Note : Les descriptions sont présentées dans la langue officielle dans laquelle elles ont été soumises.
CA 02325576 2000-10-10
WO 99/53099 _1_ PCT/US99/07886
RECOMBINANT PROTEINS OF TREPONEMA PALLIDUM AND THEIR USE
FOR A SYPHILIS VACCINE
Field of the Invention
Isolated nucleic acids and polypeptides from Treponema pallidum subspecies
pallidum, pertenue, and errdemicum and the use of these molecules to elicit
protective
immunity against this organism.
Background of the Invention
Primary syphilis is characterized by a painless primary ulcerative lesion
called a
"chancre" that generally develops at the site of inoculation after sexual
contact with an
infected person. The chancre is the site of proliferation of the spirochete
Treponema
pallidum subspecies pallidum (T. p. pallidum), which causes syphilis. The
chancre
gradually resolves, and weeks to months later a rash characteristic of
secondary
syphilis usually develops. Syphilis also can be transmitted congenitally.
Without appropriate antibiotic treatment, T. p. pallidum establishes a
lifelong
chronic infection. Approximately 30% of patients in late stages of the disease
develop
tertiary neurologic, bony, hepatic, or circulatory system manifestations which
may
occur decades after the primary infection event.
Pathogenic members of the genus Treponema include at least, four natural
human pathogens and one natural rabbit pathogen. Based in part upon saturation
reassociation kinetics assays {lVBao, R.M., and A.H. Fieldsteel, J. Bacteriol.
141:427
429, 1980) three of the human pathogens are currently classified as subspecies
of
Treponema pallidum. These are Treponema pallidum subspecies pallidum,
Treponema pallidum subspecies pertenue, and Trepo»ema pallidum subspecies
endemicum, which, respectively, cause venereal syphilis, yaws, and bejel. A
fourth
CA 02325576 2000-10-10
WO 99/53099 PC'f/US99/07886
-2-
treponeme, Treponema carateum, causes a disease called pints. Yaws and bejel
occur
primarily in warm, humid, tropical areas of the world, primarily in children,
and are
transmitted by direct non-sexual contacT. Like syphilis, these diseases are
characterized by primary lesions that heal within days or weeks, followed by a
more
serious secondary phase that is systemic. Some cases of bejel exhibit tertiary
symptoms as well. In addition, poorly characterized spirochetes have been
isolated in
plaque associated with gingivitis and periodontal lesions, and are believed to
be
etiologic agents of that condition. These oral treponemes are known to be
reactive
with a monoclonal antiserum specific for a 47 kDa protein found in T. p.
pallidum,
thus appear to be subspecies or strain of T. p. pallidum (Riviere et al., N.
Eng. J.
Med. 325:539-543, 1991). Another treponeme, Treponema paraluiscuniculi, causes
venereal syphilis in rabbits, and is non-infectious to humans. These various
pathogenic treponemes are morphologically identical and are antigenica.lly
highly
cross-reactive, e.g., currently available serological tests cannot distinguish
yaws
infection from syphilis.
Pathogenic varieties of T. pallidum, including subspecies pallidum, and
endemicum, have remained refractory to being propagated in culture for more
than a
few passages, a circumstance that has hampered efforts to fully characterize
these
organisms and their pathology. However, these bacteria all can be propagated
by
serial inoculation of rabbit testes. Moreover, the rabbit provides a good
experimental
model for treponemal disease, in that rabbits develop primary chancres much
like
humans and also develop persistent infection in their lymph nodes and central
nervous
systems (Turner, T.B., and D.H. Hollander, Biology of the Trepo»ematoses,
World
Health Organization, Geneva, 1957). Rabbits, however, do not manifest
secondary or
tertiary syphilis.
A syphilis vaccine clearly is needed due to a recent upsurgence worldwide in
the frequency of occurrence of this disease. Between 1985 and 1990, the number
of
reported syphilis cases in the United States increased from 27,131 to 50,578
(golfs,
R.T., MMWR 42:13-19, 1993). Worldwide, over 3 million cases annually are
estimated to have occurred during that time period. To exacerbate the problem,
syphilis infections appear to increase the risk of acquisition and
transmission of human
immunodeficiency virus (HIV) (Greenblatt, R.M., et al., AIDS 2:47-50, 1988;
Simonsen, J.N., et al., N. Engl. J. Med 319:274-278, 1988; Darrow, W.N., et
al.,
Am. J. Public Health 77:479-483, 1987). These circumstances have spurred
efforts
to develop a vaccine for syphilis, but as of yet no practical vaccine
effective against
CA 02325576 2000-10-10
WO 99/53099 PCT/US99/07886
-3-
this disease has been reported. Moreover, no vaccines exist for yaws or bejel,
both of
which are serious treponemal diseases that take a heavy toll in tropical and
subtropical
regions of the world.
To enable rational vaccine design more information is needed about
treponemal interaction with the immune system and, specifically, the immune
evasion
mechanisms employed by T. p. pallidum. One of the central paradoxes of
syphilis is
the induction of a rapid humoral and cellular immune response that is capable
of
eliminating millions of treponemes from primary syphilitic lesions, but
incapable of
eradicating the few organisms that remain during latency. Macrophages are
believed
to be responsible for this rapid clearance of T. pallidum from early lesions,
presumably through antibody-mediated treponemal opsonization and subsequent
phagocytosis and killing by macrophages (e.g., see Lukehart and Miller,
J.Immuno1.121:2014-2024, 1978; Baker-Zander and Lukehart,
.I. InfecT. Dis. 165:69-74, 1992). In support of this, antibody has been
demonstrated
to enhance phagocytosis of treponemes by macrophages (Lukehart and lVfiller,
J. Immunol. 121:2014-2024, 1978) and is required for macrophage-mediated
killing
of T. pallidum (Baker-Zander and Lukehart, J. InfecT. Dis 165:69-74, 1992). In
addition, the systemic appearance of opsonic antibody has been shown to
immediately
precede bacterial clearance in the rabbit model (Baker-Zander et al., FEMS
Immureol.
Mec~ Microbiol. 6:273-280, 1993).
Although no success has been reported for efforts to protect animals by
immunization with defined antigens of T. p. pallidum, complete protection
against
homologous challenge with T. p. pallidum was achieved in at least one instance
following 60 injections of Y-irradiated T. p. pallidum (Miller, J. N.,
J.Immunol. 110:1206-1215, 1973). Moreover, persons infected with the highly
related T. p. pertenue, which causes yaws, exhibit partial immunity to T. p.
pallidum,
and similarly, persons infected with one strain of T. p. pallidum exhibit
partial
immunity against infections with other strains (Turner and Hollander, Biology
of the
Treponematoses, World Health Organization, 1957). These observations indicate
that
a vaccine that induces protective immunity against syphilis is a plausible
goal, but that
antigens useful for such a vaccine have not yet been discovered.
To date, most T. p. pallidum antigens considered as vaccine candidates have
been selected simply on the basis of their reactivity with immune rabbit serum
(IRS),
i.e., the serum of rabbits that are immune to syphilis by virtue of having
been
previously infected with T. p. pallidum. This approach has led to the
identification of
CA 02325576 2000-10-10
WO 99/53099 PCT/US99/07886
a number of interesting and important lipoprotein and protein antigens, but
has failed
so far to provide any protein capable of protecting experimental animals from
challenge with T. p. palliclum.
T. p. pallidum is a highly motile spirochete containing an outer membrane, a
periplasmic space, a peptidoglycan-cytoplasmic membrane complex, and a
protoplasmic cylinder. Proteins associated with the outer membrane are more
likely
to be exposed to the host immune system, and thus are more likely than other
treponemal proteins to elicit an immune response by the infected hosT.
However,
studies have indicated that T. p. pallidum has about 100-fold fewer traps-
membrane
proteins than does a typical gram negative bacterium (Radolf, J.D., et al.,
Proc. Natl.
Acad Sci. USA 86:2051-2055, 1989; Walker, E.M., et al., J. Bacteriol 171:5005-
11,
1989). Because of their paucity, some investigators have assigned T. p.
pallidum
outer membrane proteins a special name, "T. pallidum rare outer membrane
proteins,"
or "TROMPS." Candidate TROMPS include 65-, 31- (basic and acidic pI forms),
and
28- kDa proteins that are found in the outer membrane fraction (Blanco, D. R.,
et al.,
J. Bacteriol., 176:6088-6099, 1994; Blanco, D. R., et al., Emerg. I»fecT. Dis.
3:11-
20, 1997). However, no TROMP nor any other T. p. pallidum protein has
definitively been identified as being located in the outer membrane, nor has
any
candidate outer membrane protein been shown to induce a protective immune
response {Radolf JD, et al., IrrfecT. Immun. 56:490-498, 1988; Radolf et al.,
InfecT. Immun. 56:1825-1828, 1988; Cunningham et al., J. Bacteriol., 170:5789-
5796, 1988;[?J11; Blanco et al., J. Bacteriol. 176:6088-6099, 1994; Cox et
al.,
Molec. Microbiol., 15:151-1164, 1995; Radolf, J. D., Molec. Microbiol.,
16:1067-
1073, 1995). For example, a recent report suggests that TROMP 1 is localized
to the
cytoplasmic membrane, suggesting it is not surface exposed (Akins, D. R., et
al.,
J. Bacteriol., 179:5076-5086, 1997). Moreover, neither of the two TROMP genes
so
far identified is found in greater than one copy and therefore neither appears
to
function in antigenic variation. In addition, several of the highly
immunogenic
lipoprotein antigens (47, 34, 17, and 15 kDa) akeady identified for T.
pallidum have
been shown to not be exposed on the outer membrane (Radolf, J.D., Mol.
Microbiol. 16:1067-1073, 1995).
On June 24, 1997, a preliminary copy of the entire genome of T. p. pallidum,
Nichols strain, was posted on the Internet at
http://utmmg.med.uth.tmc.edu/treponema/docs/update.html. This copy of the
T. p. pallidum genome was not annotated to denote the positions of open
reading
CA 02325576 2000-10-10
WO 99/53099 PCTNS99/0'1886
-5-
frames, though subsequent updates to this original posting have noted open
reading
frames and have provided other information.
Su of the Invention
Two genes and one multi-membered gene family have been identified that are
useful for eliciting a protective immune response against infection by T. p.
pallidum,
the bacterium that causes syphilis. The nucleotide sequences of these new
genes have
been determined. In an experimental rabbit model, immunization with the
protein
products of several of these genes elicited significant protection upon
subsequent
challenge with virulent T. p. pallidum. These proteins represent the first
immunoprotective antigens that have been reported for T. pallidum subsp.
pallidum.
Comparative sequence analysis has indicated that one of the genes identified
here (SEQ ID NO:1) encodes a 356 amino acid protein (SEQ D7 N0:2) that is a
glycerophosphodiester phosphodiesterase (hereafter called "Gpd"), a . glycerol
metabolizing enzyme previously identified in other bacteria, e.g., Haemophilus
inJluenzae, Escherichia coli, Bacillus subtilis and Borrelia hermsii (3anson,
H., et al.,
InfecT. Immun., 59:119-125, 1991; Munson, R.S., et al., J. Bacteriol.,
175:4569-
4571, 1993; Tommassen, J., et al., Mol. Gen. Genet., 226:321-327, 1991;
Schwan,
T.G., et al., J. Clin. Microbiol. 34:2483-2492, 1996; Shand, E.S., et al., J.
Bacteriol.,
179:2238-2246, 1997; N'~lsson, R.P. et al., Microbiol., 140:723-730, 1994).
The
identification of this protein (SEQ TD N0:2) has been previously published
(Stebeck et al., FF~IS Microbiol. Letters, 154:303-310, 1997; Shevchenko et
al.,
InfecT. Immun., 65:4179-4189, 1997). Experiments were conducted to confirm
that
the product of the T. pallidum Gpd homologue (SEQ m NO:1) exhibited the
expected Gpd activity, and anti-Gpd antibodies were used to confirm that
T. p. pallidum indeed expresses a cross-reactive protein of the predicted
molecular
size. Injection of recombinant Gpd (SEQ ID N0:2) into rabbits was shown to
elicit a
partially protective immune response upon subsequent challenge with T. p.
pallidum.
In addition to Gpd (SEQ ID N0:2), the invention provides another protein
believed to
be associated with the outer membrane, and that has homology with the surface-
exposed D15 protein from Haemophilus influenzae (Flack, F.S., et al., Gene,
156:97-
99, 1995), and Oma87 from Pasteurella multocida (Ruffolo and Alder,
InfecT. Immun., 64:3161-3167, 1996). This protein is herein referred to as the
"D15/Oma87 homologue" and is encoded by the nucleic acid molecule having the
sequence set forth in SEQ ID N0:3. The amino acid sequence of the D15/Oma87
homologue is set forth in SEQ ID N0:4. SEQ D7 NO:S sets forth the nucleic acid
CA 02325576 2000-10-10
WO 99/53099 PCT/US99/07886
-6-
sequence of a portion of the coding region of the D15/Oma87 homologue gene
(SEQ
D7 N0:3) that was expressed to yield a D15/Oma87 homologue polypeptide
fragment
(SEQ m N0:6) that was recovered and used for vaccine testing, as more fully
described herein.
In addition to Gpd (SEQ D7 N0:2) and D15 (SEQ m N0:4), a novel
polymorphic, multicopy gene family (called Msp) has been identified in T. p.
pallidum,
T. p. pertenue and T. p. endemicum. Members of this gene fiunily have homology
to
the major outer sheath protein (Msp) of T. denticola. The members of this gene
family are divided into several subfamilies, and present within each subfamily
are
regions that are highly conserved as well as variable regions that are far
less
conserved. Analysis of their amino acid sequences suggests that many of these
molecules are likely to be outer surface exposed. Furthermore, injection of
rabbits
with several of these proteins has resulted in partial protective immunity of
the rabbits
upon challenge with a large dose of T. p. pallidum, thus these proteins are
useful as
vaccine antigens.
The nucleic acid sequences of cloned T. p. pallidum Msp genes (or portions
thereof), and the proteins encoded by the T. p. pallidum Msp genes, are
disclosed in
the following sequence listing entries: Msp 1 (SEQ m N0:7), Msp 1 protein (SEQ
m
N0:8); Msp2 (SEQ II7 N0:9), Msp2 protein (SEQ m NO:10); Msp3 (SEQ m
NO:11), Msp3 protein (SEQ ID N0:12); Msp4 (SEQ m N0:13), ~ Msp4 protein
(SEQ D3 N0:14); MspS (SEQ ID NO:15), MspS protein (SEQ m N0:16); Msp6
(SEQ m N0:17), Msp6 protein (SEQ D7 N0:18); Msp7 (SEQ D7 N0:19), Msp7
protein encoded by open reading frame A (SEQ m N0:20), Msp7 protein encoded by
open reading frame B (SEQ ID N0:21); MspB (SEQ m N0:22), Msp8 protein (SEQ
m N0:23); Msp9 (SEQ m N0:24), Msp9 protein (SEQ m N0:25); MsplO (SEQ
m N0:26), Msp 10 protein (SEQ m N0:27); Msp 11 (SEQ m N0:28), Msp 11
protein (SEQ m N0:29); and Mspl2 (SEQ D7 N0:30), Mspl2 protein (SEQ m
N0:31). The amino acid sequence of a highly conserved amino acid motif found
within all of the Msp genes of T. p. pallidum is set forth in SEQ ID N0:32.
The
nucleic acid sequence encoding the conserved amino acid sequence motif
disclosed in
SEQ D7 N0:32 is set forth in SEQ m N0:33.
The nucleic acid sequences of cloned T. p. pertem,~e Msp genes, and the
proteins encoded by the T. p. pertenue Msp genes, are disclosed in the
following
sequence listing entries: T. p. pertenue Msp homologue 1 (SEQ m N0:34), Msp
3 5 homologue 1 protein (SEQ m N0:3 5); T. p. pertenue Msp homologue 2 (SEQ DJ
CA 02325576 2000-10-10
WO 99/53099 PCT/US99/07886
_'j_
N0:36), Msp homologue 2 protein (SEQ ID N0:37); T. p. perterrue Msp homologue
3 (SEQ ID N0:38), Msp homologue 3 protein (SEQ ID N0:39); T. p. pertenue Msp
homologue 4 (SEQ ID N0:40}, Msp homologue 4 protein (SEQ 117 N0:41). The
amino acid sequence of a highly conserved amino acid motif found within all of
the
Msp genes of T. p. pertenue is set forth in SEQ ID N0:42.
The nucleic acid sequences of a cloned T. p. pallidum Msp gene (T.P. 1.6) is
disclosed in SEQ Zi7 N0:43, and the protein encoded by the nucleic acid
sequence
disclosed in SEQ ID N0:43 is disclosed in SEQ ID N0:44. SEQ ID N0:45 shows
the nucleotide sequence of a subportion of the T.P. 1.6 DNA fragment (SEQ ID
N0:43) that was expressed to obtain a polypeptide (SEQ m N0:46) to be tested
for
e~cacy in eliciting a protective immune response against T. p. pallidum (see
Example 10). SEQ ID N0:47 shows a highly conserved motif present in the amino
acid sequence of SEQ ID N0:43.
Detailed Description of the Preferred Embodiment
This invention relates to isolated nucleic acids, polypeptides and methods
that
are useful for preparing vaccines to protect against infection by Treponema
spp.,
particularly Trepo»ema pallidum subspecies pallidum, Trepo»ema pallidum
subspecies pertenue, and Treponema pallidum, subspecies e»demicum. As used
here,
the term "isolated" refers to a biological molecule that is separated from its
natural
milieu, i.e., from the organism or environment in which it is normally
presenT. In
certain embodiments, the invention provides isolated polypeptides capable of
inducing
a protective immunologic response to T. p. pallidum, T. p. pertenue, and
T. p. endemicum when administered in an effective amount to an animal hosT.
Preferred embodiments of such polypeptides include those whose amino acid
sequences are shown in SEQ ID NOS:2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 21, 23,
25,
27, 29, 31, 32, 35, 37, 39, 41, 42, 44 and 46. The invention provides
representative
examples of nucleic acid molecules capable of encoding these polypeptides in
SEQ ID
NOS:1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 22, 24, 26, 28, 30, 33, 34, 36, 38, 40,
43 and
45.
Isolated polypeptides and nucleic acids according to the invention maybe
prepared by use of recombinant DNA techniques, or may be synthesized using
widely
available technology. The use of recombinant methods to prepare the subject
vaccines provides the advantage that the immunogenic components of the
vaccines
can thus be prepared in substantially purified form free from undesired
contaminants.
CA 02325576 2000-10-10
WO 99/53099 PCT/US99/0'7886
_g_
The invention, in one aspect, provides isolated nucleic acids capable of
encoding the polypeptides whose amino acid sequences are disclosed herein.
In another aspect, the invention provides a nucleic acid molecule (SEQ m
NO:1) encoding a newly identified T. p. pallidum protein (SEQ m N0:2) that has
glycerophosphodiester phosphodiesterase activity (Gpd), and functional
equivalents
thereof. Also encompassed by the present invention is a polypeptide encoded by
the
nucleic acid of (SEQ m NO:1), and whose amino acid sequence is shown in (SEQ m
N0:2). The term "functional equivalent," as used herein, is intended to
include all
immunogenically active substances capable of evoking an immune response in
animals, including humans, to which the equivalent polypeptide or nucleic acid
has
been administered, wherein the resulting antibody has immunologic reactivity
with the
indicated polypeptide. Thus, equivalents of T. p. pallidum Gpd {SEQ m N0:2)
may
include mutant or recombinantly modified forms of the protein, or subportions
of the
Gpd molecule that retain sufixcient epitopic similarity to the native protein
(SEQ m
N0:2) to evoke an antibody response similar to that evoked by the epitope when
present in the native protein.
The invention further provides nucleic acids (such as that shown in SEQ m
N0:3) that encode a protein that has significant homology both with the D15
protein
previously identified in H. influenzae and with the Oma87 protein previously
identified in Pasteurella multocida. This T. p. pallidum protein hereafter is
referred
to as the "D 15/Oma87 homologue"), and its amino acid sequence is shown in SEQ
1D
N0:4. Provided also is the nucleic acid molecule shown in SEQ B7 NO:S, which
encodes a subportion of the amino acid sequence shown in SEQ m N0:4. The
polypeptide encoded by the nucleic acid molecule of SEQ m NO:S encodes the
polypeptide of SEQ m N0:6, which is useful as a vaccine against syphilis. The
invention encompasses the D15/Oma87 polypeptides whose amino acid sequences
are
shown in SEQ B7 N0:4 and SEQ m N0:6, and functional equivalents thereof.
In other aspects of the invention, SEQ D7 NOS:7, 9, 11, 13, 15, 17, 19, 22,
24, 26, 28 and 30 depict nucleic acids encoding portions of 12 different T. p.
pallidum
polypeptides (having amino acid sequences set forth in SEQ )I? NOS:B, 10, 12,
14,
16, 18, 20, 21, 23, 25, 27, 29 and 31) that have homology with the previously
described major sheath protein of T. denticola. These T. p. pallidum Msp
homologues hereafter are referred to as "T. p. pallidum Msp proteins (or
"homologues" or polypeptides)," whether the reference is to the full-length
protein, or
to a subportion of the protein. The invention therefore provides the
polypeptides
CA 02325576 2000-10-10
WO 99/53099 PCT/US99/07886
-9-
having the amino acid sequences shown in SEQ m NOS:B, 10, 12, 14, 16, 18, 20,
21,
23, 25, 27, 29 and 31, and functional equivalents thereof.
The terminology used for the T. p. pallidum genome project (posted at
http://utmmg.med.uth.tmc.edu/treponema/docs/update.html) refers to the Msp
genes
as "treponemal pallidum repeats" rather than "Msp" genes, and designates them
as
"TPR A L". The nomenclature used herein refers instead to Tpr A L as
Msp 1-Msp 12. Msps 1-12 correspond, respectively, to Tgr G, F, E, D, C, B, A,
L,
K, J, I and H. The full-length open reading frames for these 12 genes,
according to
the present version of the T. p. pallidum genome project, encode proteins of
the
following sizes: Msp 1, 756 amino acids; Msp 2, 364 amino acids; Msp 3, 762
amino
acids; Msp 4, 598 amino acids; Msp 5, 598 amino acids; Msp 6, 644 amino acids;
Msp 7 (ORF A), 253 amino acids; Msp 7 (ORF B), 389 amino acids; Msp 8, 443
amino acids, Msp 9, 480 amino acids; Msp 10, 758 amino acids; Msp 11, 609
amino
acids; Msp 12, 693 amino acids.
All of the T. p. pallidum Msp homologues contain a highly conserved peptide
motif encoded by the nucleic acid molecule whose nucleotide sequence is shown
in
SEQ ID N0:33, and whose amino acid sequence is shown in SEQ ID N0:32. In
view of its high degree of conservation, this conserved peptide (SEQ m N0:32)
may
be important in eliciting antibodies that will cross-react with all of the T.
p. pallidum
Msps.
To facilitate the expression of useful amounts of T. p. pallidum Msp proteins,
the invention further provides the PCR primers shown in Table 1, in which "S"
indicates the sense primer, and "AS" indicates the primer binding to the
opposite
strand, i.e., the antisense primer.
CA 02325576 2000-10-10
WO 99/53099 PC'fNS99/07886
-10-
aN
o
~- z
a
°z~
w
~o
~, z
A~~
i~ O f~ ~ N M
00 °
o °z °z °z °z z
E~ ~ ~ ~ o,
w
w w w w
~-~ z ~ ~o r oo a~
~n
O N cri
°z oo ° zz
o z o a z z
b
~ ~, a~ w w z w .w~.,W ~ w
x w v _~ H H d a ~ H ~ w c7
d ~ ~ H H ~ U
d U
V ~ U d E.., ~ U ~ ~ H H H
N ~ ~ ~ V ~ ~ ~ U C~7
U ~ H ~ d d d ~ H H
U ~ C7 d E.., ~ E.~., ~ E-r C7 ~ H
U ~ ~ ~ d ~ U
'c U ~ H ~ U d CH7
H d H E.., ~ t7 d ~ d H
U ~ E-' ~ ~ ~ ~ ~ C~'~ E~-r ~ ~ H~
U ~ ~ U E~-~ ~ ~ ~ Ed-~ U ~ EU
w v, ~n U d U E-~ U U d U U C7
a
.-W O ~D I~ n o0 0o Ov Cv N N
d
~-r N c~1 d' ~1 ~D
CA 02325576 2000-10-10
WO 99/53099 PCT/US99/07886
-11-
Each of the primer pairs in Table 1 can be used to specifically amplify a
portion of the
T. p. pallidum Msp genes) as indicated in the last column of the table.
In addition, the invention provides a PCR primer pair having the following
nucleotide sequences: 5'-ACCAGTCCTTCCTGTGTGGTTAA (sense) (SEQ m
N0:60), and 5'-ACTCCTTGGTTAGATAGGTAGCTC (antisense) (SEQ » N0:61).
This primer pair is useful for amplifying not only one of the Msp genes of
T. p. pallidum, i.e., TP 1.6 (SEQ m N0:43), but also for amplifying a portion
of at
least four different T. p. pertenue Msp genes, thus defining four genes in the
T. p. pertenue genome that are highly related to the T. p. pallidum Msp gene
family,
and that are encompassed by the present invention. These four amplified
T. p. pertenue Msp DNA fragments have the nucleotide sequences shown in SEQ B7
NOS:34, 36, 38 and 40, and the predicted amino acid sequences translated from
these
four amplicons are shown, respectively, in SEQ m NOS:35, 37, 39 and 41. Three
of
these amplicons (SEQ D7 NOS:36, 38 and 40) contain the same number of
nucleotides, but differ somewhat in nucleotide sequence, thus appear to
represent
fragments from different Msp homologues.
The primer pairs shown in Table 1 as well as the primer pair
5'-ACCAGTCCTTCCTGTGTGGTTAA (sense) (SEQ m N0:60), and
5'-ACTCCTTGGTTAGATAGGTAGCTC (antisense) (SEQ m N0:61) can be used
in accord with this invention to amplify portions of the T. p. pallidum
genome. The
resulting amplified DNA (amplicons) can be expressed as recombinant proteins
in
E. coli or another suitable host, and the recombinant proteins thus derived
used to
formulate vaccines useful for eliciting a protective immune response against
syphilis,
yaws, bejel, or other treponemal diseases. For example, the primers designated
as
"Set 1" in Table 1 are useful for amplifying portions of at least three Msp
genes found
in the genome of T. p. perterrue, and three Msp genes in the genome of
T. p. endemicum (Example 7).
In addition to the aforementioned nucleic acids, PCR primers and
polypeptides, the invention provides two novel methods for identifying T. p.
pallidum
proteins useful as vaccine candidates. The first of these methods involves the
identification of T. p. pallidum proteins that are immunologically reactive
with an
opsonizing serum against T. p. pallidum but that are immunologically
unreactive with
a non-opsonizing serum (Stebeck et al., FEMS Microbiol. Lett., 154:303-310,
1997).
Such proteins are likely to elicit protective immunity, hence are vaccine
candidates,
i.e., useful for vaccine trials and for eventual inclusion in a vaccine.
Vaccine
CA 02325576 2000-10-10
WO 99/53099 PCT/US99/07886
-12-
candidates are tested in a suitable host, i.e., one susceptible to infection
with
T. p. pallidum, for their ability to elicit an immune response that is
protective against
challenge by this organism. Rabbits, for example, can provide a suitable host
for this
purpose. Proteins that prove to be capable of eliciting such an immune
response are
determined to be vaccine candidates. This method for selecting vaccine
candidates
can be applied to identify polypeptides capable of eliciting a protective
immune
response against yaws, bejel, or any other disease caused by a subspecies of
T. p~allidum that is susceptible to opsonizing antibodies.
The rationale for the above-described strategy for obtaining vaccine
candidates is that opsonizing antibodies are known to be involved in treponeme
clearance during primary syphilis, thus a vaccine containing antigens capable
of
eliciting opsonizing antibodies should produce resistance or immunity against
infection with T. p. pallidum. The disclosed method for identifying T. p.
pallidum
proteins that are targets for opsonizing antibody requires the use of both
opsonic and
non opsonic antisera. One means of preparing opsonic serum is to use the
rabbit
model system. To prepare opsonic rabbit serum (ORS) using this system, serum
from
rabbits infected with T. p. pallidum is adsorbed to remove activity against
the major
known treponemal antigens, none of which is capable of eliciting protective
immunity.
Opsonic activity can be assessed by applying the rabbit macrophage
phagocytosis
assay (Lukehart and Miller, J. Immunol., 121:2014-2024, 1978). Non opsonic
rabbit
serum (HORS) can be derived from rabbits injected with heat-killed T. p.
pallidum.
To obtain clones corresponding to proteins that are targets for ORS, an
expression
library is constructed from T. p. pallidum genomic DNA, and the proteins
thereby
expressed are screened using both ORS and NORS. Plaques that interact with ORS
but not with NORS are isolated and the proteins they express are tested to
determine
whether they are capable of eliciting protective immunity in a susceptible
hosT. In the
representative examples given below, the application of this method has
identified
three different T. p. pallidum proteins, the above-described Gpd (four
independent
clones), the D 15/Oma87 homologue, and one member of the T. p. pallidum Msp
family. Because of the method by which they were obtained, each of these three
proteins appears to be a target for opsonizing antibodies, and all three
likely are to be
exposed on the surface of T. p. pallidum cells and capable if included in a
vaccine of
eliciting a protective immune response against syphilis.
Prior efforts to identify the potential targets of opsonic antibody have
focused
primarily on direct isolation of these proteins from the syphilis bacteria
themselves.
CA 02325576 2000-10-10
WO 99/53099 PCT/US99/07886
-13-
However, such efforts have been hampered because the T. p. pallidum outer
membrane is extremely fragile and has a relatively low number of surface
proteins
(Walker et al., J. Bacteriol., 171:5005-5011, 1989; Radolf et al., Proc. Natl.
AcaaL
Sci., 86:2051-2055, 1989
The invention further provides another method for obtaining vaccine
candidates that involves identifying proteins that are expressed by genes that
are
present in the genome of T. p. pallidum but that are not present in the genome
of the
closely related treponeme, T. paraluiscuniculi, a pathogen that causes
syphilis in
rabbits but that does not infect humans. The genes thus isolated are presumed
to
IO provide some function that enables T. p. pallidum to infect human cells.
Accordingly,
genes present in T. p. pallidum but absent from T. paraluiscuniculi are
considered to
be effective as a vaccine for syphilis, because antibodies directed against
them are
expected to protect against infection by T. p. pallidum. This method is
applicable for
identifying pathogenicity-related genes present in the genomes of other
treponemes
I S that infect humans but not rabbits, e.g., the genomes of T. p. pertenue
and
T. p. endemicum.
Genes identified by either of the aforementioned methods are tested to
determine whether their gene products are capable of eliciting in an animal
host an
immune response that is protective against challenge with T. p. pallidum. This
test
20 may be performed by any convenient means, for example, by inoculating
rabbits
intradermally or intramuscularly according to standard immunologic procedures
with
the protein being tested, then challenging the rabbit with a dose of T. p.
pallidum that
is capable of causing syphilis in an uninoculated rabbiT.
One means for identif5ang proteins present in subspecies of T. pallidum but
25 absent from T. paraluiscuniculi is to use representation difference
analysis (RDA), a
PCR based technique that selectively amplifies nucleic acid molecules that are
present
in one population of nucleic acids but absent from another. This method is
effective
using DNA from any subspecies of T. pallidum, including T. p. pallidum,
T. p. pertenue, and T. P. endemicum. In the study described in Example 5, RDA
was
30 used to obtain clones that permitted the isolation of a fragment of DNA,
called herein
"TP 1.6," (SEQ ID N0:43) that was found to be unique to the T. p. pallidum
genome. The protein encoded by the nucleotide sequence shown in SEQ m N0:43 is
set out in SEQ m N0:44. Both are included within the scope of this invention.
Sequence analysis of TP 1.6 (SEQ m N0:44) indicated that it shared a
significant
35 degree of homology with Mspl (SEQ m N0:8) and Msp2 (SEQ m NO:10) of the
CA 02325576 2000-10-10
WO 99/53099 PCT/US99/07886
-14-
T. p. pallidum Msp gene family. It should be noted that another member of the
Msp
family, Msp 9 (SEQ ID N0:25), was also identified as described above by virtue
of its
specific reactivity with opsonizing antibody against T. p. pallidum. Thus,
members of
the T. p. pallidum Msp family have been identified by two independent methods
designed for isolating syphilis vaccine candidates.
Experiments using the rabbit model system have borne out the expectation
that the T. p. pallidum proteins reactive with ORS but not NORS are capable of
eliciting antibodies that protect against T. p. pallidum (see Example 10).
Accordingly, the subject invention provides a vaccine that includes a
physiologically
acceptable carrier together with an effective amount of an isolated T. p.
pallidum
polypeptide capable of inducing a protective immunologic response to T. p.
pallidum
when administered to a suitable host, the isolated polypeptide being
immunologically
reactive with an opsonizing serum against T. p. pallidum but immunologically
unreactive with a non-opsonizing serum against T. p. pallidum.
A rabbit model was used to test the capacity of these newly identified
T. p. pallidum proteins to elicit protective immunity against T. p. pallidum
because
proteins that elicit protective immunity in rabbits are expected to have a
similar effect
in humans. This is because the clinical course of the disease is similar in
both hosts
and also because the range of antibody reactivities, measured by immunoblot,
appears
to be the same in both rabbits and humans following infection with T. p.
pallidum.
For example, in both hosts, reactive IgM becomes detectable within days after
the
appearance of clinical disease, and declines after clearance, while IgG
responses rise
somewhat later, peak at about the time of clearance, and persist for a long
period
thereafter at relatively high levels (e.g., see Baker-Zander et al.,
.I. InfecT. Dis., 151:264-272, 1985; Baker-Zander et al., Sex. Traps. Dis.,
13:214-
220, 1986; Lukehart et al., Sex Traps. Dis., 13:9-15, 1986). Moreover, these
same
studies indicated that antibodies directed against many of the same antigenic
proteins
appeared in both hosts during corresponding stages of the disease. These
observations demonstrate that the human immune system sees basically the same
antigens for this pathogen as seen by the rabbit immune system, and that both
hosts'
immune systems attack the pathogen in a similar fashion. Similarly, rabbits
are a
suitable animal model for testing the efficacy of yaws or bejel vaccines
prepared
according to the above-discussed methods.
The present studies confirm that the rabbit and human immune systems
respond similarly to infection with T. p. pallidum. Sera from rabbits infected
with
CA 02325576 2000-10-10
WO 99/53099 PCT/US99/07886
-15-
T. p. pallidum, Nichols strain, or from human syphilis patients infected with
unknown
strains both were observed here to contain antibodies against several members
of the
Msp family, and both exhibited especially high levels of activity against Msp
9 (SEQ
ID N0:25) and the D15/Oma87 homologue (SEQ ID N0:4). Moreover, immune
rabbit serum (IRS) was observed to react with Gpd (SEQ ID N0:2).
As detailed in Example 10, T. p. pallidum proteins to be tested in rabbits for
their protective capacity were expressed in E. coli, and the corresponding
recombinant molecules were purified and used as immunizing antigens. In all
cases,
rabbits were immunized three times with 200 ~tg of the recombinant antigen.
The
rabbits were subsequently challenged with 103 or 103 T. p. pallidum at
multiple
dernial sites three weeks after the last boost, and lesion development was
monitored
by comparison to a control group of rabbits that had received no immunization
prior
to challenge. Typical red, indurated ulcerating lesions appeared in the
control
unimmunized animals at days 5-7 post-challenge in animals that had received
lOs
treponemes, or at days 12 to 14 post-challenge for animals that had received
103
treponemes (Gpd challengers). The rabbits immunized with four of the Msp
proteins
were protected from challenge and did not exhibit typical development of
progressive
lesions at the corresponding time points. The mild lesions that did develop in
the
immunized rabbits healed very quickly compared to control animals, and
T. p. pallidum could not be detected by darkfield analysis in most of these
atypical
lesions.
The term "vaccine" as used herein is understood to refer to a composition
capable of evoking a specific immunologic response that enables the recipient
to resist
or overcome infection when compared with individuals that did not receive the
vaccine. Thus, the immunization according to the present invention is a
process of
causing increased or complete resistance to infection with Treponema species.
The vaccines of the present invention involve the administration of an
immunologically effective amount of one or more of the polypeptides described
above, i.e., the entire proteins, or a functional equivalent thereof, in
combination with
a physiologically acceptable carrier. This carrier may be any carrier or
vehicle usually
employed in the preparation of vaccines, e.g., a diluent, a suspending agent,
an
adjuvant, or other similar carrier. Preferably, the vaccine will include an
adjuvant in
order to increase the immunogenicity of the vaccine preparation. For example,
the
adjuvant may be selected from Freund's complete or incomplete adjuvant,
aluminum
hydroxide, a saponin, a muramyl dipeptide, an immune-stimulating complex
(ISCOM)
CA 02325576 2000-10-10
WO 99/53099 PCTNS99/07886
-16-
and an oil, such as vegetable oil, or a mineral oil, though other adjuvants
may be.used
as well.
In another aspect of the invention, the immunogenicity of the immunogenic
protein may be coupled to a macromolecular carrier, usually a non-toxic
biologically
compatible polysaccharide or protein, e.g., bovine serum albumin.
One route by which the syphilis treponemes can enter the body is through the
mucosal membranes, thus an effective vaccine optimally will prime the immune
response at mucosal surfaces to recognize T. p. pallidum. Strategies that may
be used
to administer the subject vaccines in order to elicit a mucosal immune
response
include using E. coli heat labile enterotoxin as an adjuvant, expression of
immunogenic antigens by plasmids carried in attenuated Salmonella spp.,
microsphere
or liposome delivery vehicles, ISCOMS, or naked DNA encoding antigenic
proteins
(Staats et al., Curr. Opin. Imm~nol., 6:572-583, 1994). DNA vaccines stimulate
strong CTL responses, as well as helper T cell and B cell responses. Since CTL
are
known to be present in syphilis primary and secondary lesions, and since
infection
with T. p. pallidum itself is known to be associated with the generation of
protective
immunity, a DNA vaccine thus is a preferred embodiment of the subject vaccine
compositions.
In a further aspect of the invention, genes encoding the vaccine polypeptides
of the present invention may be inserted into the genome of a non-pathogenic
organism to provide a live vaccine for administration of the vaccines of the
subject
invention. For example recombinant vaccinia viruses have been employed for
this
purpose, as well as attenuated Salmonella spp. Efficient vaccines can be
prepared by
inserting a variety of immunogenic genes into the same live vaccine, thus
providing
immunity against several different diseases in a single vaccine vehicle, e.g.,
a vaccine
against many different sexually transmitted diseases. A particularly
advantageous live
vaccine is one that is engineered to express one or more of the subject
immunogens
on the outer surface of the bacteria expressing the vaccine proteins, thus
maximizing
the recipient's exposure to the immunogens in an orientation likely to
resemble that
found in the treponemal pathogen, thereby eliciting an appropriate immune
response.
The amount of immunogenically effective component used in the vaccine will
of course vary, depending on the age and weight of the vaccine recipient, as
well as
the immunogenicity of the particular vaccine componenT. For most purposes, a
suitable dose will be in the range of l-1000 wg of each immunogen, and more
preferably, 5-500 wg of each immunogen.
CA 02325576 2000-10-10
WO 99/53099 PCT/US99/07886
-17-
The present invention provides vaccines that include the T. p. pallidum
glycerophosphodiester phosphodiesterase, D15/Oma87 homologue, and the members
of the Msp family, each to be administered alone or in various combinations in
amounts su~cient to induce a protective immunologic response to infection by
T. p. pallidum in a host animal that is normally susceptible to syphilis. It
is
understood that the vaccine of the subject invention may contain one or more
of the
aforementioned proteins, as well as additional T. p. pallidum proteins
identified by the
above described methods. For example, the vaccine may include T. p. pallidum
glycerophosphodiester phosphodiesterase in combination with one or more of the
Msps, or may include in addition the D 15/Oma87 homologue.
With regards to the T. p. pallidum glycerophosphodiester phosphodiesterase,
this may be provided by expressing in a suitable expression vector system a
nucleic
acid having the nucleotide sequence shown in SEQ 117 NO:1. The isolated
T. p. pallidum D15/Oma87 homologue may be obtained by expressing in a suitable
vector system a nucleic acid molecule having the nucleotide sequence shown in
SEQ
ID N0:4. The isolated T. p. pr~llidum Msp may be derived by expressing in a
suitable
vector the full-length T. p. pallidum Msp genes, as their positions in the
genome are
now known, or alternatively, may be derived by PCR from the variable portions
of the
Msp genes, as set out in the Examples below. The variable regions of Msps 1,
3, 4, 5,
6, 7, 8, 9, 10, 11 and 12 are shown in SEQ D7 NOS:7, 11, 13, 15, 17, 19, 22,
24, 26,
28 and 30, respectively, and polypeptides corresponding to these sequences can
be
obtained by standard recombinant technology, i.e., by expression in a suitable
bacterium, yeast, or other expression system. Alternatively, the Msp
polypeptide for
use in a vaccine of the subject invention may be provided by the nucleic acid
molecules shown in SEQ ID N0:43 or SEQ ID N0:45, or their polypeptide
products,
shown in SEQ ID N0:44 and SEQ ID N0:46, respectively. In one embodiment of
the invention, the vaccine includes several different Msps or may even include
all of
the Msps. In a preferred embodiment, the vaccine includes Msps 2 (SEQ ID
NO:10),
9 (SEQ ID N0:25) and 11 (SEQ ID N0:29). In other embodiments of the invention,
the vaccine may consist of a polypeptide that includes both conserved and
variable
regions of one or more Msps. For vaccines including the D15/Oma87 homologue,
this may be provided by expressing in a suitable host a nucleic acid molecule
having
the nucleotide sequence as shown in SEQ ID N0:3 or SEQ ID NO:S.
In addition to vaccines for T. p. pallidum, the present invention provides
vaccines to protect against yaws, which is caused by the treponeme T. p.
pertetrue.
CA 02325576 2000-10-10
WO 99/53099 PCT/US99/07886
-18-
This vaccine contains an effective amount of at least one isolated Msp capable
of
inducing a protective immunologic response when administered to a suitable
host; and
a physiologically acceptable carver as described above. The yaws vaccine
includes
one or more Msp homologues derived from the T. p. pertertue genome, and may be
obtained in isolated form by expressing in a suitable vector one of the
nucleic acid
sequences shown in SEQ 117 NOS:34, 36, 38 or 40. Other polypeptides useful for
yaws vaccines may be identified by applying the RDA method described in
Example 5,
wherein T. p. pertenue DNA is used as tester DNA. Similarly, polypeptides for
a
bejel vaccine can be identified by using T. p. endemicum DNA as tester. The
efficacy
of polypeptides so identified can be tested for their ability to elicit
protective immunity
by using a rabbit model as described in Example 10 for testing syphilis
vaccine
candidates.
The invention further encompasses vaccines against bejel, the disease caused
by Treponema pallidum subspecies endemicum, and pints, caused by Treponema
carateum. T. p. pallidum and T. p. pertenue, the causative agents of jaws and
bejel
both contain Msp genes related to those present in T. p. pallidum, by analogy,
the
closely related T. carateum must also contain Msp genes useful for vaccines,
and
these can be identified and isolated according to the methods disclosed
herein. In a
further aspect, the invention provides vaccines that provide protective
immunity
against the T. p. pallidum-related treponemes that cause gingivitis and
periodontal
disease. The Msp genes of the oral pathogen treponemes are amplified using the
primers disclosed herein (e.g., the primers of Table 1), and polypeptides
expressed
from the resulting amplicons are expressed and tested for their capacity to
elicit
protective immunity in a suitable animal host.
The subject invention includes methods of inducing a protective immune
response against T. p. pallidum that involve administering to a susceptible
host an
effective amount of any of the aforementioned treponemal vaccines, e.g., the
polypeptides whose amino acid sequences are shown in SEQ >D N0:2, SEQ >l7
N0:4, SEQ >D N0:6, SEQ >D NOS:B, 10, 12, 14, 16, 18, 20, 21, 23, 25, 27, 29
and
31, or any polypeptide whose coding region is amplifiable by one or more of
the
primer pairs of Table 1, or the primer pair 5'-ACCAGTCCTTCCTGTGTGGTTAA 3'
(sense) (SEQ m N0:60) and 5'-ACTCCTTGGTTAGATAGGTAGCTC-3'
(antisense) (SEQ m N0:61), or functional equivalents thereof. The vaccines may
be
administered by any of the methods well known to those skilled in the art,
e.g., by
intramuscular, subcutaneous, intraperitoneal, intravenous injection, orally,
or
CA 02325576 2000-10-10
WO 99/53099 PCTNS99/07886
-19-
intranasally. Naked DNA encoding the treponemal antigen or the treponemal
polypeptide itself may be administered.
The invention further provides a PCR based method for analyzing a sample of
treponemal genomic DNA to determine whether it originated from T. p.
subspecies
pallidum, T. p. subspecies pertenue or T. p. subspecies e»demicum. To carry
out this
method, DNA is isolated from the treponeme whose identity is at issue, or
Chancre
DNA is isolated, and this DNA is amplified using the PCR sense
primer 5'-ACCAGTCCTTCCTGTGTGGTTAA 3' (SEQ ID N0:60) and antisense
primer 5'-ACTCCTTGGTTAGATAGGTAGCTC-3' (SEQ 117 N0:61), and the size
of the resulting DNA fragments, e.g., by gel electrophoresis, or by some other
method. It is determined that the treponemal genomic DNA originated from
T. p. pallidum if the size analysis of the restriction products reveals a
single DNA
fragment having a size of about 1.7 kb, or that the treponemal genomic DNA
originated from T. p. subspecies pertenue if at least two DNA fragments having
sizes
of about 1.7 and 1.3 kb are detected instead. If no DNA fragments result from
amplification using this pair of primers, the treponeme DNA is determined to
have
originated from T. p. subspecies endemicum. Thus, when a patient presents with
a
primary lesion that appears to be caused by a treponemal infection, this test
can be
applied to quickly determine whether the patient suffers from syphilis, yaws,
or bejel.
It is disclosed herein that sufficient variation exists within the Msp gene
family
among various clinical isolates of T. p. pallidum such that restriction
fragment length
polymorphism (RFLP) analysis can be used to differentiate the clinical
isolates, thus
providing a useful means for epidemiologic monitoring of cases of syphilis.
The
invention provides a method of RFLP analysis for determining whether clinical
isolates of T. p. pallidum from different syphilis patients are the same or
differenT.
This method utilizes PCR to amplify samples of genomic DNA from the clinical
isolates, followed by restriction digestion and subsequent length analysis of
the
resulting DNA fragments. In an illustrative example of this technique, the
variable
domains of six alleles of the Msp gene family were amplified using the
following
primers that bind to two short conserved regions that flank a highly variable
region
within the central portion of several members of the Msp family (see Example
7). The
nucleotide sequences of the primers used in this example were
5'-CGACTCACCCTCGAACCA 3' (sense) (SEQ ID N0:48), and
5'-GGTGAGCAGGTGGGTGTAG 3' (antisense) (SEQ ID N0:49). After
amplification of the highly variable region using these primers or other
primers that
CA 02325576 2000-10-10
WO 99/53099 PCTNS99/07886
-20-
amplify this same DNA region, the amplified DNA is digested with one or more
restriction endonucleases that recognize a four-base cleavage site, and the
resulting
restriction fragments are anaiyzed on a gel.
Experimental results presented below in Example 7 have indicated that the
high degree of variability observed in the RFLPs thus obtained is sufficient
to
distinguish many different individual isolates of T. p. pallia~um. In a
preferred
embodiment, the restriction endonucleases used for differentiating individual
isolates
of T. p. pallidum are BstUI, AIuI, HhaI and NTaIII, as these enzymes yielded
15
distinct patterns among 18 tested T. p. pallidum strains. The RFLP method
described
here can be applied to clinical specimens without any need for the technically
difficult
and expensive isolation of the organism prior to analysis. Because aggressive
contact
tracing is relatively effective in the control of syphilis outbreaks, this
method can
provide a means for a public health entity to be able to identify a single
strain of
T. p. pallidum as responsible for a high proportion of incident cases versus
the
multiple strains causing a background level of syphilis in a community, or to
trace the
parties involved in spreading clusters of the disease.
Moreover, these same PCR primers were found also to amplify DNA
segments from both T. p. pertenue and T. p. endemicum (Example 7). Digestion
of
these amplified DNAs with restriction enzymes has yielded distinctive patterns
that
are sufficiently different from the patterns seen for T. p. pallidum to
provide a
diagnostic test for differentiating these three subspecies of T. p. pallidurn.
Also included in the invention is the nucleic acid molecule whose nucleotide
sequence is shown in SEQ ID N0:45, and the polypeptide it encodes which is
shown
in SEQ ID N0:46. This polypeptide represents the amino terminal portion of the
TP 1.6-encoded polypeptide (SEQ ID N0:44) that is described in Example 5, and
the
portion of the TP 1.6 polypeptide shown in SEQ 117 N0:46 matches a portion of
Msp 2 (SEQ ll7 NO:10). It is notable that Msp 2 (SEQ B7 NO:10) lacks a
variable
region, yet vaccine testing with the polypeptide shown in SEQ ID N0:46
provided
protective immunity in rabbits, thus indicating that conserved as well as
variable
region epitopes of Msp proteins are useful in vaccine compositions.
The invention is further explained by reference to the following examples.
Example 1. Production of Antisera
Immune rabbit serum (IRS):
CA 02325576 2000-10-10
WO 99/53099 PCTNS99/07886
-21-
For IRS, antiserum was prepared from rabbits that had been injected with live
infectious T. p. pallidum. Sera were collected at various times following
infection,
and were pooled.
Adsorbed opsonic antiserum (ORS):
Two rabbits infected with T. p. pallidum (Nichols strain) for three months
were boosted intraderrnally and intraperitoneally with 2 x 108 T. pallidum one
month
prior to blood collection. Sera from the two animals were pooled and shown to
have
opsonic activity. The antisenim was sequentially adsorbed with the following
antigens that do not induce opsonizing antibodies or have been shown not to
elicit
immune protection against syphilis: T. phargedenis, biotype Reiter (Lukehart,
S.A.,
et al., J. Immurtol., 129:833-838, 1982), recombinant 47, 37, 34.5, 33, 30, 17
and 15
kDa molecules (Morris et al., Electrophoresis, 8:77-92, 1987) expressed as
maltose-
binding protein-fusion peptides in the pMAL system (New England Biolabs,
Beverly,
MA) and recombinant TROMP 1 (Blanco et al., f Bacteriol., 177:3556-3562, 1995)
expressed as a glutathione-S-transferase-fusion peptide (Pharmacia,
Piscataway, Nn.
The antiserum was further adsorbed with Venereal Disease Research Laboratory
(VDRL) antigen, a lipid complex that has been shown to be the target of some
opsonic antibodies (Baker-Zander et al., J. InfecT. Dis , 167:1100-1105,
1993).
These adsorption steps were performed to reduce the number of irrelevant
positive
clones identified by this antiserum in the expression library screening.
Adsorption was
repeated until no antibody reactivity against the adsorbents could be
demonstrated by
immunofluorescence (Reiter treponeme), immunoblot analysis (recombinant
antigens)
or serological testing (VDRL). The final antiserum retained significant
opsonic
activity as measured by our rabbit macrophage phagocytosis assay (Lukehart and
Miller, J. Immunol., 121:2014-2024, 1978). This absorbed antiserum is herea8er
termed "opsoruc antiserum," or "ORS."
Non-opsonic antiserum (HORS):
Non-opsonic antiserum was prepared by immunization of a seronegative rabbit
with 6 x 10' T. p. pallidum, Nichols strain, that had been heated at
63°C for 1 h,
followed by two boosts of 2-8 x 10' heat-killed organisms. All immunizations
were
performed using incomplete Freund's adjuvanT. The resulting antiserum was
weakly
reactive in the VDRL test, 4+ reactive at 1:1000 dilution in the FTA-ABS test,
and
non-opsonic in the phagocytosis assay. This antiserum is hereafter termed "non-
opsonic antiserum," or "HORS."
CA 02325576 2000-10-10
WO 99/53099 PCTNS99/07886
-22-
Anti-E. coli antibodies present in the opsonic and non-opsonic antisera were
removed using standard techniques (Sambrook et al., Molecular Cloning: A
Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor,
N. Y., 1989, which is hereby incorporated by reference in its entirety).
Briefly, eight
nitrocellulose filters were incubated with an E. coli lysate prepared from 50
ml of
OD 1.0 bacteria , then air dried. Following blocking of non-specific sites,
four of the
E. coli lysate-impregnated filters were incubated with the antiserum.
A T. p. pallidum lysate was subjected to SDS-PAGE and the separated
proteins were tested by immunoblot analysis for reactivity with the T.
pallidum
specific ORS. Total T. pallidum lysate was separated by SDS-PAGE,
immunoblotted
onto nitrocellulose, and exposed to ORS that had not yet been adsorbed, to
post-
adsorption ORS, or to NORS. Results of these analyses indicated that fifteen
molecules with approximate molecular masses of 70, 68, 60, 55, 45, 43, 41, 39,
38,
35, 33, 32, 31, 29 and 13 kDa reacted with the adsorbed ORS. Of these fifteen,
those
with approximate sizes of 68, 43, 41, 39, 38, 35, 31 and 29 kDa exhibited
minimal
immunoreactivity with the non-opsonic antiserum, thus seemed likely to encode
proteins exposed on the surface of T. pallidum.
Example 2. Construction and Screening with ORS of a T. ,pallidum Expression
Library
Rabbit macrophages have been shown to efficiently phagocytize
T. p. pallidum in vitro using antiserum from T. p. pallidum-infected rabbits,
i.e., IRS
as a source of opsonizing antibody (Lukehart and Nlller, J. Immunol., 121:2014-
2024, 1978; Baker-Zander and Lukehart, J. InfecT. Dis., 165:69-74, 1992). In
contrast, antiserum from rabbits immunized with heat-killed T. p. pallidum
fails to
opsonize. In addition to its opsonic potential, IRS has been shown to block
T. p. pallidum adherence to host cells (Fitzgerald et al., InfecT. Immun.,
18:467-478,
1975; Fitzgerald et al., InfecT. Immun., 11:1133-1145, 1975; Hayes et al.,
InfecT. Immun., 17:174-186, 1977; Wong et al., Br. J Yener. Dis., 59:220-224,
1983) and to provide partial protection against T. p. pallidum infection in
passive
transfer experiments (Sepetjuan et al., Br. .I. Yener. Dis., 49:335-337, 1973;
Perine
et al., InfecT. Immun., 8:787-790, 1973; Turner et al., Johns Hopkins Med
J., 133:241-251, 1973; Bishop and Miller, J. Immunol., 117:191-196, 1976;
Weiser
et aL, InfecT. Immun., 13:1402-1407, 1976; Graves and Alden, Br. f Yener.
Dis., 55:399-403, 1979; Titus and Weiser, J. InfecT. Dis., 140:904-913, 1979).
As a
CA 02325576 2000-10-10
WO 99/53099 PCT/US99/07886
-23-
result, antigens exhibiting reactivity with IRS may have additional functional
roles in
cytoadherence and immune protection.
Collectively, these observations demonstrate the importance of identifying the
target antigens of T. pallidum-specific opsonic antibody. Opsonic antibodies
generally recognize bacterial peptidoglycan, 3ipopolysaccharide, capsular
polysaccharides or proteins, and since T. pallidum does not have an accessible
peptidoglycan layer nor does it contain either lipopolysaccharide or capsular
material,
the opsonic targets are likely to be surface-exposed outer membrane proteins.
