Note : Les descriptions sont présentées dans la langue officielle dans laquelle elles ont été soumises.
CA 02606229 2007-10-25
WO 2006/116763 PCT/US2006/016559
LAWSONL4 INTRA CELL ULARIS IMMUNOLOGICAL PROTEINS
RELATED APPLICATIONS
This application claims the benefit of provisional application serial number
60/675,806,
filed on April 28,2005, the teachings and contents ofwhich are hereby
incorporated by reference.
SEQUENCE LISTING
This application contains a sequence listing in coniputer readable forinat,
the teacliings
and content of whicli are hereby incoiporated by reference.
BACKGROUND OF THE INVENTION
Field of the Invention
The present application is concerned with antigens of Lawsonia intracellulay
is and their
use. More particularly, the present application is concerned with antigens
that are
immunologically relevant proteins and the nucleic acid sequences or DNA
molecules encoding
those proteins and vectors including DNA molecules coding for immunological
proteins of
Lawsonia intracellularis. Even more particularly, the present invention is
concerned with the
identification of such proteins and nucleic acid sequences. Still more
particularly, the present
invention is concerned with determining whether such proteins or nucleic acid
sequences are
good candidates for use in a subunit vaccine by their location. Even more
particularly, the
present invention is concerned with such proteins and nucleic acid sequences
that are capable of
invoking an immune response in a host animal. Still more particularly, the
present application
1
CA 02606229 2007-10-25
WO 2006/116763 PCT/US2006/016559
is concerned with such proteins and nucleic acid sequences and their
incorporation into an
immunogenic composition as well as the subsequent administration of such a
composition to a
host animal. The proteins and/or nucleic acid sequences can be used as a
component in a vaccine
and the vaccine used to provide a degree ofprotective immunity against and/or
a lessening of the
clinical symptoms associated with infection byLawsonia in.tracellular=is. The
present application
is also concerned with methods ofproducing and administering vaccines
comprising such nucleic
acid sequences or the proteins encoded thereby. Finally, the present
application is concerned
with diagnostic tests for the detection of Lawsonia intracellularis as well as
methods of
producing and administering vaccine incorporating such Lawsonia ints acellulaf
is antigens.
Description of the Prior art
Lawsonia Intracellularis is the causative agent of porcine proliferative
interopathy
("PPE"), and it effects virtually all animals, including humans, rabbits,
ferrets, hamsters, fox,
horses, and otlier animals as diverse as ostriches and emus. PPE is a common
diarrheal disease
of growing-finishing and young breeding pigs characterized by hyperplasia and
inflammation of
the ileum and colon. It often is mild and self-limiting but sometimes causes
persistent diarrhea,
depression, reduced appetite, reluctance to move, retarded growth, increased
FCR, severe
necrotic enteritis, or hemorrhagic enteritis with high mortality. The bacteria
itself is an obligate,
intracellular bacterium.
The bacteria associated with PPE have been referred to as "Campylobacter-like
organisms." S. McOrist et al., Vet. Pathol., Vol. 26, 260-264 (1989).
Subsequently, the
causative bacteria have been identified as a novel taxonomic genus and
species, vernacularly
referred to as Ileal symbiont (IS) intracellularis. C. Gebhart et al., Int'l.
J. of Systemic
Bacteriology, Vol. 43, No. 3, 533-538 (1993). More recently, these novel
bacteria have been
2
CA 02606229 2007-10-25
WO 2006/116763 PCT/US2006/016559
given the taxonomic name Lawsonia (L.) intf=acellular=is. S. McOrist et al.,
Int'l. J. of Systemic
Bacteriology, Vol. 45, No. 4, 820-825 (1995). These three names have been used
interchangeably to refer to the same organism as further identified and
described herein. Koch's
postulates have been fulfilled by inoculation of pure cultures of L
intracellularis into
conventionally reared pigs; typical lesions of the disease were produced, and
L intracellular=is
was reisolated from the lesions. The more common, nonhemorrhagic form of the
disease often
affects 18- to 36-kg pigs and is characterized by sudden onset of diarrhea.
The feces are watery
to pasty, brownish, or faintly blood stained. After -2 days, pigs may pass
yellow fibrinonecrotic
casts that have formed in the ileuin. Most affected pigs recover
spontaneously, but a significant
number develop chronic necrotic enteritis with progressive emaciation. The
hemorrhagic form
is characterized by cutaneous pallor, weakness, and passage of hemorrhagic or
blaclc, tarry feces.
Pregnant gilts may abort. Lesions may occur anywhere in the lower half of the
small intestine,
cecum, or colon but are most frequent and obvious in the ileum. The wall of
the intestine is
thickened, and the mesenterymaybe edematous. The mesenteric lymph nodes are
enlarged. The
intestinal mucosa appears thickened and rugose, may be covered with a brownish
or yellow
fibrinonecrotic membrane, and sometimes has petechial hemorrhages. Yellow
necrotic casts may
be found in the ileuin or passing through the colon. Diffuse, complete mucosal
necrosis in
chronic cases causes the intestine to be rigid, resembling a garden hose.
Proliferative mucosal
lesions often are in the colon but are detected only by careful inspection at
necropsy. In the
profusely hemorrhagic form, there are red or black, tarry feces in the colon
and clotted blood in
the ileum. Altogether, L. intracellularis is a particularly great cause of
losses in swine herds in
Europe as well as in the United States.
L. intracellularis is an obligate, intracellular bacterium which cannot be
cultured by
normal bacteriological methods on conventional cell-free media and has been
thought to require
3
CA 02606229 2007-10-25
WO 2006/116763 PCT/US2006/016559
cells for growth. S. McOrist et al., Infection and Immunity, Vol. 61, No. 19,
4286-4292 (1993)
and G. Lawson et al., J. of Clinical Microbiology, Vol. 31, No. 5, 1136-1142
(1993) discuss
cultivation of L. ints=acellulaz~is using IEC-18 rat intestinal epithelial
cell monolayers in
conventional tissue culture flasks. In U.S. Patent Nos. 5,714,375 and
5,885,823, both of which
are herein incorporated by reference in their entireties, cultivation of L.
intracellularis in
suspended host cells was described.
Pathogenic and non-pathogenic attenuated bacteria strains of L.
intracellularis are well
known in state of the art. For example, WO 96/39629 and WO 05/0 1 1 73 1
describe non-
pathogenic attenuated strains of L. intracellularis. Further attenuated
bacteria strains of L.
intracellularis are known from WO 02/26250 and WO 03/00665.
What is needed in the art is a vaccine effective against Lawsonia
intf=acellulai is infection,
which provides or confers protective immunity to an animal and/or reduces the
severity of
clinical symptoms associated with Lawsonia intracellularis infection. What is
further needed
are methods of making and administering such vaccines.
SUMMARY OF THE INVENTION
The present invention overcomes the problems inherent in the prior art and
provides a
distinct advance in the state of the art. Specifically, this invention
concerns antigens comprising
immunological proteins derived from Lawsonia intf=acellularis and their use in
the vaccination
of swine against infection by Lawsonia int>racellularis. Preferably, the
proteins will elicit a
humoral immune response during the normal course of infection in swine. These
proteins, both
individually and in combination, will be useful as a component in a protein
subunit vaccine that
invokes an immune response and provides protective immunity against or a
lessening of the
clinical symptoms associated with Lawsonia intracellularis infection. The
identified proteins
4
CA 02606229 2007-10-25
WO 2006/116763 PCT/US2006/016559
can then be generated by any conventional means and used in a vaccine.
The Lawsonia intracellularis DK15540 genomic nucleotide sequence was analyzed
for
the presence of nucleotide sequences that would encode proteins having a
minimum length of
300 amino acids. Altogether, 456 protein sequences having at least 300 amino
acids were
identified. These sequences corresponded to SEQ-ID Nos. 1-455 and 466. These
protein
sequences were further analyzed using two separate computer programs, PSORT
and CELLO.
The purpose of this analysis was to identify proteins of interest that were
300 amino acids or
longer, and find or predict their location in Lawsonia ifzty acelluaris.
Knowledge of the location
of a protein will indicate the suitability of a protein for use in a subunit
vaccine to one of skill in
the art. The PSORT program is used to predict subcellular localization and is
hosted by the
Brinkman Laboratory at Simon Fraser University and can be found at psort.org.
The CELLO
program uses a Support Vector Machine based on n-peptide composition to assign
a Gram-
negative protein to the cytoplasm, inner membrane, periplasm, outer membrane
or extracellular
space and is found at cello.life.nctu.edu.tw. Generally, the suitability of a
protein as a component
in a subunit vaccine is, in increasing order of suitability, cytoplasmic,
inner membrane,
periplasmic, outer membrane, and extracellular. In other words, extracellular
proteins provide
the greatest likelihood of effectiveness for vaccines, while cytoplasmic
proteins provide the least
likelihood of suitability. This is because such proteins are more exposed and
accessible for the
inducement of an immune response. Using CELLO, extracellular proteins included
SEQ ID Nos.
6, 329, 296, 413, 194, 143, 146, 333, 438, 188, 261, 237, 336, 291, 151, 26,
139, 333, 444, 308,
131, 284, and 340, or an immuogenic portion thereof; outer membrane proteins
included SEQ
ID Nos. 355,11, 378, 50, 35, 231, 4, 328, 313, 27,172, 275, 387,134, 201, 256,
2,12, 404, 388,
327, 306, 415, 343, 373, 214, 330, 316, 428,190,129, 320, 381, 9, 292,158,
270, 336, 423, 211,
178, 430, 77, 186, 264, 140, 193, 192, 208, 183, 108, 109, 87, 253, 379, 243,
364, 51, 99, 419,
CA 02606229 2007-10-25
WO 2006/116763 PCT/US2006/016559
278, 295, 349, 219, 127, 389, 254, 263, 294, 315, 257, 443, 403, 76, 75, 73,
344, 74, and 238,
or an immuogenic portion thereof; periplasmic proteins included SEQ ID Nos.
6,132, 421,112,
110, 310, 247, 205, and 7, or an immuogenic portion thereof; inner membrane
proteins included
SEQ ID Nos. 228, 452, 144, 323, 305, 357, 360, 95, 130, 34, 405, 118, 451,
299, 48, 376, 358,
377, 352, 39, 106, 258, 309, 445, 195, 311, 179, 410, 265, 249, 354, 398, 408,
20, 44, 68, 31,
153, 187, 345, 69, 366, 348, 1, 324, 281, 88, 239, 36,276, 29,104, 70,426,
302, 314, 369, 418,
58, 166, 384, 107, 18, 272, 41, 200, 180, 92, 386, 156, 455, 383, 361, 116,
277, 55, 252, 32, 93,
241, 120, 229, 121, 89, 382, and 250, or an immuogenic portion thereof; and
cytoplasmic
proteins included SEQ ID Nos. 6, 79, 346, 332, 11, 53, 81, 8, 21, 435, 234,
185, 450, 347, 424,
326,155, 215, 399, 209, 216, 416, 147, 313, 157,342, 343, 293, 271, 337, 72,
269,103, 64, 425,
148, 341, 24, 285, 289, 429, 268, 177, 405, 260, 407, 100, 442, 321, 370, 47,
353, 80, 67, 436,
30, 220, 397, 212, 96, 149, 119, 273, 105, 85, 15, 3, 232, 40, 225, 420, 19,
286, 259, 196, 207,
176, 280, 431, 160, 367, 168, 128, 124, 394, 126, 5, 255, 242, 46, 152, 16,
65, 433, 167, 221,
414, 287, 412, 111, 303, 449, 114, 233, 406, 25, 210, 61, 203, 86, 141, 171,
447, 266; 437, 173,
78, 199, 319, 400, 392, 351, 184, 43, 217, 189, 174, 409, 204, 396, 83, 335,
98, 224, 113, 372,
301, 164, 246, 56, 175, 262, 226, 17, 362, 338, 267, 356, 251, 300, 62, 14;
350, 37, 202, 159,
115, 331, 317, 163, 38, 240, 318, 236, 304, 439, 191, 244, 97, 417, 133, 123,
22, 359,165, 385,
218,162,102, 223, 283, 453, 290, 402, 71, 446, 380, 339,122,161,117, 390,
82,427, 371, 454,
49, 368, 28, 10, 42, 63, 57, 59, 54, 136, 84, 181, 60, 90, 52, 125, 230, 142,
440, 197, 363, 23,
325, 154, 227, 282, 213, 33, 391, 91, 312, 198, 101, 45, 422, 298, 448, 375,
274, 150, 206, 374,
248, 393, 222, 288, 235, 66,182, 307, 334, 322,169, 279,13, 395, 434,
365,137,145,170, 401,
441, 138, 94, 245, 411, and 135, or an immuogenic portion thereof. Moreover,
the order
provided in each of the CELLO prediction lists above provides the proteins in
order, from least
suitable of the group to most suitable, for vaccine purposes. Thus, for
purposes of the present
6
CA 02606229 2007-10-25
WO 2006/116763 PCT/US2006/016559
invention, it is preferred to use a Lawsonia intf=acellularis protein. More
preferably, it is
preferred to use a sequence selected from the group consisting of SEQ ID Nos.
