Note : Les descriptions sont présentées dans la langue officielle dans laquelle elles ont été soumises.
CA 02327445 2000-10-04
WO 99/51749 PCT/IL99/00184
RECOMBINANT POTYVIRUS CONSTRUCT AND USE THEREOF
Field of the Invention
The present invention generally relates to a recombinant potyvirus infectious
nucleic acid construct useful for providing protection against viral infection
in
plants and to a recombinant virus harboring said construct. More specifically,
the present invention relates to a recombinant potyvirus infectious construct
containing an HC - Pro gene whose sequence coding for the conserved FRNK
box contains a substitution. Preferably, the Arginin (Arg) is substituted with
Isoleucine (11e).
The present invention further relates to a method for the production of a mild
strain of potyvirus utilizing the above mentioned construct and to a method
for
protecting plants from viral infection and for transient expression of foreign
nucleic acid (genes) in plants, using said construct. Preferably, the present
invention relates to a method for cross protection of curcurbits against ZYMV
infection.
Background of the Invention
The Curcurbitaceae is a broad botanical family comprising several
economically important species cultivated worldwide, such as cucumber,
squash, cantaloupe, zucchini pumpkin, melon and watermelon. Curcurbit
production throughout the world is impaired by several aphid transmitted
viruses, the most prevalent being the two potyviruses ZYMV (Zucchini Yellow
Mosaic Virus) and WMV-2 (Watermelon Mosaic Virus 2) and CMV
(cucumber Mosaic Virus). ZYMV infected plants show symptoms such as vein
clearing followed by a yellow mosaic on the infected systemic leaf and may
show stunting and distortion. In mild cases of infection the quantity and
quality
of the yield are damaged and in severe infections there might be a total loss
of
the yield, causing significant economical losses.
1
CA 02327445 2000-10-04
WO 99/51749 PGT/IL99/00184
Control measures include phytosanitation, the use of colored plastic mulches
for attracting virus bearing aphids and creating a hydrophobic barrier around
the plant such as oil sprays. These provide temporary protection and are a
limited protection during a massive infection.
Development of virus resistant cultivars either by classical breeding or by
introducing viral derived nucleic acid sequences into the plant genome through
genetic engineering of plants, is also employed for the protection of plants
against virus infection. Squash hybrid transgenic inbred lines exhibiting
resistance to ZYMV were produced (Tricoli D.M., Carney K.J., Russell
McMaster P.F., Grroff D.W., Hadden K.C., Himmel P.T., Hubbard J. P.,
Boeshore M.L. and Quemada H.D. (1995) Biotechnology vol. 13;1458) but
these are limited to one cultivar only.
The phenomenon of cross protection, which is the use of a mild strain of a
virus
to protect against the damage by infection with severe strains of the same
virus,
provides a good method for controlling virus diseases.
In curcurbits, cross protection, specifically against ZYMV, is an attractive
control option. Cross protection is highly effective under severe disease
pressure. The severity of the disease conferred by the ZYMV on curcurbits
and the letter's relatively short crop cycle (8 - 16 weeks) make cross
protection
a preferred control option for curcurbits.
The currently used mild strain of ZYMV for cross protection of curcurbits, was
obtained by Lecoq (Lecoq H., Lemaire JM., Wipf Scheible C., (199I) Plant
Dis. 75:208-211). This strain is designated ZYMV WK and is poorly
transmitted by aphids, causes only mild leaf mottling and does not induce
fruit
malformation in curcurbits. Plants are inoculated at an early stage with the
mild strain (ZYMV-WK), usually bY mechanical inoculation.
No full length infectious clone of this mild virus exists.