To identify potential opsonuc targets, a treponemal genomic expression library
was constructed and differentially screened with ORS and NORS that were
prepared
as described in Example 1. To prepare the library, T. p. pallidum genomic DNA
was
isolated from approximately 101° organisms using the QIAamp Tissue
Purification Kit
(Qiagen, Chatsworth, CA) and a genomic expression library was constructed
using
the Lambda ZAP~ II/EcoRI/CIAP cloning kit (Stratagene, La Jolla, CA) according
to
the manufacturer's instructions. Briefly, Z pg of T. pallidum genomic DNA were
partially digested with Tsp509I and DNA fragments in the size range of 0.5 to
4.0 kb
were gel-purified using standard techniques (Sambrook et al., 1989). One
hundred
and forty nanograms of the size-selected Tsp509I-digested DNA preparation were
ligated to EcoRI predigested Lambda ZAP II vector arms and the ligated DNA was
packaged using the Gigapack II packaging extract (Stratagene). The resulting
bacteriophage library had a titer of 4.7 x 106 pfu/ml.
E. coli XL-1 Blue (Stratagene, La Jolla, CA) was used as the host strain to
plate approximately 50,000 plaques (12,500 pfin/plate) using established
methods
(Sambrook et al., 1989). The plates were incubated for 5.5 h at 37°C,
overlaid with
10 mM isopropylthiogalactopyranoside (IPTG~impregnated nitrocellulose filters
and
incubated for a fiuther 4 h at 37°C. Duplicate lifts were prepared by
removing the
filters and overlaying the plates with fresh 1PTG impregnated filters prior to
a second
overnight incubation at 37°C. Filters were washed in Tris-buffered
saline with 0.05%
Tween-20 and stored moist at 4°C until the immunoscreening step.
Immunoblot analysis was performed as previously described (Baker-Zander
et al., J. InfecT. Dis., 151:264-272, 1985). For SDS-PAGE gels, a 10 kDa
protein
ladder (Gibco BRL, Gaithersburg, 11~) was included as a standard. Filters were
screened according to the manufacturer's instructions (Stratagene's picoBlue'
immunoscreening kit). Briefly, blots were blocked with 3% nonfat milk in Tris-
buffered saline and exposed to a 1:100 dilution of the anti-T. pallidum ORS
with the
CA 02325576 2000-10-10
WO 99/53099 PCTNS99/07886
-24-
primary plaque lifts and a similar dilution of the NORS with the duplicate
plaque lifts.
Immunoreactive plaques were detected with 1 ~Ci of 1~I-labeled protein
A/nitrocellulose filter using established methods (Sambrook et al., 1989).
Those
clones showing reactivity with the opsonic antiserum but no reactivity with
the non-
opsonic antiserum were subjected to secondary screening with both the opsonic
and
non-opsonic antiserum. Clones consistently showing differential reactivity
were
screened yet again with the opsoruc antiserum.
Cloning and sequencing:
Immunoreactive plaques were converted to pBluescript SK(-) phagemids by
in vivo excision in the E. coli host strains XL,-1 Blue and SoIR according to
the
manufacturer's instructions. Both strands of insert DNA were sequenced by a
combination of single-stranded and double-stranded DNA sequencing using the
Sequenase' Version 2.0 and the Applied Biosystems dye terminator sequencing
kits
and the ABI 373A DNA sequencer according to the manufacturer's instructions.
In
all cases both universal sequencing primers and internal primers designed from
DNA
sequences were used.
Results of Screening:
A Lambda ZAP II T. P. pallidum genomic expression library was constructed
and screened in duplicate with the ORS as well as with the NORS. Ten clones
were
identified that were immunoreactive exclusively with the opsonic antiserum. As
discussed in more detail in the examples to follow, nucleotide sequence
analysis has
been performed for six of these clones.
DNA and protein sequence analysis:
Ten clones that specifically reacted with ORS were selected for DNA
sequence analysis. Of these, four proved to encode the same protein (see
Example 3),
while one encoded a putative outer membrane protein (see Example 4), and the
remaining positive encoded one member of a 12-member gene family (see
Example 5). Nucleotide sequences were analyzed using the SeqApp' software
(Gilbert, D.G. (1992) SeqApp', which is published electronically on the
Internet, and
which is available via anonymous ftp from ftp.bio.indiana.edu. ILTBio archive
of
molecular and general biology software and data). Database searches were
performed
using the basic local alignment search tool (BLAST) algorithm (Altschul et
al.,
J. Mol. Biol., 215:4673-4680, 1990) and either the BLASTN, BLASTX or BLASTP
programs. Alignments of the protein sequences encoded by the clones were
performed using the Clustal W general purpose multiple alignment program
CA 02325576 2000-10-10
WO 99/53099 PCT/US99/07886
-25-
(Thompson et al., Nucl. Acids Res., 22:4673-4680, I994). The percentage of
positional identity and similarity between sequences was calculated from the
number
of identical or similar residues, respectively, between aligned sequences, but
insertions
and deletions were not scored. The molecular mass and pI of the translated
product
were calculated using the MacProMass' v1.05 software (Beckman Research
Institute,
Duarte, CA). The Prosite' protein motif database was used to access the signal
peptidase I and II cleavage sites.
Example 3 T p yallidum~,r ycerophosnhodiester phosphodiesterase (GydO
The ten ORS-specific plaques described in Example 2 were subjected to
tertiary screening to obtain well-isolated plaques and to verify positivity.
Analysis of
one of these plaques has been reported previously in Stebeck et al., FEMS
Microbiol.
Letters, 154:303-310, 1997, which is hereby incorporated by reference in its
entirety.
In vivo excision of the plaque described in Stebeck et al., 1997, produced a
pBluescript phagemid containing a 3. S kb inserT. Nucleotide sequence analysis
of
the 3.5 kb insert revealed a 1071 by open reading frame (SEQ ID NO:1) encoding
a 356 amino acid translated. product (SEQ ID N0:2). Sequence analysis of three
more of the ten positive plaques described in Example 2 revealed nucleotide
sequences encoding this same 41 kDa protein. The polypeptide shown in SEQ ID
N0:2 has a predicted isoelectric point at pH 9.13 and a predicted molecular
mass
of 41,014 kDa. Putative -35 (TGCACG) and -10 (TATAA) promoter regions and a
ribosome binding site (GAGGAG) were noted in the nucleotide sequence encoding
this protein, upstream from the ATG initiation codon.
Analysis indicated that the 41 kDa protein of SEQ 117 N0:2 contains a two
amino acid signal peptide characteristic of previously identified prokaryotic
membrane
lipoproteins, including an amino-terminal basic residue, a hydrophobic core
and a
putative Leu-Val-Ala-Gly-Cys signal peptidase II cleavage site (Hayashi and
Wu,
J. Bioenerg. Biomembr., 22:451-471, 1990), strongly indicating that this
protein itself
is a membrane lipoprotein. Another group of investigators using a different
gene
isolation approach reported the isolation of a gene encoding this same 356
amino acid
protein from T. p. pallidum, but reported that the protein was anchored to the
periplasmic leaflet rather than being part of the outer membrane. (Shevchenko
et al.,
InfecT. Immun., 65:4179-4189, 1997).
This predicted molecular mass corresponds with that of the 41 kDa-
immunoreactive protein described in Example 1 that reacts specifically with
ORS
when this antiserum was used to develop Western blots containing treponeme
lysates
CA 02325576 2000-10-10
WO 99/53099 PCT/US99/0'7886
-26-
(see Example 1). It was shown previously that a 41 kDa protein is among those
that
can be detected in treponeme lysates analyzed on Western blots with serum from
human syphilis patients (Baker-Zander et al., 1985). As described in more
detail
below, antibody directed against the subject recombinant 41 kDa protein also
reacts
with a 41 kDa protein present in treponeme lysates, thus this new gene may
correspond to the same protein detected with human syphilis patient sera.
Sequence alignment analyses:
Sequence database analysis of the 356 amino acid translated sequence (SEQ
ID N0:2) identified glycerophosphodiester phosphodiesterase (Gpd) from a
variety of
bacterial species as the optimal scoring protein, the closest match being with
the Gpd
of Haemophilus inJlue»zae. The T. p. pallidum Gpd homologue (SEQ D7 N0:2)
exhibited about 72.2% sequence similarity with the corresponding H. in,
fluerrzae
protein (Janson et al., InfecT. Immun., 59:119-125, 1991; Munson and Sasaki,
.l. Bacteriol, 175:4569-4571, 1993), as well as 70.5% amino acid sequence
homology
with an E. coli enzyme having the same activity (Tomrnassen et al., Mol. Gerr.
Genet., 226:321-327, 1991). Homology was found also but to a lesser degree,
with
the Gpds from Borrelia hermsii (58.4%; Schwan et al., .l. Clin. Microbiol.,
34:2483-
2492, 1996; Shang et al., J. Bacteriol., 179:2238-2246, 1997) and Bacillus
subtilis
(37.4%) (Nilsson et al., Microbiol., 140:723-730, 1994). The 41 kDa T. p.
pallidum
protein (SEQ ID N0:2) is within the range of masses reported for Gpds from
other
bacterial species, and closely matches the 40-kDa T. pallidum immunoreactive
antigen
identified by Shang et al. using rabbit anti B. hermsii glycerophosphodiester
phosphodiesterase antiserum (Shang et al., J. Bacteriol., 179:2238-2246,
1997).
Taken together, these results indicated that the 356 amino acid translated
sequence
ZS (SEQ ID N0:2) is a Gpd encoded by T. p. pallidum.
Example 4. Identification of a T. pallidum D 15/Oma 87 homolostue
Another of the immunoreactive lambda clones was subjected to nucleotide
sequence analysis, and an open reading frame was found by sequencing the
portion of
the cloned insert fused with the open reading frame of ~i-galactosidase in
pBluescripT. The cloned insert was sequenced as described in Example 2, and an
open reading frame was identified that gave a 94 kDa protein, whose amino acid
sequence is shown in SEQ ID N0:4. A corresponding full length ORF encoding
this 94 kDa protein was identified from the T. p. pallidum genome sequence
that was
released June 24, 1997, by the Institute for Genomic Research (TIGR), although
TIGR predicted a different initiating methionine for the D15/Oma87 homologue.
CA 02325576 2000-10-10
WO 99/53099 PCTNS99/07886
-27-
The amino acid sequence predicted from this cloned insert was found to share
sequence similarity with the protective surface-exposed outer membrane
antigens D15
of H. influenzae (36.3%) (Flack et al., Gene, 156:97-99, 1995) and Oma87 of
Pasteurella multocida (35.7%) (Ruffolo and Alder, Infec. Immun., 64:3161-3167,
1996), as well as with outer membrane proteins from Brucella abortus (37.2%,
Genbank accession number U51683) and N. gonorrhoeae (35.2%, Genbank accession
number U81959). The open reading frame of this clone was subcloned into
expression vectors for further analysis.
The T. pallidum D15/Oma87 homologue (SEQ ID N0:4) is predicted to have
a type I cleavable signal sequence (using rules devised by von Heinje, et al.
(Nucleic
Acids Res., 14:4683-4690, 1986) and McGeoch, et al. (Virus Res., 3:271-286,
1985).
In addition, the protein was shown to have an 85% probability of being an
outer
membrane protein by the pSORT program which takes into account hydrophobic
domains and secondary structure (see http://psort.nibb.ac.jp~. Moreover, the
Borrelia burgdorferi homologue of this clone has been identified from the
B. burgdorferi genome project (Vugt et al., Nature, 390:580-586, 1997) and has
been
classified as a probable outer membrane protein.
As described in Example 10, this protein has been expressed in E. coli and the
recombinant protein used to immunize rabbits.
Example 5 Identification of a family of T. pallidum maior sheath protein
homolo~tue
Another of the ORS-reactive clones described in Example 2 was sequenced,
and upon analysis the polypeptide it encoded proved to have 41.5% amino acid
sequence similarity with the 53 kDa Treponema denticola major outer membrane
sheath protein (Msp) (Egli et al., InfecT. Immun., 61:1694-99, 1993) and, as
discussed further below, with a T. pallidum sequence deposited in Genbank
(50.1%;
Genbank accession number TPU88957, deposited by Hardham et al., Univ. N.
Carolina, and corresponding to TIGR TprK, or Msp9).
Fragments of another gene related to the T. denticola Msp gene were
identified by a separate approach using representational difference analysis
(RDA), a
subtractive hybridization technique in which one compares two populations of
nucleic
acid molecules to obtain clones of genes that are present in one population
but not in
the other (Lisitsyn et al., Science, 259:947-950, 1993; Lisitsyn et al.,
Nature
Genetics, 6:57-63, 1994). For RDA, the DNA that contains the genes of interest
is
called the "tester," and the reference DNA is the "driver." In essence,
sequences
present in the tester DNA but absent from the driver DNA are selectively
amplified by
CA 02325576 2000-10-10
WO 99/53099 PCT/US99/07886
-28-
using PCR. In a first annealing step, an excess of driver DNA is hybridized
with a
small amount of tester DNA. Tester sequences common to both populations are
thus
selectively driven into tester-driver hybrids, while unique tester sequences
will form
only tester-tester hybrids. The unique tester-tester hybrid molecules are
separated
from tester-driver hybrids as follows. Prior to the first hybridization step,
short
adapter oligonucleotides are ligated to the tester DNA. After the tester DNA
has
been hybridized with the driver DNA, the adapter sequences are annealed with
PCR
primers that bind to the protruding adapter sequences, and the tester-tester
hybrids
are thus selectively amplified.
For the experiments described below, the organisms used were T. p. pallidum,
Nichols strain, and T. paraluiscuniculi, Cuniculi A strain. After being
propagated in
New Zealand white rabbits, the bacteria were extracted from infected rabbit
testes in
sterile saline, collected in DNAse/RNAse-free 1.7 ml microfuge tubes, and spun
immediately in a microfuge at 12,000 X G for 30 minutes at 4°C.
Bacterial pellets
were resuspended in 200 ~tl of 1X lysis buffer (10 mM Tris pH 8.0, O.1M EDTA,
0.5% SDS), and DNA was extracted using the Qiagen Kit for genomic DNA
extraction (Qiagen Inc., Chatsworth, CA) using the manufacturer's
instructions. The
DNA was treated with RNAse A. RDA was carried out using the CLONTECH PCR-
Select Subtraction Kit (Clontech, Palo Alto, CA) following the manufacturer's
protocol beginning from the section describing the restriction digestion step.
For RDA, DNA from T. p. pallidum served as the tester DNA, and a mixture
of Treponema paraluiscuniculi (a rabbit pathogen) plus rabbit genomic DNA
served
as the driver. T. paraluiscuniculi was used as a driver DNA because this
relative of
T. p. pallidum, unlike its virulent cousin, cannot infect humans. Thus, it was
surmised
that genes present in T. p. pallidum but absent from T. paraluiscuniculi would
be
involved in pathogenicity, and would provide likely candidates for vaccine
testing.
Rabbit genomic DNA was included in the driver to remove any traces of rabbit
DNA
that co-purified with the bacterial DNA. This same experimental strategy is
applicable
to the isolation of genes related to pathogenicity in humans from any species
or
subspecies of Treponema that infects humans but not rabbits. For example, to
isolate
pathogenicity-related genes from T. p. pertenue or T. p. endemicum using RDA,
one
would use tester DNA from one or the other of these bacteria and driver DNA
from
T. paraluiscuniculi.
Two separate subtraction libraries were created using the above-described
tester and driver DNAs. Briefly, 0.5 p,g of T. p. pallidum genomic DNA (tester
CA 02325576 2000-10-10
WO 99/53099 PCTNS99/07886
-29-
DNA) and a pool of 3 pg of T. paraluiscuniculi DNA plus 3 pg of rabbit liver
DNA
(driver DNA) were digested to completion with Rsa I. The digestion products
were
purified by the phenol/chloroform/isoamyl alcohol method and the digested
tester was
then divided into 2 aliquots (tester-1 and tester-2) and each was ligated to
one of two
adapters that were to serve as binding sites for PCR primers:
Adapter 1. 5'-TAATACGACTCACTATAGGGCTCGAGCGGCCGCCCGGG
CAGGT-3' (SEQ ID N0:62)
Adapter 2. 5'-GTAATACGACTCACTATAGGGCAGCGTGGTCGCGGCCG
AGGT-3' (SEQ ID N0:63)
These adapters are sufficiently long to accommodate binding with two different
sets
of primers to permit "nested PCR" as described below. No adapters were ligated
to
the driver DNA.
For the first hybridization, two aliquots of tester DNA (tester-1 and tester-
2)
were heat denatured in separate reaction tubes in the presence of an excess of
driver
and allowed briefly to reanneal. During this time, low abundance DNA fragments
that
are unique to the tester remained as single-stranded DNA, and common DNA
fragments annealed with the driver to form double stranded DNA.
For the second hybridization step, both of the first hybridization mixtures
were
pooled and hybridized again with additional excess denatured driver DNA. This
second hybridization step permitted further removal of common sequences, and
permitted the single-stranded DNA fragments unique to the tester populations
to form
hybrids with one another, these latter hybrids including tester-tester
duplexes having
different adaptors at each end, i.e., tester-1/tester-2 duplexes. At this
stage, the
adapter sequences were single-stranded, forming overhangs at each end of the
duplex
molecules. These overhangs were filled in with DNA polymerase, yielding unique
double-stranded molecules having different primer binding sites on their 5'
and 3' ends
adaptor sequences. Primary PCR was then used to amplify these unique tester-
tester
hybrids, using a PCR primer No. 1, which binds to both adaptors 1 and 2,
followed by
a nested PCR (nested primer l, 5'-TCGAGCGGCCGCCCGGGCAGGT (SEQ ID
N0:64), and nested primer 2, 5'--AGCGTGGTCGCGGCCGAGGT (SEQ D7
N0:65)), to further enrich unique sequences, to reduce the background, and to
increase the specificity of the amplification. Secondary PCR products were
then
cloned directly into the PCR 3.1 T/A cloning vector (Invitrogen, Sorrento,
CA), and
the cloned inserts subjected to DNA sequence analysis.
CA 02325576 2000-10-10
WO 99/53099 PCT/IJS99/07886
-30-
For sequencing, single colonies were selected and plasmid DNA was digested
with Eco RI to identify the clones containing inserts. Double-stranded plasmid
DNA
was extracted with the Qiagen Plasmid Kit (Qiagen, Chatsworth, CA), and 500 ng
of
each DNA was used for fully automated sequencing by the dye terminator method
(Perkin Elmer, Foster City, CA) according to the manufacturer's instructions
but with
the addition of 1 pl of molecular grade dimethylsulfoxide (Sigma, ST. Louis,
MO) per
reaction, giving a final concentration of 5% vol/vol. Cloned DNAs were
sequenced in
both directions using the T7 and reverse sequencing primers homologous to
plasmid
regions flanking the cloned inserts. The cloned inserts were found to range in
size
from 100 by to 500 bp. Two clones of particular interest were obtained, clones
3 and
33, each of which was isolated from an independently constructed subtraction
library
made as described above.
The sequences obtained from clones 3 and 33 were used to do Blast searches
in the nucleotide and protein databases. No significant homologies were found
at the
nucleotide sequence level, but the predicted amino acid sequences encoded by
both
clones indicated that these polypeptides were related to the Msp protein of
T. denticola, an oral treponeme associated with periodontal disease (Genbank
accession No. U29399). Alignment using the Clustal W program indicated that
the
inserts of clones 3 and 33 aligned, respectively, with regions near the amino
and
carboxyl ends of the T. denticola Msp protein. These clones were subsequently
used
as described below for hybridization with Southern blots of the T. p. pallidum
genomic DNA, and to design oligonucleotides for PCR amplification of longer
pieces
of the T.p. pallidum Msp homologue from which they appeared to be derived.
To determine the specificity of the cloned unique sequences for T. p.
pallidum,
as well as their hybridization patterns to digested genomic DNA, approximately
3 pg
each of T. p. pallidum (Nichols strain) and rabbit DNA were digested with Eco
RI,
Pst I, and Bam HI, then separated in 1% TBE agarose gels, denatured with 0.5 M
NaOH and transferred to Hybond N membrane (Amersham Laboratories, Arlington
Heights, IL). The inserts of clones 3 and 33 were labeled as follows to use as
hybridization probes. The inserts were PCR amplified from the cloning vectors
using
the nested primers described above under the same conditions as for the nested
PCR
during the subtraction experiments, and purified using the Qiaquick PCR
Purification
Kit (Qiagen, Chattsworth, CA). Fifty ng of the purified amplicons were then
labeled
by random priming with a-3zP using the Random Priming labeling Kit (Boehringer
3 5 Manheim, Indianapolis, III according to the manufacturer's protocol.
CA 02325576 2000-10-10
WO 99/53099 PCT/US99/07886
-31-
The labeled inserts of clones 3 and 33 were hybridized under high stringency
conditions to the above-described Southern blots. Each probe was allowed to
bind
the PCR products on a separate filter for 12 hours at 37°C in
hybridization solution
(50% formamide, SX SSC, 50 mM NaP04, 1% SDS, SX Denhardt's solution). The
blots were then subjected to stringent washes at 65°C in buffers
containing 2X SSPE,
0.1% SDS, and 0.2X SSPE, 0.1% SDS, for 20 minutes each (SSPE: 150 mM NaCI,
mM NaP04, 1 mM NaEDTA, p 7.4). Hybridization was detected by
autoradiography. No hybridization of these probes with rabbit DNA was
observed,
indicating that the probes were specific for T. p. pallidum. The results of
these
10 Southern blots disclosed several hybridizing DNA fragments, thus suggesting
that the
cloned genes belonged to a multigene family. The Eco RI digests yielded bands
of
about 8 and 5 kb, the Pst I digests bands of about 1 kb, 800 bp, and 500 bp,
and the
Bam HI digests bands of about 8, 5 and 3 kb.
Isolation of TP 1.6 (SEQ ID N0:43):
As explained above, the inserts of clones 3 and 33 were homologous,
respectively, to the 5' and 3' ends of the Msp gene of T. denticola, thus
primers were
designed to amplify that portion of the T. p. pallidum Msp homologue that
presumably lay between the two clones. Primers used were the S-3 sense primer
corresponding to the 5' end of the insert of clone 3 and having the sequence
5'-ACCAGTCCTTCCTGTGTGGTTAA (SEQ ID N0:66), and the antisense primer
As-33, corresponding to the 3' end of the insert of clone 33, and having the
sequence
5'-ACTCCTTGGTTAGATAGGTAGCTC (SEQ ID N0:67). A hot start PCR
amplification was performed as described above using as templates
approximately 1
pg of genomic DNA of T. p. pallidum, Nichols strain. The DNA was amplified in
a
total volume of 100 N,1 per tube, each containing 200 l,iM dNTPs, 50 mM TRIS-
HCl
(pH 9.0 at 200° C), 200 mM ammonium sulfate, 1 p,M each primer and 2.5
units of
Taq polymerise (Promega, Madison, WI). MgCl2 beads (Invitrogen, San Diego
California) were added giving a final MgCl2 concentration of 1.5 mM. The
following
cycling conditions were used: an initial step of 4 minutes denaturation at
94°C
followed by 40 cycles at 94°C for 1 minute, 65°C for 2 minutes,
72°C for 1 minute,
and a final elongation step of 10 minutes at 72°C. The PCR products
were then kept
at 4°C and directly cloned into T/A cloning vectors for sequencing and
for further
analysis on agarose gels. The PCR was repeated several times, and each time
yielded
one band that proved to contain 1687 by (TP 1.6)(SEQ ID N0:43).
CA 02325576 2000-10-10
WO 99/53099 PCT/US99/07886
-32-
The sequence of TP 1.6 (SEQ ID N0:43) was found later to have high
homology with a newly released T. p. pallidum Msp-like sequence in Genbank
(TPU88957), and to at least 10 different ORFs that were present in the initial
release
on June 24, 1997 of the TIGR T. p. pallidum genome project (posted at
http://med.uth.tmc.edu/Treponema/tpall.html~. When first posted on the
Internet in
June, 1997, the TIGR T. p. pallidum sequence was not annotated, i.e., the
locations
of open reading frames were not indicated. The August 18, 1997 update was
annotated, but not until the January 1, 1998 update were all 12 Msp family
members
(Tprgenes by TIGR Terminology) identified according to their coordinates. It
should
be noted that all versions of the T. p. pallidum genome posted at the TIGR
site are
regarded as preliminary in nature and may contain misassembled genes,
mutations and
frameshifts, particularly within the Msp family. Nonetheless, comparisons were
conducted to determine whether the posted sequences contained any sequences
similar or identical to the nucleotide sequence of TP 1.6 (SEQ ID N0:43). A
search
located an open reading frame in the posted T. p. pallidum sequence at
positions 73,979 - 75,665 (based on the August 18, 1997 version) that is
90.21%
identical to the sequence of TP 1.6 (SEQ ID N0:43). The aligned sequences
contained 55 amino acid mismatches spread throughout the 5' end from amino
acid
positions 1 through 123. Beyond this point to the 3' end, the identity of both
amino
acid sequences is 100%.
The Msp genes are arranged into five regions on the T. p. pallidum
chromosome. There are three major subfamilies of Msps as defined by homology
of
their predicted amino acid sequences. Subfamily I includes Msps 2 (SEQ ID
N0:9), 4
(SEQ ID N0:13), 5 (SEQ ID NO:15), and 11 (SEQ 117 N0:28), which are highly
homologous to one another at their 5' and 3' termini. Msps 4 (SEQ ID N0:13)
and 5
(SEQ D7 NO:15) and 11 (SEQ ID N0:28) have central variable regions of
about 600 bp, while Msp 2 (SEQ ID N0:9) lacks any variable region. Msp 4 (SEQ
ID N0:13) and 5 (SEQ D7 NO:15) are identical. Subfamily II includes Msps 1
(SEQ
ID N0:7), 3 (SEQ 11? NO:11) and 10 (SEQ ID N0:26), and has larger variable
regions of about 1000 bp. This subfamily shares significant homology at the 5'
and 3'
ends with the Subfamily I. Subfamily III includes Msps 6 (SEQ ID NO: I7), 7
(SEQ
ID N0:19), 8 (SEQ ID N0:22), 9 (SEQ D3 N0:24) and 12 (SEQ ID N0:30), all of
whose sequences are comparatively distinct from the two other groups and from
one
another. Msp 7 (SEQ 117 N0:19) appears to have a premature termination, in
that at
the termination of ORF A (SEQ ID N0:20), in another reading frame, there is
another
CA 02325576 2000-10-10
WO 99/53099 PCT/US99/07886
-33-
ORF encoding another 368 amino acids (ORF B (SEQ ID N0:21)) that is
homologous to the other Msps.
The TP 1.6 sequence (SEQ ID N0:43} was found by comparison to the TIGR
Tpr sequences to be a hybrid gene. The amino terminus, i.e., the first 152
amino
acids, of the TP 1.6 polypeptide (SEQ ID N0:44) matches the amino terminus of
Msp 2 (SEQ ID N0:9), and differs in only two amino acids from the amino
terminus
of Msp 4 (SEQ 117 N0:13) and S (SEQ ID N0:15), while the 410 amino acids at
the
carboxyl terminus of TP 1.6 (SEQ ID N0:43) match the corresponding portion of
Msp 1 (SEQ ID N0:7). The significance of this finding is not presently known.
One Msp gene is predominantly transcribed by T. p. pallidum Nichols strain:
T. p. pallidum Nichols that was isolated on days 5, 7, and 15 after infection
transcribes predominantly Msp 9 (SEQ ID N0:24) mRNA, as determined by reverse
transcriptase PCR (RT-PCR), a procedure that amplifies cDNA synthesized from
total
RNA, including mRNA, found in the bacteria, thus reflecting transcribed genes.
To
perform RT PCR, a group of oligonucleotide primers were prepared that are
specific
to the variable regions of Msps 1 (SEQ ID N0:7), 3 (SEQ ID NO:11), 4 (SEQ ID
N0:13), 5 (SEQ ID NO:15), 6 (SEQ ID N0:17), 7 (SEQ ID N0:19), 8 (SEQ ID
N0:22), 9 (SEQ ID N0:24}, 10 (SEQ ID N0:26), 11 (SEQ ID N0:28), and 12 (SEQ
ID N0:30)(see Table 1), thus providing specific amplification of transcripts
of those
Msps. Using T. p. pallidum RNA extracted from infected rabbit testes, RT-PCR
analysis of the Msp transcription pattern was conducted beginning at day 5
after
infection. At day 5, a strong signal for Msp 9 (SEQ ID N0:24) was evident with
a
weak signal for Msps 6 (SEQ ID N0:17) and 11 (SEQ 117 N0:28). Transcripts from
Msps 1 (SEQ ID N0:7) or 12 (SEQ ID N0:30) mRNA were detected, but signals
were weak and variable. After 5 more PCR cycles, signal was discernible for
all the
Msps, indicating that transcripts from all of them were present, but at
relatively low
levels. The preponderance of Msp 9 (SEQ ID N0:24) product was not due to an
overly efficient Msp 9 (SEQ ID N0:24) PCR, because when these same primers
were
used to amplify T. p. pallidum genome DNA, it was found that the primers for
Msp 9
(SEQ ID N0:24) were less efficient than the primers for Msp 7 (SEQ ID N0:19)
or 4
(SEQ ID N0:13) or 5 (SEQ ID NO:15). Moreover, the PCR products obtained from
the RT-PCR RNA likely reflected mRNA and not contaminating T. p. pallidum
genome DNA because the RNA preparation was extensively pre-treated with DNAse
before the cDNA synthesis step. Furthermore, omitting reverse transcriptase
from the
reactions Ied to no producT.
CA 02325576 2000-10-10
WO 99/53099 PCT/US99/07886
-34-
The most likely explanation for these results is that a majority of the
treponemes express Msp9 (SEQ ID N0:24), and that a minority of them express
Msps 1 (SEQ 117 N0:7), 6 (SEQ ID N0:17), 11 (SEQ ll7 N0:28), or 12 (SEQ ID
N0:30). Alternatively, it may be the case that each individual treponeme cell
S expresses high amounts of Msp 9 mRNA and lower quantities of Msps 1 (SEQ ID
N0:7), 6 (SEQ ID N0:17), 11 (SEQ ID N0:28), and 12 (SEQ ID N0:30).
Other strains of T. p. pallidum have been similarly analyzed by RT PCR, and
proved to express other Msp preferentially, i.e., the pattern of expression
appears to
be strain-specific.
Identification of an Msp homologue in Treponema pallidum perte~tue:
The primers described above for amplification of TP 1.6 (SEQ ID N0:43)
were used to amplify a fragment of DNA from the closely related treponeme,
T. p. pertenue, the etiologic agent of yaws. A hot start PCR amplification was
performed as described above using as templates approximately 1 pg of genomic
DNA of T. p. pallidum, Nichols strain, and T. p. pertenue, Gauthier strain,
using the
same cycling conditions described in Example 5 for these primers. The PCR
products
were then kept at 4°C and directly cloned into T/A cloning vectors for
sequencing and
for fiuther analysis on agarose gels. PCR amplification with these primers
reproducibly yielded the expected 1687 by band using T. p. pallidum DNA, and
for
the T. p. perterrue DNA, a band of 1705 bp, as well as smaller bands of 1291
bp.
When attempts were made to amplify the DNA of T. p. endemicum with this
same primer pair, no DNA fragment was amplified.
Analysis of the T. p. pallidum and T. p. pertenue Msp Homologues:
Sequencing was done by the primer walking approach, using the T7, PCR 3.1
reverse, the INT-S, 5'-GGCTTCCGCTTCTCCTTCG (SEQ ID N0:68), and the
INT-As, 5'-GTTTCGAGCTTAAGGAATCC (SEQ ID N0:69). The following
clones were sequenced: T. p. pallidum, clones 1,2,4,5,7, and T. p. pertenue,
clones 6
and 16 of the larger amplicons (~ 1.7 kb), and clones 2, 3, 5, 7, and 8 of the
shorter
ampIicons (~1.3 kb).
Automated sequencing of the 1.6 kb amplicon of T. p. pallidum and of
the 1.7 kb and 1.3 kb amplicons of T. p. perterrue revealed four different
copies in
T. p. pertem~e, one 1.6 kb (clones 6 and 16) and three 1.3 kb homologues
(homologue l3Ty 238, TyS, and Ty7; from clones 2/3/8, 5 and 7, respectively),
and a
single DNA sequence in T. p. pallidum (clones 1, 2, 4, 5, and 7) among the 19
clones
3 5 of T. p. pertenue and the five from T. p. pallidum that were examined. The
CA 02325576 2000-10-10
WO 99/53099 PCT/US99/07886
-35-
T. p. pallidum DNA fragment (TP 1.6)(SEQ B7 N0:43) has 1687 bp, thus
predicting
a peptide sequence of 562 amino acids (frame +1).
The long homologue of T. p. pertenue (l7Ty) had a DNA sequence
of 1705 bp, and encodes a putative polypeptide of 568 amino acids (SEQ m
N0:35).
The shorter amplicons ( 13 Ty 23 8, 13 TyS, and 13 Ty7) all were 1291 by long,
and
predicted polypeptides having the same length, 438 amino acids, but differing
at their
carboxyl termini (SEQ m NOS:37, 39 and 41). When the deduced peptide sequences
of amplicons identified in both subspecies were aligned, i.e., TP 1.6, 17 Ty
and 13 Ty,
it was found that the T. p. pertenue Msp homologue, like those of T. p.
pallidum,
have highly conserved regions located at the amino and carboxyl terminal ends,
separated by a central variable region. For the three 438 amino acid
polypeptides, the
amino terminal conserved regions extend from amino acid positions 1 through
153,
the carboxyl terminal conserved regions from positions 444 through 592, and
the
internal variable region from positions 154 through 443. As compared with the
polypeptide encoded by 17 Ty, the central variable portions of the 438 amino
acid
polypegtides lack the 161 amino acids present at positions 241 through 400 of
the 17 Ty polypeptide.
When the peptides encoded by the three 1.3 kb short fragments of
T. p. pertenue were compared, it was found that they are highly conserved in
almost
their entire length, except at their 3' regions where sequence variation was
found in a
short region from amino acids 354 through 381.
Based on the differences in their Msp regions, it is clear that PCR using the
above described primer pair can differentiate the treponemes responsible for
syphilis,
yaws, and bejel, as the results for the three treponemes yield DNA fragments
that
differ in size and number, and of course, nucleotide sequence. As shown in
Example 7, this approach has been extended to develop an RFLP-based method for
the differentiation of other strains and subspecies of Treponema.
The various subspecies of T. pallidum, including the etiologic agents of human
syphilis, yaws, and bejel, possess very small and highly-related genomes, yet
all are
able to produce lifelong infection in untreated patients. The past inability
to
differentiate subspecies and strains of T. p. pallidum using serologic methods
has led
some investigators to hypothesize that these pathogens actually are identical,
with
only environmental factors dictating different clinical manifestations
(Hudson, E.H.,
Treponematosis Perspectives Bull., WHO 32:735-748, 1965). However, this view
is
contraindicated, e.g., by differences in the pathogenesis of the infections,
and by the
CA 02325576 2000-10-10
WO 99/53099 PCT/US99/07886
-36-
co-existence of more than one distinct treponemal disease in some locales.
Moreover,
there is experimental evidence for antigenic heterogeneity between subspecies
and
strains. More specifically, this heterogeneity must lie in the "protective"
antigen or
antigens, since hosts infected with one of the strains is only partially
resistant to the
other strains. To date, the molecular bases for differences in pathogenesis
and
immunity have not been identified. The present findings provide an additional
means
of differentiating the strains of T. pallidum responsible for syphilis, yaws
and bejel,
and moreover may be directly relevant to the antigenic variations that are
responsible
for the differences in pathogenicity among these treponemes.
Transmembrane Topology Analysis:
Like the protein encoded by the T. p. pallidutn TP 1.6 (SEQ m N0:44), the
proteins predicted from all four of the T. p. pertenue DNA fragments described
above
were found to have significant homology to the Msp protein of T. denticola.
The
T. p. pallidum and T. p. pertenue peptide sequences were analyzed for
indications of
transmembrane topology using the TmPred program (Hofinan and Stoffel, A
Database of Membrane Spanning Protein Segments, Biochem. Hoppe-Seylor 348,
166). For T. p. pallidum, results indicated three possible amphipathic
transmembrane
helices at amino acid positions 46-65, 389-409, and 415-438. For T. p.
pertenue,
three transmembrane helices have were determined for the translate of the 1.7
kb
homologue at similar positions, i.e., at amino acids 46-65, 394-412, and 421-
444, and
two transmembrane regions were found for the short 1.3 kb copies of T. p.
pertenue
at amino acid numbers 46-65, and 291-314.
The T. p. pallidum Msp homologue described by another laboratory
(GenBank accession number U88957) was similarly analyzed to determine whether
it
also has a predicted transmembrane topology to the sequences disclosed here.
The
three transmembrane regions in the proteins encoded by the 1.6 kb clone of
T. p. pallidum and the 1.7 kb clone of T. p. pertenue, and the three in the
1.3 kb
homologues of T. p. pertenue were found to overlap extensively with the
corresponding predicted transmembrane regions of the GenBank Msp homologue.
Interestingly, the differences found between the syphilis and yaws Msp
proteins are
located in the variable, middle portion of the protein, which is relatively
hydrophilic,
and thus may be exposed to the extracellular environmenT.
The pathogenic treponemes are classified based upon the distinct clinical
infections they produce, as well as their host specificity and very limited
genetic
. studies. The syphilis and the yaws treponemes have been classified as
subspecies of
CA 02325576 2000-10-10
WO 99/53099 PC'f/US99/07886
-37-
T. pallidum based upon saturation reassociation assays, methods of low
sensitivity to
detect small differences. All attempts to show species or subspecies-specific
signatures had failed until it was recently shown that these two organisms
differ in
the 5' and 3' untranslated regions of their 15 kDa lipoprotein genes. However,
the 15 kDa lipoprotein gene is neither a protective antigen or a molecule
related to
differential pathogenesis because the open reading frame is identical in T. p.
pallidum
and in T. p. perterrae. Furthermore, immunization of rabbits with recombinant
15 kDa
lipoprotein has failed to provide any evidence of protection against virulent
challenge.
The above-described studies on a novel Msp gene family in the Genus
Treponema describes for the first time extensive differences in the coding
regions of
putative outer membrane antigens in two subspecies of T. pallidum. These
differences can serve as the basis for the diagnostic differentiation, e.g.,
using PCR,
for determining whether one of these two treponemes, or the treponeme
responsible
for bejel, is present in a primary lesion.
Attachment and invasion are the first steps for a successful treponemal
infection, as in vitro studies have shown that T. p. pallidum penetrates
~zcaryotic
cells and localizes to the cytoplasm (J.A. Sykes, et al., Br. J. Yener. Dis.,
50:40-44,
1974). The molecules involved in attachment and invasion of eukaryotic cells
have not
yet been identified, but outer surface proteins are likely to be involved. In
T. denticola, an oral spirochete associated with periodontal disease, the Msp
antigen
has been shown to be involved in cell adhesion, and has porin and
extracellular matrix
binding activities (Egli et al., In,~'ecT. Immun., 61:1694-9, 1993; Fenno et
al.,
J. Bacteriol., 178:2489-97, 1996). The transmembrane topology analyses {see
above)
have indicated that there are three overlapping amphipathic regions in the 1.6
kb
sequences of T. p. pallidum and T. p. perterrue and two in the 1.3 kb
fragments of
T. p. pertenue, leaving in both cases a large, intermediate hydrophilic
segment that
includes part of the conserved region and the whole internal variable region.
These
analyses suggest that the Msp homologous proteins of T. p. pallidum identified
in this
study, as well as the other members of the T. p. pallidum Msp family, probably
are
membrane-spanning molecules located in the outer sheath, making them likely
candidates for cell attachment and invasion, as demonstrated for the Msp of
T. denticola, and suggesting that they are useful as vaccine candidates.
It should be noted that no Msp homologue completely identical to the one
described here is present in the current version of the Internet-posted T.
pallidum
genome sequence, with the best match being the Msp 1 homologue (SEQ ID N0:7),
CA 02325576 2000-10-10
WO 99/53099 PCT/US99/07886
-38-
which is only 90.21% identical. As compared with the posted Msp 1, the ORF of
TP 1.6 (SEQ m N0:43) has mismatches throughout the 5' end from amino acid
position 1 until amino acid 123 and is completely identical in the rest of the
sequence.
The present finding that PP 1.6 is a "hybrid" of two of the posted Msp genes,
i.e.,
Msp 1 and 2, may indicate that homologous recombination may be occurring
between
two homologues so that the 5' region corresponds to one gene in which the
downstream portion has been replaced by the corresponding piece of another
gene,
creating a hybrid molecule with different antigenic characteristics.
Mechanisms of this
type have been described in Borrelia (e.g., Zhang et al., Cell, 89:275-85,
1997).
Alternatively, the Msp genes in the current version of the T. pallidum genome
may
simply be misassembled, or the results described here may have resulted from
copying
errors during the PCR amplification.
Example 6. PCR Amplification of Msp Homologues in Various Treponemes
These same PCR primers used originally to amplify TP I.6 (SEQ m N0:43)
were tested also with DNA from several other species and subspecies of the
Treponema genus, including genomic DNA from T. pallidum subspecies endemicum,
Bosnia A strain, T. paraluiscuniculi, Cuniculi A strain, and a Treponema sp.
Simian
strain. As a control, aliquots of the DNAs were amplified using primers
specific for
a 15 kDa lipoprotein gene common to all treponemal species. Results with these
control primers yielded bands for all the DNA templates, thus indicating that
suiBcient
amounts of DNA for PCR were present in all of the DNA preparations. Using the
TP 1.6 primers, no amplification was seen for T. p. endemicum (which causes
bejel),
Bosnia A strain, or for T. paraluiscuniculi, Cuniculi A strain. Treponema sp,
Simian
strain, which is capable of infecting humans, yielded two bands of the same
sizes as
those noted previously when these primers were used to amplify T. p. pertenue
DNA,
i.e., 1.6 kb, 1.3 kb. Thus, this group of pathogens can be distinguished using
PCR
with this primer pair.
Example 7. RFLP Strain Differentiation of T. p, pallidum
Infection of rabbits with one strain of T. p. pallidum is completely
protective
against homologous strain challenge, but only partially protective against
heterologous strain challenge (Egli et al., InfecT. Immun., 61:1694-1699,
1993). This
may be because treponemal surface proteins vary from strain to strain,
possibly due to
variation in Msps. Strain variation in the Msp region was investigated by
comparing
the Msp variable regions from I8 different clinical isolates of T. p.
pallidum, which
were isolated from different geographical locations and at different times.
These were
CA 02325576 2000-10-10
WO 99/53099 PCT/US99/07886
-39-
as follows: Ba173-1; Bal-2; Bal-3; Bal-5; Bal-6; Bal-7; Bal-8; Bal-9; Chicago;
Mexico A; Nichols; Sea 81-1; Sea 81-2; Sea 81-3; Sea 81-4; Sea 81-8; Sea 83-1;
Sea 83-2; Sea 84-2; Sea 85-1; Sea 86-I; Sea 86-2; Sea 87-1; Sea 87-2; Street
14;
Yobs.
The alignment of the amino acid sequences for Msps 1, 3, 4, 5, I0, and 11
indicated a middle region of high heterogeneity flanked by conserved regions.
Within
these conserved regions are short stretches of identity in all of these Msp
alleles. The
short highly conserved stretches of sequence were used to design the following
primers for PCR amplification of the variable regions of these 6 Msps: sense,
5'
CGACTCACCCTCGAACCA (SEQ ID N0:48); antisense, 5'
GGTGAGCAGGTGGGTGTAG (SEQ ID N0:49) (corresponding to Set 1 in Table
1). The 18 strains of T. p. pallidum were propagated and their DNA extracted.
PCR
was performed using a 100 N,l reaction containing 200 E,iM dNTPs, 50 mM TRIS-
HCl
(pH 9.0 at 20°C), 1.5 mM MgClz, 200 mM NH4S04, 1 l,iM of each primer,
and
2.5 units of Taq polymerase (Promega, Madison, WI). The cycling conditions
were
as follows: denaturation at 94°C for 3 minutes, then 40 cycles of
94°C for 1 minute,
60°C for 1 minute and 72°C for 1 minute.
Amplicons were purified away from primer-dimers using the QuiaQuick Kit
extraction (Qiagen Inc., Chatsworth, CA), and the purified DNAs were
quantitated by
spectrophotometry. Restriction digests of amplicons were performed with 10 pg
of
purified PCR product from each treponemal strain, according to the
manufacturer's
instructions (New England Biolabs, Beverly, MA), using the following 13
restriction
endonucleases, all of which recognize four base cleavage sites: BstUI, AIuI,
Tsp509I,
MseI, NheI, Taq*I, HhaI, IVlaIll, BfaI, RsaI, MspI, MboI, and AciI. The
resulting
DNA fragments were separated by electrophoresis in 2.5% TBE/ethidium bromide
NuSieve agarose gels. PCR amplification was optimized so that no smearing of
bands
was detected on the gels.
For all T. p. pallidum strains tested, these primers gave bands at about 650
by
and 1.1 kb and about 1 kb. After cleavage with the above-listed restriction
enzymes,
it was apparent that the 650 by and 1.0 kb bands actually were quite
heterogeneous.
The restriction digestion patterns could be divided into 15 distinct "RFLP"
patterns.
This degree of polymorphism is remarkable in an organism with a small genome
of
only 1.2 MB. Each enzyme identified a different number of restriction patterns
in
the 18 T. p. pallidum strains. Msp I and Nhe I each recognized three groups of
organisms that gave the same RFL,P pattern for that enzyme. Mbo I, Rsa I, and
Bfa I,
CA 02325576 2000-10-10
WO 99/53099 PCT/US99/07886
-40-
each recognized four groups, Taq a I, five; Hha I, Tsp 509 I, BstU I, six; and
Alu I
and NLA III, seven groups. Combining the data from these enzyme digests
permitted
the division of the 18 strains into 15 distinguishable groups, based upon RFLP
differences. Further analysis of the restriction patterns of the T. p.
pallidum strains
showed that digestion with only four individual enzymes, BstUI, AIuI, HhaI,
and
NlaZII, was sufficient to differentiate the 15 groups.
Using these four enzymes, three of the groups were especially easily
differentiated from the other strains. These three groups each contain strains
that
have the same RFLP patterns with these four enzymes. Group I comprises the
strains
Bal 9, Sea 81-8, and Sea 84-2; group II, Nichols and Yobs strains, and group
III
includes the Bal 2 and Bal 8 strains. The strains in each subgroup do not
represent
unique geographical areas, year of isolation or tissue tropism. Unlike the
isolates of
these three subgroups, the other 11 T. p. pallidum strains tested showed
distinct,
specific patterns. Some strains, such as Sea 81-1 and 81-3, were collected in
the same
city, year, and from the same site in the body, yet showed very different RFLP
profiles. Although three groups were identified with at least two strains
each, overall,
these results indicate that there is a very high degree of heterogeneity in
the variable
regions of these Msp homologues of these bacterial isolates.
In summary, the RFLP patterns demonstrate that there is marked
heterogeneity in the variable regions of the different strains of T. p.
pallidum.
Table III shows the distribution the variability of Msp variable domains
amongst the
different strains and restriction enzymes tested to date. One of the strains
appeared
identical to T. p. pallidum Nichols strain, but the other 16 differed from
Nchols in
their variable domains. Thus, these results demonstrate that the variable
domains
differ in different strains of T. p. pallidum and this may be the basis for
the lack of
complete protection of infected animals after heterologous strain challenge.
Accordingly, a fully effective vaccine may require a combination of several or
all of
the Msp proteins.
In other experiments, it was found that the above-described PCR primers used
for RFLP analysis of T. p. pallidum strains also primed the amplification of
Msp genes
in T. p. perterrue and in T. p. endemicum, in each case yielding bands of 600
bp,
630 bp, 600 and 1.1 kb. For RFLP analysis, these amplicons were digested with
Mbo 1, Rsa 1, Hae III, Alu 1, Nla III, Hha 1, Msp 1, Taq 1(a), and Tsp 509.
The
resulting DNA fragment patterns permitted these two subspecies of T. pallidum
to be
easily distinguished from one another and from T. p. pallidum.
CA 02325576 2000-10-10
WO 99/53099 PCT/US99/07886
-41-
Moreover, the primer pair used to amplify the DNA fragments for these RFLP
analyses, i.e., Set 1 from Table 1, appears to be useful for identifying Msps
from many
or perhaps all species of Treponema, including pathogens associated with
gingivitis
and periodontitis. For example, when this primer pair was used with DNA from
Treponema denticola (an oral pathogen not reactive with antibodies for the 47
kDa
protein of T. p. palliaum; Riviere et al, 1991) or from Treponema phagedenis
(not
considered a pathogen), bands of about 1 and 0.6 kb were obtained.
Example 8. Expression in E. coli of Recombinant Gpd and D 15
To further characterize the clones described in Example 2, efforts were made
to express in E. coli the genes contained in all 10 of the immunoreactive
lambda
plaques. However, the products these positive lambda plaques proved to be
diiBcult
to obtain because of apparent toxicity to E. coli of the proteins expressed
from these
clones. Such toxicity is typical of outer membrane proteins. During the
original
immunoscreening of the lambda expression library (Example 2), protein
expression
from the Lambda ZAP protein did not depend upon survival of the E. coli host,
thus
the toxicity to E. coli of these proteins was not apparent during the initial
screening.
However, in order to obtain cloned DNA for nucleotide sequence analysis, the
immunoreactive plaques identified in this screen were subsequently subjected
to
in vivo excision to recover the positives as pBluesctipt phagemids, a process
that is
strictly dependent upon survival of the E. coli host strain. Of the ten
positive plaques,
seven were successfully converted to pBluescript phagemids only after several
attempts, while the remaining three so far have not been converted
successfully. With
regard to these last three clones, though their inserts have not yet been
identified, it
has been shown that they do not encode Gpd because it has not been possible
amplify
their inserts using PCR primers corresponding to the Gpd sequences. Methods
expected to ultimately obtain expression of the remaining clones will involve
minimal
bacterial growth times to prevent accumulation of the toxic protein, lowering
the
growth temperature to 30°C instead of the standard 37°C to
prevent bacterial
overgrowth, immediate purification of recombinant proteins from recently
transformed bacterial constructs rather than purification from previously
frozen
bacterial construct stock cultures, and additional experimental approaches.
In addition to Gpd (SEQ m NO:1), the T. p. pallidum homologue of
D15/Oma 87 (SEQ ID N0:3) was expressed in E. coli with the pRSET expression
vector system. The expressed D 15 homologue was used to immunize rabbits, as
described below in Example 10. Antibodies to this protein are being prepared.
CA 02325576 2000-10-10
WO 99/53099 PCT/US99/07886
-42-
Example 9. Characterization of T. p. pallidum Gpd protein
The T. p. pallidum Gpd protein (SEQ ID N0:2) was expressed in E. coli
BL21 (DE3) pLysS using the pET-3a expression system by inserting the entire
coding
region of Gpd (SEQ ID NO:1). This yielded a full-length, 41 kDa recombinant
protein molecule.
To verify that the T. p. pallidum Gpd (SEQ 1D N0:2) indeed possessed the
predicted enzymatic activity, Gpd activity was measured in crude lysates of E.
coli
that were expressing the recombinant molecule. (Larson et al., J. Biol. Chem.,
258,
5428-5432, 1983). A glycerophosphodiester phosphodiesterase functions by
hydrolyzing glycerophosphodiesters from phospholipid and triglyceride
metabolism to
glycerol 3-phosphate. The assay used here measures the conversion of the
substrate
glycerophosphocholine, a glycerophosphodiester, to dihydroxyacetone phosphate
(DHAP) via glycerol 3-phosphate with the concomitant reduction of NAD to
NADIi.
This reduction of NAD is followed spectophotometrically by measuring the
increase
in absorbance at 340 nm.
In brief, aliquots of a sonicated lysate of E. coli expressing the recombinant
T. p. pallidum Gpd were added to a hydrazine/glycine 0.5 ml assay mixture
containing
NAD, CaCl2, and gtycerol-3-phosphate dehydrogenase. The substrate
glycerophosphocholine was then added to 0.5 p,m. A background control to
account
for the E. coli intrinsic Gpd activity (a.k.a. "GIpQ") was provided by a
sonicated
lysate of E. coli transformed with only the pET-3a vector, i.e., the vector
with no
T. p. pallidum Gpd inserT. A positive assay was considered one in which an
increase
in absorbance at 340 nm was observed in E. coli expressing the recombinant
T. p. pallidum Gpd over the absorbance at 340 nm observed in the background
control sample. The results of these assays indicated a three fold increase in
absorbance in E. coli transformed with the T. p. pallidum Gpd (SEQ m NO:1).
These assay results thus demonstrated that the recombinant Gpd was
enzymatically
active and, at least within the context of the enzyme's active site,
confoimationally
correct, a characteristic important to various manipulations involving the
recombinant
T. p. pallidum Gpd (SEQ ID NO:1).
Inclusion bodies containing recombinant T. p. pallidum Gpd (SEQ ID N0:2)
were recovered from transformed E. coli and used as an immunogen to generate
polyclonal antiserum. This antiserum failed to induce opsonization of T. p.
pallidum
appreciably compared to nonimmune rabbit serum. One possible reason for this
result
may be that Gpd is not involved in opsonization, but alternatively, it may be
that Gpd
CA 02325576 2000-10-10
WO 99/53099 PCT/US99/07886
-43-
is an opsonic target antigen, but that for opsonization to occur addition
opsonic target
antigens must also be present.
A 1:1000 dilution of the rabbit anti-Gpd antiserum was used to develop
Western blots containing lysates of T. p. pallidum before and after washing by
centrifugation. The washes are know to partially remove the bacterium's outer
membrane. Blots were developed with 1:3000 dilution of goat anti-rabbit IgG
(peroxidase-conjugated Fab fragment, Amersham), using the chemiluminescence
protocol provided by Amersham. An immunoreactive band was observed that had a
size of 41 kDa, the approximate molecular weight predicted for Gpd from the
open
reading frame identified in the cloned DNA. The 41 kDa band was not observed
in
control blots developed with normal rabbit serum collected from the same
rabbits
prior to immunization. The signal for Gpd was observed in lysates obtained
from
unwashed, once-washed, and from thrice-washed treponemes, but signal strength
diminished noticeably with increasing numbers of washes. These results thus
imply
that Gpd is associated with the outer membranes of T. p. pallidum.
The polyclonal antiserum to Gpd was used in further studies to analyze the
surface disposition of Gpd using a previously described immunoffuorescence
assay
(Cox et al., Mol. Microbiol., 15:1151-1164, 1995). Because of the fragility of
the
T. pallidum outer membrane, special precautions to preserve this membrane were
employed (Cox et al., 1995) Briefly, virulent T. pallidum were encapsulated in
gel
microdroplets to preserve the treponemal molecular architecture prior to
immunofluorescence analysis, thus ensuring an accurate cellular localization
for Gpd
within T. pallidum. Preliminary results using the anti-Gpd antiserum showed
uniform
surface immunoffuorescence on both intact and detergent-treated T. pallidum,
as did
immune rabbit serum collected from chronically infected rabbits. To ensure
that the
integrity of the T. pallidum cellular architecture had been maintained despite
the
experimental manipulations, the level of immunoreactivity was examined for pre-
immune serum and serum prepared against the periplasmic 37 kDa endoflagellar
sheath protein (Isaacs et al., InfecT. Immun., 57:3403-3411, 1989}. The pre-
immune
serum lacked immunoreactivity against either the intact or the detergent-
treated
treponemes, while the anti-37 kDa serum was reactive only against detergent
treated
treponemes, a finding consistent with its periplasmic location. These studies
thus
support a cell surface disposition for the T. p. pallidum Gpd.