1-455 and 466,
as well as the proteins eiicoded by SEQ ID Nos. 456 and 457. Still more
preferably, it is
preferred to use an extracellular or outer membrane protein, and even more
preferably, a protein
selected from the group consisting of SEQ ID Nos. 355, 11, 378, 50, 35, 231,
4, 328, 313, 27,
172, 275, 387, 134, 201, 256, 2, 12,404, 388, 327, 306, 415, 343, 373, 214,
330, 316, 428, 190,
129, 320, 381, 9, 292, 158, 270, 336, 423, 211, 178, 430, 77, 186, 264, 140,
193, 192, 208, 183,
108, 109, 87,253, 379, 243, 364, 51, 99, 419, 278, 295, 349, 219, 127, 389,
254, 263, 294, 315,
257, 443, 403, 76, 75, 73,344, 74, 238, 6, 329, 296, 413,194,143, 146,333,
438,188, 261, 237,
336, 291, 151, 26, 139, 333, 444, 308, 131, 284, and 340, or any immunogenic
portion, or
homolog of the above-mentioned Lawsonia proteins, or any immunogenic portion
of said
homolog. Again, these proteins are listed in order of increasing suitability
for use in a subunit
vaccine. Still more preferably, extracellular proteins are used, and even more
preferably, the
protein is selected from the group consisting of SEQ ID Nos.. 6, 329, 296,
413, 194, 143, 146,
333, 438, 188, 261, 237, 336, 291, 151, 26, 139, 333, 444, 308, 131, 284, and
340, or any
immunogenic portion, or homolog of the above-mentioned Lawsonia proteins, or
any
immunogenic portion of said homolog. . The complete CELLO results are included
in Table 1
of U.S. Serial No. 60/675,806, the application to which benefit is claimed
herein.
Using PSORT, extracellular proteins (ECSVM - Localization) included SEQ ID
Nos.
237, 292, and 327; outer membrane proteins (OMSVM - Localization) included SEQ
ID Nos..
51, 108, 140, 193, 194, 211, 217, 219, 237, 256, 257,269, 278, 284, 292, 294,
315, 327, 329,
344, 349, 389, and 403; outer membrane proteins identified by Motif -
Localization included
SEQ ID Nos.. 32, 70, and 155; no periplasmic proteins were identified using
PPSVM -
Localization; periplasmic proteins identified using Motif-Localization
included 187, 250, 272,
7
CA 02606229 2007-10-25
WO 2006/116763 PCT/US2006/016559
and 303; inner melnbrane proteins identified by CMSVN - Localization included
SEQ ID Nos,.
1, 16,18, 20, 29, 31, 32, 41, 44, 55, 58, 68, 69, 70, 88, 89, 92, 93, 104,
107, 116, 120, 121, 153,
156, 166, 179, 180, 187, 195, 200, 229, 239, 241, 250, 252, 272, 276, 277,
300, 302, 314, 324,
345, 348, 361, 366, 369, 382, 383, 384, 386, 408, 410, 418, 426, 432, and 455;
inner membrane
proteins identified using HMMTOP - Localization included SEQ ID Nos.. 16,18,
20, 29, 31, 32,
36, 41, 44, 53, 55, 58, 67, 68, 69, 70, 74, 77, 88, 89, 92, 93, 104, 107, 114,
116, 120, 121, 140,
146, 153, 156, 166, 179, 180, 187, 195, 200, 201, 211, 229, 239, 241, 242,
250, 252, 265, 272,
276, 277, 278, 281, 292, 302, 310, 311, 314, 324, 341, 345, 348, 354, 355,
361, 366, 369, 382,
383, 384, 386, 404, 408, 410, 418, 424, 426, 427, 432, 443, and 455; and
cytoplasmic proteins
identified using CytoSVM - Localization included SEQ ID Nos.. 5, 8,10, 13, 17,
22, 23, 24, 30,
33, 37, 38, 42, 43, 45, 49, 52, 54, 60, 62, 63, 64, 84, 85, 86, 90, 91, 94,
98, 101, 113, 125, 133,
135, 136, 137, 138, 142, 145, 150, 152, 154, 155, 165, 168, 169, 170, 171,
173, 174, 175, 176,
181, 182, 189, 197, 198, 202, 206, 213, 214, 218, 220, 221, 222, 223, 224,
226, 227, 230, 235,
236, 240, 242, 245, 247, 248, 254, 255, 268, 274, 279, 282, 288, 293, 295,
298, 303, 304, 307,
312, 313, 317, 325, 330, 334, 338, 350, 352, 353, 356, 362, 363, 365, 368,
371, 372, 374, 375,
380, 385, 390, 392, 394, 395, 400, 401, 402, 406, 407, 409, 411, 412, 417,
420, 422, 431, 433,
434, 437, 439, 440, 441, 443, 448, 453, and 454. The complete PSORT results
were provided
in Table 2 of U.S. Serial No. 60/675,806.
Next, each of the sequences were searched through BLAST in order to find other
proteins
that were homologous to the 456 Lawsonia proteins. The results of this BLAST
searching is
contained herein as Fig. 5.
Finally, amino acid alignments between the Lawsonia DKl 5540 hemolysin and
Omp85-
like proteins with Desulfovibria were provided in TABLE 3 of U.S. Serial No.
60/675,806.
As used herein, the following definitions will apply: "Sequence Identity" as
it is known
8
CA 02606229 2007-10-25
WO 2006/116763 PCT/US2006/016559
in the art refers to a relationship between two or more polypeptide sequences
or two or more
polynucleotide sequences, namely a reference sequence and a given sequence to
be compared
with the reference sequence. Sequence identity is determined by comparing the
given sequence
to the reference sequence after the sequences have been optimally aligned to
produce the highest
degree of sequence similarity, as determined by the match between strings of
such sequences.
Upon such alignment, sequence identity is ascertained on a position-by-
position basis, e.g., the
sequences are "identical" at a particular position if at that position, the
nucleotides or amino acid
residues are identical. The total number of such position identities is then
divided by the total
nuinber of nucleotides or residues in the reference sequence to give %
sequence identity.
Sequence identity can be readily calculated by known methods, includirig but
not limited to,
those described in Computational Molecular Biology, Lesk, A. N., ed., Oxford
University Press,
New York (1988), Biocomputing: Informatics and Genome Projects, Smith, D.W.,
ed., Academic
Press, New York (1993); ComputerAnalysis of Sequence Data, Part I, Griffin,
A.M., and Griffin,
H. G., eds., Humana Press, New Jersey (1994); Sequence Analysis in Molecular
Biology, von
Heinge, G., Academic Press (1987); Sequence Analysis Primer, Gribskov, M. and
Devereux, J.,
eds., M. Stockton Press, New York (1991); and Carillo, H., and Lipman, D.,
SIAM J. Applied
Math., 48: 1073 (1988), the teachings of which are incorporated herein by
reference. Preferred
methods to determine the sequence identity are designed to give the largest
match between the
sequences tested. Methods to determine sequence identity are codified in
publicly available
computer programs which determine sequence identity between given sequences.
Examples of
such programs include, but are not limited to, the GCG program package
(Devereux, J., et al.,
Nucleic Acids Research,12(1):387 (1984)), BLASTP, BLASTN and FASTA (Altschul,
S. F. et
al., J. Molec. Biol., 215:403-410 (1990). The BLASTX program is publicly
available from NCBI
and other sources (BLAST Manual, Altschul, S. et al., NCVI NLM NIH Bethesda,
MD 20894,
9
CA 02606229 2007-10-25
WO 2006/116763 PCT/US2006/016559
Altschul, S. F. et al., J. Molec. Biol., 215:403-410 (1990), the teachings of
which are
incorporated herein by reference). These programs optimally align sequences
using default gap
weights in order to produce the highest level of sequence identity between the
given and
reference sequences. As an illustration, by apolynucleotide having a
nucleotide sequence having
at least, for example, 95% "sequence identity" to a reference nucleotide
sequence, it is intended
that the nucleotide sequence of the given polynucleotide is identical to the
reference sequence
except that the given polynucleotide sequence may include up to 5 point
mutations per each 100
nucleotides of the reference nucleotide sequence. In other words, in a
polynucleotide having a
nucleotide sequence having at least 95% identity relative to the reference
nucleotide sequence,
up to 5% of the nucleotides in the reference sequence may be deleted or
substituted with another
nucleotide, or a number of nucleotides up to 5% of the total nucleotides in
the reference sequence
may be inserted into the reference sequence. These mutations of the reference
sequence may
occur at the 5' or 3' terminal positions of the reference nucleotide sequence
or anywhere between
those terminal positions, interspersed either individually among nucleotides
in the reference
sequence or in one or more contiguous groups within the reference sequence.
Analogously, by
a polypeptide having a given amino acid sequence having at least, for example,
95% sequence
identity to a reference amino acid sequence, it is intended that the given
ainino acid sequence of
the polypeptide is identical to the reference sequence except that the given
polypeptide sequence
may include up to 5 amino acid alterations per each 100 amino acids of the
reference amino acid
sequence. In other words, to obtain a given polypeptide sequence having at
least 95% sequence
identity with a reference amino acid sequence, up to 5% of the amino acid
residues in the
reference sequence may be deleted or substituted with another amino acid, or a
number of amino
acids up to 5% of the total number of amino acid residues in the reference
sequence may be
inserted into the reference sequence. These alterations of the reference
sequence may occur at
CA 02606229 2007-10-25
WO 2006/116763 PCT/US2006/016559
the amino or the carboxy termijnal positions of the reference amino acid
sequence or anywhere
between those terminal positions, interspersed either individually among
residues in the reference
sequence or in the one or more contiguous groups within the reference
sequence. Preferably,
residue positions which are not identical differ by conservative amino acid
substitutions.
However, conservative substitutions are not included as a match when
determining sequence
identity.
Similarly, "sequence homology", as used herein, also refers to a method of
determining
the relatedness of two sequences. To determine sequence homology, two or more
sequences are
optimally aligned as described above, and gaps are introduced ifnecessary.
However, in contrast
to "sequence identity", conservative amino acid substitutions are counted as a
match when
determining sequence homology. In other words, to obtain a polypeptide or
polynucleotide
having 95% sequence homology with a reference sequence, 95% of the amino acid
residues or
nucleotides in the reference sequence must match or coinprise a conservative
substitution with
another anlino acid or nucleotide, or a number of amino acids or nucleotides
up to 5% of the total
amino acid residues or nucleotides, not including conservative substitutions,
in the reference
sequence may be inserted into the reference sequence.
A "conservative substitution" refers to the substitution of an amino acid
residue or
nucleotide with another amino acid residue or nucleotide having similar
characteristics or
properties including size, hydrophobicity, etc., such that the overall
functionality does not change
significantly.
"Isolated" means altered "by the hand of man" from its natural state., i.e.,
if it occurs in
nature, it has been changed or removed from its original environment, or both.
For example, a
polynucleotide or polypeptide naturally present in a living organism is not
"isolated," but the
same polynucleotide or polypeptide separated from the coexisting materials of
its natural state
11
CA 02606229 2007-10-25
WO 2006/116763 PCT/US2006/016559
is "isolated", as the term is employed herein.
In general, each sequence described herein including the protein sequences and
the DNA
encoding such proteins also covers proteins and DNA sequences having certain
percentages of
sequence homology or sequence identity relative to the disclosed sequences.
While it is preferred
to have high percentages of sequence homology or identity, it is more
preferred to retain the
functions of the claimed sequence than the sequence per se. In other words,
those of skill in the
art will be able to make minor changes to the sequences disclosed herein yet
retain the
functionality of the disclosed sequences with such "derivative" sequences.
