Note : Les descriptions sont présentées dans la langue officielle dans laquelle elles ont été soumises.
CA 02469098 2004-06-22
Pathogen inducible plant promoter and use thereof
Field of the invention:
The invention relates to a plant promoter that is induced by pathogen attack.
More specifically,
the invention relates to a wound and pathogen inducible promoter and uses
thereof.
Background of the invention:
Over the years, there have been many approaches to dealing with pests and
diseases in plants. In
days gone by, crop rotation and burning were relied upon to reduce the pest
load in crop species.
As cropping moved progressively to mono-cropping on very large acreages,
disease loads
increased and crops losses resulted. Spraying programmes were developed to
assist producers in
reducing crop losses as a result of pests and diseases. While these could
often prevent crop
failures, the cost of spraying programmes was substantial. Further, the use of
sprays was found
to be deleterious to the environment, as it polluted ground water and soil,
and led to resistant
diseases and pests.
With regard to disease, there is often a very rapid onset and spreading of the
disease vector. A
crop can be destroyed in a matter of days. Hence, unless a prophylactic
spraying programme is
in place, a crop may be lost before spraying commences.
In more recent years, there has been the development of a number of transgenic
plants with
elevated tolerance to economically important pests and disease agents.
However, in most of
them the transgene is driven by a powerful constitutive promoter, such as the
cauliflower mosaic
virus 35S (CaMV 35S) and its derivatives, and is expressed at high levels even
in the absence of
pathogen invasion. For example, we showed earlier that potato plants can be
engineered for
broad-spectrum disease resistance by expression of antimicrobial peptides from
a constitutive
CaMY 35S promoter [5]. Continuous synthesis and high accumulation of transgene
products,
especially toxins, could interfere with plant metabolic pathways and the
overall expression of
other valuable traits.
1
CA 02469098 2004-06-22
Studies of inducible promoters have led to the isolation and characterization
of a number of
plant promoters. Within those that have been studied are a group that are
referred to as wound
inducible promoters. These promoters control expression of a heterogeneous
array of genes.
For example, there are genes that encode chitinases, glucanases, structural
proteins such as
S hydroxyl proline-rich glycoproteins, peroxidases, enzymes of the
phenylpropanoid pathway,
glycine rich proteins and protease inhibitors.
A number of wound inducible genes have been isolated from poplar (Populus
trichocarpa x P.
deltoids. These genes are predicted to encode chitinases, protease inhibitors
and storage
proteins. Promoters controlling expression of these genes have been shown to
be induced by
wounding. For example, the win6 promoter was studied and was shown to be
induced by
wounding, was developmentally activated in young leaves and floral tissue.
The win3.l2 is another promoter that has been isolated from poplar. This
promoter controls
expression of a gene that belongs to a heterogeneous multigene family of
proteinase inhibitors.
These genes encode for protein that represent up to 5% of the total protein in
storage organs,
serve multifunctional roles in plant development, and some of whose members
have been shown
to retard growth and development of insect larvae in artificial feeding
experiments [6]. The
win3. l2 gene, specifically is thought to encode a Kunitz-type proteinase
inhibitor.
Hollick and Gordon [4] have shown that 1352 by region upstream of the
translation initiation
site of the win3.12 gene from hybrid poplar (P. trichocarpa x P. deltoides) is
responsive to
wound stimuli in transgenic tobacco. The sequence is shown in Fig. 6 and is
designated SEQ ID
No 1.
Although proteases and chitinases have been shown to accumulate in response to
wounding,
fungal elicitors and insect feeding, there are many that are not induced by
these stressors. For
example in Arabidopsis 8200 genes were analysed from the sequences in
databank. A total of
657 genes were identified as wound responsive. Only 30% of wound responsive
genes were
reported to be involved in plant defense. Of those 30%, no information exists
on induction of
these genes in response to pathogens. Further, a wound responsive gene Pin
from potato does
not respond to fungal challenge and shows a high background level of
expression. Thus, the
wound induced pin promoter of potato is not useful to engineer fungal induced
activity. A
2
CA 02469098 2004-06-22
further indication of a lack of relationship between wound induction and
pathogen induction is
seen with regard to the Lox gene family. The Lox gene family of potato
contains several
members that are transcriptionally activated in response to wounding,
pathogens or their
elicitors. However, there are also members that are not induced by either
wounding or
pathogens. The POTLX-3 gene is specifically induced by pathogen infection and
does not
respond to wounding.
It is an object of the invention to overcome the deficiencies in the prior
art.
Summary of the invention:
It is an object of the invention to provide a pathogen inducible promoter for
use with plant
defense genes. The use of promoters of plant defensive genes has distinct
advantages because
most of them are activated only when the plant is attacked by pests or
pathogens and the
transgene product when expressed constitutively and at a high level may be
toxic to the plants
and animals. The win3.12T promoter, induces low transgene expression in
vegetative organs
(except in roots) under normal conditions, and increases expression only in
response to pathogen
invasion. Another advantage is that this promoter has low activity in tubers,
the edible part of
potato. In addition, transgene expression in win3.12T plants can be predicted
from the number
of insertions and is useful for applications where low to moderate promoter
activity is preferred.
The use of native plant promoters (i.e. from native species) can also help to
avoid transgene
silencing often associated with the presence of promoters of non-plant origin
in the plant
genome.
In one embodiment of the invention, an isolated polynucleotide sequence
comprising SEQ. ID
No 2, its complement, its homologues, complements of the homologues and
variants having
conserved deletions, replacements, and truncations, and homologues of said
variants, that do no
alter the function of said sequence is provided.