Because the H. in, fluerrzae Gpd homologue has been reported to have
IgG binding capability (Janson et al., InfecT. Immun., 59:119-125, 1991;
Sasaki and
CA 02325576 2000-10-10
WO 99/53099 PCT/US99/07886
-44-
Munson, Inf'ecT. Immun., 61:3026-3031, 1993), the immunoglobulin binding
capacity
of the recombinant T. pallidum Gpd was investigated. To analyze the
immunoglobulin binding capability of recombinant T. p. pallidum Gpd, inclusion
bodies were purified from E. coli transformants using standard techniques,
subjected
to SDS-PAGE analysis, and transferred to Immobilon-PVDF. The blots were
exposed first to one of several types of immunoglobulin (primary
immunoglobulin),
washed, and then to the corresponding peroxidase-conjugated secondary
antibody,
followed by use of the Enhanced Chemiluminescence (ECL) Detection system
(Amersham). The antibody pairs used were: (i) human IgA followed by goat
F(ab~2
anti-human IgA (a-chain specific); (ii) human IgD followed by goat F(ab'~ anti
human IgD (S-chain specific); (iii) human IgG followed by goat F(ab')2 anti-
human
IgG (y-chain specific}; and (iv) human IgM followed by goat F(ab'~ anti-human
IgM
(p,-chain specific). For control blots, the primary incubation was conducted
in the
absence of any primary immunoglobulin. As expected, no signal was observed for
the
control blots.
Results of these binding studies showed that the recombinant T. p. pallidum
Gpd bound specifically with human immunoglobulins A, D and G but not M. The
immunoglobulin binding was specific for the T. p. pallidum Gpd and did not
represent
spurious binding by a contaminating E. coli protein, as no immunoglobulin
binding
was observed for similarly prepared inclusion bodies from E. coli expressing
the
pET-3 a vector alone.
The IgG binding of T. pallidum Gpd was further characterized by IgG
fractionation studies. For these studies, Fab and Fc fragments of human IgG
were
prepared by papain digestion, and purified using a standard procedure (Harlow
and
Lane, Eds., Antibodies: A Laboratory Manual, Cold Spring Harbor, NY, 1988,
which is hereby incorporated by reference in its entirety). Immunoblots were
incubated with either the Fab or Fc fragment, then developed with horseradish
peroxidase/goat anti-human IgG (F(ab')2 fragment) and the Enhanced
Chemiluminescense Reagent (Amersham, Cleveland, OIL. Results of binding assays
with these IgG fragments revealed that the T. p. pallidum Gpd specifically
binds the
Fc fragment of human IgG with an intensity similar to that observed for intact
IgG,
while no binding to either the Fab fragment of human IgG or the secondary
antibody
was detected. Control lanes containing inclusion bodies prepared from E. coli
transformed with the pET-3a vector alone once again did not exhibit binding to
intact
IgG, IgG Fc and Fab fragments or the secondary antibody.
CA 02325576 2000-10-10
WO 99/53099 PCT/US99/07886
-45-
In H. influenzae, the Gpd homologue has been linked to pathogenesis, as Gpd
knockout mutants for that organism have been shown to be 100-fold less
virulent in
animal models (Janson et al., InfecT. Immun., 62:4848-4854, 1994). Similarly,
Gpd
may be relevant to the pathogenesis of T. pallidum. It has been proposed that
the
coating of T. pallidum by host IgG is a factor in long-term treponeme survival
in the
host (Alderete and Baseman, InfecT. Immun., 26:1048-1056, 1979), a hypothesis
that
is consistent with the present indications that Gpd is disposed on the
treponeme
surface and that Gpd avidly binds the Fc region of IgG. The binding of T.
pallidum
Gpd to IgA and IgG is significant also because IgA and IgG represent much of
the
immunoglobulins at mucosal surfaces where syphilis is sometimes transmitted.
Example 10 Induction of Protective Immunity by Gpd. D 15. and MSP
Gpd:
If Gpd contributes to treponemal evasion of the host immune system, the
introduction of excess high affinity Gpd-specific antibodies through
recombinant Gpd
vaccination may provide protective immunity to T. p. pallidum infection. The
protection afforded by immunization with Gpd was tested in the rabbit syphilis
model
in two separate experiments. In the first experiment, one rabbit was immunized
with
inclusion bodies purified from E. coli expressing the pET-3a-Gpd construct
emulsified
in RIBI~ adjuvant prior to intradermal challenge. A control rabbit received no
prior
immunization and served as a comparison animal for intradermal challenge. The
test
rabbit was immunized intramuscularly, subcutaneously, and intradermally three
times
at three-week intervals with RIBI adjuvant using 200 ug recombinant Gpd per
immunization. One week after the final boost, the immunized and unimmunized
control rabbits were challenged intradermally at each of six sites with 103 T.
pallidum
Nichols strain per site.
The Gpd immunized rabbit developed atypical pale, flat, slightly-indurated and
non-ulcerative lesions within several days of challenge at two out of the six
challenge
sites, with no lesions observed at the remaining four challenge sites. In
contrast, the
control rabbit developed typical red, raised, highly-indurated and ulcerative
lesions at
five of six challenge sites at 12 to 14 days post-challenge.
In a second vaccination trial, the above immunization and challenge protocol
was repeated using four rabbits immunized with the pET-3a-Gpd inclusion body
preparation prior to intradermal T. pallidum challenge. Four control rabbits
were
similarly immunized with inclusion bodies purified from E. coli expressing the
pET-3 a
vector alone. As an additional control, another four rabbits received no prior
CA 02325576 2000-10-10
WO 99/53099 PCT/US99/07886
-46-
immunization. After challenge, all eight control rabbits developed typical
red, raised,
highly-indurated and ulcerative lesions at each of the six challenge sites,
while all four
of the Gpd-immunized rabbits developed atypical pale, flat, slightly-indurated
and
non-ulcerative reactions at each of the six challenge sites. In all cases, the
reactions in
the Gpd-immunized animals resembled delayed type hypersensitivity responses
more
than typical syphilis chancres and resolved before lesions appeared in the
control
animals.
This is the first time a defined vaccine has been shown to be protective
against
T. pallidum challenge, in marked contrast to previous experiments where no
protection was observed when rabbits were immunized with a variety of
recombinant
T. pallidum proteins.
Dark field examination of the challenge sites were performed 31 days
following the infection, and revealed treponemes in four of four unimmunized
control
rabbits and three of four control pET-3 a vector-immunized rabbits. No
treponemes
were observed in the three pET-3a-Gpd construct-immunized animals. The fourth
pET-3 a-Gpd rabbit could not be evaluated at this point, as it had expired.
The
absence of treponemes in one of the control rabbits rnay reflect an adjuvant
effect
and/or animal to animal variability.
In summary, these results indicate that immunization with the Gpd antigen is
ZO significantly protective for challenge with T. p. pallidum. Gpd represents
the first
surface-exposed, immunoprotective antigen reported for T. p. pallidum, and
thus is
valuable for a human syphilis vaccine.
T. p. pallidum D 15/Oma87 Homologue:
In T. p. pallidum infected rabbits, anti-D15 antibodies were observed to
develop between days 13 and 17, and to peak at about day 30 after infection,
after
which time the level of anti-D 15 activity decreased slightly and plateaued.
Thus the
appearance of antibodies to the T. p. pallidum D15 corresponds to the
appearance of
antibodies that opsonize and block cytoadherence of the organism, and to the
time of
treponemal clearance from the syphilis lesions in these animals. Thus,
immunization
with the D15/Oma87 homologue is likely to elicit protective immunity,
especially
given that D 15 of H. inf luenzae and the Oma87 protein of Pastuerella
multocida are
protective against infection by those organisms (Flack et al., Gene, 156:97-
99, 1995;
Loosmore et al., InfecT. Immun., 65:3161-3167, 1996; Ruffolo and Alder,
InfecT. Immun., 64:3161-3167, 1996).
CA 02325576 2000-10-10
WO 99/53099 PCTNS99/07886
-47-
To determine directly whether D15 is capable of eliciting protective immunity,
a sector of the coding region corresponding to base pairs 76-2514 of the D
15/Oma87
homologue (SEQ ID N0:3) that does not include the cleavable signal sequence,
was
cloned into the pRSET-C expression vector, and was expressed in E. coli BL21
(DE3) pLysS. The amino acid sequence of this portion of the D15/Oma87
homologue is shown in SEQ ID N0:6. The T. p. pallidum recombinant D 15 was
purified using Ni-NTA matrices according to the manufacturer's instructions
(Qiagen,
Valencia, CA).
Using 200 ~g of the recombinant D 15, one rabbit was immunized using the
vaccination protocol described above for Gpd. This rabbit will be challenged
with
T. p. pallidum as described above for Gpd.
Msp:
Because of the methods by which the Msp homologues of T. p. pallidum were
here identified, this protein family was thought likely to provide an
effective syphilis
vaccine.
The 785 by at the 5' end of TP 1.6 (SEQ D7 N0:45), which corresponds to
the 5' half of Msp 2 (SEQ ID N0:9), was expressed with a 6-histidine tag in
the
pRSET system (Knoll et al., DNA & Cell Biol., 12:441-453, 1993) to yield a
polypeptide having 261 amino acids (SEQ ID N0:46}. Recombinant protein was
purified by nickel chromatography and a rabbit was immunized subcutaneously,
intramuscularly and intradermally with RIBI adjuvant and 200 pg recombinant TP
1.6
protein. Injections were given three times at three-week intervals, as for Gpd
immunization.
The rabbit that was immunized with the polypeptide corresponding to TP 1.6
(SEQ D7 N0:46) was challenged with 105 T. p. pallidum, Nichols strain,
intradermally in eight sites on the back. A control rabbit that was not
immunized was
also challenged. The TP 1.6-immunized rabbit developed small, slightly
indurated
patches which cleared in seven days. These lesions were not typical of
syphilis
chancres, but rather resembled delayed type hypersensitivity responses. The
control
rabbit developed red, indurated nodules at the sites of inoculation at 5 days.
These
persisted and reached a maximum size of 2 cm and ulcerated at
approximately 20 days. At 21 days, the VDRL (Venereal Diseases Research
Laboratory cardiolipin-antibody test) serology of the TP 1.6-immunized animal
remained negative, but the VDRL serology of the control rabbit was positive at
a 1:2 dilution. At 28 days, the TP 1.6-immunized animal was sacrificed, and
its lymph
CA 02325576 2000-10-10
WO 99/53099 PCTNS99/07886
-48-
nodes and testes were minced and extracted for treponemes. Treponemes were
found
on dark field examination, implying that the TP 1.6 immunization was only
partially
protective.
This experiment has now been now repeated with 2 additional rabbits and
darkfield examination of challenge sites revealed treponemes in only 2 out of
12 sites
in immunized rabbits, but in 6 out of 6 sites in unimmunized rabbits. These
results
indicate that significant protection was achieved with TP 1.6 immunization
against an
extremely large challenge of T. p. pallidum (the m50 for rabbits is 51
treponemes).
To further explore the ability of Msp polypeptides to elicit protective
immunity, PCR primers were devised to specifically amplify the central
variable region
present in all of the Msps that contain a variable region. Because some of the
Msp
variable regions share short stretches of identity even within their variable
regions, it
was possible to amplify all of the variable regions using primers sets shown
in Table 1.
The amplified variable region DNAs were prepared from a T. p. pallidum
genomic DNA template using the primers in Table 1 to amplify all of the Msps
(except for Msp 2), and each of the DNAs thus obtained was expressed in E.
coli, and
the recombinant polypeptides recovered in order to test their capacity to
induce
protective immunity against T. p. pallidum. The nucleotide sequences of these
amplified DNA fragments are shown in SEQ m N0:7 and SEQ m NOS:11, 13, 15,
17, 19, 22, 24, 26, 28 and 30, and the amino acid sequence of each of the
corresponding variable region recombinant polypeptides are shown in SEQ m N0:8
and SEQ m NOS:12, 14, 16, 18, 20, 21, 23, 25, 27, 29 and 31.
In tests conducted so far, variable region polypeptides corresponding to
Msps 1 (SEQ m N0:8), 9 (SEQ m N0:25) and 11 (SEQ m N0:29) have been used
to immunize a single rabbit as described above for the first test conducted
with the
TP 1.6 amino terminus polypeptide (SEQ m N0:46). Upon challenge with
T. p. pallidum, immunization with Msp 9 (SEQ m N0:25) and Msp 11 (SEQ m
N0:29), but not Msp 1 (SEQ m N0:8), were found to have conferred protective
immunity as compared with controls. Although Msp 1 (SEQ m N0:8) failed to
yield
positive results in this preliminary trial, it cannot be ruled out that the
single rabbit
inoculated here with Msp 1 (SEQ m N0:8) was unusually susceptible to syphilis,
or
that Msp 1 (SEQ m N0:8) could contribute to immunity if injected in
combination
with other Msp antigens.
In other experiments, antiserum was withdrawn from rabbits immunized as
described above with Msp polypeptides 1 (SEQ m N0:8), 9 (SEQ m N0:25), 11
CA 02325576 2000-10-10
WO 99/53099 PCT/US99/07886
-49-
(SEQ 117 N0:29), and TP 1.6 (SEQ ID N0:46) and these antisera were tested in
an
opsonization assay. For this assay, in brief, rabbit macrophages were mixed
with the
test antiserum, treponemes added, then incubated for 4 hours. At that time,
the cells
were fixed and stained using an immunofluorescent tag specific for T. p.
pollidum.
Macrophages containing ingested treponemes were scored by microscopy. All four
test antisera were found to have promoted opsonization over negative control
serum
from unimmunized rabbits. IRS provided a positive control. In one such
experiment,
the 90 percentages of macrophages containing ingested treponemes were:
unimmunized control, 16.9%; IRS, 45.3%; Msp 1 antiserum, 67.9%; Msp 9
antiserum, 47.4%; Msp 11 antiserum, 33.5%; and TP 1.6 32.7%. These values are
the averages of triplicate plates for each antiserum.
It is of note that the protection seen after inoculation with the Msp 9 (SEQ
ID
N0:25) polypeptide was more complete than the protection seen after injecting
polypeptides corresponding to the variable regions of TP 1.6 (SEQ D7 N0:46) or
Msp 11 (SEQ ID N0:29). These results are consistent with other observations
indicating that Msp 9 is expressed at relatively high levels during the early
stages after
infection of rabbits with the Nichols strain of T. p. pallidum (see Example
5). These
experiments are being repeated in additional rabbits, and with the remaining
Msp
variable region polypeptides. This result is in marked contrast to previous
experiments in which no protection was observed when rabbits were immunized
with
a variety of recombinant T. p. pallidum proteins, including Tp47, Tp37,
Tp34.5,
Tp33, Tp30, Tpl7, TplS, Tp190 (4D), Tp44.5 (TmpA), Tp34 (TmpB), Tp37
(TmpC), Tp 29-3 5 (TpD) (Tp terminology refers to MW consensus according to
Norris et al., 54), and TROMP1 (Blanco et al., J. Bacteriol. 178:? 199?).
Clearly, the
Msp family provides a group of antigens useful for vaccination against
syphilis.
As indicated above (see Examples 6 and 7), experiments have indicated that
the pathogens T. p. pertenue and T. p. endemicum each contain several Msp
genes.
These are exploited for vaccine production by expressing these Msp homologues
using a suitable vector, and the resulting polypeptides are used in
combination with a
pyhsiologicalty acceptable carrier as vaccines to protect against yaws or
bejel. By
combining the Msp polypeptides derived from several different subspecies of
Treponema pallidum, a vaccine is made whose administration to a suitable
animal
host confers protective immunity to syphilis, yaws and bejel. Such a vaccine
may
include the T. p. pallidum Gpd (SEQ ID N0:2) and D 15/Oma87 homologues (SEQ
ID N0:4) disclosed above, and may further include Msp genes from pathogenic
CA 02325576 2000-10-10
WO 99/53099 PGT/US99/07886
-50-
spirochetes that cause oral disease. Due to the high degree of relatedness
among
these subspecies of T. pallidum, and because infection with any one of them
has been
noted to confer partial immunity against the other two, a vaccine comprising
at least
one Msp from any one of the three subspecies should confer at least partial
protection
against infection with either of the other two.
Example 11 Sequence Conservation of Glycero~hosQhodiester Phosphodiesterase
Amon~Tr~onema pallidum Strains
The suitability of the glycerophosphodiester phosphodiesterase (Gpd) as a
potential syphilis vaccine candidate was further investigated by determining
the degree
of Gpd sequence conservation among pathogenic treponemes.
Bacterial species. The Gpd coding sequence was PCR amplified from
genomic DNA isolated from a variety of treponemal strains. All strains were
propagated in New Zealand white rabbits as previously described (Lukehart, S.
A., S.
A. Baker-Zander, and S. Sell. 1980. Characterization of lymphocyte
responsiveness in
early experimental syphilis. I. In vitro response to mitogens and Treponema
pallidum
antigens. J. Immunol. 124:454-460). T. pallidum subsp. pallidum, Nichols
strain, was
originally sent to the University of Washington by James N. Miller (University
of
California, Los Angeles) in 1979, and T. parllidum subsp. pertenue, Gauthier
strain,
was supplied by Peter Perine (Centers for Disease Control, Atlanta, GA) in
1981.
T. pallidum subsp. pallidum, Bal-3, Bal-7 and Bat 73-1 strains; T.
paraluiscuniculi,
Cuniculi A strain; T. pallidum subsp. pertenue, Haiti B strain; T. pallidum
subsp.
endemicum, Iraq B strain; and the Simian isolate were supplied by Paul Hardy
(John
Hopkins University, Baltimore, MD). T. pallidum subsp. pallidum, Sea 81-3 and
Sea
83-1 strains, were isolated by Sheila A. Lukehart from the cerebrospinal fluid
of
untreated syphilis patients.
PCR amplifications. To obtain the entire gpd open reading frame, primers
were designed from the 5' (5'-TGCACGGTGACGATCTGTGC-3')(SEQ ID N0:70)
and 3' (5'-GGTACCAGGCGACACTGAAC-3')(SEQ ID N0:71) non-coding regions
flanking the ~d gene (Eraser, C. M.,et al., 1998, Science 281:375-388). These
primers are located 48 by upstream and 51 by downstream, respectively, of the
gpd
open reading frame. PCR amplification of the gpd gene was performed using a
100 ~,1
reaction containing 200 E.iM dNTP's, 0.25 liM of each primer, lx Taq
polymerase
buffer (50 mM Tris-HCI, pH 9.0 at 20°C, 1.5 mM MgCl2, 20 mM NH4S04),
and
1 pl of genomic DNA containing 5,000-10,000 treponeme equivalents for each
strain.
The PCR reaction conditions were 30 cycles of 1 minute denaturation at
94°C,
CA 02325576 2000-10-10
WO 99/53099 PCT/US99/07886
-51-
1 minute annealing at 60°C, and 2 minutes extension at 74°C. For
each reaction, "hot
start" PCR (Chou, Q., M. Russell, D. E. Birch, J. Raymond, and W. Bloch. 1992.
Prevention of pre-PCR mis-priming and primer dimerization improves low-copy-
number amplifications. Nucleic Acids Res. 20:1717-1723) was performed by
adding
2.5 units of Taq polymerase after the initial denaturation step. Following
PCR, the
amplification products were cloned into the pGEM-T vector (Promega, Madison,
WI)
and each insert was sequenced in its entirety in both directions. To reduce
the
possibility of PCR or sequencing-induced errors, two clones derived from
independent PCR amplifications were sequenced for each strain.
Sequence analysis. Double-stranded plasmid DNA was extracted using the
Qiagen Plasmid Mini Kit (Qiagen, Chatsworth, CA) and both strands of insert
DNA
were sequenced using the Applied Biosystems dye terminator sequencing kit (PE
Applied Biosystems, Foster City, CA) and the ABI 373A DNA sequencer in
accordance with the manufacturer's instructions. In all cases both universal
sequencing primers and internal primers designed from the insert sequence were
used.
Nucleotide sequences were translated and analyzed using the SequencherTM
Version
3.1RC4 sequence analysis software (Gene Codes Corporation, Ann Arbor, MI).
Alignment of protein and DNA sequences was performed using the Clustal W
general
purpose multiple alignment program (Thompson, J. D., D. G. Higgins, and T. J.
Gibson. 1994. CLUSTAL W: improving the sensitivity of progressive multiple
sequence alignment through sequence weighting, positions-specific gap
penalties and
weight matrix choice. Nucleic Acids Res. 22:4673-4680).
Restriction fragment length polymorphism (RFLP) analysis. RFLP analysis
was performed on the gpd open reading frame amplified from each treponeme
strain.
One microgram of each of the amplified templates was digested with PIeI (New
England Biolabs, Beverly, MA) for four hours at 37°C prior to
electrophoresis on a
1.5% NuSieve~ (FMC BioProducts, Rockland, ME) agarose gel.
Nucleotide accession numbers. The nucleotide sequences of the gpd genes
from the Nichols, Bal-3, Bal-7, Bal 73-1, Sea 81-3, Sea 83-1, Mexico A, Haiti
B,
Gauthier, Iraq B, Simian, and Cuniculi A strains have been assigned GenBank
accession numbers AF004286 and AF127415-AF127425, respectively, each of which
nucleotide sequences, accorded the foregoing GenBank accession numbers, are
incorporated herein by reference.
As shown in Table 2, all six strains of T. pallidum subsp. pallidum have
identical Gpd gene sequences, while the other human subspecies (pertenue and
CA 02325576 2000-10-10
WO 99/53099 PCTNS99/07886
-52-
endemicum) and the animal pathogens (Simian strain and T. paraluiscuniculi)
have a
silent A to G change at base pair 579.
Table 2 Summary of Gpd sequence conservation between T. yallidum subsn.
nallidum (Nichols strain~and various patho e~poneme strains.
Subspecies Strain Se uence Diver
ence from Nchols
nucleotide amino acid
pallidum Bal-3 none none
pallidum Bal-7 none none
pallidum Bal 73-1 none none
pallidum Sea 81-3 none none
pallidum Sea 83-1 none none
Ilidum Mexico A none none
ertenue ? Haiti B none none
pertenue Gauthier base pair none
579 A to G
endemicum Iraq B base pair none
579 A to G
? Simian base pair none
579 A to G
paraluiscuniculiCuniculi A base pair residue 88,
R to H
263, G to A none
base pair none
459, A to G none
base pair none
579, A to G none
base pair
711, A to G
base pair
960, C to T
base pair
999, G to C
Interestingly, T. paraluiscuniculi (the only different species represented)
has 5
additional base pair changes, one of which (base pair 263) results in a
conservative
CA 02325576 2000-10-10
WO 99/53099 PCT/US99/07886
-53-
amino acid substitution at residue 88. This demonstrates genetic divergence of
the
nonvenereal treponemal strains and the rabbit pathogen away from the syphilis
strains,
consistent with their different clinical diseases and host ranges. The Simian
strain has
been thought to be very closely related (or identical) to the human pertenue
subspecies (Felsenfeld, O., and R. H. Wolf 16:294-305(1971); Sepetjian, M., F.
T. Guerraz, D. Salussola, J. Thivolet, and J. C. Monier 40:141-151(1969)), and
this
study supports this hypothesis.
The base pair change at position 579 in the non-syphilis strains introduces a
PIeI restriction site that creates different RFLP patterns between the T.
pallidum
subsp. pallidum strains and the other human and animal pathogens. PIeI
digestion of
the T. pallidum subsp. pallidum strains generates three restriction fragments
of sizes
766, 241 and 163 base pairs. The presence of the additional PIeI site in the
non-
syphilis strains generates four restriction fragments of sizes 635, 241, 163
and 131
base pairs. These characteristic RFLP patterns provide a means of genetically
differentiating between infections caused by the pallidum subspecies and those
caused
by the various other pathogenic treponemes.
The finding that the Haiti B strain, which is reportedly a T. pallidum subsp.
pertertue strain, shows sequence identity with the pallidum subspecies and not
with
the non-syphilis strains supports the proposal by Centurion-Lara et al.
(Centurion-
Lara, A., C. Castro, R. Castillo, J.M. Shaffer, W. C. Van Voorhis, and S. A.
LukeharT., J. InfecT. Dis. 177:1036-1040(1998)) that this strain is
misidentified and
should be classified as a T. pallidum subsp. pallidum strain. Similar sequence
analyses performed on the tpr K {Centurion-Lara, A., C. Castro, W. C. Van
Voorhis,
and S. A. LukeharT. Unpublished data) and tp92 (Cameron, C. E., C. Castro, S.
A.
Lukehart, and W. C. Van Voorhis. Unpublished data) sequences from the Haiti B
strain further support its identification as a T. pallidum subsp. pallidum
strain.
Homologues of Gpd from other bacterial species also demonstrate remarkable
conservation of amino acid sequence. The enzyme from Haemophilus influenzae,
designated Protein D, is 98% conserved among eight strains (Song, X., A.
Forsgren,
and H. Janson., InfecT. Immun. 63:696-699(1995)). The corresponding molecule
from the relapsing fever spirochete Borrelia hermsii, GIpQ, exhibits a range
of 96.5%
to 100% amino acid sequence similarity among 26 B. hermsii isolates (Schwas,
T. G.,
and S. F. Porcella. Personal communication). Similarly, results reported here
show
Gpd is highly conserved among twelve strains that encompass a total of five
pathogenic treponemes. The invariant nature of the Gpd, combined with the
CA 02325576 2000-10-10
WO 99/53099 PCTNS99/07886
-54-
immunoprotective capability previously described for this molecule in the
experimental syphilis model (Cameron, C. E., C. Castro, S. A. Lukehart, and W.
C.
Van Voorhis, InfecT. Immun. 66:5763-5770 (1998)), make it an attractive
candidate
for inclusion in a universal subunit vaccine against T. pallidum infection.
Example 12 Opsonic Potential Protective CaQacity and Sequence Conservation of
the
Treno»ema parllidum subsp. pallidum Tn92
The T pallidum D 15/Oma87 homologue protein is referred to as Tp92 in the
present example. As discussed more fully herein, Tp92 is protective against
challenge
with T pallidum. As disclosed more fully herein, the predicted Tp92 amino acid
sequence from a variety of different strains of T pallidum is almost
identical. This
observation suggests that immunization with Tp92 should protect against many
strains
of syphilis. Additionally, as discussed more fully herein, Tp92 is a target of
opsonizing antibodies for T pallidum, and thus Tp92 is likely to be a surface
antigen.
Bacterial Strains. All T. pallidum subspecies and strains were propagated in
New Zealand white rabbits as previously described (Lukehart, S.A., S.A. Baker
Zander, and S. Sell. J. Immunol. 124:454-460 (1980)). E. coli XL-1 Blue, Sollt
and
BL21 (DE3) pLysS were obtained from Stratagene (La Jolla, CA).
Expression Library Screening. The T. pallidum subsp. pallidum tpa92 gene
was identified using the previously published method of differentially
screening a
T. pallidum genomic expression library (Stebeck, C.E., et al. FEMS Microbiol.
Le#.
154:303-310 (1997)). Briefly, the library was prepared using the Lambda ZAP~
II
cloning kit (Stratagene) according to the manufacturer's instructions.
Approximately
200,000 plaques (12,500 pfu/plate) were plated and duplicate lifts prepared
and
screened using established methods (Sambrook, J., E.F. Fritsch, and T.
Maniatis.
1989. Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory
Press, Cold Spring Harbor, N~. Filters were differentially screened with a
T. pallidum-specific immune rabbit serum depleted of activity against the
major
known treponemal antigens but still retaining its opsonic capacity (termed
opsonic
rabbit serum; ORS), and a non-opsonic antiserum prepared using heat-killed
T. pallidum (termed non-opsonic rabbit serum; NORS). The ORS was prepared by
sequential adsorption of pooled syphilitic rabbit serum with T. phagedenis,
biotype
Reiter, recombinant T. pallidum 47, 37, 34.5, 33, 30, 17 and 15 kDa molecules
(as
designated in Table 3 in Norris, S.J. et al., Electrophoresis 8:77-92 (1987),
incorporated herein by reference) and recombinant Tromp 1 (Blanco, D.R., C.I.
Champion, M.M. Exner, H. Erdjument Bromage, R.E. Hancock, P. Tempst, J.N.
CA 02325576 2000-10-10
WO 99/53099 PCT/US99/07886
-55-
Miller, and M.A. Lovett. 1995. Porin activity and sequence analysis of a 31-
kilodalton
Treponema pallidum subsp. pallidum rare outer membrane protein (Trompl). J.
Bacteriol. 177:3556-3562). In unpublished studies from our laboratory,
antisera
raised against electroeluted or recombinant forms of these antigens failed to
demonstrate opsoruc function. The antiserum was further adsorbed with VDRL
antigen, a lipid complex that has been shown to be the target of a minor
portion of
opsonic antibodies (Baker-Zander, S.A., J.M. Shaffer, and S.A. Lukehart. J.
Infect.
Dis. 167:1100-1105 (1993)). These adsorption steps were performed to reduce
the
number of irrelevant positive clones identified by this antiserum in the
expression
library screening. Immunoreactive plaques were detected with 1 p,Ci of 1251-
labeled
protein A on nitrocellulose filters using established methods (Sambrook, J.,
E.F.
Fritsch, and T. Maniatis. 1989. Molecular Cloning: A Laboratory Manual. Cold
Spring Harbor Laboratory Press, Cold Spring Harbor, N~. Plaques showing
reactivity with the ORS but no reactivity with the NORS were subjected to
secondary
screening with both the ORS and the NORS. Those plaques showing consistent
differential reactivity were screened a third time with ORS and converted to
pBluescript SK(-) phagemids by in vivo excision in the E. coli strains XL-1
Blue and
SoIR according to the manufacturer's instructions.
DNA Sequencing. Double-stranded plasmid DNA was extracted using the
Qiagen Plasmid Mini Kit (Qiagen, Chatsworth, CA) and both strands of insert
DNA
were sequenced using the Applied Biosystems dye terminator sequencing kit (PE
Applied Biosystems, Foster City, CA) and the ABI 373A DNA sequencer in
accordance with the manufacturer's instructions. In all cases both universal
sequencing primers and internal primers designed from the insert sequence were
used.
DNA and Protein Sequence Analyses. Nucleotide sequences were translated
and analyzed using the SequencherTM Version 3.1RC4 sequence analysis software
(Gene Codes Corporation, Ann Arbor, MI). Database searches were performed
using
the basic local alignment search tool (BLAST) algorithm (Altschul, S.F., et
al. J. Mol.
Biol. 215:403-410 (1990)) and either the blastn, blastx or blastp programs.
The
published T. pallidum genome
(http://utmmg.med.uth.tmc.edu/treponema/tpall.html)
was used to obtain the complete tpa92 open reading frame and the corresponding
non-coding flanking regions. Alignment of protein and DNA sequences was
performed using the Clustal W general purpose multiple alignment program
(Thompson, J.D. et al. Nucleic Acids Res. 22:4673-4680 (1994)). The percentage
of
positional identity and similarity between sequences was calculated from the
number
CA 02325576 2000-10-10
WO 99/53099 PCTNS99/0'7886
-56-
of identical or similar residues, respectively, between aligned sequences;
insertions
and deletions were not scored. For the predicted amino acid sequence of Tpa92,
the
molecular mass was calculated using the Compute pI/MW Tool
(http -://www.expasy.ch/ch2d/pi tool.html), transmembrane topology analysis
was
performed using the TMpred program (http://ukec3.unil.ch/software/TMPItED),
and
signal sequence and cellular location predictions were performed using the
PSORT
program (http://psort.nibb.ac jp:8800).
PCR Amplification of ipa92 from T. pallidum Subspecies and Strains. The
Tpa92 coding sequence was PCR amplified from genomic DNA isolated from a
variety of T. pallidum subspecies and strains. To obtain the entire open
reading
frame, primers were designed from the 5' (5'-GGGTGTCGTGGAGTTTTGCG-
3')(SEQ I17 N0:72) and 3' (5'-CTTGCCTGGTGGACGCAGC-3')(SEQ m N0:73)
non-coding regions flanking the tpa92 gene. These primers are located 55 by
upstream and 49 by downstream, respectively, of the tpa92 open reading frame.
PCR
amplification of tpa92 was performed using a 100 l.il reaction containing 200
wM
dNTP's, 0.25 wM of each primer, lx Taq polymerase buffer (50 mM Tris-HCI, pH
9.0
at 20°C, 1.5 mM MgCl2, 20 mM NH4S04), and 1 pl of genomic DNA
containing
5,000-10,000 treponeme equivalents for each T. pallidum subspecies and strain.
The
PCR reaction conditions were as follows: 30 cycles of 1 minute denaturation at
94°C,
1 minute annealing at 60°C, 2 minutes extension at 74°C for T.
pallidum Bal 73-1,
Bal-3, Bal-7, Sea 81-3, Sea 83-1, Haiti B and Simian templates; 35 cycles of 1
minute denaturation at 94°C, 1 minute annealing at 55°C, 2
minutes and 30 seconds
extension at 74°C for the T. pallidum Gauthier template; and 35 cycles
of 1 minute
denaturation at 94°C, 1 minute annealing at 60°C, and 2 minutes
and 30 seconds
extension at 74°C for the T. pallidum Cuniculi A template. For each
reaction, "hot
start" PCR (Chou, Q. et al., Nucleic Acids Res. 20:1717-1723 (1992)) was
performed
by adding 2.5 units of Taq polymerase after the initial denaturation step.
Following
PCR, the amplification products were cloned into the pGEM T vector (Promega,
Madison, Wn and each insert was sequenced in its entirety in both directions.
To
reduce the possibility of PCR- or sequence-induced errors, two clones derived
from
independent PCR amplifications were sequenced for each T. pallidum subspecies
and
strain.
Overexpression Studies. The open reading frame encoding Tpa92 was PCR
amplified from T. pallidum subsp. pallidum (Nichols strain) genomic DNA using
primers designed from the 5' (5'-CGGGATCCACAATTGGTACGAGGGAAAGCC
CA 02325576 2000-10-10
WO 99/53099 PCT/US99/07886
-57-
3 ; contains a BamHI site)(SEQ ID N0:74) and 3' (5'-
CGGAATTCCTACAAATTATTTACCGTGAACG 3 ; contains an EcoRI site)(SEQ
ID N0:75) ends of the Tpa92 coding region. PCR amplification was performed as
outlined above, using 30 cycles of 1 minute denaturation at 94°C, 1
minute annealing
at 60°C, and 2 minutes extension at 74°C. To ensure optimal
expression of the
recombinant molecule within E. coli, the DNA sequence encoding the N-terminal
25
amino acids, which include the predicted signal sequence, were excluded from
the
primer design and, thus, from the resulting expressed recombinant molecule.
Following PCR, the 2457 by amplification product was digested with BamHI and
EcoRI, ligated to a similarly digested pRSETc T7 expression vector
(Invitrogen,
Carlsbad, CA) and transformed first into E. coli XL,-1 Blue and then into the
E. coli
expression strain BL21 (DE3) pLysS. The reading frame and sequence of the
expression construct was verified by DNA sequencing using the T7 promoter
primer
(Pharmacia, Piscataway, Nn and internal primers designed from the tpa92 DNA
sequence, the Applied Biosystems dye terminator sequencing kit and the ABI
373A
DNA sequencer according to the manufacturer's instructions. Expression of the
recombinant T. pallidum Tpa92 was performed using 500 ml of LB broth seeded
with
50 ml of OD 0.6 E. coli transformed with the Tpa92-pRSETc construct. Cells
were
grown for 3 hours at 30°C prior to induction of protein expression from
the T7
promoter by the addition of 0.4 mM IPTG and a further 4 hour incubation at
30°C.
Cells were harvested by centrifugation, and the histidine-tagged recombinant
Tpa92
protein was purified from the bacterial pellet according to the manufacturer's
instructions (Invitrogen).
Antisera. Immune rabbit serum (IRS) was collected from rabbits that had
been chronically infected with T. pallidum for >90 days. Anti-Tpa92 polyclonal
antiserum was raised in four New Zealand white rabbits (#5061, #5200, #5202,
and
#5207) by immunizing three times with 100 ~tg each of the purified recombinant
Tpa92 emulsified in the Ribi adjuvant MPL + TDM + CWS (Monophosphoryl lipid A
+ Trehalose dicorynomycolate + Cell wall skeleton; Sigma, St. Louis, MO).
Immunizations were administered intradermally (ID), subcutaneously (SC),
intramuscularly (IM) and intraperitoneally (IP) at three week intervals as
outlined by
the Ribi adjuvant system, and antiserum was collected one week after the final
immunization.
Opsonization Assay. IRS, anti-Tpa92 polyclonal antiserum collected from
rabbit #5061, and the corresponding control pre-immune serum were tested in
three
CA 02325576 2000-10-10
WO 99/53099 PCTNS99/07886
-58-
separate experiments with a total number of replicate assays of 9 (lltS), 7
(anti-Tpa92
serum) and 8 (pre-immune serum) for their ability to opsonize T. pallidum
using a
standard phagocytosis assay as previously described (Shaffer, J.M. et al.,
Infect. Immun. 61:781-784 (1993)). All antisera were used at a 1:100 dilution
and
incubated for four hours with rabbit peritoneal macrophages and T. pallidum
prior to
determination of the percentage of macrophages phagocytosing treponemes.
Statistical analysis was performed using the two-tailed Student t test.
PAGE and Immunoblot Analyses. Sodium dodecylsulfate polyacrylamide gel
electrophoresis (SDS-PAGE) and immunoblotting were performed as previously
described (Baker-Zander, S.A. et al., J. Infect. Dis. 151:264-272 (1985)),
except that
samples were blotted to Immobilon-PVDF membrane (Millipore Corp., Bedford,
MA). Heterologous expression of the recombinant T. pallidum Tpa92 was
monitored
by SDS PAGE analysis of approximately 5 pg of total bacterial lysate or 2 pg
of
purified recombinant protein and subsequent staining with Coomassie blue R
250.
The level of immunoreactivity of anti-Tpa92 polyclonal antiserum on purified
recombinant Tpa92 was assayed by electrophoresis and blotting of 2 ~g of
purified
recombinant protein, and probing with a 1:200 dilution of anti-Tpa92
polyclonal
rabbit serum followed by a 1:3000 dilution of alkaline phosphatase-labeled
goat anti-
rabbit IgG (Fc; Promega). For analysis of the level of immunoreactivity of
anti-
Tpa92 antiserum on washed and unwashed treponemes, T. pallidum was extracted
from infected testes as previously described (Lukehart, S.A. et al., J.
Immunol.
121:2014-2024 (1978)) and either immediately resuspended in SDS-PAGE sample
buffer (unwashed preparation) or washed one time or three times with lOmM Tris-
HCl pH 7.5 by centrifugation (15,000 xg) prior to resuspension of the
treponemes in
sample buffer. Approximately 1.4 x 107 Z: pallidum were electrophoresed for
each
sample (unwashed, washed one time, washed three times), blotted and probed
with a
1:200 dilution of anti-Tpa92 polyclonal rabbit serum (collected from rabbit
#5061)
followed by a 1:3000 dilution of alkaline phosphatase-labeled goat anti-rabbit
IgG
(Fc). All immunoblots were blocked with 5% milk powder in Tris-buffered saline
with 0.1% Tween-20 and developed using BCIP/NBT color substrate detection
(Promega). RainbowTM high range molecular weight markers (Amersham, Cleveland,
OH) were used as standards.
Protection Experiments. Four New Zealand white rabbits, as designated
above, were immunized three times (IM, SC, IP and ID) at three week intervals
with
the Ribi MPL + TDM + CWS adjuvant and 100 ~tg purified recombinant Tpa92.
CA 02325576 2000-10-10
WO 99/53099 PCT/US99/07886
-59-
Three weeks after administration of the final immunization, the immunized
rabbits and
two unimmunized control rabbits were intradermally challenged at each of eight
sites
on their shaved backs with 105 T. pallidum subsp. pallidum (Nichols strain)
per site.
The rabbits were examined daily to monitor the development, morphological
appearance and progression of lesions appearing at the challenge sites. Lesion
development was designated for each individual rabbit as typical if lesions
were red,
raised, indurated and generally progressed to ulceration, and atypical if
lesions were
pale, flat, only slightly indurated and generally non-ulcerative. Prior to
lesion
ulceration on the control animals (19 days post-challenge), lesion aspirates
were
collected from all challenge sites and examined by darkfield microscopy for
viable
treponemes. The serological status of all challenged rabbits was determined
using the
Venereal Disease Research Laboratory (VDRL) and the FTA ABS tests at 4 weeks
post-challenge. Statistical analyses were performed using the two-tailed
Student
t-test and analysis of variance with repeated measures.
Results
Identification of T. pallidum subsp. pallidum tpa92.
A Lambda ZAP II T. pallidum subsp. parllidum genomic expression library
was constructed and screened with a T. pallidum-specific, antigen-adsorbed
opsonic
antiserum preparation. As the name implies, immunoreactivity against known
T. pallidum antigens had been adsorbed from this preparation, although the
opsonic
capability of the antiserum was retained as demonstrated by phagocytosis
assays (data
not shown). To aid in distinguishing plaques specifically reacting with
opsonic
antibodies from background immunoreactive plaques, duplicate plaque lifts were
differentially screened with a T. pallidum-specific non-opsonic antiserum.
Plaques
exhibiting consistent immunoreactivity with the opsonic antiserum but no
immunoreactivity with the non-opsonic antiserum on the primary and secondary
screens were selected for further study and subjected to tertiary screening to
obtain
well isolated plaques.
In vivo excision of one immunoreactive plaque produced a pBluescript
phagemid containing a 3.0 kb insert, as shown by restriction digest analysis
(data not
shown). Nucleotide sequence analysis of the insert revealed a 2439 by open
reading
frame encoding an 812 amino acid translated product. Comparison of the insert
sequence with an early version (July, 1997) of the released T. pallidum genome
sequence (http://utmmg.med.uth.tmc.edu/treponema/tpall.html) identified 75 by
at the
5' end of the open reading frame that were missing from the insert sequence of
the
CA 02325576 2000-10-10
WO 99/53099 PCT/US99/07886
-60-
immunoreactive clone. This DNA sequence was downstream from a putative
ribosome binding site and thus was presumed to encode the N-terminal 25 amino
acids of the translated protein product. Subsequent release of the completed
T. pallidum genome identified the putative open reading frame between base
pairs
344,276 and 346,834 of the genome, corresponding to open reading frame TP0326
(genbank accession number AE001212; Fraser, C.M. et al., Science 281:375-388
(1998)). This open reading frame encodes a slightly larger translated protein
containing an extra 16 amino acids at the N-terminus, a discrepancy that
arises due to
the assignment of an alternative initiator methionine.
PSORT analysis (http://psort.nibb.ac jp:8800) performed on the complete 837
residue translated protein predicts a 21 amino acid cleavable N-terminal
signal
sequence and an 84.6% likelihood that this putative protein is located in the
T. pallidum outer membrane. The mature translated protein, lacking the 21
residue
signal sequence, has a predicted molecular mass of 92,040 Da. This translated
protein
was designated Tpa92 (T. pallidum antigen, 92 kDa). The DNA sequence of Tpa92
is incorporated herein by reference and is available from EMBL/Genbank/DDBJ
under accession number AF042789.
Sequence Analyses.
As shown in Table 3, sequence database analysis using the blastp algorithm
(Altschul, S.F. et ai., Basic local alignment search tool. J. Mol. Biol.
215:403-410
(1990)) revealed the T. pallidum Tpa92 shares the highest degree of sequence
similarity with a putative outer membrane protein identified by genome
sequencing of
the related spirochete, Borrelia burgdorferi (28.1% identical, 44.7% similar;
Fraser,
C.M. et al., Nature 390:580-586 (1997)).
CA 02325576 2000-10-10
WO 99/53099 PGTNS99/07886
-61-
0
z
0
d
..
° 00 Ov O M
O ~ pMp
O p M
r~ N Pr ~ N N N
O o ,~
l~ Oy~ cV d: ~1' o0 l~ N N ~
d' O 00 WD ~G vi ~n Vi vi Vi
~' M M M M M M M M M
r.., p ~ .--~ ~D t~ 00 00 ~O N V1
N N
Ur~-~ N N~ O~ N~NN
o0
v~ '~d', ~ ~ N
M O 00 00 C~ V1
Q~ rr 00 00 00 00 00 00 00 00 00
4r
E~ a7 ' n .wO OO N t~ O OO O~ N N N .";
1~ O N N ~, vG 00 01 ~-~ ~ 00 01 Ov Ov g
'm z ~. oo Ov c~ ~ t~ oo c~ ~ e~ ~ t'~ H
O .~ O i
'" ° c ~ t3
a
4. ~ .~ .-~ ~ o ~", .~ 00 00 00 00
0 0 °~ o ~ ~ ~ ~ °~' o ~ E ~ E
p, o a. A O O ~1 ~ o a. O O O O
0
a
°' ''~ o ~ ~ 'r 6'0 ,
'Zt° ~ ~ ~ '~ c°,~ ~ ~ ~ '~ Ct
m
a? o. ~ ,p, ~o ;v a ~ ~ ~ ~ ~t o 0
.a ~ .o v a ct ,t ;r a ~ ,Ct ~s '
ova o ~°''~~a"~" ~~'~U
CA 02325576 2000-10-10
WO 99/53099 PCTNS99/07886
-62-
The T. pallidum Tpa92 also shares approximately equal levels of sequence
similarity with high molecular weight outer membrane proteins identified from
a large
variety of bacterial species (18.6-22.1% identical, 35.1-40.9% similar). The
observed
sequence similarity within this group of bacterial proteins is evenly
distributed
throughout the coding sequence of Tpa92, with the exception of a stretch of
serine
residues at the C-terminal end of the translated protein that is unique to the
T. pallidum Tpa92. The presence of transmembrane segments within Tpa92 was
analyzed using the TMPred program, resulting in the prediction of three
transmembrane helices (data not shown). In this putative model, the C-terminal
serine-rich stretch of Tpa92 is predicted to be located within an external
loop on the
outer face of the outer membrane.
Sequence Conservation of Tpa92 Among T. pallidum Subspecies and Strains.
To assess the degree of sequence conservation of Tpa92 among T. pallidum
subspecies and strains, the tpa92 open reading frame was PCR amplified and
subsequently sequenced from six additional T. pallidum subsp. pallidum
strains, two
T. pallidum subsp. pertenue strains (causative agent of the disease Yaws), one
T. pallidum subsp. paraluiscuniculi strain (causes venereal syphilis in
rabbits), and the
Simian strain. The sequence divergence observed for each of these strains from
the
Tpa92 sequence of T. pallidum subsp. pallidum Nichols strain is tabulated in
Tables 4-7, and the overall percentage of sequence conservation for each
strain
compared to the Nichols strain is summarized in Table 8.
CA 02325576 2000-10-10
WO 99/53099 PCTNS99/07886
-63-
0
o ~s
~
a
a ~ r
o oMOoMO oMOoMo
0
do d x > a~ x z U vsm
z ~ ~
~ o ~ ~ ~ ~ 0 0 0 0
v ~ v~ ~ E-~ P4 m w fxP~
0
o $'
N N M M ~ OO00~0
V1 ~ V1V1 V1 N V1
;, ~ ~ d c7 d d C7 H d U ~ C7 U U
e~O O O O O O
0 0 0 0 d d
C7 H H U d U C'?C7 C7E"'
'
~ y
~ O 1n 1r1n ~ ~ ooonoV1 ~DO~ M M
~ ~k ~1V1h h ~1
z .C m .-.~....-..-.r, ....-..-.~.....-~N N
~
O
N
a~
rn
U
G~
viv'
O
N
H
M
~i
CA 02325576 2000-10-10
WO 99/53099 PCTNS99/07886
-64-
,~ o
i'
d x > x x z v
r a o 0 a~ a
0 ~ w P4
v ~ ~ ~ ~ ~' Ei P4 ~
U
.-~~ O v1 O et
f3~~ 1r ~ M M ~1Y1 N N N M ~''~ ~ ~ 0N0O
V1 V1 V1~ ~.,
..Vr
z
d C7 d t7 d d c7 H d U d c7U U
v 0 0 0 0 0 0 0 0 0 0 0 0 0 ,o $ .~
C7v L7E- E-~U d U t7 C7C7 E-~E-~d d
d' v..a' C W1O~ ~ ~ O~ O ~O M ~ O W1 O N
M 00 ~'~f'~n~n t~ o0o0 OvO ~ N d' n
p V)~ v1V1 v) v1~ V1vC OvO M m
.-.r,r...-,.-~.- m.r, .-~.-..-.N N N
H
M
~' OMO
CA 02325576 2000-10-10
WO 99/53099 PCT/US99/07886
-65-
a
b
~
o
~ o N M z
oMO o0
c7 z U ,~ w ~ H '~ d
a~ r ~ O O O ~i O O
~ . O O _ O ~ p p v d p
~. W w ~
", v G C7 ~ ~l z C7 ~ - , pG
O o
.d
g" ~ '~.~ ~ ~ ' ~ o o r ~ o '-..~ d
' V ~ 00 n
rn O, ~ 4, t~N N 1 V1 ~D ~D~ ~ t
~k
N
O~
H ~ U C7 d d L7d U L7c7 d U ~ C7 U
0 0 0 0 0 0 0
o ~ 0 0 0 0 ~
~ ~ E-~d L7t7 d E~ H d U C5H -o U d
a
3 o ~
$"
M
N
O d ~ ~ M 00 00 ~ O WOV1 ~O ~O O
N O ~WO v~t~ .~ t~t~ ooN M
~ V l~ C O O O M M ~ M
v ~ t N ~ M M 7 ~--~v N N N N N N N
~ N t~ o000 ~--~ ~
.a
~k
00
H H
. ~"
H
H
O t~
x
CA 02325576 2000-10-10
WO 99/53099 PCT/US99/07886
-66-
x
z
y
~, a
U
O ~ M
. ~ o0
O
o w Z ~ i~
~ ~ ~ ~ -'
~ c~ a ~ c~
w
'~ ~ o
~, b
o y ~ N N ~ ~ ~ ~ ~ ~
G. b w V 00
~k 1
N
O~
U E-~~ ~ ~ E-a~ U
0 0 0 0 0 0 0 ~ ~ o,
H U C7C7 H U L7 E-~b U
O. N
' O
d ~ ~ 00 OWD VW ~O
N l~ M M t~ O O M M ~!'
L 'O .o N M o000 .~ N N N N N
a
b .
w
a
N
'
H
H
H
CA 02325576 2000-10-10
WO 99/53099 PCT/US99/07886
-67-
x
~ b
~
, o
4.
G.O N
~
,~ O 00
A
O O O ~ ~
O O O O O O O O O
3 ~ ~ ~ ~ c~~ H w
0
N oo OvM ~ N ~O N M ~ vt
w. O ~ ~ M et t~oo Ov ~ - N N N N
~k N M t~ N N N N N M ~ ~1v1 ~1v1
N
O~
H ~ U Q U d C5 ~ U ~ U U U ~ E-~U
0
0 0 0 o a o o o a
H C7H L'7U C7E-~d d E-~L7L7 U C7
a
3 ~ ''
,.,
z ~ a. ~ M N ~ ~ ~ ~ o
~
~ -.
H .a v1 OvN vGt 0000 00 .
b
fi
y v .$
O ~
G1,
H
H ~ ~ d
E~ t~~ U
CA 02325576 2000-10-10
WO 99/53099 PCTNS99/07886
-68-
.~ b
a
U
04 d
4,
O
O
H a ~ w a t~
H ~ x o o
w a ~ ~ x a ~ x
...
t~.b ~k N W N N M M ~ eTo0 0o vioo O~
w n ~1 ~n ~1 ~n ~1~n v1 ~D~O vC
~ H a H H H U U a a c~ c~H V a d H c~
O O O O O O O O O O O O O O O O O O
r ~
d U C7d U c7 C7C7 L7C7 d H d t7H L7L7 d
~.
Ov O ~--~N W D l~00 O ~ O ~ t'~1~100 N
"p ~ V'1~!1N ~ ~ V1~1 ~ N ~G ~O~ l~t~ C~O O
.~ ,-..~ ,--m-.~,--~r, '-...~,~ .....~ .~N N
.",
.",
d
.a
CA 02325576 2000-10-10
WO 99/53099 PCT/US99/07886
-69-
a
b
o
0
0
x A x z w ~, ~ w
s ~ s
w z x c5 a ~ w
o y -'
O. '~~ ~k~D v0~O ~D h ~ h h o0 a
...,
w
d C7C7 d d C7 U H c7 d d
0 0 0 0 0 0 ~ _0 0 0 0 0
c~ v C7 d d U"C7 U ~ E~ U U U U
b
N
4.
z ' G. ~ h et ~Dh o0N O M ~O h
~ M N
A b h h 00 000o h C W h ~' d'
~ N N N N N N N O N N N
N
b
w
.
H
CA 02325576 2000-10-10
WO 99/53099 PCT/US99/07886
-70-
0
0
b
x
z
o v, as o o err;o owc O
o4
0
U
a~
U
O ~ O O~ O O OvO OvM o
O ~ O~ Ov ~ ~ Ov~ OvOv Ov
01
G
O
r
...
lid
C
O
C7
O
U
~
~ M ~
v' O N M ~ ~ 0000 .,~~ ~
v~ ~ ~ ~ ~ ~ v~ x U
E~
0
a~
a.
E~iv~
CA 02325576 2000-10-10
WO 99/53099 PCTNS99/07886
-71-
The amino acid sequence of Tpa92 is highly conserved, with a range of 95.5-
100% identity and 96.8-100% similarity shared between the Nichols Tpa92
sequence
and that of the various other T. pallidum strains. However, several of the
amino acid
sequence changes that do exist are of particular interest. First, parallel
sequence
divergence is observed between Bal-2 and Sea 81-3 strains and again with
Gauthier
and Simian strains, thus suggesting a common strain origin for each of these
groups.
Second, and most importantly, a distinctive sequence deletion pattern is
present in the
Tpa92 sequences from non-T. pallidum subsp. pallidum strains. The tpa92 genes
of
the Gauthier and Simian strains have base pairs 2336-2350 deleted (data not
shown),
which corresponds to deletion of the amino acids that comprise the end of the
T. pallidum Tpa92 signature serine stretch, residues 780-784. The tpa92 gene
sequence of the Cuniculi A strain possesses an additional complexity, in that
base
pairs 2293-2352, which encode the characteristic serine stretch comprising
amino acid
residues 765-784, are deleted. This DNA sequence is replaced with 30 base
pairs that
encode an alternative 10 amino acids that, although serine-rich, represents a
minimal
serine content compared to that of the same stretch of amino acids in the
other
T. pallidum strains. All DNA sequence deletions are in-frame and do not
introduce
premature termination codons into the tpa92 open reading frame.
Overexpression of the T. pallidum Tpa92.