Potyviruses have a genome consisting of a positive - sense single stranded RNA
possessing a covalently linked 5' - terminal viral protein (Vpg) and a 3'
terminal poly (A) tail. The viral RNA is expressed as a single polyprotein,
_. 2
CA 02327445 2000-10-04
WO 99/51749 PCT/IL99/00184
which is subsequently processed by three virus encoded proteases, producing
eight to ten genes, which are a conserved region throughout the potyvirus
genome. The potyviruses are transmitted from plant to plant by aphids in a non
persistent manner, and this process is dependent on the presence of two virus
encoded proteins, the coat protein (CP) and the helper component proteinase
HC-Pro. The HC-Pro is a multifunctional protein involved in aphid
transmission, polyprotein processing, virus replication, symptom expression
and in virus movement in the plant (Mafia I. G., Haenni A., and Bernardi F.,
(1996) Journal of General Virology 77:1335-1341).
Zucchini yellow mosaic virus (ZYMV) is a member of the potyvirus group
which causes devastating epidemics in commercial curcurbits world wide. A
full length clone of ZYMV, from which infectious transcripts were produced,
was constructed (Gal On A., Antignus Y., Rosner A., and Raccah B. (1991)
Journal of General Virology 72:2639-2643).
It was found that a substitution of the Alanin (Ala) residue to Threonin (Thr)
at
position 10 in the conserved DAG (Aspartate - Alanin - Glycine; Asp-Ala-Gly)
triplet in the N terminal region of the CP effectively abolished aphid
transmissibility of ZYMV (Gal On A., Antignus Y., Rosner A., and Raccah B.
(1992) Journal of General Virology 73:2183-2187). Also substitution of Thr
by Ala at position 309 in the HC-Pro gene of the infectious clone of ZYMV
effected aphid transmissibility without changing virus accumulation and
symptom development (Huet H., Gal On A., Meiri E., Lecoq H. and Raccah
B.(1994) Journal of General Virology 75:1407-1414), though less effectively
than the substitution in the DAG triplet in the CP of the ZYMV.
It has surprisingly been found that an amino acid substitution in the
conserved
FRNK box of the potyvirus HC-pro gene allows for the construction of an
infectious potyvirus construct, which, when introduced to plants, induces
little
or no symptom development, and which does not effect the accumulation of the
virus in the plant. This infectious construct is therefore a unique potyvirus
construct which is highly superior for plant cross protection and for
transient
3-
CA 02327445 2000-10-04
WO 99/51749 PCT/IL99/00184
expression of foreign nucleic acid in plants. It has an improved ability of
protection against infection by the severe strain of ZYMV, over any of the
existing protection methods, is significantly safer and more environment
friendly than the naturally occurring viruses, does not cause the development
of
symptoms in a variety of curcurbits, and is stable (no revenant virus has been
found after several passages through plants).
Sunnmary of the Invention
The present invention relates to a recombinant potyvirus infectious nucleic
acid, preferably cDNA or RNA, construct useful for plant cross protection,
comprising a full length clone characterized in that its HC- Pro gene
conserved
FRNK box sequence contains a substitution, preferably a substitution of Arg.
Preferably, the construct further contains a substitution which effectively
abolishes aphid transmissibility, such as a substitution of the Ala residue at
position 10 in the conserved DAG triplet in the N terminal region of the CP or
substitution of Thr at position 309 in the HC - pro in ZYMV.
The recombinant construct of the present invention may be useful for plant
cross protection (especially against severe strains of Z~ and for the
transient expression of foreign nucleic acid in plants wherein the full length
clone has, in any position, a sequence of DNA or RNA inserted into it or
wherein any viral genes are removed from the full length clone (defective
RNA). The full length clone may be of any potyvirus, preferably of ZYMV.
The present invention also relates to a method for providing protection
against
viral infection in plants comprising inoculating plants, by mechanical
inoculation or by bombardment, with the recombinant potyvirus infectious
construct.
The present invention also relates to a method for introducing foreign nucleic
acid into plants according comprising infecting a plant with a full length
clone
or co-infecting a plant with a full length clone, from which any viral genes
are
4
CA 02327445 2000-10-04
WO 99/5149 PCT/IL99/00184
removed, together with a full length clone or virus harboring a full length
clone.
