Note : Les descriptions sont présentées dans la langue officielle dans laquelle elles ont été soumises.
CA 02246623 1998-10-07
1
TITLE OF THE INVENTION
OLIGONUCLEOTIDE PRIMERS THAT DESTABILIZE
NON-SPECIFIC DUPLEX FORMATION AND REDUCE MISPRIMING
DURING cDNA LIBRARY CONSTRUCTION AND USES THEREOF.
FIELD OF THE INVENTION
The present invention relates to genetic engineering.
More specifically, a method is presented for reducing mispriming during
DNA synthesis. In particular, the present invention relates to universal
primers which reduce mispriming during cDNA library construction,
thereby increasing the proportion of cDNA clones having been primed
from the bona fide 3' poly A tail. The present invention further relates to
the use of the discriminating oligonucleotides of the present invention in
other methods such as mRNA purification, PCR-based detection methods
and sequencing.
BACKGROUND OF THE INVENTION
The isolation and rapid mapping of complementary
DNAs (cDNAs) is central to characterizing the information that is of
significant biological relevance in the genome of an organism. A full
length cDNA allows one to predict transcription initiation start sites,
translation initation start sites, deduce certain protein characteristics
based on primary amino acid sequence, predict transcription termination
sites, and visually inspect the 5' and 3' untranslated regions for elements
which may be involved in post-transcriptional regulation of gene
expression. The analysis of several complete cDNAs of a given gene
enables one to gather information on alternative splicing, alternative
CA 02246623 1998-10-07
2
promoter usage, and alternative polyadenylation signals - all events
known to be important in gene expression regulation. In addition, the
comparison of genomic and cDNA sequence is essential to determine
exon-intron structure and document the occurrence of RNA editing - a
post-transcriptional regulatory mechanism on which there is little
information.
The cloning of mRNA into cDNA for the purposes of
functional studies is a complex, interrelated series of enzyme-catalyzed
reactions involving the in vitro synthesis of a DNA copy of mRNA, its
subsequent conversion to duplex cDNA, and insertion into an appropriate
prokaryotic vector. The procedure involves the following series of steps
(outlined in Fig.1):
1 ) Isolation of high quality mRNA from the tissue or cell
line of interest.
2) Annealing of a DNA oligonucleotide, either a mixture
of oligonucleotides of random sequence or an oligo d(T) primer, to the
mRNA. When full-length cDNAs are required, oligo d(T) is utilized, since
this is expected to anneal to the 3' poly (A) tail of the mRNA.
3) Reverse transcriptase is then utilized to prime from
2o the DNA primer and copy the RNA template into cDNA.
4) Second strand synthesis is performed utilizing RNAse
H, DNA polymerase I, and DNA ligase.
5) The ends of the cDNAs are polished, prepared for
cloning, and the cDNAs are introduced into an appropriate cloning vector.
Although a number of different approaches can be used
to generate cDNA libraries, they all suffer from two major problems, often
making the isolation of a complete cDNA an arduous task. The cloning of
CA 02246623 1998-10-07
3
incomplete cDNAs is widespread, resulting in only partial characterization
of mRNA transcripts and significantly increasing the cost and amount of
work required to obtain a full-length copy of the cDNA of interest. One
major reason why many clones in current cDNA libraries are not full-
y length is due to mispriming of the oligo d(T) primer (de Fatima Bonaldo
et al., 1996, Genome Res. _6:791-806). Many eukaryotic mRNAs contain
regions of A-rich stretches within their sequence. Thus oligo d(T) primers
can anneal to these internal A-rich stretches, and when reverse
transcriptase primes from these internal sites, sequence information from
the 3' end of the mRNA is lost during the cDNA cloning process (Fig. 1).
Although the genetic code of most organisms is composed of -- 50%
guanosine + cytosine residues and 50% of adenosine + thymidine
residues, there are well known examples of organisms whose genetic
code deviates from this ratio. For example, the genome of the parasite
responsible for malaria transmission, Plasmodium falciparum, has a
genome of >80% adenosine + thymidine residues (Weber, J.L., 1987,
Gene 52:103-109). This implies that cDNA libraries derived from this
organism will contain many truncated, less-than-full-length clones, due to
mispriming of the oligo d(T) primer during first strand synthesis.
Mispriming is thus a serious hindrance to gene discovery and
characterization.
These technical limitations imply that a set of products
of variable length are often generated during first strand synthesis.
Consequently, a number of truncated clones are present in any given
library. Given these cloning complications, interpretations about gene
structure are sometimes misleading and cDNA cloning is often inefficient,
CA 02246623 1998-10-07
4
costly, and time-consuming - often requiring the sampling of several
different libraries.
The actual procedure for generating cDNA libraries has
not extensively deviated from the original method of Gubler et al., 1983,
Gene 25:263-269. A major limitation of the current technology is that a
set of products of variable length are often generated during first strand
synthesis. Consequently, a number of truncated clones will be present
in libraries for any given gene. Priming from the poly (A) tract of mRNAs
with oligo d(T) is necessary to obtain a copy of the entire 3' untranslated
region. However, it is the experience of many laboratories screening
cDNA libraries, that a significant proportion of clones do not have a bona
fide 3' end, due to misannealing of the oligo d(T) primer to internal A-rich
sites. Indeed, cDNAs with 3' truncations are estimated to occur at
frequencies of 10-15% in some libraires (de Fatima Bonaldo et al., 1996,
supra). Such clones are easily recognized by the absence of a bona fide
polyadenylation signal sequence -20 nucleotides upstream of the oligo
(dA) tail of the cDNA. If enhanced discrimination could be achieved
between annealing to the bona fide poly (A) tail versus internal A-rich
sequences by the Reverse Transcriptase primer, then the frequency of
this "mispriming artifact" would be significantly reduced.