Heterologous expression of the mature 816 residue T. pallidum Tpa92 open
reading frame in E. coli BL21 (DE3) pLysS using the IPTG-inducible pRSETc T7
expression system resulted in production of a recombinant molecule with an
approximate molecular mass of 70 kDa, as assayed by SDS-PAGE and subsequent
Coomassie blue staining. Expression of the 70 kDa recombinant protein was
significantly decreased in E. coli lysates in which protein expression from
the pRSETc
T7 promoter had not been induced by IPTG addition. The 70 kDa molecular mass
of
the recombinant protein is unexpectedly lower than the 97 kDa molecular mass
predicted for the histidine-tagged recombinant molecule (92 kDa for the T.
pallidum
Tpa92 plus 5 kDa extra for the N-terminal hexa-histidine tag). This Iow
molecular
mass is not the result of truncated expression of the tpa92 open reading
frame, as
sequencing of the tpa92-pRSETc construct verified the entire 2451 by insert
encoding
the 816 residue open reading frame was present, but likely represents sequence-
induced aberrant migration of the recombinant molecule on SDS-PAGE. Nickel
resin
chromatography performed on E. coli expressing the Tpa92-pRSETc construct
allowed purification of the histidine-tagged recombinant molecule away from
CA 02325576 2000-10-10
WO 99/53099 PCT/US99/07886
-72-
contaminating E. coli proteins. The recombinant 70 kDa molecule represented
the
major protein in the resulting preparation (approximately 90% of the total
protein).
Proteins of a smaller molecular mass present in the nickel-purified
preparation
represent breakdown products of the 70 kDa recombinant Tpa92.
The recombinant T. pallidum Tpa92 was used to generate polyclonal
antiserum, and subsequent immunoblot analysis showed an immunoreactive 70 kDa
protein in both the nickel-purified recombinant protein preparation and
lysates of E.
coli expressing the Tpa92-pRSETc construct. No corresponding immunoreactive
protein was observed using either control pre-immune serum on the nickel-
purified
recombinant protein preparation or the anti-Tpa92 antiserum on preparations of
E.
coli expressing the pRSETc vector alone.
Characterization of Anti-Tpa92 Imunoreactivity on T. pallidum Lysates.
The level of reactivity of the anti-Tpa92 polyclonal antiserum on lysates of
washed and unwashed T. pallidum preparations was investigated by immunoblot
analysis. An immunoreactive band corresponding to the 92 kDa T. pallidum Tpa92
was present in lysates of unwashed treponemes extracted directly from infected
rabbit
testes. In contrast, no immunoreactive 92 kDa bands were observed in equal
quantities of lysates prepared from T. pallidum washed one time and three
times
following extraction from rabbit testes, or in lysates of unwashed treponemes
using
control pre-immune serum. Previous investigations have demonstrated that the
fragile
outer membrane is partially removed during washing of T. pallidum by
centrifugation
(Cox, D. L. et al., Mol. Microbiol. 15:1151-1164 (1995)), and thus the above
results
suggest concurrent loss of anti-Tpa92 immunoreactivity, and therefore loss of
Tpa92
itself, with the treponeme outer membrane during washing.
Opsonic Potential of the T. pallidum Tpa92.
The anti-Tpa92 antiserum was also investigated for its ability to opsonize
T. pallidum in three separate experiments using a standard phagocytosis assay.
The
anti-Tpa92 polyclonal antiserum was significantly opsonic for the Nichols
strain of
T. pallidum, as compared with control pre-immune serum (p=0.0089). The level
of
opsonic activity observed for anti-Tpa92 approximated that observed with serum
collected from rabbits chronically infected with T. pallidum (immune rabbit
serum;
p<0.0001).
Immunoprotective Capacity of T. pallidum Tpa92.
The protection afforded by immunization with the T. pallidum Tpa92 was
tested in the rabbit syphilis model. In these experiments, four rabbits were
immunized
CA 02325576 2000-10-10
WO 99/53099 PCT/US99/07886
-73-
three times each with the purified recombinant Tpa92 emulsified in Ribi
adjuvant.
Rabbit #5061 and #5200 demonstrated approximately equal levels of
immunoreactivity against the recombinant Tpa92, while rabbit #5202 showed
slightly
less anti-Tpa92 immunoreactivity and rabbit #5207 demonstrated no detectable
reactivity. No immunoreactivity was observed using control pre-immune sera
collected from each of the rabbits prior to immunization.
Three weeks following administration of the final immunization, rabbits were
intradermally challenged at eight independent sites with 105 T. pallidum per
site.
Two control rabbits received no prior immunization but underwent the same
intradermal challenge. Table 9 summarizes the post-challenge analyses
performed on
the rabbits to determine the degree of protection provided by immunization
with the
T. pallidum recombinant Tpa92.
CA 02325576 2000-10-10
WO 99/53099 PCT/US99/07886
-74-
a
U
N
N
H
H ~ + +
w '. cn
v
..
N
H
.d
N G.
H
~3
a
y ~ ~ 8
o ~ >
z ~.
0
v
°
°
. s
z~ ~ ~ o o a
a o
... ...
H
°
N o 0 0 0 ~ ;5
O .-a N O N N N
V1 h t!1 ~ V1 N
O~
O O
.a '~ V
H
N N N N °'
.a
w ~ ~ E~ E~ E~ E~
CA 02325576 2000-10-10
WO 99/53099 PCT/US99/07886
-75-
As shown in the table, the control animals developed typical red, raised and
highly-indurated lesions, the majority of which progressed to ulceration. In
contrast,
the rabbits immunized with the T. pallidum recombinant Tpa92 prior to
challenge all
demonstrated alteration of lesion development. However, the degree of
protection
varied amongst the immunized rabbits, with the highest levels of protection
observed
for those rabbits exhibiting strong anti-Tpa92 immunoreactivity in immunoblot
analysis. Significant attenuation of lesion development was observed in
rabbits #5061
and #5200, with atypical pale, flat, slightly-indurated and non-ulcerative
lesions
appearing at the sites of challenge. The lesions of rabbit #5202 also were
morphologically atypical, although two of the eight challenge sites progressed
to
ulceration. This value, however, still represents a statistically significant
difference
from the occurrence of ulceration in the control unimmunized animals
(p=0.0047),
and thus these lesions received an atypical designation. In contrast, although
rabbit
#5207 developed lesions that were paler, flatter and less indurated than those
of the
control rabbits, all lesions progressed to ulceration and therefore were
designated as
typical.
The results of darkfield microscopy examination of the challenge sites
performed 19 days following infection paralleled the observed range of
clinical
manifestations of lesion development in the challenged rabbits. Analysis of
the control
unimmunized rabbits (#5111 and #5228) revealed treponemes in all eight
challenge
sites. Similarly, analysis of the Tpa92-immunized rabbits #5202 and #5207
showed
the presence of treponemes in six out of eight lesions. In contrast, the Tpa92-
immunized rabbits that demonstrated the most impressive clinical alteration in
lesion
development, #5061 and #5200, had significantly lower numbers of lesions
containing
treponemes (one and three out of eight, respectively). Serological examination
of the
rabbits four weeks post-challenge revealed a high VDRL and FTA ABS test titer
for
normal, unimmunized animals compared to significantly reduced titers observed
for
the Tpa92-immunized rabbits (P< ). Parallel experiments revealed that
immunization
with an unrelated, non-treponemal recombinant molecule in Ribi adjuvant
provided no
protection (data not shown), thus demonstrating that the adjuvant did not
contribute
to the protection observed in the Tpa92-immunized rabbits.
The data reported herein describes the identification and characterization of
a
92 kDa T. pallidum protein that shares sequence similarity with outer membrane
proteins from a wide range of bacterial species, including the related
spirochete B.
burgdorferi and two STD-causing bacterial species, N. gonorrhoeae and
CA 02325576 2000-10-10
WO 99/53099 PCT/US99/07886
-76-
C. trachomatis. Although the majority of these proteins have been identified
through
genome sequencing of the bacterial species in which they are found, and thus
are
hypothetical, six have been independently isolated using molecular biological
or
protein immunochemical approaches. These include an unknown protein from E.
coli
(genbank accession number P39170), OMP1 from B. abortus (genbank accession
number U51683), Omp85 proteins from N. meningitides and N. gonorrhoeae
(Manning, D.S., D.K. Reschke, and R.C. Judd. 1998. Omp85 proteins of Neisseria
gonorrhoeae and Neisseria meningitides are similar to Haemophilus influenzae D-
15-
Ag and Pasteurella multocida Oma87. Microb. Pathog. 25:11-21), Oma87 from P.
multocida (Ruffolo, C.G., and Adler, B. 1996. Cloning, sequencing, expression,
and
protective capacity of the oma87 gene encoding the Pasteurella multocida 87-
kilodalton outer membrane antigen. Infect. Immun. 64:3161-3167) and D15 from
H.
influenzae (Flack, F.S., S. Loosmore, P. Chong, and W.R. Thomas. 1995. The
sequencing of the 80-kDa D15 protective surface antigen of Haemophilus
influenzae.
Gene 156:97-99). Characterization of the latter four proteins confirms they
are
present on the bacterial surface (Ruffolo, C.G., and Adler, B. 1996. Cloning,
sequencing, expression, and protective capacity of the oma87 gene encoding the
Pasteurella multocida 87-kilodalton outer membrane antigen. Infect. Immun.
64:3161-3167; Manning, D.S., D.K. Reschke, and R.C. Judd. 1998. Omp85 proteins
of Neisseria gonorrhoeae and Neisseria meningitides are similar to Haemophilus
influertzae D-15-Ag and Pasteurella multocida Oma87. Microb. Pathog. 25:11-
21.;
Thomas, W.R., M.G. Callow, R.J. Dilworth, and A.A. Audesho. 1990. Expression
in
Escherichia coli of a high molecular weight protective surface antigen found
in
nontypeable and type b Haemophilus influenzae. Infect Immun. 58:1090-1913),
and
passive immunization of antiserum against Oma87 and D 15 has been shown in
animal
models to be protective against P. multocida and H. influenzae challenge,
respectively
(Ruffolo, C.G., and Adler, B. 1996. Cloning, sequencing, expression, and
protective
capacity of the oma87 gene encoding the Pasteurella multocida 87-kilodalton
outer
membrane antigen. Infect. Immun. 64:3161-3167; Thomas, W.R., M.G. Callow, R.J.
Dilworth, and A.A. Audesho. 1990. Expression in Escherichia coli of a high-
molecular weight protective surface antigen found in nontypeable and type b
Haemophilus influenzae. Infect. Immun. 58:1090-1913; Yang, Y., W.R. Thomas, P.
Chong, S.M. Loosmore, and M.H. Klein. 1998. A 20-kilodalton N-terminal
fragment
of the D 15 protein contains a protective epitope(s) against Haemophilus
influe»zae
type a and type b. Infect. Immun. 66:3349-3354; and 32.Loosmore, S.M., Y.
Yang,
CA 02325576 2000-10-10
WO 99/53099 PCT/US99/07886
-77-
D.C. Coleman, J.M. Shortreed, D.M. England, and M.H. Klein. 1997. Outer
membrane protein D15 is conserved among Haemophilus influenzae species and may
represent a universal protective antigen against invasive disease. Infect.
Immun.
65:3701-3707.). Results reported here suggest that Tpa92 is a similar
protective
outer membrane antigen of T. pallidum.
Evidence for the surface location of Tpa92 in T. pallidum comes from the
observation that antibodies directed against Tpa92 have significant opsonic
activity
for living T. pallidum, thus demonstrating that this protein is accessible on
the surface
of intact treponemes. Indirect evidence for the presence of Tpa92 in T.
pallidum
outer membranes was obtained by immunoblot analysis using the anti-Tpa92
antiserum on T. pallidum lysate preparations. A loss of immunoreactivity was
observed in lysates prepared from treponemes whose outer membranes had been
partially removed by washing prior to lysis, compared to lysates prepared from
unwashed treponemes in which the fragile outer membrane and its constituent
proteins remain intact prior to Iysis. Analysis of the amino acid sequence of
Tpa92
also provides supporting evidence for the presence of Tpa92 on the bacterial
surface.
The first 21 amino acid residues at the N-terminus of Tpa92 comprise a
cleavable
signal sequence that is characteristic of proteins translocated across the
bacterial inner
membrane (Von Heijne, G. 1983. Patterns of amino acids near signal-sequence
cleavage sites. Eur. J. Immunol. 133:17-21). In addition, analysis reveals the
C-terminus of Tpa92 is not a perfect match for the consensus hydrophobicity
pattern
predicted for bacterial outer membrane proteins of hydrophobic residues at
positions 1 (Phe), 3 (preferentially Tyr), 5, 7 and 9 from the C-terminus
(Struyve, M.,
M. Moons, and J. Tommassen. 1991. Carboxy-terminal phenylalanine is essential
for
the correct assembly of a bacterial outer membrane protein. J. Mol. Biol.
218:141-
148.), but does contain hydrophobic residues at positions 1, 5 and 7 from the
C-
terminus and thus loosely conforms to this pattern. Furthermore, PSORT
analysis
predicts an 84.6% probability that Tpa92 resides in the T. pallidum outer
membrane,
and the TMPred program identified three potential transmembrane helices within
the
Tpa92 amino acid sequence. These combined results suggest Tpa92 is associated
with the T. pallidum outer membrane, and additional biochemical studies are
currently
underway to investigate the potential cell surface disposition of this
molecule.
PCR amplification and subsequent sequence analysis of the Tpa92 open
reading frame from twelve T. pallidum strains revealed minimal amino acid
sequence
divergence between the various strains. Similarly, the D15 antigen is
conserved
CA 02325576 2000-10-10
WO 99/53099 PCT/US99/07886
-78-
among H. influeniae strains and thus also represents an invariant antigen
(Loosmore,
S.M., Y. Yang, D.C. Coleman, J.M. Shortreed, D.M. England, and M.H. Klein.
1997.
Outer membrane protein D 15 is conserved among Haemophilus in, f luerrzae
species
and may represent a universal protective antigen against invasive disease.
Infect.
Immun. 65:3701-3707). Of the divergence that does occur in the Tpa92 sequence,
the majority is found in non-T. pallidum subsp. pallidum strains and lies
within a
serine-rich sequence that is unique to Tpa92. The C-terminal end of this
serine stretch
is deleted in the Tpa92 sequences from both the Simian strain and the T.
pallidum
subsp. pertenue Gauthier strain. Surprisingly, this sequence is not deleted in
the
Tpa92 sequence from the Haiti B strain, suggesting its classification as a T.
pallidum
subsp. pertenue strain is a misnomer. Similar sequence analyses performed on
other
T. pallidum antigens, including glycerophosphodiester phosphodiesterase (C.E.
Cameron, unpublished observations) and Tpr K (A. Centurion-Lara, unpublished
observations), also suggest the Haiti B strain should be re-classified as a T.
pallidum
subsp. pallidum strain. It is interesting to note that the entire C-terminal
serine-rich
sequence has been deleted from the Tpa92 sequence of the rabbit-infective
T. pallidum subsp. paraluiscuniculi strain Cuniculi A, although the relevance
of this
sequence divergence is not known at this time.
The potential significance of the serine-rich sequence present in Tpa92
becomes apparent when one considers similar serine-rich sequence stretches are
observed in proteins involved in attachment to cells or cellular substances,
including
the Saccharomyces cerevisiae A agglutinin attachment subunit precursor (Roy,
A. et
al., Mol. Cell. Biol. 11:4196-4206 (1991)) and the Candida albicans chitinase
3
precursor (McCreath, K.J. et al., Proc. Natl. Acad Sci. USA. 92:2544-2548
(1995)).
Numerous studies have shown T. parllidum attaches to host cells (Fitzgerald,
T.J., J.N.
lVfiller, and J.A. Sykes. Infect. Immun. 11:1133-1140 (1975); Fitzgerald, T.J.
et al.,
Infect. Immun. 18:467-478 (1977); Hayes, N.S. et al., Infect.lmmun. 17:174-186
(1977); Baseman, J.B., and E.C. Hayes., J. Fxp. Med. 151:573-586 (1980);
Baseman,
J.B., and J.F. Alderete, Pathogenesis and immunology of Treponema infections,
Vol.
20., (1983), R. Schell and D. Musher, editors. Marcel Dekke, Inc., New York.
229-
239; Wong, G.H.W., B. Steiner, and S. Graves., Br. J. Yener. Dis. 59:220-224
(1983); Fitzgerald, T.J. et al., Br. J. Vener. Dis. 60:357-363 (1984); Rice,
M., and
T.J. Fitzgerald, Can. J. Microbiol. 31:62-67 (1984); Thomas, D.D. et al., J.
Facp.
Med. 161:514-525 (1985); Thomas, D.D. et al., Proc. Natl. Acaci Sci. USA.
85:3608-
3612 (1988)), although the T. pallidum proteins mediating such attachment have
not
CA 02325576 2000-10-10
WO 99/53099 PCT/US99/07886
-79-
yet been identified. As a putative outer membrane protein, Tpa92 could be
hypothesized to constitute one such attachment ligand. In this scenario, the
stretch of
serine residues present in the C-terminal end of the Tpa92 sequence, which
have been
predicted to reside within an external loop on the outer face of the outer
membrane,
could act as potential sites for hydrogen bonding to carbohydrates present on
the
surface of host cells. In support of this, preliminary investigations
conducted in our
laboratory show Tpa92-specific antiserum can inhibit T. pallidum attachment to
rabbit
epithelial cells (E. S. Sun, unpublished observations). Studies are currently
underway
to fiuther investigate this putative functional role of Tpa92 as a T. pallidum
adhesion.
The immunoprotective potential of the T. pallidum Tpa92 was also
investigated in this study for several reasons. First, antiserum raised
against the
analogous proteins Oma87 and D15 from P. multocida and H. influerrzae,
respectively, have been shown to induce protection in animal models (Ruffolo,
C.G.,
and Adler, B., Infect. Immure. 64:3161-3167 (1996); Thomas, W.R. et al.,
Infect.
Immure. 58:1090-1913 (1990); Yang, Y., W.R. et al., Infect. Immure. 66:3349-
3354
(1998); Loosmore, S.M. et al., Infect. Immure. 65:3701-3707 (1997)). Second,
the
invariant nature of Tpa92 among various T. pallidum subspecies and strains
makes it
an attractive candidate for design of a universal subunit vaccine against T.
pallidum
infections. And lastly, the identification of Tpa92 as a target of opsonic
antibodies,
through both the differential immunologic expression library screen and the
phagocytosis assays, combined with the central role opsonization and
phagocytosis
plays in bacterial clearance, suggests this antigen may have immunoprotective
capability. Indeed, immunization of rabbits with the T. pallidum Tpa92
resulted in
partial protection from subsequent T. pallidum challenge, with alteration of
lesion
development at the sites of challenge compared to unimmunized control rabbits.
Not
surprisingly, the level of protection achieved strongly corresponded to the
antibody
response generated in the immunized rabbit, with rabbits exhibiting the
highest level of
Tpa92-specific immunoreactivity demonstrating significant protection upon
challenge.
These rabbits developed atypical small, pale, fiat, slightly indurated and non-
ulcerative
lesions at the sites of challenge. Darkfield examination of aspirates
collected from the
sites of challenge in these rabbits showed a lower number of lesions contained
viable
treponemes compared to control unimmunized animals. Alternative methods of
antigen delivery will be investigated in an attempt to generate higher levels
of anti
Tpa92 reactivity and, correspondingly, more significant protection against T.
pallidum
challenge.
CA 02325576 2000-10-10
WO 99/53099 PCT/US99/07886
-80-
In summary, the T. pallidum Tpa92 represents a target of opsonic antibodies
and an invariant, immunoprotective antigen. Further studies will be performed
to
determine whether co-vaccination of Tpa92 with other promising
immunoprotective
antigens, such as glycerophosphodiester phosphodiesterase (Cameron, C.E., et
al.,
Infect. Immun. 66:5763-5770 (1998)) and Tpr K (Centurion-Lara, A., C., et al.,
.l. Exp. Mec~ In Press (1999)}, can achieve complete immunity against T.
pallidum
challenge.
Example 13 DNA mediated vaccination with a vector expressing Gpd is partially
protective a.~ainst challenge with T. palladium.
We have constructed a Gpd DNA vaccine based on the high-expression CMV
promoter vector pCR3.1 (Invitrogen, San Diego, CA) expressing Gpd. We have
shown that the rabbit epithelial cell line, Sf 1 Ep (American Type Culture
Collection),
transfected with pCR3.1-Gpd expresses Gpd detectable by Western blot (data not
shown). Intradermal and intramuscular immunization of rabbits with 200 pg of
pCR3.1-Gpd performed every three weeks led to easily detectable antibodies to
Gpd
after 3 injections in 2 of 2 rabbits (data not shown). Twenty one days after
the
4th injection of DNA, the two DNA injected rabbits and one control
(uninfected)
rabbit were challenged intradermally with 105 T. palladium Nichols strain at
each of
eight separate sites on their shaved backs. Unlike the control rabbit, which
developed
progressive large chancres that ulcerated by 28 days, the DNA injected rabbits
developed only small papules at the sites of challenge which cleared before
the control
rabbit developed ulcerated lesions.
Darkfield examination of aspirates from the challenge sites on day 21 after
challenge demonstrated that 8 of 8 (100%) lesions on the control rabbit
contained
treponemes but only 2 of 16 (12.5%) of the challenge sites of the two DNA
injected
rabbits had demonstrable treponemes. Both DNA injected rabbits seroconverted
by
day 36 after challenge and were judged infected. Thus, although the DNA-
injected
rabbits did become infected, lesion development in these animals was
drastically
altered and treponeme growth was limited. These results demonstrate that DNA
vaccination with a vector expressing Gpd was partially protective against
T. palladium challenge.
This is the first time that DNA vaccination has been shown to be protective
against challenge with T. pallidum. This mechanism of immunization could be
advantageous because DNA vaccination stimulates humoral, CD4 and CD8 immunity.
Both CD4 and CD8 cells have been found in the primary and secondary syphilis
CA 02325576 2000-10-10
WO 99/53099 PCT/US99/0'7886
-81-
lesions at the time of treponemal clearance and are probably responsible with
production of IFN~y necessary for the activation of macrophages. The results
confirm
that Gpd is a protective immunogen against challenge with T. palladium using
both
standard and alternative vaccination approaches.
Example 14 Protection Studies Usinu Recombinant Msn Peptides
The variable domains of the msp-homologues have been expressed in E. coli
as 6 his-fixsion proteins, purified and used to immunize rabbits before
intradermal
challenge with 105 T. pallidum per site. Table 10 describes immunizaion of
single
animals with recombinant variable domains from msp 3, 4/5, 6, 10, and 12; of
these,
msp 4/5 showed evidence of protection, as measured by lesion appearance and
lack of
treponemes on darkfield microscopy of lesion aspirates. In addition, the
recombinant
carboxyl-terminal conserved domain from Subfamily II appears to confer
significant
protection.
CA 02325576 2000-10-10
WO 99/53099 PCTNS99/0'7886
_82_
o ~'
o ~
y y .~ 8
° '" o~ o~
w
o ''~
U
E
a o
00 $ 00 0
"" 00 o c~ o
H
!~. w ~ °~° M °\° o ~ ~.
'i' ;~ ° ° ~ ~ a~
0
a,~ ooy °y
Eo. '~' v C
ed y
p
e~
00 \ ~ ~.U~
~;
° ~J ~ . ...
a
~v ~a W
.~
a
_W _~ g
H ''" ~' yo o ~; c~ ° 0 0
~,°~
y y
r ,M ,o
U ~ °~°
d
b
o ~ ,o ~
o .~ ~' ~ .~ J
b o ~ ~ ~ L1 ni .~
-~ ..rs o .~ .. n ~,
0
.a o o. ...
Z~ A~ ~;~ a
CA 02325576 2000-10-10
WO 99/53099 PCTNS99/07886
-83-
Because of the expense, we have chosen to immunize and challenge single
animals with each of our recombinant peptides as a screening procedure. Those
antigens that appear to be protective are then examined using larger groups of
animals. For example, msp 9 appeared to be protective in the first animal
tested, so
we immunized and challenged a group of four additional rabbits, along with
four
unimmunized controls. The composite results for msp 9 are also shown in Table
10,
indicating that msp 9 variable domain induces significant protection against
infectious
challenge with 105 T. pallidum, Nichols strain.
Example 15 Opsonization of T pallidum Nchols Strain by Antisera to Msu
Homologue Variable Domains
Opsonization data for antisera raised against recombinant variable domains of
msp 1, 9, 11, and 2/1 have akeady been provided. Antisera raised against
recombinant
variable domains of msp 3, 4/5, 6, and 12 have now been tested. Only antisera
to
msp 4/5 and 12 have statistically significant opsonic activity against the
Nichols strain
(p=0.02 and p=0.05, respectively) compared to NRS, but the levels of
phagocytosis
with these antisera are lower than with IRS and lower than previously seen
with
antisera to msp 1, 9, 11, and 2/1. These results suggest that several msp-
homologues
are expressed on the surface of T. pallidum, or on subpopulations of organisms
within
the Nichols strain suspension, but that the level of expression in the
individual cell or
in the population may be lower for msp 4/5 and 12 than for the msps tested
previously. The failure of anti-msp 3 and 6 to opsonize T. pallidum suggests
that
these molecules are not expressed on the surface of the target organism.
Example 16 Heterogeneity in Msp 9 (TyrKy Among Strains of T. nalliclum
Msp 9 (tpr K) is the gene that is preferentially transcribed and expressed in
the
Nichols strain (laboratory strain) of T. pallidum. It codes for the msp
antigen that is
most protective in our studies. To examine its structure in other strains, an
issue that
is highly relevant to its ability to confer broad protection in a natural
setting, we
amplified msp 9 genomic DNA in a number of strains from our T. parllidum
strain
bank. The gene could be amplified in all strains tested, but the amplicons
showed
significant variability in size compared to the Nichols strain (from which the
primer
sequences were derived). In addition, many strains had multiple amplicons
using
these primers.
We are currently exploring msp 9 heterogeneity in other strains by cloning and
sequencing the amplicons from selected strains. All strains other than the
Nchols
strain contain multiple alleles of tpr K, and their sequences differ from the
published
CA 02325576 2000-10-10
WO 99/53099 PCTNS99/07886
-84-
tpr K sequence. The sequence differences are limited to defined
"hypervariable"
regions. Given the nature of the sequence diversity, it is highly unlikely
that these
differences are due to PCR induced errors. It is particularly interesting that
this
heterogeneity is seen in msp 9, which is a protective and opsonic antigen in
the
Nichols strain, and is the msp-homologue that is predominantly transcribed and
expressed.
The amino acid sequences of tpr K hypervariable regions from 34 different
T. pallidum strains are set forth in: SEQ ID N0:76 (strain 1N); SEQ ID N0:77
(strain 1-n); SEQ ID N0:78 (strain 1-1-Bal2); SEQ II7 N0:79 (strain 2-I-Bal2);
SEQ
ID N0:80 (strain 1-1 Bal3); SEQ ID N0:81 (strain 1-1-Bal7); SEQ ID N0:82
(strain
1-2-Bal7); SEQ ID N0:83 (strain 2-3-Bal7); SEQ ID N0:84 (strain 1-1-BaIB); SEQ
ID N0:85 (strain 1-2 Bal8); SEQ ID N0:86 (strain I-3 BaIB); SEQ 117 N0:87
(strain
1-1-Ba173-1); SEQ ID N0:88 (strain 1-2-Ba173-1); SEQ ID N0:89 (strain 1-3-
Ba173-1); SEQ ID N0:90 (strain 2-1-Ba173-1); SEQ ID N0:91 (strain 1-2-sea81-
3);
SEQ 117 N0:92 (strain 1-3-sea81-3); SEQ ID N0:93 (strain 1-1-sea81-4); SEQ II7
N0:94 (strain 1-2-sea81-4); SEQ 1D N0:95 (strain I-3-sea81-4); SEQ II? N0:96
(strain 2-1-sea81-4); SEQ ID N0:97 (strain 1-1-sea84-2); SEQ ID N0:98 (strain
1-2-
sea84-2); SEQ ID N0:99 (strain 1-3-sea84-2); SEQ ID NO:100 (strain 1-1-h); SEQ
ID NO:101 (strain 1-2-h); SEQ ID N0:102 (strain 1-4-h); SEQ ID N0:103 (strain
2-
1-h); SEQ ID N0:104 (strain 2-2-h); SEQ ID NO:105 (strain 1-1-ch); SEQ 117
N0:106 (strain 1-2-ch); SEQ ID NO:107 (strain 1-3-ch); SEQ m NO:108 (strain 1-
4-ch); SEQ ID N0:109 (strain 1-5-ch).
Example 17 Identification of a New Mss Homologue in Some T. nallidum
Strains
We have identified a new msp-homologue in approximately 50% of
T. pallidum subsp. palltdum strains. Primers targeted to conserved regions of
Subfamilies I and II were used to amplify DNA from these two strains, the
products
were cloned, and inserts were sequenced. A new sequence, called msp 13 or tpr
M
(SEQ ID NO:110), was identified. All sequences were identical and this
sequence is
not found in the Nichols genome. Primers, specific for msp 13 (SEQ ID NO:110),
were then designed: sense 5' cactagtcttggggacacgc (SEQ ID NO:111); antisense
5'
tacgtgattgcaaccagga (SEQ ID N0:112). Msp 13 appears to be most closely related
to msp 4/5 (tpr C/D) in Subfamily II.
CA 02325576 2000-10-10
WO 99/53099 PGT/US99/0'7886
-85-
While the preferred embodiment of the invention has been illustrated and
described, it will be appreciated that various changes can be made therein
without
departing from the spirit and scope of the invention.
CA 02325576 2000-10-10
WO 99/53099 PCTNS99/07886
-1-
SEQUENCE LISTING
<110> Van Voorhis, Wesley C.
Lukehart, Sheila A.
Centurion-Lara, Glaber A.
Cameron, Caroline E. Stebeck
<120> Recombinant Proteins of Treponema Pallidum and Their
Use for a Syphilis Vaccine
<I30> uofw-1-13643
<140>
<141>
<150> 09/058968
<151> 1998-04-10
<160> 112
<170> PatentIn Ver. 2.0
<210> 1
<211> 1159
<212> DNA
<213> Treponema pallidum
<220>
<221> CDS
<222> (75)..(1145)
<223> Amino acid sequence of T. pallidum sub. pallidum
Glycerophosphodiester Phosphodiesterase
<400> 1
cagtggagat atgcggcgtg ctactatgca cggtgacgat ctgtgcattc tataacaggg 60
gaggagagaa gttt atg cgg gga aca tat tgt gtg acg ctt tgg ggg ggg 110
Met Arg Gly Thr Tyr Cys Val Thr Leu Trp Gly Gly
1 5 10
gtg ttt gcg gca ttg gtt gca ggc tgt gcg tcc gaa cgt atg ata gtt 158
Val Phe Ala Ala Leu Val Ala Gly Cys Ala Ser Glu Arg Met Ile Val
15 20 25
gcg tat cgg ggc get gca gga tat gtg ccc gag cac acc ttt gcc tcg 206
Ala Tyr Arg Gly Ala Ala Gly Tyr Val Pro Glu His Thr Phe Ala Ser
30 35 40
aaa gtt ctt get ttt gca caa gga gca gat tac ctg cag cag gat gtc 254
Lys Val Leu Ala Phe Ala Gln Gly Ala Asp Tyr Leu Gln Gln Asp Val
45 50 55 60
gtg ctt tca aag gat aat cag ctt atc gta gcg caa agc cat att ctg 302
Val Leu Ser Lys Asp Asn Gln Leu Ile Val Ala Gln Ser His Ile Leu
65 70 75
gat aat atg act gac gtg gca gaa aaa ttt cca cgc cgg cag cgt gcg 350
Asp Asn Met Thr Asp Val Ala Glu Lys Phe Pro Arg Arg Gln Arg Ala
CA 02325576 2000-10-10
WO 99/53099 PCT/US99/07886
-2-
80 85 90
gatgggcat ttctatgtc atagatttt acggtagaagaa ctttcc ctc 398
AspGlyHis PheTyrVal IleAspPhe ThrValGluGlu LeuSer Leu
95 100 105
ctccgtgca accaatagt ttctatacg cgcggtaagcga catacg ccg 496
LeuArgAla ThrAsnSer PheTyrThr ArgGlyLysArg HisThr Pro
110 115 120
gtgtatggc cagcgcttt cctctttgg aagcctggtttt aggctg cac 494
ValTyrGly GlnArgPhe ProLeuTrp LysProGlyPhe ArgLeu His
125 130 135 140
acttttgaa gaggagttg cagtttatc cgtgggttggaa cagaca acc 542
ThrPheGlu GluGluLeu GlnPheIle ArgGlyLeuGlu GlnThr Thr
145 150 155
gggaaaaag attggaatt tactctgaa ataaaggtgccg tggttt cat 590
GlyLysLys IleGlyIle TyrSerGlu IleLysValPro TrpPhe His
160 165 170
catcaggaa ggaaaagac atcgcagcg cttaccctcget ctgttg aaa 638
HisGlnGlu GlyLysAsp IleAlaAla LeuThrLeuAla LeuLeu Lys
175 180 185
aaatacggt taccaaagt cgatcggat ctagtgtatgtg caaacg tat 686
LysTyrGly TyrGlnSer ArgSerAsp LeuValTyrVal GlnThr Tyr
190 195 200
gattttaac gagctgaag cgtatcaaa cgagaactttta ccaaag tac 734
AspPheAsn GluLeuLys ArgIleLys ArgGluLeuLeu ProLys Tyr
205 210 215 220
gaaatgaac gtgaagctg attcagcgt gttgettacaca gatcaa cgt 782
GluMetAsn ValLysLeu IleGlnArg ValAlaTyrThr AspGln Arg
225 230 235
gaaacacag gagaaggac tcgcgtggg aaatggataaac tacaat tac 830
GluThrGln GluLysAsp SerArgGly LysTrpIleAsn TyrAsn Tyr
240 295 250
aattggatg tttgagccc ggtggtatg cagaaaatagca aaatat gca 878
AsnTrpMet PheGluPro GlyGlyMet GlnLysIleAla LysTyr Ala
255 260 265
gacggcgtg ggtcctgac tggaggatg ctcatagagaat gaatgg tcg 926
AspGlyVal GlyProAsp TrpArgMet LeuIleGluAsn GluTrp Ser
270 275 280
aaggtgggc getgttcgc ctgagtccg atggtttctgca atccaa gat 974
LysValGly AlaValArg LeuSerPro MetValSerAla IleGln Asp
285 290 295 300
gcgaaattg gaatgtcat gtgcacacg gtacggaaagaa acactg cct 1022
AlaLysLeu GluCysHis ValHisThr ValArgLysGlu ThrLeu Pro
305 310 315
CA 02325576 2000-10-10
WO 99/53099 PCTNS99/07886
-3-
agc tac gcg cgc acc atg gac gag atg ttt tcc att ttg ttc aaa cag 1070
Ser Tyr Ala Arg Thr Met Asp Glu Met Phe Ser Ile Leu Phe Lys Gln
320 325 330
acg ggc gca aac gtg gtg ctc acg gat ttt cct gat ctt ggg gta aag 1118
Thr Gly Ala Asn Val Val Leu Thr Asp Phe Pro Asp Leu Gly Val Lys
335 340 345
ttt ctg ggc aaa ccc gcc cgc tat tga ccggcttctg tgta 1159
Phe Leu Gly Lys Pro Ala Arg Tyr
350 355
<210>
2
<211>
356
<212>
PRT
<213> pallidum
Treponema
<400>
2
Met Gly ThrTyrCys ValThrLeu TrpGlyGly ValPheAla Ala
Arg
1 5 10 15
Leu Ala GlyCysAla SerGluArg MetIleVal AlaTyrArg Gly
Val
20 25 30
Ala Gly TyrValPro GluHisThr PheAlaSer LysValLeu Ala
Ala
35 40 45
Phe Gln GlyAlaAsp TyrLeuGln GlnAspVal ValLeuSer Lys
Ala
50 55 60
Asp Gln LeuIleVal AlaGlnSer HisIleLeu AspAsnMet Thr
Asn
65 70 75 80
Asp Ala GluLysPhe ProArgArg GlnArgAla AspGlyHis Phe
Val
85 90 95
Tyr Ile AspPheThr ValGluGlu LeuSerLeu LeuArgAla Thr
Val
100 105 110
Asn Phe TyrThrArg GlyLysArg HisThrPro ValTyrGly Gln
Ser
115 120 125
Arg Pro LeuTrpLys ProGlyPhe ArgLeuHis ThrPheGlu Glu
Phe
130 135 140
Glu Gln PheIleArg GlyLeuGlu GlnThrThr GlyLysLys Ile
Leu
145 150 155 160
Gly Tyr SerGluIle LysValPro TrpPheHis HisGlnGlu Gly
Ile
165 170 175
Lys Ile AlaAlaLeu ThrLeuAla LeuLeuLys LysTyrGly Tyr
Asp
180 185 190
Gln Arg SerAspLeu ValTyrVal GlnThrTyr AspPheAsn Glu
Ser
195 200 205
CA 02325576 2000-10-10
WO 99/53099 PCT/US99/0~886
Leu Lys Arg Ile Lys Arg Glu Leu Leu Pro Lys Tyr Glu Met Asn Val
210 215 220
Lys Leu Ile Gln Arg Val Ala Tyr Thr Asp Gln Arg Glu Thr Gln Glu
225 230 235 240
Lys Asp Ser Arg Gly Lys Trp Ile Asn Tyr Asn Tyr Asn Trp Met Phe
245 250 255
Glu Pro Gly Gly Met Gln Lys Ile Ala Lys Tyr Ala Asp Gly Val Gly
260 265 270
Pro Asp Trp Arg Met Leu Ile Glu Asn Glu Trp Ser Lys Val Gly Ala
275 280 285
Val Arg Leu Ser Pro Met Val Ser Ala Ile Gln Asp Ala Lys Leu Glu
290 295 300
Cys His Val His Thr Val Arg Lys Glu Thr Leu Pro Ser Tyr Ala Arg
305 310 315 320
Thr Met Asp Glu Met Phe Ser Ile Leu Phe Lys Gln Thr Gly Ala Asn
325 330 335
Val Val Leu Thr Asp Phe Pro Asp Leu Gly Val Lys Phe Leu Gly Lys
340 345 350
Pro Ala Arg Tyr
355
<210> 3
<211> 2514
<212> DNA
<213> Treponema pallidum
<220>
<221> CDS
<222> (1)..(2514)
<223> Aminoacid Pallidum
sequence sub.
of pallidum
T.
D15/Oma87 homologue.
<400> 3
atg ctc aaagccagt ttcctaatt gcaagt tgttgtgtg atg 48
aaa gcc
Met Leu LysAlaSer PheLeuIle AlaSer CysCysVal Met
Lys Ala
1 5 10 15
tcg ctg tgggcacag aacgacaat tggtac gagggaaag cct 96
gcg gca
Ser Leu TrpAlaGln AsnAspAsn TrpTyr GluGlyLys Pro
Ala Ala
20 25 30
atc tct attagtttt gggctcgaa tatatt getcgcggc cag 144
gcg gag
Ile Ser IleSerPhe GlyLeuGlu TyrIle AlaArgGly Gln
Ala Glu
35 90 45
ttg gac attttttct tacaaggga caaaag tggacctat gag 192
acg caa
Leu Asp IlePheSer TyrLysGly GlnLys TrpThrTyr Glu
Thr Gln
50 55 60
CA 02325576 2000-10-10
WO 99/53099 PGTNS99/07886
-5-
ctg tac ctg gag ata ctg caa aag gtc tat gac ctt gag tac ttt tct 240
Leu Tyr Leu Glu Ile Leu Gln Lys Val Tyr Asp Leu Glu Tyr Phe Ser
65 70 75 80
gaa gtt tcg cct aag gcg gtg ccc acc gat ccg gag tat cag tat gtg 288
Glu Val Ser Pro Lys Ala Val Pro Thr Asp Pro Glu Tyr Gln Tyr Val
85 90 95
atg cta cag ttc acg gta aag gag cgt cct tcg gtg aag ggc atc aag 336
Met Leu Gln Phe Thr Val Lys Glu Arg Pro Ser Val Lys Gly Ile Lys
100 105 110
atg gta ggg aac agc caa atc cgc agt ggg gac ctt ttg tct aaa atc 384
Met Val Gly Asn Ser Gln Ile Arg Ser Gly Asp Leu Leu Ser Lys Ile
115 120 125
ctc ctg aaa aag gga gac att tac aat gaa gta aag atg aag gtg gac 432
Leu Leu Lys Lys Gly Asp Ile Tyr Asn Glu Val Lys Met Lys Val Asp
130 135 140
caa gag tcg ctc agg cgt cat tac ctg gac cag ggc tat gcg gcg gtt 480
Gln Glu Ser Leu Arg Arg His Tyr Leu Asp Gln Gly Tyr Ala Ala Val
145 150 155 160
aag ata tcc tgc gag gca aaa act gag gcg ggg ggc gtg gtg gta cag 528
Lys Ile Ser Cys Glu Ala Lys Thr Glu Ala Gly Gly Val Val Val Gln
165 170 175
ttt acc atc cag gaa ggt aag cag act gtt gtc tcg cgg ata cag ttt 576
Phe Thr Ile Gln Glu Gly Lys Gln Thr Val Val Ser Arg Ile Gln Phe
180 185 190
aag gga aat aag gcg ttt acc gag tcg gtg ctc aag aag gtg ctt tcc 624
Lys Gly Asn Lys Ala Phe Thr Glu Ser Val Leu Lys Lys Val Leu Ser
195 200 205
acg cag gag gcg cgt ttt ttg acc agt ggg gtg ttc aag gag aat gcg 672
Thr Gln Glu Ala Arg Phe Leu Thr Ser Gly Val Phe Lys Glu Asn Ala
210 215 220
ctg gaa gcg gat aag gcg gca gtc cac tca tac tat gca gag agg gga 720
Leu Glu Ala Asp Lys Ala Ala Val His Ser Tyr Tyr Ala Glu Arg Gly
225 230 235 240
tac att gac gcg cgg gta gaa ggc gtg gca aag acg gtt gat aaa aaa 768
Tyr Ile Asp Ala Arg Val Glu Gly Val Ala Lys Thr Val Asp Lys Lys
245 250 255
act gac gcc agt cgc aat ctg gtt acg ctt acg tac act gtg gtg gaa 816
Thr Asp Ala Ser Arg Asn Leu Val Thr Leu Thr Tyr Thr Val Val Glu
260 265 270
ggt gag cag tac cgc tac ggc ggg gtt acc att gtg ggt aac cag att 864
Gly Glu Gln Tyr Arg Tyr Gly Gly Val Thr Ile Val Gly Asn Gln Ile
275 280 285
ttt agc acc gag gag ctg cag gca aaa att agg ctc aag cgc ggg gcc 912
CA 02325576 2000-10-10
PCT/US99/07886
WO 99/53099
-6-
Phe Ser Thr Glu Glu Leu Gln Ala Lys Ile Arg Leu Lys Arg Gly Ala
290 295 300
atc atg aat atg gtg gcc ttt gag cag ggc ttt cag gcg ctg gcg gat 960
Ile Met Asn Met Val Ala Phe Glu Gln Gly Phe Gln Ala Leu Ala Asp
310 315 320
305
gcg tat ttt gaa aac gga tac acg tca aat tac ctg aac aaa gaa gaa 1008
Ala Tyr Phe Glu Asn Gly Tyr Thr Ser Aan Tyr Leu Asn Lys Glu Glu
325 330 335
cac cgg gac acg gcg gag aaa acg ctt tcg ttt-aag atc acg gtg gtg 1056
His Arg Asp Thr Ala Glu Lys Thr Leu Ser Phe Lys Ile Thr Val Val
340 345 350
gag cgc gag cgc agc cac gtc gag cac att atc att aag gga acg aag 1104
Glu Arg Glu Arg Ser His Val Glu His Ile Ile Ile Lys Gly Thr Lys
355 360 365
aat aca aaa gac gag gtt atc ctg cgt gaa atg ctg ctg aaa ccg ggg 1152
Asn Thr Lys Asp Glu Val Ile Leu Arg Glu Met Leu Leu Lys Pro Gly
370 375 380
gat gtg ttc tct aag tca aag ttt acg gat agc ttg cgc aat ctg ttc 1200
Asp Val Phe Ser Lys Ser Lys Phe Thr Asp Ser Leu Arg Asn Leu Phe
390 395 400
385
aac ctg cgc tat ttc tcg tcg ctg gtg ccg gat gtg cgg ccc ggc tct 1248
Asn Leu Arg Tyr Phe Ser Set Leu Val Pro Asp Val Arg Pro Gly Ser
405 410 915
gag cag gac ctg gtg gac att atc ctg aat gtg gag gag cag tcg acg 1296
Glu Gln Asp Leu Val Asp Ile Ile Leu Asn Val Glu Glu Gln Ser Thr
420 425 430
gca aac gtg cag ttt ggg gtg acg ttt tct ggg gtg ggg gag gca ggc 1344
Ala Asn Val Gln Phe Gly Val Thr Phe Ser Gly Val Gly Glu Ala Gly
435 440 445
acg ttc ccg ctt tcg ctc ttt tgt cag tgg gaa gaa aag aat ttt ttg 1392
Thr Phe Pro Leu Ser Leu Phe Cys Gln Trp Glu Glu Lys Asn Phe Leu
450 455 460
gga aaa ggg aat gaa att tca gta aat gca acc ttg ggg tct gag gcg 1440
Gly Lys Gly Asn Glu Ile Ser Val Asn Ala Thr Leu Gly Ser Glu Ala
470 975 480
465
cag agc ctg aag ctc ggg tat gtg gag cgc tgg ttt ctg ggc tct ccg 1488
Gln Ser Leu Lys Leu Gly Tyr Val Glu Arg Trp Phe Leu Gly Ser Pro
485 990 495
ctg acg gtg ggc ttt gac ttt gaa ctt acg cac aaa aat ctc ttt gtg 1536
Leu Thr Val Gly Phe Asp Phe Glu Leu Thr His Lys Asn Leu Phe Val
500 505 510
tac cgc gcg ggt tca tac ggc aac ggg ctg ccg cac ccg tac acg agc 1584
Tyr Arg Ala Gly Ser Tyr Gly Asn Gly Leu Pro His Pro Tyr Thr Ser
515 520 525
CA 02325576 2000-10-10
WO 99/53099
-?-
PCTNS99/07886
agg gag cag tgg get agt tcc cct ggg ctg gca gaa tcg ttt cgc ctc 1632
Arg Glu Gln Trp Ala Ser Ser Pro Gly Leu Ala Glu Ser Phe Arg Leu
535 540
530
aag tat tcg cgc ttt gag tcc gcc atc ggc gcg cac acc ggg tac cag 1680
Lys Tyr Ser Arg Phe Glu Ser Ala Ile Gly Ala His Thr Gly Tyr Gln
555 560
545 550
t tat ccg cgc tat gcg gtc att agg gtg aac ggg ggg gtg gac ttt 1728
gg Val Asn Gly Gly Val Asp Phe
Trp Tyr Pro Arg Tyr Ala Val Ile Arg
570 575
565
cgg gtt gta aag aat ttt tac gat aag gat aac aat cag ccc ttc gac 1776
Arg Val Val Lys Asn Phe Tyr Asp Lys Asp Asn Asn Gln Pro Phe Asp
585 590
580
ctg acc gta aaa gag cag ctg aac tgg acc agt atc aat tcg ttt tgg 1824
Leu Thr Val Lys Glu Gln Leu Asn Trp Thr Ser Ile Asn Ser Phe Trp
600 605
595
acg agc gtt tcg ttt gac ggg cgt gac ttt gcg tac gac ccg tcc agc 1872
Thr Ser Val Ser Phe Asp Gly Arg Asp Phe Ala Tyr Asp Pro Ser Ser
615 620
610
ggc tgg ttt tta gga cag cgc tgt acg ttc aac ggg ctc gtt ccc ttt 1920
Gly Trp Phe Leu Gly Gln Arg Cys Thr Phe Asn Gly Leu Val Pro Phe
635 640
625 630
ctc gaa aaa gag cat tcg ttt cgc tcc gac acc aag gcc gag ttc tac 1968
Leu Glu Lys Glu His Ser Phe Arg Ser Asp Thr Lys Ala Glu Phe Tyr
650 655
645
gtt acc ctg ctc aat tat ccg gtc tct gcc gtg tgg aac tta aag ttt 2016
Val Thr Leu Leu Asn Tyr Pro Val Ser Ala Val Trp Asn 67u0 Lys Phe
660 665
gtc ttg get ttc tac acc ggt gtg tcc gtt caa acg tat tat gga cgg 2064
Val Leu Ala Phe Tyr Thr Gly Val Ser Val Gln Thr Tyr Tyr Gly Arg
680 685
675
agg aaa agc gaa aac gga aag ggc aac ggg gtg cgg tcc ggc gcg ctg 2112
Arg Lys Ser Glu Asn Gly Lys Gly Asn Gly Val Arg Ser Gly Ala Leu
695 700
690
gta ata gac ggc gtg ctg gta ggg cgc ggg tgg agc gaa gac gca aag 2160
Val Ile Asp Gly Val 7iu0 Val Gly Arg Gly ~i5 Ser Glu Asp ~a ?20
705
aaa aac acc gga gac ctg ctg ctc cac cac tgg att gag ttc cgc tgg 2208
Lys Asn Thr Gly Asp Leu Leu Leu His His Trp Ile Glu Phe Arg Trp
730 735
725
ccg ctg gcg cac ggc att gtg tcc ttt gac ttt ttc ttt gat gcg gca 2256
Pro Leu Ala His Gly Ile Val Ser Phe Asp Phe Phe Phe Asp A1a Ala
745 750
740
atg gtg tac aac atc gaa agt cag tcc cca aac ggg tca tcg tcc gcc 2309
CA 02325576 2000-10-10
WO 99/53099 PCT/US99/07886
_g_
MetValTyr Ile GluSerGlnSer Pro Gly SerSerSer
Asn Asn Ala
755 760 765
agcagctcc agcagc agcagtagtagt agcagtaga accaccagc tct 2352
SerSerSer SerSer SerSerSerSer SerSerArg Thr,ThrSer Ser
770 775 780
gaaggactg tacaaa atgagctacggt ccggggctg cgctttaca ttg 2400
GluGlyLeu TyrLys MetSerTyrGly ProGlyLeu ArgPheThr Leu
785 790 795 800
ccgcaattt ccgtta aaattggcgttc gcaaacacc ttcacgtca ccc 2448
ProGlnPhe ProLeu LysLeuAlaPhe AlaAsnThr PheThrSer Pro
805 810 815
ggcggcatc ccaaaa acaaagaaaaat tggaatttt gtgttgtcg ttc 2496
GlyGlyIle ProLys ThrLysLysAsn TrpAsnPhe ValLeuSer Phe
820 825 830
2514
acggtaaat aatttg tag
ThrValAsn AsnLeu
835
<210> 4
<211> 837
<212> PRT
<213> Treponemapallidum
<400> 4
s LysAla Phe LeuIle SerCysCys ValMet
t Leu L Ser Ala
M Ala
y 5 10 15
e
1
Ser Leu TrpAla Asn Asp TyrGluGly LysPro
Ala Gln Asn
Ala Trp
20 25 30
Ile Ser IleSer GluGly LeuGlu IleAlaArg GlyGln
Ala Phe Tyr
35 40 45
Leu Asp IlePhe GlnTyr LysGly LysTrpThr TyrGlu
Thr Ser Gln
50 55 60
Leu Tyr GluIle GlnLys ValTyr LeuGluTyr PheSer
Leu Leu Asp
65 70 75 80
Glu Val ProLys ValPro ThrAsp GluTyrGln TyrVal
Ser Ala Pro
85 90 95
Met Leu PheThr LysGlu ArgPro ValLysGly IleLys
Gln Val Ser
100 105 110
Met Val AsnSer IleArg SerGly LeuLeuSer LysIle
Gly Gln Asp
115 120 125
Leu Leu LysGly IleTyr AsnGlu LysMetLys ValAsp
Lys Asp Val
130 135 140
Gln Glu LeuArg HisTyr LeuAsp GlyTyrAla AlaVal
Ser Arg Gln
CA 02325576 2000-10-10
WO 99/53099 PCT/US99/07886
-9-
150 155 160
145
Lys Ile Ser Cys Glu Ala Lys Thr Glu Ala Gly Gly Val Val Val Gln
165 170 175
Phe Thr Ile Gln Glu Gly Lys Gln Thr Val Val Ser Arg Ile Gln Phe
180 185 190
Lys Gly Asn Lys Ala Phe Thr Glu Ser Val Leu Lys Lys Val Leu Ser
195 200 205
Thr Gln Glu Ala Arg Phe Leu Thr Ser Gly Val Phe Lys Glu Asn Ala
210 215 220
Leu Glu Ala Asp Lys Ala Ala Val His Ser Tyr Tyr Ala Glu Arg Gly
230 235 240
225
Tyr Ile Asp Ala Arg Val Glu Gly Val Ala Lys Thr Val Asp Lys Lys
245 250 255
Thr Asp Ala Ser Arg Asn Leu Val Thr Leu Thr Tyr Thr Val Val Glu
260 265 270
Gly Glu Gln Tyr Arg Tyr Gly Gly Val Thr Ile Val Gly Asn Gln Ile
275 280 285
Phe Ser Thr Glu Glu Leu Gln Ala Lys Ile Arg Leu Lys Arg Gly Ala
290 295 300
Ile Met Asn Met Val Ala Phe Glu Gln Gly Phe Gln Ala Leu Ala Asp
310 315 320
305
Ala Tyr Phe Glu Asn Gly Tyr Thr Ser Asn Tyr Leu Asn Lys Glu Glu
325 330 335
His Arg Asp Thr Ala Glu Lys Thr Leu Ser Phe Lys Ile Thr Val Val
340 345 350
Glu Arg Glu Arg Ser His Val Glu His Ile Ile Ile Lys Gly Thr Lys
355 360 365
Asn Thr Lys Asp Glu Val Ile Leu Arg Glu Met Leu Leu Lys Pro Gly
370 375 380
Asp Val Phe Ser Lys Ser Lys Phe Thr Asp Ser Leu Arg Asn Leu Phe
390 395 400
385
Asn Leu Arg Tyr Phe Ser Ser Leu Val Pro Asp Val Arg Pro Qis Ser
405 410
Glu Gln Asp Leu Val Asp Ile Ile Leu Asn Val Glu Glu Gln Ser Thr
420 425 430
Ala Asn Val Gln Phe Gly Val Thr Phe Ser Gly Val Gly Glu Ala Gly
435 440 495
Thr Phe Pro Leu Ser Leu Phe Cys Gln Trp Glu Glu Lys Asn Phe Leu
450 455 460
CA 02325576 2000-10-10
WO 99/53099 PCTNS99/07886
-10-
Gly Lys Gly Asn Glu Ile Ser Val Asn Ala Thr Leu Gly Ser Glu Ala
465 470 475 480
Gln Ser Leu Lys Leu Gly Tyr Val Glu Arg Trp Phe Leu Gly Ser Pro.