Conservative
substitutions would be one preferred method of making changes to the sequence
while still
preserving functionality. Preferably the present invention will embrace other
sequences including
derivative sequences that are based on the sequences disclosed herein. Such
other sequences will
preferably have at least about 85% sequence identity or homology, more
preferably at least about
90% sequence identity or homology, still more preferably at least about 95%
sequence identity
or homology, even more preferably at least about 97% sequence identity or
homology, still even
more preferably at least about 98% sequence identity or homology, and even
more preferably at
least about 99% sequence identity or homology with a sequence disclosed
herein. Preferably,
such homology exists over a lengths of at least 25 amino acids/nucleotides,
more preferably at
least 50 amino acids/nucleotides, even more preferably at least 75 amino
acids/nucleotides, still
even more preferably at least 150 amino acids/nucleotides, even more
preferably at least 200
amino acids/nucleotides, even more preferably at least 250 amino
acids/nucleotides, and most
preferably, at least 300 amino acids/nucleotides.
Additionally, it is understood that the protein sequences described herein are
useful in
immunogenic compositions and that some stretches or portions of these
sequences play a greater
role in inducing an immune response than others. This means that sufficient
immune responses
12
CA 02606229 2007-10-25
WO 2006/116763 PCT/US2006/016559
could be induced by using just selected portions of these proteins, provided
that the selected
portions were of sufficient length to generate an immune response.
Accordingly, the invention
covers any immunogenic portion of the proteins described herein. Moreover, the
invention also
covers any DNA molecules encoding for those immunogenic stretches or portions.
Generally,
such stretches or portions will comprise the sequence of contiguous amino
acids/nucleotides up
to the entire length of the sequence. More preferably, such stretches or
portions will, in
ascending order of preference, have at least 300, 290, 280, 270, 260, 250,
240, 230, 220, 210,
200, 190, 180, 170, 160, 150, 140, 130, 120, 110, 100, 90, 80, 70, 60, 50, 45,
40, 35, 30, 25, 20,
18, 15, 13, 10, 9, or most preferably 8 contiguous amino acids from the
disclosed sequence, or
any homolog thereof. When related to a DNA molecule, such stretches or
portions will, in
ascending order of preference, encoding for at least 300, 290, 280, 270, 260,
250, 240, 230, 220,
210, 200,190,180,170,160,150,140,130,120,110,100, 90, 80, 70, 60, 50, 45, 40,
35, 30, 25,
20, 18, 15, 13, 10, 9, or most preferably 8 contiguous amino acids from the
disclosed sequence.
Preferably, said homolog sequences will preferably have at least about 85%
sequence identity or
homology, more preferably at least about 90% sequence identity or homology,
still more
preferably at least about 95% sequence identity or homology, even more
preferably at least about
97% sequence identity or homology, still even more preferably at least about
98% sequence
identity or homology, and even more preferably at least about 99% sequence
identity or
homology with a sequence disclosed herein. As with the sequences themselves,
such stretches
are also operable for manipulation without loss of function by those of skill
in the art.
Accordingly, the sequence homology and sequence identity definitions also
apply to these
stretches or portions of the disclosed proteins.
As used herein, the term "L. intracellularis" or "Lawsonia intracellularis" or
"Lawsonia"
means the intracellular, curved gram-negative bacteria described in detail by
C. Gebhart et al.,
13
CA 02606229 2007-10-25
WO 2006/116763 PCT/US2006/016559
Int'l. J. of Systemic Bacteriology, Vol. 43, No. 3, 533-538 (1993) and S.
McOrist et al., Int'l. J.
of Systemic Bacteriology, Vol. 45, No. 4, 820-825 (1995), each of which is
incorporated herein
by reference in their entireties, and includes but is not limited to the
isolates described in WO
96/39629 and WO 05/0 1 1 73 1. In particular, the term "L. intracellularis"
also means, but is not
limited to the isolates deposited under the Budapest Treaty with the American
Type Culture
Collection, 10801 University Boulevard, Manassas, Virginia 20110-2209 and
assigned ATCC
accession number PTA 4926 or ATCC accession number 55783. Both isolates are
described in
WO 96/39629 and WO 05/011731, respectively. The term "L. intracellularis" also
means, but
is not limited to any other L. intracellularis bacteria strain or isolate
preferably having the
immunogenic properties of at least one oftheL. intracellularis strains
described in WO 96/39629
and WO 05/011731, in particular having the immunogenic properties of at least
one of the
isolates deposited under the Budapest Treaty with the American Type Culture
Collection, 10801
University Boulevard, Manassas, Virginia 20110-2209 and assigned ATCC
accession numbers
PTA 4926 or ATCC accession number 55783.
Moreover, the term "L intracellularis" also means any L. intracellularis
antigen. The '
term "L. intYacellularis antigen" as used herein means, but is not limited to
any composition of
matter, that comprises at least one antigen that can induce, stimulate or
enhance the immune
response against aL. intracellularis-caused infection, when administered to an
animal, preferably
a pig. Preferably, said L. intracellularis antigen is a complete L.
intracellulaf is bacterium, in
particular in an inactivated form (a so called killed bacterium), a modified
live or attenuated L.
intracellularis bacterium (a so called MLB), a chimeric vector that comprises
at least an
immunogenic amino acid sequence ofL. intracellularis, or any other polypeptide
or component,
that comprises at least an immunogenic ainino acid sequence of L.
intracellularis. The terms
"immunogenic protein", "immunogenic polypeptide" or "immunogenic amino acid
sequence"
14
CA 02606229 2007-10-25
WO 2006/116763 PCT/US2006/016559
as used herein, refer to any amino acid sequence which elicits an immune
response in a host
against a pathogen comprising said immunogenic protein, immunogenic
polypeptide or
immunogenic ainino acid sequence. In particular, an "immunogenic protein",
"immunogenic
polypeptide" or "immunogenic amino acid sequence" ofL. intracellularis means
any amino acid
sequence that codes for an antigen which elicits an immunological response
against L.
intracellulaf is in a host to which said "immunogenic protein", "immunogenic
polypeptide" or
"immunogenic amino acid sequence" is administered. For example, the proteins
having the
sequences of SEQ ID Nos 1- 455 and SEQ ID No 466, or any immunogenic portion
thereof are
considered to be an "immunogenic protein", "immunogenic polypeptide" or
"immunogenic
amino acid sequence" ofLawsonia intracellulaNis. Furthermore, these terms
include, but are not
limited to the full-length sequence of any proteins, analogs thereof, or
iinmunogenic fragments
or portions thereof. The term "immunogenic fragment" or "immunogenic portion"
means a
fragment of a protein which includes one or more epitopes and thus elicits the
immunological
response against the relevant pathogen. Such fragments can be identified using
any number of
epitope mapping techniques that are well known in the art. See, e.g., Epitope
Mapping Protocols
in Methods in Molecular Biology, Vol. 66 (Glenn E. Morris, Ed., 1996) Humana
Press, Totowa,
New Jersey. (The teachings and content of which are incorporated by reference
herein.) For
example, linear epitopes maybe determined by e.g., concurrently synthesizing
large numbers of
peptides on solid supports, the peptides corresponding to portions of the
protein molecule, and
reacting the peptides with antibodies while the peptides are still attached to
the supports. Such
techniques are known in the art and described in, e.g., U.S. Patent No.
4,708,871; Geysen et al.
(1984) Proc. Natl. Acad. Sci. USA 81:3998-4002; Geysen et al. (1986) Molec.
Immunol. 23:709-
715. (The teachings and content of which are incorporated by reference
herein.) Similarly,
conformational epitopes are readily identified by determining spatial
conformation of amino
CA 02606229 2007-10-25
WO 2006/116763 PCT/US2006/016559
acids such as by, e.g., x-ray crystallography and 2-dimensional nuclear
magnetic resonance. See,
e.g., Epitope Mapping Protocols, supra. Synthetic antigens are also included
within the
definition, for example, polyepitopes, flanking epitopes, and otlier
recombinant or synthetically
derived.antigens. See, e.g., Bergmann et al. (1993) Eur. J. Immunol. 23:2777-
2781; Bergmann
et al. (1996), J. Immunol.157:3242-3249; Suhrbier, A. (1997), hnmunol. and
Cell Biol. 75:402-
408; Gardner et al., (1998) 12th World AIDS Conference, Geneva, Switzerland,
June 28-July 3,
1998. (The teachings and content of which are incorporated by reference
herein.)
A strain or isolate has the "immunogenic properties" of at least one of the L.
intracellularis strains described in WO 96/39629 and WO 05/0 1 1 73 1, in
particular, of the'
isolates deposited as ATCC accession number PTA 4926 or ATCC accession number
55783,
when it is detectable at least with one of the anti-L . intracellulaf is
specific antibodies, described
in W006/01294, in a detection assay that is also described in W006/01294.
Preferably those
antibodies are selected from the antibodies having the reference numbers
301:39, 287:6, 268:29,
110:9, 113:2 and 268:18. Preferably, the detection assay is a sandwich ELISA
as described in
Examples 2 and 3 of W006/12949, whereas antibody 110:9 is used as an capture
antibody and
antibody 268:29 is used as conjugated antibody. All antibodies disclosed in
W006/12949 are
produced by hybridoma cells, which are deposited at the Centre for Applied
Microbiology and
Research (CAMR) and European Collection of Cell Cultures (ECACC)", Salisbury,
Wiltshire
SP4 OJG, UK, as a patent deposit according to the Budapest Treaty. The date of
deposit was May
11, 2004. HYBRIDOMA CELL LINE 110:9 is successfully deposited under ECACC Ace.
No.
04092204. HYBRIDOMA CELL LINE 113:2 is successfully deposited under ECACC Acc.
No.
04092201. HYBRIDOMA CELL LINE 268:18 is successfully deposited under ECACC
Acc. No.
04092202. HYBRIDOMA CELL LINE 268:29 is successfully deposited under ECACC
Ace. No.
04092206. HYBRIDOMA CELL LINE 287:6 is successfully deposited under ECACC Acc.
No.
16
CA 02606229 2007-10-25
WO 2006/116763 PCT/US2006/016559
04092203. HYBRIDOMA CELLLINE 301:39 is successfully deposited under ECACC Acc.
No.
04092205.
Several of the sequences coinprising the genome of Lawsonia intYacellularis
have been
described in PCT applications W00069903, W00069904, W00069905, and W00069906
as
well as European Patent 1094070, all of which have their teachings and
contents incorporated
by reference herein.
An "immunological response" or "iminune response" to a composition or vaccine
is the
development in the host of a cellular and/ or antibody-mediated immune
response to the
coinposition or vaccine of interest. Usually, an "immune response" includes
but is not limited to
one or more of the following effects: the production or activation of
antibodies, B cells, helper
T cells, suppressor T cells, and/or cytotoxic T cells and/or yd T cells,
directed specifically to an
antigen or antigens included in the composition or vaccine of interest.
Preferably, the host will
display either a therapeutic or protective immunological response such that
resistance to new
infection will be enhanced and/or the clinical severity of the disease
reduced. Such protection
will be demonstrated by either a reduction or lack of the symptoms associated
with host
infections as described above.
In addition, the immunogenic and vaccine compositions of the present invention
can
include one or more veterinary-acceptable carriers. As used herein, "a
veterinary-acceptable
carrier" includes any and all solvents, dispersion media, coatings, adjuvants,
stabilizing agents,
diluents, preservatives, antibacterial and antifungal agents, isotonic agents,
adsorption delaying
agents, and the like.
"Diluents" can include water, saline, dextrose, ethanol, glycerol, and the
like. Isotonic
agents can include sodium chloride, dextrose, mannitol, sorbitol, and lactose,
among others.
Stabilizers include albumin and alkalisalts of ethylendiamintetracetic acid,
among others.
17
CA 02606229 2007-10-25
WO 2006/116763 PCT/US2006/016559
"Adjuvants" as used herein, can include aluminum hydroxide and aluminum
phosphate,
saponins e.g., Quil A, QS-21 (Cambridge Biotech Inc., Cambridge MA), GPI-0100
(Galenica
Pharmaceuticals, Inc., Birmingham, AL), water-in-oil emulsion, oil-in-water
emulsion, water-in-
oil-in-water emulsion. The emulsion can be based in particular on light liquid
paraffin oil
(European Pharmacopea type); isoprenoid oil such as squalane or squalene; oil
resulting from
theoligomerization of alkenes, in particular of isobutene or decene; esters of
acids or of alcohols
containing a linear alkyl group, more particularly plant oils, ethyl oleate,
propylene glycol di-
(caprylate/caprate), glyceryl tri-(caprylate/caprate) or propylene glycol
dioleate; esters of
branched fatty acids or alcohols, in particular isostearic acid esters. The
oil is used in
coinbination with emulsifiers to form the emulsion. The eniulsifiers are
preferably nonionic
surfactants, in particular esters of sorbitan, of mannide (e.g.
anhydromannitol oleate), of glycol,
of polyglycerol, of propylene glycol and of oleic, isostearic, ricinoleic or
hydroxystearic acid,
which are optionally ethoxylated, and polyoxypropylene-polyoxyethylene
copolymer blocks, in
particular the Pluronic products, especially L121. See Hunter et al., The
Theory and Practical
Application of Adjuvants (Ed.Stewart-Tull, D. E. S.). JohnWiley and Sons, NY,
pp51-94 (1995)
and Todd et al., Vaccine 15:564-570 (1997). For example, it is possible to use
the SPT einulsion
described on page 147 of "Vaccine Design, The Subunit and Adjuvant Approach"
edited by M.
