Note : Les descriptions sont présentées dans la langue officielle dans laquelle elles ont été soumises.
CA 02332331 2000-11-15
WO 99/60023 PCT/US99/10741
TREATMENT OF HUMAN TUMORS WITH RADIATION AND
INHIBITORS OF GROWTH FACTOR RECEPTOR TYROSINE KINASES
Normal cells proliferate by the highly controlled activation of growth factor
receptors by their respective ligands. An example of such receptors are the
growth
factor receptor tyrosine kinases.
Cancer cells also proliferate by the activation of growth factor receptors,
but
lose the careful control of normal proliferation. The loss of control may be
caused by
numerous factors, such as the autocrine secretion of growth factors, increased
expression of receptors, and autonomous activation of biochemical pathways
regulated by growth factors.
Some examples of receptors involved in tumorigenesis are the receptors for
epidermal growth factor (EGFR), platelet-derived growth factor (PDGFR),
insulin-
like growth factor (IGFR), nerve growth factor (NGFR), and fibroblast growth
factor
(FGF).
Members of the epidermal growth factor (EGF) receptor family are
particularly important growth factor receptor tyrosine kinases associated with
tumorigenesis of epidermal cells. The first member of the EGF receptor family
to be
discovered was the glycoprotein having an apparent molecular weight of
approximately 165 kD. This glycoprotein, which was described by Mendelsohn et
al.
in U.S. Patent No. 4,943,533, is known as the EGF receptor (EGFR) and also as
human EGF receptor-1 (HERD.
The EGFR is overexpressed on many types of epidermoid tumor cells. EGF
and transforming growth factor alpha (TGF-alpha) are two known ligands of
EGFR.
Examples of tumors that express EGF receptors include glioblastomas, as well
as
cancers of the lung, breast, head and neck, and bladder. The amplification
and/or
CA 02332331 2000-11-15
WO 99/60023 PCT/US99/10741
overexpression of the EGF receptors on the membranes of tumor cells is
associated
with a poor prognosis.
Some progress has been made in treating cancer. Useful treatments include
those that rely on the programmed death of cells that have suffered DNA
damage.
The programmed death of cells is known as apoptosis.
Treatments of cancer traditionally include chemotherapy or radiation therapy.
Some examples of chemotherapeutic agents include doxorubicin, cis-platin, and
taxol.
The radiation can be either from an external beam or from a source placed
inside a
patient, i.e., brachytherapy.
Another type of treatment includes inhibitors of growth factors or growth
factor receptors involved in the proliferation of cells. Such inhibitors
neutralize the
activity of the growth factor or receptor, and inhibit the growth of tumors
that express
the receptor.
For example, U.S. Patent No. 4,943,533 describes a marine monoclonal
antibody called 225 that binds to the EGF receptor. The patent is assigned to
the
University of California and licensed exclusively to ImClone Systems
Incorporated.
The 225 antibody is able to inhibit the growth of cultured EGFR-expressing
tumor
lines as well as the growth of these tumors in vivo when grown as xenografts
in nude
mice. See Masui et al., Cancer Res. ~, 5592-5598 (1986).
Similarly, Prewett et al. reported the inhibition of tumor progression of well-
established prostate tumor xenografts in mice with a chimeric form of the anti-
EGFR
225 monoclonal antibody discussed above. The chimeric form is called c225.
Journal
of lmmunotherapy ]~, 419-427 (1997).
A disadvantage of using marine monoclonal antibodies in human therapy is
the possibility of a human anti-mouse antibody (HAMA) response due to the
presence
z
CA 02332331 2000-11-15
WO 99/60023 PCTNS99/10741
of mouse Ig sequences. This disadvantage can be minimized by replacing the
entire
constant region of a marine (or other non-human mammalian) antibody with
that~of a
human constant region. Replacement of the constant regions of a marine
antibody
with human sequences is usually referred to as chimerization.
The chimerization process can be made even more effective by also replacing
the framework variable regions of a marine antibody with the corresponding
human
sequences. The framework variable regions are the variable regions of an
antibody
other than the hypervariable regions. The hypervariable regions are also known
as the
complementarity-determining regions (CDRs).