Nucleic acid hybridization, in which a DNA or RNA
strand binds to its complement to form a duplex structure is a
fundamental process in molecular biology. A critical aspect of this
process is the specificity of molecular recognition of one strand by the
other. Sequence differences as subtle as a single base change are
sufficient to enable discrimination of short (e.g. - 14 mer) oligomers, and
are frequently used to detect point mutations in genes (Conner et al.,
CA 02246623 1998-10-07
1983, Proc. Natl. Acad. Sci. USA. 80:278-282.). Molecular discrimination
of single point changes using oligonucleotides has been well documented
and the underlying thermodynamics well characterized (Ikuta et al., 1987,
Nucl. Acids Res. 15:797-811; Doktycz et al., 1995, J. Biol. Chem.
5 270:8439-8445; Southern et al., 1994, Nucl. Acids Res. 22:1368-1373;
Saiki et al., 1989, Proc. Natl. Acad. Sci. USA 86:6230-6234). However,
in many cases, the stability difference between a perfectly matched
complement (e.g. - between a poly (A) tail and oligo d(T),5) and a
complement mismatched at only one base (e.g. - between
AAAAAAATAAAAAAA and oligo d(T),5) can be quite small, corresponding
to as little as 0.5°C difference in their duplex melting temperature
(T,"s)
(Fig. 2). The longer the oligomer of interest (e.g. an oligo d(T)zo primer
versus and oligo d(T),5 primer) the smaller the effect of a single-base
mismatch on overall duplex stability. This limitation in hybridization is the
major reason why oligo d(T) primers often hybridize to internal A-rich
sequences on mRNA templates during cDNA library construction, and
consequently why a large number of clones in such libraries do not
contain the bona fide 3' end.
Guo et al. (1997, Nature Biotech. 15:331-335) have
recently shown that increased discrimination of single nucleotide
mismatches by oligonucleotides can be achieved by introducing artifical
mismatches into the probe oligonucleotide using the base analog 3-
nitropyrrole. This base analog acts as a universal nucleoside that
hydrogen bonds minimally with all four bases without steric disruption of
the DNA duplex (Nichols et al., 1994, Nature 369:492-493). Since
hydrogen bonding between bases of two complementary strands of DNA
are the major thermodynamic forces responsible for maintaining the
CA 02246623 1998-10-07
6
integrity of a double strand DNA duplex, base substitutions with analogs
with lessened hydrogen bond capacity can function as universal
nucleosides (Nichols et al., 1994, supra). A number of different
nucleoside analogs have been developed which function in this fashion
(Millican et al., 1984, Nucl. Acids Res. 12:7435-7453; Inone et al., 1985,
Nucl. Acids Res. 13:7119-7128; Fukada et al., 1986, Naturforsch. B.
41:1571-1579; Seela et al., 1986, Nucl. Acids Res. 14:1825-1844; Eritja
et al., 1986, NucL Acids Res. 14:8135-8153; Habener et al., 1988, Proc.
Natl. Acad. Sci. USA 85:1735-1739; Lin et al., 1989, Nucl. Acids Res.
17:10373-10383; Francois et al., 1990, Tetrahedron Lett. 31:6347-6350;
Brown et al., 1991, Carbohydrate Res. 216:129-139.). Guo et al. (1997,
supra) have shown that the introduction of universal analogues into
heteropolymeric oligonucleotides during their synthesis, increases the
thermal stability (nTm) of hybrids formed between an oligonucleotide with
the universal nucleoside and with normal and single-nucleotide variant
DNA targets by as much as 200%, as compared to hybrids formed
between a wild-type oligonucleotide and normal or single-nucleotide
variant DNA targets.
U.S. patent 5,438,131 of Bergstrom et al. teaches
oligonucleotides of at least 10 nucleosides, composed of at least two
different bases, and containing at least one universal nucleoside and the
use thereof to reduce the element of risk and enhance success in
screening DNA libraries. The universal base is defined in U.S. 5,438,131
as being a modified nucleic acid base that can base-paired with its ally,
one of the common bases A, T, C and G (as well as U). The aim of the
universal base is to reduce degeneracy while still preserving the
uniqueness of the probe. A variety of compounds have been investigated
CA 02246623 1998-10-07
7
as universal bases and a number of them are described in U.S.
5,438,131. In a preferred embodiment, U.S. 5,438,131 relates to
oligonucleotides containing universal nucleosides at degenerate
positions, such that the oligomer allows bonding to unknown bases,
enabling the formation of duplexes with ambiguous or unknown nucleic
acid sequences. In a particularly preferred embodiment, U.S. 5,438,131
relates to 3-nitropyrrole nucleoside as the universal nucleoside. U.S.
5,438,131 thus relates to the use of universal nucleosides in order to
stabilize duplex formation between heteropolymers of oligonucleotides
and a target nucleic acid.
In view of the technical limitations of current methods of
cDNA synthesis, there remains a need to destabilize artefactual duplex
formation to increase the discrimination between specific and non-specific
duplexes, to provide the means to reduce mismatches in general, and
more particularly to reduce mispriming during DNA synthesis, cDNA
library construction, and PCR applications. The present invention seeks
to meet these and other needs.