485 490 495
Leu Thr Val Gly Phe Asp Phe Glu Leu Thr His Lys Asn Leu Phe Val
500 505 510
Tyr Arg Ala Gly Ser Tyr Gly Asn Gly Leu Pro His Pro Tyr Thr Ser
515 520 525
Arg Glu Gln Trp Ala Ser Ser Pro Gly Leu Ala Glu Ser Phe Arg Leu
530 535 540
Lys Tyr Ser Arg Phe Glu Ser Ala Ile Gly Ala His Thr Gly Tyr Gln
545 550 555 560
Trp Tyr Pro Arg Tyr Ala Val Ile Arg Val Asn Gly Gly Val Asp Phe
565 570 575
Arg Val Val Lys Asn Phe Tyr Asp Lys Asp Asn Asn Gln Pro Phe Asp
580 585 590
Leu Thr Val Lys Glu Gln Leu Asn Trp Thr Ser Ile Asn Ser Phe Trp
595 600 605
Thr Ser Val Ser Phe Asp Gly Arg Asp Phe Ala Tyr Asp Pro Ser Ser
610 615 620
Gly Trp Phe Leu Gly Gln Arg Cys Thr Phe Asn Gly Leu Val Pro Phe
625 630 635 640
Leu Glu Lys Glu His Ser Phe Arg Ser Asp Thr Lys Ala Glu Phe Tyr
645 650 655
Val Thr Leu Leu Asn Tyr Pro Val Ser Ala Val Trp Asn Leu Lys Phe
660 665 670
Val Leu Ala Phe Tyr Thr Gly Val Ser Val Gln Thr Tyr Tyr Gly Arg
675 680 685
Arg Lys Ser Glu Asn Gly Lys Gly Asn Gly Val Arg Ser Gly Ala Leu
690 695 700
Val Ile Asp Gly Val Leu Val Gly Arg Gly Trp Ser Glu Asp Ala Lys
705 710 715 720
Lys Asn Thr Gly Asp Leu Leu Leu His His Trp Ile Glu Phe Arg Trp
725 730 735
Pro Leu Ala His Gly Ile Val Ser Phe Asp Phe Phe Phe Asp Ala Ala
740 745 750
Met Val Tyr Asn Ile Glu Ser Gln Ser Pro Asn Gly Ser Ser Ser Ala
755 760 765
CA 02325576 2000-10-10
WO 99!53099 PCT/US99/07886
-11-
Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Arg Thr Thr Ser Ser
770 775 ?80
Glu Gly Leu Tyr Lys Met 5er Tyr Gly Pro Gly Leu Arg Phe Thr Leu
790 795 800
785
Pro Gln Phe Pro Leu Lys Leu Ala Phe Ala Asn Thr Phe Thr Ser Pro
805 810 815
Gly Gly Ile Pro Lys Thr Lys Lys Asn Trp Asn Phe Val Leu Ser Phe
820 825 830
Thr Val Asn Asn Leu
835
<210> 5
<211> 2439
<212> DNA
<213> Treponema pallidum
<220>
<221> CDS
<222> (1)..(2439)
<223> Coding region for portion of D15/Gnna87 used in
vaccine testing.
<400> 5
aat tgg tac gag gga aag cct atc tct gcg att agt ttt gag ggg ctc 48
Asn Trp Tyr Glu Gly Lys Pro Ile Ser Ala Ile Ser Phe Glu Gly Leu
1 5 10 15
gaa tat att get cgc ggc cag ttg gac acg att ttt tct caa tac aag 96
Glu Tyr Ile Ala Arg Gly Gln Leu Asp Thr Ile Phe Ser Gln Tyr Lys
20 25 30
gga caa aag tgg acc tat gag ctg tac ctg gag ata ctg caa aag gtc 144
Gly Gln Lys Trp Thr Tyr Glu Leu Tyr Leu Glu Ile Leu Gln Lys Val
35 40 45
tat gac ctt gag tac ttt tct gaa gtt tcg cct aag gcg gtg ccc acc 192
Tyr Asp Leu Glu Tyr Phe Ser Glu Val Ser Pro Lys Ala Val Pro Thr
50 55 60
gat ccg gag tat cag tat gtg atg cta cag ttc acg gta aag gag cgt 240
Asp Pro Glu Tyr Gln Tyr Val Met Leu Gln Phe Thr Val Lys Glu Arg
65 70 75 80
cct tcg gtg aag ggc atc aag atg gta ggg aac agc caa atc cgc agt 288
Pro Ser Val Lys Gly Ile Lys Met Val Gly Asn Ser Gln Ile Arg Ser
85 90 95
ggg gac ctt ttg tct aaa atc ctc ctg aaa aag gga gac att tac aat 336
Gly Asp Leu Leu Ser Lys Ile Leu Leu Lys Lys Gly Asp Ile Tyr Asn
100 105 110
gaa gta aag atg aag gtg gac caa gag tcg ctc agg cgt cat tac ctg 384
Glu Val Lys Met Lys Val Asp Gln Glu Ser Leu Arg Arg His Tyr Leu
CA 02325576 2000-10-10
WO 99/53099 PCT/E1S99/07886
-12-
115 120 125
gaccagggc tatgcggcggtt aagatatcc tgcgaggca aaaact gag 432
AspGlnGly TyrAlaAlaVal LysIleSer CysGluAla LysThr Glu
130 135 140
gcggggggc gtggtggtacag tttaccatc caggaaggt aagcag act 480
AlaGlyGly ValValValGln PheThrIle GlnGluGly LysGln Thr
145 150 155 160
gttgtctcg cggatacagttt aagggaaat aaggcgttt accgag tcg 528
ValValSer ArgIleGlnPhe LysGlyAsn LysAlaPhe ThrGlu Ser
165 170 175
gtgctcaag aaggtgctttcc acgcaggag gcgcgtttt ttgacc agt 576
ValLeuLys LysValLeuSer ThrGlnGlu AlaArgPhe LeuThr Ser
180 185 190
ggggtgttc aaggagaatgcg ctggaagcg gataaggcg gcagtc cac 624
GlyValPhe LysGluAsnAla LeuGluAla AspLysAla AlaVal His
195 200 205
tcatactat gcagagagggga tacattgac gcgcgggta gaaggc gtg 672
SerTyrTyr AlaGluArgGly TyrIleAsp AlaArgVal GluGly Val
210 215 220
gcaaagacg gttgataaaaaa actgacgcc agtcgcaat ctggtt acg 720
AlaLysThr ValAspLysLys ThrAspAla SerArgAsn LeuVal Thr
225 230 235 240
cttacgtac actgtggtggaa ggtgagcag taccgctac ggcggg gtt 768
LeuThrTyr ThrValValGlu GlyGluGln TyrArgTyr GlyGly Val
245 250 255
accattgtg ggtaaccagatt tttagcacc gaggagctg caggca aaa 816
ThrIleVal GlyAsnGlnIle PheSerThr GluGluLeu GlnAla Lys
260 265 270
attaggctc aagcgcggggcc atcatgaat atggtggcc tttgag cag 864
IleArgLeu LysArgGlyAla IleMetAsn MetValAla PheGlu Gln
275 280 285
ggctttcag gcgctggcggat gcgtatttt gaaaacgga tacacg tca 912
GlyPheGln AlaLeuAlaAsp AlaTyrPhe GluAsnGly TyrThr Ser
290 295 300
aattacctg aacaaagaagaa caccgggac acggcggag aaaacg ctt 960
AsnTyrLeu AsnLysGluGlu HisArgAsp ThrAlaGlu LysThr Leu
305 310 315 320
tcgtttaag atcacggtggtg gagcgcgag cgcagccac gtcgag cac 1008
SerPheLys IleThrValVal GluArgGlu ArgSerHis ValGlu His
325 330 335
attatcatt aagggaacgaag aatacaaaa gacgaggtt atcctg cgt 1056
IleIleIle LysGlyThrLys AsnThrLys AspGluVal IleLeu Arg
340 345 350
CA 02325576 2000-10-10
WO 99/53099 PCTNS99/07886
-13-
gaaatgctg ctgaaaccg ggggatgtg ttctctaag tcaaagttt acg 1104
GluMetLeu LeuLysPro GlyAspVal PheSerLys SerLysPhe Thr
355 360 365
gatagcttg cgcaatctg ttcaacctg cgctatttc tcgtcgctg gtg 1152
AspSerLeu ArgAsnLeu PheAsnLeu ArgTyrPhe SerSerLeu Val
370 375 380
ccggatgtg cggcccggc tctgagcag gacctggtg gacattatc ctg 1200
ProAspVal ArgProGly SerGluGln AspLeuVal AspIleIle Leu
385 390 395 400
aatgtggag gagcagtcg acggcaaac gtgcagttt ggggtgacg ttt 1248
AsnValGlu GluGlnSer ThrAlaAsn ValGlnPhe GlyValThr Phe
405 410 415
tctggggtg ggggaggca ggcacgttc ccgctttcg ctcttttgt cag 1296
SerGlyVal GlyGluAla GlyThrPhe ProLeuSer LeuPheCys Gln
420 425 430
tgggaagaa aagaatttt ttgggaaaa gggaatgaa atttcagta aat 1394
TrpGluGlu LysAsnPhe LeuGlyLys GlyAsnGlu IleSerVal Asn
935 440 945
gcaaccttg gggtctgag gcgcagagc ctgaagctc gggtatgtg gag 1392
AlaThrLeu GlySerGlu AlaGlnSer LeuLysLeu GlyTyrVal Glu
450 455 460
cgctggttt ctgggctct ccgctgacg gtgggcttt gactttgaa ctt 1440
ArgTrpPhe LeuGlySer ProLeuThr ValGlyPhe AspPheGlu Leu
465 470 475 480
acgcacaaa aatctcttt gtgtaccgc gcgggttca tacggcaac ggg 1488
ThrHisLys AsnLeuPhe ValTyrArg AlaGlySer TyrGlyAsn Gly
485 490 495
ctgccgcac ccgtacacg agcagggag cagtggget agttcccct ggg 1536
LeuProHis ProTyrThr SerArgGlu GlnTrpAla SerSerPro Gly
500 505 510
ctggcagaa tcgtttcgc ctcaagtat tcgcgcttt gagtccgcc atc 1584
LeuAlaGlu SerPheArg LeuLysTyr SerArgPhe GluSerAla Ile
515 520 525
ggcgcgcac accgggtac cagtggtat ccgcgctat gcggtcatt agg 1632
GlyAlaHis ThrGlyTyr GlnTrpTyr ProArgTyr AlaValIle Arg
530 535 540
gtgaacggg ggggtggac tttcgggtt gtaaagaat ttttacgat aag 1680
ValAsnGly GlyValAsp PheArgVal ValLysAsn PheTyrAsp Lys
545 550 555 560
gataacaat cagcccttc gacctgacc gtaaaagag cagctgaac tgg 1728
AspAsnAsn GlnProPhe AspLeuThr ValLysGlu GlnLeuAsn Trp
565 570 575
accagtatc aattcgttt tggacgagc gtttcgttt gacgggcgt gac 1776
ThrSerIle AsnSerPhe TrpThrSer ValSerPhe AspGlyArg Asp
CA 02325576 2000-10-10
WO 99/53099 PCT/US99/07886
-14-
580 585 590
tttgcgtac gacccgtcc agcggctgg tttttagga cagcgctgt acg 1824
PheAlaTyr AspProSer SerGlyTrp PheLeuGly GlnArgCys Thr
595 600 605
ttcaacggg ctcgttccc tttctcgaa aaagagcat tcgtttcgc tcc 1872
PheAsnGly LeuValPro PheLeuGlu LysGluHis SerPheArg Ser
610 615 620
gacaccaag gccgagttc tacgttacc ctgctcaat tatccggtc tct 1920
AspThrLys AlaGluPhe TyrValThr LeuLeuAsn TyrProVal Ser
625 630 635 640
gccgtgtgg aacttaaag tttgtcttg getttctac accggtgtg tcc 1968
AlaValTrp AsnLeuLys PheValLeu AlaPheTyr ThrGlyVal Ser
645 650 655
gttcaaacg tattatgga cggaggaaa agcgaaaac ggaaagggc aac 2016
ValGlnThr TyrTyrGly ArgArgLys SerGluAsn GlyLysGly Asn
660 665 670
ggggtgcgg tccggcgcg ctggtaata gacggcgtg ctggtaggg cgc 2064
GlyValArg SerGlyAla LeuValIle AspGlyVal LeuValGly Arg
675 680 685
gggtggagc gaagacgca aagaaaaac accggagac ctgctgctc cac 2112
GlyTrpSer GluAspAla LysLysAsn ThrGlyAsp LeuLeuLeu His
690 695 700
cactggatt gagttccgc tggccgctg gcgcacggc attgtgtcc ttt 2160
HisTrpIle GluPheArg TrpProLeu AlaHisGly IleValSer Phe
705 710 715 ?20
gactttttc tttgatgcg gcaatggtg tacaacatc gaaagtcag tcc 2208
AspPhePhe PheAspAla AlaMetVal TyrAsnIle GluSerGln Ser
725 730 735
ccaaacggg tcatcgtcc gccagcagc tccagcagc agcagtagt agt 2256
ProAsnGly SerSerSer AlaSerSer SerSerSer SerSerSer Ser
740 745 750
agcagtaga accaccagc tctgaagga ctgtacaaa atgagctac ggt 2304
SerSerArg ThrThrSer SerGluGly LeuTyrLys MetSerTyr Gly
755 760 765
ccggggctg cgctttaca ttgccgcaa tttccgtta aaattggcg ttc 2352
ProGlyLeu ArgPheThr LeuProGln PheProLeu LysLeuAla Phe
770 775 780
gcaaacacc ttcacgtca cccggcggc atcccaaaa acaaagaaa aat 2400
AlaAsnThr PheThrSer ProGlyGly IleProLys ThrLysLys Asn
785 790 795 800
tggaatttt gtgttgtcg ttcacggta aataatttg tag 2439
TrpAsnPhe ValLeuSer PheThrVal AsnAsnLeu
805 810
CA 02325576 2000-10-10
WO 99/53099 PCT/US99/07886
-15-
<210> 6
<211> 812
<212> PRT
<213> Treponema pallidum
<400> 6
Asn Trp Tyr Glu Gly Lys Pro Ile Ser Ala Ile Ser Phe Glu Gly Leu
1 5 10 15
Glu Tyr Ile Ala Arg Gly Gln Leu Asp Thr Ile Phe Ser Gln Tyr Lys
20 25 30
Gly Gln Lys Trp Thr Tyr Glu Leu Tyr Leu Glu Ile Leu Gln Lys Val
35 40 45
Tyr Asp Leu Glu Tyr Phe Ser Glu Val Ser Pro Lys Ala Val Pro Thr
50 55 60
Asp Pro Glu Tyr Gln Tyr Val Met Leu Gln Phe Thr Val Lys Glu Azg
65 70 75 80
Pro Ser Val Lys Gly Ile Lys Met Val Gly Asn Ser Gln Ile Arg Ser
85 90 95
Gly Asp Leu Leu Ser Lys Ile Leu Leu Lys Lys Gly Asp Ile Tyr Asn
100 105 110
Glu Val Lys Met Lys Val Asp Gln Glu Ser Leu Arg Arg His Tyr Leu
115 120 125
Asp Gln Gly Tyr Ala Ala Val Lys Ile Ser Cys Glu Ala Lys Thr Glu
130 135 140
Ala Gly Gly Val Val Val Gln Phe Thr Ile Gln Glu Gly Lys Gln Thr
145 150 155 160
Val Val Ser Arg Ile Gln Phe Lys Gly Asn Lys Ala Phe Thr Glu Ser
165 170 175
Val Leu Lys Lys Val Leu Ser Thr Gln Glu Ala Arg Phe Leu Thr Ser
180 185 190
Gly Val Phe Lys Glu Asn Ala Leu Glu Ala Asp Lys Ala Ala Val His
195 200 205
Ser Tyr Tyr Ala Glu Arg Gly Tyr Ile Asp Ala Arg Val Glu Gly Val
210 215 220
Ala Lys Thr Val Asp Lys Lys Thr Asp Ala Ser Arg Asn Leu Val Thr
225 230 235 240
Leu Thr Tyr Thr Val Val Glu Gly Glu Gln Tyr Arg Tyr Gly Gly Val
245 250 255
Thr Ile Val Gly Asn Gln Ile Phe Ser Thr Glu Glu Leu Gln Ala Lys
260 265 270
CA 02325576 2000-10-10
WO 99/53099 PCT/US99/07886
-16-
Ile Arg Leu Lys Arg Gly Ala Ile Met Asn Met Val Ala Phe Glu Gln
275 280 285
Gly Phe Gln Ala Leu Ala Asp Ala Tyr Phe Glu Asn Gly Tyr Thr Ser
290 295 300
Asn Tyr Leu Asn Lys Glu Glu His Arg Asp Thr Ala Glu Lys Thr Leu
305 310 315 320
Ser Phe Lys Ile Thr Val Val Glu Arg Glu Arg Ser His Val Glu His
325 330 335
Ile Ile Ile Lys Gly Thr Lys Asn Thr Lys Asp Glu Val Ile Leu Arg
340 345 350
Glu Met Leu Leu Lys Pro Gly Asp Val Phe Ser Lys Ser Lys Phe Thr
355 360 365
Asp Ser Leu Arg Asn Leu Phe Asn Leu Arg Tyr Phe Ser Ser Leu Val
370 375 380
Pro Asp Val Arg Pro Gly Ser Glu Gln Asp Leu Val Asp Ile Ile Leu
385 390 395 400
Asn Val Glu Glu Gln Ser Thr Ala Asn Val Gln Phe Gly Val Thr Phe
405 410 415
Ser Gly Val Gly Glu Ala Gly Thr Phe Pro Leu Ser Leu Phe Cys Gln
920 425 430
Trp Glu Glu Lys Asn Phe Leu Gly Lys Gly Asn Glu Ile Ser Val Asn
435 440 445
Ala Thr Leu Gly Ser Glu Ala Gln Ser Leu Lys Leu Gly Tyr Val Glu
950 455 460
Arg Trp Phe Leu Gly Ser Pro Leu Thr Val Gly Phe Asp Phe Glu Leu
465 470 475 480
Thr His Lys Asn Leu Phe Val Tyr Arg Ala Gly Ser Tyr Gly Asn Gly
485 490 495
Leu Pro His Pro Tyr Thr Ser Arg Glu Gln Trp Ala Ser Ser Pro Gly
500 505 510
Leu Ala Glu Ser Phe Arg Leu Lys Tyr Ser Arg Phe Glu Ser Ala Ile
515 520 525
Gly Ala His Thr Gly Tyr Gln Trp Tyr Pro Arg Tyr Ala Val Ile Arg
530 535 540
Val Asn Gly Gly Val Asp Phe Arg Val Val Lys Asn Phe Tyr Asp Lys
545 550 555 560
Asp Asn Asn Gln Pro Phe Asp Leu Thr Val Lys Glu Gln Leu Asn Trp
565 570 575
Thr Ser Ile Asn Ser Phe Trp Thr Ser Val Ser Phe Asp Gly Arg Asp
CA 02325576 2000-10-10
WO 99/53099 PCT/US99/07886
-17-
580 585 590
Phe Ala Tyr Asp Pro Ser Ser Gly Trp Phe Leu Gly Gln Arg Cys Thr
595 600 605
Phe Asn Gly Leu Val Pro Phe Leu Glu Lys Glu His Ser Phe Arg Ser
610 615 620
Asp Thr Lys Ala Glu Phe Tyr Val Thr Leu Leu Asn Tyr Pro Val Ser
625 630 635 640
Ala Val Trp Asn Leu Lys Phe Val Leu Ala Phe Tyr Thr Gly Val Ser
645 650 655
Val Gln Thr Tyr Tyr Gly Arg Arg Lys Ser Glu Asn Gly Lys Gly Asn
660 665 670
Gly Val Arg Ser Gly Ala Leu Val Ile Asp Gly Val Leu Val Gly Arg
675 680 685
Gly Trp Ser Glu Asp Ala Lys Lys Asn Thr Gly Asp Leu Leu Leu His
690 695 700
His Tzp ale Glu Phe Arg Trp Pro Leu Ala His Gly Ile Val Ser Phe
705 710 715 720
Asp Phe Phe Phe Asp Ala Ala Met Val Tyr Asn Ile Glu Ser Gln Ser
725 730 735
Pro Asn Gly Ser Ser Ser Ala Ser Ser Ser Ser Ser Ser Ser Ser Ser
790 745 750
Ser Ser Arg Thr Thr Ser Ser Glu Gly Leu Tyr Lys Met Ser Tyr Gly
755 760 765
Pro Gly Leu Arg Phe Thr Leu Pro Gln Phe Pro Leu Lys Leu Ala Phe
770 775 780
Ala Asn Thr Phe Thr Ser Pro Gly Gly Ile Pro Lys Thr Lys Lys Asn
785 790 795 800
Trp Asn Phe Val Leu Ser Phe Thr Val Asn Asn Leu
805 810
<210> 7
<211> 1029
<212> DNA
<213> Treponema pallidum
<220>
<221> CDS
<222> (1)..(1029)
<223> Mspl
<220>
<221> primer bind
CA 02325576 2000-10-10
WO 99/53099 PCT/US99/07886
-18-
<222>
(1)..(18)
<223> imerS1 binding site
PCR
pr
<220>
<221> bind
primer
<222> ((1011). .(1029))
Complement
<223> imerAS1binding site
PCR
pr
<400>
7
cgactcacc ctcgaaccaggc gccggcttc cgcttctcc ttcgccctc 48
ArgLeuThr LeuGluProGly AlaGlyPhe ArgPheSer PheAlaLeu
1 5 10 15
gacgccggt aaccaacaccag agtgcacag gactttcaa aatcgcaca 96
AspAlaGly AsnGlnHisGln SerAlaGln AspPheGln AsnArgThr
20 25 30
cagagggcg cagagtgaactc accgccctc tcaaataac ctcttccag 144
GlnArgAla GlnSerGluLeu ThrAlaLeu SerAsnAsn LeuPheGln
35 40 45
ggagaaagt caaaaacaggaa gcctggctg gacgaatat gcaaagaag 192
GlyGluSer GlnLysGlnGlu AlaTrpLeu AspGluTyr AlaLysLys
50 55 60
gtgcttgat gccgtaacggca gccaccgaa accgccctt cagtcgagg 240
ValLeuAsp AlaValThrAla AlaThrGlu ThrAlaLeu GlnSerArg
65 70 75 80
ggaaacgcg tacataacggca gtgtcaaac gtaaaagtc acccctccg 288
GlyAsnAla TyrIleThrAla ValSerAsn ValLysVal ThrProPro
85 90 95
gtagetgcc acgcttttgacg aacctgaag gtgttcatt accgaccct 336
ValAlaAla ThrLeuLeuThr AsnLeuLys ValPheIle ThrAspPro
100 105 110
cctacaccg tcaccgcttccc gcgcttcct gcattttcc ctgatgggg 384
ProThrPro SerProLeuPro AlaLeuPro AlaPheSer LeuMetGly
115 120 125
caggttttg ctgcagtacgat gcggagcag gtggtgaag gggtttgag 432
GlnValLeu LeuGlnTyrAsp AlaGluGln ValValLys GlyPheGlu
130 135 140
caggtacag acgcaaatcgtt getgaaatt aaccagaaa gtgcaagcg 480
GlnValGln ThrGlnIleVal AlaGluIle AsnGlnLys ValGlnAla
145 150 155 160
getgtgget cagagcaagget gcagcacag gcattcatc aacggtctt 528
AlaValAla GlnSerLysAla AlaAlaGln AlaPheIle AsnGlyLeu
165 170 175
accaaggca atagaagacgtg getgatgcg ttgcttgca ccgcataag 576
ThrLys~AlaIleGluAspVal AlaAspAla LeuLeuAla ProHisLys
180 185 190
ggaaatccg atgagcctcttc aaccttccg gatcaacaa aaattactg 624
CA 02325576 2000-10-10
WO 99/53099 PCTNS99/07886
-19-
Gly Pro SerLeuPhe LeuPro GlnGln LysLeuLeu
Asn Met Asn Asp
195 200 205
aaggacgatctc gccgatctt attccaaag cttacgget gaggetaca 672
LysAspAspLeu AlaAspLeu IleProLys LeuThrAla GluAlaThr
210 215 220
aagtttttcact gagggtcag acgtttgta accgaagaa gtgaagaag 720
LysPhePheThr GluGlyGln ThrPheVal ThrGluGlu ValLysLys
225 230 235 240
aagacggatgcg ttggacgcg gggcagcag atacgtcag getatacag 768
LysThrAspAla LeuAspAla GlyGlnGln IleArgGln AlaIleGln
245 250 255
aacctgcgtgcg tctgcatgg cgtgccttt ctaatggga gtcagcgcc 816
AsnLeuArgAla SerAlaTrp ArgAlaPhe LeuMetGly ValSerAla
260 265 270
gtgtgtctgtat cttgacacc tacaatgtc gccttcgat gcgctgttt 864
ValCysLeuTyr LeuAspThr TyrAsnVal AlaPheAsp AlaLeuPhe
275 280 285
acggcgcagtgg aagtggctg tcttctggc atatacttt gccacagca 912
ThrAlaGlnTrp LysTrpLeu SerSerGly IleTyrPhe AlaThrAla
290 295 300
ccggcaaacgtt tttggcacc agggtgtta gataacacc atcgcaagc 960
ProAlaAsnVal PheGlyThr ArgValLeu AspAsnThr IleAlaSer
305 310 315 320
tgtggcgacttt gccggattc cttaagctc gaaactaag agcggtgac 1008
CysGlyAspPhe AlaGlyPhe LeuLysLeu GluThrLys SerGlyAsp
325 330 335
ccc tac acc cac ctg ctc acc 1029
Pro Tyr Thr His Leu Leu Thr
340
<210> 8
<211> 343
<212> PRT
<213> Treponema pallidum
<400> 8
Arg Leu Thr Leu Glu Pro Gly Ala Gly Phe Arg Phe Ser Phe Ala Leu
1 5 10 15
Asp Ala Gly Asn Gln His Gln Ser Ala Gln Asp Phe Gln Asn Arg Thr
20 25 30
Gln Arg Ala Gln Ser Glu Leu Thr Ala Leu Ser Asn Asn Leu Phe Gln
35 90 45
Gly Glu Ser Gln Lys Gln Glu Ala Trp Leu Asp Glu Tyr Ala Lys Lys
50 55 60
CA 02325576 2000-10-10
WO 99/53099 PCT/US99/07886
-20-
Val Leu Asp Ala Val Thr Ala Ala Thr Glu Thr Ala Leu Gln Ser Arg
65 70 75 80
Gly Asn Ala Tyr Ile Thr Ala Val Ser Asn Val Lys Val Thr Pro Pro
85 90 95
Val Ala Ala Thr Leu Leu Thr Asn Leu Lys Val Phe Ile Thr Asp Pro
I00 . 105 110
Pro Thr Pro Ser Pro Leu Pro Ala Leu Pro Ala Phe Ser Leu Met Gly
115 120 125
Gln Val Leu Leu Gln Tyr Asp Ala Glu Gln Val Val Lys Gly Phe Glu
130 135 190
Gln Val Gln Thr Gln Ile Val Ala Glu Ile Asn Gln Lys Val Gln Ala
145 150 155 160
Ala Val Ala Gln Ser Lys Ala Ala Ala Gln Ala Phe Ile Asn Gly Leu
165 170 175
Thr Lys Ala Ile Glu Asp Val Ala Asp Ala Leu Leu Ala Pro His Lys
180 185 190
Gly Asn Pro Met Ser Leu Phe Asn Leu Pro Asp Gln Gln Lys Leu Leu
195 200 205
Lys Asp Asp Leu Ala Asp Leu Ile Pro Lys Leu Thr Ala Glu Ala Thr
210 215 220
Lys Phe Phe Thr Glu Gly Gln Thr Phe Val Thr Glu Glu Val Lys Lys
225 230 235 240
Lys Thr Asp Ala Leu Asp Ala Gly Gln Gln Ile Arg Gln Ala Ile Gln
245 250 255
Asn Leu Arg Ala Ser Ala Trp Arg Ala Phe Leu Met Gly Val 5er Ala
260 265 270
Val Cys Leu Tyr Leu Asp Thr Tyr Asn Val Ala Phe Asp Ala Leu Phe
275 280 285
Thr Ala Gln Trp Lys Trp Leu Ser Ser Gly Ile Tyr Phe Ala Thr Ala
290 295 300
Pro Ala Asn Val Phe Gly Thr Arg Val Leu Asp Asn Thr Ile Ala Ser
305 310 315 320
Cys Gly Asp Phe Ala Gly Phe Leu Lys Leu Glu Thr Lys Ser Gly Asp
325 330 335
Pro Tyr Thr His Leu Leu Thr
390
<210> 9
CA 02325576 2000-10-10
WO 99/53099 PCTNS99/07886
-2I-
<211> 336
<212> DNA
<213> Treponemapallidum
<220>
<221> CDS
<222> (1)..(333)
<223> Msp2
<220>
<221> primer
bind
<222> (1)..(18)
<223> PCR S1 bindingsite
primer
<900> 9
cga ctc acc gaacca ggcgccggcttc cgcttctcc ttcgcc ctc 48
ctc
Arg Leu Thr GluPro GlyAlaGlyPhe ArgPheSer PheAla Leu
Leu
1 5 10 15
gac gcc ggt caacac caggaccctgcc gatgcaggt aatcgc ctt 96
aac
Asp Ala Gly GlnHis GlnAspProAla AspAlaGly AsnArg Leu
Asn
20 25 30
ctg gca acg agctca cgggagaagttt gacagcgcg ttcgat gcc 144
ggg
Leu Ala Thr SerSer ArgGluLysPhe AspSerAla PheAsp Ala
Gly
35 40 45
ctc agg gtg caatac cgtgtaaaggat aagtatctt gaattt ttg 192
gag
Leu Arg Val GlnTyr ArgValLysAsp LysTyrLeu GluPhe Leu
Glu
50 55 60
ctg gga cag gcggag tcctcgattctc gagcgggtg gggctt gcc 290
atg
Leu Gly Gln AlaGlu SerSerIleLeu GluArgVal GlyLeu Ala
Met
65 70 75 80
ctc acg ctg gacggt acgctcgtctct acgctgacg aaggtt gcc 288
cag
Leu Thr Leu AspGly ThrLeuValSer ThrLeuThr LysVal Ala
Gln
85 90 95
act gat agt gga get cag cgc cca gtg gga aca ggg ggt get tgc tga 336
Thr Asp Ser Gly Ala Gln Arg Pro Val Gly Thr Gly Gly Ala Cys
100 105 110
<210> 10
<211> 111
<212> PRT
<213> Treponema pallidum
<400> 10
Arg Leu Thr Leu Glu Pro Gly Ala Gly Phe Arg Phe Ser Phe Ala Leu
1 5 10 15
Asp Ala Gly Asn Gln His Gln Asp Pro Ala Asp Ala Gly Asn Arg Leu
20 25 30
Leu Ala Thr Gly Ser Ser Arg Glu Lys Phe Asp Ser Ala Phe Asp Ala
CA 02325576 2000-10-10
WO 99/53099 PCT/US99/07886
-22-
35 40 45
Leu Arg Val Glu Gln Tyr Arg Val Lys Asp Lys Tyr Leu Glu Phe Leu
50 55 60
Leu Gly Gln Met Ala Glu Ser Ser Ile Leu Glu Arg Val Gly Leu Ala
65 70 75 80
Leu Thr Leu Gln Asp Gly Thr Leu Val Ser Thr Leu Thr Lys Val Ala
85 90 95
Thr Asp Ser Gly Ala Gln Arg Pro Val Gly Thr Gly Gly Ala Cys
100 105 110
<210> 11
<211> 1047
<212> DNA
<213> Treponema pallidum
<220>
<221> CDS
<222> (1)..(1047)
<223> Msp3
<220>
<221> primer bind
<222> (1)..(18)
<223> PCR primer S1 binding site
<220>
<221> primer bind
<222> Complement((1029)..(1047))
<223> PCR primer AS1 binding site
<400> 11
cga ctc acc ctc gaa cca ggc gcc ggc ttc cgc ttc tcc ttc gcc ctc 48
Arg Leu Thr Leu Glu Pro Gly Ala Gly Phe Arg Phe Ser Phe Ala Leu
1 5 10 15
gac gccggt caacaccagagt gaggetacc gcggcgatg aggacc 96
aac
Asp AlaGly GlnHisGlnSer GluAlaThr AlaAlaMet ArgThr
Asn
20 25 30
gaa aggaca gagcgtgcacag gaggttgca ctggcaatt tttacg 194
cgc
Glu ArgThr GluArgAlaGln GluValAla LeuAlaIle PheThr
Arg
35 40 45
cac getgcg gaacaggetaaa caggcgget gatacggtt ggtagc 192
cag
His AlaAla GluGlnAlaLys GlnAlaAla AspThrVal GlySer
Gln
50 55 60
acc atagat tcggtgcaggtg gcaagatca gttattact cagatc 290
aac
Thr IleAsp SerValGlnVal AlaArgSer ValIleThr GlnIle
Asn
65 70 75 80
get gaagga gtgaagcaggca cacgatcag attaaacgc accaat 288
gcg
CA 02325576 2000-10-10
WO 99/53099 PCT/US99/07886
-23-
Ala Glu Gly Ala Val Lys Gln Ala His Asp Gln Ile Lys Arg Thr Asn
85 90 95
gga aca caa gta gtg aat att gac gtg acc gtt ccg gtg aac gtc cgg 336
Gly Thr Gln Val Val Asn Ile Asp Val Thr Val Pro Val Asn Val Arg
100 105 110
caa agt cct gtt cgg caa cct gac ttg cct tca ctt acc gca atc gca 384
Gln Ser Pro Val Arg Gln Pro Asp Leu Pro Ser Leu Thr Ala Ile Ala
115 120 125
gcg caa ttg cca aat gta acc aag ctc ttc ttc ctt agt gcc ggg gcg 432
Ala Gln Leu Pro Asn Val Thr Lys Leu Phe Phe Leu Ser Ala Gly Ala
130 135 140
gcc gcc gcg agg ccc att atc ggg cag att act ggc gtg gtg cag aac 480
Ala Ala Ala Arg Pro Ile Ile Gly Gln Ile Thr Gly Val Val Gln Asn
145 150 155 160
gtt atc acc cag cag gta cag gcc cgg gtt gcg cag tcg acc gcg gtt 528
Val Ile Thr Gln Gln Val Gln Ala Arg Val Ala Gln Ser Thr Ala Val
165 170 175
gca atc cag caa gtt ctt gtg ttc aac cag caa acc gtc get gca gaa 576
Ala Ile Gln Gln Val Leu Val Phe Asn Gln Gln Thr Val Ala Ala Glu
180 185 190
aaa gcg aat acg caa aag cat acg ata aat ggc aag tca tac gcg get 629
Lys Ala Asn Thr Gln Lys His Thr Ile Asn Gly Lys Ser Tyr Ala Ala
195 200 205
cat atc ggc tcg ttg gta agt ctc get acc aac agg gcg ctg cct act 672
His Ile Gly Ser Leu Val Ser Leu Ala Thr Asn Arg Ala Leu Pro Thr
210 215 220
ata cga cag cgt gtt gag caa get gtt cag gaa aat ata cgg agg atc 720
Ile Arg Gln Arg Val Glu Gln Ala Val Gln Glu Asn Ile Arg Arg Ile
225 230 235 240
aac get gtg gtg cag caa aaa gcg caa acg ctc acc tct tcc cag gaa 768
Asn Ala Val Val Gln Gln Lys Ala Gln Thr Leu Thr Ser Ser Gln Glu
245 250 255
ctg gaa aag gca gtg tat tcg ttg ttc gtt ccc acg ttt gaa aac ctg 816
Leu Glu Lys Ala Val Tyr Ser Leu Phe Val Pro Thr Phe Glu Asn Leu
260 265 270
gtg ttg ggt gca ggc gcg ctg ctg get ctt ttg gat atg cat cag att 864
Val Leu Gly Ala Gly Ala Leu Leu Ala Leu Leu Asp Met His Gln Ile
275 280 285
gcg gtg gac gcg ctg ttt acg gcg cag tgg aag tgg ctg tct tct ggc 912
Ala Val Asp Ala Leu Phe Thr Ala Gln Trp Lys Trp Leu Ser Ser Gly
290 295 300
ata tac ttt gcc aca gca ccg gca aac gtt ttt ggc acc agg gtg tta 960
Ile Tyr Phe Ala Thr Ala Pro Ala Asn Val Phe Gly Thr Arg Val Leu
305 310 315 320
CA 02325576 2000-10-10
WO 99/53099 PCT/US99/07886
-24-
gat aac acc atc gca agc tgt ggc gac ttt gcc gga ttc ctt aag ctc 1008
Asp Asn Thr Ile Ala Ser Cys Gly Asp Phe Ala Gly Phe Leu Lys Leu
325 330 335
gaa act aag agc ggt gac ccc tac acc cac ctg ctc acc I04?
Glu Thr Lys Ser Gly Asp Pro Tyr Thr His Leu Leu Thr
340 345
<210> 12
<211> 349
<212> PRT
<213> Treponemapallidum
<400> 12
Arg Leu Thr GluProGly GlyPhe ArgPheSer PheAlaLeu
Leu Ala
1 5 10 15
Asp Ala Gly GlnHisGln GluAla ThrAlaAla MetArgThr
Asn Ser
20 25 30
Glu Arg Thr GluArgAla GluVal AlaLeuAla IlePheThr
Arg Gln
35 40 45
His Ala Ala GluGlnAla GlnAla AlaAspThr ValGlySer
Gln Lys
50 55 60
Thr Ile Asp SerValGln AlaArg SerValIle ThrGlnIle
Asn Val
65 70 75 80
Ala Glu Gly ValLysGln HisAsp GlnIleLys ArgThrAsn
Ala Ala
85 90 95
Gly Thr Gln ValAsnIle ValThr ValProVal AsnValArg
Val Asp
100 105 110
Gln Ser Pro ArgGlnPro LeuPro SerLeuThr AlaIleAla
Val Asp
115 120 125
Ala Gln Leu AsnValThr LeuPhe PheLeuSer AlaGlyAla
Pro Lys
130 135 140
Ala Ala Ala ProIleIle GlnIle ThrGlyVal ValGlnAsn
Arg Gly
145 150 155 160
Val Ile Thr GlnValGln ArgVal AlaGlnSer ThrAlaVal
Gln Ala
165 170 175
Ala Ile Gln ValLeuVal AsnGln GlnThrVal AIaAlaGlu
Gln Phe
180 185 190
Lys Ala Asn GlnLysHis IleAsn GlyLysSer TyrAlaAla
Thr Thr
195 200 205
His Ile Gly LeuValSer AlaThr AsnArgAla LeuProThr
Ser Leu
210 215 220
CA 02325576 2000-10-10
WO 99/53099 PCT/t3S99/07$$6
-25-
IleArgGln Val Gln Ala Gln Glu Ile Ile
Arg Glu Val Asn Arg
Arg
225 230 235 240
AsnAlaVal Gln Lys Ala Thr LeuThrSer Ser Glu
Val Gln Gln Gln
245 250 255
LeuGluLys Val Ser Leu Val ProThrPhe Glu Leu
Ala Tyr Phe Asn
260 265 270
ValLeuGly Gly Leu Leu Leu LeuAspMet His Ile
Ala Ala Ala Gln
275 280 285
AlaValAsp Leu Thr Ala Trp LysTrpLeu Ser Gly
Ala Phe Gln Ser
290 295 300
IleTyrPhe Thr Pro Ala Val PheGlyThr Arg Leu
Ala Ala Asn Val
305 310 315 320
AspAsnThr Ala Cys Gly Phe AlaGlyPhe Leu Leu
Ile Ser Asp Lys
325 330 335
GluThrLys Gly Pro Tyr His LeuLeuThr
Ser Asp Thr
340 345
<210> 13
<211> 600
<212> DNA
<213> Treponema pallidum
<220>
<221> CDS
<222> (1)..(600)
<223> Msp4
<220>
<221> primer bind
<222> (1)..(18)
<223> PCR primer S1 binding site
<220>
<221> primer bind
<222> Complement((582)..(600))
<223> PCR primer AS1 binding site
<400> 13
cga ctc acc ctc gaa cca ggc gcc ggc ttc cgc ttc tcc ttc gcc ctc 48
Arg Leu Thr Leu Glu Pro Gly Ala Gly Phe Arg Phe Ser Phe Ala Leu
1 5 10 15
gac gcc ggt aac caa cac cag agt aac gca cat get cag acc caa gag 96
Asp Ala Gly Asn Gln His Gln Ser Asn Ala His Ala Gln Thr Gln Glu
20 25 30
aga get atc ctc aaa gca agg gaa gtg ttt aga cgg gtg gag ggg aaa 144
Arg Ala Ile Leu Lys Ala Arg Glu Val Phe Arg Arg Val Glu Gly Lys
35 40 45
CA 02325576 2000-10-10
WO 99/53099 PCT/US99/07886
-26-
ctcgtgcagaac cttcccaat atcatgatg ccaccagga atcaccgaa 192
LeuValGlnAsn LeuProAsn IleMetMet ProProGly IleThrGlu
50 55 60
caaaccactctc atagagatg gtaggactt getgetttg attgcagaa 240
GlnThrThrLeu IleGluMet ValGlyLeu AlaAlaLeu IleAlaGlu
65 70 75 80
ggaacgctcggc agcgccatt caaaccgtg ctagccget ggcgcgctc 288
GlyThrLeuGly SerAlaIle GlnThrVal LeuAlaAla GlyAlaLeu
85 90 95
gcggcgcttgta tcgcaactt gtaccgaac atagagcaa ggagtacgt 336
AlaAlaLeuVal SerGlnLeu ValProAsn IleGluGln GlyValArg
100 105 110
gatgtcttccgc tcttccgat ccaagagtt gtcactget aaacttctc 384
AspValPheArg SerSerAsp ProArgVal ValThrAla LysLeuLeu
115 120 125
getttccttgag cgcgcacct atgaacgcg ctcaacata gacgcgctc 432
AlaPheLeuGlu ArgAlaPro MetAsnAla LeuAsnIle AspAlaLeu
130 135 140
ctgcgtatgcag tggaagtgg ctctcttct ggcatatac tttgccacc 480
LeuArgMetGln TrpLysTrp LeuSerSer GlyIleTyr PheAlaThr
145 150 155 160
gcaggcactaat atctttggc aaacgcgtc tttgetacc actcgtgcg 528
AlaGlyThrAsn IlePheGly LysArgVal PheAlaThr ThrArgAla
165 170 175
cactactttgat tttgccgga ttccttaag ctcgaaacc aaaagcggt 576
HisTyrPheAsp PheAlaGly PheLeuLys LeuGluThr LysSerGly
180 185 190
gacccctacacc cacctgctc acc 600
AspProTyrThr HisLeuLeu Thr
195 200
<210> 14
<211> 200
<212> PRT
<213> Treponemapallidum
<400> 14
Arg Leu Thr Glu Pro Gly Ala Gly Phe Arg PheAla
Leu Phe Ser Leu
1 5 10 15
Asp Ala Gly Gln His Gln Ser Asn Ala His ThrGln
Asn Ala Gln Glu
20 25 30
Arg Ala Ile Lys Ala Arg Glu Val Phe Arg GluGly
Leu Arg Val Lys
35 40 45
CA 02325576 2000-10-10
WO 99/53099 PCT/US99/07886
-27-
Leu Val Gln Asn Leu Pro Asn Ile Met Met Pro Pro Gly Ile Thr Glu
50 55 60
Gln Thr Thr Leu Ile Glu Met Val Gly Leu Ala Ala Leu Ile Ala Glu
65 70 75 80
Gly Thr Leu Gly Ser Ala Ile Gln Thr Val Leu Ala Ala Gly Ala Leu
85 90 95
Ala Ala Leu Val Ser Gln Leu Val Pro Asn Ile Glu Gln Gly Val Arg
100 105 110
Asp Val Phe Arg Ser Ser Asp Pro Arg Val Val Thr Ala Lys Leu Leu
115 120 125
Ala Phe Leu Glu Arg Ala Pro Met Asn Ala Leu Asn Ile Asp Ala Leu
130 135 140
Leu Arg Met Gln Trp Lys Trp Leu Ser Ser Gly Ile Tyr Phe Ala Thr
145 150 155 160
Ala Gly Thr Asn Ile Phe Gly Lys Arg Val Phe Ala Thr Thr Arg Ala
165 170 175
His Tyr Phe Asp Phe Ala Gly Phe Leu Lys Leu Glu Thr Lys Ser Gly
180 185 190
Asp Pro Tyr Thr His Leu Leu Thr
195 200
<210> 15
<211> 600
<212> DNA
<213> Treponema pallidum
<220>
<221> CDS
<222> (1)..(600)
<223> MspS
<220>
<221> primer bind
<222> (1)..(18)
<223> PCR primer S1 binding site
<220>
<221> primer bind
<222> Complement((582)..(600))
<223> PCR primer AS1 binding site
<400> 15
cga ctc acc ctc gaa cca ggc gcc ggc ttc cgc ttc tcc ttc gcc ctc 48
Arg Leu Thr Leu Glu Pro Gly Ala Gly Phe Arg Phe Ser Phe Ala Leu
1 5 10 15
gac gcc ggt aac caa cac cag agt aac gca cat get cag acc caa gag 96
Asp Ala Gly Asn Gln His Gln Ser Asn Ala His Ala Gln Thr Gln Glu
CA 02325576 2000-10-10
WO 99/53099 PC'TNS99/07886
-28-
20 25 30
aga atcctcaaa gcaagggaa gtgtttaga cgggtggag gggaaa 194
get
Arg IleLeuLys AlaArgGlu ValPheArg ArgValGlu GlyLys
Ala
35 90 45
ctc cagaacctt cccaatatc atgatgcca ccaggaatc accgaa 192
gtg
Leu GlnAsnLeu ProAsnIle MetMetPro ProGlyIle ThrGlu
Val
50 55 60
caa actctcata gagatggta ggacttget getttgatt gcagaa 240
acc
Gln ThrLeuIle GluMetVal GlyLeuAla AlaLeuIle AlaGlu
Thr
65 70 75 80
gga ctcggcagc gccattcaa accgtgcta gccgetggc gcgctc 288
acg
Gly LeuGlySer AlaIleGln ThrValLeu AlaAlaGly AlaLeu
Thr
85 90 95
gcg cttgtatcg caacttgta ccgaacata gagcaagga gtacgt 336
gcg
Ala LeuValSer GlnLeuVal ProAsnIle GluGlnGly ValArg
Ala
100 105 110
gat ttccgctct tccgatcca agagttgtc actgetaaa cttctc 384
gtc
Asp Ph.eArgSer SerAspPro ArgValVal ThrAlaLys LeuLeu
Val
115 120 125
get cttgagcgc gcacctatg aacgcgctc aacatagac gcgctc 432
ttc
Ala LeuGluArg AlaProMet AsnAlaLeu AsnIleAsp AlaLeu
Phe
130 135 140
ctg atgcagtgg aagtggctc tcttctggc atatacttt gccacc 980
cgt
Leu MetGlnTrp LysTrpLeu SerSerGly IleTyrPhe AlaThr
Arg
145 150 155 160
gca actaatatc tttggcaaa cgcgtcttt getaccact cgtgcg 528
ggc
Ala ThrAsnIle PheGlyLys ArgValPhe AlaThrThr ArgAla
Gly
165 170 175
cac tttgatttt gccggattc cttaagctc gaaaccaaa agcggt 576
tac
His PheAspPhe AlaGlyPhe LeuLysLeu GluThrLys SerGly
Tyr
180 185 190
gac tacacccac ctgctcacc 600
ccc
Asp TyrThrHis LeuLeuThr
Pro
195 200
<210>
16
<211>
200
<212>
PRT
<213> pallidum
Treponema
<400> 16
Arg Leu Thr Leu Glu Pro Gly Ala Gly Phe Arg Phe Ser Phe Ala Leu
1 5 10 15
Asp Ala Gly Asn Gln His Gln Ser Asn Ala His Ala Gln Thr Gln Glu
20 25 30
CA 02325576 2000-10-10
WO 99/53099 PCT/US99/07886
-29-
Arg Ala Ile Leu Lys Ala Arg Glu Val Phe Arg Arg Val Glu Gly Lys
35 40 45
Leu Val Gln Asn Leu Pro Asn Ile Met Met Pro Pro Gly Ile Thr Glu
50 55 60
Gln Thr Thr Leu Ile Glu Met Val Gly Leu Ala Ala Leu Ile Ala Glu
65 70 75 80
Gly Thr Leu Gly Ser Ala Ile Gln Thr Val Leu Ala Ala Gly Ala Leu
85 90 95
Ala Ala Leu Val Ser Gln Leu Val Pro Asn Ile Glu Gln Gly Val Arg
100 105 110
Asp Val Phe Arg Ser Ser Asp Pro Arg Val Val Thr Ala Lys Leu Leu
115 120 125
Ala Phe Leu Glu Arg Ala Pro Met Asn Ala Leu Asn Ile Asp Ala Leu
130 135 140
Leu Arg Met Gln Trp Lys Trp Leu Ser Ser Gly Ile Tyr Phe Ala Thr
145 150 155 160
A1a Gly Thr Asn Ile Phe Gly Lys Arg Val Phe Ala Thr Thr Arg Ala
165 170 175
His Tyr Phe Asp Phe Ala Gly Phe Leu Lys Leu Glu Thr Lys Ser Gly
180 185 190
Asp Pro Tyr Thr His Leu Leu Thr
195 200
<210> 17
<211> 585
<212> DNA
<213> Treponema pallidum
<220>
<221> CDS
<222> (3)..(584)
<223> Msp6
<220>
<221> primer bind
<222> (1)..(20)
<223> PCR primer S6 binding site
<220>
<221> primer bind
<222> Complement((563)..(585))
<223> PCR primer AS6 binding site
<400> 17
cg cgt ttg acg ctt tcc ccg gga gca gga ttc aag atc gtg tgt gcc 47
Arg Leu Thr Leu Ser Pro Gly Ala Gly Phe Lys Ile Val Cys Ala
CA 02325576 2000-10-10
WO 99/53099 PC'f/US99/07886
-30-
I 5 10 15
ttcgatget gggacaccgtac aagaagggt gccgcgagg gagtccctc 95
PheAspAla GlyThrProTyr LysLysGly AlaAlaArg GluSerLeu
20 25 30
getgaaacg cttgcggcacag cgtggttgt aatcgtttt gacaccgcg 143
AlaGluThr LeuAlaAlaGln ArgGlyCys AsnArgPhe AspThrAla
35 40 45
ctcatgcac gcgcttgggtta cttgttget getgcgaag acacgcaat 191
LeuMetHis AlaLeuGlyLeu LeuValAla AlaAlaLys ThrArgAsn
50 55 60
gaactcgcc gcacagatgcga tcgcagtca ccaccaggt gtgtgggaa 239
GluLeuAla AlaGlnMetArg SerGlnSer ProProGly ValTrpGlu
65 70 75
aaatttgaa caggcggtgcaa tcgttacct cctataacg cagggaaag 287
LysPheGlu GlnAlaValGln SerLeuPro ProIleThr GlnGlyLys
80 85 90 95
cctggcgtc gttggggcggag gtccgcccg ggtacgatg tggatggaa 335
ProGlyVal ValGlyAlaGlu ValArgPro GlyThrMet TrpMetGlu
100 105 110
ctttccccg gtaaggaaagca cttgtcgat gtactttct gtacttgag 383
LeuSerPro ValArgLysAla LeuValAsp ValLeuSer ValLeuGlu
115 120 125
cagggtggt tttgatcgtgtc gcctttgac gcattgctg attgtgcaa 431
GlnGlyGly PheAspArgVal AlaPheAsp AlaLeuLeu IleValGln
130 135 140
tggcgctgg atttcgctggga gcatacgta gcaagtget cctaccaat 479
TrpArgTrp IleSerLeuGly AlaTyrVal AlaSerAla ProThrAsn
145 150 155
gtgtttggc tcaatgcttttt ccgcgtggg agtagtgac cattttgac 527
ValPheGly SerMetLeuPhe ProArgGly SerSerAsp HisPheAsp
160 165 170 175
tgtgccgca ttcgtgcgggtg gaaagtaag tggtacgat tctctttct 575
CysAlaAla PheValArgVal GluSerLys TrpTyrAsp SerLeuSer
180 185 190
aagcttgtg t 585
LysLeuVal
<210> 8
1
<211> 94
I
<212>
PRT
<213> reponema pallidum
T
<400> 18
Arg Leu Thr Leu Ser Pro Gly Ala Gly Phe Lys Ile Val Cys Ala Phe
CA 02325576 2000-10-10
WO 99/53099 PCTNS99/07886
-31-
1 5 10 15
Asp Ala Gly Thr Pro Tyr Lys Lys Gly Ala Ala Arg Glu Ser Leu Ala
20 25 30
Glu Thr Leu Ala Ala Gln Arg Gly Cys Asn Arg Phe Asp Thr Ala Leu
35 40 45
Met His Ala Leu Gly Leu Leu Val Ala Ala Ala Lys Thr Arg Asn Glu
50 55 60
Leu Ala Ala Gln Met Arg Ser Gln Ser Pro Pro Gly Val Trp Glu Lys
65 70 75 80
Phe Glu Gln Ala Val Gln Ser Leu Pro Pro Ile Thr Gln Gly Lys Pro
85 90 95
Gly Val Val Gly Ala Glu Val Arg Pro Gly Thr Met Trp Met Glu Leu
100 105 110
Ser Pro Val Arg Lys Ala Leu Val Asp Val Leu Ser Val Leu Glu Gln
115 120 125
Gly Gly Phe Asp Arg Val Ala Phe Asp Ala Leu Leu Ile Val Gln Trp
130 135 140
Arg Trp Ile Ser Leu Gly Ala Tyr Val Ala Ser Ala Pro Thr Asn Val
145 150 155 160
Phe Gly Ser Met Leu Phe Pro Arg Gly Ser Ser Asp His Phe Asp Cys
165 170 175
Ala Ala Phe Val Arg Val Glu Ser Lys Trp Tyr Asp Ser Leu Ser Lys
180 185 190
Leu Val
<210> 19
<211> 1062
<212> DNA
<213> Treponema pallidum
<220>
<221> CDS
<222> (2)..(514)
<223> Msp7A
<220>
<221> CDS
<222> (515)..(1060)
<223> MspB
<220>
<221> primer bind
<222> (1)..(22)
<223> PCR primer S7 binding site
CA 02325576 2000-10-10
WO 99/53099 PCT/US99/07886
-32-
<220>
<221> primer bind
<222> Complement((1042)..(1062))
<223> PCR primer AS7 binding site
<400> 19
c ttt ttc tcg ctg acg ctt tgt cca ccg aaa act cgg tcg aat ctg cat 49
Phe Phe Ser Leu Thr Leu Cys Pro Pro Lys Thr Arg Ser Asn Leu His
1 5 10 15
aaa agc agc ggt gtg tat gca gaa atc ctg tta agg aac cta gag tgt 97
Lys Ser Ser Gly Val Tyr Ala Glu Ile Leu Leu Arg Asn Leu Glu Cys
20 25 30
gcg ctc ccc ctc ggt tcc tta tct ggt gag get tta ggc gaa ctc acg 145
Ala Leu Pro Leu Gly Ser Leu Ser Gly Glu Ala Leu Gly Glu Leu Thr
35 40 45
ccc aca gaa aaa caa agc ttc tcc gta gaa gcg acc ctt cgc ttc tac 193
Pro Thr Glu Lys Gln Ser Phe Ser Val Glu Ala Thr Leu Arg Phe Tyr
50 55 60
ggc gca tat ctc act att gga aaa aat ccg acc ttt tct aaa aat ttt 241
Gly Ala Tyr Leu Thr Ile Gly Lys Asn Pro Thr Phe Ser Lys Asn Phe
65 70 75 80
gcc aaa ttg tgg ccc ccg ttc atc acc aca cga tac aag gaa gca gac 289
Ala Lys Leu Trp Pro Pro Phe Ile Thr Thr Arg Tyr Lys Glu Ala Aap
85 90 95
acc caa tac gcc cct ggc ttt ggg ggt tat gga ggg aag att ggt tac 337
Thr Gln Tyr Ala Pro Gly Phe Gly Gly Tyr Gly Gly Lys Ile Gly Tyr
100 105 110
cgc gta gaa gac gtc ggg aat tcc ggg cta ggt ttt gac ttt ggg ttc 385
Arg Val Glu Asp Val Gly Asn Ser Gly Leu Gly Phe Asp Phe Gly Phe
115 120 125
ctt tcc ttc get tca aac ggc gac tgg agc acg agc ggg act agc cat 433
Leu Ser Phe Ala Ser Asn Gly Asp Trp Ser Thr Ser Gly Thr Ser His
130 135 140
agc aaa tat ggg ttt ggt agt gac ctc tct atg gta caa gag aaa caa 481
Ser Lys Tyr Gly Phe Gly Ser Asp Leu Ser Met Val Gln Glu Lys Gln
145 150 155 160
gaa get gtt ttt aac tgt gga act cgc cgg taa atg ggt ttg gta gtg 529
Glu Ala Val Phe Asn Cys Gly Thr Arg Arg Met Gly Leu Val Val
165 170 175
acc tct cta tgg tac aag aga aac aag aag ctg ttt tta act gtg gaa 577
Thr Ser Leu Trp Tyr Lys Arg Asn Lys Lys Leu Phe Leu Thr Val Glu
180 185 190
ctc gcc ggt aat get acc ctc cag gag ggt tat gcc acg tta get cca 625
Leu Ala Gly Asn Ala Thr Leu Gln Glu Gly Tyr Ala Thr Leu Ala Pro
195 200 205
CA 02325576 2000-10-10
WO 99/53099 PCT/US99/07886
-33-
acattttcg ggagcaccc aacaacaaacgg gcatcccac gcgctctta 673
ThrPheSer GlyAlaPro AsnAsnLysArg AlaSerHis AlaLeuLeu
210 215 220
tggagtgtg ggagggcgt ctttcgatcatg c.ctggtgca ggattccgc 721
TrpSerVal GlyGlyArg LeuSerIleMet ProGlyAla GlyPheArg
225 230 235 240
ttcatttta getacggat gccggaaatacc taccgggat acgaacagt 769
PheIleLeu AlaThrAsp AlaGlyAsnThr TyrArgAsp ThrAsnSer
245 250 255
gcgagagca cgtgtcgtc gaacaggcacta gaactcgcg gagaagacg 817
AlaArgAla ArgValVal GluGlnAlaLeu GluLeuAla GluLysThr
260 265 270
tatccgtca ttacggacg gtgcgtcgtata ttcagctgg atggtacag 865
TyrProSer LeuArgThr ValArgArgIle PheSerTrp MetValGln
275 280 285
cacgtggac tcattaggc atagacgcgctg gttacagcg cagtggcgt 913
HisValAsp SerLeuGly IleAspAlaLeu ValThrAla GlnTrpArg
290 295 300
tggctttca ggaggtgta tacggcgcaaca ggggcggcg tctgttttt 961
TrpLeuSer GlyGlyVal TyrGlyAlaThr GlyAlaAla SerValPhe
305 310 315 320
gggagtggt ccctttgta aagtcaactttt caatacacg gactttget 1009
GlySerGly ProPheVal LysSerThrPhe GlnTyrThr AspPheAla
325 330 335
gcgtttctc agactagaa actcgttcggga gatgattac acccatgcc 1057
AlaPheLeu ArgLeuGlu ThrArgSerGly AspAspTyr ThrHisAla
340 395 350
ttgca 1062
Leu
<210>
20
<211>
170
<212>
PRT
<213> pallidum
Treponema
<400>
20
Phe Phe Leu Thr Leu ProProLys Thr Arg Ser Leu
Ser Cys Asn His
1 5 10 15
Lys Ser Gly Val Tyr GluIleLeu Leu Arg Asn Glu
Ser Ala Leu Cys
20 25 30
Ala Leu Leu Gly Ser SerGlyGlu Ala Leu Gly Leu
Pro Leu Glu Thr
35 40 45
Pro Thr Glu Lys Gln Ser Phe Ser Val Glu Ala Thr Leu Arg Phe Tyr
CA 02325576 2000-10-10
WO 99/53099 PCT/US99/07886
-34-
50 55 60
Gly Ala Tyr Leu Thr Ile Gly Lys Asn Pro Thr Phe Ser Lys Asn Phe
65 70 75 BO
Ala Lys Leu Trp Pro Pro Phe Ile Thr Thr Arg Tyr Lys Glu Ala Asp
85 90 95
Thr Gln Tyr Ala Pro Gly Phe Gly Gly Tyr Gly Gly Lys Ile Gly Tyr
100 105 110
Arg Val Glu Asp Val Gly Asn Ser Gly Leu Gly Phe Asp Phe Gly Phe
115 120 125
Leu Ser Phe Ala Ser Asn Gly Asp Trp Ser Thr Ser Gly Thr Ser His
130 135 140
Ser Lys Tyr Gly Phe Gly Ser Asp Leu Ser Met Val Gln Glu Lys Gln
195 150 155 160
Glu Ala Val Phe Asn Cys Gly Thr Arg Arg
165 170
<210> 21
<211> 182
<212> PRT
<213> Treponemapallidum
<400> 21
Met Gly Leu ValThr SerLeuTrp LysArg Asn Lys Leu
Val Tyr Lys
1 5 10 15
Phe Leu Thr GluLeu AlaGlyAsn ThrLeu Gln Gly Tyr
Val Ala Glu
20 25 30
Ala Thr Leu ProThr PheSerGly ProAsn Asn Arg Ala
Ala Ala Lys
35 40 45
Ser His Ala LeuTrp SerValGly ArgLeu Ser Met Pro
Leu Gly Ile
50 55 60
Gly Ala Gly ArgPhe IleLeuAla AspAla Gly Thr Tyr
Phe Thr Asn
65 70 75 80
Arg Asp Thr SerAla ArgAlaArg ValGlu Gln Leu Glu
Asn Val Ala
85 90 95
Leu Ala Glu ThrTyr ProSerLeu ThrVal Arg Ile Phe
Lys Arg Arg
100 105 110
Ser Trp Met GlnHis ValAspSer GlyIle Asp Leu Val
Val Leu Ala
115 120 125
Thr Ala Gln ArgTrp LeuSerGly ValTyr Gly Thr Gly
Trp Gly Ala
130 135 140
Ala Ala Ser PheGly SerGlyPro ValLys Ser Phe Gln
Val Phe Thr
CA 02325576 2000-10-10
WO 99/53099 PCT/US99/07886
-35-
145 150 155 160
Tyr Thr Asp Phe Ala Ala Phe Leu Arg Leu Glu Thr Arg Ser Gly Asp
165 170 175
Asp Tyr Thr His Ala Leu
180
<210> 22
<211> 537
<212> DNA
<213> Treponemapallidum
<220>
<221> CDS
<222> (1)..(537)
<223> MspB
<220>
<221> primer
bind
<222> (1)..(18)
<223> PCR bindingsite
primer S8
<220>
<221> primer
bind
<222> Complement((516).. (531))
<223> PCR binding site
primer AS8
<400> 22
cgg ctg acg accccg gggtacggg tttcggctc gtgctggcg ctt 48
ctg
Arg Leu Thr ThrPro GlyTyrGly PheArgLeu ValLeuAla Leu
Leu
I 5 10 15
gat gtg gga attcac cggagcgac gcggatata gggaagacg gta 96
aac
Asp Val Gly IleHis ArgSerAsp AlaAspIle GlyLysThr Val
Asn
20 25 30
aac gtg cag aaggcg gcagaagcc gtaagtgca gcggtaacc gaa I44
gcc
Asn Val Gln LysAla AlaGluAla ValSerAla AlaValThr Glu
Ala
35 40 45
ttt tgg gca gtggcc cagataatg gccaacggt ggcgtcgga gag 192
caa
Phe Trp Ala ValAla GlnIleMet AlaAsnGly GlyValGly Glu
Gln
50 55 60
ttt ttt gtc aaagtg cggggcget gccctcata gcgcaagtg gca 240
aaa
Phe Phe Val LysVal ArgGlyAla AlaLeuIle AlaGlnVal Ala
Lys
65 70 75 80
ctg gtg gtt catttg gaaggaaaa ctctccaat ctacttcag agc 288
tcc
Leu Val Val HisLeu GluGlyLys LeuSerAsn LeuLeuGln Ser
Ser
85 90 95
aca ctg ggc ggagcg gtggtaaac cagctcacc cagggattc gcc 336
ctg
Thr Leu Gly GlyAla ValValAsn GlnLeuThr GlnGlyPhe.pla
Leu
100 105 110
CA 02325576 2000-10-10
WO 99/53099 PCT/US99/07886
-36-
gagctcctt aaaaagccggac ccggccatt gcgctcgtc acgttc ttt 384
GluLeuLeu LysLysProAsp ProAlaIle AlaLeuVal ThrPhe Phe
115 120 125
gcgtggctg caccgcctgcac gtgcacgag ttgggcget gacgcc ttg 432
AlaTrpLeu HisArgLeuHis ValHisGlu LeuGlyAla AspAla Leu
130 135 140
ctgagcatg cagtggaagtgg ctttcttcc ggcgcgtat tttgcc acc 480
LeuSerMet GlnTrpLysTrp LeuSerSer GlyAlaTyr PheAla Thr
145 150 155 160
gccggcgcc aatatgtttggc aagcgcgtc ttttccagg cagctt aca 528
AlaGlyAla AsnMetPheGly LysArgVal PheSerArg GlnLeu Thr
165 170 175
gactacttg 537
AspTyrLeu
<210> 23
<211> 179
<212> PRT
<213> Treponema pallidum
<400> 23
Arg Leu LeuThrPro GlyTyrGly ArgLeu LeuAla Leu
Thr Phe Val
1 5 10 15
Asp Val AsnIleHis ArgSerAsp AspIle LysThr Val
Gly Ala Gly
20 25 30
Asn Val AlaLysAla AlaGluAla SerAla ValThr Glu
Gln Val Ala
35 40 45
Phe Trp GlnValAla GlnIleMet AsnGly ValGly Glu
Ala Ala Gly
50 55 60
Phe Phe LysLysVal ArgGlyAla LeuIle GlnVal Ala
Val Ala Ala
65 70 75 80
Leu Val SerHisLeu GluGlyLys SerAsn LeuGln Ser
Val Leu Leu
85 90 95
Thr Leu LeuGlyAla ValValAsn LeuThr GlyPhe Ala
Gly Gln Gln
100 105 110
Glu Leu LysLysPro AspProAla AlaLeu ThrPhe Phe
Leu Ile Val
115 120 125
Ala Trp HisArgLeu HisValHis LeuGly AspAla Leu
Leu Glu Ala
130 135 140
Leu Ser GlnTrpLys TrpLeuSer GlyAla PheAla Thr
Met Ser Tyr
145 150 155 160
Ala Gly AsnMetPhe GlyLysArg PheSer GlnLeu Thr
Ala Val Arg
CA 02325576 2000-10-10
WO 99/53099 PCT/US99/07886
-37-
165 170 175
Asp Tyr Leu
<210> 24
<211> 94B
<212> DNA
<213> Treponema pallidum
<220>
<221> CDS
<222> (3)..(997)
<223> Msp9
<220>
<221> primer bind
<222> (1)..(23)
<223> PCR primer S9 binding site
<220>
<221> primer bind
<222> Complement((927)..(948))
<223> PCR primer AS9 binding
site
<220>
<221> misc
feature
_
<222> (40)
<223> DNA sequence uncertain
<220>
<221> misc
feature
_
<222> (41)
<223> DNA sequence uncertain
<220>
<221> misc
feature
_
<222> (45)
<223> DNA sequence uncertain
<220>
<221> misc
feature
_
<222> (51)
<223> DNA sequence uncertain
<220>
<221> misc feature
<222> (831)
<223> DNA sequence uncertain
<400> 24
at att gaa ggc tat gcg gag ctg ggc att gca tnn gaa nat
gcc tgg 47
Ile Glu Gly Tyr Ala Glu Leu Ala Gly Ile Ala Xaa Glu Xaa
Trp
1 5 10 15
ggt ngc gcc gga aac ctc aag cat aag act act act gat ttt
gga ttt 95
Gly Xaa Ala Gly Asn Leu Lys His Lys Thr Thr Thr Asp Phe
Gly Phe
CA 02325576 2000-10-10
WO 99/53099 PCT/US99/07886
-38-
20 25 30
aag att gtg ttc ccc att gtg gca aag aag gat ttc aag tac cgc ggt 143
Lys Ile Val Phe Pro Ile Val Ala Lys Lys Asp Phe Lys Tyr Arg Gly
35 90 45
gag ggg aat gtc tat gcg gaa att aat gtt aaa gcg ttg aag ttg agt 191
Glu Gly Asn Val Tyr Ala Glu Ile Asn Val Lys Ala Leu Lys Leu Ser
50 55 60
tta gag tca aat ggt gga gca aag ttt gac acg aag ggt tct gca aag 239
Leu Glu Ser Asn Gly Gly Ala Lys Phe Asp Thr Lys Gly Ser Ala Lys
65 70 75
acg ata gag gca acc ctg cac tgt tat ggg gcc tac ctg acc att ggg 287
Thr Ile Glu Ala Thr Leu His Cys Tyr Gly Ala Tyr Leu Thr Ile Gly
80 85 90 95
aag aat cct gat ttt aag tca acg ttt get gtt ttg tgg gag ccg tgg 335
Lys Asn Pro Asp Phe Lys Ser Thr Phe Ala Val Leu Trp Glu Pro Trp
100 105 110
acc gcg aat ggg gat tat aag tct aag gga gat aag ccg gtg tat gag 383
Thr Ala Asn Gly Asp Tyr Lys Ser Lys Gly Asp Lys Pro Val Tyr Glu
115 120 125
ccg ggg ttt gag gga gcc ggg gga aag tta ggg tat aaa cag act gac 431
Pro Gly Phe Glu Gly Ala Gly Gly Lys Leu Gly Tyr Lys Gln Thr Asp
130 135 140
atc gcc ggc acg ggg ctc acg ttt gat att gcg ttt aag ttt gcg tct 479
Ile Ala Gly Thr Gly Leu Thr Phe Asp Ile Ala Phe Lys Phe Ala Ser
145 150 155
aac acc gac tgg gag ggc aaa gac agc aag ggc aac gtc cca gca gga 52?