The replacement of the constant regions and framework variable regions with
human sequences is usually referred to as humanization. The humanized antibody
is
less immunogenic (i.e. elicits less of a HAMA response) as more marine
sequences
are replaced by human sequences. Unfortunately, both the cost and effort
increase as
more regions of a marine antibodies are replaced by human sequences.
Another approach to reducing the immunogenicity of antibodies is the use of
antibody fragments. For example, an article by Aboud-Pirak et al., Journal of
the
National Cancer Institute $Q, 1605-1611 (1988), compares the anti-tumor effect
of an
anti-EGF receptor antibody called 108.4 with fragments of the antibody. The
tumor
model was based on KB cells as xenografts in nude mice. KB cells are derived
from
human oral epidermoid carcinomas, and express elevated levels of EGF
receptors.
Aboud-Pirak et al. found that both the antibody and the bivalent F(ab')2
fragment retarded tumor growth in vivo, although the F(ab')2 fragment was less
efficient. The monovalent Fab fragment of the antibody, whose ability to bind
the
cell-associated receptor was conserved, did not, however, retard tumor growth.
Attempts have also been made to improve cancer treatments by combining
some of the techniques mentioned above. For example, Baselga et al. reported
anti-
3
CA 02332331 2000-11-15
WO 99/60023 PCT/US99/10741
tumor effects of the chemotherapeutic agent doxorubicin with anti-EGFR
monoclonal
antibodies in the Journal of the National Cancer Institute $5, 1327-1333
(1993).
Others have attempted to enhance the sensitivity of cancer cells to radiation
by
combining the radiation with adjuvants. For example, Bonnen, U.S. Patent
4,846,782,
reported increased sensitivity of human cancers to radiation when the
radiation was
combined with interferon. Snelling et al. reported a minor improvement in the
radiation treatment of patients with astrocytomas with anaplastic foci when
the
radiation was combined with an anti-EGFR monoclonal antibody radiolabeled with
iodine-125 in a phase II clinical trial. See Hybridoma 14, 1 I 1-114 (1995).
Similarly, Balaban et al. reported the ability of anti-EGFR monoclonal
antibodies to sensitize human squamous carcinoma xenografts in mice to
radiation
when the radiation treatment was preceded by administration of an anti-EGFR
antibody called LA22. See Biochimica et Biophysica Acta 1314, 147-156 (1996).
Saleh et al. also reported better tumor control in vitro and in mice when
radiation
therapy was augmented with anti-EGFR monoclonal antibodies. Saleh et al.
concluded that: "Further studies...may lead to a novel combined modality
RT/Mab
therapy." See abstract 4197 in the proceedings of the American Association for
Cancer Research ~, 612 (1996).
While some of the studies described above suggest further experiments in
humans, the results reported are for models in mice. Such models do not
necessarilly
provide a reasonable expectation for success in humans. As was stated in the
New
York Times of May 3, 1998, in regard to the spectacular success reported by
Judah
Folkman in treating tumors in mice with angiostatin and endostatin: "Until
patients
take them, he said, it is dangerous to make predictions. All he knows, Dr.
Folkman
said, is that'if you have cancer and you are a mouse, we can take good care of
you.' "
See page 1 of the New York Times of May 3, 1998.
4
CA 02332331 2000-11-15
WO 99/60023 PCT/US99/10741
Cancer continues to be a major health problem. The objective of the present
invention is to provide an improved method for treating certain cancers in
humans.
SUMMARY OF ~'~E INVENTION
This, and other objectives as will be apparent to those having ordinary skill
in
the art, have been achieved by providing a new method to inhibit the growth of
tumors
in human patients. The method comprises treating the human patients with an
effective amount of a combination of radiation and a non-radiolabeled protein
receptor
tyrosine kinase inhibitor, the overexpression of which can lead to
tumorigenesis.
DETAILED DESCRIPTION OF THE INVENTION
The present invention provides an improved method for treating tumors,
1 S particularly malignant tumors, in human patients who have cancer, or are
at risk of
developing cancer. The types of tumors that can be treated in accordance with
the
invention are tumors that overexpress one or more growth factor receptor
tyrosine
kinases. Some examples of growth factor receptor tyrosine kinases that can
lead to
tumorigenesis if overexpressed include the EGFR family of receptors, PDGFR
family
of receptors, IGFR family of receptors, NGFR family of receptors, TGF family
of
receptors, and FGFR family of receptors.