Powell and M. Newman, Plenum Press, 1995, and the emulsion MF59 described on
page 183 of
this same book.
A further instance of an adjuvant is a compound chosen from the polymers of
acrylic or
methacrylic acid and the copolymers of maleic anhydride and alkenyl
derivative. Advantageous
adjuvant compounds are the polymers of acrylic or methacrylic acid which are
cross-linked,
especially with polyalkenyl ethers of sugars or polyalcohols. These compounds
are known by the
term carbomer (Phameuropa Vol. 8, No. 2, June 1996). Persons skilled in the
art can also refer
18
CA 02606229 2007-10-25
WO 2006/116763 PCT/US2006/016559
to U. S. Patent No. 2,909,462 which describes such acrylic polymers cross-
linked with a
polyhydroxylated compound having at least 3 hydroxyl groups, preferably not
more than 8, the
liydrogen atoms of at least three hydroxyls being replaced by unsaturated
aliphatic radicals
having at least 2 carbon atoms. The preferred radicals are those containing
from 2 to 4 carbon
atoms, e.g. vinyls, allyls and otlier ethylenically unsaturated groups. The
unsaturated radicals may
themselves contain other substituents, such as methyl. The products sold under
the name
Carbopol ; (BF Goodrich, Ohio, USA) are particularly appropriate. They are
cross-linked with
an allyl sucrose or with allyl pentaerythritol. Among then, there may be
mentioned Carbopol
974P, 934P and 971P. Most preferred is the use of Cabopo1971P. Among the
copolymers of
maleic anhydride and alkenyl derivative, the copolymers EMA (Monsanto) which
are copolyiners
of maleic anhydride and ethylene. The dissolution of these polymers in water
leads to an acid
solution that will be neutralized, preferably to physiological pH, in order to
give the adjuvant
solution into which the immunogenic, immunological or vaccine composition
itself will be
incorporated.
Further suitable adjuvants include, but are not limited to, the RIBI adjuvant
system (Ribi
Inc.), Block co-polymer (CytRx, Atlanta GA), SAF-M (Chiron, Emeryville CA),
monophosphoryl lipid A, Avridine lipid-amine adjuvant, heat-labile enterotoxin
from E. coli
(recombinant or otherwise), cholera toxin, IMS 1314 or muramyl dipeptide among
many others.
Preferably, the adjuvant is added in an amount of about 100 g to about 10 mg
per dose.
Even more preferred the adjuvant is added in an amount of about 100 g to
about 10 mg per
dose. Even more preferred the adjuvant is added in an amount of about 500 g
to about 5 mg per
dose. Even more preferred the adjuvant is added in an aniount of about 750 g
to about 2.5 mg
per dose. Most preferably, the adjuvant is added in an amount of about 1 mg
per dose.
19
CA 02606229 2007-10-25
WO 2006/116763 PCT/US2006/016559
Owing to the degeneracy of the genetic code, it is known that several
variations of nucleic
acids may encode the same protein. As the encoding of amino acids and the
genetic code are
both well known in the art, all such variations in nucleic acid sequences that
result in the same
amino acid are covered by the present invention.
In one embodiment of the present invention, there is provided an immunological
protein
derived from Lawsonia intracellularis. It is herewitli understood, that the
terms "immunogenic
and "immunological" are synonyniously used herein. Preferably, the protein is
selected from the
group consisting of Lawsonia proteins. More preferably, the immunological
protein is coded for
by a DNA sequence coding for a protein having at least 85%, more preferably
90%, still more
preferably 93%, even more preferably 95%, still more preferably 97%, even more
preferably
98%, still more preferably 99% and most preferably 100% sequence homology with
a sequence
selected fiom the group consisting of SEQ ID Nos. 1-455 and 466 and
conzbinations thereof.
Alternatively, the protein is encoded for by a DNA sequence having at least
about 85%, more
preferably 90%, still more preferably 93%, even more preferably 95%, still
more preferably 97%,
even more preferably 98%, still more preferably 99% and most preferably 100%
sequence
homology with a sequence selected from the group consisting of SEQ ID No. 456
and SEQ ID
No. 457. More preferably, the protein is selected from the group consisting of
extracellular and
outer membrane Lawsonia proteins. Still more preferably, the protein is
selected from the group
consisting of SEQ ID Nos. 355,11, 378, 50, 35, 231, 4, 328, 313, 27, 172, 275,
387, 134, 201,
256, 2, 12, 404, 388, 327, 306, 415, 343, 373, 214, 330, 316, 428, 190, 129,
320, 381, 9, 292,
158, 270, 336, 423, 211,178, 430, 77,186, 264,140,193,192, 208,183,108,109,
87, 253, 379,
243, 364, 51, 99, 419, 278, 295, 349, 219, 127, 389, 254, 263, 294, 315, 257,
443, 403, 76, 75,
73, 344, 74, 238, 6, 329, 296, 413, 194, 143, 146, 333, 438, 188, 261, 237,
336, 291, 151, 26,
139, 333, 444, 308, 131, 284, 340, 466, and combinations thereof. Still more
preferably, the
CA 02606229 2007-10-25
WO 2006/116763 PCT/US2006/016559
protein is selected from the group consisting of SEQ ID Nos. 344, 466, and
combinations thereof.
It is furthermore understood that the reference to the sequences of SEQ ID NOS
1-455 as used
herein, includes the reference to each individual sequence, which means for
example to SEQ ID
No 1, No. 2, No. 3, No. 4, No. 5, ..., No. 450, No. 451, No. 452, No. 453, No.
454, and No. 455.
More preferably, the immunological protein or combination ofproteins reacts
with convalescent
swine serum in a Western blot. In another embodiment of the present invention,
the
immunological protein has a similar function and/or generates a similar immune
response as a
protein coded by either SEQ ID No. 456 or SEQ ID No. 457 or a protein selected
from the group
consisting of SEQ ID Nos.. 1-455 and 466 (e.g. a "reference protein"). To
"generate a similar
immune response as a reference protein coded by either SEQ ID No. 456 or SEQ
ID No. 457 or
a protein selected from the group consisting of SEQ ID Nos. 1-455 and 466" as
used herein,
means that the immunological protein reacts in a standardized detection assay,
e.g. an ELISA,
with an amplitude of at least 20%, preferably 50%, even more preferred 75%,
most preferred
100% as compared to the amplitude detected for the corresponding reference
protein, when used
in the detection assay under the same conditions. It being further understood
that a combination
of proteins may induce a greater immune response and thereby provide greater
protective
immunity than a single protein.
Another embodiment of the present invention provides an immunogenic protein or
a
vaccine composition comprising an amino acid*sequence having at least 8
contiguous amino
acids from a protein sequence as described above, homologs or immunogenic
portions thereof,
or homologs of said immunogenic portions. Still more preferably, the amino
acid sequence
which includes the required contiguous amino acids will be up to 8 amino acids
in length, more
preferably, up to 14 amino acids in length, still more preferably up to 23
amino acids in length,
even more preferably, up to 40 amino acids in length, still more preferably,
at least up to 70
21
CA 02606229 2007-10-25
WO 2006/116763 PCT/US2006/016559
amino acids in length, and still more preferably, up to 100 amino acids in
length, still more
preferably up to 200 amino acids in length, and even more preferably up to 300
amino acids in
length. In preferred forms, the immunogenic or vaccine composition ofthe
present invention will
further comprise veterinary-acceptable carriers, as set forth above.
In another embodiment of the present invention, there is provided a method of
vaccinating animals, preferably swine by inoculating them with an
immunological protein
derived from Lawsonia intracellularis. Preferably, the protein is as described
above.
In another embodiment of the present invention, the vaccine comprises proteins
selected
from the group consisting of any one of SEQ ID Nos.. 1-455 and 466, the
protein encoded by
SEQ ID No. 456, the protein encoded by SEQ ID No. 457, proteins that have
similar functions
and induce similar immune responses as any one of SEQ ID Nos. 1-455 and 466,
or any portion
thereof, proteins that have similar functions and induce similar immune
responses to the protein
encoded by SEQ ID No. 456, proteins that have similar functions and induce
similar immune
responses as the protein encoded by SEQ ID No. 457, immunogenic portions
thereof, and
combinations thereof.
In another embodiment of the present invention, the animals are vaccinated by
inoculating
them with a vaccine prepared by inserting DNA coding for an immunological
protein derived
from Lawsonia intracellularis into a vector and administering the vector
through any
conventional means. One preferred method of administration is oral.
Preferably, the vector is
a bacteria. More preferably, the vector is salmonella. Preferably, the protein
is selected from the
group consisting of Lawsonia proteins. More preferably, the protein coded for
by the DNA is
selected from the group consisting of SEQ ID Nos. 1-455 and 466, homologs
thereof,
immunogenic portions thereof, homologs of said immunogenic portions, proteins
that have
similar functions and induce similar immune responses as any one of SEQ ID
Nos. 1-455 and
22
CA 02606229 2007-10-25
WO 2006/116763 PCT/US2006/016559
466, proteins that have similar functions and induce similar immune responses
to the protein
encoded by SEQ ID NO. 456, proteins that have similar functions and induce
similar immune
responses as the protein encoded by SEQ ID No. 457, and combinations thereof.
More
preferably, the immunological protein is coded for by a DNA sequence coding
for a protein
having at least 85%, more preferably 90%, still more preferably 93%, even more
preferably 95%,
still more preferably 97%, even more preferably 98%, still more preferably 99%
and most
preferably 100% sequence homology with a sequence selected from the group
consisting of SEQ
ID Nos. 1-455 and 466 and combinations thereof. Alternatively,'the protein is
encoded for by
a DNA sequence having at least about 85%, more preferably 90%, still more
preferably 93%,
even more preferably 95%, still more preferably 97%, even more preferably 98%,
still more
preferably 99% and most preferably 100% sequence homology with a sequence
selected from
the group consisting of SEQ ID No. 456 and SEQ ID No. 457, or a portion
thereof coding for an
immunogenic portion of the proteins encoded by the sequences of SEQ ID No. 456
and SEQ ID
No. 457. More preferably, the protein is selected from the group consisting of
extracellular and
outer membrane Lawsonia proteins. Still more preferably, the protein is
selected from the group
consisting of SEQ ID Nos. 355, 11, 378, 50, 35, 231, 4, 328, 313, 27, 172,
275, 387, 134, 201,
256, 2, 12, 404, 388, 327, 306, 415, 343, 373, 214, 330, 316, 428, 190, 129,
320, 381, 9, 292,
158, 270, 336, 423, 211,178, 430, 77,186, 264,140,193,192, 208,183,108,109,
87, 253, 379,
243, 364, 51, 99, 419, 278, 295, 349, 219, 127, 389, 254, 263, 294, 315, 257,
443, 403, 76, 75,
73, 344, 74, 238, 6, 329, 296, 413, 194, 143, 146, 333, 438, 188, 261, 237,
336, 291, 151, 26,
139, 333, 444, 308, 131, 284, 340, 466, and combinations thereof. Still more
preferably, the
protein is selected from the group consisting of SEQ ID Nos. 344, 466, and
combinations thereof.
More preferably, the immunological protein or combination of proteins reacts
with convalescent
swine serum in a Western blot. In another embodiment of the present invention,
the
23
CA 02606229 2007-10-25
WO 2006/116763 PCT/US2006/016559
immunological protein has a similar function and/or generates a similar immune
response as a
protein coded by either SEQ ID No. 456 or SEQ ID No. 457 or a protein selected
from the group
consisting of SEQ ID Nos. 1-455 and 466, or a portion thereof, or a nucleotide
sequence coding
for an immunogenic portion of the proteins encoded by the sequences of SEQ ID
No. 456 and
SEQ ID No. 457, or portion thereof.
In another einbodiment of the present invention, the DNA coding for an
immunological
protein derived from Lawsonia intNacellularis is delivered to a desired host
using a DNA
vaccine. Preferably, the protein is selected from the group consisting of
Lawsonia proteins.