In another aspect of the invention the sequence is characterized as having
promoter activity.
In another aspect of the invention, the activity is inducible.
3
CA 02469098 2004-06-22
In another aspect of the invention, the activity is inducible in response to
at least one of
wounding, exposure to at least one suitably selected pathogen or exposure to
at least one
suitably selected pathogen elicitor.
In another aspect of the invention, the activity is in response to exposure to
at least one suitably
selected pathogen or exposure to at least one suitably selected pathogen
elicitor.
In another aspect of the invention, the pathogen is Fusarium.
In another aspect of the invention, the sequence further comprises regulatory
sequences
operatively linked to SEQ. ID No 2, its complement, its homologues,
complements of the
homologues and variants having conserved deletions, replacements, and
truncations, and
homologues of said variants, that do no alter the function of said sequence.
In another aspect of the invention, the sequence further comprises a suitably
selected plant
pathogen defense gene.
In another aspect of the sequence of the invention, the selected plant
pathogen defense gene is
selected from the group consisting of the antimicrobial peptide genes cecropin-
mellitin,
dermaseptin B gene and temporin A.
In another embodiment of the invention a transgenic cell comprising a
polynucleotide sequence
comprising SEQ. ID No 2, its complement, its homologues, complements of the
homologues
and variants having conserved deletions, replacements, and truncations, and
homologues of said
variants, that do no alter the function of said sequence is provided.
In another aspect of the invention the transgenic cell comprises a suitably
selected plant
pathogen defense gene.
In another aspect of the transgenic cell of the invention, the suitably
selected plant pathogen
defense gene is selected from the group consisting of the antimicrobial
peptide genes cecropin-
mellitin, dermaseptin B gene and temporin A.
4
CA 02469098 2004-06-22
In another aspect of the invention the transgenic cell further comprising
sequences operatively
linked to SEQ. ID No 2, its complement, its homologues, complements of the
homologues and
variants having conserved deletions, replacements, and truncations, and
homologues of said
variants, that do no alter the function of said sequence.
In another aspect of the invention, the transgenic cell is a plant cell.
In yet another embodiment of the invention, a method for expressing a nucleic
acid sequence of
interest in a plant cell, comprising providing:
a plant cell;
a nucleic acid sequence of interest; and
a polynucleotide sequence comprising SEQ. ID No 2, its complement, its
homologues, complements of the homologues and variants having conserved
deletions, replacements, and truncations, and homologues of said variants,
that do no
alter the function of said sequence, is provided.
In another aspect of the method of the invention, the nucleic acid sequence of
interest is a
suitably selected pathogen defense gene.
In another aspect of the method of the invention, the suitably selected plant
pathogen defense
gene is selected from the group consisting of the antimicrobial peptide genes
cecropin-mellitin,
dermaseptin B gene and temporin A.
In another aspect of the method of the invention, the polynucleotide sequence
is SEQ ID No 2 or
its complement.
In another aspect of the method of the invention, the plant cell is a potato
plant cell.
In another aspect of the invention, the method further comprises regenerating
the plant cell into
a plant using PetM regeneration medium.
In another embodiment of the invention, a transformed plant produced by
transforming a plant
cell with a nucleic acid sequence of interest and a polynucleotide sequence
comprising SEQ. ID
5
CA 02469098 2004-06-22
No 2, its complement, its homologues, complements of the homologues and
variants having
conserved deletions, replacements, and truncations, and homologues of said
variants, that do no
alter the function of said sequence, and regenerating said plant is provided.
In another aspect of the transgenic plant of the invention, the transformed
plant is a potato plant.
In another aspect of the transgenic plant of the invention, the transformed
plant is regenerated
by culturing in PetM regeneration medium.
In another aspect of the transgenic plant of the invention, the nucleic acid
sequence of interest is
a pathogen defense gene.
In another aspect of the transgenic plant of the invention, the suitably
selected plant pathogen
defense gene is selected from the group consisting of the antimicrobial
peptide genes cecropin-
mellitin, dermaseptin B gene and temporin A.
In another aspect of the invention, a cell line derived from a plant that is
the product of the
process of transforming a plant cell with a nucleic acid sequence of interest
and a polynucleotide
sequence comprising SEQ. ID No 2, its complement, its homologues, complements
of the
homologues and variants having conserved deletions, replacements, and
truncations, and
homologues of said variants, that do no alter the function of said sequence,
and regenerating said
plant, is provided.
In another aspect of the invention, the cell line is derived from a potato
plant.
In another aspect of the invention, the cell line is derived from a plant that
has been regenerated
by culturing in PetM regeneration medium.
In another aspect of the cell line of the invention, the nucleic acid sequence
of interest is a
pathogen defense gene.
6
CA 02469098 2004-06-22
In another aspect of the cell line of the invention, the suitably selected
plant pathogen defense
gene is selected from the group consisting of the antimicrobial peptide genes
cecropin-mellitin,
dermaseptin B gene and temporin A.
Figures:
Figure 1. A-C. A schematic presentation of the pwin3.12T-GUS construct for
potato
transformation in accordance with an embodiment of the invention. Restriction
sites relevant
for cloning are in bold. The positions of PCR primers for DNA analyses are
indicated by
arrows. PolyA (NOS-t) is a poly-adenylation sequence of the nopaline synthase
gene.