The present invention also relates to a method for the production of a mild
strain of potyvirus comprising inoculating plants with the recombinant
potyvinxs infectious construct as defined in any of the preceding claims and
collecting the resulting progeny, and to a virus produced in this method.
The present invention further relates to compositions for plant inoculation or
for transient expression of foriegn nucleic acid in plants containing, as an
active
ingredient, the recombinant construct or a virus containing the recombinant
construct.
Detailed Description of the Invention
The present invention relates to a recombinant potyvirus infectious nucleic
acid
construct useful for plant cross protection and for the transient expression
of
foreign nucleic acid in plants. The present invention further relates to
compositions for plant inoculation or for transient expression of foriegn
nucleic
acid in plants containing, as an active ingredient, the recombinant construct
or a
virus containing the recombinant construct.
The construct of the present invention comprises a full length potyvirus clone
containing a substitution in the conserved FRNK box sequence in the HC - pro
gene, preferably, Arg (in the FRNK box) is substituted with an amino acid
having a bulky side chain or an amino acid from the hydrophobic group such as
Ile. This substitution in the FRNK box dramatically effects the severity of
symptom development without effecting the accumulation of the virus in the
plant. Preferably, the construct of the present invention also contains a
substitution which effectively abolishes aphid transmissibility , such as the
substitution of the Ala residue to Thr at position 10 in the conserved DAG
(Asp-Ala-Gly) triplet in the N terminal region of the CP or substitution of
Thr
by Ala at position 309 in the HC - pro of ZYMV.
CA 02327445 2000-10-04
WO 99/51749 PCT/IL99/00184
Full length infectious clones of a severe strain of ZYMV were constructed and
put under the control of a phage promoter, such as the T7 RNA polymerise
promoter (Gal On A., Antignus Y., Rosner A., and Raccah B. (1991) Journal of
General Yirolo~ 72:2639-2643), bacterial promoters or a promoter effective in
planta, such as the cauliflower mosaic virus (CaMV) 35S promoter (Gal On A.,
Meiri E., Huet H., Hua W.J., Raccah B. and Gaba V. (1995) Journal of
General Virology 76:3223-3227).
In the work presented here, the FRNK box is implicated, for the first time, as
being of importance in symptom development, surprisingly without effecting
the accumulation of the virus in the plant. Due to the highly conserved
sequence of the FRNK box within the HC -Pro gene of the potyviruses, any
substitution in the FRNK box of a potyvirus would have an effect on symptom
development, not only the substitution of Arg in position 180 with Ile, in
ZYMV, demonstrated in the work described here.
Based on the highly conserved genome, organization and gene function of the
potyviruses, it may be concluded that the conserved FRNK box in the HC - pro
gene has the same function in all potyviruses (perhaps as a receptor).
Therefore, the substitution in the FRNK box in any of the potyviruses would
have a similar effect on symptom development. Members of the potyviruses
that are economically important are, for example, BCMV (Bean Common
Mosaic Virus), BYMV (Bean Yellow Mosaic Virus}, BtMV (Beet mosaic),
hTWMV (Moroccan watermelon mosaic), OYDV (Onion yellow dwarf), PRSV
(Papaya ringspot), PStV (Peanut stripe), PepMoV (Pepper mottle), PVMV
(pepper veinal mottle), CGVBV (Cowpea green vein banding), GEV (ground
eyespot), ISMV (Iris severe mosaic), JGMV (Johnsongrass mosaic), LYSV
(Leek yellow stripe), LMV (Lettuce mosaic), MDMV (Maize dwarf mosaic),
PPV (Plum box), PVA (Potato A), PVV (Potato V), PVY (Potato Y), SbMV
(Soybean mosaic), SCMV (Sugarcane mosaic), SPFMV (Sweet potato feathery
mottle), TEV (Tobacco etch), TVMV (Tobacco vein mottling), TBV (Tulip
6
CA 02327445 2000-10-04
WO 99/51749 PCT/IL99/00184
breaking), TuMV (Turnip mosaic), WMV-2 {Watermelon Mosaic Virus 2) ,
YMV (Yam mosaic), ZYFV {Zucchini yellow fleck).