The present description refers to a number of
documents, the content of which is herein incorporated by reference.
SUMMARY OF THE INVENTION
The invention concerns the identification of primer
modifications that can destabilize artifactual duplex formation and
decrease the number of mismatches between same and its target
sequence.
The invention further concerns the identification of
primer modifications that improve the binding thereof to a homopolymeric
CA 02246623 1998-10-07
8
target sequence. The invention therefore provides oligonucleotides which
are better at discriminating between their homopolymeric complementary
sequence and a related target sequence. In addition, the present
invention provides assays which can be used (and adapted) to identify
oligonucleotide modifications that destabilize mismatches.
The invention also concerns the development of primers
which decrease mispriming events encountered during DNA synthesis.
More specifically, the invention concerns the development of universal
primers which decrease the number of internal mispriming events during
cDNA generation, improving the efficiency of correct priming from the
bona fide 3' poly (A) tail.
The present invention further relates to universal primers
which reduce the proportion of mismatches during genetic engineering
methods such as, for example, mRNA purification, 3' RACE, 5' RACE,
PCR, sequencing and the like. In a particularly preferred embodiment,
the present invention relates to the incorporation of at least one universal
base in a homopolymeric oligonucleotide in order to reduce mismatches
to its homopolymeric target sequence. The invention concerns more
particularly homopolymeric oligonucleotide primers having modifications
which improve their binding to their target sequence.
More specifically, the present invention relates to
primers incorporating 3-nitropyrrole modifications.
The invention also concerns assays to identify
modifications in oligonucleotides which reduce the proportion of
mismatches and mispriming events, comprising a random or rational
design of modifications of a chosen primer, a hybridization thereof with its
target sequence to form a duplex, a synthesis of DNA priming from this
CA 02246623 1998-10-07
9
duplex and an analysis of the synthesized DNA to assess for the
presence of mispriming events, wherein the number of mispriming events
is compared between the DNA synthesis initiated from modified and
control oligonucleotides.
In accordance with the present invention, there is
therefore provided a method for destabilizing non-specific duplex
formation between an oligonucleotide and a target nucleic acid, wherein
at least one of the oligonucleotide and target nucleic acid is a
homopolymeric sequence, comprising an incubation of the target nucleic
acid with a modified oligonucleotide, wherein the modified oligonucleotide
includes modifications which decrease or abrogate hydrogen bonding
between same and non-specific target sequences.
In accordance with the present invention, there is also
provided a method for increasing the proportion of full length cDNA
clones in a library, comprising a use of a modified oligo d(T) primer during
first strand synthesis, wherein the modification decreases or abrogates
hydrogen bonding between the modified oligo d(T) primer and a non-
specific target sequence, thereby increasing the proportion of full length
cDNA clones.
In accordance with another aspect of the present
invention, there is provided a method for reducing mispriming events
during DNA synthesis comprising a use of a modified oligonucleotide to
prime the DNA synthesis, wherein the modification decreases or
abrogates hydrogen bonding between the modified primer and a non-
specific target sequence, thereby reducing mispriming events.
In accordance with yet another aspect of the present
invention, there is provided modified oligonucleotide primers that
CA 02246623 1998-10-07
destabilize non-specific duplex formation and reduce mispriming during
DNA synthesis.
While the method of the instant invention is
demonstrated during first strand cDNA synthesis to improve the quality of
5 cDNA libraries by reducing the number of clones containing aberrant 3'
ends due to oligo d(T) mispairing, and more specifically using the eIF-4GI1
mRNA template, the present invention, which has broad utility, is not so
limited. Although 3' mispairing is a general problem encountered when
generating cDNA libraries from a number of organisms, this problem can
10 be particularly exacerbated when generating cDNA libraries from
organisms that have A rich genomes, since the number of internal A-rich
stretches will be higher in genes from these organisms. This type of
incomplete A-tract is expected to misanneal to oligo d(T) and produce
truncated cDNAs during library construction. An example of such an
organism is Plasmodium falciparum, the parasite responsible for malaria
transmission by mosquitos.
In addition, while the instant invention is demonstrated
using an oligo d(T)~Z primer (an oligo d(T) primer in which two of the
thymine bases are substituted by 3-nitropyrrole), the instant invention is
not so limited. Indeed, the position of the modified bases within the
examplified oligonucleotide, oligo d(T) primer, can be altered (Fig. 2C)
without changing the discrimination between primer and either
complementary template or partially complementary template. Indeed,
Guo et al. (1997, supra) have changed the position of 2 universal
nucleosides within a given heteropolymeric oligonucleotide and shown
that in many cases increased discrimination between pertect matched
template and mismatched template is maintained. Thus, the instant
CA 02246623 1998-10-07
11
invention extends to any homopolymeric oligonucleotide (or any
oligonucleotide designed to bind to a homopolymeric target sequence)
such as an oligo d(T) primer containing modified nucleosides at any
position, provided that such modification maintains the discriminating
ability of the oligonucleotide. It should be clear to the person of ordinary
skill that the present invention further provides the means to assess
whether the modifications alter this discriminating activity of the
oligonucleotide. It should also be clear that any type of homopolymeric-
complementary sequence duplex formation could be improved by the
instant invention. In a broad sense therefore, the present invention
provides the means and method to improve homopolymeric
complementarity sequence duplex formation.