The EGFR family of receptors includes EGFR, which is also referred to in the
literature as HER1; HER2, which is also referred to in the literature as Neu,
c-erbB-2,
and p185erbB-2; erbB-3 and erbB-4. In this specification, EGFR refers to the
EGFR
family of receptors. The specific member of the EGFR family of receptors that
is also
called EGFR will be referred to as EGFR/HER1.
The PDGFR family of receptors includes PDGFRa and PDGFR~i. The IGF
family of receptors includes IGFR-1. Members of the FGFR family include FGFR-
1,
5
CA 02332331 2000-11-15
WO 99/60023 PCT/US99/10741
FGFR-2, FGFR-3, and FGFR-4. The TGFR family of receptors includes TGFRa and
TGFR~i.
Any type of tumor that overexpresses at least one growth factor receptor
tyrosine kinase, the overexpression of which can lead to tumorigenesis, can be
treated
in accordance with the method of the invention. These types of tumor include
carcinomas, gliomas, sarcomas, adenocarcinomas, adenosarcomas and adenomas.
Such tumors occur in virtually all parts of the human body, including every
organ. The tumors may, for example, be present in the breast, lung, colon,
kidney,
bladder, head and neck, ovary, prostate, brain, pancreas, skin, bone, bone
marrow,
blood, thymus, uterus, testicles, cervix, and liver. For example, tumors that
overexpress the EGF receptor include breast, lung, colon, kidney, bladder,
head and
neck, especially squamous cell carcinoma of the head and neck, ovary,
prostate, and
brain.
The tumors are treated with a combination of radiation therapy and a non-
radiolabeled growth factor receptor tyrosine kinase inhibitor. For the
purposes of this
specification, the inhibition of a growth factor receptor tyrosine kinase
means that the
growth of cells overexpressing such receptors is inhibited.
No particular mechanism of inhibition is implied. Nevertheless, growth factor
receptor tyrosine kinases are generally activated by means of phosphorylation
events.
Accordingly, phosphorylation assays are useful in predicting the inhibitors
useful in
the present invention. Some useful assays for tyrosine kinase activity are
described in
Panek et al., Journal of Pharmacology and Experimental Therapeutics ~, 1433-
1444
(1997) and in Batley et al., Life Sciences ~2_, 143-150 (1998). The
description of
these assays is incorporated herein by reference.
In the preferred embodiment, there is synergy when tumors in human patients
are treated with a combination of an inhibitor of a growth factor receptor
tyrosine
6
CA 02332331 2000-11-15
WO 99/60023 PCT/US99/10741
kinase and radiation, as described herein. In other words, the inhibition of
tumor
growth from the combined treatment with an inhibitor and radiation is better
than
would be expected from treatment with either the inhibitor or radiation alone.
Synergy may be shown, for example, by greater inhibition of tumor growth with
the
combined treatment than would be expected from treatment with either inhibitor
or
radiation alone. Preferably, synergy is demonstrated by remission of the
cancer with
the combined treatment with inhibitor and radiation where remission is not
expected
from treatment with either inhibitor or radiation alone.
The source of radiation can be either external or internal to the patient
being
treated. When the source is external to the patient, the therapy is known as
external
beam radiation therapy (EBRT). When the source of radiation is internal to the
patient, the treatment is called brachytherapy (BT).
The radiation is administered in accordance with well known standard
techniques with standard equipment manufactured for this purpose, such as AECL
Theratron and Varian Clinac. The dose of radiation depends on numerous factors
as is
well known in the art. Such factors include the organ being treated, the
healthy
organs in the path of the radiation that might inadvertently be adversely
affected, the
tolerance of the patient for radiation therapy, and the area of the body in
need of
treatment. The dose will typically be between l and 100 Gy, and more
particularly
between 2 and 80 Gy. Some doses that have been reported include 35 Gy to the
spinal
cord, 15 Gy to the kidneys, 20 Gy to the liver, and 65-80 Gy to the prostate.
It should
be emphasized, however, that the invention is not limited to any particular
dose. The
dose will be determined by the treating physician in accordance with the
particular
factors in a given situation, including the factors mentioned above.
