Note : Les descriptions sont présentées dans la langue officielle dans laquelle elles ont été soumises.
CA 2707880 2017-05-10
TITLE
A MOSQUITO COMPRISING MOSQUITO-ADAPTED WOLBACHIA
BACTERIA, AND METHOD OF MODIFYING MOSQUITO POPULATIONS
FIELD OF THE INVENTION
THIS INVENTION relates to arthropods and arthropod-transmitted diseases. More
particularly, this invention relates to a modified arthropod, an arthropod-
modifying
bacterium, and use thereof as an agent for control of diseases transmitted by
arthropods, particularly mosquitoes.
BACKGROUND OF THE INVENTION
Arthropods are a source of, or transmit, many diseases and conditions in
humans and other animals. Some arthropods may simply cause localized
irritation of
the skin without transmission of disease, such as occurs with mites and ticks,
or by
transmission of disease-causing pathogens such as arboviruses, protozoa,
bacteria
and nematodes. These disease-causing pathogens are responsible for a variety
of
different diseases of humans and other animals including malaria, Dengue
fever,
Eastern Equine encephalitis, Western Equine encephalitis, Venezuelan equine
encephalitis, Japanese encephalitis, Murray Valley encephalitis, West Nile
fever,
Yellow fever, LaCrosse encephalitis Asian spotted fever, Q fever, Lymphatic
filariasis (Elephantiasis), Chikungunya fever, Ross river fever and Chagas
disease.
Most pathogens that are transmitted by mosquitoes share a common property:
they have to undergo a significant period of development in their insect
vector before
they can be transmitted to a new host. After a female mosquito ingests an
infectious
blood-meal, parasites or arboviruses, such as dengue, penetrate the mosquito's
midgut and replicate in various tissues before infecting the salivary glands,
where
they are transmitted to a new host during subsequent blood-feeding. This time
period
from pathogen ingestion to potential infectivity is termed the extrinsic
incubation
period (EIP), and lasts approximately two weeks for both dengue (Siler et al.,
1926;
Watts et al., 1987) and malaria (Gilles etal., 2002). A female mosquito must
survive
longer than its initial non-feeding period (usually less than 2 days) plus the
EIP to
successfully contribute to pathogen transmission. Mosquito survival is
therefore
considered a critical component of a vector population's capacity for pathogen
transmission (Dye, 1992). Interventions that aim to reduce the daily
survivorship of
CA 02707880 2010-06-17
2
adult mosquitoes, such as the spraying of residual insecticides in houses and
insecticide-treated bednets for malaria control, yield large reductions in
pathogen
transmission rates (Masabo et al., 2004; Schellenberg et al., 2001) because of
the
sensitive relationship between mosquito survival and vectorial capacity
(Garrett-
Jones, 1964; MacDonald, 1957).
The control of diseases such as dengue primarily targets Aedes aegypti, a
domesticated mosquito that prefers to live in and around human habitation
(Gubler et
al., 1997). With few exceptions, dengue management strategies have been
complicated by the inability to completely eradicate A. aegypti from urban
settings,
and the ineffective application of long lasting vector control programs
(Morrison et
al., 2008). This has led to a worldwide resurgence of dengue, and highlighted
the
urgent need for novel and sustainable disease control strategies.
A strain of the obligate intracellular bacterium Wolbachia pipientis,
wMelPop, has been described that reduces adult lifespan of its natural fruit
fly host
Drosophila melanogaster (Min and Benzer, 1997). Wolbachia are maternally-
inherited bacteria that use mechanisms such as cytoplasmic incompatibility
(CI), a
type of embryonic lethality that results from crosses between infected males
with
uninfected females, to rapidly spread into insect populations (Hoffmann and
Turelli,
1997).
However, life-shortening Wolbachia strains do not occur in mosquitoes
naturally and experimental transfer of Wolbachia between host species
(transinfection) has lacked success (Van Meer and Stouthamer, 1999). In some
cases,
transferred strains can be stable and maternally inherited, primarily when
Wolbachia
is transferred within or between closely related species in a family or genus
(Boyle et
al., 1993; Xi et al., 2005; Zabalou et al., 2004). In other cases, the new
infection
appears poorly adapted to its new host, showing fluctuating infection
densities and
variable degrees of transovarial transmission. The result is often loss of
infection
within a few host generations. Wolbachia infections tend to be more
susceptible to
loss when they have been transferred between phylogenetically distant hosts
(Kang et
al., 2003; Riegler et al., 2004). Similarly, those species that do not
naturally harbour
Wolbachia have proven refractory to transinfection (Curtis and Sinkins, 1998;
Rigaud
CA 02707880 2010-06-17
3
et al., 2001).
SUMMARY OF THE INVENTION
Most pathogens require a relatively long incubation period in their arthropod
host before they can be transmitted to a new host. Thus, it has been proposed
that a
life-shortening Wolbachia bacterium may be used to reduce disease transmission
by
arthropod hosts that do not naturally harbour Wolbachia.
However, despite significant efforts, researchers have been unable to achieve
colonization of Wolbachia in distantly related arthropod species due to the
inability
of Wolbachia to quickly adapt to new intra-cellular environments. To overcome
this
problem, the inventors have identified a need for a modified bacterium that
can be
easily introduced into populations of disease-transmitting arthropod vectors
and
reduce transmission of pathogens such as dengue virus and malaria.
The invention therefore arises from the inventors' unexpected finding that
long-term serial passage of Wolbachia in an arthropod cell line resulted in
the
production of an arthropod-adapted bacterium that can be successfully
transferred
into, and maintained in, an arthropod and populations thereof. Furthermore,
the
inventors surprisingly discovered that arthropods harbouring this arthropod-
adapted
bacterium have a shorter lifespan, a reduced fecundity, altered feeding
behaviour,
and/or are less susceptible to pathogens, including viruses, fungi, worms,
protozoans,
and bacteria, than their wild-type counterparts.
In a first aspect, the invention provides an isolated arthropod-adapted
bacterium capable of modifying one or more biological properties of an
arthropod
host, wherein said arthropod-adapted bacterium does not normally colonize,
inhabit,
reside in, or infect said arthropod host.
In a preferred embodiment, said arthropod-adapted bacterium is of the genus
Wolbachia.
In another preferred embodiment, said isolated arthropod-adapted bacterium
is of a species of Wolbachia pipientis.
In one particularly preferred embodiment, said isolated arthropod-adapted
bacterium is wMelPop-CLA.
CA 02707880 2010-06-17
4
In a second aspect, the invention provides a method of producing an
arthropod-adapted bacterium capable of modifying one or more biological
properties
of an arthropod host, said method including the step of culturing a bacterium
with
one or more arthropod cells, optionally with one or more differentiating
agents, to
thereby produce said arthropod-adapted bacterium, wherein said arthropod-
adapted
bacterium does not normally colonize, inhabit, reside in, or infect said
arthropod host.
In one particular embodiment, the isolated arthropod-adapted bacterium of the
first aspect or the arthropod-adapted bacterium produced according to the
method of
the second aspect, comprises one or more genetic modifications compared to a
wild-
type counterpart.
In certain particular embodiments, said one or more genetic modifications
correspond to one or more nucleotide sequence deletions, insertions,
substitutions or
mutations.
In one preferred embodiment, said arthropod-adapted bacterium is of the
genus Wolbachia.
In another preferred embodiment, said arthropod-adapted bacterium is of a
species of Wolbachia pipientis.
In one particularly preferred embodiment, said arthropod-adapted bacterium
is wMelPop-CLA.
Preferably, said arthropod-adapted bacterium is cultured outside its native
host for at least 6 months.
More preferably, said arthropod-adapted bacterium is cultured outside its
native host between 1.5 to 5 years.
Even more preferably, said arthropod-adapted bacterium is cultured outside
its native host for 2 to 4 years.
In one embodiment, the isolated arthropod-adapted bacterium of the first
aspect or the arthropod-adapted bacterium produced according to the method of
the
second aspect shortens a life-span of an arthropod.
In another embodiment, the isolated arthropod-adapted bacterium of the first
aspect or the arthropod-adapted bacterium produced according to the method of
the
second aspect reduces a susceptibility of an arthropod to a pathogen.
CA 02707880 2010-06-17
In yet another embodiment, the isolated arthropod-adapted bacterium of the
first aspect or the arthropod-adapted bacterium produced according to the
method of
the second aspect reduces a fecundity of an arthropod.
In still another embodiment, the isolated arthropod-adapted bacterium of the
5 first aspect or
the arthropod-adapted bacterium produced according to the method of
the second aspect reduces a desiccation tolerance of eggs produced by the
arthropod.
In still yet another embodiment, the isolated arthropod-adapted bacterium of
the first aspect or the arthropod-adapted bacterium produced according to the
method
of the second aspect reduces the ability of the arthropod to feed from a host.
In a third aspect, the invention provides an arthropod comprising the isolated
arthropod-adapted bacterium of the first aspect, or the arthropod-adapted
bacterium
produced according to the method of the second aspect.
Suitably, said arthropod-adapted bacterium does not normally colonize,
inhabit, reside in, or infect said arthropod.
Preferably, said arthropod is selected from the group consisting of an insect,
an arachnid and a crustacean.
In one embodiment, said arthropod is an insect.
In another embodiment, said arthropod is a mosquito.
In one preferred embodiment, a wild-type of said arthropod is a disease-
transmitting mosquito.
In another preferred embodiment, said arthropod is a mosquito of the genus
selected from the group consisting of Culex, Aedes and Anopheles.
In one particularly preferred embodiment, said arthropod is a mosquito of a
species selected from the group consisting of Aedes aegypti, and Anopheles
gambiae.
In a fourth aspect, the invention provides a method of producing an arthropod
comprising the isolated arthropod-adapted bacterium of the first aspect, or
the
arthropod-adapted bacterium produced according to the method of the second
aspect.
In one embodiment, the arthropod of the third aspect or the arthropod
produced according to the method of the fourth aspect has a reduced life-span.
Typically, according to this embodiment, said reduced life-span is shorter
than an average life-span of a wild-type of said arthropod.
CA 02707880 2010-06-17
6
In another embodiment, the arthropod of the third aspect, or the arthropod
produced according to the method of the fourth aspect, has a reduced
susceptibility to
a pathogen.
Preferably, the arthropod of the third aspect, or the arthropod produced
according to the method of the fourth aspect, has improved protection against,
or
resistance to, a pathogen compared to a wild-type counterpart.
Typically, according to this embodiment, said pathogen is selected from the
group consisting of a virus, a fungus, a worm, a protozoan, and a bacterium.
In yet another embodiment, the arthropod of the third aspect, or the arthropod
produced according to the method of the fourth aspect has a reduced fecundity.
In still another embodiment, the arthropod of the third aspect, or the
arthropod
produced according to the method of the fourth aspect has a reduced ability to
feed
from a host.
In a fifth aspect, the invention provides a method of modifying an arthropod
population, said method including the step of introducing the arthropod of the
third
aspect, or the arthropod produced according to the method of the fourth
aspect, into
said arthropod population, to thereby modify one or more biological properties
of
said arthropod population.
In one embodiment of the fifth aspect, the invention provides a method of
reducing pathogen transmission by an arthropod population, said method
including
the step of introducing the arthropod of the third aspect, or the arthropod
produced
according to the method of the fourth aspect, into said arthropod population,
to
thereby reduce, decrease, or mitigate pathogen transmission by said arthropod
population.
In another embodiment of the fifth aspect, the invention provides a method of
reducing a susceptibility to a pathogen in an arthropod population, said
method
including the step of introducing the arthropod of the third aspect, or the
arthropod
produced according to the method of the fourth aspect, into said arthropod
population, to thereby reduce, decrease, or mitigate the susceptibility to
said pathogen
in said arthropod population.
CA 02707880 2010-06-17
7
Preferably, said pathogen is selected from the group consisting of a virus, a
fungus, a worm, a protozoan, and a bacterium.
In yet another embodiment of the fifth aspect, the invention provides a
method of reducing an average life-span of an arthropod population, said
method
including the step of introducing the arthropod of the third aspect, or the
arthropod
produced according to the method of the fourth aspect, into said arthropod
population, to thereby reduce, lower, shorten or decrease said average life-
span of
said arthropod population.
In still another embodiment of the fifth aspect, the invention provides a
method of reducing a fecundity of an arthropod population, said method
including the
step of introducing the arthropod of the third aspect, or the arthropod
produced
according to the method of the fourth aspect, into said arthropod population,
to
thereby reduce, lower, or decrease said fecundity of said arthropod
population.
In still yet another embodiment of the fifth aspect, the invention provides a
method of reducing an ability of an arthropod population to feed from a host,
said
method including the step of introducing the arthropod of the third aspect, or
the
arthropod produced according to the method of the fourth aspect, into said
arthropod
population, to thereby reduce, lower, or decrease said ability of said
arthropod
population to feed from a host.
Throughout this specification, unless otherwise indicated, "comprise",
"comprises" and "comprising" are used inclusively rather than exclusively, so
that a
stated integer or group of integers may include one or more other non-stated
integers
or groups of integers.
BRIEF DESCRIPTION OF THE FIGURES
Figure 1. Electron microscopy of wMelPop in mosquito cell lines. (A) Low
magnification transmission electron micrograph showing a large number of
Wolbachia (examples marked with arrow heads) dispersed throughout the
cytoplasm
of an Ae. aegypti RML-12 cell. (B) High magnification micrograph of four
Wolbachia presumably undergoing the process of cell division in RML-12 cells
(arrow heads) (C) Low magnification micrograph showing the presence of several
Wolbachia in the cytoplasm of an Ae. albopictus Aa23 cell (D) A cluster of An.
CA 02707880 2010-06-17
8
gambiae MOS-55 cells each infected by multiple Wolbachia.
Figure 2. Wolbachia infection frequencies of D. melanogasterwMelPopCLA-1 and
wMelPopCLA-2 lines post-transinfection (Go). Grey shaded regions represent
periods
of experimental selection for infection.
Figure 3. Mean relative Wolbachia densities in fly heads ( SE, Tr= 12 per each
point)
as determined by real-time quantitative PCR for four lines of infected flies
collected
at various ages over their lifespan at 29 C. Flies were sampled at four-day
intervals
until dead.
Figure 4. Survival curves of populations of male and female flies from wMelPop
and
wMelPopCLA lines at G31 post-transinfection. Shaded lines represent infected
flies
and unshaded lines represent uninfected tetracycline-treated counterparts.
Error bars
on curves represent standard error. Adult flies were maintained at 29 C.
Figure 5. Ability of wMelPop and wMelPopCLA lines to induce and rescue CI.
Mean percentage egg hatch ( SE) for wMelPop.T females mated with infected
treatment males (incompatible cross) and; infected treatment females mated
with
wMelPop males (rescue cross). Bracketed values above error bars represent the
number of replicate crosses.
Figure 6. Survival of wMelPop-infected PGYP1 A. aegypti (red lines) compared
to
the naturally uninfected JCU (blue lines) and tetracycline-cleared PGYP1.tet
(grey
lines) strains. Lifespan assays were initially conducted at G6 post-
transinfection by
the comparison of PGYP1 and JCU strains at 25 C (A) and 30 C (B). For each
strain, six replicate groups of 50 mosquitoes (25 of each sex) were maintained
in an
incubator at their respective test temperature, and 80% relative humidity.
Subsequently, after tetracycline treatment at G13 post-transinfection,
survival of
PGYP1 was compared to PGYP1.tet and JCU strains in larger cages under
insectary
conditions (C). For this assay, three replicate 30 x 30 x 30 cm cages of 200
CA 02707880 2010-06-17
9
mosquitoes (100 of each sex) were maintained for each strain at 25 1 C, 70-
90%
relative humidity, 12:12 h light:dark. In all three experiments mosquitoes
were
provided with 2% sucrose and cages checked daily for mortality.
Figure 7. Wolbachia-mediated cytoplasmic incompatibility resulting from
crosses of
the wMelPop-infected PGYP1 A. aegypti strain with the naturally uninfected JCU
(A), and tetracycline-cleared PGYP1.tet strains (B). Female parents are listed
first in
each cross. Results are mean percent embryo hatch standard error (minimum
1400
embryos total counted per cross), and number of replicates for each of the
four cross
types are shown in parentheses. Crosses were conducted as described (see
Materials
and Methods in Example 2).