The infectious clone may be an RNA transcript or a cDNA construct, though
the use of infectious transcripts is the less efficient process in vitro.
A method for providing protection against viral infection in plants, according
to
the present invention comprises inoculating plants with the recombinant
potyvirus infectious construct, for example, by mechanical inoculation or by
bombardment.
Compositions containing, as an active ingredient, the construct of the present
invention may be used for superior plant cross protection, especially against
infection by the severe strain of ZYMV and for transient expression of foreign
nucleic acid in plants. The composition used for the introduction of the
construct into plants, for infecting them by bombardment is an aqueous
composition comprising, in aproximately equal volumes, the construct, a salt,
such as calcium nitrate and particles such as tungsten, gold. The composition
used for the introduction of the construct into plants by mechanical
inoculation
comprises infected plant tissue.
The construct of the present invention may be further used as a vehicle for
the
transient expression of foreign nucleic acid, namely genes, in a plant. The
construct according to the present invention is highly infective, does not
induce
symptoms in the infected plants and is not transmitted by aphids.
Use of compositions, containing as an active ingredient, this clone provides
an
efficient, safe and environment friendly method for transient expression of
foreign nucleic acid into the infected plants. Further applications of this
construct may, therefore, be the expression of foreign sequences or genes
within a defective RNA molecule of potyviruses. Defective RNAs are viral
RNA genomes which are missing some of the viral genes but which, together
with a complete helper virus (the full length parental virus), can facilitate
the
expression of the sequences they contain. Defective RNAs are derived from
the helper virus genome, but still require the presence of a complete helper
7
CA 02327445 2000-10-04
WO 99/51749 PCT/IL99/00184
virus for replication in the plant cell. The construct of the present
invention
may have viral genes removed from the full length clone and may then serve to
support the expression of foreign genes via potyviruses defective RNA by
co-infection of a plant with a full length clone, from which any viral genes
are
removed, together with a full length clone or virus harboring a full length
clone.
A method for introducing foreign nucleic acid into plants according to the
present invention comprises infecting a plant with a full length clone into
which
any sequence of DNA or RNA is inserted or co-infecting a plant with a full
length clone, from which any viral genes are removed, together with a full
length clone or virus harboring a full length clone.
A method for the production of a mild strain of potyvirus, according to the
present invention comprises inoculating plants with the recombinant potyvirus
infectious construct and collecting the resulting progeny.
The said invention will be further described and illustrated by the following
experiments and figure. These experiments and figure do not intend to limit
the
scope of the invention but to demonstrate and clarify it only.
Brief Descriution of the Fi ug-rere
Figure 1 is a schematic drawing of four constructs of ZYMV infectious cDNA
(a-d).
Detailed Description of the Figuure
Figure 1 is a schematic drawing of four constructs of ZYMV infectious cDNA
{a d). The open and striped bars indicate the ZYMV NAT and ZYMV-WK
sequences within the FLC respectively. The relevant restriction enzymes and
the amino acid changes are present. On the right side the severity of the
symptoms in squash is indicated, from very severe (+++++} to mild (+). The
sequence of the primer used for the mutagenesis is indicated.