Asn Thr Asp Trp Glu Gly Lys Asp Ser Lys Gly Asn Val Pro Ala Gly
160 165 170 175
gta acc ccc agc aag tat gga ttg ggg gga gat att ttg ttc ggc tgg 575
Val Thr Pro Ser Lys Tyr Gly Leu Gly Gly Asp Ile Leu Phe Gly Trp
180 185 190
gag cgt acg cgt gaa gat ggc gtg cag gaa tac att aaa gtg gag ctc 623
Glu Arg Thr Arg Glu Asp Gly Val Gln Glu Tyr Ile Lys Val Glu Leu
195 200 205
acc ggc aac tcc aca ctg tct agc gac tat gcc caa gcc cga gcc ctg 671
Thr Gly Asn Ser Thr Leu Ser Ser Asp Tyr Ala Gln Ala Arg Ala Leu
210 215 220
gca gcc ggg get aag gtg agt atg aag ctt tgg ggt ctg tgt get ctg 719
Ala Ala Gly Ala Lys Val Ser Met Lys Leu Trp Gly Leu Cys Ala Leu
225 230 235
get get aca gac gtg ggg cat aag aaa aac gga gcg cag ggc acc gta 767
Ala Ala Thr Asp Val Gly His Lys Lys Asn Gly Ala Gln Gly Thr Val
240 245 250 255
CA 02325576 2000-10-10
WO 99/53099 PCT/US99/07886
-39-
ggcgcagatgcg ttgttgacg ttggggtat cgttggttc tcggcggga 815
GlyAlaAspAla LeuLeuThr LeuGlyTyr ArgTrpPhe SerAlaGly
260 265 270
ggatatttcgca tcgnaggcc agcaatgta ttcggggga gtatttctc 863
GlyTyrPheAla SerXaaAla SerAsnVal PheGlyGly ValPheLeu
275 280 285
aacatggccatg cgagagcac gactgtget gcctatatt aagctcgaa 911
AsnMetAlaMet ArgGluHis AspCysAla AlaTyrIle LysLeuGlu
290 295 300
accaaggggtct gatcctgat acttctttc cttgagg 948
ThrLysGlySer AspProAsp ThrSerPhe LeuGlu
305 310 315
<210> 25
<211> 315
<212> PRT
<213> Treponema pallidum
<220>
<221> Unsure
<222> (13)
<223> DNA sequence uncertain
<220>
<221> Unsure
<222> (15)
<223> DNA sequence uncertain
<220>
<221> Unsure
<222> (17)
<223> DNA sequence uncertain
<220>
<221> Unsure
<222> (277)
<223> DNA sequence uncertain
<400> 25
Ile Glu Gly Tyr Ala Glu Leu Ala Trp Gly Ile Ala Xaa Glu Xaa Gly
1 5 10 15
Xaa Ala Gly Asn Leu Lys His Gly Phe Lys Thr Thr Thr Asp Phe Lys
20 25 30
Ile Val Phe Pro Ile Val Ala Lys Lys Asp Phe Lys Tyr Arg Gly Glu
35 40 45
Gly Asn Val Tyr Ala Glu Ile Asn Val Lys Ala Leu Lys Leu Ser Leu
50 55 60
Glu Ser Asn Gly Gly Ala Lys Phe Asp Thr Lys Gly Ser Ala Lys Thr
65 70 75 80
CA 02325576 2000-10-10
WO 99/53099 PCT/US99/07886
-40-
Ile Glu Ala Thr Leu His Cys Tyr Gly Ala Tyr Leu Thr Ile Gly Lys
85 90 95
Asn Pro Asp Phe Lys Ser Thr Phe Ala Val Leu Trp Glu Pro Trp Thr
100 105 110
Ala Asn Gly Asp Tyr Lys Ser Lys Gly Asp Lys Pro Val Tyr Glu Pro
115 120 125
Gly Phe Glu Gly Ala Gly Gly Lys Leu Gly Tyr Lys Gln Thr Asp Ile
130 135 140
Ala Gly Thr Gly Leu Thr Phe Asp Ile Ala Phe Lys Phe Ala Ser Asn
145 150 155 160
Thr Asp Trp Glu Gly Lys Asp Ser Lys Gly Asn Val Pro Ala Gly Val
165 170 175
Thr Pro Ser Lys Tyr Gly Leu Gly Gly Asp Ile Leu Phe Gly Trp Glu
180 185 190
Arg Thr Arg Glu Asp Gly Val Gln Glu Tyr Ile Lys Val Glu Leu Thr
195 200 205
Gly Asn Ser Thr Leu Ser Ser Asp Tyr Ala Gln Ala Arg Ala Leu Ala
210 215 220
Ala Gly Ala Lys Val Ser Met Lys Leu Trp Gly Leu Cys Ala Leu Ala
225 230 235 240
Ala Thr Asp Val Gly His Lys Lys Asn Gly Ala Gln Gly Thr Val Gly
245 250 255
Ala Asp Ala Leu Leu Thr Leu Gly Tyr Arg Trp Phe Ser Ala Gly Gly
260 265 270
Tyr Phe Ala Ser Xaa Ala Ser Asn Val Phe Gly Gly Val Phe Leu Asn
275 280 285
Met Ala Met Arg Glu His Asp Cys Ala Ala Tyr Ile Lys Leu Glu Thr
290 295 300
Lys Gly Ser Asp Pro Asp Thr Ser Phe Leu Glu
305 310 315
<210> 26
<211> 1035
<212> DNA
<213> Treponema pallidum
<220>
<221> CDS
<222> (1)..(1035)
<223> MsplO
<220>
CA 02325576 2000-10-10
WO 99/53099 PCT/US99/07886
-41-
<221> primer bind
<222> (1)..(18)
<223> PCR primer S1 binding site
<220>
<221> primer bind
<222> Complement((1017)..(1035))
<223> PCR primer AS1 binding site
<400> 26
cga ctc acc ctc gaa cca ggc gcc ggc ttc cgc ttc tcc ttc gcc ctc 98
Arg Leu Thr Leu Glu Pro Gly Ala Gly Phe Arg Phe Ser Phe Ala Leu
1 5 10 15
gac gcc ggt aac caa cac cag agt gca cag gac ttt caa aat cgc aca 96
Asp Ala Gly Asn Gln His Gln Ser Ala Gln Asp Phe Gln Asn Arg Thr
20 25 30
cag agg gcg cag agt gaa ctc acc gcc ctc tca aat aac ctc ttc cag 144
Gln Arg Ala Gln Ser Glu Leu Thr Ala Leu Ser Asn Asn Leu Phe Gln
35 40 45
gga gaa agt caa aaa cag gaa gcc tgg gta acc cag gta gtg caa cag 192
Gly Glu Ser Gln Lys Gln Glu Ala Trp Val Thr Gln Val Val Gln Gln
50 55 60
gcg acg cag aca gta acg get gga gtt cga agc gcg ctg gaa tct cgg 240
Ala Thr Gln Thr Val Thr Ala Gly Val Arg Ser Ala Leu Glu Ser Arg
65 70 75 80
ggg act acg tac ata aac gcg cta gag gca gtt cag cct aat cct get 288
Gly Thr Thr Tyr Ile Asn Ala Leu Glu Ala Val Gln Pro Asn Pro Ala
85 90 95
aaa cct acc ggt aag gtt gtg caa aat ctt cac acc ccg cag gga agt 336
Lys Pro Thr Gly Lys Val Val Gln Asn Leu His Thr Pro Gln Gly Ser
100 105 110
ccg ccg aac ctg ccg ccg ctt cct gca ctt cct gca ttt tcc ctg atg 384
Pro Pro Asn Leu Pro Pro Leu Pro Ala Leu Pro Ala Phe Ser Leu Met
115 120 125
ggg cag gtt ttg ctg cag tac gat gcg gag cag gtg gtg aag ggg ttt 432
Gly Gln Val Leu Leu Gln Tyr Asp Ala Glu Gln Val Val Lys Gly Phe
130 135 190
gag cag gta cag acg caa atc gtc act gaa att aat cag aaa gtg caa 480
Glu Gln Val Gln Thr Gln Ile Val Thr Glu Ile Asn Gln Lys Val Gln
145 150 155. 160
gcg get gtg gca aaa aat aat gca aac atg caa gcg gtc ggg ggt agt 528
Ala Ala Val Ala Lys Asn Asn Ala Asn Met Gln Ala Val Gly Gly Ser
165 170 175
cta ggc gat act gcg aga atg gta ggc gaa gcg ctc att aag cag caa 576
Leu Gly Asp Thr Ala Arg Met Val Gly Glu Ala Leu Ile Lys Gln Gln
180 185 190
CA 02325576 2000-10-10
WO 99/53099 PCT/US99/07886
-42-
ctatcacgtaag cagaacagcatt ctgaccatg gtgagcgtg caagat 624
LeuSerArgLys GlnAsnSerIle LeuThrMet ValSerVal GlnAsp
195 200 205
gaggtgaaacag gatctggcagat ttagtgccg atgatgcga acggaa 672
GluValLysGln AspLeuAlaAsp LeuValPro MetMetArg ThrGlu
210 215 220
ataacggcgttt ttcgcgagtgtc cagcaacac ataaccgaa gaagtg 720
IleThrAlaPhe PheAlaSerVal GlnGlnHis IleThrGlu GluVal
225 230 235 240
aagaagaagacg gatgcgttgaat gcggggcag cagatacgt cagget 768
LysLysLysThr AspAlaLeuAsn AlaGlyGln GlnIleArg GlnAla
245 250 255
atacagaacctg cgtgcgtctgca tggcgtgcc tttctaatg ggagtc 816
IleGlnAsnLeu ArgAlaSerAla TrpArgAla PheLeuMet GlyVal
260 265 270
agcgccgtgtgt ctgtatcttgac acctacaat gtcgccttc gatgcg 864
SerAlaValCys LeuTyrLeuAsp ThrTyrAsn ValAlaPhe AspAla
275 280 285
ctgtttacggcg cagtggaagtgg ctgtcttct ggcatatac tttgcc 912
LeuPheThrAla GlnTrpLysTrp LeuSerSer GlyIleTyr PheAla
290 295 300
acagcaccggca aacgtttttggc accagggtg ttagataac accatc 960
ThrAlaProAla AsnValPheGly ThrArgVal LeuAspAsn ThrIle
305 310 315 320
gcaagctgtggc gactttgccgga ttccttaag ctcgaaact aagagc 1008
AlaSerCysGly AspPheAlaGly PheLeuLys LeuGluThr LysSer
325 330 335
ggtgacccctac acccacctgctc acc 1035
GlyAspProTyr ThrHisLeuLeu Thr
340 345
<210> 27
<211> 345
<212> PRT
<213> Treponema pallidum
<400> 27
Arg Leu Thr Leu Glu Pro Gly Ala Gly Phe Arg Phe Ser Phe Ala Leu
1 5 10 15
Asp Ala Gly Asn Gln His Gln Ser Ala Gln Asp Phe Gln Asn Arg Thr
20 25 30
Gln Arg AIa Gln Ser Glu Leu Thr Ala Leu Ser Asn Asn Leu Phe Gln
35 40 45
Gly Glu Ser Gln Lys Gln Glu Ala Trp Val Thr Gln Val Val Gln Gln
CA 02325576 2000-10-10
WO 99153099 PCTNS99/07886
-43-
50 55 60
Ala Thr Gln Thr Val Thr Ala Gly Val Arg Ser Ala Leu Glu Ser Arg
65 70 75 80
Gly Thr Thr Tyr Ile Asn Ala Leu Glu Ala Val Gln Pro Asn Pro Ala
85 90 95
Lys Pro Thr Gly Lys Val Val Gln Asn Leu His Thr Pro Gln Gly Ser
100 105 110
Pro Pro Asn Leu Pro Pro Leu Pro Ala Leu Pro Ala Phe Ser Leu Met
115 120 125
Gly Gln Val Leu Leu Gln Tyr Asp Ala Glu Gln Val Val Lys Gly Phe
130 135 140
Glu Gln Val Gln Thr Gln Ile Val Thr Glu Ile Asn Gln Lys Val Gln
145 150 155 160
Ala Ala Val Ala Lys Asn Asn Ala Asn Met Gln Ala Val Gly Gly Ser
165 170 175
Leu Gly Asp Thr Ala Arg Met Val Gly Glu Ala Leu Ile Lys Gln Gln
180 185 190
Leu Ser Arg Lys Gln Asn Ser Ile Leu Thr Met Val Ser Val Gln Asp
195 200 205
Glu Val Lys Gln Asp Leu Ala Asp Leu Val Pro Met Met Arg Thr Glu
210 215 220
Ile Thr Ala Phe Phe Ala Ser Val Gln Gln His Ile Thr Glu Glu Val
225 230 235 240
Lys Lys Lys Thr Asp Ala Leu Asn Ala Gly Gln Gln Ile Arg Gln Ala
245 250 255
Ile Gln Asn Leu Arg Ala Ser Ala Trp Arg Ala Phe Leu Met Gly Val
260 265 270
Ser Ala Val Cys Leu Tyr Leu Asp Thr Tyr Asn Val Ala Phe Asp Ala
275 280 285
Leu Phe Thr Ala Gln Trp Lys Trp Leu Ser Ser Gly Ile Tyr Phe Ala
290 295 300
Thr Ala Pro Ala Asn Val Phe Gly Thr Arg Val Leu Asp Asn Thr Ile
305 310 315 320
Ala Ser Cys Gly Asp Phe Ala Gly Phe Leu Lys Leu Glu Thr Lys Ser
325 330 335
Gly Asp Pro Tyr Thr His Leu Leu Thr
340 345
<210> 28
CA 02325576 2000-10-10
WO 99/53099 PCT/US99/0?886
-44-
<211> 633
<212> DNA
<213> Treponema
pallidum
<220>
<221> CDS
<222> (ly..(633)
<223> Mspll
<220>
<221> primer
bind
<222> (1)..(18y
<223> PCR primerbinding site
S1
<220>
<221> primer
bind
<222> Complement((615)..(633 ))
<223> PCR primer site
AS1 binding
<400> 28
cga ctc acc ctc ccaggc gccggcttc cgcttc tccttcgcc ctc 48
gaa
Arg Leu Thr Leu ProGly AlaGlyPhe ArgPhe SerPheAla Leu
Glu
1 5 10 15
gac gcc ggt aac caccag gaccctgcc gatgca ggtaatcgc ctt 96
caa
Asp Ala Gly Asn HisGln AspProAla AspAla GlyAsnArg Leu
Gln
20 25 30
ctg gca acg ggg tcacgg gagaagttt gacagc gcgttcgat gcc 144
agc
Leu Ala Thr Gly SerArg GluLysPhe AspSer AlaPheAsp Ala
Ser
35 40 45
ctc agg gtg gag taccgt gtaaaggat aagtat cttgaattt ttg 192
caa
Leu Arg Val Glu TyrArg ValLysAsp LysTyr LeuGluPhe Leu
Gln
50 55 60
ctg gga cag atg gagtcc tcgattctc gagcgg gtggggctt gcc 240
gcg
Leu Gly Gln Met GluSer SerIleLeu GluArg ValGlyLeu Ala
Ala
65 ?0 75 80
ctc acg ctg cag ggtacg ctcgtctct acgctg acgaaggtt gcc 288
gac
Leu Thr Leu Gln GlyThr LeuValSer ThrLeu ThrLysVal Ala
Asp
85 90 95
act gat agt gga cggttt atccaaatg gcgttg gtaaaactc ttg 336
gat
Thr Asp Ser Gly ArgPhe IleGlnMet AlaLeu ValLysLeu Leu
Asp
100 105 110
ccc cag agg gcg gcggag cagagacta caggag attgtggcg ccg 384
cag
Pro Gln Arg Ala AlaGlu GlnArgLeu GlnGlu IleValAla Pro
Gln
115 120 125
agt cag tcg gac gtgctt atcatgctg ctaacc tggcttgag cgt 432
atc
Ser Gln Ser Asp ValLeu IleMetLeu LeuThr TrpLeuGlu Arg
Ile
130 135 140
gca cgg ctg gac ttcaat getgatgcg ctgctt acggcgcag tgg 480
cgg
Ala Arg Leu Asp PheAsn AlaAspAla LeuLeu ThrAlaGln Trp
Arg
CA 02325576 2000-10-10
WO 99!53099 PCTNS99/07886
-45-
145 150 155 160
acc tat gtg tcg get gga ctg tat ggg gcg acg gcg ggt acc aat gta 528
Thr Tyr Val Ser Ala Gly Leu Tyr Gly Ala Thr Ala Gly Thr Asn Val
165 170 175
ttt ggt aag cgc gtg ctg cct gcg ctg cgg tcc tgg cat ttt gat ttt 576
Phe Gly Lys Arg Val Leu Pro Ala Leu Arg Ser Trp His Phe Asp Phe
180 185 190
gcc gga ttc ctc aaa ctc gaa acc aaa agc ggt gac ccc tac acc cac 624
Ala Gly Phe Leu Lys Leu Glu Thr Lys Ser Gly Asp Pro Tyr Thr His
195 200 205
ctg ctc acc 633
Leu Leu Thr
210
<210> 29
<211> 211
<212> PRT
<213> Treponema
pallidum
<400> 29
Rrg Leu Thr Leu Pro AlaGly ArgPhe SerPhe Ala
Glu Gly Phe Leu
1 5 10 15
Asp Ala Gly Asn His AspPro AspAla GlyAsn Arg
Gln Gln Ala Leu
20 25 30
Leu Ala Thr Gly Ser GluLys AspSer AlaPhe Asp
Ser Arg Phe Ala
35 40 45
Leu Arg Val Glu Tyr ValLys LysTyr LeuGlu Phe
Gln Arg Asp Leu
50 55 60
Leu Gly Gln Met Glu SerIle GluArg ValGly Leu
Ala Ser Leu Ala
65 70 75 BO
Leu Thr Leu Gln Gly LeuVal ThrLeu ThrLys Val
Asp Thr Ser Ala
85 90 95
Thr Asp Ser Gly Arg IleGln AlaLeu ValLys Leu
Asp Phe Met Leu
100 105 110
Pro Gln Arg Ala Ala GlnArg GlnGlu IleVal Ala
Gln Glu Leu Pro
115 120 125
Ser Gln Ser Asp Val IleMet LeuThr TrpLeu Glu
Ile Leu Leu Arg
130 135 140
Ala Arg Leu Asp Phe AlaAsp LeuLeu ThrAla Gln
Arg Asn Ala Trp
145 150 155 160
Thr Tyr Val Ser Gly TyrGly ThrAla GlyThr Asn
Ala Leu Ala Val
165 170 175
CA 02325576 2000-10-10
WO 99/53099 PCT/US99/07886
-46-
Phe Gly Lys Arg Val Leu Pro Ala Leu Arg Ser Trp His Phe Asp Phe
180 185 190
Ala Gly Phe Leu Lys Leu Glu Thr Lys Ser Gly Asp Pro Tyr Thr His
195 200 205
Leu Leu Thr
210
<210> 30
<211> 542
<212> DNA
<213> Treponema pallidum
<220>
<221> CDS
<222> (3)..(542)
<223> Mspl2
<220>
<221> primer bind
<222> (1)..(19)
<223> PCR primer S12 binding
site
<220>
<221> primer bind
<222> Complement((521)..(542))
<223> PCR primer AS12 binding
site
<400> 30
cg cgc ata acg ctc act 47
cct ctt tcg gac ttc aag
gtg gtg ttg get
Arg Ile Thr Leu Thr Pro
Leu Ser Asp Phe Lys Val
Val Leu Ala
1 5 10 15
ctg gac atg ggt aac cat ggtcgg aaaacg ctcgactat ctt 95
tat gca
Leu Asp Met Gly Asn His GlyArg LysThr LeuAspTyr Leu
Tyr Ala
20 25 30
gcc ccg atc ctt atc gat aaaacc aaggtc acccccgga ggg 143
atg gaa
Ala Pro Ile Leu Ile Asp LysThr LysVal ThrProGly Gly
Met Glu
35 40 45
ccg gtg gcg tat gcc att cgcgtg ttgcag ctgcctgag tac 191
gca cag
Pro Val Ala Tyr Ala Ile ArgVal LeuGln LeuProGlu Tyr
Ala Gln
50 55 60
gcg cag aag ctc gat agt aacgga atgtcc getaacgga tcc 239
gtc aag
Ala Gln Lys Leu Asp Ser AsnGly MetSer AlaAsnGly Ser
Val Lys
65 70 75
tct gtg cgg gat att gca atcgta caagca gaacagacg aac 287
acc aaa
Ser Val Arg Asp Ile Ala IleVal GlnAla GluGlnThr Asn
Thr Lys
gp 85 90 95
ccg aca gtt agt tca aac cttgca gcgctg ttgacagtg ctc 335
ccc ttg
Pro Thr Val Ser Ser Asn LeuAla AlaLeu LeuThrVal Leu
Pro Leu
CA 02325576 2000-10-10
WO 99/53099 PCT/US99/07886
-47-
100 105 110
tgg caa caa gcg ctg gac acc tac gcg ctc gat gca ctc ctg act ctg 383
Trp Gln Gln Ala Leu Asp Thr Tyr Ala Leu Asp Ala Leu Leu Thr Leu
115 120 125
caa tgg cgc tgg ttt gcc tgc ggc gtg tac gtg gcc act get cct gca 431
Gln Trp Arg Trp Phe Ala Cys Gly Val Tyr Val Ala Thr Ala Pro Ala
130 135 140
agc gtg ttt ggg gcc atg gtc ttt cct acg tat ggg agc aca cac acg 479
Ser Val Phe Gly Ala Met Val Phe Pro Thr Tyr Gly Ser Thr Hia Thr
145 150 155
gac ggc ggc ggc ttt ctg cgg gta gaa acc aaa gcg gga gac gcg tat 527
Asp Gly Gly Gly Phe Leu Arg Val Glu Thr Lys Ala Gly Asp Ala Tyr
160 165 170 175
aca cac ctt ata gac 542
Thr His Leu Ile Asp
180
<210> 31
<211> 180
<212> PRT
<213> Treponemapallidum
<400> 31
Arg Ile Thr Thr LeuSer Asp LysValVal LeuAlaLeu
Leu Pro Phe
1 5 10 15
Asp Met Gly His AlaGly Arg ThrLeuAsp TyrLeuAla
Asn Tyr Lys
20 25 30
Pro Ile Leu Asp GluLys Thr ValThrPro GlyGlyPro
Ile Met Lys
35 40 45
Val Ala Tyr Ile GlnArg Val GlnLeuPro GluTyrAla
Ala Ala Leu
50 55 60
Gln Lys Leu Ser LysAsn Gly 5erAlaAsn GlySerSer
Asp Val Met
65 70 75 80
Val Arg Asp Ala LysIle Val AlaGluGln ThrAsnPro
Ile Thr Gln
85 90 95
Thr Val Ser Asn LeuLeu Ala LeuLeuThr ValLeuTrp
Ser Pro Ala
100 105 110
Gln Gln Ala Asp TyrAla Leu A1aLeuLeu ThrLeuGln
Leu Thr Asp
115 120 125
Trp Arg Trp Ala GlyVal Tyr AlaThrAla ProAlaSer
Phe Cys Val
130 135 140
Val Phe Gly Met PhePro Thr GlySerThr HisThrAsp
Ala Val Tyr
CA 02325576 2000-10-10
WO 99/53099 PCTNS99/07886
-48-
145 150 155 160
Gly Gly Gly Phe Leu Arg Val Glu Thr Lys Ala Gly Asp Ala Tyr Thr
165 170 175
His Leu Ile Asp
180
<210> 32
<211> 26
<212> PRT
<213> Treponema pallidum
<220>
<221> DOMAIN
<222> (1)..(26)
<223> Highly conserved amino acid motif of T. pallidum
sub. pallidum Msp genes.
<400> 32
Val Gly Gly Arg Leu Thr Leu Glu Pro Gly Ala Gly Phe Arg Phe Ser
1 5 10 15
Phe Ala Leu Asp Ala Gly Asn Gln His Gln
20 25
<210> 33
<211> 78
<212> DNA
<213> Treponema pallidum
<220>
<221> misc_feature
<222> (1). (78)
<223> Nucleotide sequence encoding conserved T.
pallidum sub. pallidum Msp motif.
<400> 33
gtaggaggcc gactcaccct cgaaccaggc gccggcttcc gcttctcctt cgccctcgac 60
gccggtaacc aacaccag 78
<210> 34
<211> 1705
<212> DNA
<213> Treponema pallidum
<220>
<221> CDS
<222> (1)..(1704)
<223> T. pallidum sub. pertenue Msp homolgue
<400> 34
acc agt cct tcc tgt gtg gtt aac ttt gcc cag ctg tgg aaa ccc ttt 48
Thr Ser Pro Ser Cys Val Val Asn Phe Ala Gln Leu Trp Lys Pro Phe
CA 02325576 2000-10-10
WO 99/53099 PCT/US99/07886
-49-
1 5 10 15
gtcacccgtgcctat tcagaaaag gacactcgc tatgcccct ggtttc 96
ValThrArgAlaTyr SerGluLys AspThrArg TyrAlaPro GlyPhe
20 25 30
tccggctccggggca aaactcggc taccaggcc cacaatgtg ggaaac 144
SerGlySerGlyAla LysLeuGly TyrGlnAla HisAsnVal GlyAsn
35 40 45
agcggagtagatgtg gacatcggt ttcctctcc ttcctttcc aatggt 192
SerGlyValAspVal AspIleGly PheLeuSer PheLeuSer AsnGly
50 55 60
gcctgggatagtact gacaccacg cacagcaag tatggcttc ggggcc 240
AlaTrpAspSerThr AspThrThr HisSerLys TyrGlyPhe GlyAla
65 70 75 80
gatgcaacgctt tcctatggc gtcgaccgt cagcggctg cttacgttg 288
AspAlaThrLeu SerTyrGly ValAspArg GlnArgLeu LeuThrLeu
e5 90 9s
gagctggcaggg aatgccaca ctggagcag cactaccgt aagggtacc 336
GluLeuAlaGly AsnAlaThr LeuGluGln HisTyrArg LysGlyThr
100 105 110
gaagactccacg aacgaaaac aaaacagca ctcctgtgg ggagtagga 384
GluAspSerThr AsnGluAsn LysThrAla LeuLeuTrp GlyValGly
115 120 125
ggccgactcacc ctcgaacca ggcgccggc ttccgcttc tccttcgcc 432
GlyArgLeuThr LeuGluPro GlyAlaGly PheArgPhe SexPheAla
130 135 140
ctcgacgccggt taccaacac cagagtgag getaccgcg gcggtgagg 480
LeuAspAlaGly TyrGlnHis GlnSerGlu AlaThrAla AlaValArg
145 150 155 160
accgaaaggaca cgcgagcgt gcacaggag gttgcactg gcaattttt 528
ThrGluArgThr ArgGluArg AlaGlnGlu ValAlaLeu AlaIlePhe
165 170 175
acgcacgetgcg caggaacag getaaacag gcggetgat acggttggt 576
ThrHisAlaAla GlnGluGln AlaLysGln AlaAlaAsp ThrValGly
180 185 190
agcaccatagat aactcggtg caggtggca agatcagtt attactcag 624
SerThrIleAsp AsnSerVal GlnValAla ArgSerVal IleThrGln
195 200 205
atcgetgaagga gcggtgaag caggcacac gatcagatt aaacgcacc 672
IleAlaGluGly AlaValLys GlnAlaHis AspGlnIle LysArgThr
210 215 220
aatggaacacaa gtagtgaat attgacgtg accgttccg gtgaacgtc 720
AsnGlyThrGln ValValAsn IleAspVal ThrValPro ValAsnVal
225 230 235 240
CA 02325576 2000-10-10
WO 99/53b99 PCTNS99107886
-50-
cgg caa agt cct gtt cgg caa cct gac ttg cct tca ctt acc gca atc 768
Arg Gln Ser Pro Val Arg Gln Pro Asp Leu Pro Ser Leu Thr Ala Ile
245 250 255
gca gcg caa ttg cca aat gta acc aag ctc ttc ttc ctt agt gcc ggg 816
Ala Ala Gln Leu Pro Asn Val Thr Lys Leu Phe Phe Leu Ser Ala Gly
260 265 270
gcg ccc gcc gcg agg ccc att atc ggg cag att act ggc gtg gtg cag 864
Ala Pro Ala Ala Arg Pro Ile Ile Gly Gln Ile Thr Gly Val Val Gln
275 280 285
aac gtt atc acc cag cag gta cag gcc cgg gtt gcg cag tcg acc gcg 912
Asn Val Ile Thr Gln Gln Val Gln Ala Arg Val Ala Gln Ser Thr Ala
290 295 300
gtt gca atc cag caa gtt tct gtg ttc aac cag caa acc gtc get gca 960
Val Ala Ile Gln Gln Val Ser Val Phe Asn Gln Gln Thr Val Ala Ala
305 310 315 320
gaa aaa gcg aat acg caa aag cat acg ata aat ggc aag tca tac gcg 1008
Glu Lys Ala Asn Thr Gln Lys His Thr Ile Asn Gly Lys Ser Tyr Ala
325 330 335
get cat atc ggc tcg ttg gta agt ctc get acc aac agg gcg ctg cct 1056
Ala His Ile Gly Ser Leu Val Ser Leu Ala Thr Asn Arg Ala Leu Pro
340 395 350
act ata caa cag cgt gtt aag caa get gtt cag gaa aat ata cgg agg 1104
Thr Ile Gln Gln Arg Val Lys Gln Ala Val Gln Glu Asn Ile Arg Arg
355 360 365
atc aac get gtg gtg cag caa aaa gcg caa acg ctc acc tct tcc cag 1152
Ile Asn Ala Val Val Gln Gln Lys Ala Gln Thr Leu Thr Ser Ser Gln
370 375 380
gaa ctg gaa aag gca gtg tat tcg ttg ttc gtt ccc acg ttt gaa aac 1200
Glu Leu Glu Lys Ala Val Tyr Ser Leu Phe Val Pro Thr Phe Glu Asn
385 390 395 400
ctg gtg ttg ggt gca ggc gcg ctg ctg get ctt ttg gat atg cgt cag 1248
Leu Val Leu Gly Ala Gly Ala Leu Leu Ala Leu Leu Asp Met Arg Gln
405 410 415
att gcg gtg gac gcg ctg ttt aca gcg cag tgg aag tgg ctg tct tct 1296
Ile Ala Val Asp Ala Leu Phe Thr Ala Gln Trp Lys Trp Leu Ser Ser
420 425 930
ggc ata tac ttt gcc aca gca ccg gca aac gtt ttt ggc acc agg gtg 1344
Gly Ile Tyr Phe Ala Thr Ala Pro Ala Asn Val Phe Gly Thr Arg Val
435 440 445
tta gat aac acc att gca agc tgt ggc gac ttt gcc gga ttc ctt aag 1392
Leu Asp Asn Thr Ile Ala Ser Cys Gly Asp Phe Ala Gly Phe Leu Lys
450 455 460
ctc gaa act aag agc ggt gac ccc tac acc cac ctg ctc acc ggc ttg 1440
CA 02325576 2000-10-10
WO 99/53099 PCT/US99/07886
-51-
LeuGluThrLys SerGly Pro TyrThrHis LeuLeu ThrGlyLeu
Asp
465 470 475 980
gacgccggcgtt gaaacacgcatg tacatcccc ctcacc tatgcgcta 1488
AspAlaGlyVal GluThrArgMet TyrIlePro LeuThr TyrAlaLeu
485 490 995
tacaaaaataac ggggggacgget gtgcgtggc attcag gaaaaggag 1536
TyrLysAsnAsn GlyGlyThrAla ValArgGly IleGln GluLysGlu
500 505 510
tatatccgtcca ccggtggtgggg aaggcgtgg tgtagc tatcgcatc 1589
TyrIleArgPro ProValValGly LysAlaTrp CysSer TyrArgIle
515 520 525
ccggtgcaggat tacggctgggtg aagccaagc gttacg gtccatgcc 1632
ProValGlnAsp TyrGlyTrpVal LysProSer ValThr ValHisAla
530 535 540
tctaccaaccgt gcacacctgaat gcccctget gcaggc ggagcagta 1680
SerThrAsnArg AlaHisLeuAsn AlaProAla AlaGly GlyAlaVal
545 550 555 560
ggagetacctat ctaaccaaggag t 1705
GlyAlaThrTyr LeuThrLysGlu
565
<210> 35
<211> 568
<212> PRT
<213> Treponema pallidum
<400> 35
Thr Ser Pro Ser Cys Val Val Asn Phe Ala Gln Leu Trp Lys Pro Phe
1 5 10 15
Val Thr Arg Ala Tyr Ser Glu Lys Asp Thr Arg Tyr Ala Pro Gly Phe
20 25 30
Ser Gly Ser Gly Ala Lys Leu Gly Tyr Gln Ala His Asn Val Gly Asn
35 40 45
Ser Gly Val Asp Val Asp Ile Gly Phe Leu Ser Phe Leu Ser Asn Gly
50 55 60
Ala Trp Asp Ser Thr Asp Thr Thr His Ser Lys Tyr Gly Phe Gly Ala
65 70 75 80
Asp Ala Thr Leu Ser Tyr Gly Val Asp Arg Gln Arg Leu Leu Thr Leu
85 90 95
Glu Leu Ala Gly Asn Ala Thr Leu Glu Gln His Tyr Arg Lys Gly Thr
100 105 110
Glu Asp Ser Thr Asn Glu Asn Lys Thr Ala Leu Leu Trp Gly Val Gly
115 120 125
CA 02325576 2000-10-10
WO 99/53099 PCT/US99/07886
-52-
Gly Arg Leu Thr Leu Glu Pro Gly Ala Gly Phe Arg Phe Ser Phe Ala
130 135 140
Leu Asp Ala Gly Tyr Gln His Gln Ser Glu Ala Thr Ala Ala Val Arg
145 150 155 160
Thr Glu Arg Thr Arg Glu Arg Ala Gln Glu Val Ala Leu Ala Ile Phe
165 170 175
Thr His Ala Ala Gln Glu Gln Ala Lys Gln Ala Ala Asp Thr Val Gly
180 185 190
Ser Thr Ile Asp Asn Ser Val Gln Val Ala Arg Ser Val Ile Thr Gln
195 200 205
Ile Ala Glu Gly Ala Val Lys Gln Ala His Asp Gln Ile Lys Arg Thr
210 215 220
Asn Gly Thr Gln Val Val Asn Ile Asp Val Thr Val Pro Val Asn Val
225 230 235 240
Arg Gln Ser Pro Val Arg Gln Pro Asp Leu Pro Ser Leu Thr Ala Ile
245 250 255
Ala Ala Gln Leu Pro Asn Val Thr Lys Leu Phe Phe Leu Ser Ala Gly
260 265 270
Ala Pro Ala Ala Arg Pro Ile Ile Gly Gln Ile Thr Gly Val Val Gln
275 280 285
Asn Val Ile Thr Gln Gln Val Gln Ala Arg Val Ala Gln Ser Thr Ala
290 295 300
Val Ala Ile Gln Gln Val Ser Val Phe Asn Gln Gln Thr Val Ala Ala
305 310 315 320
Glu Lys Ala Asn Thr Gln Lys His Thr Ile Asn Gly Lys Ser Tyr Ala
325 330 335
Ala His Ile Gly Ser Leu Val Ser Leu Ala Thr Asn Arg Ala Leu Pro
340 345 350
Thr Ile Gln Gln Arg Val Lys Gln Ala Val Gln Glu Asn Ile Arg Arg
355 360 365
Ile Asn Ala Val Val Gln Gln Lys Ala Gln Thr Leu Thr Ser Ser Gln
370 375 380
Glu Leu Glu Lys Ala Val Tyr Ser Leu Phe Val Pro Thr Phe Glu Asn
385 390 395 400
Leu Val Leu Gly Ala Gly Ala Leu Leu Ala Leu Leu Asp Met Arg Gln
405 410 415
Ile Ala Val Asp Ala Leu Phe Thr Ala Gln Trp Lys Trp Leu Ser Ser
420 425 430
CA 02325576 2000-10-10
WO 99/53099 PCTNS99/07886
-53-
GlyIleTyr Thr Pro PheGly Thr
Phe Ala Ala Arg
Ala Asn Val
Val
435 490 445
LeuAspAsn IleAlaSer CysGly PheAlaGly Phe Lys
Thr Asp Leu
450 455 460
LeuGluThr SerGlyAsp ProTyr HisLeuLeu Thr Leu
Lys Thr Gly
465 470 475 480
AspAlaGly GluThrArg MetTyr ProLeuThr Tyr Leu
Val Ile Ala
4B5 490 495
TyrLysAsn GlyGlyThr AlaVal GlyIleGln Glu Glu
Asn Arg Lys
500 505 510
TyrIleArg ProValVal GlyLys TrpCysSer Tyr Ile
Pro Ala Arg
515 520 525
ProValGln TyrGlyTrp ValLys SerValThr Val Ala
Asp Pro His
530 535 540
SerThrAsn AlaHisLeu AsnAla AlaAlaGly Gly Val
Arg Pro Ala
545 550 555 560
Gly~u Thr LeuThrLys Glu
Tyr
565
<210> 36
<211> 1291
<212> DNA
<213> Treponemapallidum
<220>
<221> CDS
<222> (1)..(1290)
<223> T, Msphomologue
pallidum encoded
sub. pertenue by
1.3(1) KB fragment.