Figure 8. Wolbachia infection frequencies ofA. aegypti PGYP1 and PGYP2 strains
post-transinfection (Go) (Panels A and B, respectively). Grey shaded regions
represent periods of experimental selection for infection where only the
offspring
from females that tested positive for Wolbachia by PCR screening were used as
parental stock. Broken lines indicate colony closure where outcrossing of PGYP
females to uninfected JCU males ceased, and after which time males and females
within the PGYP1 and PGYP2 colonies were allowed to interbreed. Mosquitoes (n=
10 males and females per timepoint) from each line were assayed for wMelPop
infection using PCR as described.
Figure 9. Survival of wMelPop-infected PGYP1 A. aegypti (red lines) compared
to
the naturally uninfected JCU strain (blue lines) under fluctuating
environmental
conditions with daily blood feeding. G9 PGYP1 and JCU strains were exposed to
a
diurnal cycle of 12 h light, 32 C, and 50% RH; and a nocturnal cycle 12 h
dark, 25 C
and 80% RH designed to simulate a summer day in Cairns, North Queensland,
Australia. For each strain a cohort of 300 adult mosquitoes (150 of each sex)
were
maintained in 30 x 30 x 30 cm cages. Females in each cage were provided with a
human blood meal for 15 min each day, and a moist oviposition substrate. Cages
were provided with a sugar cube as a carbohydrate source and checked daily for
CA 02707880 2010-06-17
mortality.
Figure 10. Survival of wMelPop-infected PGYP2 A. aegypti (red lines) compared
to
the naturally uninfected JCU (blue lines) and tetracycline-cleared PGYP2.tet
(grey
5 lines) strains. For each strain, three replicate 30 x 30 x 30 cm cages of
200
mosquitoes (100 of each sex) were maintained under insectary conditions at 25
1 C, 70-90% RH, 12:12 h light:dark. Cages were provided with 2% sucrose and
checked daily for mortality. Assays were conducted at G15 post-transinfection.
10 Figure 11. Fecundity and egg viability of wMelPop-infected PGYP1 A.
aegypti
compared to tetracycline-cleared PGYP1.tet and naturally uninfected JCU
strains at
G13 post-transinfection. Five day old females were fed on human blood, and 96
hours
later were isolated individually for egg laying. Eggs hatched 120 h after
oviposition,
and the percentage of hatched eggs determined. A total of 86% of PGYP1, 86% of
PGYP1.tet and 92% of JCU strain eggs hatched. Error bars represent SEM of the
total number of eggs and hatched eggs. The numbers of replicates for each
strain are
shown in parentheses.
Figure 12. CI crossing pattern and reproductive fitness of wMelPop-infected
PGYP2
A. aegypti at G16 post-transinfection. (A) For CI assays, PGYP2 A. aegypti
were
crossed with the tetracycline-cleared PGYP2.tet strain as described above.
Female
parents are listed first in each cross. Results are mean percent embryo hatch
standard error (minimum 2900 embryos total counted per cross), and number of
replicates for each of the four cross types are shown in parentheses. (B) To
evaluate
fecundity and egg viability differences between PGYP2 and PGYP2.tet strains,
five
day old colony females were fed on human blood, and 96 h post-blood meal
females
isolated individually for egg laying. Eggs were hatched 120 h after
oviposition, and
the percentage of hatched eggs determined. Error bars represent SEM of the
total
number of eggs and hatched eggs, and numbers of replicates for each strain are
shown in parentheses.
CA 02707880 2010-06-17
11
Figure 13. Mean total time active sem per 1 hour window for infected and
uninfected males and females at 3 adult ages. Times on X-axis denote the
beginning
of the hour session. Lights were turned on daily at 07:00 and off at 19:00.
Each
point represents 10 mosquitoes x 3 replicate recording days.
Figure 14. Mean metabolic rate sem based on two 4 hour windows (07:30-11:30
and 11:30 ¨ 3:30) for infected (black bars) an uninfected (white bars) males
and
females at 3 adult ages. Each bar represents data from 15 mosquitoes x 3
replicates x
2 windows.
Figure 15. Infection with Wolbachia protects flies from virus-induced
mortality. (A)
Comparison of the survival of Wolbachia infected (w) or uninfected Oregon RC
(ORCT) flies following challenge with DCV (B) Comparison of the survival of
Wolbachia infected (w) or uninfected (T) w"18 flies following challenge with
DCV
(C) Comparison of the survival of Wolbachia infected (w) or uninfected Oregon
RC
(ORCT) flies following challenge with CrPV (D) Comparison of the survival of
Wolbachia infected (w) or uninfected Oregon RC (ORCT) flies following
challenge
with FHV. For all panels the data shown represents the mean of triplicates and
the
bars indicate standard error. For each panel the survival curves were
significantly
different for Wolbachia infected versus uninfected flies (Kaplan-Meier
analysis,
p<0.0001 in each case).
Figure 16. Wolbachia infection in fly lines. (A) Comparison of DCV mortality
in
three wild-type laboratory fly lines. DCV induced mortality is delayed in the
Oregon
RC (ORC) fly line as compared to Oregon R (OR) and Champetieres (Champ) flies.
Data shown represents the mean of triplicates and the error bars indicate
standard
error. The survival curve for the ORC flies was significantly different from
either OR
(p<0.001) or Champ (p<0.001), whereas those of OR and Champ were not
significantly different (p=0.1) (Kaplan-Meier analysis). (B) Detection of
Wolbachia
infection by PCR using primers specific for the Wolbachia surface protein
(wsp)
upper panel. Detection of the 12S DNA was used as a positive control for DNA
CA 02707880 2010-06-17
12
template quality (bottom panel). Tetracycline treatment cured the ORC and
w1118 fly
lines of Wolbachia infection.
Figure 17. Virus RNA accumulation is delayed in Wolbachia infected ORC flies.
Infected flies were collected 0, 2 and 7 days post infection and assayed for
virus
RNA. Values shown are in arbitrary units and are relative to time 0 values.
Data
shown represents the mean of four replicates and the bars indicate standard
error.
Figure 18. Wolbachia strain wMel provides antiviral protection in D. simulans.
A.
Graph shows survival of flies infected with DCV (black line) or mock infected
(grey
line). wMel-infected (circle and plus sign) or uninfected (triangle and cross)
flies.
The survival of DCV infected flies with and without Wolbachia is significantly
different (p <0.0001). Error bars represent SEM calculated from three
replicate vials.
This is a representative experiment which was repeated twice more with similar
results. B. Graph showing accumulation of infectious DCV in wMel infected
(grey
bars) or uninfected (white bar) flies. Bars represent means from two
replicates with
SEM shown, and * indicates a significant difference between the means of day 2
samples (p <0.05, unpaired t test).
Figure 19. Antiviral protection of different Wolbachia strains in D. simulans.
Graphs
show survival of flies infected by wAu (A), wRi (B), wHa (C), and wNo (D)
challenged with DCV (black line) or mock infected (grey line). Flies with
Wolbachia
(circle and plus sign) and without Wolbachia (triangle and cross). Error bars
represent SEM calculated from three replicates. The survival of DCV infected
flies
with and without Wolbachia is significantly different for wAu (p <0.0001), wRi
(p <
0.0001), and wHa (p < 0.01), using log rank test on Kaplan-Meier curves.
Experiments were replicated on at least two additional independent cohorts of
flies,
and the results for all respective replicates of experiments shown in panel A,
B and D
were similar, however the replicates for panel C varied (see results in
Example 5).
Figure 20. The effect of different Wolbachia strains on the accumulation of
DCV in
CA 02707880 2010-06-17
13
D. simulans. Graphs show accumulation of infectious DCV in flies with (grey
bar) or
without (white bar) wAu (A), wRi (B), wHa (C), and wNo (D). Bars represent
means
from two replicates with SEM shown, and * indicates a significant difference
between the means of day 2 samples (p <0.05, unpaired t test).
Figure 21. The effect of different Wolbachia strains on the accumulation of
FHV in
D. simulans. Graphs show survival of flies infected by wAu (A), wRi (B), wHa
(C),
and wNo (D) challenged with FHV (black line) or mock infected (grey line).
Wolbachia infected (circle and plus sign) and uninfected (triangle and cross)
flies.
Error bars represent SEM calculated from three replicates. The survival of FHV
infected flies with and without Wolbachia is significantly different for wAu
and wRi
(p < 0.0001, log rank test on Kaplan-Meier curves). For each fly line a
similar result
was recorded in a replicate experiment.
Figure 22. Relative-density of Wolbachia strains in D. simulans. For each fly
line
the graph shows the relative abundance of Wolbachia to host genomic DNA
estimated using quantitative PCR. Bars represent the mean of 10 replicates and
error
bars are SEM.
Figure 23. Quantitative PCR analysis of dengue virus in mosquitoes. Two
strains of
Wolbachia-harbouring (+ Wolb)A. aegypti mosquitoes (PGYP1 and PGYP1.out) and
their tetracycline treated counterparts (- Wolb) (PGYP1.tet and PGYP1.out.tet)
were
intrathoracically injected with DENV-2. The quantity of DENV- 2 RNA present
was
estimated by quantitative real-time PCR. A) Quantity of genomic RNA (+RNA) in
thorax and head 5 days post-infection (dpi), abdomen 5 dpi and whole mosquito
14
dpi. B) Quantity of anti-genomic RNA (-RNA) in thorax and head 5 dpi, abdomen
5
dpi and whole mosquito 14 dpi. Bars represent grand means + SEM calculated
across
four independent replicate experiments. * P<0.05 by Mann-Whitney U test.
Figure 24. Localization of Wolbachia and dengue virus in A. aegypti
mosquitoes.
Double immunofluorescence staining of mosquito paraffin sections showing the
CA 02707880 2010-06-17
14
localization of dengue virus (in red) and Wolbachia (in green). Sections were
probed
simultaneously with polyclonal anti-wsp antibody (Wolbachia) and monoclonal
anti-
DENV antibody 4G4, followed by anti-rabbit- Alexa 488 (green) and anti-mouse-
Alexa 594 (red) conjugated antibodies, respectively. DNA (blue) is stained
with
DAPI. In panels A, B, E, F, G the red, green and blue channels are merged. C
and D
show only red and green channels merged. (A, C, E) PGYP1.tet (- Wolb)
mosquitoes,
14 days post DENV-2 thoracic 39 injection. Dengue virus is visible in
ommatidia
cells (A, C) and fat tissue (E). (B, D, F) PGYP1 mosquitoes (+ Wolb), 14 days
post
DENV-2 thoracic injection. Wolbachia can be seen in ommatidia cells and brain
(B,
D) and fat tissue (F). In contrast no dengue virus was detected. (G) Cellular
exclusion
of DENV-2 by Wolbachia, where the presence of both Wolbachia and DENV-2 was
observed at very low frequency in a small number of Wolbachia-infected
outcrossed
mosquitoes, 14 days post DENV-2 injection. Dengue is only apparent in cells
lacking
Wolbachia however. Scale bars: A-D, G: 50 gm; E,F: 20 pm. See also Figure 28.
Figure 25. Plasmodium gallinaceum detection in Aedes spp. mosquitoes. A.
aegypti
and A. fluviat ills mosquitoes were fed on P. gallinaceum infected chickens
and
parasites infection was detected by different means. A) Box plots of median
numbers
and 25 (bar below median) and 75% (above median) percentiles of oocyst
intensities,
seven days post-infection in wMelPop infected (PGYP1.out, +Wolb) or uninfected
(PGYP.out.tet, -Wolb) A. aegypti and in A. fluviatilis mosquitoes (***
P<0.0001 by
Mann-Whitney U test). B) Mercurochrome staining of mosquito midguts showing
representative localization of Plasmodium gallinaceum oocysts (arrows) in
wMelPop
(+Wolb) infected and uninfected (-Wolb) and in A. fluviatilis mosquitoes,
seven days
post-infection (100X magnification). C) Quantitative PCR analysis 15 days
after
infection showing the relative abundance 40 of Plasmodium 18S ssu rRNA
sequences in comparison to Actin gene (** P<0.005, *** P<0.0001 by Mann-
Whitney U test). See also Figure 29.
Figure 26. Wolbachia distribution in Aedes spp. mosquitoes. Fluorescence in
situ
hybridization of paraffin sections showing the localization of Wolbachia (in
red) in
CA 02707880 2010-06-17
different tissues of A. aegypti and in A. fluviatilis mosquitoes. Sections
were
hybridized with two Wolbachia specific 16S rRNA probes labelled with
rhodamine.
DNA is stained with DAPI (blue). A green filter is used to provide contrast.
The top
diagram has been adapted from (Jobling, 1987). Panels A) Anterior part of the
5 digestive system, showing the salivary glands (SG) and the cardia (C),
together with
the thoracic ganglion (G) of uninfected A. aegypti (-Wolb), PGYP I .out
(+Wolb) and
A. fluviatilis mosquitoes. Panels B). Fat tissue showing the presence of
wMelPop-
CLA in PGYP1.out (+ Wolb) mosquitoes but absence of the bacteria in
PGYP1.out.tet (-Wolb) and A. fluviatilis. C) wMelPop-CLA is present in the fat
10 tissue surrounding the gut in PGYP1.out mosquitoes (+Wolb), as well as
in nurse
cells (NC) and embryos (E). No wFlu Wolbachia was detected in fat tissue or
salivary
glands of A. fluviatilis. See also Figures 30-31.
Figure 27. Immune gene regulation in response to Wolbachia infection. RTqPCR
15 analysis of mRNA expression from selected immune genes of 5-6 day old
PGYP1.out and PGYP I .out.tet mosquitoes. Graphs show the target gene to house-
keeping gene ratio calculated for the genes indicated from the immune
pathways.
Box plots of median numbers and 25 (bar below median) and 75 (above 41 median)
percentiles of 10 individual mosquitoes analyzed from a single cohort. Results
from
two independently reared cohorts are shown (cohort 1 A and C; cohort 2 B and
D).
Statistically significant medians by Mann Whitney-U test (*P<0.05, ** P <0.01
and
*** P <0.001) are indicated and the corresponding foldchange for the gene is
shown
above the box plots.
Figure 28. Wolbachia and/or dengue proteins detected in A. aegypti mosquitoes.
Western blots showing the presence of Wolbachia and/or dengue virus in A.
aegypti
mosquitoes infected with DENV-2 using wsp polyclonal antibody for Wolbachia
detection and 4G4 monoclonal antibody for DENV-2 detection. The expected
infection status (Wolbachia or DENV-2) of the mosquitoes used is indicated
above
each blot. (A) 14 days after thoracic injection with DENV-2, (B) 7 and 16 days
after
oral feeding with DENV-2.
CA 02707880 2010-06-17
16
Figure 29. P. gallinaceum distribution and maturation in Aedes spp. mosquitoes
7
and 14 days post infection. A) DAPI (blue) staining of an oocyst (00) in the
gut of a
PGYP1.out (+ Wolb) mosquito, 7 days postinfection (dpi) with Plasmodium
gallinaceum. The presence of numerous wMelPop Wolbachia (red) nearby
Malpighian cells is detected by FISH. B) Immunofluorescence localization of
two
mature oocysts (red 0o) among immature oocysts (white 0o) in the gut epithelia
of
A. fluviatilis, 7dpi with P. gallinaceum. C, D) Immunofluorescence showing the
presence of mature P. gallinaceum sporozoites (Sp, red) in the salivary gland
(SG)
and gut epithelia of A. fluviatilis, 15 dpi.
Figure 30. Wolbachia density in Aedes spp. mosquitoes. Box plots of median
numbers and 25 and 75% percentiles of number of Wolbachia copies per mosquito,
based on standard curve analysis for the wsp gene. wMelPop- CLA infected
PGYP1.out strain (+Wolb) or PGYP1.out.tet uninfected (-Wolb) strains ofA.
aegypti
and A. fluviatilis mosquitoes (*** P<0.0001 by Mann- Whitney U test).
Figure 31. wMelPop-CLA and wFlu Wolbachia distribution in Aedes spp.
mosquitoes. The first column (A, E, I) shows the localization of wMelPop- CLA
(E)
and wFlu (I) Wolbachia (green) in A. aegypti and A.fluviatilis heads. Both
Wolbachia
strains are localized by immunofluorescence using a Wolbachia specific
polyclonal
anti-wsp antibody and visualized using rabbit- Alexa 488 (green). B, C, D)
FISH
showing the absence of Wolbachia in thoracic muscle, developing oocytes and
Malpighian tubules of uninfected mosquitoes. F, G, H) wMelPop-CLA Wolbachia is
present at high densities in the thoracic muscle, embryos, Malpighian tubules
(MT),
fat tissue (FT) and around the midgut (MG) of PGYP1.out mosquitoes (+Wolb). J,
K,
L) wFlu Wolbachia is absent in the thoracic muscle ofA. fluviatilis (J), but
is present
in the nurse cells (NC), apical part of embryos (E) and in the Malpighian
tubules
(MT), although the densities are much lower than those observed for wMelPop-
CLA-
transinfected A. aegypti (+Wolb). IFA Micrographs (A, E, I) were taken using a
filter
for Alexa 488 (green, Wolbachia), Alexa 594 (contrast) and DAPI (DNA, blue)
and
CA 02707880 2010-06-17
17
then merged. FISH Micrographs (B-D. FH, J-L) were taken using a filter for
Alexa
488 (contrast), Alexa 594 (red, Wolbachia) and DAPI (DNA, blue) and then
merged.