More preferably, the immunological protein is coded for by a DNA sequence
coding for a protein
having at least 85%, more preferably 90%, still more preferably 93 10, even
more preferably 95%,
still more preferably 97%, even more preferably 98%, still more preferably 99%
and most
preferably 100% sequence homology with a sequence selected from the group
consisting of SEQ
ID Nos. 1-455 and 466, homologs thereof, immunogenic portions thereof,
homologs of said
immunogenic portions, proteins that have similar functions and induce similar
immune responses
as any one of SEQ ID Nos. 1-455 and 466, and combinations thereof.
Alternatively, the protein
is encoded for by a DNA sequence having at least about 85%, more preferably
90%, still more
preferably 93%, even more preferably 95%, still more preferably 97%, even more
preferably
98%, still more preferably 99% and most preferably 100% sequence homology with
a sequence
selected from the group consisting of SEQ ID No. 456 and SEQ ID No. 457, or a
portion thereof
coding for an immunogenic portion of the proteins encoded by the sequences of
SEQ ID No. 456
and SEQ ID No. 457.. More preferably, the protein is selected from the group
consisting of
extracellular and outer membrane Lawsonia proteins. Still more preferably, the
protein is
selected from the group consisting of SEQ ID Nos. 355, 11, 378, 50, 35, 231,
4, 328, 313, 27,
172, 275, 387,134, 201, 256, 2, 12, 404, 388, 327, 306, 415, 343, 373, 214,
330, 316, 428, 190,
24
CA 02606229 2007-10-25
WO 2006/116763 PCT/US2006/016559
129, 320, 381, 9, 292, 158, 270, 336, 423, 211,178, 430, 77, 186, 264,
140,193, 192, 208, 183,
108, 109, 87,253, 379, 243, 364, 51, 99, 419, 278, 295, 349, 219,127, 389,
254, 263, 294, 315,
257, 443, 403, 76,75, 73, 344, 74, 238, 6, 329, 296, 413,194,143,146, 333,
438,188, 261, 237,
336, 291,151, 26,139, 333, 444, 308, 131, 284, 340, 466, and combinations
thereof. Still more
preferably, the protein is selected from the group consisting of SEQ ID Nos.
344, 466, and
combinations thereof. More preferably, the immunological protein or
combination of proteins
reacts with convalescent swine seruni in a Western blot. In another embodiment
of the present
invention, the immunological protein has a similar function and/or generates a
siinilar immune
response as a protein coded by either SEQ ID No. 456 or SEQ ID No. 457 or a
protein selected
from the group consisting of SEQ ID Nos.. 1-455 and 466.
In still another embodiment of the present invention, the DNA coding for an
immunological protein derived from Lawsonia intracellularis could be expressed
in a
prokaryotic or eukaryotic system, then purified and delivered to the desired
host. Preferably, the
protein is selected from the group consisting of Lawsonia proteins. More
preferably, the
immunological protein is coded for by a DNA sequence coding for a protein
having at least 85%,
more preferably 90%, still more preferably 93 %, even more preferably 95 %,
still more preferably
97%, even more preferably 98%, still more preferably 99% and most preferably
100% sequence
homology with a sequence selected from the group consisting of SEQ ID Nos.1-
455 and 466 and
combinations thereof. Alternatively, the protein is encoded for by a DNA
sequence having at
least about 85%, more preferably 90%, still more preferably 93%, even more
preferably 95%,
still more preferably 97%, even more preferably 98%, still more preferably 99%
and most
preferably 100% sequence homology with a sequence selected from the group
consisting of SEQ
ID No. 456 and SEQ ID No. 457. More preferably, the protein is selected from
the group
consisting of extracellular and outer membrane Lawsonia proteins. Still more
preferably, the
CA 02606229 2007-10-25
WO 2006/116763 PCT/US2006/016559
protein is selected from the group consisting of SEQ ID Nos. 355, 11, 378, 50,
35, 231, 4, 328,
313, 27, 172, 275, 387, 134, 201, 256, 2, 12, 404, 388, 327, 306, 415, 343,
373, 214, 330, 316,
428,190,129,320,381,9,292,158,270,336,423,211, 178, 430, 77, 186, 264, 140,
193, 192,
208, 183, 108,109, 87, 253, 379, 243, 364, 51, 99, 419, 278, 295, 349,
219,127, 389, 254, 263,
294, 315, 257, 443, 403, 76, 75, 73, 344, 74, 238, 6, 329, 296, 413,194, 143,
146, 333, 438,188,
261, 237, 336, 291, 151, 26, 139, 333, 444, 308, 131, 284, 340, 466, and
conibinations thereof.
Still more preferably, the protein is selected from the group consisting of
SEQ ID Nos. 344, 466,
and combinations thereof. More preferably, the immunological protein or
combination of
proteins reacts with convalescent swine serum in a Western blot. In another
embodiment of the
present invention, the immunological protein has a similar function and/or
generates a similar
immune response as a protein coded by either SEQ ID No. 456 or SEQ ID No. 457
or a protein
selected from the group consisting of SEQ ID Nos.. 1-455 and 466.
Additionally, other vaccination methods known in the art such as IM injection,
biodegradable microspheres, or inhalation, among others, may be used for the
delivery of an
immunological protein in accordance with the present invention.
Thus, the present invention relates to an immunological or immunogenic
protein,
preferably of Lawsonia intracellularis that is selected from the group of:
1) a polypeptide comprising a sequence selected from the group consisting of
SEQ
ID Nos.: 1-455, SEQ ID No 466, or the polypeptide encoded by SEQ ID No: 456,
SEQ ID No: 457 or SEQ ID No: 466;
2) any polypeptide that has at least 85% sequence homology, more preferably at
least about 90% sequence homology, still more preferably at least about,95%
sequence homology, even more preferably at least about 97% sequence
homology, still even more preferably at least about 98% sequence homology, and
26
CA 02606229 2007-10-25
WO 2006/116763 PCT/US2006/016559
even more preferably at least about 99% sequence homology to the polypeptide
of 1)=,
3) any immunogenic portion of the polypeptides of 1) and/or 2)
4) the immunogenic portion of 3), comprising at least 300, 290, 280, 270, 260,
250,
240, 230, 220, 210, 200,190,180,170,160,150,140,130,120,110,100, 90, 80,
70, 60, 50, 45, 40, 35, 30, 25, 20, 18, 15, 13, 10, 9, or most preferably 8
contiguous amino acids included in the sequences of SEQ ID No: 1-455, SEQ ID
No: 456, or the amino acid sequence encoded by SEQ ID No: 457 or SEQ ID No:
466; and/or
5) a polypeptide that is encoded by a DNA that codes for a peptide comprising
the
sequence of SEQ ID No: 1-455 or SEQ ID No: 466.
The immunogenic proteins described herein, can be obtained from Lawsonia
intracellularis by isolation and/or purification, or can be obtained from in
vitro recombinant
expression of the nucleic acid(s), coding for the immunogen(s) or portions or
epitopes thereof.
Methods for the isolation and/or purification of known proteins are well known
to a person
skilled in the art. Moreover, several methods are known in the art to
recombinantly express a
protein of a known sequence.
A fixrther aspect of the present invention relates to a DNA molecule that
includes a
nucleotide sequence, that encodes for at least one of the immunological
proteins described above.
Preferably, that DNA molecule includes a nucleotide sequence which encodes for
at least one
immunological protein selected from the group consisting of:
1) a polypeptide comprising a sequence selected from the group consisting of
SEQ ID Nos.: 1-455, SEQ ID No 466, or the polypeptide encoded by SEQ ID
No: 456, SEQ ID No: 457 or SEQ ID No: 466;
27
CA 02606229 2007-10-25
WO 2006/116763 PCT/US2006/016559
2) any polypeptide that has at least 85% sequence homology, more preferably at
least about 90% sequence homology, still more preferably at least about 95%
sequence homology, even more preferably at least about 97% sequence
homology, still even more preferably at least about 98% sequence homology,
and even more preferably at least about 99% sequence homology to the
polypeptide of 1);
3) any immunogenic portion of the polypeptides of 1) and/or 2); and/or
4) the imniunogenic portion of 3), comprising at least 300, 290, 280, 270,
260,
250, 240, 230, 220, 210, 200, 190, 180, 170, 160, 150, 140, 130, 120, 110,
100, 90, 80, 70, 60, 50, 45, 40, 35, 30, 25, 20, 18, 15, 13, 10, 9, or most
preferably 8 contiguous amino acids included in the sequences of SEQ ID No:
1-455, SEQ ID No: 456, or the amino acid sequence encoded by SEQ ID No:
457 or SEQ ID No: 466.
In still another enibodiment of the present invention, the DNA coding for an
immunological protein derived from Lawsonia intf acellulaf is is expressed in
a prokaryotic or
eukaryotic system, then purified and delivered to the desired host.
Preferably, the protein is
selected from the group consisting of:
1) a polypeptide comprising a sequence selected from the group consisting of
SEQ
ID Nos.: 1-455, SEQ ID No 466, or the polypeptide encoded by SEQ ID No: 456,
SEQ ID No: 457 or SEQ ID No: 466;
2) any polypeptide that has at least 85% sequence homology, more preferably at
least about 90% sequence homology, still more preferably at least about 95%
sequence homology, even more preferably at least about 97% sequence
homology, still even more preferably at least about 98% sequence homology, and
28
CA 02606229 2007-10-25
WO 2006/116763 PCT/US2006/016559
even more preferably at least about 99% sequence homology to the polypeptide
of 1);
3) any immunogenic portion of the polypeptides of 1) and/or 2); and/or
4) the immunogenic portion of 3), comprising at least 300, 290, 280, 270, 260,
250,
240, 230, 220, 210, 200,190,180,170,160,150,140,130,120,110,100, 90, 80,
70, 60, 50, 45, 40, 35, 30, 25, 20, 18, 15, 13, 10, or most preferably 9
contiguous
amino acids included in the sequences of SEQ ID No: 1-455, SEQ ID No: 456,
or the amino acid sequence encoded by SEQ ID No: 457 or SEQ ID No: 466.
According to a further aspect, the present invention also relates to a vector
comprising
any of the DNA molecules described herein. Preferably, that DNA molecule
includes a
nucleotide sequence which encodes for at least one immunological protein
selected from the
group consisting of:
1) a polypeptide comprising a sequence selected from the group consisting of
SEQ
ID Nos.: 1-455, SEQ ID No 466, or the polypeptide encoded by SEQ ID No: 456,
SEQ ID No: 457 or SEQ ID No: 466;
2) any polypeptide that has at least 85% sequence homology, more preferably at
least about 90% sequence homology, still more preferably at least about 95%
sequence homology, even more preferably at least about 97% sequence
homology, still even more preferably at least about 98% sequence homology, and
even more preferably at least about 99% sequence homology to the polypeptide
of 1);
3) any immunogenic portion of the polypeptides of 1) and/or 2); and/or
4) the immunogenic portion of 3), comprising at least 300, 290, 280, 270, 260,
250,
240, 230, 220, 210, 200,190,180,170,160,150,140,130,120,110,100, 90, 80,
29
CA 02606229 2007-10-25
WO 2006/116763 PCT/US2006/016559
70, 60, 50, 45, 40, 35, 30, 25, 20, 18,15,13,10, or most preferably 9
contiguous
amino acids included in the sequences of SEQ ID No: 1-455, SEQ ID No: 456,
or the amino acid sequence encoded by SEQ ID No: 457 or SEQ ID No: 466.
Methods for making and/or using vectors (or recombinants) for expression can
be by or
analogous to the methods disclosed in: U. S. Patent Nos.4,603,112, 4,769,330,
5,174,993,
5,505,941, 5,338,683, 5,494,807, 4,722,848, 5,942,235, 5,364,773, 5,762,938,
5,770,212,
5,942,235, 382,425, PCT publications WO 94/16716, WO 96/39491, WO 95/30018,
Paoletti,"Applications of pox virus vectors to vaccination: An update,"PNAS
USA 93: 11349-
11353, October 1996, Moss, "Genetically engineered poxviruses for recombinant
gene
expression, vaccination, and safety," PNAS USA 93: 11341-11348, October 1996,
Smith et al.,
U. S. Patent No. 4,745,051, (recombinant baculovirus), Richardson, C.D.
(Editor), Methods in
Molecular Biology 39, "Baculovirus Expression Protocols" (1995 Humana Press
Inc.), Smith et
al.,"Production of Huma Beta Interferon in Insect Cells Infected with a
Baculovirus Expression
Vector", Molecular and Cellular Biology, Dec., 1983, Vol. 3, No. 12, p. 2156-
2165; Pennock et
al., "Strong and Regulated Expression of Escherichia coli B-Galactosidase in
Infect Cells with
a Baculovirus vector, "Molecular and Cellular Biology Mar. 1984, Vol. 4, No.