<900> 36
acc agt cct tgt gttaac tttgcccag ctgtggaaa cccttt 48
tcc gtg
Thr Ser Pro Cys ValAsn PheAlaGln LeuTrpLys ProPhe
Ser Val
1 5 10 15
gtc acc cgt tat gaaaag gacactcgc tatgcccct ggtttc 96
gcc tca
Val Thr Arg Tyr GluLys AspThrArg TyrAlaPro GlyPhe
Ala Ser
20 25 30
tcc ggc tcc gca ctcggc taccaggcc cacaatgtg ggaaac 144
ggg aaa
Ser Gly Ser Ala LeuGly TyrGlnAla HisAsnVal GlyAsn
Gly Lys
35 40 45
agc gga gta gtg atcggt ttcctctcc ttcctttcc aatggt 192
gat gac
Ser Gly Val Val IleGly PheLeuSer PheLeuSer AsnGly
Asp Asp
50 55 60
gcc tgg gat act accacg cacagcaag tatggcttc ggggcc 240
agt gac
Ala Trp Asp Thr ThrThr HisSerLys TyrGlyPhe GlyAla
Ser Asp
CA 02325576 2000-10-10
WO 99/53099 PCT/US99/07886
-54-
65 70 75 80
gat gca acg ctt tcc tat ggc gtc gac cgt cag cgg ctg ctt acg ttg 288
Asp Ala Thr Leu Ser Tyr Gly Val Asp Arg Gln Arg Leu Leu Thr Leu
85 90 95
gag ctg gca ggg aat gcc aca ctg gag cag cac tac cgt aag ggt acc 336
Glu Leu Ala Gly Asn Ala Thr Leu Glu Gln His Tyr Arg Lys Gly Thr
100 105 110
gaa gac tcc acg aac gaa aac aaa aca gca ctc ctg tgg gga gta gga 384
Glu Asp Ser Thr Asn Glu Asn Lys Thr Ala Leu Leu Trp Gly Val Gly
115 120 125
ggc cga ctc acc ctc gaa cca ggc gcc ggc ttc cgc ttc tcc ttc gcc 432
Gly Arg Leu Thr Leu Glu Pro Gly Ala Gly Phe Arg Phe Ser Phe Ala
130 135 140
ctc gac gcc ggt aac caa cac cag agt aac gca gat gca gac tgt cgc 480
Leu Asp Ala Gly Asn Gln His Gln Ser Asn Ala Asp Ala Asp Cys Arg
145 150 155 160
ctt ccg gca acg ggg aac tca cgg gag aag ttt gac agg gcg ttc gat 528
Leu Pro Ala Thr Gly Asn Ser Arg Glu Lys Phe Asp Arg Ala Phe Asp
165 170 175
gcc ctc agg gtg gag caa tac cgt gta aag gat aag tat ctt gaa ttt 576
Ala Leu Arg Val Glu Gln Tyr Arg Val Lys Asp Lys Tyr Leu Glu Phe
le0 185 190
ttg ctg gga cag atg gcg gag tcc tcg att ctc gag cgg gtg ggg ctt 624
Leu Leu Gly Gln Met Ala Glu Ser Ser Ile Leu Glu Arg Val Gly Leu
195 200 205
gcc ctc acg ctg cag gac ggt acg ctc gtc tct acg ctg acg aag gtt 672
Ala Leu Thr Leu Gln Asp Gly Thr Leu Val Ser Thr Leu Thr Lys Val
210 215 220
gtc act gat agt gga gat cgg ttt atc caa atg gcg ttg gta aaa ctc 720
Val Thr Asp Ser Gly Asp Arg Phe Ile Gln Met Ala Leu Val Lys Leu
225 230 235 240
ttg ccc cag agg gcg caa gcg gag cag ggc cta cgg gag att gtg gcg 768
Leu Pro Gln Arg Ala Gln Ala Glu Gln Gly Leu Arg Glu Ile Val Ala
245 250 255
cgg agt cag tcg gac atc gtg ctt atc atg ctg cta acc tgg ctt gag 816
Arg Ser Gln Ser Asp Ile Val Leu Ile Met Leu Leu Thr Trp Leu Glu
260 265 270
cgt gca cgg ctg gac cgg ttc aat get gat gcg ctg ctt acg gcg cag 869
Arg Ala Arg Leu Asp Arg Phe Asn Ala Asp Ala Leu Leu Thr Ala Gln
275 280 285
tgg acc tat gtg tcg get gga ctg tat ggg gcg acg gcg ggt acc aat 912
Trp Thr Tyr Val Ser Ala Gly Leu Tyr Gly Ala Thr Ala Gly Thr Asn
290 295 300
CA 02325576 2000-10-10
WO 99/53099 PCT/'US99/07886
-55-
gtatttggt aagcgcgtg ctgcctgcgctg cggtcctgg catttt gat 960
ValPheGly LysArgVal LeuProAlaLeu ArgSerTrp HisPhe Asp
305 310 315 320
tttgetgga ttccttaag ctcgaaactaag agcggtgac ccctac acc 1008
PheAlaGly PheLeuLys LeuGluThrLys SerGlyAsp ProTyr Thr
325 330 335
cacctgctc accggcctg gacgccggcgtt gaaacacgc gtgtac atc 1056
HisLeuLeu ThrGlyLeu AspAlaGlyVal GluThrArg ValTyr Ile
340 345 350
cccctcacc catgacctg tacaaaaataat aacgggaac cctctc cct 1104
ProLeuThr HisAspLeu TyrLysAsnAsn AsnGlyAsn ProLeu Pro
355 360 365
tccggcggt tcctcaggg cacattggcctg ccggtggtg gggaag gcg 1152
SerGlyGly SerSerGly HisIleGlyLeu ProValVal GlyLys Ala
370 375 380
tggtgtagc tatcgcatc ccggtgcaggat tacggctgg gtgaag cca 1200
TrpCysSer TyrArgIle ProValGlnAsp TyrGlyTrp ValLys Pro
385 390 395 400
agcgttacg gtccatgcc tctaccaaccgt gcacacctg aatgcc cct 1248
SerValThr ValHisAla SerThrAsnArg AlaHisLeu AsnAla Pro
405 410 415
getgcaggt ggagcagta ggagetacctat ctaaccaag gagt 1291
AlaAlaGly GlyAlaVal GlyAlaThrTyr LeuThrLys Glu
420 925 430
<210> 37
<211> 430
<212> PRT
<213> Treponema pallidum
<400> 37
Thr Ser Pro Ser Cys Val Val Asn Phe Ala Gln Leu Trp Lys Pro Phe
1 5 10 15
Val Thr Arg Ala Tyr Ser Glu Lys Asp Thr Arg Tyr Ala Pro Gly Phe
20 25 30
Ser Gly Ser Gly Ala Lys Leu Gly Tyr Gln Ala His Asn Val Gly Asn
35 40 45
Ser Gly Val Asp Val Asp Ile Gly Phe Leu Ser Phe Leu Ser Asn Gly
50 55 60
Ala Trp Asp Ser Thr Asp Thr Thr His Ser Lys Tyr Gly Phe Gly Ala
65 70 75 80
Asp Ala Thr Leu Ser Tyr Gly Val Asp Arg Gln Arg Leu Leu Thr Leu
85 90 95
Glu Leu Ala Gly Asn Ala Thr Leu Glu Gln His Tyr Arg Lys Gly Thr
CA 02325576 2000-10-10
W O 99/53099
-56-
PCTNS99/07886
105 110
100
Glu Asp Ser Thr Asn Glu Asn Lys Thr Ala Leu Leu Trp Gly Val Gly
120 125
115
Gly Arg Leu Thr Leu Glu Pro Gly Ala Gly Phe Arg Phe Ser Phe Ala
135 140
130
Leu Asp Ala Gly Asn Gln His Gln Ser Asn Ala Asp Ala Asp Cys Arg
155 160
145 150
Leu Pro Ala Thr Gly Asn Ser Arg Glu Lys Phe Asp Arg Ala Phe Asp
170 175
165
Ala Leu Arg Val Glu Gln Tyr Arg Val Lys Asp Lys Tyr Leu Glu Phe
185 190
180
Leu Leu Gly Gln Met Ala Glu Ser Ser Ile Leu Glu Arg Val Gly Leu
200 205
195
Ala Leu Thr Leu Gln Asp Gly Thr Leu Val Ser Thr Leu Thr Lys Val
215 220
210
Val Thr Asp Ser Gly Asp Arg Phe Ile Gln Met Ala Leu Val Lys Leu
235 240
225 230
Leu Pro Gln Arg Ala Gln Ala Glu Gln Gly Leu Arg Glu Ile Val Ala
250 255
245
Arg Ser Gln Ser Asp Ile Val Leu Ile Met Leu Leu Thr Trp Leu Glu
265 270
260
Arg Ala Arg Leu Asp Arg Phe ~n ~a Asp Ala Leu Leu Thr Ala Gln
280 285
275
Trp Thr Tyr Val Ser Ala Gly Leu Tyr Gly Ala Thr Ala Gly Thr Asn
295 300
290
Val Phe Gly Lys Arg Val Leu Pro Ala Leu Arg Ser Trp His Phe Asp
315 320
305 310
Phe Ala Gly Phe Leu Lys Leu Glu Thr Lys Ser Gly Asp Pro Tyr Thr
330 335
325
His Leu Leu Thr Gly Leu Asp Ala Gly Val Glu Thr Arg Val Tyr Ile
395 350
340
Pro Leu Thr His Asp Leu Tyr Lys Asn Asn Asn Gly ~n Pro Leu Pro
360 365
355
Ser Gly Gly Ser Ser Gly His Ile Gly Leu Pro Val Val Gly Lys Ala
375 380
370
Trp Cys Ser Tyr Arg Ile Pro Val Gln Asp Tyr Gly Trp Val Lys Pro
395 400
385 390
Ser Val Thr Val His Ala Ser Thr Asn Arg Ala His Leu Asn Ala Pro
CA 02325576 2000-10-10
WO 99/53099
-57-
PCTNS99/07886
410 415
405
Ala Ala Gly Gly Ala Val Gly Ala Thr Tyr Leu Thr Lys Glu
425 430
420
<210> 38
<211> 1291
<212> DNA
<213> Treponema pallidum
<220>
<221> CDS
<222> (1)..(1290)
tenue Msp homologue encoded by
<223> T. pallidum sub. per
1.3(2) KB DNA fragment.
<400> 38
gtt aac ttt gcc cag ctg tgg aaa ccc ttt 48
t
t
t
g
g
g
acc agt cct tcc
l Asn Phe Ala Gln Leu Trp Lys Pro Phe
l V
a
Thr Ser Pro Ser Cys Va
15
10
1
tat tca gaa aag gac act cgc tat gcc cct ggt ttc 96
gtc acc cgt gcc
Glu Lys Asp Thr Arg Tyr Ala Pro Gly Phe
S
er
Val Thr Arg Ala Tyr
30
20 25
aaa ctc ggc tac cag gcc cac aat gtg gga aac 144
tcc ggc tcc ggg gca
Leu Gly Tyr Gln Ala His Asn Val Gly Asn
Ser Gly Ser Gly Ala Lys
45
35 90
c atc ggt ttc ctc tcc ttc ctt tcc aat ggt 192
agc gga gta gat gtg ga
Ile Gly Phe Leu Ser Phe Leu Ser Asn Gly
Ser Gly Val Asp Val Asp
60
50 55
t act gac acc acg cac agc aag tat ggc ttc ggg gcc 240
t a
l
g
a
gcc tgg ga
Thr Thr His Ser Lys Tyr Gly Phe Gly A
Ala Trp Asp Ser Thr Asp
75 80
65 70
t tcc tat ggc gtc gac cgt cag cgg ctg ctt acg ttg 288
gat gca acg ct
Val Asp Arg Gln Arg Leu Leu Thr Leu
r Gl
T
y
y
Asp Ala Thr Leu Ser
90 95
85
c aca ctg gag cag cac tac cgt aag ggt acc 336
gag ctg gca ggg aat gc
Glu Gln His Tyr Arg Lys Gly Thr
Glu Leu Ala Gly Asn Ala Thr Leu
110
105
100
aac gaa aac aaa aca gca ctc ctg tgg gga gta gga 384
gaa gac tcc acg
s Thr Ala Leu Leu Trp Gly Val Gly
Rsn L
Gl
y
u
Glu Asp Ser Thr Asn
125
120
115
c ctc gaa cca ggc gcc ggc ttc cgc ttc tcc ttc gcc 432
ggc cga ctc ac
Ala Gly Phe Arg Phe Ser Phe Ala
o Gl
P
y
r
Gly Arg Leu Thr Leu Glu
190
135
130
a cac cag agt aac gca gat gca gac tgt cgc 480
ctc gac gcc ggt aac ca
G1n Ser Asn Ala Asp Ala Asp Cys Arg
Hi
s
Leu Asp Ala Gly Asn Gln
155 160
145 150
CA 02325576 2000-10-10
WO 99/53099 PC'T/US99/07886
-58-
ctt ccg gca acg ggg aac tca cgg gag aag ttt gac agg gcg ttc gat 528
Leu Pro Ala Thr Gly Asn Ser.Arg Glu Lys Phe Asp Arg Ala Phe Asp
165 170 175
gcc ctc agg gtg gag caa tac cgt gta aag gat aag tat ctt gaa ttt 576
Ala Leu Arg Val Glu Gln Tyr Arg Val Lys Asp Lys Tyr Leu Glu Phe
180 185 190
ttg ctg gga cag atg gcg gag tcc tcg att ctc gag cgg gtg ggg ctt 624
Leu Leu Gly Gln Met Ala Glu Ser Ser Ile Leu Glu Arg Val Gly Leu
195 200 205
gcc ctc acg ctg cag gac ggt acg ctc gtc tct acg ctg acg aag gtt 672
Ala Leu Thr Leu Gln Asp Gly Thr Leu Val Ser Thr Leu Thr Lys Val
210 215 220
gcc act gat agt gga gat cgg ttt atc caa atg gcg ttg gta aaa ctc 720
Ala Thr Asp Ser Gly Asp Arg Phe Ile Gln Met Ala Leu Val Lys Leu
230 235 240
225
ttg ccc cag agg gcg caa gcg gag cag ggc cta cgg gag att gtg gcg 768
Leu Pro Gln Arg Ala Gln Ala Glu Gln Gly Leu Arg Glu Ile Val Ala
245 250 255
cgg agt cag tcg gac atc gtg ctt atc atg ctg cta acc tgg ctt gag 816
Arg Ser Gln Ser Asp Ile Val Leu Ile Met Leu Leu Thr Trp Leu Glu
260 265 270
cgt gca cgg ctg gac cgg ttc aat get gat gcg ctg ctt acg gcg cag 864
Arg Ala Arg Leu Asp Arg Phe Asn Ala Asp Ala Leu Leu Thr Ala Gln
275 280 285
tgg acc tat gtg tcg get gga ctg tat ggg gcg acg gcg ggt acc aat 912
Trp Thr Tyr Val Ser Ala Gly Leu Tyr Gly Ala Thr Ala Gly Thr Asn
290 295 300
gta ttt ggt aag cgc gtg ctg cct gcg ctg cgg tcc tgg cat ttt gat 960
Val Phe Gly Lys Arg Val Leu Pro Ala Leu Arg Ser Trp His Phe Asp
310 315 320
305
ttt get gga ttc ctt aag ctc gaa act aag agc ggt gac ccc tac acc 1008
Phe Ala Gly Phe Leu Lys Leu Glu Thr Lys Ser Gly Asp Pro Tyr Thr
325 330 335
cac ctg ctc acc ggc ctg gac gcc ggc gtt gaa aca cgc atg tac atc 1056
His Leu Leu Thr Gly Leu Asp Ala Gly Val Glu Thr Arg Met Tyr Ile
390 345 350
ccc ctc act tat gcg cta tac aaa aat aac ggg ggg acg get gtg cgt 1104
Pro Leu Thr Tyr Ala Leu Tyr Lys Asn Asn Gly Gly Thr Ala Val Arg
355 360 365
ggc att cag gaa aag gag tat atc cgt cca ccg gtg gtg ggg aag gcg 1152
Gly Ile Gln Glu Lys Glu Tyr Ile Arg Pro Pro Val Val Gly Lys Ala
370 375 380
tgg tgt agc tat cgc atc ccg gtg cag gat tac ggc tgg gtg aag cca 1200
CA 02325576 2000-10-10
PCT/US99/07886
WO 99/53099
-59-
Trp Cys Ser Tyr Arg Ile Pro Val Gln Asp Tyr Gly Trp Val Lys Pro
385 390 395 400
agc gtt acg gtc cat gcc tct acc aac cgt gca cac ctg aat gcc cct 1248
Ser Val Thr Val His Ala Ser Thr Asn Arg Ala His Leu Asn Ala Pro
410 415
405
get gca ggc gga gca gta gga get acc tat cta acc aag gag t 1291
Ala Ala Gly Gly Ala Val Gly Ala Thr Tyr Leu Thr Lys Glu
425 430
420
<210> 39
<211> 430
<212> PRT
<213> Treponema pallidum
<400> 39
Thr Ser Pro Ser Cys Val Val Asn Phe Ala Gln Leu Trp Lys Pro Phe
1 5 10 15
Val Thr Arg Ala Tyr Ser Glu Lys Asp Thr Arg Tyr Ala Pro Gly Phe
20 25 30
Ser Gly Ser Gly Ala Lys Leu Gly Tyr Gln Ala His Asn Val Gly Asn
35 40 45
Ser Gly Val Asp Val Asp Ile Gly Phe Leu Ser Phe Leu Ser Asn Gly
50 55 60
Ala Trp Asp Ser Thr Asp Thr Thr His Ser Lys Tyr Gly Phe Gly Ala
65 70 75 80
Asp Ala Thr Leu Ser Tyr Gly Val Asp Arg Gln Arg Leu Leu Thr Leu
85 90 95
Glu Leu Ala Gly Asn Ala Thr Leu Glu Gln His Tyr Arg Lys Gly Thr
105 110
100
Glu Asp Ser Thr Asn Glu Asn Lys Thr Ala Leu Leu Trp Gly Val Gly
120 125
115
Gly Arg Leu Thr Leu Glu Pro Gly Ala Gly Phe Arg Phe Ser Phe Ala
135 140
130
Leu Asp Ala Gly Asn Gln His Gln Ser Asn Ala Asp Ala Asp Cys Arg
155 160
145 150
Leu Pro Ala Thr Gly Asn Ser Arg Glu Lys Phe Asp Arg Ala Phe Asp
17 0 17 5
165
Ala Leu Arg Val Glu Gln Tyr Arg Val Lys Asp Lys Tyr Leu Glu Phe
185 190
180
Leu Leu Gly Gln Met Ala Glu Ser Ser Ile Leu Glu Arg Val Gly Leu
200 205
195
Ala Leu Thr Leu Gln Asp Gly Thr Leu Val Ser Thr Leu Thr Lys Val
CA 02325576 2000-10-10
PCT/1JS99/07886
WO 99/53099
_6p_
210 215 220
Ala Thr Asp Ser Gly Asp Arg Phe Ile Gln Met Ala Leu Val Lys Leu
230 235 240
225
Leu Pro Gln Arg Ala Gln Ala Glu Gln Gly Leu Arg Glu Ile Val Ala
245 250 255
Arg Ser Gln Ser Asp Ile Val Leu Ile Met Leu Leu Thr Trp Leu Glu
260 265 270
Arg Ala Arg Leu Asp Arg Phe Asn Ala Asp Ala Leu Leu Thr Ala Gln
280 285
275
Trp Thr Tyr Val Ser Ala Gly Leu Tyr Gly Ala Thr Ala Gly Thr Asn
290 295 300
Val Phe Gly Lys Arg Val Leu Pro Ala Leu Arg Ser Trp His Phe Asp
310 315 320
305
Phe Ala Gly Phe Leu Lys Leu Glu Thr Lys Ser Gly Asp Pro Tyr Thr
325 330 335
His Leu Leu Thr Gly Leu Asp ~a 345 Val Glu Thr Arg Met Tyr Ile
340 350
Pro Leu Thr Tyr Ala Leu Tyr Lys Asn Asn Gly Gly Thr Ala Val Arg
360 365
355
Gly Ile Gln Glu Lys Glu Tyr Ile Arg Pro Pro Val Val Gly Lys Ala
375 380
370
Trp Cys Ser Tyr Arg Ile Pro Val Gln Asp Tyr G1y Trp Val Lys Pro
395 400
385 390
Ser Val Thr Val His Ala Ser Thr Asn Arg Ala His Leu Asn Ala Pro
410 415
405
Ala Ala Gly Gly Ala Val Gly Ala Thr Tyr Leu Thr Lys Glu
425 430
420
<210> 40
<211> 1291
<212> DNA
<213> Treponema pallidum
<220>
<221> CDS
<222> (1)..(1290)
<223> T. pallidum sub. pertenue Msp homologue encoded by
1.3(3) KB DNA fragment.
<400> 40
acc agt cct tcc tgt gtg gtt aac ttt gcc cag ctg tgg aaa ccc ttt 48
Thr Ser Pro Ser Cys Val Val Asn Phe Ala Gln Leu Trp Lys Pro Phe
1 5 10 15
CA 02325576 2000-10-10
WO 99/53099
-61-
PCTNS99/07886
c tat tca gaa aag gac act cgc tat gcc cct ggt ttc 96
gtc acc cgt gc
r Glu Lys Asp Thr Arg Tyr Ala Pro Gly Phe
S
e
Val Thr Arg Ala Tyr
30
20 25
aaa ctc ggc tac cag gcc cac aat gtg gga aac 149
tcc ggc tcc ggg gca
Tyr Gln Ala His Asn Val Gly Asn
Leu Gl
y
Ser Gly Ser Gly Ala Lys
45
35 40
ac atc ggt ttc ctc tcc ttc ctt tcc aat ggt 192
t
g g
agc gga gta gat g
Ile Gly Phe Leu Ser Phe Leu Ser Asn Gly
Ser Gly Val Asp Val Asp
60
50 55
t act gac acc acg cac agc aag tat ggc ttc ggg gcc 240
t a
l
g
a
gcc tgg ga
Thr Thr His Ser Lys Tyr Gly Phe Gly A
Ala Trp Asp Ser Thr Asp
75 eo
6s 70
c tat ggc gtc gac cgt cag cgg ctg ctt acg ttg 288
t t
c
gat gca acg ct
Val Asp Arg Gln Arg Leu Leu Thr Leu
r Gl
T
y
y
Asp Ala Thr Leu Ser
90 95
85
c aca ctg gag cag cac tac cgt aag ggt acc 336
t
gc
gag ctg gca ggg aa
Leu Glu Gln His Tyr Arg Lys Gly Thr
Th
r
Glu Leu Ala Gly Asn Ala
110
105
100
aac gaa aac aaa aca gca ctc ctg tgg gga gta gga 384
gaa gac tcc acg
s Thr Ala Leu Leu Trp Gly Val Gly
n L
A
l
y
s
u
Glu Asp Ser Thr Asn G
125
120
115
a cca ggc gcc ggc ttc cgc ttc tcc ttc gcc 432
ggc cga ctc acc ctc ga
Pro Gly Ala Gly Phe Arg Phe Ser Phe Ala
l
u
Gly Arg Leu Thr Leu G
190
135
130
a cac cag agt aac gca gat gca gac tgt cgc 480
ctc gac gcc ggt aac ca
Ser Asn Ala Asp Ala Asp Cys Arg
Gl
n
Leu Asp Ala Gly Asn Gln His
155 160
145 150
ac tca cgg gag aag ttt gac agg gcg ttc gat 528
ctt ccg gca acg ggg a
Glu Lys Phe Asp Arg A1a Phe Asp
A
rg
Leu Pro Ala Thr Gly Asn Ser
175
170
165
aa tac cgt gta aag gat aag tat ctt gaa ttt 576
gcc ctc agg gtg gag c
r Arg Val Lys Asp Lys Tyr Leu Glu Phe
T
Gl
y
n
Ala Leu Arg Val Glu
190
185
180
tcc tcg att ctc gag cgg gtg ggg ctt 624
a
g
ttg ctg gga cag atg gcg g
Ile Leu Glu Arg Val Gly Leu
Leu Leu Gly Gln Met Ala Glu Ser Ser
205
200
195
ac ggt acg ctc gtc tct acg ctg acg aag gtt 672
gcc ctc acg ctg cag g
Gly Thr Leu Val Ser Thr Leu Thr Lys Val
A
l
sp
n
Ala Leu Thr Leu G
220
215
210
ttt atc caa atg gcg ttg gta aaa ctc 720
gcc act gat agt gga gat cgg
Gln Met Ala Leu Val Lys Leu
Il
e
Ala Thr Asp Ser Gly Asp Arg Phe
235 240
225 230
caa gcg gag cag ggc cta cgg gag att gtg gcg 768
ttg ccc cag agg gcg
Gln Gly Leu Arg Glu Ile Val Ala
Gl
u
Leu Pro Gln Arg Ala Gln Ala
CA 02325576 2000-10-10
PC'TNS99/07886
WO 99/53099
-62-
245 250 255
cgg agt cag tcg gac atc gtg ctt atc atg ctg cta acc tgg ctt gag 816
Arg Ser Gln Ser Asp Ile Val Leu Ile Met Leu Leu Thr Trp Leu Glu
260 265 270
cgt gca cgg ctg gac cgg ttc aat get gat gcg ctg ctt acg gcg cag 864
Arg Ala Arg Leu Asp Arg Phe Asn Ala Asp Ala Leu Leu Thr Ala Gln
275 280 285
tgg acc tat gtg tcg get gga ctg tat ggg gcg acg gcg ggt acc aat 912
Trp Thr Tyr Val Ser Ala Gly Leu Tyr Gly Ala Thr Ala Gly Thr Asn
290 295 300
gta ttt ggt aag cgc gtg ctg cct gcg ctg cgg tcc tgg cat ttt gat 960
Val Phe Gly Lys Arg Val Leu Pro Ala Leu Arg Ser Trp His Phe Asp
310 315 320
305
ttt get gga ttc ctt aag ctc gaa act aag agc ggt gac ccc tac acc 1008
Phe Ala Gly Phe Leu Lys Leu Glu Thr Lys Ser Gly Asp Pro Tyr Thr
325 330 335
cac ctg ctc acc ggc ctg aac gcc ggc gtc gaa gca cgc gtg tac atc 1056
His Leu Leu Thr Gly Leu Asn Ala Gly Val Glu Ala Arg Val Tyr Iie
340 345 350
ccc ctc acc tac atc cgt tac aga aat aac gga ggg tac cca ctg aat 1104
Pro Leu Thr Tyr Ile Arg Tyr Arg Asn Asn Gly Gly Tyr Pro Leu Asn
355 360 365
gga gtt gtg ccc cct ggg act atc aat atg ccg att ttg ggg aag gcg 1152
Gly Val Val Pro Pro Gly Thr Ile Asn Met Pro Ile Leu Gly Lys Ala
370 375 380
tgg tgt agc tat cgc atc ccg gtg cag gat tac ggc tgg gtg aag cca 1200
Trp Cys Ser Tyr Arg Ile Pro Val Gln Asp Tyr Gly Trp Val Lys Pro
390 395 400
385
agc gtt acg gtc cat gcc tct acc aac cgt gca cac ctg aat gcc cct 1248
Ser Val Thr Val His Ala Ser Thr Asn Arg Ala His Leu Asn Ala Pro
405 410 415
get gca ggc gga gca gta gga get acc tat cta acc aag gag t 1291
Ala Ala Gly Gly Ala Val Gly Ala Thr Tyr Leu Thr Lys Glu
420 425 430
<210> 41
<211> 430
<212> PRT
<213> Treponema pallidum
<400> 41
Thr Ser Pro Ser Cys Val Val Asn Phe Ala Gln Leu Trp Lys Pro Phe
1 5 10 15
Val Thr Arg Ala Tyr Ser Glu Lys Asp Thr Arg Tyr Ala Pro Gly Phe
20 25 30
CA 02325576 2000-10-10
WO 99/53099 PCT/US99/07886
-63-
Ser Gly Ser Gly Ala Lys Leu Gly Tyr Gln Ala His Asn Val Gly Asn
35 40 45
Ser Gly Val Asp Val Asp Ile Gly Phe Leu Ser Phe Leu Ser Asn Gly
50 55 60
Ala Trp Asp Ser Thr Asp Thr Thr His Ser Lys Tyr Gly Phe Gly Ala
65 70 75 BO
Asp Ala Thr Leu Ser Tyr Gly Val Asp Arg Gln Arg Leu Leu Thr Leu
85 90 95
Glu Leu Ala Gly Asn Ala Thr Leu Glu Gln His Tyr Arg Lys Gly Thr
100 105 110
Glu Asp Ser Thr Asn Glu Asn Lys Thr Ala Leu Leu Trp Gly Val Gly
115 120 125
Gly Arg Leu Thr Leu Glu Pro Gly Ala Gly Phe Arg Phe Ser Phe Ala
130 135 140
Leu Asp Ala Gly Asn Gln His Gln Ser Asn Ala Asp Ala Asp Cys Arg
145 150 155 160
Leu Pro Ala Thr Gly Asn Ser Arg Glu Lys Phe Asp Arg Ala Phe Asp
165 170 175
Ala Leu Arg Val Glu Gln Tyr Arg Val Lys Asp Lys Tyr Leu Glu Phe
180 185 190
Leu Leu Gly Gln Met Ala Glu Ser Ser Ile Leu Glu Arg Val Gly Leu
195 200 205
Ala Leu Thr Leu Gln Asp Gly Thr Leu Val Ser Thr Leu Thr Lys Val
210 215 220
Ala Thr Asp Ser Gly Asp Arg Phe Ile Gln Met Ala Leu Val Lys Leu
230 235 240
225
Leu Pro Gln Arg Ala Gln Ala Glu Gln Gly Leu Arg Glu Ile Val Ala
245 250 255
Arg Ser Gln Ser Asp Ile Val Leu Ile Met Leu Leu Thr Trp Leu Glu
260 265 270
Arg Ala Arg Leu Asp Arg Phe Asn Ala Asp Ala Leu Leu Thr Ala Gln
275 280 285
Trp Thr Tyr Ser GlyLeu Tyr Gly Thr Ala Thr
Val Ala Ala Gly Asn
290 295 300
Val Phe Gly Arg LeuPro Ala Leu Ser Trp Phe
Lys Val Arg His Asp
305
310 315 320
Phe Ala Gly Leu LeuGlu Thr Lys Gly Asp Tyr
Phe Lys Ser Pro Thr
325 330 335
CA 02325576 2000-10-10
WO 99/53099 PC'T/US99/07886
His Leu Leu Thr Gly Leu Asn Ala Gly Val Glu Ala Arg Val Tyr Ile
340 345 350
Pro Leu Thr Tyr Ile Arg Tyr Arg Asn Asn Gly Gly Tyr Pro Leu Asn
355 360 365
Gly Val Val Pro Pro Gly Thr Ile Asn Met Pro Ile Leu Gly Lys Ala
370 375 380
Trp Cys Ser Tyr Arg Ile Pro Val Gln Asp Tyr Gly Trp Val Lys Pro
385 390 395 400
Ser Val Thr Val His Ala Ser Thr Asn Arg Ala His Leu Asn Ala Pro
405 410 415
Ala Ala Gly Gly Ala Val Gly Ala Thr Tyr Leu Thr Lys Glu
420 425 430
<210> 42
<211> 418
<212> PRT
<213> ~~reponema pallidum
<220>
<221> DOMAIN
<222> (121)..(148)
<223> Highly conserved amino acid motif found in the Msp
genes of T. pallidum sub. pallidum.
<900> 42
Ser Pro Ser Cys Val Val Asn Phe Ala Gln Leu Trp Lys Pro Phe Val
1 5 10 15
Thr Arg Ala Tyr Ser Glu Lys Asp Thr Arg Tyr Ala Pro Gly Phe Ser
20 25 30
Gly Ser Gly Ala Lys Leu Gly Tyr Gln Ala His Asn Val Gly Asn Ser
35 40 45
Gly Asp Val Asp Ile Gly Phe Leu Ser Phe Leu Ser Asn Gly Ala Trp
50 55 60
Asp Ser Thr Asp Thr Thr His Ser Lys Tyr Gly Phe Gly Ala Asp Ala
65 70 75 80
Thr Leu Ser Tyr Gly Val Asp Arg Gln Arg Leu Leu Thr Leu Glu Leu
85 90 95
Ala Gly Ala Thr Leu Glu Gln His Tyr Arg Lys Gly Thr Glu Asp Ser
100 105 110
Thr Asn Glu Asn Lys Thr Ala Leu Leu Trp Gly Val Gly Gly Arg Leu
115 120 125
Thr Leu Glu Pro Gly Ala Gly Phe Arg Phe Ser Phe Ala Leu Asp Ala
130 135 190
CA 02325576 2000-10-10
WO 99/53099 PCTNS99/07886
-65-
Gly Asn Gln Asp Cys Leu Pro Ala
Gln Ser Arg Thr
Asn
Ala
Asp
Ala
145 150 155 160
Gly Asn LysPhe Ala Phe Leu Arg
Ser Arg Asp Asp Val
Glu Arg Ala
I65 170 175
Glu Gln LysAsp Lys Leu Glu Leu Leu Gly
Tyr Arg Tyr Phe Gln
Val
180 185 190
Met Ala Ser LeuGlu Arg Gly Leu Leu Thr Leu
Glu Ile Val Ala Gln
195 200 205
Asp Gly Leu SerThr Leu Lys Val Thr Asp Ser
Thr Val Thr Val Gly
210 215 220
Asp Arg Ile MetAla Leu Lys Leu Pro Gln Arg
Phe Gln Val Leu Ala
225 230 235 240
Gln Ala Gln ArgGlu Ile Ala Arg Gln Ser Asp
Glu Gly Val Ser Ile
245 250 255
Val Leu Met LeuThr Trp Glu Arg Arg Leu Asp
Ile Leu Leu Ala Arg
260 265 270
Phe Asn Asp LeuLeu Thr Gln Trp Tyr Val Ser
Ala Ala Ala Thr Ala
275 280 285
Gly Leu Gly ThrThr Asn Phe Gly Arg Val Leu
Tyr Ala Val Lys Pro
290 295 300
Ala Leu Ser HisPhe Asp Ala Gly Leu Lys Leu
Arg Trp Phe Phe Glu
305 310 315 320
Thr Lys Gly ProTyr Thr Leu Leu Gly Leu Asp
Ser Asp His Thr Ala
325 330 335
Gly Val Thr ValIle Leu His Asp Tyr Lys Asn
Glu Arg Thr Leu Asn
340 345 350
Asn Gly Pro ProSer Gly 5er Ser His Ile Gly
Asn Leu Gly Gly Leu
355 360 365
Pro Val Gly AlaTrp Cys Tyr Arg Pro Val Gln
Val Lys Ser Ile Asp
370 375 380
Tyr Gly Val ProVal Thr Ala Ser Asn Arg Ala
Trp Lys His Thr His
385 390 395 400
Leu Asn Pro AlaGly Gly Val Gly Thr Tyr Leu
Ala Ala Ala Ala Thr
405 410 415
Lys Glu
<210> 43
<211> 1687
CA 02325576 2000-10-10
WO 99/53099 PCT/US99/0'f886
-66-
<212>
DNA
<213> pallidum
Treponema
<220>
<221>
CDS
<222>
(1)..(1686)
<223> pallidum Msp homologue
T. sub. encoded
pallidum by
TP
1.6.
<900>
43
acc agtcct tcctgtgtggtt aacttt gcccagctgtgg aaaccc ttt 48
Thr SerPro SerCysValVal AsnPhe AlaGlnLeuTrp LysPro Phe
1 5 10 15
gtc acccgt gcctattcagaa aaggac actcgctatgcc cctggt ttc 96
Val ThrArg AlaTyrSerGlu LysAsp ThrArgTyrAla ProGly Phe
20 25 30
tcc ggctcc ggggcaaaactc ggctac caggcccacaat gtggga aac 144
Ser GlySer GlyAlaLysLeu GlyTyr GlnAlaHisAsn ValGly Asn
35 40 45
agc ggagta gatgtggac~atcggtttc ctctccttcctt tccaat ggt 192
Ser GlyVal AspValAspIle GlyPhe LeuSerPheLeu SerAsn Gly
50 55 60
gcc tgggat agtactgacacc acgcac agcaagtatggc ttcggg gcc 240
Ala TrpAsp SerThrAspThr ThrHis SerLysTyrGly PheGly Ala
65 70 75 80
gat gcaacg ctttcctatggc gtcgac cgtcagcggctg cttacg ttg 288
Asp AlaThr LeuSerTyrGly ValAsp ArgGlnArgLeu LeuThr Leu
85 90 95
gag ctggca gggaatgccaca ctggag cagcactaccgt aagggt acc 336
Glu LeuAla GlyAsnAlaThr LeuGlu GlnHisTyrArg LysGly Thr
100 105 110
gaa gactcc acgaacgaaaac aaaaca gcactcctgtgg ggagta gga 384
Glu AspSer ThrAsnGluAsn LysThr AlaLeuLeuTrp GlyVal Gly
115 120 125
ggc cgactc accctcgaacca ggcgcc ggcttccgcttc tccttc gcc 432
Gly ArgLeu ThrLeuGluPro GlyAla GlyPheArgPhe SerPhe Ala
130 135 140
ctc gacgcc ggtaaccaacac cagagt gcacaggacttt caaaat cgc 480
Leu AspAla GlyAsnGlnHis GlnSer AlaGlnAspPhe GlnAsn Arg
145 150 155 160
aca cagagg gcgcagagtgaa ctcacc gccctctcaaat aacctc ttc 528
Thr GlnArg AlaGlnSerGlu LeuThr AlaLeuSerAsn AsnLeu Phe
165 170 175
cag ggagaa agtcaaaaacag gaagcc tggctggacgaa tatgca aag 576
Gln GlyGlu SerGlnLysGln GluAla TrpLeuAspGlu TyrAla Lys
180 185 190
CA 02325576 2000-10-10
WO 99/53099 PCT/US99/07886
-67-
aaggtg cttgatgcc gtaacggca gccaccgaa accgccctt cagtcg 624
LysVal LeuAspAla ValThrAla AlaThrGlu ThrAlaLeu GlnSer
195 200 205
agggga aacgcgtac ataacggca gtgtcaaac gtaaaagtc acccct 672
ArgGly AsnAlaTyr IleThrAla ValSerAsn ValLysVal ThrPro
210 215 220
ccggta getgccacg cttttgacg aacctgaag gtgttcatt accgac 720
ProVal AlaAlaThr LeuLeuThr AsnLeuLys ValPheIle ThrAsp
225 230 235 240
cctcct acaccgtca ccgcttccc gcgcttcct gcattttcc ctgatg 768
ProPro ThrProSer ProLeuPro AlaLeuPro AlaPheSer LeuMet
245 250 255
gggcag gttttgctg cagtacgat gcggagcag gtggtgaag gggttt 816
GlyGln ValLeuLeu GlnTyrAsp AlaGluGln ValValLys GlyPhe
260 265 270
gagcag gtacagacg caaatcgtt getgaaatt aaccagaaa gtgcaa 864
GluGln ValGlnThr GlnIleVal AlaGluIle AsnGlnLys ValGln
275 280 285
gcgget gtggetcag agcaagget gcagcacag gcattcatc aacggt 912
AlaAla ValAlaGln SerLysAla AlaAlaGln AlaPheIle AsnGly
290 295 300
cttacc aaggcaata gaagacgtg getgatgcg ttgcttgca ccgcat 960
LeuThr LysAlaIle GluAspVal AlaAspAla LeuLeuAla ProHis
305 310 315 320
aaggga aatccgatg agcctcttc aaccttccg gatcaacaa aaatta 1008
LysGly AsnProMet SerLeuPhe AsnLeuPro AspGlnGln LysLeu
325 330 335
ctgaag gacgatctc gccgatctt attccaaag cttacgget gagget 1056
LeuLys AspAspLeu AlaAspLeu IleProLys LeuThrAla GluAla
340 345 350
acaaag tttttcact gagggtcag acgtttgta accgaagaa gtgaag 1104
ThrLys PhePheThr GluGlyGln ThrPheVal ThrGluGlu ValLys
355 360 365
aagaag acggatgcg ttggacgcg gggcagcag atacgtcag getata 1152
LysLys ThrAspAla LeuAspAla GlyGlnGln IleArgGln AlaIle
370 375 380
cagaac ctgcgtgcg tctgcatgg cgtgccttt ctaatggga gtcagc 1200
GlnAsn LeuArgAla SerAlaTrp ArgAlaPhe LeuMetGly ValSer
385 390 395 400
gccgtg tgtctgtat cttgacacc tacaatgtc gccttcgat gcgctg 1248
AlaVal CysLeuTyr LeuAspThr TyrAsnVal AlaPheAsp AlaLeu
405 410 415
tttacg gcgcagtgg aagtggctg tcttctggc atatacttt gccaca 1296
PheThr AlaGlnTrp LysTrpLeu SerSerGly IleTyrPhe AlaThr
CA 02325576 2000-10-10
WO 99/53099 PCTNS99/07886
-68-
420 425 430
gcaccg gcaaacgtt tttggcaccagg gtgttagat aacacc atcgca 1344
AlaPro AlaAsnVal PheGlyThrArg ValLeuAsp AsnThr IleAla
435 440 445
agctgt ggcgacttt gccggattcctt aagctcgaa actaag agcggt 1392
SerCys GlyAspPhe AlaGlyPheLeu LysLeuGlu ThrLys SerGly
450 455 460
gacccc tacacccac ctgctcaccggc ctggacgcc ggcgtt gaaaca 1440
AspPro TyrThrHis LeuLeuThrGly LeuAspAla GlyVal GluThr
465 470 475 480
cgcgtg tacatcccc ctcacctatgcg ctatacaaa aataac gggggg 1988
ArgVal TyrIlePro LeuThrTyrA1a LeuTyrLys AsnAsn GlyGly
485 490 495
acgget gtgcgtggc attcaggaaaag gagtatatc cgtcca ccggtg 1536
ThrAla ValArgGly IleGlnGluLys GluTyrIle ArgPro ProVal
500 505 510
gtgggg aaggcgtgg tgtagctatcgc atcccggtg caggat tacggc 1584
ValGly LysAlaTrp CysSerTyrArg IleProVal GlnAsp TyrGly
515 520 525
tgggtg aagccaagc gttacggtccat gcctctacc aaccgt gcacac 1632
TrpVal LysProSer ValThrValHis AlaSerThr AsnArg AlaHis
530 535 540
ctgaat gcccctget gcaggtggagca gtaggaget acctat ctaacc 1680
LeuAsn AlaProAla AlaGlyGlyAla ValGlyAla ThrTyr LeuThr
545 550 555 560
aaggag t 1687
LysGlu
<210> 94
<211> 562
<212> PRT
<213> Treponema pallidum
<400> 44
Thr Ser Pro Ser Cys Val Val Asn Phe Ala Gln Leu Trp Lys Pro Phe
1 5 10 15
Val Thr Arg Ala Tyr Ser Glu Lys Asp Thr Arg Tyr Ala Pro Gly Phe
20 25 30
Ser Gly Ser Gly Ala Lys Leu Gly Tyr Gln Ala His Asn Val Gly Asn
35 40 45
Ser Gly Val Asp Val Asp Ile Gly Phe Leu Ser Phe Leu Ser Asn Gly
50 55 60
Ala Trp Asp Ser Thr Asp Thr Thr His Ser Lys Tyr Gly Phe Gly Ala
CA 02325576 2000-10-10
WO 99/53099 PCT/US99/07886
-69-
65 70 75 80
Asp Ala Thr Leu Ser Tyr Gly Val Asp Arg Gln Arg Leu Leu Thr Leu
85 90 95
Glu Leu Ala Gly Asn Ala Thr Leu Glu Gln His Tyr Arg Lys Gly Thr
100 105 110
Glu Asp Ser Thr Asn Glu Asn Lys Thr Ala Leu Leu Trp Gly Val Gly
115 120 125
Gly Arg Leu Thr Leu Glu Pro Gly Ala Gly Phe Arg Phe Ser Phe Ala
130 135 140
Leu Asp Ala Gly Asn Gln His Gln Ser Ala Gln Asp Phe Gln Asn Arg
145 150 155 160
Thr Gln Arg Ala Gln Ser Glu Leu Thr Ala Leu Ser Asn Asn Leu Phe
165 170 175
Gln Gly Glu Ser Gln Lys Gln Glu Ala Trp Leu Asp Glu Tyr Ala Lys
180 185 190
Lys Val Leu Asp Ala Val Thr Ala Ala Thr Glu Thr Ala Leu Gln Ser
195 200 205
Arg Gly Asn Ala Tyr Ile Thr Ala Val Ser Asn Val Lys Val Thr Pro
210 215 220
Pro Val Ala Ala Thr Leu Leu Thr Asn Leu Lys Val Phe Ile Thr Asp
225 230 235 240
Pro Pro Thr Pro Ser Pro Leu Pro Ala Leu Pro Ala Phe Ser Leu Met
245 250 255
Gly Gln Val Leu Leu Gln Tyr Asp Ala Glu Gln Val Val Lys Gly Phe
260 265 270
Glu Gln Val Gln Thr Gln Ile Val Ala Glu Ile Asn Gln Lys Val Gln
275 280 285
Ala Ala Val Ala Gln Ser Lys Ala Ala Ala Gln Ala Phe Ile Asn Gly
290 295 300
Leu Thr Lys Ala Ile Glu Asp Val Ala Asp Ala Leu Leu Ala Pro His
305 3I0 315 320
Lys Gly Asn Pro Met Ser Leu Phe Asn Leu Pro Asp Gln Gln Lys Leu
325 330 335
Leu Lys Asp Asp Leu Ala Asp Leu Ile Pro Lys Leu Thr Ala Glu Ala
340 345 350
Thr Lys Phe Phe Thr Glu Gly Gln Thr Phe Val Thr Glu Glu Val Lys
355 360 365
Lys Lys Thr Asp Ala Leu Asp Ala Gly Gln Gln Ile Arg Gln Ala Ile
370 375 380
CA 02325576 2000-10-10
WO 99/53099 PCTNS99/07886
-70-
Gln Asn Leu Arg Ala Ser Ala Trp Arg Ala Phe Leu Met Gly Val Ser
385 390 395 400
Ala Val Cys Leu Tyr Leu Asp Thr Tyr Asn Val Ala Phe Asp Ala Leu
405 410 415
Phe Thr Ala Gln Trp Lys Trp Leu Ser Ser Gly Ile Tyr Phe Ala Thr
420 425 430
Ala Pro Ala Asn Val Phe Gly Thr Arg Val Leu Asp Asn Thr Ile Ala
435 490 445
Ser Cys Gly Asp Phe Ala Gly Phe Leu Lys Leu Glu Thr Lys Ser Gly
450 455 460
Asp Pro Tyr Thr His Leu Leu Thr Gly Leu Asp Ala Gly Val Glu Thr
465 470 475 980
Arg Val Tyr Ile Pro Leu Thr Tyr Ala Leu Tyr Lys Asn Asn Gly Gly
485 990 495
Thr Ala Val Arg Gly Ile Gln Glu Lys Glu Tyr Ile Arg Pro Pro Val
500 505 510
Val Gly Lys Ala Trp Cys Ser Tyr Arg Ile Pro Val Gln Asp Tyr Gly
515 520 525
Trp Val Lys Pro Ser Val Thr Val His Ala Ser Thr Asn Arg Ala His
530 535 540
Leu Asn Ala Pro Ala Ala Gly Gly Ala Val Gly Ala Thr Tyr Leu Thr
595 550 555 560
Lys Glu
<210> 45
<211> 785
<212> DNA
<213> Treponema pallidum
<220>
<221> CDS
<222> (1)..(783)
<223> Amino acid sequence of Msp peptide encoded by 5'
half of TP 1.6 for vaccine trial
<400> 45
acc agt cct tcc tgt gtg gtt aac ttt gcc cag ctg tgg aaa ccc ttt 48
Thr Ser Pro Ser Cys Val Val Asn Phe Ala Gln Leu Trp Lys Pro Phe
1 5 10 15
gtc acc cgt gcc tat tca gaa aag gac act cgc tat gcc cct ggt ttc 96
Val Thr Arg Ala Tyr Ser Glu Lys Asp Thr Arg Tyr Ala Pro Gly Phe
20 25 30
CA 02325576 2000-10-10
WO 99/53099 PCf/US99/07886
-71-
tccggc tccggggca aaactcggc taccaggcc cacaatgtg ggaaac 144
SerGly SerGlyAla LysLeuGly TyrGlnAla HisAsnVal GlyAsn
35 40 45
agcgga gtagatgtg gacatcggt ttcctctcc ttcctttcc aatggt 192
SerGly ValAspVal AspIleGly PheLeuSer PheLeuSer AsnGly
50 55 60
gcctgg gatagtact gacaccacg cacagcaag tatggcttc ggggcc 240
AlaTrp AspSerThr AspThrThr HisSerLys TyrGlyPhe GlyAla
65 70 75 80
gatgca acgctttcc tatggcgtc gaccgtcag cggctgctt acgttg 288
AspAla ThrLeuSer TyrGlyVal AspArgGln ArgLeuLeu ThrLeu
85 90 95
gagctg gcagggaat gccacactg gagcagcac taccgtaag ggtacc 336
GluLeu AlaGlyAsn AlaThrLeu GluGlnHis TyrArgLys GlyThr
100 105 110
gaagac tccacgaac gaaaacaaa acagcactc ctgtgggqa gtagga 384
GluAsp SerThrAsn GluAsnLys ThrAlaLeu LeuTrpGly ValGly
115 120 125
ggccga ctcaccctc gaaccaggc gccggcttc cgcttctcc ttcgcc 432
GlyArg LeuThrLeu GluProGly AlaGlyPhe ArgPheSer PheAla
130 135 140
ctcgac gccggtaac caacaccag agtgcacag gactttcaa aatcgc 480
LeuAsp AlaGlyAsn GlnHisGln SerAlaGln AspPheGln AsnArg
145 150 155 160
acacag agggcgcag agtgaactc accgccctc tcaaataac ctcttc 528
ThrGln ArgAlaGln SerGluLeu ThrAlaLeu SerAsnAsn LeuPhe
165 170 175
caggga gaaagtcaa aaacaggaa gcctggctg gacgaatat gcaaag 576
GlnGly GluSerGln LysGlnGlu AlaTrpLeu AspGluTyr AlaLys
180 185 190
aaggtg cttgatgcc gtaacggca gccaccgaa accgccctt cagtcg 624
LysVal LeuAspAla ValThrAla AlaThrGlu ThrAlaLeu GlnSer
195 200 205
agggga aacgcgtac ataacggca gtgtcaaac gtaaaagtc acccct 672
ArgGly AsnAlaTyr IleThrAla ValSerAsn ValLysVal ThrPro
210 215 220
ccggta getgccacg cttttgacg aacctgaag gtgttcatt accgac 720
ProVal AlaAlaThr LeuLeuThr AsnLeuLys ValPheIle ThrAsp
225 230 235 240
cctcct acaccgtca ccgcttccc gcgcttcct gcattttcc ctgatg 768
ProPro ThrProSer ProLeuPro AlaLeuPro AlaPheSer LeuMet
245 250 255
gggcag gttttgctg ca 785
GlyGln ValLeuLeu
CA 02325576 2000-10-10
WO 99/53099 PCT/US99/07886
-'72-
260
<210> 46
<211> 261
<212> PRT
<213> Treponema pallidum
<400> 46
Thr Ser Pro Ser Cys Val Val Asn Phe Ala Gln Leu Trp Lys Pro Phe
1 5 10 15
Val Thr Arg Ala Tyr Ser Glu Lys Asp Thr Arg Tyr Ala Pro Gly Phe
20 25 30
Ser Gly Ser Gly Ala Lys Leu Gly Tyr Gln Ala His Asn Val Gly Asn
35 40 45
Ser Gly Val Asp Val Asp Ile Gly Phe Leu Ser Phe Leu Ser Asn Gly
50 55 60
Ala Trp Asp Ser Thr Asp Thr Thr His Ser Lys Tyr Gly Phe Gly Ala
65 70 75 80
Asp Ala Thr Leu Ser Tyr Gly Val Asp Arg Gln Arg Leu Leu Thr Leu
85 90 95
Glu Leu Ala Gly Asn Ala Thr Leu Glu Gln His Tyr Arg Lys Gly Thr
100 105 110
Glu Asp Ser Thr Asn Glu Asn Lys Thr Ala Leu Leu Trp Gly Val Gly
115 120 125
Gly Arg Leu Thr Leu Glu Pro Gly Ala Gly Phe Arg Phe Ser Phe Ala
130 135 140
Leu Asp Ala Gly Asn Gln His Gln Ser Ala Gln Asp Phe Gln Asn Arg
145 150 155 160
Thr Gln Arg Ala Gln Ser Glu Leu Thr Ala Leu Ser Asn Asn Leu Phe
165 170 175
Gln Gly Glu Ser Gln Lys Gln Glu Ala Trp Leu Asp Glu Tyr Ala Lys
180 185 190
Lys Val Leu Asp Ala Val Thr Ala Ala Thr Glu Thr Ala Leu Gln Ser
195 200 205
Arg Gly Asn Ala Tyr Ile Thr Ala Val Ser Asn Val Lys Val Thr Pro
210 215 220
Pro Val Ala Ala Thr Leu Leu Thr Asn Leu Lys Val Phe Ile Thr Asp
225 230 235 240
Pro Pro Thr Pro Ser Pro Leu Pro Ala Leu Pro Ala Phe Ser Leu Met
245 250 255
Gly Gln Val Leu Leu
CA 02325576 2000-10-10
WO 99/53099 PCT/US99/07886
-73-
260
<210> 47
<211> 562
<212> PRT
<213> Treponema pallidum
<220>
<221> DOMAIN
<222> (127)..(152)
<223> Highly conserved amono acid motif found in the Msp
genes of T. pallidum sub. pallidum.
<220>
<221> DOMAIN
<222> (1)..(152)
<223> The amino acids in this region are identical to
the amino terminal portions of Msps 2 and 11.
<400> 47
Thr Ser Pro Ser Cys Val Val Asn Phe Ala Gln Leu Trp Lys Pro Phe
1 5 10 15
Val Thr Arg Ala Tyr Ser Glu Lys Asp Thr Arg Tyr Ala Pro Gly Phe
20 25 30
Ser Gly Ser Gly Ala Lys Leu Gly Tyr Gln Ala His Asn Val Gly Asn
35 40 45
Ser Gly Val Asp Val Asp Ile Gly Phe Leu Ser Phe Leu Ser Asn Gly
50 55 60
Ala Trp Asp Ser Thr Asp Thr Thr His Ser Lys Tyr Gly Phe Gly Ala
65 70 75 80
Asp Ala Thr Leu Ser Tyr Gly Val Asp Arg Gln Arg Leu Leu Thr Leu
85 90 95
Glu Leu Ala Gly Asn Ala Thr Leu Glu Gln His Tyr Arg Lys Gly Thr
100 105 110
Glu Asp Ser Thr Asn Glu Asn Lys Thr Ala Leu Leu Trp Gly Val Gly
115 120 125
Gly Arg Leu Thr Leu Glu Pro Gly Ala Gly Phe Arg Phe Ser Phe Ala
130 135 140
Leu Asp Ala Gly Asn Gln His Gln Ser Ala Gln Asp Phe Gln Asn Arg
145 150 155 160
Thr Gln Arg Ala Gln Ser Glu Leu Thr Ala Leu Ser Asn Asn Leu Phe
165 170 175
Gln Gly Glu Ser Gln Lys Gln Glu Ala Trp Leu Asp Glu Tyr Ala Lys
180 185 190
Lys Val Leu Asp Ala Val Thr Ala Ala Thr Glu Thr Ala Leu Gln Ser
CA 02325576 2000-10-10
WO 99/53099 PCT/US99/07886
-74-
195 200 205
Arg Gly Asn Ala Tyr Ile Thr Ala Val Ser Asn Val Lys Val Thr Pro
210 215 220
Pro Val Ala Ala Thr Leu Leu Thr Asn Leu Lys Val Phe Ile Thr Asp
225 230 235 240
Pro Pro Thr Pro Ser Pro Leu Pro Ala Leu Pro Ala Phe Ser Leu Met
245 250 255
Gly Gln Val Leu Leu Gln Tyr Asp Ala Glu Gln Val Val Lys Gly Phe
260 265 270
Glu Gln Val Gln Thr Gln Ile Val Ala Glu Ile Asn Gln Lys Val Gln
275 280 285
Ala Ala Val Ala Gln Ser Lys Ala Ala Ala Gln Ala Phe Ile Asn Gly
290 295 300
Leu Thr Lys Ala Ile Glu Asp Val Ala Asp Ala Leu Leu Ala Pro His
305 310 315 320
Lys Gly Asn Pro Met Ser Leu Phe Asn Leu Pro Asp Gln Gln Lys Leu
325 330 335
Leu Lys Asp Asp Leu Ala Asp Leu Ile Pro Lys Leu Thr Ala Glu Ala
340 345 350
Thr Lys Phe Phe Thr Glu Gly Gln Thr Phe Val Thr Glu Glu Val Lys
355 360 365
Lys Lys Thr Asp Ala Leu Asp Ala Gly Gln Gln Ile Arg Gln Ala Ile
370 375 380
Gln Asn Leu Arg Ala Ser Ala Trp Arg Ala Phe Leu Met Gly Val Ser
385 390 395 400
Ala Val Cys Leu Tyr Leu Asp Thr Tyr Asn Val Ala Phe Asp Ala Leu
405 410 415
Phe Thr Ala Gln Trp Lys Trp Leu Ser Ser Gly Ile Tyr Phe Ala Thr
420 425 430
Ala Pro Ala Asn Val Phe Gly Thr Arg Val Leu Asp Asn Thr Ile Ala
435 440 445
Ser Cys Gly Asp Phe Ala Gly Phe Leu Lys Leu Glu Thr Lys Ser Gly
450 455 460
Asp Pro Tyr Thr His Leu Leu Thr Gly Leu Asp Ala Gly Val Glu Thr
465 470 475 480
Arg Val Tyr Ile Pro Leu Thr Tyr Ala Leu Tyr Lys Asn Asn Gly Gly
485 490 495
Thr Ala Val Arg Gly Ile Gln Glu Lys Glu Tyr Ile Arg Pro Pro Val
CA 02325576 2000-10-10
WO 99/53099 PCT/US99/07886
-'75-
500 505 510
Val Gly Lys Ala Trp Cys Ser Tyr Arg Ile Pro Val Gln Asp Tyr Gly
515 520 525
Trp Val Lys Pro Ser Val Thr Val His Ala Ser Thr Asn Arg Ala His
530 535 540
Leu Asn Ala Pro Ala Ala Gly Gly Ala Val Gly Ala Thr Tyr Leu Thr
545 550 555 560
Lys Glu
<210> 48
<211> 18
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: PCR primer S1
for amplification of Msps 1, 3, 4, 5, 10, 11.
<220>
<221> misc_feature
<222> (1) . (18)
<223> Oligonucleotide used for PCR amplification_of Msps
1, 3, 4, 5, 10, 11.
<400> 48
cgactcaccc tcgaacca 18
<210> 49
<211> 19
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: PCR primer
AS1 for use in amplification of Msps 1, 3, 4, 5,
10, 11.