Figure 32. Pre-imaginal development times of (A) males and (B) females from
the
wMelPop-infected PGYP1 and tetracycline-cleared PGYP1.tet A. aegypti strains.
Average development time SE for each immature stage is shown. Numbers of
replicates for each strain are denoted in parentheses above error bars.
Asterisks
indicate a significant difference in the time to eclosion between strains (P
<0.001,
MWU test).
Figure 33. Wing-size comparisons of PGYP1 and PGYP1.tet strains. Average wing
lengths and standard error bars are shown. Asterisks indicate values
significantly
different from one another (P <0.05, MWU test).
Figure 34. Viability of quiescent embryos from PGYP1 and PGYP I .tet strains
over
time at different temperatures. After embryonic maturation (120 h post
oviposition),
eggs were stored at either: (A) 25 C and (B) 18 C, with 85 % relative
humidity.
Average proportion of eggs hatching (n= 20 oviposition papers per time point)
and
standard error bars are shown.
Figure 35. Age-associated decline of fecundity in PGYP1 and PGYP I .tet
strains. (A)
Average number of eggs oviposited per female SE. (B) Average number of
larvae
produced per female SE, and (C) Proportion of sampled females that did not
oviposit. Females were assayed over successive gonotrophic cycles until death
(n=
48 females per time-point). As death occurred over time, samples sizes
decreased
below 48 females in cycle 7 for PGYP1 females (n= 22), and in cycles 13-16 for
PGYP1.tet females (n= 22, 12, 5, and 5 respectively).
Figure 36. Time until first attempted bite. Bars represent means sem from
individual trials. No significant differences were observed between infected
and
uninfected mosquitoes for any of the ages.
CA 02707880 2010-06-17
18
Figure 37. Number of attempted bites. Bars represent means sem from
population
trials. *P<0.05, **P<0.00 I by t-test.
Figure 38. Weight of imbibed blood meal. Bars represent means sem from
individual trials. *P<0.05, **P<0.001 by t-test.
Figure 39. Proportion of the population that imbibed a blood meal. Bars
represent
medians 25% and 75% quartile values from population trials. **P<0.001 by
Mann
Whitney-U test.
Figure 40. Pre-probing behaviour of A. aegypti mosquitoes.
Comparison of time spent by mosquitoes infected with Wolbachia (black bars) or
tetracycline treated counterparts (white bars) of different ages (5, 15, 26
and 35 days)
after landing on a human hand until the insertion of mouthparts into the skin
(N=12-
40 per group). Bars depict means + S.E.M. * p<0.05; ** p<0.01 by t-test.
Figure 41. Probing behaviour of A. aegypti mosquitoes.
Comparison of time spent by mosquitoes infected with Wolbachia (black bars) or
tetracycline treated counterparts (white bars) of different ages (5, 15,26 and
35 days)
from the insertion of mouthparts into the skin of a human hand and the first
sign of
blood within the insect midgut. (N=12-40 per group). Bars depict means +
S.E.M.
*** p<0.0001 by t-test.
Figure 42. Percent of A. aegypti mosquitoes that obtained a blood meal.
Percentage of wMelPop-infected (black bars) and tetracycline-treated
mosquitoes
(white bars), that successfully imbibed blood within 10 minutes of
observation, by
age class. Bars depict medians + 75% quartile values based on four replicates.
*
p<0.05 by Mann-Whitney U test.
Figure 43. Number of probings in A. aegypti mosquitoes.
CA 02707880 2010-06-17
19
Comparison of number of probings of mosquitoes infected with Wolbachia (black
bars) or tetracycline treated counterparts (white bars) of different ages (5,
15, 26 and
35 days). (N=40 per group). Bars depict means + S.E.M. *** p<0.0001 by t-test.
Figure 44. Additional phenotypes observed in Wolbachia-infected A. aegypti.
Proportion of wMelPop-infected mosquitoes exhibiting abnormal pre-probing
behaviour as: body jittering ("shaky") or bended proboscis ("bendy") in
mosquitoes
from their first occurrence at 15 days of age. Neither of these behaviours was
observed in Wolbachia non-infected mosquitoes.
Figure 45. Apyrase content and saliva volume.
Comparisons of apyrase and saliva volume of mosquitoes infected with Wolbachia
(black bars) or tetracycline treated counterparts (white bars) of different
ages (5, 26
and 35 days). A) Apyrase activity measured through the release of inorganic
phosphate from ATP. B) Saliva volume measured through the sphere volume of
saliva droplets. Number of replicates in each group and age are represented.
Bars
depict means + S.E.M. P values relate to univariate tests of significance
derived from
general linear models. ** indicates P <0.01 from t-tests for the specific age
category.
Figure 46. Wolbachia screening in mosquito saliva.
PCR analysis to detect Wolbachia in mosquito saliva. Mosquito (apyrase) or
Wolbachia (WSP) specific primers in infected (InfMq) or uninfected mosquitoes
(UnMq), saliva (InfSal or UnSal) or salivary glands (InfSG or UnSG). Specific
bands
were only detected in whole mosquitoes or salivary glands. Neg= negative
control;
M=100bp NEB DNA ladder.
Figure 47. Protein sequence alignment of the WD0200 proteins of wMelPop and
wMelPop-CLA, showing the mutation of one aspartic residue (D) into asparagine
(N).
Figure 48. Partial DNA sequence alignment between wMelPop and wMelPop-CLA
CA 02707880 2010-06-17
gene WD0413 showing a 10 bp deletion in the 3'-end of the gene.
Figure 49. Protein sequence alignment of wMelPop and wMelPop-CLA WD0413
showing the extension of the wMelPop-CLA putative protein by 10 amino acids,
as a
5 result of the creation of a frameshift.
Figure 50. Diagram showing the insertion of an IS5 element between the genes
WD0765 and WD0766 in the wMelPop-CLA Wolbachia strain.
10 Figure 51. Diagram showing the deletion of 13 genes in the wMelPop-CLA
strain
compared to the original wMelPop strain.
Figure 52. DNA (Top) and protein (bottom) alignment of WD0758 from wMelPop
and wMelPop-CLA, showing the insertion of a G that creates a frameshift and a
15 premature stop codon.
Figure 53. Differential amplification of 3 out of the 5 unique features of
wMelPop-
CLA by PCR.
20 Figure 54. Results illustrating that dengue virus interference is
generated by the
wMel strain in mosquitoes. The graph shows the results of oral feeding of
mosquitoes
with DENV-2 virus 14 days post infection (14 d.p.i.). Dengue has been measured
in
mosquito legs by qPCR to determine disseminated infection. Graphs show mean
number of viral copies +/- standard error. Tet=control Wolbachia uninfected
mosquitoes, Pop=wMelPop-CLA infected mosquitoes and Mel=wMel infected
mosquitoes.
DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENT
The present invention has arisen from the inventors' unexpected discovery
that long-term serial passage of a Wolbachia bacterium in an arthropod cell
line
resulted in the production of an arthropod-adapted bacterium that can be
successfully
CA 02707880 2010-06-17
21
transferred into an arthropod which does not naturally harbour Wolbachia. The
inventors have also surprisingly found that arthropods harbouring the
arthropod-
adapted bacterium, and populations thereof, have a shorter life-span, a
reduced
fecundity, altered feeding behaviour, and/or a lower susceptibility to
pathogens such
as viruses, fungi, worms (e.g. nematodes), protozoans, and bacteria.
This invention therefore provides an arthropod-adapted bacterium, and an
arthropod comprising the same, for use in the reduction of arthropod-borne
diseases
such as, but not limited to, dengue fever, malaria and lymphatic filariasis.
For the purposes of this invention, by "isolated" is meant material that has
been removed from its natural state or otherwise been subjected to human
manipulation. Isolated material may be substantially or essentially free from
components that normally accompany it in its natural state, or may be
manipulated so
as to be in an artificial state together with components that normally
accompany it in
its natural state.
As used herein, the term "arthropod" refers to an invertebrate animal that is
characterized by a chitinous exoskeleton and a segmented body with paired,
jointed
appendages (e.g. legs or feet). Accordingly, an arthropod may be an insect
(e.g. a
mosquito or a fly), a crustacean (e.g. a prawn, a crab, or a lobster), or an
arachnid
(e.g. a tick or a mite), although without limitation thereto. As also used
herein, the
terms "arthropod vector" or "arthropod vector population" refer to an
arthropod, or a
population thereof, that is capable of transmitting a pathogen from one host
to
another.
Arthropods preferably include insects, arachnids and crustaceans.
Insects include insects of orders such as Dtptera (e.g. mosquitoes,
horseflies,
midges, stableflies and tsetse flies), Phthiraptera (e.g. lice), Siphonaptera
(e.g. fleas)
and Hemiptera (e.g. bedbugs and triatomine bugs).
An example of an arachnid is a tick or mite (e.g of the families Argasida,
Trombidiidae and Ixodidae). These can simply cause localized irritation of the
skin
or transmit pathogens such as bacteria (e.g. Rickettsia and Coxiella) and
viruses
(typically Flaviviruses) which cause diseases such as Asian spotted fever,
North
American or Rocky Mountain spotted fever, American mountain fever or Colorado
CA 02707880 2010-06-17
22
tick fever, Q fever, Russian spring-summer encephalitis and tick paralysis.
Spider
mites, which are members of the Acari (mite) family Tetranychidae, may also
spread
disease by transferring pathogens (e.g. fungus) between plants.
An example of a crustacean is a prawn or a crab (e.g. of the families Peneidae
and Coenobitidae). Most cultured penaeid prawns (e.g. Penaeus monodon,
Marsupenaeus japonicus and Litopenaeus vannamei) carry and transfer the DNA
viruses of the species White Spot Syndrome Baculovirus Complex, which cause
White Spot Syndrome in crustaceans such as prawns, lobsters and crabs.
In one aspect, the invention provides an isolated arthropod-adapted bacterium
capable of modifying one or more biological properties of an arthropod host.
By "arthropod-adapted" bacterium is meant a bacterium (e.g. of the genus
Wolbachia) that has been taken out of its native host environment and adapted
to a
new arthropod host environment, in which environment said bacterium does not
naturally reside. Accordingly, a non-limiting example of an arthropod-adapted
bacterium is a Wolbachia bacterium that has been isolated from its native host
(e.g.
Drosophila melanogaster) and adapted to a new host (e.g. Aedes aegyptii or
Anopheles gambiae).
It will be appreciated that the term arthropod-adapted bacterium encompasses
any bacterium that is capable of colonizing, infecting, or residing in an
arthropod host
within which it does not normally reside.
In a preferred embodiment, said isolated arthropod-adapted bacterium is of
the genus Wolbachia.
Wolbachia includes strains such as wMel, wMelPop, wMelPop-CLA,
wMeICS, wAu, wRi, wNo, wHa, wMau, and wCer2, although without limitation
thereto.
In one particular embodiment, said isolated arthropod-adapted bacterium is
Wolbachia pipientis.
In one particularly preferred embodiment, said isolated arthropod-adapted
bacterium is wMelPop-CLA.
As used herein, the term "wMelPop-CLA" refers to a particularly preferred
arthropod-adapted wMelPop.
CA 02707880 2010-06-17
23
In one embodiment, said isolated arthropod-adapted bacterium shortens a life-
span of an arthropod.
In another embodiment, said isolated arthropod-adapted bacterium reduces a
susceptibility of an arthropod to a pathogen.
As used herein, an arthropod that has a "reduced susceptibility" to a pathogen
is less likely to become infected by, carry and/or transmit a pathogen than a
wild-type
counterpart.
As referred to herein, a pathogen may be a virus, a fungus, a protozoan, a
worm or a bacterium.
Non-limiting examples of virus pathogens include arboviruses such as
Alphaviruses (e.g. Chikungunya virus, Eastern Equine Encephalitis virus,
Western
Equine Encephalitis virus), Flaviviruses (e.g. dengue virus, West Nile virus,
Yellow
Fever virus), and Bunyaviruses (e.g. La Crosse virus, Rift Valley fever virus,
Colorado tick fever virus).
An example of a protozoan parasite is a malaria parasite of the Plasmodium
genus such as, but not limited to, Plasmodium falciparum, Plasmodium vivax,
Plasmodium ovale, Plasmodium malariae, Plasmodium berghei, Plasmodium
gallinaceum, and Plasmodium knowlesi.
Non-limiting examples of worm pathogens include nematodes, inclusive of
filarial nematodes such as Wuchereria bancrofti. Brugia malayi, Brugia
pahangi,
Brugia timori, and Dirofilaria immitis.
A pathogen may also be a bacterium, inclusive of a Gram negative and Gram
positive bacterium.
It will be appreciated that non-limiting examples of pathogenic bacteria
include spirochetes (e.g. Borrelia), actinomycetes (e.g. Actinomyces),
mycoplasmas,
Rickettsias, Gram negative aerobic rods, Gram negative aerobic cocci, Gram
negatively facultatively anaerobic rods (e.g. Erwinia and Yersinia), Gram-
negative
cocci, Gram negative coccobacilli, Gram positive cocci (e.g. Staphylococcus
and
Streptococcus), endospore-forming rods, and endospore-forming cocci.
By way of example only, pathogenic bacteria include Yersinia pestis, Bore/ha
spp, Rickettsia spp, and Erwinia carotovora.
CA 02707880 2010-06-17
24
In yet another embodiment, said isolated arthropod-adapted bacterium
introduces a reproductive abnormality in an arthropod host such as, but not
limited
to, parthenogenesis, feminization, male killing, and cytoplasmic
incompatibility (CI).
Typically, according to this embodiment, said reproductive abnormality
reduces a fecundity within an arthropod vector population.
As used herein, the term "fecundity" refers to the ability of an arthropod, or
a
population thereof, to reproduce.
In another aspect, the invention provides a method of producing an arthropod-
adapted bacterium capable of modifying one or more biological properties of an
arthropod host, said method including the step of culturing a bacterium with
one or
more arthropod cells, optionally with one or more differentiating agents, to
thereby
produce said arthropod-adapted bacterium.
Suitably, said arthropod-adapted bacterium does not normally colonize,
inhabit, reside in, or infect said arthropod host.
In a preferred embodiment, said arthropod-adapted bacterium is of the genus
Wolbachia.
Wolbachia includes strains such as wMel, wMelPop, wMelPop-CLA,
wMeICS, wAu, wRi, wNo, wHa, wMau, and wCer2, although without limitation
thereto.
In one particular embodiment, said isolated arthropod-adapted bacterium is
Wolbachia pipientis.
In one particularly preferred embodiment, said arthropod-adapted Wolbachia
bacterium is wMelPop-CLA.
Preferably, said arthropod-adapted bacterium is cultured outside its native
host for at least 6 months.
More preferably, said arthropod-adapted bacterium is cultured outside its
native host between 1.5 to 5 years.
Accordingly, it will be appreciated that said arthropod may be cultured
outside its native host for about 2 years, 2.5 years, 3 years, 3.5 years, 4
years. 4.5
years, and up to about 5 years.
CA 02707880 2010-06-17
Even more preferably, said arthropod-adapted bacterium is cultured outside
its native host for 2 to 4 years.
In one particular embodiment, said native host is of the genus Drosophila.
In another particular embodiment, said native host is of a species of
5 Drosophila melanogaster.
In yet another particular embodiment, said native host is of a species of
Drosophila simulans.
In one embodiment, said one or more arthropod cells are of an arthropod of
the genus selected from the group consisting of Aedes and Anopheles.
10 In another embodiment, said one or more arthropod cells are of an
arthropod
of a species selected from the group consisting of Aedes albopictus, Aedes
aegypti,
and Anopheles gambiae.
Accordingly, a non-limiting exemplary method of producing the arthropod-
adapted bacterium according to this aspect comprises the steps of (i)
isolating a
15 bacterium (e.g. wMelPop) from an arthropod host (e.g. Drosophila
melanogaster),
(ii) establishing the isolated bacterium in a first culture of one or more
arthropod cells
(e.g. of a species of Aedes albopietus); (iii) culturing the first culture for
a period of
time (e.g. 2-3 years); (iv) isolating the bacterium from the first culture;
(v)
introducing the bacterium from the first culture into a second culture of one
or more
20 arthropod cells (e.g. of a species of Aedes aegyptii or Anopheles
gambiae), and (vi)
culturing the second culture for a period of time (e.g. 3-12 months), to
thereby
produce the arthropod-adapted bacterium (e.g. wMelPop-CLA) according to this
aspect.