It should be clear to a person of ordinary skill that the
present invention has broad implications since it demonstrates that a
modification which results in destabilization of a duplex (examplified with
oligo d(T), having 2 substitutions, and its poly A target sequence),
significantly decreases the proportion of mismatches and of mispriming
events. Hence, it is expected that other types of destabilization of the
hydrogen bonds between an oligonucleotide and its target sequence
would have the same effect. Non-limiting examples of modifications of
the oligonucleotide which would result in such a destabilization of the
duplex formation, include modifications which reduce or abrogate
hydrogen bonding. Non-limiting more specific examples include known
base modifications, base analogs (e.g. inosine), universal bases, and
partial mismatches. Of course, it will be understood that such
modifications should not favor duplex formation with a non-desired target
sequence.
CA 02246623 1998-10-07
12
It should also be understood that the different
modifications of the oligonucleotides encompassed by the present
invention can be adapted by the person of ordinary skill to suit particular
utilities (i.e. mRNA purification, sequencing).
The present invention should not be limited to the
modifications of oligonucleotides with 3-nitropyrrole, since other universal
bases are well known in the art. Indeed, in addition to 3-nitropyrrole, a
number of universal nucleosides have been synthesized and
characterized (Millican et al. 1984, supra; Inone et al., 1985, supra;
Fukada et al., 1986, supra; Seela et a1.,1986, supra; Eritja et al., 1986,
supra; Habener et al., 1988, supra; Lin et al., 1989, supra; Francois et al.,
1990, supra; Brown et al., 1991, supra). Thus, the present invention
covers any oligo d(T) primer containing any universal nucleoside which
allows for enhanced discrimination when hybridizing to pertect versus
mismatched templates.
A non-limiting example of an alternative use of this
technology is in mRNA purification, by replacing oligo d(T) affinity
matrixes currently employed with modified oligo d(T) according to the
instant invention. An oligo d(T)~Z affinity matrix would perform the same
task, except that binding to internal A-rich stretches would be minimized
and could result in a purification method with a higher stringency than
currently employed. This matrix, for example, could provide a better
selection between eukaryotic mRNA and contaminating mycoplasmic
RNA (which is A-T rich). Since mycoplasms often contaminate tissue
culture cell lines, co-purification of mycoplasma RNA with eukaryotic
mRNA on oligo d(T) column can produce cDNA libraires contaminated
with mycoplasma clones.
CA 02246623 1998-10-07
13
Often the sequence of a particular RNA must be
interogated. Reverse transcriptase (RT), in combination with PCR, can be
used to amplify a given region on an RNA template. The use of oligo
d(T)~Z as primer in the RT reaction would ensure that the 3' end of the
mRNA is represented on the cDNA template. Thus, the present invention
can also be incorporated into current 3' RACE (Rapid Amplification of
cDNA Ends) protocols, designed to obtain the 3' end of a given clone.
In some cloning protocols, first strand synthesis is
followed by homopolymeric tailing of the products utilizing terminal
deoxynucleotidyl transferase. For example, dGTP can be utilized to add
a homopolymeric stretch of G's at the 5' end of the cDNA. Thus the DNA
polymerase utilized in second strand synthesis can take advantage of this
G-stretch by priming from an oligo d(C) primer annealed to the G-stretch
positioned at the 5' end. This procedure has the advantage of maintaining
the sequence at the 5' terminal end of the cDNA, and is also used in 5'
RACE strategies to identify the 5' end of mRNAs (Frohman et al., 1988,
Proc. Natl. Acad. Sci. USA x:8998-9002; Loh et al., 1989, Science
2:217-220) (Fig. 5). One drawback of this approach however is that,
since 5' untranslated regions of mRNAs are usually GC rich, the oligo
d(C) can misprime from internal G-rich regions, producing less than full-
length cDNAs. It is envisaged that the incorporation of universal
nucleosides into such homopolymeric primers would be useful to increase
the specificity of binding and generating cDNAs which terminate at the
bona fide 5' end. Thus, the present invention further relates to cloning
procedures or RACE protocols involving priming of second strand
synthesis from a homopolymeric tail.
CA 02246623 1998-10-07
14
It may be desirable in some PCR protocols to utilize
homopolymeric oligonucleotides containing universal nucleosides (or
other non-specific duplex destabilizing modifications), to achieve
increased discrimination between a target site (or several target sites) of
interest when generating a specific product or a set of products (for
example use of an oligo d(T) primer to prime DNA synthesis from the A-
rich stretch of Alu repeats in humans). Since these products can be
developed to be used as genetic markers (by identifying polymorphisms
residing with the sequence of the product), changing the specificity of
targeting by altering the specificity of the oligo d(T) primer, could result
in
a more consistent representation of the final PCR products. The present
invention thus further relates to the use of universal oligonucleotides or
other modified oligonucleotides, during PCR amplification.
Nucleotide sequences are presented herein by single
strand, in the 5' to 3' direction, from left to right, using the one letter
nucleotide symbols as commonly used in the art and in accordance with
the recommendations of the IUPAC-IUB Biochemical Nomenclature
Commission.
Unless defined otherwise, the scientific and
technological terms and nomenclature used herein have the same
meaning as commonly understood by a person of ordinary skill to which
this invention pertains. Generally, the procedures for cell cultures,
infection, molecular biology methods and the like are common methods
used in the art. Such standard techniques can be found in reference
manuals such as for example Sambrook et al. (1989, Molecular Cloning -
CA 02246623 1998-10-07
A Laboratory Manual, Cold Spring Harbor Laboratories) and Ausubel et
al. (1994, Current Protocols in Molecular Biology, Wiley, New York).