<220>
<221> misc_feature
<222> (1). (19)
<223> Oligonucleotide used for PCR amplification of Msps
1, 3, 9, 5, 10, 11.
<400> 49
ggtgagcagg tgggtgtag 19
<210> 50
<211> 20
<212> DNA
<213> Artificial Sequence
<220>
CA 02325576 2000-10-10
WO 99/53099 PCT/US99/07886
-76-
<223> Description of Artificial Sequence: PCR primer S6
for use in amplification of Msp6.
<220>
<221> misc_feature
<222> (1) . (20)
<223> Oligonucleotide used for PCR amplification of Msp6.
<400> 50
cgcgtttgac gctttccccg 20
<210> 51
<211> 23
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: PCR primer
AS6 for amplification of Msp6.
<220>
<221> mi.sc_feature
<222> (1). (23)
<223> Oligonucleotide used for PCR amplification of Msp6.
<400> 51
acacaagctt agaaagagaa tcg 23
<210> 52
<211> 22
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: PCR primer
sequence S7 for use in amplification of Msp7.
<220>
<221> misc_feature
<222> (1)..(22)
<223> Oligonucleotide used for PCR amplification of Msp7.
<400> 52
ctttttctcg ctgacgcttt gt 22
<210> 53
<211> 21
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: PCR primer
sequence AS7 for the amlification of Msp7.
<220>
CA 02325576 2000-10-10
WO 99/53099 PCT/US99/07886
_77_
<221> misc_feature
<222> (1). (21)
<223> Oligonucleotide used for PCR amplification of Msp7.
<400> 53
tgcaaggcat gggtgtaatc a 21
<210> 54
<211> 18
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: PCR primer
sequence S8 for the amplification of Msp8.
<220>
<221> misc_feature
<222> (1). (18)
<223> Oligonucleotide used for PCR amplification of MspB.
<400> 54
cggctgacgc tgaccccg 18
<210> 55
<211> 22
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: PCR primer
sequence AS8 for the amplification of Msp8.
<220>
<221> misc_feature
<222> (1). (22)
<223> Oligonucleotide used for PCR amplification of MspB.
<400> 55
caagtagtct gtaagctgcc tg 22
<210> 56
<211> 23
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: PCR primer
sequence S9 for use in amplification of Msp9.
<220>
<221> misc_feature
<222> (1). (23)
<223> Oligonucleotide used for PCR amplification of Msp9.
CA 02325576 2000-10-10
WO 99/53099 PCT/US99/07886
_78_
<400> 56
atattgaagg ctatgcggag ctg 23
<210> 57
<211> 22
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: PCR primer
sequence AS9 for amplification of Msp9.
<220>
<221> misc_feature
<222> (1). (22)
<223> Oligonucleotide used for PCR amplification of Msp9.
<400> 57
cctcaaggaa agaagtatca gg 22
<210> 58
<211> 19
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: PCR primer
sequence S12 for amplification of Mspl2.
<220>
<221> misc_feature
<222> (1). (19)
<223> Oligonucleotide used for PCR amplification of Mspl2.
<400> 58
cgcgcataac gctcactcc 19
<210> 59
<211> 22
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: PCR primer
sequence AS12 for amplification of Mspl2.
<220>
<221> misc_feature
<222> (1) . (22)
<223> Oligonucleotide used for PCR amplification of Mspl2.
<400> 59
gtctataagg tgtgtatacg cg 22
CA 02325576 2000-10-10
WO 99/53099 PCTNS99/07886
-79-
<210> 60
<211> 23
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: PCR primer
sequence 51.6 for amplification of Msp-TP1.6.
<220>
<221> misc_feature
<222> (1). (23)
<223> Oligonucleotide used for PCR amplification of Msp-TP1.6.
<400> 60
accagtcctt cctgtgtggt taa 23
<210> 61
<211> 24
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: PCR primer
sequence AS1.6 for amplification of Msp-TP1.6.
<220>
<221> misc_feature
<222> (1). (24)
<223> Oligonucleotide used for PCR amplification of Msp-TP1.6.
<400> 61
actccttggt tagataggta gctc 24
<210> 62
<211> 43
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: Cloning
adapter 1, to permit "nested PCR" using multiple
PCR primers.
<220>
<221> misc_feature
<222> (1). (43)
<223> Oligonucleotide used as cloning adaptor.
<400> 62
taatacgact cactataggg ctcgagcggc cgcccgggca ggt 43
<210> 63
<211> 42
<212> DNA
CA 02325576 2000-10-10
WO 99153099 PCT/US99/07886
-80-
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: Cloning
adaptor 2, to permit "nested PCR" using multiple
PCR primers.
<220>
<221> misc_feature
<222> (1)..(42)
<223> Oligonucleotide used as cloning adaptor.
<400> 63
gtaatacgac tcactatagg gcagcgtggt cgcggccgag gt 42
<210> 64
<211> 22
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: Nested primer
1, which hybridizes to both adapter 1 and adapter 2.
<220>
<221> misc_feature
<222> (1). (22)
<223> Oligonucleotide used for "nested PCR."
<400> 64
tcgagcggcc gcccgggcag gt 22
<210> 65
<211> 20
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: Nested primer
2, which hybridizes with adapter 1 and adapter 2.
<220>
<221> misc_feature
<222> (1). (20)
<223> Oligonucleotide used for "nested PCR."
<400> 65
agcgtggtcg cggccgaggt 20
<210> 66
<211> 23
<212> DNA
<213> Artificial Sequence
<220>
CA 02325576 2000-10-10
WO 99/53099 PCT/US99/07886
-81-
<223> Description of Artificial Sequence: PCR primer
sequence S3.
<220>
<221> misc_feature
<222> (1). (23)
<223> Oligonucleotide used for amplification of Msp3.
<400> 66
accagtcctt cctgtgtggt taa 23
<210> 67
<211> 29
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: PCR primer
sequence AS33.
<220>
<221> misc_feature
<222> (1) . (24)
<223> Gligonucleotide used for amplification of Msp33.
<400> 67
actccttggt tagataggta gctc 24
<210> 68
<211> 19
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: T7, PCR3.1
<220>
<221> misc_feature
<222> (1). (19)
<223> Oligonucleotide used for DNA sequencing.
<400> 68
ggcttccgct tctccttcg 19
<210> 69
<211> 20
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: INT-AS
sequencing primer.
<220>
CA 02325576 2000-10-10
WO 99/53099 PCT/US99/07886
-82-
<221> misc_feature
<222> (1). (20)
<223> Oligonucleotide used for DNA sequencing.
<400> 69
gtttcgagct taaggaatcc 20
<210> 70
<211> 20
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: PCR primer
<220>
<221> misc_feature
<222> (1). (20)
<223> PCR primer designed to 5' end of gpd open reading
frame
<400> 70
tgcacggtga cgatctgtgc 20
<210> 71
<211> 20
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: PCR primer
<220>
<221> misc_feature
<222> (1). (20)
<223> PCR primer designed to 3' end of gpd open reading
frame
<400> 71
ggtaccaggc gacactgaac 20
<210> ?2
<211> 20
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: PCR primer
<220>
<221> misc_feature
<222> (1). (20)
<223> PCR primer designed to the 5' end of the tpa92
gene
<400> 72
gggtgtcgtg gagttttgcg 20
CA 02325576 2000-10-10
WO 99/53099 PCT/US99/07886
-83-
<210> 73
<211> 19
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: PCR primer
<220>
<221> misc_feature
<222> (1). (19)
<223> PCR primer designed to 3' end of tpa92 gene
<400> 73
cttgcctggt ggacgcagc 19
<210> 79
<211> 30
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: PCR primer
<220>
<221> misc_feature
<222> (1). (30)
<223> PCR primer designed to 5' end of tpa92 open
reading frame
<400> 79
cgggatccac aattggtacg agggaaagcc 30
<210> 75
<211> 31
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: PCR primer
<220>
<221> misc_feature
<222> (1). (31)
<223> PCR primer designed to 3' end of tpa92 open
reading frame
<400> 75
cggaattcct acaaattatt taccgtgaac g 31
<210> 76
<211> 136
<212> PRT
<213> Treponema pallidum
<400> 76
Phe Ala Ser Asn Thr Asp Trp Glu Gly Lys Asp Ser Lys Gly Asn Val
CA 02325576 2000-10-10
WO 99/53099 PCT/US99/07886
-84-
1 5 10 15
Pro Ala Gly Val Thr Pro Ser Lys Tyr Gly Leu Gly Gly Asp Ile Leu
20 25 30
Phe Gly Trp Glu Arg Thr Arg Glu Asp Gly Val Gln Glu Tyr Ile Lys
35 40 45
Val Glu Leu Thr Gly Asn Ser Thr Leu Ser Ser Asp Tyr Ala Gln Ala
50 55 60
Arg Ala Leu Ala Ala Gly ALa Lys Val Ser Met Lys Leu Trp Gly Leu
65 70 75 80
Cys Ala Leu Ala Ala Thr Asp Val Gly His Lys Lys Asn Gly Ala Gln
85 90 95
Gly Thr Val Gly Ala Asp Ala Leu Leu Thr Leu Gly Tyr Arg Trp Phe
100 105 110
Ser Ala Gly Gly Tyr Phe Ala Ser Xaa Ala Ser Asn Val Phe Gly Gly
115 120 125
Val Phe Leu Asn Met Ala Met Arg
130 135
<210> 77
<211> 136
<212> PRT
<213> Treponema pallidum
<400> 77
Phe Ala Ser Asn Thr Asp Trp Glu Gly Lys Asp Ser Lys Gly Asn Val
1 5 10 15
Pro Ala Gly Val Thr Pro Ser Lys Tyr Gly Leu Gly Gly Asp Ile Leu
20 25 30
Phe Gly Trp Glu Arg Thr Arg Glu Asp Gly Val Gln Glu Tyr Ile Lys
35 40 45
Val Glu Leu Thr Gly Asn Ser Thr Leu Ser Ser Asp Tyr Ala Gln Ala
50 55 60
Arg Ala Leu Ala Ala Gly Ala Lys Val Ser Met Lys Leu Trp Gly Leu
65 70 75 80
Cys Ala Leu Ala Ala Thr Asp Val Gly His Lys Lys Asn Gly Ala Gln
85 90 95
Gly Thr Val Gly Ala Asp Ala Leu Leu Thr Leu Gly Tyr Arg Trp Phe
100 105 110
Ser Ala Gly Gly Tyr Phe Ala Ser Gln Ala Ser Asn Val Phe Gly Gly
115 120 125
Val Phe Leu Asn Met Ala Met Arg
CA 02325576 2000-10-10
WO 99/53099 PCT/US99/07886
-85-
130 135
<210> 78
<211> 138
<212> PRT
<213> Treponema pallidum
<400> 78
Phe Ala Ser Asn Thr Asp Trp Glu Gly Lys Pro Asn Gly Asn Val Pro
1 5 10 15
Ala Gly Ala Asn His Ser Lys Tyr Gly Leu Gly Gly Asp Ile Leu Phe
20 25 30
Gly Trp Glu Arg Thr Arg Glu Asp Gly Val Gln Glu Tyr Ile Lys Val
35 40 45
Glu Leu Thr Gly Asn Ser Thr Leu Ser Ser Asp Tyr Ala Arg Ala Pro
50 55 60
Ala Asn Ile Leu Trp Asp Val Gly Ala Lys Val Ser Met Lys Leu Trp
65 70 75 80
Gly Leu Cys Ala Leu Ala Ala Thr Asp Val Gly His Lys Lys Asn Gly
85 90 95
Ala Asn Gly Asp Ile Gly Ala Asp Ala Leu Leu Thr Leu Gly Tyr Arg
100 105 110
Trp Phe Ser Ala Gly Gly Tyr Phe Ala Ser Gln Ala Ser Asn Val Phe
115 120 125
Gln Gly Val Phe Leu Asn Met Ala Met Arg
130 135
<210> 79
<211> 141
<212> PRT
<213> Treponemapallidum
<400> 79
Phe Ala Ser Thr TrpGlu GlyLysAsp Ser Gly LysAla
Asn Asp Gln
1 5 10 15
Pro Gly Ala Pro LysTyr GlyLeuGly Gly Ile LeuPhe
Thr Ser Asp
20 25 30
Gly Trp Glu Thr GluAsp GlyValGln Glu Ile LysVal
Arg Arg Tyr
35 40 45
Glu Leu Thr Asn ThrLeu SerSerGly Tyr Gln AlaAla
Gly Ser Ala
50 55 60
Arg Ala Pro Asn LeuTrp AspValGly Ala Val SerMet
Ala Ile Lys
65 70 75 BO
CA 02325576 2000-10-10
WO 99/53099 PCT/US99/07886
-86-
Lys Leu Trp Gly Leu Cys Ala Leu Ala Ala Thr Asp Val Gly His Lys
85 90 95
Lys Asn Gly Ala Asn Gly Asp Ile Gly Ala Asp Ala Leu Leu Thr Leu
100 105 110
Gly Tyr Arg Trp Phe Ser Ala Gly Gly Tyr Phe Ala Ser Lys Ala Ser
115 120 125
Asn Val Phe Gln Gly Val Phe Leu Asn Met Ala Met Arg
130 135 140
<210> 80
<211> 140
<212> PRT
<213> Treponema pallidum
<400> 80
Phe Ala Ser Asn Thr Asp Trp Glu Gly Lys Asp Ser Gln Gly Lys Ala
1 5 10 15
Pro Ala Gly Val Thr Pro Ser Lys Tyr Gly Leu Gly Gly Asp Ile Leu
20 25 30
Phe Gly Trp Glu Arg Thr Arg Glu Asp Gly Val Gln Glu Tyr Ile Lys
35 40 45
Val Glu Leu Thr Gly Asn Ser Thr Leu Ser Ser Gly Tyr Ala Thr Ala
50 55 60
Pro Ala Asn Asp Ile Leu Trp Asp Val Gly Ala Lys Val Ser Met Lys
65 70 75 80
Leu Trp Gly Leu Cys Ala Leu Ala Ala Thr Asp Val Gly His Lys Lys
85 90 95
Asn Gly Ala Asn Gly Gly Ile Gly Ala Asp Ala Leu Leu Thr Leu Gly
100 105 110
Tyr Arg Trp Phe Ser Ala Gly Gly Tyr Phe Ala Ser Gln Ala Ser Asn
115 120 125
Val Phe Gln Gly Val Phe Leu Asn Met Ala Met Arg
130 135 140
<210> 81
<211> 152
<212> PRT
<213> Treponema pallidum
<400> 81
Phe Ala Ser Asn Thr Asp Trp Glu Gly Lys Ser Asn Thr Gly Ala Pro
1 5 10 15
Ala Ala Gly Val Thr Pro Ser Lys Tyr Gly Leu Gly Gly Asp Ile Leu
20 25 30
CA 02325576 2000-10-10
WO 99/53099 PCTNS99/07886
_87_
Phe Gly Trp Glu Arg Thr Arg Glu Asp Gly Val Gln Glu Tyr Thr Lys
35 40 45
Val Glu Leu Thr Gly Asn Ser Thr Leu Ser Ser Gly Tyr Ala Gln Ala
50 55 60
Ala Gly Ala Ala Ala Gly Val Pro Ala Ala Ala Asp Asp Ile Leu Trp
65 70 75 80
Asp Val Gly Ala Lys Val Ser Met Lys Leu Trp Gly Leu Cys Ala Leu
85 90 95
Ala Ala Thr Asp Val Gly His Lys Lys Glu Asn Ala Ala Asn Val Asn
100 105 110
Gly Thr Val Gly Ala Asp Ala Leu Leu Thr Leu Gly Tyr Arg Trp Phe
115 120 125
Ser Ala Gly Gly Tyr Phe Ala Ser Lys Ala Ser Asn Val Phe Gln Gly
130 135 140
Val Phe Leu Asn Met Ala Met Arg
145 150
<210> 82
<211> 147
<212> PRT
<213> Treponema pallidum
<400> 82
Phe Ala Ser Asn Thr Asp Trp Glu Gly Lys Pro Asn Gly Asn Val Pro
1 5 10 15
Ala Gly Val Thr Pro Ser Lys Tyr Gly Leu Gly Gly Asp Ile Leu Phe
20 25 30
Gly Trp Glu Arg Thr Arg Glu Asp Gly Val Gln Glu Tyr Ile Lys Val
35 40 45
Glu Leu Thr Gly Asn Ser Thr Leu Ser Ser Gly Tyr Ala Thr Ala Arg
50 55 60
Ala Gln Leu Pro Ala Val Ala Pro Ala Asn Asp Ile Leu Trp Asp Val
65 70 75 80
Gly Ala Lys Val Ser Met Lys Leu Trp Gly Leu Cys Ala Leu Ala Ala
85 90 95
Thr Asp Val Gly Arg Lys Lys Asp Gly Ala Gln Gly Thr Val Gly Ala
100 105 110
Asp Ala Leu Leu Thr Leu Gly Tyr Arg Trp Phe Ser Ala Gly Gly Tyr
115 120 125
Phe Ala Ser Gln Ala Ser Asn Val Phe Gln Gly Val Phe Leu Asn Met
130 135 140
CA 02325576 2000-10-10
WO 99/53099 PCT/US99/07886
_88_
Ala Met Arg
145
<210> 83
<211> 145
<212> PRT
<213> Treponema pallidum
<400> 83
Phe Ala Ser Asn Thr Asp Trp Glu Gly Lys Pro Asn Gly Asn Val Pro
1 5 10 15
Ala Gly Val Thr Pro Ser Lys Tyr Gly Leu Gly Gly Asp Ile Leu Phe
20 25 30
Gly Trp Glu Arg Thr Arg Glu Asp Gly Val Gln Glu Tyr Ile Lys Val
35 40 45
Glu Leu Thr Gly Asn Ser Thr Leu Ser Ser Gly Tyr Ala Gln Ala Ala
50 55 60
Ala Ala Ala Ala Ala Val Asn Asn Asp Ile Leu Trp Asp Val Gly Ala
65 70 75 80
Lys Val Ser Met Lys Leu Trp Gly Leu Cys Ala Leu Ala Ala Thr Asp
85 90 95
Val Gly Arg Lys Lys Asp Gly Ala Gln Gly Thr Val Gly Ala Asp Ala
100 105 110
Leu Leu Thr Leu Gly Tyr Arg Trp Phe Ser Ala Gly Gly Tyr Phe Ala
115 120 125
Ser Lys Ala Ser Asn Val Phe Gln Gly Val Phe Leu Asn Met Ala Met
130 135 140
Arg
195
<210> 84
<211> 143
<212> PRT
<213> Treponema pallidum
<400> 84
Phe Ala Ser Asn Thr Asp Trp Glu Gly Lys Ser Asn Thr Gly Ala Pro
1 5 10 15
Ala Gly Val Thr Pro Ser Lys Tyr Gly Leu Gly Gly Asp Ile Leu Phe
20 25 30
Gly Trp Glu Arg Thr Arg Glu Asp Gly Val Gln Glu Tyr Ile Lys Val
35 40 45
Glu Leu Thr Gly Asn Ser Thr Leu Ser Ser Gly Tyr Ala Gln Ala Ala
CA 02325576 2000-10-10
WO 99/53099 PCT/US99/07886
_89_
50 55 60
ProAla Pro Asn AlaIle LeuTrp Asp Gly LysVal
Ala Asn Val Ala
65 70 75 80
SerMet Lys Trp LeuCys AlaLeu Ala Thr ValGly
Leu Gly Ala Asp
85 90 95
ArgLys Lys Gly GlnGly ThrVal Gly Asp LeuLeu
Asp Ala Ala Ala
100 105 110
ThrLeu Gly Arg PheSer AlaGly Gly Phe SerGln
Tyr Trp Tyr Ala
115 120 125
AlaSer Asn Phe GlyVal PheLeu Asn Ala Arg
Val Gln Met Met
130 135 140
<210> 85
<211> 194
<212> PRT
<213> Treponemapallidum
<400> 85
Phe Ala Ser Thr TrpGlu GlyLysSer ThrGly Pro
Asn Asp Asn Ala
1 5 10 15
Ala Gly Val Pro LysTyr GlyLeuGly AspIle Phe
Thr Ser Gly Leu
20 25 30
Gly Trp Glu Thr GluAsp GlyValGln TyrIle Val
Arg Arg Glu Lys
35 40 45
Glu Leu Thr Asn ThrLeu SerSerGly AlaGln Ala
Gly Ser Tyr Ala
50 55 60
Gly Ala Ala Asn AsnPhe ProValTrp ValGly Lys
Ala Ile Asp Ala
65 70 75 80
Val Ser Met Leu GlyLeu CysAlaLeu AlaThr Val
Lys Trp Ala Asp
85 90 95
Gly Arg Lys Asp AlaGln GlyThrVal AlaAsp Leu
Lys Gly Gly Ala
100 105 110
Leu Thr Leu Tyr TrpPhe SerAlaGly TyrPhe Ser
Gly Arg Gly Ala
115 120 125
Lys Ala Ser Val GlnGly ValPheLeu MetAla Arg
Asn Phe Asn Met
130 135 140
<210> 86
<211> 140
<212> PRT
CA 02325576 2000-10-10
WO 99/53099 PCTNS99/07886
_9Q_
<213> Treponemapallidum
<400> 86
Phe Ala Ser Thr TrpGlu Lys Ser ThrGly AlaPro
Asn Asp Gly Asn
1 5 10 15
Ala Gly Val Pro LysTyr Leu Gly AspIle LeuPhe
Thr Ser Gly Gly
20 25 30
Gly Trp Glu Thr GluAsp Val Gln TyrIle LysVal
Arg Arg Gly Glu
35 40 45
Glu Leu Thr Asn ThrLeu Ser Gly AlaPro AlaPro
Gly Ser Ser Tyr
50 55 60
Ala Asn Asn Ile TrpAsp Gly Ala ValSer MetLys
Ala Leu Val Lys
65 70 75 80
Leu Trp Gly Cys LeuAla Thr Asp GlyArg LysLys
Leu Ala Ala Val
85 90 95
Asp Gly Ala Gly ValGly Asp Ala LeuThr LeuGly
Gln Thr Ala Leu
100 105 110
Tyr Arg Trp Ser GlyGly Phe Ala LysAla SerAsn
Phe Ala Tyr Ser
115 120 125
Val Phe Gln Val PheAsn Ala Met
Gly Phe Met Arg
130 135 140
<210> 87
<211> 141
<212> PRT
<213> Treponemapallidum
<400> 87
Phe Ala Ser Thr TrpGluGly Pro Asn Asn Pro
Asn Asp Lys Gly Val
1 S 10 15
Ala Giy Val Pro LysTyrGly Gly Gly Ile Phe
Thr Ser Leu Asp Leu
20 25 30
Gly Trp Glu Thr GluAspGly Gln Glu Ile Val
Arg Arg Val Tyr Lys
35 40 45
Glu Leu Thr Asn ThrLeuSer Gly Tyr Gln Ala
Gly Ser Ser Ala Ala
50 55 60
Ala Val Asn Asp LeuTrpAsp Gly Ala Val Met
Asn Ile Val Lys Ser
65 70 ?5 80
Lys Leu Trp Leu AlaLeuAla Thr Asp Gly Lys
Gly Cys Ala Val Arg
85 90 95
Lys Asp Gly Gln ThrValGly Asp Ala Leu Leu
Ala Gly Ala Leu Thr
100 105 110
CA 02325576 2000-10-10
WO 99/53099 PCT/US99/07886
-91-
Gly Tyr Arg Trp Phe Ser Ala Gly Gly Tyr Phe Ala Ser Lys Ala Ser
115 120 125
Asn Val Phe Gln Gly Val Phe Leu Asn Met Ala Met Arg
130 135 140
<210> 88
<211> 148
<212> PRT
<213> Treponema pallidum
<400> 88
Phe Ala Ser Asn Thr Asp Trp Glu Gly Lys Asp Ser Lys Gly Val Val
1 5 10 15
Gln Ala Gly Ala Asn His Ser Lys Tyr Gly Leu Gly Gly Asp Ile Leu
20 25 30
Phe Gly Trp Glu Arg Thr Arg Glu Asp Gly Val Gln Glu Tyr Ile Lys
35 40 45
Val Glu Leu Thr Gly Asn Ser Thr Leu Ser Ser Gly Tyr Ala Gln Ala
50 55 60
Ala Ala Ala Ala Ala Ala Ala Ala Val Asn Asn Asp Ile Leu Trp Asp
65 70 75 80
Val Gly Ala Lys Val Ser Met Arg Leu Trp Gly Leu Cys Ala Leu Ala
85 90 95
Ala Thr Asp Val Gly Arg Lys Lys Asp Gly Ala Gln Gly Thr Val Gly
100 105 110
Ala Asp Ala Leu Leu Thr Leu Gly Tyr Arg Trp Phe Ser Ala Gly Gly
115 120 125
Tyr Phe Ala Ser Gln Ala Ser Asn Val Phe Gln Gly Val Phe Leu Asn
130 135 140
Met Ala Met Arg
145
<210> 89
<211> 143
<212> PRT
<213> Treponema pallidum
<400> 89
Phe Ala Ser Asn Thr Asp Trp Glu Gly Lys Pro Asn Gly Asn Val Pro
1 5 10 15
Ala Gly Val Thr Pro Ser Lys Tyr Gly Leu Gly Gly Asp Ile Leu Phe
20 25 30
Gly Trp Glu Arg Thr Arg Glu Asp Gly Val Gln Glu Tyr Ile Lys Val
35 40 45
CA 02325576 2000-10-10
WO 99/53099 PCTNS99/07886
-92-
Glu Leu Thr Gly Asn Ser Thr Leu Ser Ser Gly Tyr Ala Pro Ala Gln
50 55 60
Pro Pro Ala Asn Ile Leu Trp Asp Val Gly Ala Lys Val Ser Met Lys
65 70 75 80
Leu Trp Gly Leu Cys Ala Leu Ala Ala Thr Asp Val Gly His Lys Lys
85 90 95
Glu Asn Ala Ala Asn Val Asn Gly Thr Val Gly Ala Asp Ala Leu Leu
100 105 110
Thr Leu Gly Tyr Arg Trp Phe Ser Ala Gly Gly Tyr Phe Ala Ser Gln
115 120 125
Ala Ser Asn Val Phe Gln Gly Val Phe Leu Asn Met Ala Met Arg
130 135 140
<210> 90
<211> 142
<212> PRT
<213> Treponema pallidum
<400> 90
Phe Ala Ser Asn Pro Asp Trp Glu Gly Lys Asp Ser Gln Gly Lys Ala
1 5 10 15
Pro Ala Gly Val Thr Pro Ser Lys Tyr Gly Leu Gly Gly Asp Ile Leu
20 25 30
Phe Gly Trp Glu Arg Thr Arg Glu Asp Gly Val Gln Glu Tyr Ile Lys
35 40 45
Val Glu Leu Thr Gly Asn Ser Thr Leu Ser Ser Gly Tyr Ala Gln A1a
50 55 60
Ala Ala Val Asn Asn Asp Ile Leu Trp Asp Val Gly Ala Lys Val Ser
65 70 75 80
Met Lys Leu Trp Gly Leu Cys Ala Leu Ala Ala Thr Asp Val Gly Arg
85 90 95
Lys Lys Asp Gly Ala Gln Gly Thr Val Gly Ala Asp Ala Leu Leu Thr
100 105 110
Leu Gly Tyr Arg Trp Phe Ser Ala Gly Gly Tyr Phe Ala Ser Gln Ala
115 120 125
Ser Asn Val Phe Gln Gly Val Phe Leu Asn Met Ala Met Arg
130 135 140
<210> 91
<211> 140
<212> PRT
<213> Treponema pallidum
CA 02325576 2000-10-10
WO 99/53099 PCT/US99/07886
-93-
<400> 91
Phe Ala Ser Asn Thr Asp Trp Glu Gly Lys Asp Ser Lys Gly Val Val
1 5 10 15
Gln Ala Gly Ala Asn His Ser Lys Tyr Gly Leu Gly Gly Asp Ile Leu
20 25 30
Phe Gly Trp Glu Arg Thr Arg Glu Asp Gly Val Gln Glu Tyr Ile Lys
35 40 45
Val Glu Leu Thr Gly Asn Ser Thr Leu Ser Gly Gly Tyr Ala Thr Ala
50 55 60
Pro Ala Asn Asp Ile Leu Trp Asp Val Gly Ala Lys Val Ser Met Lys
65 70 75 80
Leu Trp Gly Leu Cys Ala Leu Ala Ala Thr Asp Val Gly His Lys Lys
85 90 95
Asn Gly Ala Asn Gly Asp Ile Gly Ala Asp Ala Leu Leu Thr Leu Gly
100 105 110
Tyr Arg Trp Phe Ser Ala Gly Gly Tyr Phe Ala Ser Lys Ala Ser Asn
115 120 125
Val Phe Gln Gly Val Phe Leu Asn Met Ala Met Arg
130 135 140
<210> 92
<211> 143
<212> PRT
<213> Treponema pallidum
<400> 92
Phe Ala AsnThr Asp Glu Lys Ser Lys Val Val
Ser Trp Gly Asp Gly
1 5 10 15
Gln Ala AlaAsn His Lys Gly Gly Gly Ile Leu
Gly Ser Tyr Leu Asp
20 25 30
Phe Gly GluArg Thr GIu Gly Gln Glu Ile Lys
Trp Arg Asp Val Tyr
35 40 45
Val Glu ThrGly Asn Thr Ser Gly Tyr Gln Ala
Leu Ser Leu Ser Ala
50 55 60
Ala Gly ProAla Asn Ile Trp Val Gly Lys Val
Ala Asp Leu Asp Ala
65 70 75 80
Ser Met LeuTrp Gly Cys Leu Ala Thr Val Gly
Lys Leu Ala Ala Asp
85 90 95
Arg Lys AspGly Ala Gly Val Ala Asp Leu Leu
Lys Gln Thr Gly Ala
100 105 110
Thr Leu TyrArg Trp Ser Gly Tyr Phe Ser Gln
Gly Phe Ala Gly Ala
CA 02325576 2000-10-10
WO 99/53099 PCT/US99/07886
-94-
115 120 125
Ala Ser Asn Val Phe Gln Gly Val Phe Leu Asn Met Ala Met Arg
130 135 140
<210> 93
<211> 139
<212> PRT
<213> Treponema pallidum
<400> 93
Phe Ala Ser Asn Thr Asp Trp Glu Gly Lys Pro Asn Gly Asn Val Pro
1 5 10 15
Ala Gly Ala Asn His Ser Lys Tyr Gly Leu Gly Gly Asp Ile Leu Phe
20 25 30
Gly Trp Glu Arg Thr Arg Glu Asp Gly Val Gln Glu Tyr Ile Lys Val
35 40 45
Glu Leu Thr Gly Asn Ser Thr Leu Ser Ser Gly Tyr Ala Gln Ala Ala
50 55 60
Gly Ala Asn Ile Leu Trp Asp Val Gly Ala Lys Val Ser Met Lys Leu
65 70 75 80
Trp Gly Leu Cys Ala Leu Ala Ala Thr Asp Val Gly His Lys Lys Asn
85 90 95
Gly Ala Asn Gly Asp Ile Gly Ala Asp Ala Leu Leu Thr Leu Gly Tyr
100 105 110
Arg Trp Phe Ser Ala Gly Gly Tyr Phe Ala Ser Gln Ala Ser Asn Val
115 120 125
Phe Gln Gly Val Phe Leu Asn Met Ala Met Arg
130 135
<210> 94
<211> 140
<212> PRT
<213> Treponema pallidum
<400> 94
Phe Ala Ser Asn Thr Asp Trp Glu Gly Lys Pro Asn Gly Asn Val Gln
1 5 10 15
Ala Gly Ala Asn His Ser Lys Tyr Gly Leu Gly Gly Asp Ile Leu Phe
20 25 30
Gly Trp Glu Arg Thr Arg Glu Asp Gly Val Gln Glu Tyr Ile Lys Val
35 40 45
Glu Leu Ala Gly Asn Ser Thr Leu Ser Ser Gly Tyr Ala Pro Ala Gln
50 55 60
CA 02325576 2000-10-10
WO 99/53099 PCT/US99/07886
-95-
Pro Pro Ala Asn Ile Leu Trp Asp Val Gly Ala Lys Val Ser Met Lys
65 70 75 80
Leu Trp Gly Leu Cys Ala Leu Ala Ala Thr Asp Val Gly His Lys Lys
85 90 95
Asn Gly Ala Asn~Gly Asp Ile Gly Ala Asp Ala Leu Leu Thr Leu Gly
200 105 110
Tyr Arg Trp Phe Ser Ala Gly Gly Tyr Phe Ala Ser Gln Ala Ser Asn
115 120 125
Val Phe Gln Gly Val Phe Leu Asn Met Ala Met Arg
130 135 140
<210> 95
<211> 141
<212> PRT
<213> Treponema pallidum
<900> 95
Phe Ala Ser Asn Thr Asp Trp Glu Gly Lys Asp Ser Lys Gly Val Val
1 5 10 15
Gln Ala Gly Ala Asn His Ser Lys Tyr Gly Leu Gly Gly Asp Ile Leu
20 25 30
Phe Gly Trp Glu Arg Thr Arg Glu Asp Gly Val Gln Glu Tyr Ile Lys
35 40 45
Val Glu Leu Thr Gly Asn Ser Thr Leu Ser Ser Gly Tyr Ala Pro Ala
50 55 60
Pro Ala Asn Asn Ala Ile Leu Trp Asp Val Gly Ala Lys Val Ser Met
65 70 75 80
Lys Leu Trp Gly Leu Cys Ala Leu Ala Ala Thr Asp Val Gly His Lys
85 90 95
Lys Asn Gly Ala Asn Gly Asp Ile Gly Ala Asp Ala Leu Leu Thr Leu
100 105 110
Gly Tyr Arg Trp Phe Ser Ala Gly Gly Tyr Phe Ala Ser Gln Ala Ser
115 120 125
Asn Val Phe Gln Gly Val Phe Leu Asn Met Ala Met Arg
130 135 140
<210> 96
<211> 141
<212> PRT
<213> Treponema pallidum
<400> 96
Phe Ala Ser Asn Thr Asp Trp Glu Gly Lys Asp Ser Lys Gly Val Val
1 5 10 15
CA 02325576 2000-10-10
WO 99/53099 PCT/US99/07886
-96-
Gln Gly His Lys Tyr Leu Gly IleLeu
Ala Ala Ser Gly Gly Asp
Asn
20 25 30
PheGly TrpGlu Thr Glu Asp Val GluTyr IleLys
Arg Arg Gly Gln
35 40 45
ValGlu LeuThr Asn Thr Leu Ser TyrAla ThrAla
Gly Ser Ser Gly
50 55 60
ProAla AlaAla Ile Trp Asp Gly LysVal SerMet
Asn Leu Val Ala
65 70 75 80
LysLeu TrpGly Cys Leu Ala Thr ValGly HisLys
Leu Ala Ala Asp
85 90 95
LysAsn GlyAla Gly Ile Gly Asp LeuLeu ThrLeu
Asn Asp Ala Ala
100 105 110
GlyTyr ArgTrp Ser Gly Gly Phe SerGln AlaSer
Phe Ala Tyr Ala
115 120 125
AsnVal PheGln Val Leu Asn Ala Arg
Gly Phe Met Met
130 135 140
<210> 97
<211> 140
<212> PRT
<213> Treponemapallidum
<400> 97
Phe Ala Ser Thr Trp GlyLys SerGlnGly LysAla
Asn Asp Glu Asp
1 5 10 15
Pro Ala Gly Pro Lys GlyLeu GlyAspIle LeuPhe
Thr Ser Tyr Gly
20 25 30
Gly Trp Glu Thr Glu GlyVal GlyTyrIle LysVal
Arg Arg Asp Gln
35 40 45
Glu Leu Thr Asn Thr SerGly TyrAlaArg AlaGln
Gly Ser Leu Asp
50 55 60
Pro Pro Ala Ile Trp ValGly LysValSer MetLys
Asn Leu Asp Ala
65 70 75 80
Leu Trp Gly Cys Leu AlaThr ValGlyArg LysLys
Leu Ala Ala Asp
85 90 95
Asp Gly Ala Gly Val AlaAsp LeuLeuThr LeuGly
Gln Thr Gly Ala
100 105 110
Tyr Arg Trp Ser Gly TyrPhe SerLysAla SerAsn
Phe Ala Gly Ala
115 120 125
Val Phe Gln Val Leu MetAla Arg
Gly Phe Asn Met
130 135 140
CA 02325576 2000-10-10
WO 99/53099 PCTNS99/07886
-97-
<210> 98
<211> 141
<212> PRT
<213> Treponemapallidum
<400> 98
Phe Ala Ser Thr Asp Glu LysAsp Lys Gly Val
Asn Trp Gly Ser Val
1 5 10 15
Gln Ala Gly Asn His Lys GlyLeu Gly Asp Leu
Ala Ser Tyr Gly Ile
20 25 30
Phe Gly Trp Arg Thr Glu GlyVal Glu Tyr Lys
Glu Arg Asp Gln Ile
35 40 45
Val Glu Leu Gly Rsn Thr SerGly Tyr Ala Ala
Thr Ser Leu Asp Arg
50 55 60
Gln Pro Pro Asn Ile Trp ValGly Lys Val Met
Ala Leu Asp Ala Ser
65 70 75 80
Lys Leu Tip Leu Cys Leu AlaThr Val Gly Lys
Gly Ala Ala Asp Arg
85 90 95
Lys Asp Gly Gln Gly Val AlaAsp Leu Leu Leu
Ala Thr Gly Ala Thr
100 105 110
Gly Tyr Arg Phe Ser Gly TyrPhe Ser Gln Ser
Trp Ala Gly Ala Ala
115 I20 125
Asn Val Phe Gly Val Leu MetAla Arg
Gln Phe Asn Met
130 135 140
<210> 99
<211> 139
<212> PRT
<213> Treponemapallidum
<400> 99
Phe Ala Ser Thr Asp GluGly Ser Thr Ala Pro
Asn Trp Lys Asn Gly
1 5 10 15
Ala Gly Thr Ser Lys GlyLeu Gly Ile Phe Gly
Pro Tyr Gly Asp Leu
20 25 30
Trp Glu Arg Arg Glu GlyVal Glu Ile Val Glu
Thr Asp Gln Tyr Lys
35 40 45
Leu Thr Gly Ser Thr SerGly Tyr Arg Gln Pro
Asn Leu Asp Ala Ala
50 55 60
Pro Ala Asn Leu Trp ValGly Lys Ser Lys Leu
Ile Asp Ala Val Met
65 70 75 80
Trp Gly Leu Cys Ala Leu Ala Ala Thr Asp Val Gly His Lys Lys Asn
CA 02325576 2000-10-10
WO 99/53099 PCTNS99/07886
_98_
e5 90 95
Gly Ala Asn Gly Asp Ile Gly Ala Asp Ala Leu Leu Thr Leu Gly Tyr
100 105 110
Arg Trp Phe Ser Ala Gly Gly Tyr Phe Ala Ser Lys Ala Ser Asn Val
115 120 125
Phe Gln Gly Val Phe Leu Asn Met Ala Met Arg
130 135
<210> 100
<211> 196
<212> PRT
<213> Treponema pallidum
<400> 100
Phe Ala Ser Asn Thr Asp Trp Glu Gly Lys Pro Asn Gly Asn Val Pro
1 5 10 15
Ala Gly Val Thr Pro Ser Lys Tyr Gly Leu Gly Gly Asp Ile Leu Phe
20 25 30
Gly Trp Ala Arg Thr Arg Glu Asp Gly Val Gln Glu Tyr Ile Lys Val
35 40 45
Glu Leu Thr Gly Asn Ser Thr Leu Ser Ser Gly Tyr Ala Gln Ala Ala
50 55 60
Pro Ala Ala Val Asn Asn Asp Ile Leu Trp Asp Val Gly Ala Lys Val
65 70 75 80
Ser Met Lys Leu Trp Gly Leu Cys Ala Leu Ala Ala Thr Asp Val Gly
85 90 95
His Lys Lys Glu Asn Ala Ala Asn Val Asn Gly Thr Val Gly Ala Asp
100 105 110
Ala Leu Leu Thr Leu Gly Tyr Arg Trp Phe Ser Ala Gly Gly Tyr Phe
115 120 125
Ala Ser Gln Rla Ser Asn Val Phe Gln Gly Val Phe Leu Asn Met Ala
130 135 140
Met Arg
145
<210> 101
<211> 141
<212> PRT
<213> Treponema pallidum
<400> 101
Phe Ala Ser Asn Thr Asp Trp Glu Gly Lys Ser Asn Thr Gly Val Val
1 5 10 15
CA 02325576 2000-10-10
WO 99/53099 PCT/US99/07886
-99-
Gln Ala Gly Ala Asn His Ser Lys Tyr Gly Leu Gly Gly Asp Ile Leu
20 25 30
Phe Gly Trp Ala Arg Thr Arg Glu Asp Gly Val Gln Glu Tyr Ile Lys
35 40 45
Val Glu Leu Thr Gly Asn Ser Thr Leu Ser Ser Gly Tyr Ala Thr Ala
50 55 60
Gln Pro Pro Ala Asn Ile Leu Trp Asp Val Gly Ala Lys Val Ser Met
65 70 75 80
Lys Leu Trp Gly Leu Cys Ala Leu Ala Ala Thr Asp Val Gly His Lys
85 90 95
Lys Asn Gly Ala Gln Gly Thr Val Gly Ala Asp Ala Leu Leu Thr Leu
100 105 110
Gly Tyr Arg Trp Phe Ser Ala Gly Gly Tyr Phe Ala Ser Gln Ala Ser
115 120 125
Asn Val Phe Gln Gly Val Phe Leu Asn Met Ala Met Arg
130 135 140
<210> 102
<211> 139
<212> PRT
<213> Treponema pallidum
<400> 102
Phe Ala Ser Asn Thr Asp Trp Glu Gly Lys Pro Asn Gly Lys Ala Pro
1 5 10 15
Ala Gly Thr Pro Ser Lys Tyr Gly Leu Gly Gly Asp Ile Leu Phe Gly
20 25 30
Trp Glu Arg Thr Arg Glu Asp Gly Val Gln Glu Tyr Ile Lys Val Glu
35 40 45
Leu Thr Gly Asn Ser Thr Leu Ser Ser Gly Tyr Ala Thr Ala Arg Ala
50 55 60
Gly Ala Asp Ile Leu Trp Asp Val Gly Ala Lys Val Ser Met Lys Leu
65 70 75 80
Trp Gly Leu Cys Ala Leu Ala Ala Thr Asp Val Gly His Lys Lys Asn
85 90 95
Gly Ala Gln Gly Thr Val Gly Ala Asp Ala Leu Leu Thr Leu Gly Tyr
100 105 110
Arg Trp Phe Ser Ala Gly Gly Tyr Phe Ala Ser Gln Ala Ser Asn Val
115 120 125
Phe Gln Gly Val Phe Leu Asn Met Ala Met Arg
130 135
CA 02325576 2000-10-10
WO 99/53099 PCT/US99/07886
-100-
<210>
103
<211>
143
<212>
PRT
<213> pallidum
Treponema
<400>
103
Phe Ala Asn Thr Trp GluGlyLys Pro Gly ValPro
Ser Asp Asn Asn
1 5 10 15
Ala Gly Thr Pro Lys TyrGlyLeu Gly Asp LeuPhe
Val Ser Gly Ile
20 25 30
Gly Trp Arg Thr Glu AspGlyVal Gln Tyr LysVal
Ala Arg Glu Ile
35 40 45
Glu Leu Gly Asn Thr LeuSerSer Gly Ala AlaAla
Thr Ser Tyr Gln
50 55 60
Gly Ala Val Asn Asp IleLeuTrp Asp Gly LysVal
Ala Asn Val Ala
65 70 75 80
Ser Met Leu Trp Leu CysAlaLeu Ala Thr ValGly
Lys Gly Ala Asp
85 90 95
His Lys Asn Gly Gln GlyThrVal Gly Asp LeuLeu
Lys Ala Ala Ala
100 105 110
Thr Leu Tyr Arg Phe SerAlaGly Gly Phe SerLys
Gly Trp Tyr Ala
115 120 125
Ala Ser Val Phe Gly ValPheLeu Asn Ala Arg
Asn Gln Met Met
130 135 140
<210> 104
<211> 141
<212> PRT
<213> Treponema pallidum
<400> 104
Phe Ala Ser Asn Thr Asp Trp Glu Gly Lys Ser Asn Thr Gly Val Val
1 5 10 IS
Gln Ala Gly Val Thr Pro Ser Lys Tyr Gly Leu Gly Gly Asp Ile Leu
20 25 30'
Phe Gly Trp Ala Arg Thr Arg Glu Asp Gly Val Gln Glu Tyr Ile Lys
35 40 45
Val Glu Leu Thr Gly Asn Ser Thr Leu Ser Ser Gly Tyr Ala Thr Ala
50 55 60
Gln Pro Pro Ala Asn Ile Leu Trp Asp Val Gly Ala Lys Val Ser Met
65 70 75 80
Lys Leu Trp Gly Leu Cys Ala Leu Ala Ala Thr Asp Val Gly His Lys
85 90 95
CA 02325576 2000-10-10
WO 99/53099 PCT/US99/07886
-101-
Lys Asn Gly Ala Gln Gly Thr Val Gly Ala Asp Ala Leu Leu Thr Leu
100 105 110
Gly Tyr Arg Trp Phe Ser Ala Gly Gly Tyr Phe Ala Ser Gln Ala Ser
115 120 125
Asn Val Leu Gln Gly Val Phe Leu Asn Met Ala Met Arg
130 135 140
<210> 105
<211> 140
<212> PRT
<213> Treponema pallidum
<400> 105
Phe Ala Ser Asn Thr Asp Trp Glu Gly Lys Pro Asn Gly Asn Val Pro
1 5 10 15
Ala Gly Val Thr Pro Ser Lys Tyr Gly Leu Gly Gly Asp Ile Leu Phe
20 25 30
Gly Trp Glu Arg Thr Arg Glu Asp Gly Val Gln Glu Tyr Ile Lys Val
35 40 45
Glu Leu Thr Gly Asn Ser Thr Leu Ser Ser Gly Tyr Ala Thr Ala Arg
50 55 60
Ala Gly Ala Asp Ile Leu Trp Asp Val Gly Ala Lys Val Ser Met Lys
65 70 75 80
Leu Trp Gly Leu Cys Ala Leu Ala Ala Thr Asp Val Gly His Lys Lys
85 90 95
Asn Ala Ala Pro Asp Gly Ile Gly Ala Asp Ala Leu Leu Thr Leu Gly
100 105 110
Tyr Arg Trp Phe Ser Ala Gly Gly Tyr Phe Ala Ser Gln Ala Ser Asn
115 120 125
Val Phe Gln Gly Val Phe Leu Asn Met Ala Met Arg
130 135 190
<210> 106
<211> 139
<212> PRT
<213> Treponema pallidum
<400> 106
Phe Ala Ser Asn Thr Asp Trp Glu GIy Lys Asp Ser Lys Gly Val Val
1 5 10 15
Gln Ala Gly Ala Asn His Ser Lys Tyr Gly Leu Gly Gly Asp Ile Leu
20 25 30
Phe Gly Trp Glu Arg Thr Arg Glu Asp Gly Val Gln Glu Tyr Ile Lys
CA 02325576 2000-10-10
WO 99/53099 PCT/US99/07886
-102-
35 40 45
Val Glu Leu Thr Gly Asn Ser Thr Leu Ser Ser Gly Tyr Ala Gln Pzo
50 55 60
Pro Asn IleLeuTrp Asp Gly LysVal MetLys Leu
Ala Val Ala Ser
65 70 75 80
Trp Leu CysAlaLeu Ala Thr ValGly LysLys Asp
Gly Ala Asp Arg
85 90 95
Gly Gln GlyThrVal Gly Asp LeuLeu LeuGly Tyr
Ala Ala Ala Thr
100 105 110
Arg Phe SerAlaGly Gly Phe SerGln SerAsn Val
Trp Tyr Ala Ala
115 120 125
Phe Gly ValPheLeu Asn Ala Arg
Gln Met Met
130 135
<210> 107
<211> 140
<222> PRT
<2I3> Treponema pallidum
<400> 107
Phe Ala Ser Asn Thr Asp Trp Glu Gly Lys Pro Asn Gly Asn Val Pro
1 5 10 15
Ala Gly Val Thr Pro Ser Lys Tyr Gly Leu Gly Gly Asp Ile Leu Phe
20 25 30
Gly Trp Glu Arg Thr Arg Glu Asp Gly Val Gln Glu Tyr Ile Lys Val
35 40 45
Glu Leu Thr Gly Asn Ser Thr Leu Ser Ser Gly Tyr Ala Thr Ala Arg
50 55 60
Ala Gly Ala Asp Ile Leu Trp Asp Val Gly Ala Lys Val Ser Met Lys
65 70 75 80
Leu Trp Gly Leu Cys Ala Leu Ala Ala Thr Asp Val Gly His Lys Lys
85 90 95
Asn Gly Ala Gln Gly Thr Val Gly Ala Asp Ala Leu Leu Thr Leu Gly
100 105 110
Tyr Arg Trp Phe Ser Ala Gly Gly Tyr Phe Ala Ser Gln Ala Ser Asn
115 120 125
Val Phe Gln Gly Val Phe Leu Asn Met Ala Met Arg
130 135 140
<210> 108
<211> 140
<212> PRT
CA 02325576 2000-10-10
WO 99/53099 PGT/US99/07886
-103-
<213> Treponema pallidum
<400> 108
Phe Ala Ser Asn Thr Asp Trp Glu Gly Lys Pro Asn Gly Asn Val Pro
1 5 10 15
Ala Gly Val Thr Pro Ser Lys Tyr Gly Leu Gly Gly Asp Ile Leu Phe
20 25 30
Gly Trp Xaa Arg Thr Arg Glu Asp Gly Val Gln Glu Tyr Ile Lys Val
35 40 45
Glu Leu Thr Gly Asn Ser Thr Leu Ser Ser Gly Tyr Ala Thr Ala Gln
50 55 60
Pro Pro Ala Asp Ile Leu Trp Asp Val Gly Ala Lys Val Ser Met Lys
65 70 75 80
Leu Trp Gly Leu Cys Ala Leu Ala Ala Thr Asp Val Gly His Lys Lys
85 90 95
Asn Gly Ala Gln Gly Thr Val Gly Ala Asp Ala Leu Leu Thr Leu Gly
100 105 110
Tyr Arg Trp Phe Ser Ala Gly Gly Tyr Phe Ala Ser Gln Ala Ser Asn
115 - 120 125
Val Phe Gln Gly Val Phe Leu Asn Met Ala Met Arg
130 135 140
<210> 109
<211> 139
<212> PRT
<213> Treponema pallidum
<400> 109
Phe Ala AsnThr Asp GluGly Pro GlyLysAla Pro
Ser Trp Lys Asn
1 5 10 15
Ala Gly ProSer Lys GlyLeu Gly IleLeuPhe Gly
Thr Tyr Gly Asp
20 25 30
Trp Glu ThrArg Glu GlyVal Glu IleLysVal Glu
Arg Asp Gln Tyr
35 40 45
Leu Thr AsnSer Thr SerSer Tyr ThrAlaArg Ala
Gly Leu Gly Ala
50 55 60
Gly Ala IleLeu Trp ValGly Lys SerMetLys Leu
Asp Asp Ala Val
65 70 75 80
Trp Gly CysAIa Leu AlaThr Val HisLysLys Asn
Leu Ala Asp Gly
85 90 95
Gly Ala GlyThr Val AlaAsp Leu ThrLeuGly Tyr
Gln Gly Ala Leu
100 105 110
CA 02325576 2000-10-10
WO 99/53099 PC1'/US99/07886
-104-
Arg Trp Phe Ser Ala Gly Gly Tyr Phe Ala Ser Gln Ala Ser Asn Val
115 120 125
Phe Gln Gly Val Phe Leu Asn Met Ala Met Arg
130 135
<210> 110
<211> 1645
<212> DNA
<213> Treponema pallidum
<400> 110
tatgcaggcg tactcactcc gcaggtcagt ggcacagccc agctccagtg gggcattgcg 60
ttccagaaga atccacgcac tggcccgggc aagcacaccc atgggtttcg cactaccaat 120
agtctgacta tttccctgcc gttggtgtca aagcacaccc acacccgccg aggggaggca 180
cgctcagggg tgtgggcaca gctgcagctg aaggacctgg cagtagagct tgcgtcttct 240
aaaagctcaa cggccctgtc ctttaccaaa cctaccgctt ccttccaggc aaccctgcac 300
tgttatgggg cctacctgac agtgggtacc agtccttcct gtgtggttaa ctttgcccag 360
ctgtggaaac cctttgtcac ccgtgcctat tcagaaaagg acactcgcta tgcccctggt 420
ttctccggct ccggggcaaa actcggctac caggcccaca atgtgggaaa cagcggagta 480
gatgtggaca tcggtttcct ctccttcctt tccaatggtg cctgggatag tactgacacc 540
acgcacagca agtatggctt cggggccgat gcaacgcttt cctatggcgt cgaccgtcag 600
cggctgctta cgttggagct ggcagggaat gccacactgg accagaacta cgttaagggt 660
accgaagact ccaagaacga aaacaaaaca gcactcctgt ggggagtagg aggccgactc 720
gccctcgaac caggcgccgg cttccgcttc tccttcgccc tcgacgccgg taaccaacac 780
cagagtaacg cacaattcta cgctagaatg gctccctcac agagggtcca tgaagtcatc 840
actagtcttg gggacacgct gctgacctcc ccgcaacaag atgttgtttc attctttgtg 900
caagaactga gcaaaggcag tcttctggag aaagctggct tagtaacgct cttggcgcag 960
cgcaccatcg tcggcttagc gtcaagcggt ggttacctaa gacatctgaa tggcaaaggc 1020
ctagaaataa acatgaggct catagagcag cagaagaatc ctgacgcgcg gatgcggaca 1080
gcactcttta tttcctggtt gcaattcacg tacaccaaaa cgctcaacat agacgcgctc 1140
ctgcgtatgc agtggaggtg gctctcttct ggcatatact ttgccaccgc aggcactaat 1200
atctttggag aacgtgtttt ctttaagaat caagcaaatc actttgattt tgccggattc 1260
ctcaaactcg aaaccaaaag cggtgacccc tacacccacc tgctcaccgg cctgaacgcc 1320
ggcgtcgaag cacgcgtgta catccccctc acctacacct tttacataaa taacggaggt 1380
gcgcagtaca agggaagtaa ttcggacggc gtcatcaaca cgcctatctt gagcaaagcg 1440
tggtgcagct atcgcatccc cctcggttcc cacgcctggc ttgcaccaca cacatccgtg 1500
ctatgggcaa caaaccgctt caaccacaac cagagcgggg atgcgctcct gcgtgagcac 1560
gcgctccagt accaggtggg actgacgttc agtcccttcg agaaggtgga gctcagcgcc 1620
cagtgggaac agggggtgct tgctg 1645
<210> 111
<211> 20
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: primer designed to 5' end of
mspl3
<220>
<221> misc_feature
<222> (1). (20)
<223> Oligonucleotide used for PCR.
<400> 111
CA 02325576 2000-10-10
WO 99/53099 PCT/US99/0788b
-105-
cactagtcttggggacacgc 20
<210> 112
<211> 19
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: primer designed to 3' end of
mspl3
<220>
<221> misc_feature
<222> (1). (19)
<223> Oligonucleotide used for PCR.
<400> 112
tacgtgattgcaaccagga 19