3, p. 399-406;
EPAO 370 573, U. S. applicationNo. 920,197, filed October 16,1986, EP Patent
publication No.
265785, U. S. PatentNo. 4,769,331 (recombinant herpesvirus), Roizman,"The
function ofherpes
simplex virus genes: A primer for genetic engineering of novel vectors," PNAS
USA 93 :11307-
11312, October 1996, Andreansky et al., "The application of genetically
engineered herpes
simplex viruses to the treatment of experimental brain tumors," PNAS USA 93:
11313-11318,
October 1996, Robertson et al."Epstein-Barr virus vectors for gene delivery to
B lymphocytes",
PNAS USA 93:11334-11340, October 1996, Frolov et al.,"Alphavirus-based
expression vectors:
Strategies and applications,"PNAS USA 93: 11371-11377, October 1996, Kitson et
al., J. Virol.
CA 02606229 2007-10-25
WO 2006/116763 PCT/US2006/016559
65,3068-3075,1991; U. S. Patent Nos. 5,591,439, 5,552,143, WO 98/00166,
allowed U. S.
applications Serial Nos. 08/675,556, and 08/675,566 both filed July 3,1996
(recombinant
adenovirus), Grunhaus et a1.,1992,"Adenovirus as cloning vectors," Seminars in
Virology (Vol.
3) p. 237-52, 1993, Ballay et al. EMBO Journal, vol. 4, p. 3861-65,Graham,
Tibtech 8,85-87,
April, 1990, Prevec et al., J. Gen Virol. 70,42434, PCT WO 91/11525, Felgner
et al. (1994), J.
Biol. Chem. 269,2550-2561, Science, 259:1745-49,1993 andMcClements et al.,
"Immunization
with DNA vaccines encoding glycoprotein D or glycoprotein B, alone or in
combination, induces
protective immunity in animal models of herpes simplex virus-2 disease", PNAS
USA 93:
11414-11420, October 1996, and U. S. Patent Nos. 5,591,639, 5,589,466, and
5,580,859, as well
as WO 90/11092, W093/19183, W094/21797, W095/11307, W095/20660, Tang et al.,
Nature
and Furth et al. Analytical Biochemistry, relating to DNA expression vectors,
inter alia. See also
WO 98/33510; Ju et al., Diabetologia, 41: 736-739,1998 (lentiviral expression
system); Sanford
et al., U. S. Patent No. 4,945,050; Fischbachet al. (Intracel), WO 90/01543;
Robinson et al.,
seminars in Immunologyvol. 9, pp. 271-283 (1997), (DNA vector systems); Szoka
et al., U. S.
Patent No. (method of inserting DNA into living cells); McCormick et al., U.
S. Patent No.
5,677,178 (use of cytopathic viruses); and U. S. PatentNo. 5,928,913 (vectors
for gene delivery),
as well as other documents cited herein. A viral vector, for instance,
selected from pig herpes
viruses, such as Aujeszky's diseasevirus, porcine adenovirus, poxviruses,
especially vaccinia
virus, avipox viras, canarypox virus, and swinepox virus, as well as DNA
vectors (DNA
plasmids) are advantageously employed in the practice of the invention.
According to a further aspect the present invention relates to an
immunological
composition, preferably a vaccine composition, effective for lessening the
severity of clinical
symptoms associated with a Lawsoiaia intracellularis infection. Preferably,
that immunological
composition comprises an immunological protein, a DNA molecule coding for an
immunological
31
CA 02606229 2007-10-25
WO 2006/116763 PCT/US2006/016559
protein, and/or a vector including a DNA coding for an immunological protein
as disclosed
herein. Preferably, said immunological protein is:
1) a polypeptide comprising a sequence selected from the group consisting of
SEQ
ID Nos.: 1-455, SEQ ID No 466, or the polypeptide encoded by SEQ ID No: 456,
SEQ ID No: 457 or SEQ ID No: 466;
2) any polypeptide that has at least 85% sequence homology, more preferably at
least about 90% sequence homology, still more preferably at least about 95%
sequence homology, even more preferably at least about 97% sequence
homology, still even more preferably at least about 98% sequence homology, and
even more preferably at least about 99% sequence homology to the polypeptide
of 1);
3) any iinmunogenic portion of the polypeptides of 1) and/or 2)
4) the immunogenic portion of 3), comprising at least 300, 290, 280,.270, 260,
250,
240, 230, 220, 210, 200,190,180,170,160,150,140,130,120,110,100, 90, 80,
70, 60, 50, 45, 40, 35, 30, 25, 20, 18, 15, 13, 10, or most preferably 9
contiguous
amino acids included in the sequences of SEQ ID No: 1-455, SEQ ID No: 456,
or the amino acid sequence encoded by SEQ ID No: 457 or SEQ ID No: 466;
and/or
5) a polypeptide that is encoded by a DNA that codes for a peptide comprising
the
sequence of SEQ ID No: 1-455 or SEQ ID No: 466.
The immunogenic and vaccine compositions of the present invention can include
diluents,
isotonic agents, stabilizers, and/or adjuvants, preferably selected from those
which are disclosed
herein.
Thus, according to a further aspect, the present invention relates to a
immunological
32
CA 02606229 2007-10-25
WO 2006/116763 PCT/US2006/016559
composition, that comprises an immunological protein, an DNA molecule coding
for an
immunological protein, and/or an vector including a DNA coding for an
inlmunological protein
described herein and a diluents, isotonic agents, stabilizers, or adjuvants.
Preferably, said
immunological protein is:
1) a polypeptide comprising a sequence selected from the group consisting of
SEQ
ID Nos.: 1-455, SEQ ID No 466, or the polypeptide encoded by SEQ ID No: 456,
SEQ ID No: 457 or SEQ ID No: 466;
2) any polypeptide that has at least 85% sequence homology, more preferably at
least about 90% sequence homology, still more preferably at least about 95%
sequence homology, even more preferably at least about 97% sequence'
homology, still even more preferably at least about 98% sequence homology, and
even more preferably at least about 99% sequence homology to the polypeptide
ofl);
3) any immunogenic portion of the polypeptides of 1) and/or 2)
4) the immunogenic portion of 3), comprising at least 300, 290, 280, 270, 260,
250,
240, 230, 220, 210, 200,190,180,170,160,150,140,130,120,110,100, 90, 80,
70, 60, 50, 45, 40, 35, 30, 25, 20,18,15,13,10, or most preferably 9
contiguous
amino acids included in the sequences of SEQ ID No: 1-455, SEQ ID No: 456,
or the ainino acid sequence encoded by SEQ ID No: 457 or SEQ ID No: 466;
and/or
5) a polypeptide that is encoded by a DNA that codes for a peptide comprising
the
sequence of SEQ ID No: 1-455 or SEQ ID No: 466.
Preferably said diluent, isotonic agent, stabilizer, or adjuvant is anyone
ofthose described
above.
33
CA 02606229 2007-10-25
WO 2006/116763 PCT/US2006/016559
In another embodiment of the present invention, there is provided a method for
the
prevention or treatment of an animal against Lawsonia intracellular is
infections by inoculating
said animal with an immunological protein derived from Lawsonia
intracellularis. Preferably,
the protein or immunological composition is anyone of those described above.
Preferably, said
immunological protein is:
1) a polypeptide comprising a sequence selected from the group consisting of
SEQ
ID Nos.: 1-455, SEQ ID No 466, or the polypeptide encoded by SEQ ID No: 456,
SEQ ID No: 457 or SEQ ID No: 466;
2) any polypeptide that has at least 85% sequence homology, more preferably at
least about 90% sequence homology, still more preferably at least about 95%
sequence homology, even more preferably at least about 97% sequence
homology, still even more preferably at least about 98% sequence homology, and
even more preferably at least about 99% sequence homology to the polypeptide
of 1);
3) any immunogenic portion of the polypeptides of 1) and/or 2)
4) the immunogenic portion of 3), comprising at least 300, 290, 280, 270, 260,
250,
240, 230, 220, 210, 200,190,180,170,160,150,140,130,120,110,100, 90, 80;
70, 60, 50, 45, 40, 35, 30, 25, 20, 18,15, 13, 10, or most preferably 9
contiguous
amino acids included in the sequences of SEQ ID No: 1-455, SEQ ID No: 456,
or the amino acid sequence encoded by SEQ ID No: 457 or SEQ ID No: 466;
and/or
5) a polypeptide that is encoded by a DNA that codes for a peptide comprising
the
sequence of SEQ ID No: 1-455 or SEQ ID No: 466.
In another embodiment of the present invention, the animal is vaccinated by
inoculating
34
CA 02606229 2007-10-25
WO 2006/116763 PCT/US2006/016559
it with a vaccine prepared by inserting DNA coding for an immunological
protein derived from
Lawsonia intr=acellularis into a vector and administering the vector through
any conventional
means. One preferred method of administration is oral. Preferably, the vector
is a bacteria.
More preferably, the vector is salmonella. Preferably, the DNA codes for a
protein selected from
the group consisting of :
1) a polypeptide comprising a sequence selected from the group consisting of
SEQ
ID Nos.: 1-455, SEQ ID No 466, or the polypeptide encoded by SEQ ID No: 456,
SEQ ID No: 457 or SEQ ID No: 466;
2) any polypeptide that has at least 85% sequence homology, more preferably at
least about 90% sequence homology, still more preferably at least about 95%
sequence homology, even more preferably at least about 97% sequence
homology, still even more preferably at least about 98% sequence homology, and
even more preferably at least about 99% sequence homology to the polypeptide
of 1);
3) any immunogenic portion of the polypeptides of 1) and/or 2)
4) the immunogenic portion of 3), comprising at least 300, 290, 280, 270, 260,
250,
240, 230, 220, 210, 200,190,180,170,160,150,140,130,120,110,100, 90, 80,
70, 60, 50, 45, 40, 35, 30, 25, 20, 18, 15,13, 10, or most preferably 9
coin.tiguous
amino acids included in the sequences of SEQ ID No: 1-455, SEQ ID No: 456,
or the amino acid sequence encoded by SEQ ID No: 457 or SEQ ID No: 466;
and/or
5) a polypeptide that is encoded by a DNA that codes for a peptide comprising
the
sequence of SEQ ID No: 1-455 or SEQ ID No: 466.
More preferably, the immunological protein or combination of proteins coded by
said
CA 02606229 2007-10-25
WO 2006/116763 PCT/US2006/016559
DNA molecule reacts with convalescent swine serum in a Western blot.
In another embodiinent of the present invention, the DNA molecule coding for
an
immunological protein derived from Lawsonia intracellularis is delivered to a
desired host using
a DNA vaccine. Preferably, the DNA molecule expresses the immunological
protein, when it
has entered a host cell. Preferably, the immunological protein encoded by the
DNA molecule
is selected from the group consisting of:
1) a polypeptide comprising a sequence selected from the group consisting of
SEQ
ID Nos.: 1-455, SEQ ID No 466, or the polypeptide encoded by SEQ ID No: 456,
SEQ ID No: 457 or SEQ ID No: 466;
2) any polypeptide that has at least 85% sequence homology, more preferably at
least about 90% sequence homology, still more preferably at least about 95%
sequence homology, even more preferably at least about 97% sequence
homology, still even more preferably at least about 98% sequence homology, and
even more preferably at least about 99% sequence homology to the polypeptide
ofl);
3) any immunogenic portion of the polypeptides of 1) and/or 2); and/or
4) the immunogenic portion of 3), comprising at least 300, 290, 280, 270, 260,
250,
240, 230, 220, 210, 200,190,180,170,160,150,140,130,120,110,100, 90, 80,
70, 60, 50, 45, 40, 35, 30, 25, 20, 18,15,13,10, or most preferably 9
contiguous
amino acids included in the sequences of SEQ ID No: 1-455, SEQ ID No: 456,
or the amino acid sequence encoded by SEQ ID No: 457 or SEQ ID No: 466.
More preferably, the immunological protein or combination of proteins reacts
with
convalescent swine serum in a Western blot.
The vaccine compositions of the present invention, as disclosed herein, can
further
36
CA 02606229 2007-10-25
WO 2006/116763 PCT/US2006/016559
include one or more other iminunomodulatory agents such as, e.
g.,interleukins, interferons, or
other cytokines. The vaccine compositions can also include Gentamicin and
Merthiolate. While
the amounts and concentrations of adjuvants and additives useful in the
context of the present
invention can readily be determined by the skilled artisan, the present
invention contemplates
compositions comprising from about 50 ug to about 2000 ug of adjuvant and
preferably about
250 ug/ ml dose of the vaccine composition. In another preferred embodiment,
the present
invention contemplates vaccine compositions comprising from about lug/ml to
about 60 ug/ml
of antibiotics and/or immunomodulatory agents, and more preferably less than
about 30 ug/ml
of antibiotics and/or immunomodulatory agents.