The present description refers to a number of routinely
used recombinant DNA (rDNA) technology terms. Nevertheless,
5 definitions of selected examples of such rDNA terms are provided for
clarity and consistency. For certainty, it is emphasized that the present
invention finds utility with nucleic acids in general. Non-limiting examples
of nucleic acids which can be used in accordance with the teachings of
the present invention include that from eukaryotic cells such as that of
10 animal cells, plant cells, or microorganisms as well as that from
prokaryotic cells.
As used herein, the term "homopolymeric sequences"
refers to a sequence composed essentially of a unique type of common
base (adenosine A; cytosine C; guanine G; thymine T; uracil U) or of a
15 less common base (non-limiting examples including inosine, I; and
pseudouridine, W).
As used herein, "nucleic acid molecule", refers to a
polymer of nucleotides. Non-limiting examples thereof include DNA (i.e.
genomic DNA, cDNA) and RNA molecules (i.e. mRNA). The nucleic acid
molecule can be obtained by cloning techniques or synthesized. DNA
can be double-stranded or single-stranded (coding strand or non-coding
strand [antisense]).
The term "recombinant DNA" as known in the art refers
to a DNA molecule resulting from the joining of DNA segments. This is
often referred to as genetic engineering.
The terminology "amplification pair" refers herein to a
pair of oligonucleotides (oligos) of the present invention, which are
CA 02246623 1998-10-07
16
sequence by one of a number of types of amplification processes,
preferably a polymerase chain reaction. Other types of amplification
processes include ligase chain reaction, strand displacement
amplification, or nucleic acid sequence-based amplification, as explained
in greater detail below. As commonly known in the art, the
oligonucleotides are designed to bind to a complementary sequence
under selected conditions.
The nucleic acid (i.e. DNA or RNA) for practicing the
present invention may be obtained according to well known methods.
Oligonucleotide probes or primers of the present
invention may be of any suitable length, depending on the particular
assay format and the particular needs and targeted genomes employed.
In general, the oligonucleotide probes or primers are at least 10
nucleotides in length, preferably between 12 and 24 molecules, and they
may be adapted to be especially suited to a chosen nucleic acid
amplification system. As commonly known in the art, the oligonucleotide
probes and primers can be designed by taking into consideration the
melting point of hydrizidation thereof with its targeted sequence (see
below and in Sambrook et al., 1989, Molecular Cloning - A Laboratory
Manual, 2nd Edition, CSH Laboratories; Ausubel et al., 1989, in Current
Protocols in Molecular Biology, John Wiley & Sons Inc., N.Y.).
The term "oligonucleotide" or "DNA" molecule or
sequence refers to a molecule comprised of the deoxyribonucleotides
adenine (A), guanine (G), thymine (T) and/or cytosine (C), in a double-
stranded form, and comprises or includes a "regulatory element"
according to the present invention, as the term is defined herein. The
term "oligonucleotide" or "DNA" can be found in linear DNA molecules or
CA 02246623 1998-10-07
17
fragments, viruses, plasmids, vectors, chromosomes or synthetically
derived DNA. As used herein, particular double-stranded DNA
sequences may be described according to the normal convention of
giving only the sequence in the 5' to 3' direction.
As used herein, "oligonucleotides" or "oligos" define a
molecule having two or more nucleotides (ribo or deoxyribonucleotides).
In essence, "oligonucleotides" define at least dimers of nucleotides. The
size of the oligonucleotide will be dictated by the particular situation and
ultimately on the particular use thereof and adapted accordingly by the
person of ordinary skill. An oligonucleotide can be synthesized chemically
or derived by cloning according to well known methods.
Probes and oligonucleotides of the invention can be
utilized with naturally occurring sugar-phosphate backbones as well as
modified backbones including phosphorothioates, dithionates, alkyl
phosphonates and a-nucleotides and the like. Modified sugar-phosphate
backbones are generally taught by Miller, 1988, Ann. Reports Med.
Chem. 23:295 and Moran et al., 1987, Nucleic acid molecule. Acids Res.,
14:5019. Probes of the invention can be constructed of either ribonucleic
acid (RNA) or deoxyribonucleic acid (DNA), and preferably of DNA.
General teachings on the synthesis of oligonucleotides and substituents
and modifications thereof can be found for example in US 5,438,131.
The selection of the best suited synthesis pathway of an oligonucleotide
and of the appropriate modifications, and substituents to be used, may be
selected accordingly by the person of ordinary skill to which the instant
invention pertains.
The modified oligonucleotides of the present invention
can be synthesized chemically or produced through recombinant DNA
CA 02246623 1998-10-07
18
technology. All these methods are well known in the art. In a preferred
embodiment, these modified oligonucleotides are a molecule composed
of a single type of nucleotide (ribo- or deoxyribonucleotides, A, C, G, T or
U) and containing at least one universal nucleoside. The length is
dictated by the particular application. Typically, the oligonucleotide is at
least 10 bases and probably 12-24 bases.
As used herein, a "primer" defines an oligonucleotide
which is capable of annealing to a target sequence, thereby creating a
double stranded region or duplex which can serve as an initiation point for
DNA synthesis under suitable conditions.