8
CA 02327445 2000-10-04
WO 99/51749 PCT/IL99/00184
Example 1 - full length clone (FLC) of ZYMV
Construction of the mutants in the full len clone (FLC,~I of ZYMV
The constructs which represent the HC - Pro sequences (Huet H., Gal On A.,
Meiri E., Lecoq H. and Raccah B.(1994) Journal of General Virology
75:1407-1414) of the ZYMV - WK strain were placed under the T7 RNA
promoter in the infectious FLC. In order to get higher rate of infection with
those constructs the fragment BstXI/AgeI from the FLC of 35SZYMVNOS
cDNA (Gal On A., Antigaus Y., Rosner A., and Raccah B. (1991) Journal of
General Virology 72:2639-2643 and Gal On A., Meiri E., Huet H., Hua W.J.,
Raccah B. and Gaba V. (1995) Journal of General Virology 76:3223-3227),
was replaced by the appropriate fragment from pZYHC (-) clone (Huet H., Gal
On A., Meiri E., Lecoq H. and Raccah B.(1994) Journal of General Virology
75:1407-1414). Site directed mutagenesis was introduced on ssDNA template
of the subclone pksMl6B (Gal On A., Antigaus Y., Rosner A., and Raccah B.
(1991) Journal of General Virology 72:2639-2643), using the primer 5'
ATGTTCATAAATAAGCGCTCTAG3' (amino acid Ile is underlined and the
unique restriction site of Eco4711I is in bold). The clone pksM 16B carrying
the
mutations was double digested by BamHi/BstEII and the obtained fragment
(L4kb) was introduced to the same sites in the 35SZYMVNOS cDNA (Gal On
A., Meiri E., Huet H., Hua W.J., Raccah B. and Gaba V. (1995) Journal of
General Virology 76:3223-3227).
Plants. mechanical or bombardment inoculation and symptom appearance of
the ZYMV AG1
Greenhouse - grown zucchini squash (Curcurbita pepo. L. cv Ma'ayan),
cucumber (Cucumis sativus L. cv. Bet Alpha; Shimshon; Delila), melon
(Cucumis melo L. cv. Arava) and watermelon (Citrullus lanatus Schad cv.
Malali) plants were used at the cotyledon stage. The inoculated plants were
maintained in a growth chamber under continuous light at about 25°C.
The
plants were examined daily for visual symtom development.
9
CA 02327445 2000-10-04
WO 99/51749 PCT/IL99/00184
Bombardment inoculation were as previously described by Gal - On et al.
(1995). Mechanical inoculation of plants infected by the recombinant virus
were performed by sap inoculation ( 100mg/ml), applied to a cotyledon
previously dusted with carborundum.
CrOSS Drotection experiments
Cross protection by the ZYMV-AG1 strain was tested as described by Lecoq et
al. (1991) Squash seedlings at the fully expanded cotyledon stage were
bombarded with the 35S-AG1 at 0.1 pg/pl. A week later they were infected in
the greenhouse by 5 - 7 aphids (Myzus persicae) per plant according to
Antignus Y., Raccah B., Gal - On A. and Cohen S. (1989) Phytoparasitica
17:287-289).
Determination of the mutation in the~rogen~ ons
To ascertain the presence of the mutations in the viral RNA total mRNA from
infected leaf tissue was extracted. The synthesis of the RT-PCR was
performed as described by Huet et al. ( 1994).
ELISA assay for evaluation of ZYMV titer
Leaf discs of squash and cucumber ZYMV-infected plants were taken 7 - 10
d.p.i. and the homogenized tissue were subjected to ELISA as described by
Antigaus et al ( 1989).
Previously, sequence comparison has shown four amino acid changes in the
455 amino acid sequence of the HC - pro gene between the severe field strain
(ZYMV - J~ and the mild field strain ZYMK - WK. The replacement of a
fragment of the HC - Pro of ZYMV - WK containing two substitutions
Aspartate (Asp) 148 and Arg 180 (BstXIlBstEII fragment), reduced symptom
expression of the virus in squash plants without effecting virus accumulation.
To distinguish which of the two substitutions, Asp 148 or Arg 180, effect
CA 02327445 2000-10-04
WO 99/51749 PGT/IL99/00184
symptom development, Arg 180 was replaced by Ile within the FRNK box
(figure 1, clone d) by site directed mutagensis.
The engineered virus containing the Arg 180 replacement by Ile, was
designated ZYMV-AG1. This new strain did not cause the development of
symptoms in cucumber (three different varieties), melon and watermelon. The
virus did accumulate to levels as high as that of the wild type ZYMV-JV. It
was assumed, therefore, that the second amino acid difference ( Asp at
position
148) is dispensable for altering the symptoms from mild to severe.