A skilled person will appreciate that the bacterium which is to be adapted to
a
25 new arthropod host may be isolated from an arthropod during different
developmental stages of their life-cycle and from different tissues such as,
an
embryo, a cytoplasm, or a hemolymph, although without limitation thereto.
Non-limiting methods for introducing an isolated bacterium into an
uninfected arthropod host, or cells thereof, may be selected from the group
consisting
of a shell vial technique, and a microinjection.
CA 02707880 2010-06-17
26
In yet another embodiment, the arthropod-adapted bacterium reduces the
ability of an arthropod to feed from a host.
Typically, according to this embodiment, the arthropod (e.g. a mosquito) may
have a reduced ability to obtain, ingest, or otherwise acquire blood from an
arthropod
host (e.g. a human) compared to a corresponding wild-type arthropod.
In some embodiments, the arthropod-adapted bacterium (e.g. wMelPop-CLA)
comprises one or more genetic modifications when compared to a corresponding
wild-type counterpart (e.g. wMelPop).
Such genetic modifications may be selected from the group consisting of a
nucleotide sequence insertion, a deletion, a single nucleotide polymorphism
(SNP), a
mutation, a frame-shift, a chromosomal rearrangement, or a transposition,
although
without limitation thereto.
In some embodiments, said genetic modifications relate to the modification of
one or more nucleotide sequences as set forth in Table 7.
In another aspect, the invention provides an arthropod comprising the isolated
arthropod-adapted bacterium.
An arthropod comprising the isolated arthropod-adapted bacterium of the
aforementioned aspects may be referred to as a "rnodified arthropod".
Suitably, a wild-type of said modified arthropod is an arthropod vector that
carries and transfers a pathogen from one "host" to another.
A "host" may be any animal or plant upon which an arthropod feeds and/or to
which an arthropod is capable of transmitting a disease-causing pathogen. Non-
limiting examples of hosts are plants (e.g. flowers, vegetables, fruits, and
crops),
mammals such as humans, domesticated pets (e.g. dogs and cats), wild animals
(e.g.
monkeys, rodents and wild cats) livestock animals (e.g. sheep, pigs, cattle,
and
horses), avians such as poultry (e.g. chickens, turkeys and ducks) and other
animals
such as crustaceans (e.g. prawns and lobsters).
It will be appreciated that an arthropod vector may act as a carrier of a
pathogen that is harmful to a host (e.g. a human) and not to the arthropod
vector
itself.
CA 02707880 2010-06-17
27
A non-limiting example of vector-borne pathogen transmission is by blood-
feeding arthropods (e.g. mosquitoes). The pathogen (e.g. a dengue virus)
multiplies
within the arthropod vector, and the pathogen is transmitted from the
arthropod
vector to an animal host (e.g. a human) when the arthropod takes a blood meal.
Mechanical transmission of pathogens may occur when arthropods physically
carry
pathogens from one place or host to another, usually on body parts.
It will also be appreciated that an arthropod vector may transmit disease
within an arthropod group. A non-limiting example is the transmission of the
viral
pathogens that cause White Spot Syndrome in crustaceans from one arthropod
(e.g. a
prawn) to another.
An arthropod may also facilitate pathogen transmission between plants. A
non-limiting example is the transfer of yeast pathogens to grapes by mites.
While in certain embodiments, arthropod-adapted bacteria may be useful for
creating modified arthropod vectors (e.g. mosquitoes) having reduced capacity
to
transmit disease-causing pathogens (e.g. malaria), in other embodiments, the
invention provides arthropods that have "beneficial traits" or uses which are
enhanced or improved by arthropod-adapted bacteria. Non-limiting examples
include
insects such as honey-bees and crustaceans such as prawns, lobsters and crabs
having
reduced susceptibility to pathogens.
Preferably, said arthropod is selected from the group consisting of an insect,
an arachnid and a crustacean.
In one particular embodiment, said arthropod is an insect.
In another particular embodiment, said arthropod is a mosquito.
In one particular embodiment, a wild-type of said arthropod is a disease-
transmitting mosquito.
As used herein "mosquito" and "mosquitoes" include insects of the family
Culicidae. Preferably, mosquitoes are of the sub-families Anophelinae and
Culicinae.
Even more preferably, mosquitoes are capable of transmitting disease-causing
pathogens, including viruses, protozoa, worms (e.g. nematodes) and bacteria.
Non-
limiting examples include species of the genus Anopheles which transmit
malaria
pathogens, species of the genus Culex, and species of the genus Aedes (e.g.
Aedes
CA 02707880 2010-06-17
28
aegypti, Aedes albopictus and Aedes polynesiensis) which transmit nematode
worm
pathogens, arbovirus pathogens such as Alphaviruses (e.g. Eastern Equine
encephalitis, Western Equine encephalitis, Venezuelan equine encephalitis),
Flavivirus pathogens that cause diseases such as Japanese encephalitis, Murray
Valley Encephalitis, West Nile fever, Yellow fever, Dengue fever, and
Bunyavirus
pathogens that cause diseases such as LaCrosse encephalitis, Rift Valley
Fever, and
Colorado tick fever, although without limitation thereto. Non-limiting
examples of
worm pathogens include nematodes (e.g. filarial nematodes such as Wuchereria
bancrofii, Brugia malayi, Brugia pahangi or Brugia timori), which may be
transmitted by mosquitoes.
Disease-causing pathogens transmitted by mosquitoes also include bacteria
(e.g. Yersinia pestis, Bore/ha spp, Rickettsia spp, and Erwinia carotovora).
Non-limiting examples of pathogens that may be transmitted by Aedes
aegypti are dengue virus, Yellow fever virus, Chikungunya virus and heartworm
(Dirofilaria immitis).
Examples of pathogens that may be transmitted by Aedes albopictus include
West Nile Virus, Yellow fever virus, St. Louis Encephalitis, dengue virus, and
Chikungunya fever although without limitation thereto.
Pathogens frequently transmitted by the mosquito vector Anopheles gambiae
include malaria parasites of the genus Plasmodium such as, but not limited to,
Plasmodium falciparum, Plasmodium vivax, Plasmodium ovale, Plasmodium
malariae, Plasmodium berghei, Plasmodium gallinaceum, and Plasmodium
knowlesi.
In one particularly preferred embodiment, said arthropod is a mosquito of the
genus selected from the group consisting of Culex, Aedes and Anopheles.
In another particularly preferred embodiment, said arthropod is a mosquito of
a species selected from the group consisting of Aedes aegypti, Aedes
albopictus, and
Anopheles gambiae.
In another aspect, the invention provides a method of producing the modified
arthropod.
CA 02707880 2010-06-17
29
In one embodiment, the modified arthropod has a reduced susceptibility to a
pathogen.
Typically, according to this embodiment, said pathogen is selected from the
group consisting of a virus, a fungus, a protozoan, a nematode, and a
bacterium.
In another embodiment, the modified arthropod has a reduced life-span.
Typically, according to this embodiment, said "reduced life-span" is shorter
than an average life-span of a wild-type of said modified arthropod.
Accordingly,
said reduced life-span may be 10%, 20%, 30%, 40%, 50%, or up to 80% shorter
than
the average life-span of a wild-type of said arthropod.
It will be appreciated that the modified arthropod may be less likely to
transmit a pathogen than its wild-type counterpart, since most pathogens have
to
undergo a relatively long incubation period in an arthropod vector before they
can be
transmitted to a new host.
In yet another embodiment, the modified arthropod has a reduced fecundity.
In one particular embodiment, said reduced fecundity may result in a loss of
progeny following a cross between a modified male arthropod and a wild-type
female
arthropod.
In another particular embodiment, the modified arthropod (e.g. a mosquito)
may be used in a method for controlling the growth of an arthropod population
during the dry period since eggs from a modified arthropod (e.g. a female
mosquito)
have a reduced tolerance to desiccation and a shorter life-span compared to
eggs from
a wild-type arthropod.
As used herein, "reduced tolerance to desiccation" refers to a reduced,
diminished or decreased ability of eggs from an arthropod to withstand or
endure
extreme dryness or drought-like conditions.
According to this particular embodiment, the life-span of eggs from a
modified arthropod (e.g. a mosquito) may be at least 4 weeks, at least 8
weeks, at
least 12 weeks, and up to at least 18 weeks shorter than eggs from said wild-
type
arthropod.
In another aspect, the invention provides a method of modifying an arthropod
population, said method including the step of introducing the modified
arthropod into
CA 02707880 2010-06-17
said arthropod population, to thereby modify one or more biological properties
of
said arthropod population.
Preferably, said arthropod population is an insect vector population.
More preferably, said arthropod population is a mosquito vector population.
5 Even more preferably, said arthropod population is a disease-
transmitting
mosquito vector population.
In one embodiment, this aspect provides a method of mitigating, reducing, or
decreasing pathogen transmission by said arthropod population.
In another embodiment, this aspect provides a method of reducing,
10 mitigating, or decreasing a susceptibility to a pathogen in said
arthropod population.
Typically, according to this embodiment, said pathogen is selected from the
group consisting of a virus, a fungus, a worm, a protozoan, and a bacterium.
In one particular embodiment, said pathogen is a protozoan of the genus
Plasmodium.
15 In another particular embodiment, said pathogen is of a species
selected from
the group consisting of Plasmodium falciparum, Plasmodium vivax, Plasmodium
ovale, Plasmodium malariae, Plasmodium berghei, Plasmodium gallinaceum, and
Plasmodium knowlesi.
In yet another particular embodiment, said pathogen is a virus of the genus
20 Flavivirus (e.g., a dengue virus).
Accordingly, in a non-limiting example, an arthropod population (e.g. a
population ofAedes aegypti) comprising one or more modified arthropods may
have
a reduced susceptibility to a pathogen (e.g. a malaria parasite or a dengue
virus),
compared to a corresponding wild-type arthropod population.
25 In yet another embodiment, this aspect of the invention provides a
method of
reducing, lowering, shortening, or decreasing an average life-span of said
arthropod
population.
It will be appreciated that an arthropod population with a reduced average
life-span compared to a corresponding wild-type arthropod population may have
a
30 reduced capacity to transmit pathogens, such as viruses, fungi, worms,
parasites, and
bacteria, since a pathogen must undergo a significant period of development in
their
CA 02707880 2010-06-17
31
arthropod vector before it can be transmitted to a new host. Accordingly, a
reduction
of the average life-span of a disease-transmitting mosquito population may
help
reduce transmission of vector-borne diseases such as, but not limited to,
malaria,
dengue fever, and lymphatic filariasis.
In yet another embodiment, this aspect of the invention provides a method of
reducing, lowering or decreasing an average fecundity of said arthropod
population.
In one particular embodiment, said reduced average fecundity results in a loss
of progeny following a cross between a modified male arthropod and a wild-type
female arthropod.
In another particular embodiment, said reduced average fecundity results in a
reduced life-span of eggs from a modified female arthropod.
In still yet another embodiment, this aspect of the invention provides a
method of reducing an ability of an arthropod population to feed from a host.
It will also be appreciated that the methods of this aspect may be used
together with other agents that reduce an average life-span of an arthropod
population. Such agents include entomopathogenic fungi and mosquito
densoviruses,
although without limitation thereto.
So that the invention may be fully understood and put into practical effect,
the
skilled reader is directed to the following non-limiting detailed Examples.
EXAMPLES
EXAMPLE I
HOST ADAPTATION OF WOLBACHIA AFTER LONG-TERM SERIAL
PASSAGE IN MOSQUITO CELL LINES
Materials and Methods
Cell lines and maintenance
Three cell lines were used in this study: (i) Aa23.T derived from Ae.
albopictus
embryos (O'Neill et al., 1997) (ii) RML-12 derived from Ae. aegypti larvae
(C.E.
Yunker; personal communication) (Kuno, 1983) and (iii) MOS-55 derived from An.
gambiae larvae (Marhoul and Pudney, 1972). All these cell lines were confirmed
as
negative for Wolbachia infection prior to this study by PCR as outlined below.
CA 02707880 2010-06-17
32
Aa23.T and RML-12 cell lines were maintained in growth medium consisting of
equal volumes of Mitsuhashi-Maramorosch (Mitsuhashi and Maramorosch, 1964) (1
mM CaCl2, 0.2 mM MgC12, 2.7 mM KCI, 120 mM NaC1, 1.4 mM NaHCO3, 1.3 mM
NaH2PO4, 22 mM D (+) glucose, 6.5 g/L lactalbumin hydrolysate, and 5.0 g/L
yeast
extract) and Schneider's Insect Medium (Sigma-Aldrich, St Louis, Mo)
supplemented
with 10% heat-inactivated fetal bovine serum (HIFBS). MOS-55 was maintained in
Schneider's Insect Medium supplemented with 20% HIFBS. Both media also
contained penicillin (50 U/mL) and streptomycin (50 lag/mL). For routine
maintenance, cells were grown in 25 cm2 plastic tissue culture flasks
containing 5 mL
of medium at 26 C without CO2 incubation. Cells were passed every 3-4 days by
vigorous shaking of the flask, and seeding a new flask with 20% of the
resuspended
cells with 5 mL fresh media.
Establishment of wMelPop infected cell lines
wMelPop was purified from D. melanogaster w1118 embryos (Min and Benzer, 1997)
and established in an uninfected Ae. albopictus cell line (Aa23.T) using the
shell vial
technique (Dobson etal., 2002). Embryos were collected every 45 min on
molasses
agar plates covered with live yeast paste and dechorionated using freshly
prepared
50%-diluted bleach (White King, Victoria, Australia) (2.1% sodium hypochlorite
final concentration) for 2 min. Embryos were then rinsed several times in
sterile
dH20, immersed in 70% ethanol for 15 sec, and rinsed three times in sterile
PBS, pH
7.4. Approximately 20 mg of surface sterilized embryos (¨ 50-100 1.., of
packed
embryos) were then transferred to a mini Dounce tissue homogenizer (Wheaton,
USA) and suspended in 400 vd, of PBS. Embryos were then homogenized for 2-3
min with a tight pestle. 200 pL of homogenate was then overlaid separately
onto two
80% confluent wells of Aa23.T cells prepared 24 hr earlier in a 12-well cell
culture
plate. The plate was then centrifuged at 2000 g for 1 hr at 15 C. Cells were
then
incubated at 26 C for 24 hr and the contents of each well transferred to
individual 25
cm2 cell culture flasks with 5 mL of fresh media. After a confluent monolayer
had
formed, cells were split 1:5 and passaged as usual.
CA 02707880 2010-06-17
33
To establish the infection in Ae. aegypti RML-12 and An. gambiae, MOS-55 cell
lines, wMelPop, was purified from Aa23 cells as described below and introduced
into
these cell lines using the shell vial technique.
Characterization of wMelPop in cell lines
Wolbachia infections were characterized in cell lines using (i) PCR screening
and
sequencing, and (ii) electron microscopy. For each assay naturally uninfected
or
tetracycline-cured derivatives of each cell line were used as negative
controls.
(i) PCR screening and sequencing
To monitor infection status of cells, DNA was extracted from cultures as
previously
described (Dobson et al., 2002) and amplified using the general Wolbachia
surface
protein (wsp) primers 81F and 691R, or the diagnostic wsp primer set for
wMelPop,
308F and 691R (Zhou et al., 1998). To confirm the presence of wMelPop in these
three cell lines, fragments of the Wolbachia 16S rRNA and wsp gene were PCR-
amplified, cloned and sequenced. DNA was extracted from cells using a DNeasy
Tissue kit (Qiagen) and amplified as previously described using the diagnostic
primers 99F and 994R for the Wolbachia 16S rRNA gene (O'Neill etal., 1992),
and
the primers 81F and 691R for the wsp gene (Zhou et al., 1998). Total DNA from
cell
lines was also PCR-amplified using the general eubacterial 16S rRNA primers
10F/1507R (Mateos et al., 2006) and 968F/R1401R (Nubel et al., 1996). The
resulting PCR products were cloned into the pGEM-T easy vector (Promega) and
four clones from each infected cell line randomly picked and sequenced for
each
product. The presence of wMelPop and no other contaminating bacteria in cell
lines
was verified by denaturing gradient gel electrophoresis (DGGE), using a
general
primer set targeting eubacterial 16S rRNA genes (F-968-GC and R-1401) (Nubel
et
al., 1996), using previously described methods (Pittman etal., 2008).