"Nucleic acid hybridization" refers generally to the
hybridization of two single-stranded nucleic acid molecules having
complementary base sequences, which under appropriate conditions will
form a thermodynamically favored double-stranded structure. Examples
of hybridization conditions can be found in the two laboratory manuals
referred above (Sambrook et al., 1989, supra and Ausubel et al., 1989,
supra) and are commonly known in the art. In the case of a hybridization
to a nitrocellulose filter, as for example in the well known Southern
blotting procedure, a nitrocellulose filter can be incubated overnight at
65°C with a labeled probe in a solution containing 50% formamide, high
salt (5 x SSC or 5 x SSPE), 5 x Denhardt's solution, 1 % SDS, and 100
Ng/ml denatured carrier DNA (i.e. salmon sperm DNA). The non-
specifically binding probe can then be washed off the filter by several
washes in 0.2 x SSC/0.1% SDS at a temperature which is selected in
view of the desired stringency: room temperature (low stringency), 42°C
(moderate stringency) or 65°C (high stringency). The selected
temperature is based on the melting temperature (Tm) of the DNA hybrid.
CA 02246623 1998-10-07
19
Of course, RNA-DNA hybrids can also be formed and detected. In such
cases, the conditions of hybridization and washing can be adapted
according to well known methods by the person of ordinary skill. Stringent
conditions will be preferably used (Sambrook et a1.,1989, supra).
The types of detection methods in which probes can be
used include Southern blots (DNA detection), dot or slot blots (DNA,
RNA), and Northern blots (RNA detection).
Although the present invention is not specifically
dependent on the use of a label, such a label might be beneficial in
certain embodiments. Probes or oligonucleotides can be labeled
according to numerous well known methods (Sambrook et al., 1989,
supra). Non-limiting examples of labels include 3H, '"C, 3zP, and 35S.
Non-limiting examples of detectable markers include ligands,
fluorophores, chemiluminescent agents, enzymes, and antibodies. Other
detectable markers for use with probes, which can enable an increase in
sensitivity of the method of the invention, include biotin and
radionucleotides. It will become evident to the person of ordinary skill that
the choice of a particular label dictates the manner in which it is bound to
the probe.
As commonly known, radioactive nucleotides can be
incorporated into probes of the invention by several methods. Non-limiting
examples thereof include kinasing the 5' ends of the probes using gamma
'zP ATP and polynucleotide kinase, using the Klenow fragment of Pol I of
E. coli in the presence of radioactive dNTP (i.e. uniformly labeled DNA
probe using random oligonucleotide primers in low-melt gels), using the
SP6/T7 system to transcribe a DNA segment in the presence of one or
more radioactive NTP, and the like.
CA 02246623 1998-10-07
Amplification of a selected, or target, nucleic acid
sequence may be carried out by a number of suitable methods. See
generally Kwoh et al., 1990, Am. Biotechnol. Lab. 8_:14-25. Numerous
amplification techniques have been described and can be readily adapted
5 to suit particular needs of a person of ordinary skill. Non-limiting
examples
of amplification techniques include polymerase chain reaction (PCR),
ligase chain reaction (LCR), strand displacement amplification (SDA),
transcription-based amplification, the Q(3 replicase system and NASBA
(Kwoh et al., 1989, Proc. Natl. Acad. Sci. USA 86, 1173-1177; Lizardi et
10 al., 1988, BioTechnology 6_:1197-1202; Malek et al., 1994, Methods Mol.
Biol., 28:253-260; and Sambrook et al., 1989, supra). Preferably,
amplification will be carried out using PCR.
Polymerase chain reaction (PCR) is carried out in
accordance with known techniques. See, e.g., U.S. Pat. Nos. 4,683,195;
15 4,683,202; 4,800,159; and 4,965,188 (the disclosures of all three U.S.
Patent are incorporated herein by reference). In general, PCR involves,
a treatment of a nucleic acid sample (e.g., in the presence of a heat
stable DNA polymerase) under hybridizing conditions, with one
oligonucleotide primer for each strand of the specific sequence to be
20 detected. An extension product of each primer which is synthesized is
complementary to each of the two nucleic acid strands, with the primers
sufficiently complementary to each strand of the specific sequence to
hybridize therewith. The extension product synthesized from each primer
can also serve as a template for further synthesis of extension products
using the same primers. Following a sufficient number of rounds of
synthesis of extension products, the sample is analysed to assess
whether the sequence or sequences to be detected are present.
CA 02246623 1998-10-07
21
Detection of the amplified sequence may be carried out by visualization
following EtBr staining of the DNA following gel electrophores, or using
a detectable label in accordance with known techniques, and the like. For
a review on PCR techniques (see PCR Protocols, A Guide to Methods
and Amplifications, Michael et al. Eds, Acad. Press, 1990).
Ligase chain reaction (LCR) is carried out in accordance
with known techniques (Weiss, 1991, Science 254:1292). Adaptation of
the protocol to meet the desired needs can be carried out by a person of
ordinary skill. Strand displacement amplification (SDA) is also carried out
in accordance with known techniques or adaptations thereof to meet the
particular needs (Walker et al., 1992, Proc. Natl. Acad. Sci. USA
89:392-396; and ibid., 1992, Nucleic Acids Res. 20:1691-1696).
As used herein, the term "gene" is well known in the art
and relates to a nucleic acid sequence defining a single protein or
polypeptide. A "structural gene" defines a DNA sequence which is
transcribed into RNA and translated into a protein having a specific amino
acid sequence thereby giving rise the a specific polypeptide or protein. It
will be readily recognized by the person of ordinary skill, that the nucleic
acid sequence of the present invention can be incorporated into anyone
of numerous established kit formats which are well known in the art.