The distance between the source of the external radiation and the point of
entry
into the patient may be any distance that represents an acceptable balance
between
killing target cells and minimizing side effects. Typically, the source of the
external
radiation is between 70 and 100 cm from the point of entry into the patient.
7
CA 02332331 2000-11-15
WO 99/60023 PCT1US99/10741
Brachytherapy is generally carried out by placing the source of radiation in
the
patient. Typically, the source of radiation is placed approximately 0-3 cm
from the
tissue being treated. Known techniques include interstitial, intercavitary,
and surface
brachytherapy. The radioactive seeds can be implanted permanently or
temporarily.
Some typical radioactive atoms that have been used in permanent implants
include
iodine-125 and radon. Some typical radioactive atoms that have been used in
temporary implants include radium, cesium-137, and iridium-192. Some
additional
radioactive atoms that have been used in brachytherapy include americium-241
and
gold-198.
The dose of radiation for brachytherapy can be the same as that mentioned
above for external beam radiation therapy. In addition to the factors
mentioned above
for determining the dose of external beam radiation therapy, the nature of the
radioactive atom used is also taken into account in determining the dose of
brachytherapy.
The growth factor receptor tyrosine kinase inhibitor is administered before,
during, or after commencing the radiation therapy, as well as any combination
thereof,
i.e. before and during, before and after, during and after, or before, during,
and after
commencing the radiation therapy. The antibody is typically administered
between 1
and 30 days, preferably between 3 and 20 days, more preferably between 5 and
12
days before commencing radiation therapy and/or termination of external beam
radiation therapy.
Any non-radiolabeled inhibitor of a growth factor receptor tyrosine kinase,
the
overexpression of which can be tumorigenic, is useful in the method of the
invention.
The types of tumors that overexpress such receptors have been discussed above.
The
inhibitors may be biological molecules or small molecules.
CA 02332331 2000-11-15
WO 99/60023 PCT/US99/10741
Biological inhibitors include proteins or nucleic acid molecules that inhibit
the
growth of cells that overexpress a growth factor receptor tyrosine kinase.
Most
typically, biological molecules are antibodies, or functional equivalents of
antibodies.
Functional equivalents of antibodies have binding characteristics comparable
to those of antibodies, and inhibit the growth of cells that overexpress
growth factor
receptor tyrosine kinase receptors. Such functional equivalents include, for
example,
chimerized, humanized and single chain antibodies as well as fragments
thereof.
Functional equivalents of antibodies include polypeptides with amino acid
sequences substantially the same as the amino acid sequence of the variable or
hypervariable regions of the antibodies of the invention. "Substantially the
same"
amino acid sequence is defined herein as a sequence with at least 70%,
preferably at
least about 80%, and more preferably at least about 90% homology to another
amino
acid sequence, as determined by the FASTA search method in accordance with
Pearson and Lipman, Proc. Natl. Acad. Sci. USA ~, 2444-2448 (1988). The DNA
molecules that encode functional equivalents of antibodies typically bind
under
stringent conditions to the DNA of the antibodies.
The functional equivalent of an antibody is preferably a chimerized or
humanized antibody. A chimerized antibody comprises the variable region of a
non-
human antibody and the constant region of a human antibody. A humanized
antibody
comprises the hypervariable region (CDRs) of a non-human antibody. The
variable
region other than the hypervariable region, e.g. the framework variable
region, and the
constant region of a humanized antibody are those of a human antibody.
For the purposes of this application, suitable variable and hypervariable
regions of non-human antibodies may be derived from antibodies produced by any
non-human mammal in which monoclonal antibodies are made. Suitable examples of
mammals other than humans include, for example, rabbits, rats, mice, horses,
goats, or
primates. Mice are preferred.
9
CA 02332331 2000-11-15
WO 99/60023 PCTNS99/10741
Functional equivalents further include fragments of antibodies that have
binding characteristics that are the same as, or are comparable to, those of
the whole
antibody. Suitable fragments of the antibody include any fragment that
comprises a
sufficient portion of the hypervariable (i.e. complementarity determining)
region to
S bind specifically, and with sufficient affinity, to a growth factor receptor
tyrosine
kinase to inhibit growth of cells that overexpress such receptors.