B: PCR analysis of DNA isolated from 12 transgenic potato lines. Fragments of
1812 by (B)
were generated using GUS-specific primers and they indicated the presence of
the full-length
transgene. Fragments of 971 by (C) were generated using promoter- and GUS-
specific primers
and they indicated both the presence of the win3.12T promoter (823 bp) and the
correct
promoter-transgene fusion. Lane 1 and 17: 1 kb DNA ladder. Lane 2: PCR mix
without
template DNA. Lane 3: plasmid pwin3.12T-GUS. Lane 4: untransformed potato.
Lanes S tol6:
transgenic potato lines Trwl, Trw2, Trw3, Trw4, TrwS, Trw7, TrwB, Trw9, TrwlO,
Trwll,
Trwl2, and Trwl4, respectively.
Figure 2. Systemic activity of win3.I2T promoter in response to mechanical
wounding in
accordance with an embodiment of the invention. The fifth leaf from the apex
(line Trwl l) was
repeatedly wounded at 0, 1, and 2 h. Mean values of GUS activities t SE (n=3)
in pmol MU
mg 1 protein miri 1 were measured at indicated time points in the upper leaf 3
(light grey bars)
and leaf 4 (dark grey bars), in the wounded leaf 5 (black bars), and in the
lower leaf 6 (white
bars). Vertical lines are SE.
Figure 3. Southern blot analysis of transgenic plants in accordance with an
embodiment of the
invention. Potato DNA was digested with XbaI, eleetrophoresed, and probed with
32-P-labelled
GUS gene. The number of bands reflects the number of transgene insertions.
Transgene copy
number in bands with higher signal intensity was determined by a Molecular
Dynamics
densitometer. Molecular weight DNA markers are shown on the left.
7
CA 02469098 2004-06-22
Figure 4. A. Results demonstrating that the win3.12T promoter is systemically
responsive to
fungal infection in accordance with an embodiment of the invention. Mean
values of GUS
activities ~ SE in pmol MU mg 1 protein miri 1 were measured in leaves from
three plants of
transgenic line Trw3. Leaf 1 is the most apical leaf with lamina length longer
than 5 mm. Black
bars represent systemic GUS activities in potato leaves after co-cultivation
of the plant with F.
solani. Grey bars represent local GUS activities in the wounded leaves 24 h
after mechanical
wounding. White bars represent GUS activities in leaves in the absence of
treatment. Vertical
lines are SE, and the asterisks indicate GUS activities that are significantly
different (P<0.05, by
Student's t test) from the corresponding controls. B. Histochemical GUS
staining of leaves
from win3.12T plants (line Trw9) grown in the absence of stress (left) and
subjected to F. solani
infection (right).
Figure 5. A. Systemic activity of poplar promoter in response to crude
Fusarium extract. Stems
of transgenic plants (line Trw3) were injected with either extract from fungal
mycelium (black
bars) or 50 mM sodium phosphate buffer (grey bars). White bars denote controls
for single
wounding of stem by needle. Mean values are GUS activities in the first five
leaves located
above the site of injection. B. Dynamics of activation of the poplar promoter
in leaves incubated
with Fusarium extract. One half of detached leaf (line Trw3) was incubated in
fungal extract
(black bars), and the other half was incubated in 50 mM sodium phosphate
buffer (grey bars). In
both figures, mean GUS activity t SE (n=3) is given in pmol MU mg 1 protein
miri 1, the
vertical lines are SE, and the asterisks indicate GUS activities that are
significantly different
(P<0.05, by Student's t test) from the corresponding controls.
Figure 6. Gene sequence of the win3.12 promoter (SEQ ID No 1 ). The truncated
promoter SEQ
ID No 2), win3.12T is underlined and is in accordance with an embodiment of
the invention.
Detailed Description of the Invention:
Materials and methods
Plant material
8
CA 02469098 2004-06-22
Solanum tuberosum L. cultivar Desiree plants were grown aseptically in culture
tubes (Sigma)
on MS medium [7] containing 2% sucrose, in a 16-h photoperiod (25 ~M m 2 s 1 )
at 240C. In
vitro tubers were induced as described elsewhere [8] on MS medium containing
8% sucrose, 2.5
mg I; 1 kinetin and 0.5 mg I; 1 abscisic acid
Vector construction
Two binary vectors designed to express the reporter 13-D-glucuronidase (GUS)
gene from
different promoters were used for potato transformations: pBI121 [9] contained
the 35S
promoter of cauliflower mosaic virus (CaMV), and pwin3.12T-GUS contained the
823 by
fragment of the wound-inducible promoter win3.12 from hybrid poplar [4]. To
make the
pwin3.12T-GUS construct, the promoter part of the proteinase inhibitor-like
gene win3.12
(GenBank accession # L11233) was amplified by PCR from plasmid pwin3.12 [4] in
a 100 ~,l
reaction mix containing 70 ng of pwin3.l2, 2 Units of Deep Vent DNA polymerase
(NE
Biolabs) and standard concentrations of MgCl2 dNTPs, and primers (5' WIN, 5'-
AACTGCAGAAGCTTCCAACATCAATGAT-3', 28-mer; 3' WIN, 5'-
CGGGATCCTCTAGAATTTGTTGAATATGAG-3', 30-mer). The underlined parts of the
primers correspond to the win3.12 promoter sequence in GenBank Database,
HindIII (forward
primer) and engineered XbaI (reverse primer) sites are shown in bold and were
used in
subsequent cloning. PCR was performed with the manual hot-start and by
denaturing the
template DNA at 94°C for 3 min, followed by 30 cycles of 30 s at
94°C, 30 s at 55°C, and 1
min at 72°C, with a 10 min extension at 72°C for the last cycle
prior to halting the reaction at
4°C. After electrophoresis in a 1 % (w/v) agarose gel, an 846 by PCR
product corresponding to
the desired length of the win3.12T promoter was excised, purified using a
NucleoSpin
Extraction KitTM (Clontech), digested with HindIII and XbaI, and the 823 by
HindIIIlXbaI DNA
fragment ligated into the corresponding sites of pBI121 in place of deleted
CaMV 35S promoter.