(h) Electron microscopy
Insect cells were washed in PBS and rapidly fixed with microwave processing in
2.5% glutaraldehyde solution containing 0.1% CaCl2 and 1% sucrose in 0.1 M Na
cacodylate, enrobed in 2% agarose, and postfixed in 1% osmium tetroxide in 0.1
M
Na cacodylate buffer. Samples were then dehydrated in a sequence of increasing
CA 02707880 2010-06-17
34
ethanol concentration and in a final step in acetone (100%), and then embedded
in
epoxy resin (Epon 812) using microwave processing (Feinberg et al., 2001;
O'Neill et
al., 1997). Ultra-thin sections (50-80nm) prepared on a Leica Ultracut T
ultramicrotome (Leica Inc.) were then placed on copper grids and stained with
2%
uranyl acetate followed by Reynolds lead citrate. The sections were then
examined in
a JEOL-1010 electron microscope operated at 80 kV.
Purification of Wolbachia from cell culture for embryonic microinjection
Insect cells from the confluent monolayers of two 175 cm2 flasks were
harvested and
centrifuged in 50 mL conical flasks at 1000 g for 5 min at 4 C and the cell
culture
media discarded. The cellular pellet was then washed in SPG buffer (218 mM
sucrose, 3.8 mM KH2PO4, 7.2 mM K2HPO4, and 4.9 mM L-glutamate, pH 7.2) and
the centrifugation and wash steps repeated. After washing, the pellet was
resuspended
in 5 mL SPG and sonicated twice on ice for 10 sec at 12.5 W with a Fisher
Scientific
model 60 Sonic Dismembranator (3 mm microtip diameter) to lyse the cells. This
suspension was then centrifuged at 1,000 g for 5 min at 4 C to pellet cellular
debris.
The supernatant was then passed through a 5 1.1M Acrodisc syringe filter (Pall
Life
Sciences) and the filtrate collected in 1.5 mL microcentrifuge tubes. These
were then
centrifuged at 12,000 g for 15 min at 4 C to pellet Wolbachia. The supernatant
was
then discarded, pellets were combined and resuspended in 400 pL SPG buffer and
centrifuged at 300 g for 5 min to remove any remaining debris (Xi and Dobson,
2005). The supernatant was then transferred into a clean tube and stored on
ice until
used for injection (< 3hr).
Embryonic microinjection
Purified Wolbachia from RML-12 was microinjected into embryos of the D.
melanogaster line will8.T (Min and Benzer, 1997). Prior to microinjection,
this line
was confirmed to be free of Wolbachia by PCR using primers specific for the
wMelPop IS5 repeat: 1S5-FWDI (5' -GTATCCAACAGATCTAAGC) and IS5-
REV 1 (5'- ATAACCCTACTCATAGCTAG). IS5 is a multi-copy insertion element,
and as such a much more sensitive target for determining infection status than
single
CA 02707880 2010-06-17
copy genes such as wsp. For microinjection, early (pre-blastoderm) stage
embryos
were collected every 30 min using molasses agar plates with live yeast paste.
Purified
Wolbachia was microinjected into the posterior pole of embryos within 30 min
of
collection using standard techniques (Ashburner, 1989; Boyle etal., 1993; Xi
and
5 Dobson, 2005). After hatching, larvae were transferred to a standard
cornmeal based
Drosophila rearing medium (Ashburner and Roote, 2000) and incubated at 24 C.
Drosophila rearing and PCR screening for infection status
Virgin females resulting from injected embryos (generation 0 [GO]) were placed
in
10 vials with three W1118.T males to establish isofemale lines. After egg
laying GO
females were sacrificed and DNA extracted using the Holmes-Bonner DNA
extraction protocol (Holmes and Bonner, 1973). Wolbachia was detected in
samples
using PCR primers specific for the IS5 repeat element in wMelPop. The quality
of the
insect DNA was assessed using the primer set 12SA1 and 12SB1 that amplifies
the
15 D. melanogaster 12S ribosomal RNA gene (O'Neill et al., 1992).
Amplification of
DNA was carried out in a 20 1.11, reaction volume which included: 2.0 1AL of
10x
buffer (New England Biolabs, Beverly, MA), 25 1.1,M of dNTPs, 0.5 ptM of
forward
and reverse primer, 0.75 U of Taq polymerase (New England Biolabs, Beverly,
MA),
and 1.0 L of DNA template. PCR conditions were as follows; denaturation at 94
C
20 for 3 min; 35 cycles of denaturation at 94 C for 30 sec, annealing at 55
C for 30 secs,
and extension at 72 C for I min; followed by a final 10 min extension step at
72 C.
To select for a stable infection, only offspring from females that tested
positive for
Wolbachia by PCR screening were used as parental stock. Each generation, 25-50
25 females from each line were isolated as virgins, placed into individual
vials and
outcrossed to three wm8.T males. Females that tested negative for Wolbachia
were
discarded along with their progeny. This selection regime was maintained for
three
generations after which the lines were closed. The two resulting lines,
wMelPopCLA-
1 and wMelPopCLA-2, were then monitored periodically by PCR to confirm
30 infection status. The selection regime was again repeated at G14 due to
fluctuations in
infection frequencies in both lines.
CA 02707880 2010-06-17
36
Lifespan assays
The lifespan of wMelPopCLA-1, wMelPopCLA-2 and wMelPop lines was compared
to tetracycline-cured derivatives of each line created by the addition of
tetracycline
into the adult diet (3 mg/mL) according to standard methods (Hoffmann et al.,
1986).
Treated flies were reared on tetracycline for two generations, and then
transferred to a
normal diet for a minimum of five generations before being used in
experiments. To
reduce genetic drift effects that may have occurred in these lines during
tetracycline
treatment, 100 females from each fly line (including infected lines) were
backcrossed
with 100 males from the same Wiii8.T stock line and the progeny combined to
form
the next generation. This was repeated for five generations (G23-G28).
Longevity
assays were then conducted at G31, G33 and G35. To control for any crowding
effects
or size variability, the larval density of each stock bottle used to obtain
flies was
standardized (200 larvae/bottle) prior to longevity assays. Stock bottles were
kept at
24 C until adult eclosion 9-10 days later, when flies were sexed as virgins
and
separated. In each assay, six vials of 20 flies for each sex were maintained
at 29 C in
standard cornmeal food vials without additional live yeast. Each day the
number of
new deaths were recorded. Flies were moved to fresh food vials every five
days.
Survival curves for the various treatment groups were compared using a mixed
effects Cox Proportional Hazard (coxme) model of survival analysis using the
kinship package of the R suite of statistical software (www.r-project.org).
Cytoplasmic incompatibility (CI) tests
CI tests were conducted at G36 and G38 post-transinfection using the
previously
backcrossed lines. To standardize rearing conditions for CI tests, fly stock
bottles
were grown under low-density conditions (n= 150-200) at 24 C with a 12 hr
light/dark cycle. To obtain offspring for CI crosses, stock bottles were
seeded with a
set density of 200 eggs per 40 mL of diet. After eclosion, flies were sexed
and
separated as virgins and aged until CI tests. Male flies were collected on day
2 of
emergence and were used within 24 hr of eclosion (Reynolds et al., 2003;
Yamada et
al., 2007). The female flies used were 5-7 days old. For each cross, single
mating
CA 02707880 2010-06-17
37
pairs (n= 40) were introduced to plastic bottles with molasses plate lids.
Pairs were
given 24 hr to mate, then the males were removed and the females allowed to
lay
eggs. Eggs were collected every 24 hr on molasses agar plates dotted with live
yeast
suspension for three days. Females that laid < 50 eggs total across the three
plates
were discarded from the experiment. The plates were then placed at 24 C for a
further 36-48 hr, and then the number of total and unhatched eggs were
counted.
Statistical significance of hatch rates for various crosses was determined
using a
Mann-Whitney U-Test. A Bonferroni correction was used to compensate for
multiple
comparisons.
Quantitative PCR and density determination
To examine if the density of Wolbachia in D. melanogaster had changed after
long-
term serial passage in mosquito cell lines, infection densities were monitored
in head
tissues of will8 flies carrying the wMelPopCLA-1 , wMe1PopCLA-2 or wMelPop
strain over their lifespan using quantitative PCR (qPCR). Heads were selected
for
qPCR as wMelPop infection densities had previously been shown to rapidly
increase
in nervous tissue with adult age (McGraw et al., 2002; Min and Benzer, 1997).
Density of the closely-related non-virulent Wolbachia strain wMel was also
examined
after introgression for three generations from yw67c23 into the w'118 genetic
background. qPCR assays were conducted at G46 post-transinfection. Flies
reared as
described for lifespan assays were collected at four-day intervals (from 4-32
days)
until all the flies in a line were dead, and stored at -80 C before analysis.
Total DNA
was extracted from dissected head tissues using the DNeasy tissue kit protocol
(Qiagen). To estimate the relative abundance of Wolbachia in each sample, we
compared abundance of the single-copy Wolbachia ankyrin repeat gene WD0550 to
the single-copy D. melanogaster gene Act88F. The following primers were used
to
amplify a 74 bp ampl icon from WD0550 (For 5'-
CAGGAGTTGCTGTGGGTATATTAGC and Rev 5'-
TGCAGGTAATGCAGTAGCGTAAA); and a 78 bp amplicon from Act88F (For 5'-
ATCGAGCACGGCATCATCAC and Rev 5'-CACGCGCAGCTCGTTGTA). 12
biological replicates were examined per time point for each treatment. For
each
CA 02707880 2010-06-17
38
sample, qPCR amplification of DNA was performed in triplicate using a Rotor-
Gene
6000 (Corbett Research, Australia). Amplification was carried out in a 10 jAL
reaction volume which included: 5 1.1L Platinum SYBR Green I Supermix
(Invitrogen, CA), 1 [tM of forward and reverse primer and 1 ng DNA template.
The
PCR conditions were 50 C for 2 min; 95 C for 2min; 40 cycles of 95 C for 5
sec,
60 C for 5 sec and 72 C for 10 sec; followed by a melt curve from 67 C to 95
C. A
standard calibrator was used to normalise between qPCR runs; and the
specificity of
PCR products was determined by melt-curve analysis. Crossing threshold (CI)
and
amplification efficiency values for each sample were calculated using Corbett
Rotor-
Gene (Version 1.7.75) software. The relative abundance of Wolbachia in each
sample
was then determined using the method discussed by Pfaffl (Pfaffl, 2001).
Regression
analysis was used to detect trends in density of Wolbachia over the lifetime
of
individual fly lines. ANCOVA was then employed to examine the relationship
between density and the covariates age and strain. All abundance data were log
transformed prior to analysis. A Bonferroni correction was used to compensate
for
multiple comparisons.
Results
Several initial attempts to establish wMelPop in the Ae. albopictus embryonic
cell
line Aa23 were unsuccessful. Typically infection was lost after several
passages, or
lines were discontinued due to a complete loss of confluence or growth of
mosquito
cells. This situation mirrors that observed when wMelPop purified from
Drosophila
is injected into mosquitoes, with large fluctuations in infection density
eventually
leading to loss of infection (EAM and SLO unpublished data). In total, only 2
out of
68 (3%) independent attempts to establish the wMelPop infection in Aa23 cells
were
successful.
Once established in Aa23, wMelPop was serially passaged for 237 passages 2.5
years) before being transferred to the Ae. aegypti cell line RML-12 and the
An.
garnbiae cell line MOS-55. Stable establishment of wMelPop in these two cell
lines
occurred much more easily than the initial infection of Aa23, with 2 out of 2
CA 02707880 2010-06-17
39
independent attempts for each cell line forming stable wMelPop infections.
Partial
sequences of the Wolbachia 16S rRNA and wsp genes from the three cell lines
used
were all identical to the sequence from wMelPop, confirming that infections
were not
the result of contamination with other strains. Infection in mosquito cells
was also
confirmed using transmission electron microscopy (TEM). TEM micrographs of the
three infected mosquito cell lines show that representative cells from each
line were
heavily infected by wMelPop (Figure 1). wMelPop was purified from the Ae.
aegypti
RML-12 cell line, and re-introduced back into its native host, D. melanogaster
that had been previously cured of its natural wMelPop infection by
tetracycline
treatment. At the time of re-introduction, wMelPop had been maintained for
over 3
years outside its native host: 237 passages in Aa23 and 60 passages in RML-12
cell
lines. In total, 446 embryos were microinjected giving rise to 108 Go larvae
(24%
hatch). All 10 surviving Go females were PCR positive for Wolbachia. Of these,
8
produced offspring, and 2 produced PCR positive G1 isofemale lines. These two
independent isofemale lines were named "wMelPopCLA -1" and "wMelPopCLA -2"
(wMelPop Cell Line Adapted).
The infection frequency in wMelPopCLA lines was then monitored periodically
over
time (Figure 2). Both wMelPopCLA lines were initially observed to display
variable
maternal transmission rates in the original Drosophila host, reflected in
fluctuating
infection frequencies in the absence of experimental selection. During an
initial
period of experimental selection for increased infection (G1-G3post-
transinfection),
frequencies as detected by PCR were observed to increase in both wMelPopCLA-1
(58% to 87%) and wMelPopCLA -2 (55% to 100%). In the absence of experimental
selection from G4 onwards, infection frequencies in both lines initially were
stable or
fluctuated, but then rapidly decreased such that by G14 post-transinfection
only 32%
of wMelPopCLA-1 and 24% of wMe1PopCLA-2 individuals remained infected.
Selection was repeated again at G14 and after one additional generation
infection
frequencies in both lines moved to 100% and remained fixed for infection to
G46
when last assayed.
CA 02707880 2010-06-17
To assess the effect of continuous cell line culture on the ability of this
Wolbachia
strain to colonize Drosophila, we compared infection densities in flies that
contained
wMelPopCLA with those carrying the original wMelPop infection by qPCR. Since
it
is known that wMelPop densities increase rapidly in adult flies when held at
29 C,
5 we assessed Wolbachia densities across the adult lifespan. As populations
of flies
aged, Wolbachia densities in head tissue rapidly increased in wMelPop infected
flies
(Figure 3). The density of Wolbachia also increased in wMelPopCLA-1 and
wMelPopCLA-2 infected flies as they aged, although these increases were
noticeably
less than wMelPop. Wolbachia densities were roughly four fold higher in
wMelPop-
10 infected flies when compared to wMelPopCLA-1 or wMe1PopCLA-2 infected
flies at
day 12 post-emergence. Flies infected with the non life-shortening wMel strain
had
the lowest infection which only increased slightly over the lifespan of flies.
Overall,
there was a significant effect of age and strain on Wolbachia density (F1,275=
41.92,
P <0.001 for age; F3, 275 = 678.37, P < 0.001 for strain) for all lines. This
was
15 reflected by significant differences in the effects of strain and age
after pair-wise
comparisons between lines (P <0.001 for all comparisons), except for
wMe1PopCLA-
1 and wMelPopCLA-2 lines where strain effects were not significantly different
from
one another (F1,144 = 0.09, P >0.05).
20 To test whether the ability of wMelPop to induce the life-shortening
phenotype had
changed during long-term serial passage, we conducted a series of longevity
assays at
G31, G33 and G35 post-transinfection. For these experiments, the survival of
infected
flies from wMelPopCLA-1, wMelPopCLA-2 and wMelPop lines was compared with
uninfected tetracycline-treated lines of each strain at 29 C. Survival curves
for males
25 and females of each treatment group were measured independently. In all
assays,
male and female flies from the wMelPop-infected line demonstrated the most
pronounced lifespan reduction when compared to flies from the wMelPopCLA lines
and tetracycline-treated controls (Figure 4). The lifespan of wMelPopCLA-1 and
wMelPopCLA-2 lines appeared intermediate relative to wMelPop, but were
30 shortened relative to tetracycline treated controls. For example, at G31
post-
transinfection the mean time to death ( SE) for wMelPop females (9.8 + 0.1
days)
CA 02707880 2010-06-17
41
was noticeably shorter than that of wMe1PopCLA-1 females (22.2 0.3 days), or
wMe1PopCLA-2 females (23.4 + 0.3 days). Mean time to death was increased for
tetracycline-treated control lines, with wMelPop.T females (32.1 0.5 days),
wMelPopCLA-1.T females (34.6 0.5 days), and wMe1PopCLA-2.T females (33.4
0.6 days) all having extended lifespan relative to infected counterparts. For
females,
the proportional hazard of death associated with carrying infection was
significantly
greater for individuals with wMelPop (relative risk ratio, 135.7; 95%
confidence
interval, 40.3 - 456.5), compared to those either carrying wMelPopCLA-1
(relative
risk ratio, 30.0; 95% CI, 15.4 ¨ 58.5) or wMe1PopCLA-2 (relative risk ratio,
17.7;
95% CI, 10.5 ¨ 30.7) (P <0.001 for all comparisons to wMelPop). The same
trends
were also observed for males. These results were consistent with those
obtained from
measurements at G33 and G35 post-transinfection (data not shown).