Such fragments may, for example, contain one or both Fab fragments or the
F(ab')z fragment. Preferably the antibody fragments contain all six
complementarity
determining regions of the whole antibody, although functional fragments
containing
fewer than all of such regions, such as three, four or five CDRs, are also
included.
The preferred fragments are single chain antibodies, or Fv fragments. Single
chain antibodies are polypeptides that comprise at least the variable region
of the
1 S heavy chain of the antibody linked to the variable region of the light
chain, with or
without an interconnecting linker. Thus, Fv fragment comprises the entire
antibody
combining site. These chains may be produced in bacteria or in eucaryotic
cells.
The antibodies and functional equivalents may be members of any class of
immunoglobulins, such as: IgG, IgM, IgA, IgD, or IgE, and the subclasses
thereof.
The preferred antibodies are members of the IgGI subclass. The functional
equivalents may also be equivalents of combinations of any of the above
classes and
subclasses.
Antibodies may be made from the desired receptor by methods that are well
known in the art. The receptors are either commercially available, or can be
isolated
by well known methods. For example, methods for isolating and purifying EGFR
are
found in Spada, U.S. Patent 5,646,153 starting at column 41, line 55. Methods
for
isolating and purifying FGFR are found in Williams et al., U.S. Patent
5,707,632 in
examples 3 and 4. The methods for isolating and purifying EGFR and FGFR
CA 02332331 2000-11-15
WO 99/60023 PCTNS99/10741
described in the Spada and Williams et al. patents are incorporated herein by
reference.
Methods for making monoclonal antibodies include the immunological
method described by Kohler and Milstein in Nature X56, 495-497 (1975) and by
Campbell in "Monoclonal Antibody Technology, The Production and
Characterization of Rodent and Human Hybridomas" in Burdon et al., Eds,
Laboratoty Techniques in Biochemistry and Molecular Biology, Volume 13,
Elsevier
Science Publishers, Amsterdam (1985). The recombinant DNA method described by
Huse et al. in Science 4~6, 1275-1281 (1989) is also suitable.
Briefly, in order to produce monoclonal antibodies, a host mammal is
inoculated
with a receptor or a fragment of a receptor, as described above, and then,
optionally,
boosted. In order to be useful, the receptor fragment must contain sufficient
amino
acid residues to define the epitope of the molecule being detected. If the
fragment is
too short to be immunogenic, it may be conjugated to a carrier molecule. Some
suitable carrier molecules include keyhold limpet hemocyanin and bovine serum
albumen. Conjugation may be carned out by methods known in the art. One such
method is to combine a cysteine residue of the fragment with a cysteine
residue on the
Garner molecule.
Spleens are collected from the inoculated mammals a few days after the final
boost. Cell suspensions from the spleens are fused with a tumor cell. The
resulting
hybridoma cells that express the antibodies are isolated, grown, and
maintained in
culture.
Suitable monoclonal antibodies as well as growth factor receptor tyrosine
kinases for making them are also available from commercial sources, for
example,
from Upstate Biotechnology, Santa Cruz Biotechnology of Santa Cruz,
California,
Transduction Laboratories of Lexington, Kentucky, R&D Systems Inc of
Minneapolis, Minnesota, and Dako Corporation of Carpinteria, California.
11
CA 02332331 2000-11-15
WO 99/60023 PCT/US99/10741
Methods for making chimeric and humanized antibodies are also known in the
art. For example, methods for making chimeric antibodies include those
described in
U.S. patents by Boss (Celltech) and by Cabilly (Genentech). See U.S. Patent
Nos.
4,816,397 and 4,816,567, respectively. Methods for making humanized antibodies
are
described, for example, in Winter, U.S. Patent No. 5,225,539.
The preferred method for the humanization of antibodies is called CDR-
grafting. In CDR-grafting, the regions of the mouse antibody that are directly
involved in binding to antigen, the complementarity determining region or
CDRs, are
grafted into human variable regions to create "reshaped human" variable
regions.
These fully humanized variable regions are then joined to human constant
regions to
create complete "fully humanized" antibodies.
In order to create fully humanized antibodies that bind well to antigen, it is
advantageous to design the reshaped human variable regions carefully. The
human
variable regions into which the CDRs will be grafted should be carefully
selected, and
it is usually necessary to make a few amino acid changes at critical positions
within
the framework regions {FRs) of the human variable regions.