The correct insertion and full nucleotide sequence of the amplified win3.12T
promoter was
confirmed by DNA sequence analysis (PE Applied Biosystems). The constructs
were
maintained in Agrobacterium tumefaciens MP90.
Medium for potato regeneration (Medium PetM)
9
CA 02469098 2004-06-22
One-step regeneration medium PetM was used for shoot induction and plant
regeneration from
all types of potato explants. It contained MS salts [7], Gamborg's vitamins
[10], 40 mg L-1
adenine ' S04~ 20 g L; 1 glucose, 20 g I; 1 mannitol, 900 mg L; 1 2-[N-
morpholino]ethanesulfonic acid (MES), 0.04 mg L-1 GA3, 0.02 mg I; 1 NAA, 2 mg
L; 1 ZR,
and 4 g L-1 agarose at pH5.7. Growth regulators GA3 and ZR were filter
sterilized and added
to the cooled autoclaved medium.
Plant transformation, selection and regeneration
Petioles from 4-5-week-old potato plants were used for transformation. After
pre-cultivation on
liquid PetM for 2 days at 24°C in low light intensity (5 p.M m 2 s 1 ),
the explants were
incubated with a fresh Agrobacterium culture (re-suspended at OD600=1.0 in
liquid PetM
immediately before plant infection) for 1 h with slow shaking, then blotted
with sterile filter
paper to remove excess bacteria, and placed horizontally on antibiotic-free
PetM medium
solidified with 0.4% (w/v) agarose. After 3-4 days of cultivation at
24°C in low light, the
infected explants were washed twice for 1 h with liquid PetM containing 1 g I;
1 carbenicillin,
and placed onto selective PetM medium containing 50 to 100 mg L-1 kanamycin
and 500 mg I;
1 carbenicillin. The explants were cultivated at 24 °C in a 16-h
photoperiod (60 ~,M m 2 s 1 )
and transferred to fresh antibiotic-containing PetM every 2 weeks. Regenerated
shoots (1-1.5 cm
high) were rooted in the hormone-free medium (see "Plant material")
supplemented with 25 mg
I; 1 kanamycin
PCR and Southern analysis of transgenic plants
Genomic DNA was isolated from potato leaves using a GenEluteTM Plant Genomic
DNA Kit
(Sigma). Amplification reactions comprised 200 ng of plant DNA in 50 p,l of a
PCR mix
containing Taq PCR Master MixTM (Qiagen) and specific primers, and were
carried out with
the following parameters: 94°C for 3 min, then 30 cycles of 94°C
for 30 s, 57°C for 30 s, and
72°C for 1 min 30 s, followed by a final 10 min incubation at
72°C. Primers for plants
CA 02469098 2004-06-22
containing pBIl21 and pwin3.12T-GUS constructs were designed to amplify 1812
by full-
length GUS gene: forward primer S'GUS (5'-ATGTTACGTCCTGTAGAAACC-3', 21-mer)
and reverse primer 3'GUS (5'- TCATTGTT"TGCCTCCCTGCTG - 3', 21-mer). Another
set
of primers for win3.12T-GUS plants was used to confirm the correct promoter-
transgene
fusions (971 by amplified DNA fragment): forward primer 5' WIN (see "Vector
construction")
and reverse primer 3'M/GUS with sequence complimentary to nucleotides +89 to
+109 of the
GUS gene upstream region (5'- CTTTCCCACCAACGCTGATCA - 3', 21-mer).
For Southern analysis, 4 p,g of potato DNA from each line was digested with
XbaI,
electrophoresed in a 1 % (w/v) agarose gel, transferred to a Biodyne B nylon
membrane (Pall),
and hybridized with 32P-labelled GUS gene in PerfectHyb PIusTM buffer (Sigma)
according to
the manufacturer's protocol. After final wash in O.Sx SSC, 0.1% SDS at 65
°C for 10 min, the
membrane was exposed to a Phosphor ScreenTM (Molecular Dynamics).
Transgenic plant wounding and tissue sampling
Leaf tissue samples for protein extraction were collected from the distal
portion of fully
developed potato leaves on one side of the midrib. After the first samples had
been removed,
the proximal portion and the periphery of the sampled leaf (~50% of the leaf)
were wounded
with forceps. In some experiments, the wounded part of the leaf was treated
with an aqueous
solution of cell wall degrading enzymes, containing 0.2% (w/v) Cellulase
(Sigma) and 0.1%
(w/v) Driselase (Sigma). After 18 h (unless otherwise indicated), the distal
portion of the same
leaf was sampled as before on the opposite side of the midrib.
Plant treatments with Fusarium and fungal extract
TM
Fusarium solani was cultivated on medium containing 10% V-8 juice, 5 mM MES,
15 g I. 1
of agar Difco (pH6.4), at RT and low light. Two 1 cm2 agar blocks of the
fungal mycelia were
placed 3 cm from the stem of a 6-8-week-old well-developed potato plant grown
aseptically in a
MagentaTM vessel (Sigma), and cultivated for several days. One to two days
after the fungal
mycelia reached the plant stem (disease symptoms were not visible yet),
tissues from all parts of
the plant were collected for protein extractions.