In order to examine effects of long-term cell culture on CI expression we
established
test crosses between uninfected and infected flies and examined hatch rates of
the
resulting eggs. Results from incompatible test crosses indicated that
wMelPop.T
females mated with wMelPop males produced embryos with a mean hatch rate of
24%, which was significantly lower than the same cross with wMe1P0pCLA-1 males
or wMe1PopCLA-2 males (Mann Whitney, P < 0.001) (Figure 5). A statistically
significant difference in mean hatch rate for crosses with wMelPopCLA-1 males
relative to those with wMelPopCLA-2 males (P < 0.001) was also observed. In
rescue tests, mean hatch rates of embryos produced from crosses between
wMelPop
males and wMelPop females; wMe1PopCLA-1 females; or wMe1PopCLA-2 females
were not significantly different from one another. As such, lines infected
with
wMelPopCLA have a reduced ability to induce CI when compared to wMelPop. In
contrast, the ability to rescue an incompatible cross appears unchanged in the
cell-
adapted lines.
EXAMPLE 2
STABLE INTRODUCTIION OF A LIFE-SHORTENING WOLBACHIA
INFECTION INTO MOSQUITO AEDES AEGYPTI
CA 02707880 2010-06-17
42
Materials and Methods
Mosquito Strains and Maintenance
The naturally uninfected JCU strain of Aedes aegypti was established from A.
aegypti
eggs that were field-collected from Cairns (Queensland, Australia) in 2005.
For
routine maintenance, eggs were hatched under vacuum for 30 min, and larvae
reared
at a set density of ¨150 larvae in 3 L of distilled water in plastic trays (30
x 40 x 8
cm). Larvae were fed with 150 mg CA tablet) fish food per pan per day
(Tetramin
Tropical Tablets, Tetra, Germany) until pupation. Adult mosquitoes were
maintained
in screened 30 x 30 x 30 cm cages enclosed within transparent plastic bags,
with
damp cotton wool to maintain elevated humidity (25 1 C, ¨ 80% relative
humidity
(RH), 12:12 h light:dark). Adults were provided with constant access to 10%
sucrose
solution, and females (5 day old) supplied with a human blood source for egg
production. PGYP1 and PGYP2 lines were maintained continuously without
prolonged desiccation of eggs.
Embryonic Microinjection
Methods used for embryo injections were based upon those successfully used for
the
transfer of Wolbachia to both Drosophila and A. aegypti (Example 1; Xi et al.,
2005). To collect eggs for microinjection, approximately ten gravid JCU
females (--5
days post-blood meal) were placed in a Drosophila vial with a wet filter paper
funnel,
and the vial moved to a dark place to promote oviposition. Embryos were
collected
after allowing females to oviposit for < 90 min. Pre-blastoderm stage embryos
(grey
in colour) (Lobo et al., 2006) were aligned on double-sided tape (Scotch 665,
St.
Paul, MN), briefly desiccated, and covered with water-saturated halocarbon 700
oil
(Sigma-Aldrich) (Xi et al., 2005). Embryos were then microinjected in the
posterior
pole with wMelPop, purified as previously described from the Aedes cell line
RML-
12 (see Example I), using an IM-200 micro-injector (Narishige, Tokyo, Japan).
Microinjection needles were prepared from borosilicate microcapillaries (#30-
0038,
Harvard Apparatus, Kent, UK) using a PC-10 micropipette puller (Narishige,
Tokyo,
Japan). After injection, embryos were incubated at 80% RH and 25 C for
approximately 40 min, after which time excess oil was removed and embryos
CA 02707880 2010-06-17
43
transferred to wet filter paper. Embryos were then allowed to develop for 4-5
days,
before being hatched and reared to adulthood using the standard maintenance
procedures outlined above.
Isofemale Line Rearing and Selection for Stable Infection
Females (Go) resulting from microinjected embryos were isolated as pupae to
assure
virginity, and subsequently mated with JCU males. Following blood feeding and
oviposition, Go females were sacrificed and DNA extracted using the DNeasy
protocol (Qiagen). Wolbachia was detected in samples using PCR primers
specific
for the IS5 repeat element in wMelPop (see Example 1). Go females that tested
negative for Wolbachia were discarded along with their progeny. Offspring from
females that tested positive for Wolbachia by PCR screening were used as
parental
stock to select for stable infections. PGYP1 females were outcrossed with JCU
males
for three generations (Go - G2), after which time this line was closed and
infected
females and males allowed to interbreed. Typically 50 JCU males and 50 virgin
PGYP1 females were used in an outcross. Experimental selection to increase
infection frequencies was applied to this line from G0-G3 (Figure 8A). In the
PGYP2
line, females were outcrossed with JCU males for five generations (Go - G4),
after
which time the line was closed. Experimental selection to increase infection
frequency was applied to the PGYP2 line from G0-G2, and subsequently for one
generation at G8 (Figure 8B).
Tetracycline-Treatment of Mosquito Lines
PGYP1 and PGYP2 lines were cleared of wMelPop infection at G8 and G11
respectively, by introducing a 1 mg/ml tetracycline solution (final
concentration) -
dissolved in 10% sucrose - into adult cages (Dobson and Rattanadechakul,
2001).
Lines were treated with tetracycline for two generations (with a 14 day course
of
tetracycline) and then allowed to recover for at least two generations before
being
used in experiments. Tetracycline-treated lines were confirmed to be cured of
wMelPop by PCR as described above. The tetracycline-cleared mosquito strains,
designated PGYP1.tet and PGYP2.tet, were also re-colonized with resident gut
CA 02707880 2010-06-17
44
microflora by adding 100 ml water used to rear untreated JCU larvae to the
larval
water of treated lines for two generations after tetracycline treatment had
ceased.
Lifespan Assays
Three different experimental designs were used for lifespan assays: First, the
lifespan
of G6 PGYP1 mosquitoes was compared with those from the naturally uninfected
JCU strain at two different temperatures. For these assays, larvae were
hatched and
reared at 25 C or 30 C using the standard method described above. After
emergence,
adult mosquitoes were maintained in 2.2 L plastic buckets at their treatment
temperature; with 80% RH and a 12:12 h light:dark cycle in a controlled growth
chamber (Model 620R1-IS, Contherm Scientific, New Zealand). For each strain at
each temperature, six buckets of 50 mosquitoes (25 of each sex) were
maintained and
checked daily. Cotton balls soaked in 2% sucrose solution as a carbohydrate
source
were placed inside each cage and changed daily. Second, the lifespan of G9
PGYP1
and JCU mosquitoes was compared under fluctuating abiotic conditions designed
to
simulate a summer day in Cairns, North Queensland, Australia. Mosquitoes were
exposed to a diurnal cycle of 12 h light, 32 C, and 50% RH; and a nocturnal
cycle
12 h dark, 25 C and 80% RH in a controlled growth chamber as above. For this
experiment a cohort of 300 adult mosquitoes (150 of each sex) from each strain
were
maintained in 30 x 30 x 30 cm cages. A sugar cube suspended 10 cm below the
top
of each cage was provided to necessitate flight to obtain a carbohydrate
source. A
human blood meal was provided to females in each cage daily for 15 min, in
addition
to a water-filled cup lined with filter paper as an oviposition substrate.
Third, larger
lifespan assays were conducted to compare survivorship of PGYP I , PGYP2, JCU
and tetracycline-cleared strains. These assays were conducted at G13 and G15
for
PGYP1 and PGYP2 lines respectively. For each strain, three replicate 30 x 30 x
30
cm cages of 200 mosquitoes (100 of each sex) were maintained at 25 + 1 C, 70-
90%
RH, 12:12 h light:dark in a temperature-controlled insectary, with 2% sucrose
changed daily. For all three classes of experiments, the number of new deaths
was
recorded each day until all mosquitoes in the cages were dead. Mosquito
survival was
analysed using Kaplan-Meier Survival analysis, and log rank tests were used to
CA 02707880 2010-06-17
determine the equality of the survival distributions between treatments.
Cytoplasmic Incompatibility (CI) Tests
Mass crosses were conducted between 35 virgin individuals (3 d old) of each
sex
5 from G9 PGYP1 and JCU strains; G13 PGYP1 and PGYP1.tet; and G16 PGYP2 and
PGYP2.tet strains to assess CI levels. Groups were allowed to mate for 2 days
before
females were blood-fed and isolated individually for oviposition. Eggs were
hatched
120 hours after oviposition by submersion in nutrient-infused deoxygenated
water
(75 mg Tetramin/ L) for 48 hr. To hatch any remaining eggs, egg papers were
dried
10 briefly and then resubmerged for a further 5 days before the final
numbers of hatched
larvae were recorded. All females used in crosses were checked for
insemination by
dissection of spermathecae followed by direct observation of sperm by light
microscopy. CI expression was determined by comparing the percentage of
hatched
eggs from each of the crosses. Statistical significance of hatch rates for
various
15 crosses was determined using a Mann-Whitney U-Test. A Bonferroni
correction was
used to compensate for multiple comparisons. To examine the role of male age
on CI,
virgin G17 PGYP 1 and PGYP1.tet males were aged to 3, 10 and 17 d old prior to
mating with 3 d old PGYP1.tet virgin females.
20 Maternal Transmission
The proportion of Wolbachia-infected progeny derived from the first and third
reproductive cycles of G17 PGYP1 females was assessed to provide an estimate
of
maternal transmission over lifespan. Cohorts of virgin PGYP1 females and
uninfected wild-type JCU males were mass-mated. Five days after mating,
females
25 were blood-fed. and 72-96 hour post-blood meal, eggs were collected for
three days.
PGYP1 females were 9 days old at the time of oviposition for the first cycle,
and 23
days old for the third cycle. After development, eggs were hatched and DNA
extracted from larval offspring using the DNeasy protocol (Qiagen). In total,
515
larvae collected from 31 females (-17 larvae per female); and 527 larvae
collected
30 from five cohorts of 20 females (-105 larvae per cohort), were screened
from the first
and third reproductive cycles respectively. To establish the presence or
absence of
CA 02707880 2010-06-17
46
Wolbachia, PCR analysis was performed on individual larvae using IS5 repeat
primers as previously described (see Example 1). To ensure that Wolbachia
negative
results were not a result of low quality DNA template, samples were also
tested with
primers specific for the single-copy A. aegypti gene, Ribosomal protein Si 7
(RpS1 7)
(Cook et al., 2006): Forward 5'-CACTCCCAGGTCCGTGGTAT, Reverse 5' -
GGACACTTCCGGCACGTAGT. If samples that were initially negative for
Wolbachia tested positive for host DNA, they were screened once again with ISS
primers on a range of DNA template concentrations before infection status was
finally assigned.
Results
To facilitate the transfer of the life-shortening Wolbachia strain wMelPop
that infects
D. melanogaster (Min and Benzer, 1997) into the mosquito A. aegypti, we
adapted
the bacteria by continuous serial passage in mosquito cell culture thr three
yea' J. A
consequence of this culturing was a reduction in growth rates and associated
virulence when transferred back into Drosophila (see txample 1). We purified
the
mosquito cell-line adapted isolate of wMelPop and microinjected it into
naturally
uninfected A. aegypti embryos (JCU strain). Surviving adult females were
isolated,
blood-fed, and after egg laying were assayed for Wolbachia infection using
diagnostic PCR (see Example 1; Materials and Methods). Eight independent
isofemale lines carrying the wMelPop infection were generated. Six of these
lines
were lost from G1-G3 (See Materials and Methods), and the remaining two lines
formed stable associations. These two lines, `PGYP1' and `PGYP2' were chosen
for
further characterization, and after a period of experimental selection have
remained
persistently infected by wMelPop (100% infection frequency) until G33 and G30
respectively, when last assayed (Figure 8).
In Drosophila species, wMelPop shortens the lifespan of adult flies by up to
50%
(Min and Benzer, 1997; McGraw et al., 2002). We performed several lifespan
assays
in A. aegypti for a range of experimental conditions. As wMelPop-induced early
death in Drosophila is temperature sensitive (Min and Benzer, 1997); Reynolds
et
CA 02707880 2010-06-17
47
al., 2003), we compared the lifespan of the newly generated wMelPop-infected
PGYP1 line to the naturally uninfected JCU strain at 25 C and 30 C (Figures
6A
and 6B).
In contrast to Drosophila, where the life-shortening phenotype is weakly
expressed at
25 C and strongly at 30 C, rapid mortality of PGYP1 mosquitoes (G6) relative
to the
uninfected parental JCU strain was observed at both temperatures. Under lab
conditions at 25 C and 80% RH (Figure 6A), the median adult longevity for PGYP
I
females of 27.0 days was significantly different from the JCU control of 61.0
days
(log-rank statistic 11.67, P = < 0.0001). A similar trend was observed for
males
(Figure 6A). At a higher temperature of 30 C and 80% RH (Figure 6B), the
differential effect on median adult longevity was still apparent although the
lifespan
of all the mosquitoes was reduced: females PGYP1, 25.0 days; JCU, 43.0 days
(log-
rank statistic 11.50, P = <0.0001).
To examine the effect of the wMelPop infection under more biologically
realistic
conditions, we exposed a cohort of PGYP1 (G9) and JCU strains to a fluctuating
temperature and humidity regime, and provided female mosquitoes with daily
access
to a human blood meal (Figure 9). Under these conditions, the lifespan of
PGYP1
females was reduced by more than half relative to JCU females. Median
longevity
was significantly different between treatments: PGYP1, 21.0 days; JCU, 50.0
days
(log rank statistic, 10.13, P = <0.0001). A smaller difference in median
survival
times was observed for males from both strains (PGYP1, 9.0 days; JCU, 10.0
days),
although overall PGYP1 males still died at a significantly faster rate than
JCU males
(log-rank statistic = 3.34, P = 0.0009).
To exclude the possibility that observed reductions in lifespan resulted from
genetic
drift during the establishment of the PGYP1 strain, we generated an uninfected
strain
from PGYP1 (PGYP I .tet) by addition of the antibiotic tetracycline to the
adult diet
(Dobson and Rattanadechakul, 2001). After antibiotic curing of the wMelPop
infection (Materials and Methods), no significant differences in the rate of
mortality
CA 02707880 2010-06-17
48
were observed between females or males of uninfected PGYP1.tet and JCU strains
(e.g. females, log-rank statistic = 1.23, P= 0.2191). Both females and males
from the
PGYP1 (G13) strain had significantly reduced lifespan when compared to those
from
the PGYP1.tet strain (e.g. females, log-rank statistic = 13.70, P = < 0.0001),
indicative of wMelPop-induced life-shortening (Figure 6C). These results were
confirmed using identical assays with the PGYP2 (G15) strain as a biological
replicate
(Figure 10).
To test for CI we made crosses between the PGYP I and wild-type JCU and
PGYP1.tet strains and measured egg hatch rates. Consistent with the induction
of
strong CI in A. aegypti (Xi et al., 2005), no eggs hatched from more than 2500
embryos obtained from crosses between male PGYP1 (G,) and uninfected JCU
females (Figure 7A). Similarly, only 2 eggs hatched from more than 1900
embryos
obtained from crosses between male PGYP1 (G13) and the tetracycline-cleared
PGYP1.tet females (Figure 7B). In both assays, PGYP1 females were capable of
rescuing CI, as indicated by the high egg hatch seen in PGYP1 x PGYP1 crosses.
In its natural D. melanogaster host wMelPop infection induces CI that quickly
diminishes with male age (Reynolds et al., 2003). This effect could slow the
invasion
of the strain into natural populations. Crosses between uninfected A. aegypti
females
and wMelPop-infected males up to 17 days old resulted in a complete absence of
egg
hatch from more than 9500 embryos (Table 1), indicating wMelPop infection
induced
CI that is insensitive to male age.