According to a further embodiment, vaccine compositions in accordance with the
present
invention can first be dehydrated. If the composition is first lyophilized or
dehydrated by other
methods, then, prior to vaccination, said composition is rehydrated in aqueous
(e.g. saline, PBS
(phosphate buffered saline)) or non-aqueous solutions (e.g. oil emulsion
(mineral oil, or
vegetable/metabolizable oil based/single or double emulsion based), aluminum-
based, carbomer
based adjuvant).
Vaccine or immunogenic compositions according to the invention may be
administered
intramuscularly, intranasally, orally, intradermally, intratracheally,
orintravaginally. Preferably,
the composition is administered intramuscularly, orally, or intranasally. In
an animal body, it can
prove advantageous to apply the compositions as described above via an
intravenous injection
or by direct injection into target tissues. For systemic application, the
intravenous, intravascular,
intramuscular, intranasal, intraarterial, intraperitoneal, oral, or
intrathecal routes are preferred.
A more local application can be effected subcutaneously, intradermally,
intracutaneously,
intracardially, intralobally, intramedullarly, intrapulmonarily or directly in
or near the tissue to
be treated (connective-, bone-, muscle-, nerve-, epithelial tissue). Depending
on the desired
37
CA 02606229 2007-10-25
WO 2006/116763 PCT/US2006/016559
duration and effectiveness of the treatment, the compositions according to the
invention may be
administered once or several times, also intermittently, for instance on a
daily basis for several
days, weeks or months and in different dosages.
Another aspect of the present invention provides a diagnostic/detection assay
utilizing
proteins in accordance with the invention. Preferably, that
diagnostic/detection assay is specific
for the detection of antibodies in a sample which specifically reacts with
antigen of Lawsonia
intracellularis. Preferably, that diagnostic/detection assay is specific for
the detection of
antibodies in a sample, wherein those antibodies are generated in cause of a
Lawsonia
intracellularis infection. Preferably, the protein is selected from the group
consisting of:
1) a polypeptide comprising a sequence selected from the group consisting of
SEQ
ID Nos.: 1-455, SEQ ID No 466, or the polypeptide encoded by SEQ ID No: 456,
SEQ ID No: 457 or SEQ ID No: 466;
2) any polypeptide that has at least 85% sequence homology, more preferably at
least about 90% sequence homology, still more preferably at least about 95%
sequence homology, even more preferably at least about 97% sequence
homology, still even more preferably at least about 98% sequence homology, and
even more preferably at least about 99% sequence homology to the polypeptide
of 1);
3) any iminunogenic portion of the polypeptides of 1) and/or 2);
4) the immunogenic portion of 3), comprising at least 300, 290, 280, 270, 260,
250,
240, 230, 220, 210, 200,190,180,170,160,150,140,130,120,110,100, 90, 80,
70, 60, 50, 45, 40, 35, 30, 25, 20, 18, 15, 13, 10, or most preferably 9
contiguous
amino acids included in the sequences of SEQ ID No: 1-455, SEQ ID No: 456,
or the amino acid sequence encoded by SEQ ID No: 457 or SEQ ID No: 466;
38
CA 02606229 2007-10-25
WO 2006/116763 PCT/US2006/016559
and/or
5) a polypeptide that is encoded by a DNA that codes for a peptide comprising
the
sequence of SEQ ID No: 1-455 or SEQ ID No: 466.
Such proteins could be used in an ELISA-based test. Such a protein could also
be
injected into an animal (e.g. a rabbit) to create an antiserum useful for
detecting antibody or
antigen. Such assays would be useful in confirming or ruling out Lawsonia
infection.
Preferably the detection assay, preferably the ELISA-based test, comprises the
steps:
1) contacting a sainple comprising antibodies against Lawsonia
intyacellulaNis bacteria with an immunogenic protein of Lawsonia as
described herein;
2) incubating the mixture of 1) under conditions which allow the
immunogenic protein of Lawsonia to bind to the Lawsonia specific
antibodies of the sample and to generate a complex of Lawsonia specific
antibody and the immunogenic protein; and
3) Detecting the presence of the complex of 2).
Another aspect of the present invention relates to a kit in parts, comprising
an protein
selected from the group consisting of:
1) a polypeptide comprising a sequence selected from the group consisting
of SEQ ID Nos: 1-455, SEQ ID No 466, or the polypeptide encoded by
SEQ ID No: 456, SEQ ID No: 457 or SEQ ID No: 466;
2) any polypeptide that has at least 85% sequence homology, more
preferably at least about 90% sequence homology, still more preferably
at least about 95% sequence homology, even more preferably at least
about 97% sequence homology, still even more preferably at least about
39
CA 02606229 2007-10-25
WO 2006/116763 PCT/US2006/016559
98% sequence homology, and even more preferably at least about 99%
sequence homology to the polypeptide of 1);
3) any immunogenic portion of the polypeptides of 1) and/or 2)
4) the immunogenic portion of 3), comprising at least 300, 290, 280, 270,
260, 250, 240, 230, 220, 210, 200, 190, 180, 170, 160, 150, 140, 130,
120, 110,100, 90, 80, 70, 60, 50, 45, 40, 35, 30, 25, 20, 18, 15,13,10, or
most preferably 9 contiguous amino acids included in the sequences of
SEQ ID No: 1-455, SEQ ID No: 456, or the amino acid sequence encoded
by SEQ ID No: 457 or SEQ ID No: 466; and/or
5) a polypeptide that is encoded by a DNA that codes for a peptide
comprising the sequence of SEQ ID No: 1-455 or SEQ ID No: 466.
Preferably that kit in parts is a detection kit for the detection of
antibodies in a sainple
which specifically react witli antigen of Lawsonia intracellularis.
Preferably, that detection kit
is specific for the detection of antibodies in a sample, wherein those
antibodies are generated in
cause of a Lawsonia intf=acellularis infection.
Another aspect of the present invention provides an expression system for
expressing
proteins useful for purposes of the present invention. Those of skill in the
art are familiar with
such expression systems. A preferred expression system in this regard will
utilize E. coli or
recombinant baculovirus to express or generate recombinant proteins.
Preferably, the E. coli or
baculovirus will have nucleic acid sequences inserted therein which encode for
proteins, as
described above. It is noted that the examples of expression systems are
mentioned above in an
exemplarily manner.
In another aspect of the present invention, fusion proteins and chimeras are
provided.
Preferably, the fusion proteins or chimera present or expressed will comprise
any one of
CA 02606229 2007-10-25
WO 2006/116763 PCT/US2006/016559
1) a polypeptide comprising a sequence selected from the group consisting
of SEQ ID Nos.: 1-455, SEQ ID No 466, or the polypeptide encoded by
SEQ ID No: 456, SEQ ID No: 457 or SEQ ID No: 466;
2) any polypeptide that has at least 85% sequence homology, more
preferably at least about 90% sequence homology, still more preferably
at least about 95% sequence homology, even more preferably at least
about 97% sequence homology, still even more preferably at least about
98% sequence homology, and even more preferably at least about 99%
sequence homology to the polypeptide of 1);
3) any immunogenic portion of the polypeptides of 1) and/or 2);
4) the immunogenic portion of 3), comprising at least 300, 290, 280, 270,
260, 250, 240, 230, 220, 210, 200, 190, 180, 170, 160, 150, 140, 130,
120,110, 100, 90, 80, 70, 60, 50, 45, 40, 35, 30, 25, 20, 18, 15, 13, 10, or
most preferably 9 contiguous amino acids included in the sequences of
SEQ ID No: 1-455, SEQ ID No: 456, or the amino acid sequence encoded
by SEQ ID No: 457 or SEQ ID No: 466; and/or
5) a polypeptide that is encoded by a DNA that codes for a peptide
comprising the sequence of SEQ ID No: 1-455 or SEQ ID No: 466.
BRIEF DESCRIPTION OF TH E DR.AWING FIGURES
Figure 1 is a Coomasie stained Gel picture illustrating the expression of the
Omp85-like
protein;
Fig. 2 is picture of the IMAC fractions of E. coli (pET HlyA);
Fig. 3 is a gel picture of the HlyA and Omp85-like proteins;
41
CA 02606229 2007-10-25
WO 2006/116763 PCT/US2006/016559
Figs. 4A-C are Western Blot pictures showing reactivity to the H1yA and Omp85-
like
proteins of the present invention;
Fig. 5 provides the results of a BLAST search showing the homologous data for
the 456
Lawsonia proteins; and
Fig. 6 is a listing of the 456 Lawsonia proteins, with the first 6 proteins
being preceded
by the protein name and being SEQ ID Nos. 1-6, respectively, and the remaining
450 proteins
being preceded by their corresponding SEQ ID No.
DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS
The following examples set fortli preferred materials and procedures in
accordance with
the present invention. It is to be understood, however, that these examples
are provided by way
of illustration only, and nothing therein should be deemed a limitation upon
the overall scope of
the invention.
EXAMPLE 1
This example demonstrates the immunological detection of the Lawsonia
intracellularis
DK15540 hemolysin A(H1yA) and Omp85 proteins expressed as prokaryotic fusion
proteins.
Materials and Methods
Ti ansforming E. coli strains
To begin, McCoy cell DNA was removed from a Lawsonia intracellularis
("Lawsonia")
cell pellet. This was done by first propagating the DK1 5540 strain of
Lawsonia in a McCoy cell
suspension culture. The Lawsonia infected McCoy cells were then pelleted by
centrifugation at
10,000 rpm for 30 minutes at 4 C using a JA-17 rotor (Beckman Coulter,
Fullerton, CA). The
42
CA 02606229 2007-10-25
WO 2006/116763 PCT/US2006/016559
supematant was removed and the pelleted cells were then disrupted by repeated
passage through
a 22G double-hub emulsifying needle using two syringes. The disrupted cell
mixture was then
mixed with 35mL of a Percoll/NaC1 solution. The resulting solution was then
centrifuged at
14,000 rpm for 45 minutes at 4 C. After centrifugation, the upper layer of
debris was removed
with a pipette and the bacterial band was recovered. This bacterial band was
then centrifuged
at 14,000 rpm for 15 minutes. The resulting Lawsonia pellet was then washed
three times by
resuspending the pellet in 35inL of PBS. The resulting suspension was then
centrifuged at
14,000 rpm for 15 minutes. The supematant was discarded and the pellet'was
resuspended in
3mL of PBS. Next, 30 L of 1M MgSO4 and 30 L of DNase A was added to the
suspension.
The resulting mixture was then incubated at 37 C for 2 hours. The mixture was
then diluted to
35mL with Percoll/NaCI and centrifuged as above (14,000 rpm for 15 minutes at
4 C). The
resulting pellet was washed three times in PBS and then stored overnight at 4
C.
To extract genomic DNA from the Lawsonia cell pellet, the pellet was
resuspended in 3.5
mL of buffer B 1 from the Qiagen Genomic DNA Kit (Qiagen, Valencia, CA) after
the overnight
storage. Next, 10 L RNase A (5 g/ L), 80 L of lysozyme solution (100 mg/nil)
and 100 L
Proteinase K (20 mg/ml). The resulting mixture was incubated at 37 C for 1
hour and 1.2 mL
of Buffer B2 from the Qiagen Genomic DNA kit was added to it. The resulting
solution was then
gently mixed by inversion. Following the mixing, the solution was then
incubated at 50 C for
30 minutes. While the solution was being incubated, a genomic-tip 500G (from
the Qiagen
Genomic DNA ICit) was equilibrated with 10mL of QBT buffer. After incubation,
the resulting
solution was vortexed for 10 seconds at maximum speed (14,000 rpm) and applied
to the pre-
equilibrated tip. After the entire solution had entered the tip, it was washed
twice with 30mL of
Buffer QC, and the DNA was eluted with l5mL of Buffer QF. To the eluted DNA
was added
10.5mL of isopropanol, and the tubes were then mixed by gentle inversion. The
resulting
43
CA 02606229 2007-10-25
WO 2006/116763 PCT/US2006/016559
mixture was then dispensed into separate 1.5mL microfuge tubes and centrifuged
at 14,000 rpm
for 15 minutes. The resulting supematants were then decanted and the pellets
rinsed with 0.5 ml
of 70% ethanol. The tubes were centrifuged, the supernatants decanted again,
and the pellets
briefly dried. 12.5 L of TE buffer was then added to each tube. The tubes were
then incubated
overnight at 37 C with gentle shaking. The solutions were then pooled into a
single tube,
incubated at 55 C for 2 hours and then quantified by UV spectroscopy.