11
CA 02469098 2004-06-22
For fungal extract, 1 g of 2-week-old F. solani mycelia was ground in liquid
N2, transferred to a
centrifuge tube with 2 ml of 50 mM sodium phosphate buffer (pH 7.0), vortexed,
and then
centrifuged twice at 14,000 g for 10 min to pellet the cellular debris. The
clear supernatant
S contained crude fungal extract and was used for plant treatments. A 400 ~l
of the fungal extract
was slowly injected into stem of each plant with a 1-ml syringe equipped with
a 2761/2 needle
(Becton Dickinson). As a control, the transgenic plants were injected with 50
mM sodium
phosphate buffer (pH 7.0). First five leaves above the site of injection were
collected from each
plant at indicated time points and used for protein extractions. In another
set of experiments,
one half of the leaf was incubated in Fusarium extract, and the other half of
the same leaf was
incubated in 50 mM sodium phosphate buffer (pH 7.0). The samples were
collected for protein
extractions after 0, 0.5, 1, and 2 h of treatment.
GUS assays
Quantitative fluorometric assays of GUS activity in tissue samples, harvested
both before and
after treatments, were performed as described earlier [9] by incubation of the
extracts (20 ~g
protein) with 2 mM 4-methyl-umbelliferyl-(3-D-glucuronide (MUG) in a lysis
buffer for 60 min
at 37°C. GUS activity was calculated as pmol of 4-methyl-umbelliferone
(4-MU) produced
miri 1 mg 1 of soluble protein. Histochemical localization of GUS was done
according to
Jefferson et al. [9].
Detailed Description of the Invention:
Results
Production of transgenic plants
A plant transformation vector with transcriptional fusion between thewin3.12T
promoter and the
GUS reporter gene was constructed (Fig. 1 a) and introduced into S. tuberosum
L. cv Desiree by
Agrobacterium-mediated transformation. As a control, potato plants were
transformed with
pBI121 [9]. By using our single-step regeneration protocol, nearly 100%
regeneration frequency
12
CA 02469098 2004-06-22
with multiple shoots per explant was achieved on the selection medium. Twenty
putative
transgenic shoots were randomly selected in each experiment and rooted in the
presence of
selective agent. All plants retained the normal morphology of S.tuberosum L.
Stable transgene
integration into plants was confirmed by PCR (Fig. 1 b, c) and Southern
analyses (Fig.3).
Twelve lines with the win3.12T-GUS construct and four lines with the CaMV 35S-
GUS
construct were randomly selected among the Agrobacterium-free transgenics, and
fully
developed 6-8-week-old plants grown in vitro were used to study promoter
activity.
Local and systemic response to wounding
Eighteen hours after mechanical wounding of leaves, all but one of the
win3.12T transgenic
lines showed increased GUS expression in the uninjured part of the wounded
leaf, with the
highest GUS activity (pmol MU miri 1 mg 1 protein ) of 290.2319.11 (tSE, n=3)
in transgenic
line Trw9 (Table 1). The fold induction in response to wound stimuli was from
4.3912.07 (fSE,
n=3) in line TrwS to 21.666.12 (tSE, n=3) in Trw9, with average 11-fold
increase in GUS
activity upon wounding. The GUS expression in unwounded leaves of win3.12T
plants was
merely detectable, ranging from 2.671.1 (tSE, n=5) in line Trw2 to 23.813.86
(tSE, n=3) in
Trw7. Thus, the 823 by downstream sequence of win3.12 promoter from poplar
(win3.12T
promoter) was sufficient to confer wound-regulated transgene expression in
potato.
In contrast, the leaves of all transgenic lines containing CaMV 35S promoter
showed no
increased GUS activity in response to the same wounding conditions, although
constitutive GUS
expression in unwounded leaves was significant: average values (ASE, n=3) from
278.27127.5
in line Trsl to 1125.56188.69 pmol MU miri 1 mg 1 protein in Trs3.
Further analysis of the win3.12T promoter was concentrated on transgenic lines
with highest
GUS expression: Trw3, Trw9 and Trwll. To study systemic response to wounding,
a single
leaf in the middle part of the plant (leaf 5, counted downward from the apex)
was repeatedly
wounded and GUS activity was measured in each leaf from the same plant
(including the
unwounded part of the wounded leaf) at 0, S, 10, 15 and 20 h. (Fig. 2).
Although the response
varied among transformants, 10 h after wounding, GUS activity was clearly
detected in the leaf
just above the wounded leaf 5. Fifteen and 20 h after wounding, the remote
response was
detected in other upper leaves (2 and 3) and in the leaf 6 just below the
wounded leaf; however,
13
CA 02469098 2004-06-22
the increase in GUS activity was lower than in leaves 4 and 5. Thus, the wound
signal moved
mainly upwards, probably in the vascular system and systemic GUS expression
increased
gradually over time, with the highest activity in the leaves that were closest
to the wounded site
and just above it. In some win3.12T plants, the elevated GUS expression was
also observed in
the upper juvenile leaves, which can be explained by the strong sink status of
particular leaf and
its direct vascular connection to the wounded leaf below.
The expression pattern of the win3.12T promoter varied according to
developmental age in all
lines. In both stressed and control win3.12T plants, transgene expression was
always lowest in
young plants (1-2-week-old) and increased several fold as plants matured (8-
week-old).
Comparison with GUS activity in control CaMV 35S plants confirmed that this
developmental
expression pattern was specific for win3.12T promoter and was not a result of
GUS protein
stability and its accumulation in older plants over time.
