetised and fixed on the operation table. The abdomen
of the rabbit was opened with a scalpel and the intestine
was extracted. The caecum was located, and 20-30 cm away
from this tract of intestine (towards the stomach) 12-14
loops were made (each 5-6 cm in length) up to the
approximate end of the intestine proximal to the stomach.
Five lml samples of wild-type CT in PBS buffer were prepared
with concentrations of l.00, 0.50, 0.25, 0.10, 0.05 ~g/ml.
Mutant CT-S106 was similarly diluted to give five lml
samples with concentrations of 750, 100, 10, 1, 0.5 ~g/ml.
The samples was injected into separate ileal loops, with a
control loop receiving lml PBS. The abdomen was then closed.
After 18-20 hrs, the volume of liquid accumulated in each
loop was measured with a syringe. The length of each loop
was measured again. The results, from 4 different rabbits,
expressed as volume of liquid per unit length of the loop
(ml/cm) are reported in the Tables 1 and 2.
These data show that as little as 50ng of wild-type CT was
able to induce a fluid accumulation in the intestinal loop
of rabbits, whereas lOO~g of CT-S106 did not produce
CA 02244800 l998-07-3l
W O 97/29771 PCT~B97/00183
significant fluid accumulation, this requiring 750 ~g of
CT-S106.
I
~ABLE 1: TOXICITY CUR~E OF WILD-TYPE CT
~g of toxin 1.00 0.50 0.25 0.10 0.05
liquid in the 2.0 Z.0 2.0 1.8 1.3
loop (ml/cm)
10 TABLE 2: TOXICITY CUR~E OF MUTANT CT-S106
~g of toxin 750 100 10 1 0.5
liquid in the 1.6 0.1 0.0 0.0 0.0
loop (ml/cm)
2.2 Immunogenicity and Adjuvanticity.
The mucosal immunogenicity of CT-S106 and its adjuvanticity
was tested using the protocol of Douce et al. (PNAS 92,
1644-1648 (1995)). Five mice were i ln;sed intranasally
with l~g CT or CT-S106 and 10~g Fragment C of tetanus toxin.
All the animals were immunized on day 1 and day 22.
Responses were followed by assaying sample bleeds collected
on day 0 and day 21. On day 35 the mice were challenged with
100xLDs0tetanus toxin (The tetanus toxin was not completely
active, so 100xLD50 was used instead of 10xLD50). The results
are shown Tables 3 and 4.
TABLE 3
Titres of anti-CT specific IgG in sera of immunised mice
Mean antibody titre to cholera toxin after
Immunogen 21 days 35 days
Wild-type CT 1:5800 1:87000
CT-S106 1:1250 1:11000
CA 02244800 1998-07-31
W O 97/29771 PCT~B97/00183
46
TABLE 4
Immunogen Animals with Mean Antibody Survival at
measurable titre to lOOxLD50
antibody tetanus with
titres to toxin tetanus
(Intranasal tetanus toxin
Immunisation) toxin
Fragment C 5/5 1:129399 5/5
+CT
Fragment C 5/5 1:23413 5/5
~CT-S106
Fragment C 2/5 1:393 2/5
These data show that intranasal immunisation with Fragment
C of tetanus toxin alone does not afford protection against
subsequent challenge. The additional presence of CT-S106,
however, protects against lethal challenge with tetanus
toxin, showing that CT-S106 acts as mucosal adjuvant.
CT-specific antibodies were measured using a GM1 capture
ELISA (Douce et al.~. Plates were coated overnight at 4~C
with 100~1/well of 1.5~g/ml GMl ganglioside solution (Sigma
Chemical Co., St. Louis, USA). Plates were washed three
times with PBS/T (PBS + 0.05% Tween 20). 200~1/well of 1%
BSA were added and the plates were incubated for 1 hour at
37~C. 100~1/well of CT were added and incubated overnight at
4~C. Dilutions of serum from each mouse (1:50 dilution and
eight subsequent 1:5 dilutions~ were added to the wells. The
3S plates were then incubated for 2 hours at 37~C, washed as
described above, and incubated with anti-mouse
immunoglobulin G conjugated to alkaline phosphatase (Sigma).
After three washes, the substrate of alkaline phosphatase
(pNPP) was added and the absorbancies were read at 405nm.
ELISA titres were determined arbitrarily as the dilution
CA 02244800 1998-07-31
W O 97/29771 PCTAB97/00183
corresponding to OD405= 0-3
Fragment C specific antibodies were measured using an ELISA.
Plates were coated overnight at 4~C with 50~1/well of
lO~g/ml tetanus toxoid diluted in PBS. Plates were washed
three times with PBS/T. 200~1/well of 1% BSA were added and
the plates were incubated for 1 hour at 37~C. Dilutions of
serum from each mouse (1:50 dilution and eight subsequent
1:5 dilutions) were added to the wells. The plates were
incubated for 2 hours at 37~C, washed as described above,
and incubated with anti-mouse immunoglobulin G conjugated to
alkaline phosphatase (Sigma). After three washes, the
substrate of alkaline phosphatase (pNPP) was added and the
absorbancies were read at 405nm. ELISA titres were
determined arbitrarily as the dilution corresponding to
OD40~ 0-3-
It will be understood that the invention is described aboveby way of example only and modifications may be made within
the scope and spirit of the invention.