In order to verify the presence of the amino acid changes within the mild
virus
ZYMV - AGI, and to prevent aphid transmission, a new restriction site of
Eco47III was introduced at position 550 nt (from the 5' of the HC- Pro gene)
and the DAG motif in the CP was replaced by DTG respectively (figure 1).
The new engineered virus (AG1) and a wild type severe strain (JV)
accumulated to a similar level in systemically infected leaves of different
curcurbit species (Table 1). Therefore, it may be concluded, that a point
mutation changing amino acid Arg 180 to Ile, dramatically effects the severity
of symtom development without effecting the movement and the replication of
the ZYMV virus in the plant. The dramatic results confered by a point mutation
in the potyvirus FRNK box, demonstrated in this work for the first time, could
not have been inferred from the mere known sequence comparison which
showed amino acid changes between the severe field strain and the mild field
strain.
The stability of the amino acid substitution Arg 180 to Ile within ZYMV-AG1
was tested by infecting hundreds of squash plants and dozens of cucumber
plants (Table 2). The presence of the Ile 180 mutation in the HC - Pro was
confirmed by sequencing (data not shown). Curcurbit plants inoculated with
ZYMV-AG1 mechanically or by particle bombardment with the ZYMV-AG1
strain did show the mild symptom appearance even throughout the growing
period of the plant (Table 2). The presence of the Ile 180 mutation within the
11
CA 02327445 2000-10-04
WO 99/51749 PCT/IL99/00184
virion genome was confirmed by sequencing or indirectly by digestion of the
RT-PCR amplified fragment with the restriction enzyme Eco47III (figure 1).
Replication and movement of the engineered ZYMV-AG1 strain remained high
(as the wild type ZYMV), as seen from the accumulated level of the virus.
These results suggest that no selective pressure is exerted to cause a
reversion
in the virus mutated genome.
The ability of the newly produced mild strain (ZYMV-AG 1 ) to protect against
a challenge inoculation of the severe strain of ZYMV (JV), was studied in
cross
protection experiments. Most of the protected plants did show mild symptoms
after a challenge with the severe strain (96% protection). Two plants out of
47
that were infected with the ZYMV-AG1 strain and challenged a week later
with the JV strain exhibited severe symptoms about one month post inoculation
(Table 3).
The protection was studied in a small field experiment in which protected
plants were exposed to field inoculation. Approximately 40% of the control
non-protected plants became infected, while none of the protected plants
showed severe symptoms. Therefore, no fruit damage was observed in the
protected plants (Table 3). Previous studies showed that in a typical cross
protection phenomenon, both the protective and the challenge virus strains are
very closely related (Perring T.M., Farrar C. A., Blua M. J., Wang H.L. and
Gonsalves D. ( 1995) Crop Protection 14 no. 7, 601 - 606). This is the first
report where cross protection takes place between strains that have an
identical
sequence, including the coat protein sequence, that differ only in a single
amino
acid in a non structural protein (the HC - Pro).
2) Cross protection in melons
Melon (Cucumis melo L. cv. Ofir) seedlings were planted and were infected
with ZYMV-WK and the recombinant virus ZYMV-AG1. The viruses were
sprayed onto the melon seedlings prior to planting. The seedlings were then
planted together with untreated (control) seedlings.
12
CA 02327445 2000-10-04
WO 99/51749 PCT/IL99/00184
Half of the plants at three weeks were challenged mechanically with the wild
type virus (ZYMV-JV) and half were unchallenged for testing natural
infection.
30 days after the begining of the experiment parameters such as the plant size
and the extent of infection with the wild type virus, were studied. Plants
infected with ZYMV-JV that were not treated by the weakened virus (WK)
were small and showed clear infection symptoms. Plants treated with the
recombinant virus (ZYMV - AG1) showed no symptoms of infection.