For example, the reshaped human variable regions may include up to ten
amino acid changes in the FRs of the selected human light chain variable
region, and
as many as twelve amino acid changes in the FRs of the selected human heavy
chain
variable region. The DNA sequences coding for these reshaped human heavy and
light
chain variable region genes are joined to DNA sequences coding for the human
heavy
and light chain constant region genes, preferably y 1 and x, respectively. The
reshaped humanized antibody is then expressed in mammalian cells and its
affinity for
its target compared with that of the corresponding marine antibody and
chimeric
antibody.
Methods for selecting the residues of the humanized antibody to be substituted
and for making the substitutions are well known in the art. See, for example,
Co et
I2
CA 02332331 2000-11-15
WO 99/60023 PCTNS99/10741
al., Nature S 1, 501-502 (1992); Queen et al., Proc. Natl. Acad. Sci. ~, 10029-
1003
( 1989) and Rodrigues et al., Int. J. Cancer, Sunnlement 7, 45-50 ( I 992). A
method for
humanizing and reshaping the 225 anti-EGFR monoclonal antibody described by
Goldstein et al. in PCT application WO 96/40210. This method can be adapted to
humanizing and reshaping antibodies against other growth factor receptor
tyrosine
kinases.
Methods for making single chain antibodies are also known in the art. Some
suitable examples include those described by Wels et al. in European patent
application 502 812 and Int. J. Cancer ~0_, 137-144 (1995).
Other methods for producing the functional equivalents described above are
disclosed in PCT Application WO 93/21319, European Patent Application 239 400,
PCT Application WO 89/09622, European Patent Application 338 745, U.S. Patent
1 S 5,658,570, U.S. Patent 5,693,780, and European Patent Application EP 332
424.
Preferred antibodies are those that inhibit the EGF receptor. Preferred EGFR
antibodies are the chimerized, humanized, and single chain antibodies derived
from a
marine antibody called 225, which is described in U.S. Patent No. 4,943,533.
The
patent is assigned to the University of California and licensed exclusively to
ImClone
Systems Incorporated.
The 225 antibody is able to inhibit the growth of cultured EGFR/HERI-
expressing tumor cells in vitro as well as in vivo when grown as xenografts in
nude
mice. See Masui et al., Cancer Res. ~, 5592-5598 (1986). More recently, a
treatment regimen combining 225 plus doxorubicin or cis-platin exhibited
therapeutic
synergy against several well established human xenograft models in mice.
Basalga et
al., J. Natl. Cancer Inst. $5, 1327-1333 (15. 3).
The chimerized, humanized, and single chain antibodies derived from marine
antibody 225 can be made from the 225 antibody, which is available from the
ATCC.
13
CA 02332331 2000-11-15
WO 99/60023 PCT/US99/10741
Alternatively, the various fragments needed to prepare the chimerized,
humanized,
and single chain 225 antibodies can be synthesized from the sequence provided
in
Wels et al. in Int. J. Cancer øQ, 137-144 (1995). Chimerized 225 antibody
(c225) can
be made in accordance with the methods described above. Humanized 225 antibody
can be prepared in accordance with the method described in example IV of PCT
application WO 96/40210, which is incorporated herein by reference. Single
chain
225 antibodies (Fv225) can be made in accordance with methods described by
Wels et
al. in Int. J. Cancer 60, 137-144 (1995) and in European patent application
502 812.
The sequences of the hypervariable (CDR) regions of the light and heavy
chain are reproduced below. The amino acid sequence is indicated below the
nucleotide sequence.