Overall, no significant differences in fecundity between PGYP1, PGYP1.tet or
JCU
strains were observed at G13 post-transinfection (Figure 11). An evaluation of
CI and
reproductive fitness in PGYP2 at G16 revealed that the wMelPop infection
induced
very strong CI, but unlike PGYP1 had a 19% fecundity cost when compared to its
tetracycline-cleared counterpart (Figure 12). In D. simulans, fecundity costs
associated with the wMelPop infection were initially high after
transinfection, but
subsequently attenuated, while the life-shortening effect remained stable
(McGraw et
CA 02707880 2010-06-17
49
al., 2002). Further studies are required to determine if this will be the case
for
PGYP2, and whether observed differences in reproductive fitness between PGYP1
and PGYP2 are related to Wolbachia or host genotypes.
High maternal inheritance of Wolbachia from infected females to their progeny
is a
key parameter for successful population invasion. The maternal transmission
rate
predicts stable prevalence of the infection once it has invaded a population
under the
action of CI (Hoffmann and Turelli, 1997). To estimate maternal transmission
rates
of wMelPop over the lifespan ofA. aegypti, we used the polymerase chain
reaction to
determine the proportion of Wolbachia-infected progeny derived from the first
and
third reproductive cycles of PGYP1 females (G17) mated with uninfected wild-
type
JCU males. Of the 515 larvae screened from 31 females (¨ 17 larvae sampled per
female) from the first reproductive cycle (females aged 9 days old), 99.74
0.26%
were infected. This estimate of maternal inheritance was not significantly
different
from that obtained from the third reproductive cycle (females aged 23 days
old) in
which 527 larvae were screened from five cohorts of 20 females (¨ 105 larvae
sampled per cohort) and were 99.45 0.37% infected (Mann Whitney, P = 0.208).
EXAMPLE 3
INCREASED LOCOMOTOR ACTIVITY AND METABOLISM OF
AEDES AEGYPTI INFECTED WITH A LIFE-SHORTENING STRAIN OF
WOLBACHIA PIPIENTIS
Materials and Methods
Experimental organisms
The wMelPop-infected Aedes aegypti line (PGYP1) used in this study was
generated
as previously described (see Example 2). In brief, the Wolbachia strain,
wMelPop,
native to Drosophila melanogaster (Min and Benzer, 1997) was transferred into
Ae.
aegypti by embryonic microinjection. Descendants of this isofemale line were
outcrossed for several generations to the original recipient line of
mosquitoes and
selected for stable infection before closing the colony. At generations 8 & 9
post-
transinfection, an aposymbiotic control line was created by antibiotic
treatment of the
CA 02707880 2010-06-17
Wolbachia infected line (see Example 2). All experiments reported here were
carried
out on mosquitoes at generations 14-16 post trans-infection (i.e. 4-6
generations post
treatment), with replicates representing different generations. Mosquitoes
were reared
under standard conditions (25 C, 12:12 LD, 80% RH) (Gerberg et aL, 1994).
Larvae
5 were reared in plastic trays at a density of 150 per three litres of
water and supplied
with a daily dose of 0.15 g TetraMin aquarium fish food (Tetra, Germany).
Adults
were separated by sex and maintained as virgins in cages (30 x 30 x 30 cm) of-
150
individuals. Adults were supplied with a basic diet of 10% sucrose solution
administered through cotton pledgets. The adult ages of 3, 15, and 25 days of
age
10 were selected to represent the periods when 100%, ¨90%, and ¨20% of the
wMelPop
infected population was still surviving, respectively (see Example 2).
Videorecording of mosquito locomotion
Our locomotor assay was based on several previously published models (Allemand
et
15 al., 1994; Bonatz et al., 1987; Grobbelaar et al., 1967; Kawada and
Takagi, 2004;
Liseichikov and Zakharevskii, 1978; Mankin, 1994; Reynolds and Riley, 2002;
Rowley et al., 1987; Sbalzarini and Koumoutsakos, 2005), but was most heavily
influenced by Williams and Kokkinn (Williams and Kokkinn, 2005). Mosquitoes
were placed in an observation chamber during experiments and their motion
captured
20 via a video camera. The observation chamber was constructed using white
(sides and
back) and transparent Perspex (front pane) and contained distinct cells that
allowed
for the simultaneous observation of 10 individual mosquitoes, one per cell.
Mosquitoes were provided with 10% sucrose solution ad libitum during
observation
periods dispensed through dental cotton wicks (1 x 0 0.5 cm). The wicks placed
in
25 each observation cell also provided constant humidity (80-85% RH).
Mosquitoes
were transferred from rearing cages to observation chambers 20 min prior to
recording of activity to allow them to adapt to the new environment. Recording
began daily at 14:30 pm, was paused during the hours of darkness (21:00 ¨
07:00)
and was completed at 12:30 the following day to allow time to transfer in the
next set
30 of mosquitoes. After each observation period mosquitoes were aspirated
out of the
chamber and sacrificed. The chambers were cleaned with ethanol (80%) and food
CA 02707880 2010-06-17
51
supply replaced prior to subsequent observation periods. No mosquito mortality
was
observed during the observations. A total of three replicates each of 10
mosquitoes
were studied per sex x strain x age per study chamber.
A two-color camera (DR2-13S2m/C-CS, Point Grey Research, Vancouver, BC,
Canada) was fitted with a CCTV lens (12VM412ASIR, Tamron, Commack, NY,
USA) and fixed on a mounting bracket 110 cm from the chamber. The distance of
the
camera to the object, the zoom, and the focus and iris aperture were optimized
to
reduce barreling and distortion of images. A flat light source emitting light
intensity
was placed 10 cm behind the chamber, which provided sufficient lighting for
the
camera sensor to capture high quality images but did not increase ambient
temperatures. The light source power switch was synchronized with the room
lights
using a timer. The entire experimental setup was enclosed in cardboard to
minimise
intrusion of additional stimuli.
The file format used for recording, Audio Video Interleave (AVI), is limited
to a
maximum size of 2 GB, which amounted to approximately 8 min of video footage.
To obtain a continuous video recording, we developed a program called
Mossiecap
that recorded multiple sequential 1.5 GB AVI files. This file size captured
six
minutes of video (i.e. 10 files = 60 min) at 12 frames s. Each day's footage (-
420
GB) was recorded onto an external hard drive connected to a desktop computer.
The
contents of each hard drive were then transferred to the hierarchical storage
management (HSM) system at The University of Queensland. Video files stored on
the HSM were then evenly distributed to local disks on 20 workstations located
in the
Visualization and Advanced Computing (ViSAC) laboratories at The University of
Queensland. Mossiefly, a custom program developed in Matlab (The Math Works,
Inc, Natick, MA) was used to process videos for motion detection and tracking.
This
program detected and tracked movement (walking and flying separately) of
individual mosquitoes and digitised the coordinates and time for each
movement.
The files containing data from movement detection were then analysed using
Mossiestat, a program developed in Matlab that summarised the movement data
CA 02707880 2010-06-17
52
captured with Mossiefly into numerical values used for statistical analysis. A
total
measure of activity (summation of time spent flying and walking) reported per
hour
was used for all subsequent statistical analysis as it was more informative
than
examining the variables independently.
Metabolic rate
Closed-system respirometry was used to measure CO2 production (J co2) in the
mosquitoes. CO2 production has been shown extensively to be an accurate
measure
of the metabolism for small and highly aerobic organisms such as insects
(Lighton,
1991; Lighton and Duncan, 2002; Van Voorhies et al., 2004). Our experiment was
designed to determine whether metabolic rate was significantly different
between
wMelPop-infected and -uninfected mosquitoes in each of two, day time intervals
lasting 4 hours. Fifteen individual mosquitoes were measured for each sex x
strain x
age x interval combination. These measurements were replicated 3 times.
Mosquitoes were discarded after the recording interval and replaced with fresh
mosquitoes from the same rearing cage.
An ADInstruments gas analyzer (ML205) and a PowerLab (85P) analog-to-digital
converter connected to a computer running data acquisition software
(ADInstruments, Chart 5) were used to measure CO2 production from mosquitoes.
Before each experiment, the gas analyser was calibrated with gas of a known
CO2
content. Individual mosquitoes were loaded into 25 ml syringes, mounted with a
three-way valve stopcock. Before closing the three-way valve the syringe was
carefully flushed with room air to remove possible CO2 traces. Immediately
after
closing the 15 syringes, a separate syringe was filled with air and kept as a
control
sample for initial room air CO2 concentration. After the 4 h interval, the
syringes
were injected into the gas analyser at 2 ml s until 5 ml of air remained. The
gas
concentrations for each mosquito were used to calculate mosquito metabolic
rate.
The dry mass of each mosquito was obtained after freezing them for 48 h at -20
C
and desiccating the tissue in a dry vacuum pump. Dry mass was measured with an
electronic balance (Sartorius BP2I1 D) to the closest 0.01 of a milligram.
Mosquitoes
CA 02707880 2010-06-17
53
were not weighed before metabolic rate experiments because immobilisation
methods (i.e. CO2 asphyxiation) may alter metabolic rates.
The following formulas based on (Bartholomew et al., 1985) were used for
calculations of metabolic rates:
1XCO2 (ml CO2 h -1) = Va * V b * t -1
where Va was the increase in volume of carbon dioxide in the samples
(calculated
from the difference between final and initial CO2 fractional concentrations),
V b was
the effective volume in the syringe (25 ml minus the mosquito volume,
estimated as
1.01 * body mass), and t was the elapsed time in hours. Due to variation in
mass
between male and female, mosquitoes metabolic rate was allometrically scaled
using
the following formula based on (Fuery et al., 1998):
Scaled MR (ml CO2 h -1) = (( M) A 75)* 1NCO2
where M is the mean mass of male and female mosquitoes used for each of the
metabolic experiments, and M is the mass of individual mosquitoes. This
formula
assumes that CO2 production is proportional to the mass (075) (West et al.,
2002).
Statistical analysis
Transformations (square root) of the activity measures and the scaled
metabolic rate
were necessary to generate normal distributions. General linear models were
then
constructed in Statistica Release 8 (StatSoft) for each of the sexes
separately to
explore the effects of age, infection status, time of day and replicate on
each of the
activity and metabolic rate datasets separately. T-tests were then employed to
specifically test for differences in metabolic rates between infected and
uninfected
mosquitoes at each of the three ages.
Results
CA 02707880 2010-06-17
54
Mosquito activity
On average, Wolbachia infected individuals were more active during the day
than
their uninfected counterparts at each of the three adult ages examined (Figure
13).
Increases in activity were significant for both females (d.f. = 1, F = 54.8, P
<0.0001)
and males (d.f. = 1, F = 33.3, P < 0.0001). Median increases in activity over
the
daytime period ranged from 1.0- to 2.5-fold higher for infected mosquitoes
depending on the adult age. Age itself also played a role in mosquito activity
(females: d.f. = 2, F = 20.7, P <0.0001, males: d.f. = 2, F = 13.1, P
<0.0001). In
general, both infected and uninfected, male and female, mosquitoes showed
decreasing activity with age (Figure 13). Only males, however, demonstrated a
significant interaction between age and infection status (d.f. = 2, F = 5.1, P
<0.01),
where the increase in activity due to infection was enhanced with age (Figures
13B,
D, &F).
Mosquito metabolic rate
Metabolic rate was measured for separate sets of mosquitoes during two daytime
windows, 07:30-11:30 and 11:30 ¨ 15:30. The data from the two windows were
combined after they were shown not to differ from one another using a general
linear
model (data not shown). In females (Figure 14A), both infection status (d.f. =
1, F =
9.7, P = 0.002) and age (d.f. = 2, F = 15.7, P <0.0001) were significant
predictors of
metabolic rate. On average infected females had higher metabolic rates than
uninfected, with young mosquitoes showing no difference and 15 day old
mosquitoes
showing the greatest increase (d.f. = 58, t = 2.6, P <0.01). Female
mosquitoes, both
infected and uninfected, were most active at 15 days of age (Figure 14A). In
males,
infection played a much less consistent role in metabolic rate over the ages
examined
(Figure 14B). Infection alone was not a factor (d.f. = 1, F = 0.81, P = 0.36)
in
determining metabolic rate, while age was statistically significant (d.f. = 2,
F 15.7,
P <0.0001). There was, however, a significant interaction between age and
infection
(d.f. = 2, F = 16.7, P <0.0001). This interaction can be seen between 15 and
25 day
old males (Figure 14B), where at 15 days of age infected males have higher
metabolic rates (d.f. = 55, 1 = 4.1, P <0.001) and at 25 days of age they have
lower
CA 02707880 2010-06-17
rates (d.f. = 58, t = -2.40, P <0.05).
EXAMPLE 4
WOLBACHIA AND VIRUS PROTECTION IN INSECTS
5 Materials and Methods
Fly Stocks
All fly lines were maintained on standard cornmeal diet at a constant
temperature of
25 C with a 12 hour light/dark cycle. The Oregon RC (ORC) line was obtained
from
the Bloomington Drosophila stock centre at Indiana University in 2004, whereas
the
10 Oregon R (OR) and 11,1118 lines have been maintained long term in the
O'Neill lab.
The Champetieres (Champ) stock was obtained in 2005 from the Drosophila
Genetic
Resource Centre at Kyoto Institute of Technology (stock number 103403) and
maintained in the Johnson lab.
15 Drosophila C virus isolate EB (Johnson and Christian, 1998) was plaque
purified,
passaged in Drosophila (DL2) cells and purified by centrifugation through a 10-
40%
sucrose gradient as previously described (Hedges and Johnson, 2008). The
cricket
paralysis virus (CrPV) (Johnson and Christian, 1996) and the Flock House virus
(FHV) isolate we previously described (Johnson et al., 2001) were used in the
current
20 study. DL2 cells were infected with either CrPV or FHV and cells
harvested two days
post infection. Cells were lysed by two rounds of freeze thawing and lysates
were
clarified by centrifugation for 20 min at 5000 g. Virus was pelleted through a
20%
sucrose cushion by centrifugation at 100000 g for 3 hours. Virus was
resuspended in
50 mM Tris, pH 7.4, aliquoted and stored at -80 C. A fresh aliquot was thawed
for
25 each experiment.
The concentration of tissue culture infectious units (IU) of each virus
preparation was
determined essentially as previously described (Scotti, 1980). Briefly, 50 p.1
of a
suspension of DL2 cells (1 x 106 cells/m1) was transferred to individual wells
of a flat
30 bottomed 96 well tissue culture tray and cells were allowed to attach
for at least 1
hour. A ten-fold dilution series was prepared in standard cell culture medium
for
CA 02707880 2010-06-17
56
titration. Each virus dilution was used to inoculate 8 wells (50 1.11 per
well). The
plates were incubated at 27 C for 4-5 days before scoring for cytopathic
effects
(CPE) and the concentration of IU in the virus sample calculated as described
previously (Scotti, 1980).
Survival assays
For survival assays 4-6 day old adult male Drosophila were infected by micro-
injection of virus into the upper lateral part of the abdomen. For negative
controls
flies were injected with PBS. Samples were injected into flies anaesthetised
with
carbon dioxide, using needles pulled from borosilicate glass capillaries and a
pulse
pressure micro-injector. Virus was diluted to a standard concentration (DCV
1.8 x
108 IU/ml, CrPV 1.8 x 108 IU/ml and 1.8 x 108 Mimi FHV) in PBS and
approximately 100 nl was injected into each fly. For each fly line assayed,
three
groups of 15 flies were injected with virus and one group of 15 flies were
injected
with PBS. Flies were maintained in vials at a constant temperature of 25 C
with a 12
h light/dark cycle and mortality was recorded daily. Mortality that occurred
within 2
days of injection was deemed to be due to injury. Negligible mortality (< 10%
in all
cases) was observed in negative controls (data not shown). Each experiment was
repeated in triplicate. Survival curves were compared using Kaplan-Meier
analysis
(Statv iew).
Diagnosis of Wolbachia and DCV infection
Five flies were pooled from each fly line and genomic DNA was extracted using
the
previously described STE method (O'Neill et al., 1992). The DNA was PCR
screened for presence of Wolbachia using the diagnostic wsp primer set 81F and
691R (Zhou et al., 1998) and the integrity of the DNA was confirmed using the
12S
primer set 12SA1 and 125B1 (Simon et al., 1994). All fly stocks were confirmed
to
be DCV free (data not shown).
Tetracycline treatment
All Wolbachia infected fly lines used were treated with 0.03% tetracycline
CA 02707880 2010-06-17
57
(Hoffmann et al., 1986) to generate uninfected fly lines. Following the
tetracycline
treatment flies (designated ORCT or w1118 T) were held for more than five
generations to recover before being used for experiments.