Transgene copy number and promoter activity
To investigate if the large variation in GUS activity among the transgenic
lines is associated
with the number of transgene insertions, tra,nsgene copy number was determined
by Southern
blot (Fig. 3). We observed a strong positive correlation between transgene
copy number and
win3.12T-driven GUS expression (Table 1 ): the increase in GUS activity in
leaves upon
wounding was proportional to the number of transgene insertions. The exception
was line
Trwl2 that exhibited no GUS activity. It contained one transgene insertion,
and its transgene
silence could be explained by a position effect.
Among plants with the CaMV 35S promoter, no correlation between number of
transgene
insertions and GUS accumulation was observed, although highest GUS expression
was in
transgenic line with the largest copy number (Trs2, 14 insertions).
Win3.12T promoter is systemically responsive to fungal infection
In addition to mechanical wounding, in some experiments we treated the injured
part of the leaf
with cell wall degrading enzymes. In all experiments with the combined
treatment, local GUS
activity in win3.12T plants was at least twice as high as in leaves that
received mechanical
14
CA 02469098 2004-06-22
damage only. Moreover, 20 h after the treatment, GUS expression was detected
in all
unwounded leaves of the win3.12T plant (line Trw3) at values comparable to GUS
expression in
the wounded leaf 5 indicating a high systemic response.
Potato plants were co-cultivated with Fusarium solani, a potato pathogen, and
fluorogenic GUS
activity was quantified in all leaves of each plant 1-2 d after fungal mycelia
contacted the plant
stem. In all lines, GUS accumulation in the leaf tissue after fungal infection
was 2- to 3-fold
higher than the local GUS activity in the corresponding leaves upon mechanical
wounding: the
results from representative lines are shown in Fig. 4. Increased GUS
expression was detected
not only in the lower leaves, which are closest to the site of contact with
the mycelia, but rather
in all leaves indicating a systemic response to fungal infection.
To analyze organ-specific activity of win3.12T promoter, transgenic plants of
the same
developmental stage were infected with F.solani, and GUS expression was
measured in all
1 S vegetative parts of the plants (Table 2). Promoter activity was also
studied in the organs of non-
stressed plants. All win3.12T lines analyzed had similar spatial patterns of
promoter activity. In
the absence of treatment, the win3.12T-driven GUS accumulation in aerial parts
of the plants
was generally low, from practically negligible in leaves to moderate (5-8
times higher) in
axillary buds. In contrast, GUS activity in roots was high. This expression
pattern was
confirmed by histochemical localization of GUS, showing the most intensive
blue staining in
roots and in vegetative axillary buds with their surrounding stem regions,
whereas staining in all
other vegetative parts of non-stressed plants was not detectable. After fungal
infection, GUS
expression increased in most vegetative organs throughout the plants (Table
2). The highest
induction of GUS activity in response to F.solani invasion was in leaves (up
to SO-fold), whereas
the highest total GUS activity was in axillary bud areas. Promoter activity
remained low in
tubers. Similar to the experiments with wound treatments, there was no
increased GUS activity
detected in roots of infected win3.12T plants. No pathogen-induced GUS
accumulation was
found in plants with the CaMV 35S promoter.
Activation of poplar promoter by fungal extract
To differentiate wound response from infection and to show that the increased
GUS
accumulation after co-cultivation with F. solani was a direct response to
fungal infection and not
CA 02469098 2004-06-22
due to extensive damage of vascular tissue by growing mycelium, we injected
crude Fusarium
extract into stems of transgenic plants and measured activity of win3.12T
promoter in all leaves
above the site of injection (Fig. Sa). All transgenic plants showed a
significant increase in GUS
activity in all leaves just 5 h after injection with fungal extract. Moreover,
within a transgenic
plant, mean GUS activities in leaves were similar 5, 10, or 20 h after
treatment. The response to
fungal extract was faster than the response to wounding, reaching a plateau
within 5 h. Injection
of sodium phosphate buffer into control transgenic plants caused no increase
in GUS activity
even 20 h after the treatment, and no GUS activity was detected in the fungal
extract, indicating
that the observed increase in win3.12T promoter activity was caused by
chemical compounds
present in the fungal extract.
To determine the minimum time required for activation of poplar promoter by
fungal extract,
whole leaves of similar size and development stage were cut along the main
vein, and one half
of the leaf was incubated in fungal extract, whereas the other half of the
same Leaf was incubated
in sodium phosphate buffer. The increase in GUS accumulation after incubation
in fungal
extract was non linear, preceded by a lag phase with no detectable GUS
activity, then followed
by rapid accumulation of transgene product after 2 h of incubation (Fig. Sb).
Similar to previous
experiments, no increase in GUS activity was found in leaf samples incubated
in buffer (control
for wounding). Incubation of leaves is concentrated fungal extract did not
increase GUS
accumulation. This may be because of a lack of uptake of the extract or it may
be because of
low uptake, such that a threshold level was not attained
Our finding that the response of the poplar promoter to Fusarium is much
higher than to
mechanical wounding alone indicates that the win3.12T promoter contains
specific regulatory
sequences, together with their own set of intracellular receptors/regulatory
proteins, that are
responsive to fungal infection. The higher GUS expression is response to
Fusarium may reflect
a cumulative effect of the win3.12T promoter responses to both fungal
infection and wounding.
In contrast to inducible activity in most vegetative organs, the win3.12T
promoter is
constitutively active in the roots with no response to either wounding or
fungal infection.
concentrations.