HEAVY CHAIN HYPERVARIABLE REGIONS lVH):
AACTATGGTGTACAC (SEQ ID 1 )
N Y G V H (SEQ ID 2)
GTGATATGGAGTGGTGGAAACACAGACTATAATACACCTTTCACATCC
(SEQ ID 3)
V I W S G G N T D Y N T P F T S (SEQ
ID 4)
CDR3
GCCCTCACCTACTATGATTACGAGTTTGCTTAC (SEQ ID S)
14
CA 02332331 2000-11-15
WO 99/60023 PCT/US99/10741
A L T Y Y D Y E F A Y (SEQ ID 6)
LIGHT CHAIN HYPERVARIABLE REGIONS ~VL):
CDR 1
AGGGCCAGTCAGAGTATTGGCACAAACATACAC (SEQ ID 7)
R A S Q S I G T N I H (SEQ ID 8)
CDR2
GCTTCTGAGTCTATCTCT (SEQ ID 9)
A S E S I S (SEQ ID 10)
CDR3
CAACAAAATAATAACTGGCCAACCACG (SEQ ID 11 )
Q Q N N N W P T T (SEQ ID 12)
In addition to the biological molecules discussed above, the inhibitors useful
in the present invention may also be small molecules. For the purposes of this
specification, small molecules include any organic or inorganic molecule,
other than a
biological molecule, that inhibits the growth of cells that overexpress at
least one
growth factor receptor tyrosine kinase. The small molecules typically have
molecular
weights less than 500, more typically less than 450. Most of the small
molecules are
organic molecules that usually comprise carbon, hydrogen and, optionally,
oxygen,
nitrogen, and/or sulfur atoms.
Numerous small molecules have been described as being useful to inhibit
EGFR. For example, Spada et al., U.S. Patent 5,656,655, discloses styryl
substituted
heteroaryl compounds that inhibit EGFR. The heteroaryl group is a monocyclic
ring
CA 02332331 2000-11-15
WO 99/b0023 PCT/US99/10741
with one or two heteroatoms, or a bicyclic ring with 1 to about 4 heteroatoms,
the
compound being optionally substituted or polysubstituted. The compounds
disclosed
in U.S. Patent 5,656,655 are incorporated herein by reference.
$ Spada et al., U.S. Patent 5,646,153 discloses bis mono and/or bicyclic aryl
heteroaryl carbocyclic and heterocarbocyclic compounds that inhibit EGFR
and/or
PDGFR. The compounds disclosed in U.S. Patent 5,646,153 are incorporated
herein
by reference.
Bridges et al., U.S. Patent 5,679,683 discloses tricyclic pyrimidine compounds
that inhibit the EGFR. The compounds are fused heterocyclic pyrimidine
derivatives
described at column 3, line 35 to column 5, line 6. The description of these
compounds at column 3, line 35 to column S, line 6 is incorporated herein by
reference.
Barker, U.S. Patent 5,616,582 discloses quinazoline derivatives that have
receptor tyrosine kinase inhibitory activity. The compounds disclosed in U.S.
Patent
5,616,582 are incorporated herein by reference.
Fry et al., Science ~ø5_, 1093-1095 (1994) discloses a compound having a
structure that inhibits EGFR. The structure is shown in Figure 1. The compound
shown in Figure 1 of the Fry et al. article is incorporated herein by
reference.
Osherov et al., disclose tyrphostins that inhibit EGFR/HER1 and HER2. The
compounds disclosed in the Osherov et al. article, and, in particular, those
in Tables I,
II, III, and IV are incorporated herein by reference.
Levitzki et al., U.S. Patent 5,196,446, discloses heteroarylethenediyl or
heteroarylethenediylaryl compounds that inhibit EGFR. The compounds disclosed
in
U.S. Patent 5,196,446 from column 2, line 42 to column 3, line 40 are
incorporated
herein by reference.
16
CA 02332331 2000-11-15
WO 99/60023 PCT/US99/10741
Batley et al., Life Sciences 6?, 143-150 (1998), disclose a compound called
PD 161570 that inhibits members of the FGF are family of receptors. PD 161570
~is
identified as t-butyl-3-(6-(2,6-dichlorophenyl)-2-(4-diethylamino-butylamino)-
pyrido(2,3-d)pyrimidin-7-yl)urea having the structure shown in Figure 1 on
page 146.
The compound described in Figure 1 on page 146 of the Batley et al. article in
Life
Sciences ~2_, 143-150 (1998) is incorporated herein by reference.
Panek, et al., Journal of Pharmacology and Experimental Therapeutics ~,
1433-1444 (1997) disclose a compound identified as PD166285 that inhibits the
EGFR, PDGFR, and FGFR families of receptors. PD166285 is identified as 6-(2,6-
dichlorophenyl)-2-(4-(2-diethylaminoethoxy)phenylamino)-8-methyl-8H-pyrido(2,3-
d)pyrimidin-7-one having the structure shown in Figure 1 on page 1436. The
compound described in Figure 1 on page 1436 of the Panek et al. article is
incorporated herein by reference.