3) Expression of foreign genes through the ZYMV-AG1 clone in plants
For the expression of a foriega gene in an infected plant, a Pst I site was
inserted into the ZYMV-AG 1 between the IVIb and CP genes. The GFP (green
flurocent protein) reporter gene and the Bar gene, which confers resistance to
the non selective herbicide bialaphos (commercially named BASTA), were
amplified by PCR, using primers containing the Pst I restriction site, and
were
inserted in the PstI site.
Plants were inoculated by bombardment with the ZYMV - AG 1 containing the
GFP reporter gene or Bar gene.
Biochemical analysis showed the GFP and Bar gene to be highly and stably
expressed. Even after several passages, no revertants of the recombinant mild
virus were found and the reporter gene and Bar expression remained high and
stable. Plants expressing the GFP were luminecent and plants expressing the
Bar gene were found resistant to the herbicide bialaphos.
13
CA 02327445 2000-10-04
WO 99/51749 PCT/IL99/00184
Table 1. Comparison of virus accumulation between ZYMV-JV
and ZYMV-AG 1 strains in cucurbits.
experiment no of tested .ZYMV-JV# ZYMV-AG1~ ZYMV-WK'~
no. plants: severe mild mild
JV, AGI, WK ELISA OD(4o~
ls+ 11, 6, 0.9* (0.41)** 0.5 (0.19) 0.7 (0.18)
6
2s 2, 9, 1 (0.4) 0.7 (0.48) -
8
3s 3, 10, 0.3 (0.08) 0.9 (0.27) 1.33 (0.13)
4
4s 9, 9, 0.51 (0.4) 0.46 (0.2I) 0.59 (0.3)
9
5s 9, 9, 0.56 (0.07) 0.7 (0.09) -
-
6s 9, 8, 0.82 (0.09) 0.95 (0.09) -
-
7c 6, 7, 0.7 (0.07) 0.81 (0.2) -
-
_,______________ ________________ ________________ ________________
________________
# Severe strain of ZYMV which found in Israel in the Jordan Valley (JV).
~ The engineered virus of ZYMV.
ZYMV weak strain described by Lecoq et al. (I991).
* Average of O.D (405) detected by ELISA from 11 plants.
** Standard deviation (in brackets).
+ s and c are squash and cucumber test plants, respectively.
14
CA 02327445 2000-10-04
WO 99/51749 PCT/IL99/00184
Table 2. The stability of the ZYMV-AGI virus in the plants
number of tested plants
plant species bombardment * visual # molecular
with 3~SAG1 symptoms analysis of Ilu-180
mild I severe mutation
squash 402 398 0 10
cucumber 10~ 103 0 5
melon 30 30 0 3
Total 537~ 531+ 0 18
*Visual symptoms were observed and detected by ELISA about one and half
month post inoculation.
# The presence of the Ilu Mutation was confirmed by digestion of the RT-PCR
by Eco47III restriction enzyme.
~ Total of bombarded plants.
+ Total of infected plants
CA 02327445 2000-10-04
WO 99/51749 PCT/IL99/00184
Table 3. Cross protection in squash with the mild strain ZYMV-AG1
(induction) against the severe strain ZYMV-JV (chaIlenae) in the Greenhouse
experiments.
Number of tested plants
experiment induction #challenge symptoms "fruit damage
number* ZYMV AGl ZYMV -N mild I severe
a) 47 47 4~ 2 1
a) 14 - 15 0
a) - 5 5 5
b) I~ 15 I4 0 0
b) 5 - S 0
b) - 5 5 5
c) 43 field inocul. 43 0
c) - 6 6 6
c) 18 healthy - field inocul. 7 7
* a, b and c are three separate experiments. a and b were in the greenhouse
and c was done in a small plot in the field. c is a sum of two experiments
where the protected plants (AGn were exposed to field inoculation.
No. of plants showed fruit damage.
#' Inoculation by aphids.
16