The term "vector" is commonly known in the art and
defines a plasmid DNA, phage DNA, viral DNA and the like, which can
serve as a DNA vehicle into which DNA of the present invention can be
cloned. Numerous types of vectors exist and are well known in the art.
The term "allele" defines an alternative form of a gene
which occupies a given locus on a chromosome.
CA 02246623 1998-10-07
22
As commonly known, a "mutation" is a detectable
change in the genetic material which can be transmitted to a daughter
cell. As well known, a mutation can be, for example, a detectable change
in one or more deoxyribonucleotide. For example, nucleotides can be
added, deleted, substituted for, inverted, or transposed to a new position.
Spontaneous mutations and experimentally induced mutations exist. The
result of a mutations of nucleic acid molecule is a mutant nucleic acid
molecule. A mutant polypeptide can be encoded from this mutant nucleic
acid molecule.
As used herein, the term "purified" refers to a molecule
having been separated from a cellular component. Thus, for example, a
"purified protein" has been purified to a level not found in nature. A
"substantially pure" molecule is a molecule that is lacking in all other
cellular components.
The present invention also relates to a kit comprising the
oligonucleotide primers of the present invention. For example, a
compartmentalized kit in accordance with the present invention includes
any kit in which reagents are contained in separate containers. Such
containers include small glass containers, plastic containers or strips of
plastic or paper. Such containers allow the efficient transfer of reagents
from one compartment to another compartment such that the samples
and reagents are not cross-contaminated and the agents or solutions of
each container can be added in a quantitative fashion from one
compartment to another. Such containers will include a container which
will accept the test sample (DNA or cells), a container which contains the
primers used in the assay, containers which contain enzymes, containers
CA 02246623 1998-10-07
23
which contain wash reagents, and containers which contain the reagents
used to detect the extension products.
BRIEF DESCRIPTION OF THE DRAWINGS
Having thus generally described the invention, reference
will now be made to the accompanying drawings, showing by way of
illustration a preferred embodiment thereof, and in which:
Figure 1 (PRIOR ART) shows an example of the steps
involved in generating cDNA libraries from mRNA. Although a number of
strategies can be used for cDNA library generation, of which only one is
shown above, all libraries require as a first step, a primer from which the
reverse transcriptase (RT) can prime. In the case of full-length cDNA
libraries, an oligo d(T) primer is used because it anneals to the 3' poly (A)
tail of the eukaryotic mRNAs. In the case of prokaryotic, some viral, or
other eukaryotic mRNAs which lack a poly (A) tail, a homopolymeric
stretch of nucleoside 5'-monophosphates can be added to the 3' end of
the mRNA. For example, poly (A) polymerase can be used to add a poly
(A) tail to mRNAs which lack one. An oligonucleotide which contains
complementary nucleotides (e.g. oligo d(T)) is then annealed to the
mRNA and serves as primer for the RT.
Figure 2A shows hybridization of oligo d(T),5 primer to
the bona fide poly (A) tail of an mRNA (right) or to an internal A-rich
stretch (left) within the mRNA by conventional oligo d(T) primer used in
current cDNA library construction. Although the length of the primer used
can differ, and the two 3' most nucleotides are sometimes (A,C,G,T) and
(A,G,C) to "lock" the oligonucleotide in place at the junction of the body
of the mRNA and the poly (A) tail, neither of these modifications prevent
CA 02246623 1998-10-07
24
the misannealing of the oligo d(T) primer to internal A-rich stretches. The
asterisks denotes mispairing resulting in destabilization of the duplex.
Figure 2B shows the chemical structure of 3-nitropyrrole. Figure 2C
shows the structure of oligo d(T)~Z primer. Figure 2D shows the
expected discrimination between the poly (A) tail (right) and internal A-rich
stretches (left) when hybridizing to oligo d(T)~Z. The asterisks denote
mispairing resulting in destabilization of the duplex and circles represent
3-nitropyrrole artificial mismatches.
Figure 3A shows the structure of the eIF-4GI1 cDNA
construct used to analyze mispriming at the 3' end. The location of four
internal A-rich sequences are shown - all of which generated 3' truncated
clones when eIF-4GI1 was isolated from a cDNA library. The plasmid was
linearized with Asp 718 and T7 RNA polymerase used to generate a
-2400 nt 3H-test transcript. Figure 3B shows the integrity of the in vitro
generated transcript following fractionation on a formaldehyde/ 1.2%
agarose gel, treatment with EN3HANCE, and autoradiography of the dried
gel. Figure 3C shows the alkaline agarose analysis of RT products
generated by priming synthesis with oligo d(T) (lane 1) or oligo d(T)~Z
(lane 2) using MMLV RT. Complementary DNA was labeled with a 32P-
dCTP. The position of migration of truncated products are indicated by a
filled circle and full length product by an arrow. These results directly
demonstrate correction of 3' mispriming by utilizing oligo d(T)~Z as primer
during first strand synthesis.