Parrizas, et al., Endocrinology ~8-, 1427-1433 disclose tyrphostins that
inhibit
the IGF-1 receptor. The compounds disclosed in the Parnzas et al. article, in
particular those in Table 1 on page 1428, are incorporated herein by
reference.
The administration of small molecule and biological drugs to human patients
is accomplished by methods known in the art. For small molecules, such methods
are
described in Spada, U.S. Patent 5,646,153 at column 57, line 47 to column 59,
line 67.
This description of administering small molecules is incorporated herein by
reference.
The biological molecules, preferably antibodies and functional equivalents of
antibodies, significantly inhibit the growth of tumor cells when administered
to a
human patient in an effective amount in combination with radiation, as
described
above. The optimal dose of the antibodies and functional equivalents of
antibodies
can be determined by physicians based on a number of parameters including, for
example, age, sex, weight, severity of the condition being treated, the
antibody being
administered, and the route of administration. In general, a serum
concentration of
17
CA 02332331 2000-11-15
WO 99/60023 PCT/US99/10741
polypeptides and antibodies that permits saturation of the target receptor is
desirable.
For example, a concentration in excess of approximately 0.1 nM is normally
sufficient. For example, a dose of 100 mg/m2 of C225 provides a serum
concentration
of approximately 20 nM for approximately eight days.
S
As a rough guideline, doses of antibodies may be given weekly in amounts of
10-300 mg/mz. Equivalent doses of antibody fragments should be used at more
frequent intervals in order to maintain a serum level in excess of the
concentration that
permits saturation of the receptors.
Some suitable routes of administration include intravenous, subcutaneous, and
intramuscle administration. Intravenous administration is preferred.
The peptides and antibodies of the invention may be administered along with
additional pharmaceutically acceptable ingredients. Such ingredients include,
for
example, adjuvants, such as BCG, immune system stimulators and
chemotherapeutic
agents, such as those mentioned above.
Example 1. Clinical Trial
In a clinical trial, human patients were treated with anti-EGFR chimeric
monoclonal antibody c225 at the indicated doses along with 2 Gy (per fraction)
of
external beam radiation per day, five days a week, for seven weeks, a total of
70Gy.
The results are shown in the table, wherein CR means complete response, PR
means
partial response, and TBD means to be determined.
18
CA 02332331 2000-11-15
WO 99/60023 PCT/US99/10741
TABLE
Clinical Response
Patient Dose Level Clinical Overall
(mg/mz) (Physical Exam)Response*
1 100 CR PR
2 100 CR CR
3 100 CR CR
4 200 CR CR
5 200 CR CR
6 200 CR PR
7 400/200 PR CR
8 400/200 CR CR
9 400/200 CR PR
10 500/250 CR PR
11 500/250 CR PR
12 500/250 CR TBD
*Radiographic follow-up ongoing
SUPPLEMENTAL ENABLEMENT
The invention as claimed is enabled in accordance with the above specification
and readily available references and starting materials. Nevertheless,
Applicants have,
on May 13, 1998, re-deposited with the American Type Culture Collection, 12301
Parklawn Drive, Rockville, Md., 20852 USA (ATCC) the hybridoma cell line that
produces the marine monoclonal antibody called m225. This antibody was
originally
deposited in support of U.S. patent 4,943,533 of Mendelsohn et al. with
accession
number HB8508.
19
SUBSTITUTE SHEET {RULE 26)
CA 02332331 2000-11-15
WO 99/60023 PCT/US99/10741
The re-deposit was made under the provisions of the Budapest Treaty on the
International Recognition of the Deposit of Microorganisms for the Purposes of
Patent
Procedure and the regulations thereunder (Budapest Treaty). This assures
maintenance of a viable culture for thirty {30) years from date of deposit.
The
organism will be made available by ATCC under the terms of the Budapest
Treaty,
and subject to an agreement between Applicants and ATCC which assures
unrestricted availability upon issuance of the pertinent U.S. patent.
Availability of the
deposited strains is not to be construed as a license to practice the
invention in
contravention of the rights granted under the authority of any government in
accordance with its patent laws.