Next, PCR was performed on the Lawsonia genes and genomic sequence analysis,
including BLAST search data, was then used to identify two genes of interest:
Omp85 (SEQ ID
No. 456) and H1yA (SEQ ID No. 457). The resulting DNA sequence data was used
to determine
the potential open reading frames ("ORFs") for each gene and PCR primers were
designed which
would correspond to the 5' and 3' ends of the desired gene with the additional
ligation
independent cloning ("LIC") overhang added to the 5' end of each respective
primer (SEQ ID
Nos.. 458 GGTATTGAGGGTCGCATGACAAAACGCCTGAATATATT and 459
AGAGGAGAGTTAGAGCCTTATTAGAAGAATTGCCCCA for the LIMOP85 primers for
pET-32Xa/LIC and. SEQ ID Nos. 460
GGTATTGAGGGTCGCATGGCCAAACATAAAGTACGTGC and 461
AGAGGAGAGTTAGAGCCTTATTAACGTTTTTTCAAGTAAA, respectively, for the
Hemolysin primers in pET-32Xa.LIC vector). For each of these primers, the
underlined portion
represents the primer specific sequences required for the LIC process. These
sequences are also
provided herein as SEQ ID Nos.. 462, 463, 464, and 465, respectively. PCR was
then carried out
using the Lawsonia DK15540 genomic DNA as a template.
For the H1yA PCR cycle, the PCR reaction was heated to 95 C for 5 minutes. The
reaction then proceeded to 35 cycles of 95 C for 1 minute, 55 C for 1 minute,
and 72 C for 1
minute. The PCR cycle was completed following a final cycle of 72 C for 10
minutes.
44
CA 02606229 2007-10-25
WO 2006/116763 PCT/US2006/016559
For the Omp85 PCR cycle, the PCR reaction was heated to 95 C for 5 minutes.
The
reaction then proceeded to 35 cycles of 95 C for 1 minute, 55 C for 1 minute,
and 72 C for 1.83
minutes. The PCR cycle was completed following a final cycle of 72 C for 10
minutes.
For both PCR cycles, the reaction mixture comprised 1 l DNA, 5 L 10X ExTaq
Buffer,
4 L 2.5mM dNTP, 1 L of 10pm Primer L, 1 L of 10pm Primer R, 0.5 L ExTaq, and
38.5 L
of distilled water. The ExTaq Buffer, dNTP, and ExTaq were provided by Takara
Bio, Inc.
(Japan).
To clone the Lawsonia DK15540 hemolysin and Omp85 ORF for expression analysis,
the resulting PCR products were then gel purified using the Qiagen MiniElute
Gel Purification
kit and mixed with a pET-32Xa LIC plasmid vector and ligated as per the
manufacturer's
instructions (Novagen, Madison, WI). The ligation mixes were used to transform
competent
cells of NovaBlue E. coli (Novagen) and plated for ampicillin resistance. The
transformed
colonies were used to inoculate 3mL of LB broth and ampicillin and grown
overnight at 37 C.
A 1.5mL aliquot of the overnight culture was then harvested by centrifugation
at 14,000 xg for
2 miinutes. The plasmid DNA was then extracted by the Qiagen Mini-Prep plasmid
kit. The
purified plasmid DNA was then verified by dideoxynucleotide sequencing. The
respecitve
plasmids were then transformed into the BL21(DE3) strain of E. coli for
prokaryotic fusion
protein expression studies.
Expression Analysis
To perform an expression analysis of the transformed E. coli, 10mL of each of
the
transformed strains ofE.coli (a strain producing hemolysin A and a strain
producing Omp85)
were incubated overnight in Luria-Bertani (LB) media having 2% glucose w/v and
ampicillin (50
g/ml) at 37 C with shaking at 225 rpm in a conical tube. The next morning,
these two cultures
-45
CA 02606229 2007-10-25
WO 2006/116763 PCT/US2006/016559
were.used to inoculate two separate 10m1 pre-warmed cultures of LB media,
glucose 2% and
ampicillin (50 g/ml) at 37 C with shaking at 225 rpm in a conical tube. The
cultures were then
grown at 37 C to an OD600nm of about 0.8 to about 1Ø This took about 3 to 4
hours. One tube
of each strain was then induced with 1mM isopropyl-beta-D-
thiogalactopyranoside (IPTG) for
3 hours at 37 C. The second tube of eacli strain was left uninduced.
Next, two 1 mL samples of each culture were collected and then pelleted by
centrifugation
at 20,000 xg for one minute. This created two uninduced and two induced
samples for each
strain. One of each sanzple (that is, one uninduced and one induced sample of
each strain) was
then suspended in 400gL of 1X SDS-Page buffer containing 10mM 2-ME. The
suspensions
were then heated to 85 C for five minutes. Next, the remaining samples (that
is one induced and
one uninduced sample for each strain) were suspended in 200 L of 50mM sodium
phosphate,
0.5M NaCl, 5mM 2-ME, and 1 1o tergitol. All of the samples were then sonicated
for 4 minutes
using 0.5 second duty cycles at an amplitude of 75%. The samples that were
suspended in the
buffer including tergitol were centrifuged for 5 minutes at 20,000 x g and the
supernatant was
then collected while the pellet was discarded.
Once prepared in this manner, a western blot analysis of each of the samples
was then
performed. The resulting gel can be seen as FIG. 1.
As can be seen in the gel, the HlyA protein expression amounted to about 20 to
30% of
the total cellular protein. The Omp85-like protein did not express as well,
however.
Additionally, both proteins were only observed in the total protein induced
sample lanes, thereby
indicating that these proteins are not soluble in the 1% tergitol buffer.
EXAMPLE 2
46
CA 02606229 2007-10-25
WO 2006/116763 PCT/US2006/016559
This example demoiistrates the purification of hemolysin A and Omp85-like
Lawsonia
proteins expressed in E. coli cells.
Materials and Methods
lOmL of each of the transformed strains of E. coli were grown overnight in a
media of
LB, 2% glucose, and 50 g/mL of Ampicillin. The next morning, the overnight
cultures were
used to inoculate a 1L pre-warmed broth of LB, glucose, and Ampicillin. These
cultures were
grown at 37 C for about 3-4 hours until theyhad reached an OD600mn of about
0.8 to about 1Ø
The cultures were then each induced for 3.5 hours at 37 C with 0.5mM IPTG.
After induction,
the cells were then collected and pelleted by centrifugation at 20,000 xg for
20 minutes. The
pellet was then suspended in a 33mL buffer containing 50mM sodium phosphate,
0.5M sodium
chloride, 8M urea, 5mM 2-ME, and 10mM imidazole. The resultiing suspension was
then
extracted overnight to disrupt the cells and denature the protein and thereby
increase the
solubility at 4 C. The extracted samples were then centrifuged for 20 minutes
at 20,000 x g. The
resulting supernatants were then collected and filtered using 0.2 m syringe
filters. 1 6mL of each
sample was then loaded onto the sample loop and a partial purification was
performed using
Immobilized-metal affinity chromatography IMAC. Following purification, the
fractions were
collected and a standard SDS-PAGE was performed (4-12% Bis-Tris gel in MOPS
buffer).
Following the running of the gel, a Coomassie blue stain was performed.
Results and Discussion
The resulting gel can be seen as FIG. 2. As can be seen, expression was not
very good
in the 1L culture. However, despite the poor expression yield, there does seem
to be some
47
CA 02606229 2007-10-25
WO 2006/116763 PCT/US2006/016559
approximately 48 kDA protein in lanes 7-12 from a late gradient eluant peak.
Additionally, there
appears to be a distinct banding pattern of high molecular weight proteins in
lanes 9-12.
EXAMPLE 3
This example demonstrates the immunological detection of the Omp85-like and
Henlolysin A total proteins.
Materials and Methods
The Omp85-like protein, HlyA protein, and IMAC fraction A12 protein were used
in
three Western blots. The first blot was completed with a Lawsonia ELISA
antibody, which was
obtained from convalescent pig sera harvested from a 9 week old pig which had
previously tested
negative for Lawsonia infection by IFAT and ELISA (a "strict control"). The
antibody had been
diluted to 1:50 in TTBS + 2% dry milk. The second blot was completed with
swine anti-
Lawsonia convalescent serum which had been diluted 1:50 in TTBS + 2% dry milk.
The third
blot was a conjugate-only blot completed using a goat anti-swine HRP which had
been diluted
1:1000 in TTBS + 2% dry milk (KPL, Inc., Gaithersburg, Maryland).
First, the proteins were run through an SDS-PAGE gel (10% Bis/Tris in a MOPS
buffer).
The proteins were then transferred from the gels to a PVDF membrane at a
constant 30V for one
hour using a Novex blot module (Invitrogen). The proteins were then blocked
for at least one
hour in 50mL TTBS + 2% dry milk (w/v). The membranes were then incubated with
the
antibodies described above. The membranes were then washed 3 times in TTBS (lx
TBS +
0.05% Tween20), with each wash lasting about 2 minutes. The membranes were
then each
incubated for an hour with a secondary antibody (goat anti-swine HRP, KPL)
which had been
diluted to 1:1000 in TTBS + 2% dry milk. After incubation, the membranes were
washed twice
with TTBS, with each wash lasting about 2 minutes. The membranes were then
washed once
48
CA 02606229 2007-10-25
WO 2006/116763 PCT/US2006/016559
with PBS for about 2 minutes. After the wash, 10 ml Opti-4CN (Bio-Rad,
Hercules, CA) was
added as a substrate. The membranes were then developed for up to 30 minutes,
then rinsed with
water to stop.
Results and Discussion
FIG. 3 shows the Coomassie stained gel picture of total HIyA and Omp85-like
protein
samples as well as partially purified HlyA protein from IMAC fraction A12 from
the previous
example. The result from the conjugate only blot is provided in FIG. 4A; the
result of the Swine
anti-Lawsonia blot may be seen as FIG. 4B; and the result of the negative
control blot can be seen
as FIG. 4C. Very little banding was observed in the conjugate-only blot. There
was some
background reactivity of antibodies in the swine serums to E. coli proteins.
The reactivity of the
HlyA and Omp85-like proteins was much more intense than in the swine
convalescent serum as
opposed to that from the strict control. The convalescent serum also reacted
to the unique high
molecular weight banding in the HlyA samples. Although HlyA and Omp85-like
bands can be
observed in the strict control Western blot, they are not as intense. Based on
this data, it appears
that the infection/challenge of pigs with Lawsonia results in the production
of antibodies against
the HIyA and Omp85-like proteins, which indicates that these may be useful
proteins for a
vaccine.
EXAMPLE 4
This example describes the formation of a vaccine. Generally, any one of or a
combination of a proteins selected from the group consisting of :
1) a polypeptide comprising a sequence selected from the group consisting of
SEQ
ID Nos.: 1-455, SEQ ID No 466, or the polypeptide encoded by SEQ ID No: 456,
SEQ ID No: 457 or SEQ ID No: 466;
49
CA 02606229 2007-10-25
WO 2006/116763 PCT/US2006/016559
2) any polypeptide that has at least 85% sequence homology, more preferably at
least about 90% sequence homology, still more preferably at least about 95%
sequence homology, even more preferably at least about 97% sequence
homology, still even more preferably at least about 98% sequence homology, and
even more preferably at least about 99% sequence homology to the polypeptide
of 1);
3) any immunogenic portion of the polypeptides of 1) and/or 2)
4) the iinmunogenic portion of 3), comprising at least 300, 290, 280, 270,
260, 250,
240, 230, 220, 210, 200,190,180,170,160,150,140,130,120,110,100, 90, 80,
70, 60, 50, 45, 40, 35, 30, 25, 20, 18, 15, 13, 10, or most preferably 9
contiguous
aznino acids included in the sequences of SEQ ID No: 1-455, SEQ ID No: 456,
or the amino acid sequence encoded by SEQ ID No: 457 or SEQ ID No: 466;
and/or
5) a polypeptide that is encoded by a DNA that codes for a peptide comprising
the
sequence of SEQ ID No: 1-455 or SEQ ID No: 466, are provided for use as the
antigenic portion of a vaccine.
Veterinary-acceptable carriers, such as adjuvants, diluents, and the like will
be added to
the vaccine and the vaccine will be administered in any conventional manner.