Figure 4A shows the structure of eIF-4GI1 construct
used to demonstrate mispriming at the 3' end. The location of five
oligonucleotides (a, b, c, d, e) used in the hybridization assay to map the
sites of 3' mispriming by oligo d(T) are shown. The nucleotide targets of
CA 02246623 1998-10-07
the oligonucleotides on eIF-4611 are: Oligo a,
sss~ GAAATTGACTCAGTACTATTsssa ; pligo b,
sn,s GAAGGAAATGCTGTGGACCssss ; Oligo c,
s'9"TGTATAATAGAAAAGCAGAGsz,a. Oligo d,
5 soseTTTTAAACAAGGACTCATACsos'. and Oligo e,
°'s'AAGAGGAGTCTGAGGATAAC's°°. Figure 4B shows the
Southern
blot of the alkaline agarose gel of RT products generated by priming
synthesis with either oligo d(T) or oligo d(T)~Z. Marker lane refers to the
1 kb size ladder from GIBCO and sizes (in bp) are indicated to the left of
10 the diagram. eIF-4GI1 DNA refers to a DNA fragment of eIF-4GI1 used as
a positive control for DNA hybridizations. Oligonucleotides used as
probes on each blot are indicated below each panel. The asterisks on the
left denotes the cDNA product obtained by priming at the correct poly (A)
site. The filled circle denotes the cDNA product obtained by priming from
15 the A-rich stretch between nucleotides 5550-5575, whereas the arrow
denoted the cDNA obtained by priming from nucleotides 5085-5120.
Figure 5 shows an example illustrating mispriming
events at the 5' end of cDNAs during cDNA library construction of 5'
RACE analysis to extend the sequence of known genes.
20 Other objects, advantages and features of the present
invention will become more apparent upon reading of the following
non-restrictive description of preferred embodiments with reference to the
accompanying drawing which is exemplary and should not be interpreted
as limiting the scope of the present invention.
CA 02246623 1998-10-07
26
DESCRIPTION OF THE PREFERRED EMBODIMENT
The demonstration of the destabilization effect of non-
specific or artifactual duplex formation and of its concurrent effect on
mismatch and/or mispriming events was carried out with an oligo d(T)
primer, modified with one or two universal analogues. Whether such an
introduction could result in increased discrimination between the perfectly
matched target of that primer (i.e. the 3' poly (A) tail of the mRNA) and an
imperfect matched sequenced (internal A-rich stretches) was analyzed.
More specifically, an oligo d(T) primer, called oligo
d(T)~Z was generated, in which two of the thymine bases were
substituted by 3-nitropyrrole (Fig. 2C). General teachings on 3-
nitropyrrole, the synthesis thereof and the like can be found for example
in U.S. 5,438,131.
To test whether this primer can reduce mispriming from
internal A-rich sequences (Fig. 2D), a cDNA clone from eIF-4GI1, a
eukaryotic translation factor, was obtained. When cDNA clones to this
gene were initially isolated, only one of 5 clones had the correct 3' end.
Sequence characterization of these clones demonstrated that all the
truncated clones were the result of internal priming by oligo d(T) at four
different sites (denoted as leftward arrows in Fig. 3A). In vitro transcribed
RNA generated from this clone thus serves as an excellent test reagent
to determine the ability of the 3-nitropyrrole substituted oligo d(T) to
decrease the number of mispriming events. The quality of the in vitro
transcribed RNA is shown in Fig. 3B and demonstrates that the test
template is intact. This RNA was then annealed to oligo d(T) or oligo
d(T)~Z, and reverse transcription performed with MMLV RT. As shown
in Fig. 3C, use of oligo d(T) on this template resulted in shorter than full-
CA 02246623 1998-10-07
27
length products (>95%) generated as a result of internal priming (Fig. 3C,
lane 1). However, use of oligo d(T)~Z as primer on the same template
resulted in the majority (>95%) of products being full-length (Fig. 3C,
lane 2).
These results demonstrate that use of oligo d(T)~Z in
reverse transcription reactions significantly improves the specificity for the
3' poly (A) tail and demonstrates the usefulness of this procedure in
destabilizing non-specific duplex formation and more particularly for
generating full length cDNAs.
The sites of mispriming with oligo d(T) on the control
eIF-4GI1 template were identified (Fig. 4). This was done by fractionating
the products of RT reactions performed with either oligo d(T) or oligo
d(T)~Z on an alkaline agarose gel followed by transfer to a nylon
membrane. This membrane was then probed, by hybridization, with
oligonucleotides designed to target various regions of the 3' untranslated
region of eIF-4GI1 (oligonucleotides are labelled a, b, c, d and a in Fig.
4A). As shown in Fig. 4B, hybridization with oligonucleotide "a" detected
correctly primed cDNA when both oligo d(T) and oligo d(T)~Z were used
as primer. Hybridization with oligonucleotides b and c, detected a novel
truncated product when the RT reaction was primed with oligo d(T),
indicating mispriming from an internal A-rich stretch with this primer (Fig.
4B). Hybridization with oligonucleotides d and e, detected an additional
novel, more abundant truncated product (denoted by arrowheads in Fig.
4B) when the RT reaction was primed with oligo d(T), indicating
mispriming from a second internal A-rich stretch with this primer but not
with oligo d(T)~Z (Fig. 4B).
CA 02246623 1998-10-07
28
Mispriming event are common in Rapid Amplification of
cDNA ends (RACE). An example of mispriming at the 5' end of cDNAs
during 5' RACE analysis is shown in Figure 5. Such mispriming events
could be resolved by incorporating a universal nucleoside into the oligo
d(C) primer to increase the discrimination between the homologous target
(i.e. - the 5' end G tail) and an internal G-rich sequence. It is expected
that incorporation of at least one universal base (i.e. 3-nitropyrrole) in the
homopolymeric oligo d(C) primer should significantly reduce such
mispriming.
Although the present invention has been described
hereinabove by way of preferred embodiments thereof, it can be modified,
without departing from the spirit and nature of the subject invention as
defined in the appended claims.