Example 2:
16
CA 02469098 2004-06-22
To evaluate the efficacy of win3.12T promoter for pathogen-induced expression
of defense
genes, we constructed three plant transformation vectors with transcriptional
fusion between this
promoter and one of the following antimicrobial peptide genes: cecropin-
mellitin (CEMA)
chimeric gene (Hancock et al., 1992), dermaseptin B gene (Vouille et. al.,
1997), and temporin
A gene (Simmaco et al., 1996). These constructs were introduced into tobacco
(Nicotiana
tabacum L. cv Xanthi) and hybrid poplar (Populus nigra x Populus maximowiczii)
via
Agrobacterium-mediated transformation. As a control for promoter activity,
tobacco and poplar
were also transformed with a construct designed to express (3-glucuronidase
(GUS) reporter
gene from the win3.12T promoter. Stable transgene integration into plants
regenerated on
selective medium was confirmed with PCR and Southern analyses, indicating that
one to nine
copies of the transgene were maintained in the plant genome. All transgenic
plants had normal
genotype, with no indication of cytotoxicity due to expression of the
antomicrobial peptide
genes. Northern blot analyses of leaf RNA from win3.12T plants showed high
level of transgene
expression after pathogen infection, whereas in the absence of stimuli the
promoter activity was
negligible. The pathogen-induced activity of the win3.12T promoter was
systemic, i.e.
throughout the plant. A number of stringent bioassays showed a spectrum of
plant resistance to
fungal infections, which correlated with the expression level of transgene
mRNAs in response to
pathogen invasion.
The transgenic plants were all resistant to Fusarium solani, Pythium
aphanidermatum, and
Rhizoctonia solani. These plants were also resistant against wild type of a
pathogenic bacteria
Agrobacterium tumefaciens.
References
1. M.A. Matzke, A.J.M. Matzke, How and why do plants inactivate homologous
(trans)genes? Plant Physiol. 107 (1995) 679-685.
2. D.J.Bowles, Defense related proteins in higher plants, Annu. Rev. Biochem.
59 (1990)
873-907.
3. H.R. Clarke, J.M. Davis, S.M. Wilbert, H.D.Jr. Bradshaw, M.P. Gordon, Wound-
induced
and developmental activation of a poplar tree chitinase gene promoter in
transgenic tobacco,
Plant Mol. Biol. 25 (1994) 799-815.
17
CA 02469098 2004-06-22
4. J.B. Hollick, M.P. Gordon, A poplar tree proteinase inhibitor-like gene
promoter is
responsive to wounding in transgenic tobacco, Plant Mol. Biol. 22 (1993) 561-
572.
5. M. Osusky, G. Zhou, L. Osuska, R.E. Hancock, W.W. Kay, S. Misra, Transgenic
plants
expressing cationic peptide chimeras exhibit broad-spectrum resistance to
phytopathogens, Nat.
Biotechnol. 18 (2000) 1162-1166.
6. R.M. Broadway, S.S. Duffey, Plant proteinase inhibitors: mechanism of
action and effect
on the growth and digestive physiology of larval Heliothis zea and Spodoptera
exiqua, J. Insect
Physiol. 32 (1986) 827-833.
7. T. Murashige, F. Skoog, A revised medium for rapid growth and bioassays
with tobacco
tissue cultures, Physiol. Plant. 15 (1962) 473-497.
8. J.E.Bourque, J.C.Miller, W.D.Park, Use of an in vitro tuberization system
to study tuber
protein gene expression, In Vitro Cell. Dev. Biol. Plant 23 (1987) 381-386.
9. R.A. Jefferson, T.A. Kavanagh, M.W. Bevan, GUS fusions: D-glucuronidase as
a sensitive
and versatile gene fusion marker in higher plants, EMBO J. 6 (1987) 3901-3907.
10. O.L. Gamborg, R.A. Miller, K. Ojima, Nutrient requirements of suspension
cultures of
soybean root cells, Exp. Cell Res. 50 (1968) 151-158.
11. M. De Block, Genotype-independent leaf disc transformation of potato
(Solarium
tuberosum) using Agrobacterium tumefaciens, Theor. Appl. Genet. 76 ( 1988) 767-
774.
12. S. Sheerman, M. W. Bevan, A rapid transformation method for Solarium
tuberosum using
binary Agrobacterium tumefaciens vectors, Plant Cell Rep. 7 (1988) 13-16.
13. W.J. Stiekema, F. Heidekamp, J.D. Louwerse, H.A. Verhoeven, P. Dijkhuis,
Introduction
of foreign genes into potato cultivars Bintje and Desiree using an
Agrobacterium tumefaciens
binary vector, Plant Cell Rep. 7 (1988) 47-50.
14. H. Wenzler, G. Mignery, G. May, W. Park, A rapid and efficient
transformation method
for the production of large numbers of transgenic potato plants, Plant Sci. 63
(1989) 79-85.
15. J.M. Davis, M.P. Gordon, B.A. Smit, Assimilate movement dictates remote
sites of
wound-induced gene expression in poplar leaves, Proc. Natl. Acad. Sci. USA, 88
(1991) 2393-
2396.
16. J.B. Hollick, M.P. Gordon, Transgenic analysis of a hybrid poplar wound-
inducible
promoter reveals developmental patterns of expression similax to that of
storage protein genes,
Plant Physiol. 109 (1995) 73-85.
18
CA 02469098 2004-06-22
17. R.W. Thornburg, G. An, T.E. Cleveland, R. Johnson, C.A. Ryan, Wound-
inducible
expression of a potato inhibitor II-chloramphenicol acetyltransferase gene
fusion in transgenic
tobacco plants, Proc. Natl. Acad. Sci. USA, 84 (1987) 744-748.
18. K. Keinonen-Mettala, A. Pappinen, K. von Weissenberg, Comparisons of the
efficiency
of some promoters in silver birch (Betula pendula), Plant Cell Rep. 17 (1998)
356-361.
19. E.E. Farmer, C.A. Ryan, Octadecanoid precursors of jasmonic acid activate
the synthesis
of wound-inducible proteinase inhibitors, Plant Cell, 4(2) (1992) 129-134.
20. S.J. Wang, Y.C. Lan, S.F. Chen, Y.M. Chen, K.W. Yeh, Wound-response
regulation of
the sweet potato sporamin gene promoter region, Plant Mol. Biol. 48 (2002) 223-
231.
21. Y.H. Cheong, H.S. Chang, R. Gupta, X. Wang, T. Zhu, S. Luan,
Transcriptional profiling
reveals novel interactions between wounding, pathogen, abiotic stress, and
hormonal responses
in arabidopsis, Plant Physiol. 129 (2002) 661-677.
22. B. Alberts, D. Bray, J. Lewis, M. Raff, K. Roberts, J.D.Watson, Molecular
biology of the
cell, Ed. 3, Garland Publishing, Inc., New York,1994.
23. K. Maleck, A. Levine, T. Eulgem, A. Morgan, J. Schmid, K.A. Lawton, J.L.
Dangl, R.A.
Dietrich, The transcriptome of Arabidopsis thaliana during systemic acquired
resistance, Nat.
Genet. 26 (2000) 403-409.
24. M. Keil, J.J. Sanchez-Serrano, L. Willmitzer, Both wound-inducible and
tuber-specific
expression are mediated by the promoter of a single member of the potato
proteinase inhibitor II
gene family, EMBO J. 8 (1989) 1323-1330.
25. Hancock R.E.W., Brown M.H., Piers K. Cationic peptides and method of
preparation. US
Patent application serial No. 07/913, 492, filed August 21, 1992.
26. Vouille V., Amiche M., Nicolas P. Structure of genes for dermaseptins B,
antimicrobial
peptides from frog skin. (1997) FEBS Lett. 414, 27-32.
27. Simmaco M., Mignogna G., Canofeni S., Miele R., Mangoni M.L., Barra D.
Temporins,
antimicrobial peptides from the European red frog Rana temporaria. (1996) Eur.
J. Biochem.
242. 788-792.
19
CA 02469098 2004-06-22
p~~~g ~i~3'.:~2T ~A~ aid ~aM'V 3~~ ~'B~ p~oma~crs.
A
~ aans~a w~.3.,~''~.~r~"~
1'~ic lc T1 'CIta~3 Tt~r3 Trw~ ~ - TT!8 '"I r~r9 Trwtrl0 Tar
l 1 -Try
1 1 ~ 1 1 3 ~ 3 ! ~4
Gar 4 a2~13 ~1~3 '~O~t Lo8~8 "~~~z 2~i~ 6214
it~d.nt~'
,.,cue r~:z ~~~ ;~r:~ ~a~.~ ~:~ ~:~ s:~ ~o.~ x:~ ~~:~ .
I~cv~t Card' ,~~5'~rU~ ~r~its
T I Tint Tt~2 "~"r~ Tts"T
4 14 9
City ~cta~br
in
vra~detl tin':2Z~ i 1 1'~6 ~~~t tit
t~9
PW~i ~n a~
t; ~iyjl~,' _ _
~s r s ~ia~by aa~S~ ~ ~t~~r ~ci~ .
~ti~~r:i~.l~~~~ ~'~vi.~:~
t ~i~r ~nr~s a~ ~; liar. ~5 ~ lt~d~t=aa~t~u~ea1 h '
to 'irr~' t'~U~ ~' ie~ ~rEe~d ~'~ ~D!~ ~ ,~,
~ re~aana~.to rwat~l Eli:
20
CA 02469098 2004-06-22
Table 2. Organ-specific plants in
activity of win3.12T the
promoter in ttansgenic
absence of treatment and
in response to fungal
infection.
DNA ecmstruct wi3:IlT Ca~Y35~=GTIS
GUS
Tra~tsgenic Iine Trw3 Trw9 Trwl l Trs1
Leaves, N~ 114' I4~3 1313 3858
I;eaves;Fb 460142 52134 42621 347152
Petioles, N 21 t4 25+5 245 241 130
Petioles, P 5 t 1~r3~ 5'13~~7 48512$ 23433
~t~m segme~; 'I~ 287 3~~7 2716 31Q~43
Stem se~me~; F 6337'1 68081 597t7D 2$840
Axillary~ duds, N $711 11219 G3f8 278136
Ancillary buds, F 76054 835*~3 72567 2~ 1 ~2
Vegetative apex, N 3518 53114 f$~10 272140
Wcgetative apex, F 49112 80118 66115 29Q~44
Rots, N 3$446 423152 4U9t47 5701?
Roots; F 3645$ 44061 37439 5$31$1
Tubers; N 1614 I3t3 L5~4 I44t2f
Tubers; F 215 114 225 12$19
'tissue eras collected
frcau a non-trued plant.
~F; tissue au~s collectedsubjected solani infection(see "Materials
frr~m a plant to F.
> s
~Iea~n values-t Slr m
~nol-MU mg' ptotem mug'
represent the average
GUS accumu#ah~
in indicated orgat~s/tiss~s
from three plants of
each trans~enic line.
21