RT-qPCR analysis of virus
RNA concentration in flies Flies from the ORC and ORCT lines injected with DCV
as described above were harvested immediately following injection (0 day time
point), 2 days or 7 days post infection. Four flies were pooled, RNA
extracted,
random primed cDNA synthesised and the amount of DCV RNA quantified using the
primers DCV-rt-fw 1 5' AGGCTGTGTTTGCGCGAAG 3' and DCV-rt-rv 1
5'AATGGCAAGCGCACACAATTA3' as previously described (Hedges and
Johnson, 2008). For each time point shown four pools flies were independently
assayed.
Results
We compared the survival of flies infected with DCV in the presence or absence
of
Wolbachia infection (Figures 15 and 16) (Materials and Methods). In flies from
the
standard laboratory strain Oregon RC, Wolbachia infection delayed DCV-induced
mortality compared to Oregon RC flies cured of Wolbachia infection (Figure
15A).
The delay in mortality corresponded with a delay in virus accumulation in
Wolbachia
infected flies (Figure 17). The experiment was repeated with the fly strain
w'18 with
similar results observed (Figure 15B). The survival curves of Oregon RC and
IN1118
Wolbachia-free flies were similar to those of two wild type laboratory
populations
(Champetieres and Oregon R) that are naturally uninfected with Wolbachia
(compare
Figures 15A and 15B with Figure 16). Oregon RC and will8 flies are infected
with
two closely related strains of Wolbachia, wMelCS and wMelPop, respectively
(Riegler et al., 2005). These results indicate that these strains of
Wolbachia, in
different genetic backgrounds of Drosophila, have an antiviral effect. Two
further
viruses were tested using the survival bioassay; cricket paralysis virus
(CrPV;
Dicistroviridae) a natural Drosophila pathogen and Flock House virus (FHV;
Nodaviridae). The latter is unrelated to DCV and CrPV and is pathogenic in
adult
flies (Wang et al., 2006) although natural infections have not been reported.
Like
CA 02707880 2010-06-17
58
DCV, both CrPV and FHV induce rapid mortality when injected into adult
Drosophila. All, Oregon RC flies infected with Wolbachia and CrPV died within
17
days post infection (Figure 15C). In contrast, the Wolbachia-free Oregon RC
flies all
died within seven days of infection. Similarly, Wolbachia-free flies
challenged with
FHV died within 8 days of infection, whereas 26 days post infection only 35%
of the
Wolbachia-infected flies had succumbed to FHV induced mortality (Figure 15D).
These results indicate that the antiviral effect observed in Wolbachia-
infected
Drosophila functions to protect flies from diverse RNA viruses.
EXAMPLE 5
VARIATION IN ANTIVIRAL PROTECTION MEDIATED BY
DIFFERENT WOLBACHIA STRAINS IN DROSOPHILA SIMULANS
Materials and Methods
Viruses
Plaque purified DCV isolate EB (Hedges and Johnson, 2008) and FHV (Johnson et
al., 2001) were propagated and purified from DL2 cells (Schneider, 1972). DL2
cells
were maintained in Schneider's media supplemented with 10% FBS, 1 x glutamine
and 1 x penstrep (Invitrogen) at 27.5 C. Cells grown in 75 cm2 flasks were
infected
with either DCV or FHV at a low multiplicity of infection (< 1) and harvested
at 4-5
dpi. Cells were lysed by two rounds of freeze-thawing and cell debris removed
by
centrifugation at 5,000 rpm for 5 min. The virus was purified from the
supernatant by
pelleting through a 6 ml 10% sucrose cushion at 27,000 rpm at 12 C for 3 hours
in a
SW28 swing bucket rotor (Beckman). The resuspended virus was layered onto a
continuous 10-40% w/v sucrose gradient and centrifuged at 27,000 rpm at 12 C
for 3
hours in a SW41 swing bucket rotor (Beckman). The virus-containing fractions
were
harvested, diluted in 50 mM Tris pH 7.4 and virus was pelleted by
centrifugation at
27,000 rpm, 12 C for 3 hours. The virus was resuspended in 50 mM Tris pH 7.4
at
4 C overnight, aliquoted and stored at -20 C. The concentration of tissue
culture
infectious units (IU) of each virus preparation was determined by replicate
TCID50
analysis on two separate frozen aliquots, as previously described (see Example
4).
CA 02707880 2010-06-17
59
Flies and Wolbachia
All Wolbachia infected fly lines were obtained from the culture collection in
the
O'Neill lab and were maintained on standard cornmeal diet at a constant
temperature
of 25 C with a 12-hour light/dark cycle. The D. simulans fly line Me29 is
infected
with wMel. The wMel infection was established by injection of Wolbachia
containing
cytoplasm from D. melanogaster Wien 5 embryos into D. simulans NHaTC embryos
(Poinsot et al., 1998). The other D. simulans lines are naturally infected
with
Wolbachia strains as previously described and are listed in Table 2 (I-Ioffman
et al.,
1986; Mercot and Poinsot, 1998; O'Neill and Karr, 1990; and Hoffman et al.,
1996).
Preparation of Wolbachia- and virus-free fly lines
Virus-free populations of each of the Wolbachia containing fly line were
prepared
essentially as previously described (Brun and Plus, 1980). Briefly, flies were
aged for
at least 20 days, transferred to fresh media (supplemented with dry yeast) and
allowed to lay eggs for up to 16 hours. The eggs were collected from the
surface of
the media and treated for 4 minutes in 1.7% (w/v) sodium hypochlorite solution
to
remove the chorion. After treatment the eggs were thoroughly rinsed with
water,
transferred to moist filter paper and placed on fresh virus-free media. Virus-
free flies
were maintained separately from untreated stocks.
To generate fly lines free of Wolbachia each virus-free Wolbachia infected fly
line
was treated with 0.03% tetracycline (Hoffman et al., 1986). Following the
tetracycline treatment flies were held for more than four generations to
recover before
being used for experiments.
Survival bioassays
Drosophila were infected with DCV, FHV or mock infected by microinjection of
virus or PBS into the upper lateral part of the abdomen. Samples were injected
using
needles pulled from borosilicate glass capillaries and a pulse pressure micro-
injector
into 4-7 day old male flies that were anaesthetised with carbon dioxide. For
each fly
line assayed, three groups of 15 flies were injected with virus and one group
of 15
CA 02707880 2010-06-17
flies were injected with PBS. After injection flies were maintained in vials
at a
constant temperature of 25 C with a 12 h light/dark cycle and mortality was
recorded
daily. Mortality that occurred within one day of injection was deemed to be
due to
injury. Each experiment was replicated using independent cohorts of flies.
Survival
5 curves were compared using Kaplan-Meier analysis and log-rank statistics
reported
(GraphPad Prism). For each assay described in this paper a fresh aliquot of
either
DCV or FHV was defrosted and diluted to 1 x 108 IU/ml before use.
Virus accumulation assays
10 The accumulation of infectious DCV particles in both Wolbachia infected
and
uninfected flies was measured. For each of the five fly lines, groups of flies
with and
without Wolbachia were injected with DCV as for survival bioassays. At
designated
times post injection, two pools of four live DCV injected flies were collected
and
frozen at -20 C. Flies from all Wolbachia infected and uninfected fly lines
were
15 collected at 2 dpi. For Me29, DSR and CO flies infected with Wolbachia
samples
were also collected at 10 days post injection; for N7NO and DSH containing
Wolbachia and all tet-treated lines there were not enough live flies remaining
at 10
days for collection. For CO-Wolbachia flies an additional collection was
included at
30 dpi.
Each pool of four flies was homogenised in 100 ill of PBS with two 3 mm beads
(Sigma-Aldrich) using a Mini BeadBeater-96 (Biospec Products) for 60 seconds.
The
homogenates were clarified by centrifuging at 14 K for 8 minutes. The virus¨
containing supernatant was aliquoted and stored at -20 C. Virus titre was
determined
using the TCID50 assay as previously described (see Example 4). The two
replicates
for each fly population were assayed on different days to control for between-
day
variation in TCID50 assays. Statistical analysis of the data was done using
unpaired t
tests to compare the geometric means of the duplicate samples between flies of
each
line with and without Wolbachia at 2 dpi (GraphPad Prism).
Analysis of Wolbachia density
CA 02707880 2010-06-17
61
For each fly line 200 eggs were collected and incubated on fresh food with a
constant
temperature of 25 C for 10 days. Freshly emerged flies were collected for 8
hours,
aged to 4 days old and then five male flies from a single collection were
pooled. For
each fly line a total of 10 pools of flies were collected from independent
bottles and
the DNA extracted using a DNeasy Blood and Tissue Kit as per the
Manufacturer's
instructions (Qiagen). The relative ratio of Wolbachia to fly genomic DNA was
determined by quantitative PCR. Each 10 !IL qPCR reaction included 5 1.1L, of
Sybr
Green qPCR Supermix-UDG (Invitrogen), 1 pi, of DNA template and 1 jiM each of
the forward and reverse primers. Primers for Wolbachia were designed from an
alignment of the sequence of the WSP genes from all five Wolbachia strains
(wspFQALL 5' GCATTTGGTTAYAAAATGGACGA 3' and wspRQALL 5'
GGAGTGATAGGCATATCTTCAAT 3') and for the host gene RPS17
(Dmel.rps17F 5' CACTCCCAGGTGCGTGGTAT 3' and Dmelsps17R 5'
GGAGACGGCCGGGACGTAGT 3'). Reactions were done in duplicate in a Rotor-
gene thermal cycler (Corbett Life Sciences) with the following conditions: one
cycle
of 50 C 2 min, 95 C 2 min, followed by 40 cycles of 95 C 5 sec, 60 C 5 sec, 72
C
10 sec. A third technical replicate was done where necessary and DNA extracted
from flies without Wolbachia was used as a negative control. Ratios were
calculated
in Qgene and statistical analysis included Mann-Whitney t test to compare
differences of the means.
Accession numbers
EF423761 wsp wRi; DQ235409 wsp wAu; AF020074 wsp wNo; AF020073 wsp
wHa; NM 079278 RPS17
Results
Wolbachia strain wMel can protect D. simulans from DCV
Wolbachia strains closely related to wMel have previously been shown to
protect
their natural host D. melanogaster from accumulation of DCV particles and DCV-
induced mortality (Teixeira et al., 2008; see also Example 4). To establish
whether
wMel can protect D. simulans from DCV, we assayed Me29, a D. simulans line
that
CA 02707880 2010-06-17
62
was transinfected with wMel (Poinsot et al., 1998) (Table 2). Me29 flies
infected
with wMel and the genetically paired population that had been cured of
Wolbachia
infection were challenged with DCV and mortality was recorded for 15 days
(Figure
18A). For flies both with and without Wolbachia the mortality in PBS injected
controls was negligible. All DCV injected wMel-free flies died by 8 days post
infection (dpi), with a median survival time of 6 days. In contrast, at 15 dpi
about
50% of wMel infected flies remained alive. These results indicate that the
presence of
wMel mediates a significant decrease in DCV induced mortality in Me29 flies.
The accumulation of infectious DCV particles was assayed in Me29 flies with
and
without wMel. The titre of infectious virus in homogenates from flies
collected 2 dpi
was significantly different in flies with and without wMel (p < 0.002; Figure
18B).
The titre of virus in flies without Wolbachia was estimated to be about 2600-
fold
greater than in Me29 flies infected with wMel. By 10 dpi there were no
surviving
Wolbachia-free flies and the virus titre in the surviving wMel infected flies
had
increased to a level similar to that of Wolbachia-free flies at 2 dpi. This
indicates that
the presence of wMel in Me29 flies delays rather than prevents DCV
accumulation.
D. simulans Wolbachia strains and protection from DCV induced mortality
D. simulans populations are naturally infected with a range of Wolbachia
strains. To
analyse whether diverse strains could protect from DCV induced mortality we
assayed four D. simulans lines CO, DSR, DSH and N7NO, which are naturally
infected with wAu, wRi, wHa and wNo, respectively (Table 2). Each of the four
fly
lines was treated with tetracycline to produce a genetically paired line
without
Wolbachia infection. Flies with and without Wolbachia were challenged by
injection
with DCV or mock infected with PBS (Figure 19). In all cases less than 10%
mortality occurred in the mock-infected flies, indicating that in the absence
of virus
fly survival was stable over the course of the experiments. The CO flies
without
Wolbachia had a median survival time of 8 days following DCV injection (Figure
19A). Strikingly, the wAu-infected CO flies survived DCV infection; more than
90%
were alive when the experiment was terminated at 30 dpi. The wRi-infected DSR
CA 02707880 2010-06-17
63
flies had significantly better survival (p<0.0001) than Wolbachia-free DSR
flies
(Figure 19B). The median survival times following DCV infection were 14 dpi as
compared to 6 dpi for flies with and without wRi, respectively. Thus presence
of
either wAu or wRi in D. simulans can mitigate DCV-induced mortality.
Not all Wolbachia strains protected flies from DCV induced mortality. The
median
survival time of DSH and N7NO flies challenged with DCV was 4 days regardless
of
Wolbachia infection status for fly lines infected by wHa or wNo, respectively
(Figure
19C and 19D). While there was a small but statistically significant (p=0.001)
difference between the survival curves for the DSH flies with and without wHa
infection for the representative experiment shown in Figure 19C, a significant
difference was evident in only 2 out of 4 experiments replicated on
independent
cohorts of flies (data not shown). Taken together, the minor difference in
survival
and non-reproducible nature of the result suggests that it is unlikely that
this
difference is biologically relevant, and as such we interpret the results as
indicating
that there is no protection against DCV induced mortality in the DSH flies
infected
with wHa. There was no difference between the survival curves of N7NO flies
with
and without wNo infection (p=0.7). To investigate whether protection would be
evident for these lines challenged with reduced amounts of virus we decreased
the
concentration of DCV injected by 10- or 100-fold. Even at these lower doses of
virus
no Wolbachia-mediated antiviral protection was observed in DSH and N7NO flies
(data not shown).
Accumulation of DCV in flies with and without Wolbachia
DCV accumulation was assayed in each D. simulans line in the presence or
absence
of Wolbachia (Figure 20). DCV infected flies were assayed at 2 dpi and the DCV
titre was compared for each fly line with and without Wolbachia infection. The
average DCV titre was approximately 800-fold lower in CO flies infected with
wAu
compared to paired Wolbachia-free flies, and an unpaired t test showed this to
be a
significant difference (p<0.05; Figure 20A). Interestingly, although wAu
infected
flies survived DCV infection (Figure 19A), virus continued to accumulate
beyond 2
CA 02707880 2010-06-17
64
dpi and high titres of DCV were observed in wAu-infected flies harvested at
both 10
and 30 dpi (Figure 20A). This shows that these flies did not clear the virus
infection.
The titre of DCV was similar when comparing flies with and without Wolbachia
at 2
dpi for each of the three other fly lines assayed (Figure 20B-D).
D. simulans Wolbachia strains and protection from FHV induced mortality
Having identified that some but not all Wolbachia strains mediate protection
against
DCV in the D. simulans lines tested, we next investigated whether antiviral
protection was consistent across different viruses. Flies with and without
Wolbachia
were challenged by injection with FHV or mock infected with PBS (Figure 21).
In all
cases mortality in the mock-infected control flies was negligible. The CO
flies
without Wolbachia infection reached 100% mortality within 7 days of injection
with
FHV (Figure 21A). Similar to challenge with DCV the wAu-infected flies
survived
FHV infection; more than 90% were alive when the experiment was terminated at
24
dpi. The wRi-infected DSR flies had significantly better survival (p<0.0001)
than
Wolbachia-free DSR flies (Figure 21B). The median survival times or DSR flies
challenged with FHV were 10 days as compared to 7 days with and without wRi,
respectively. Thus median time to death was reduced in both DCV and FHV
infections for wRi-infected DSR flies. No virus-induced mortality was observed
in
wAu-infected CO flies for either virus.
Not all of the fly lines were protected from FHV-induced mortality by
Wolbachia
infection. The median survival time of DSH flies challenged with FHV was 6
days
regardless of the presence or absence of wHa (Figure 21C) and there was no
significant difference in the survival curves (p=0.4). For the N7NO line there
was no
difference between the survival curves with and without wNo infection (p=0.5;
Figure 21D).
Wolbachia density in fly lines
To investigate whether virus protection correlated with the density of the
Wolbachia
in the fly lines, we utilized quantitative PCR to determine Wolbachia density
from
CA 02707880 2010-06-17
pools of 5 male flies from each fly line. Estimates of abundance for a single
copy
Wolbachia gene were determined and then normalized against abundance of a
single
copy host gene to determine relative abundance of Wolbachia (Figure 22). The
three
Wolbachia strains (wMel, wRi and wAu ) that gave strong antiviral protection
in the
5 D. simulans lines, were significantly more abundant in these flies than
the strains that
gave no protection (wHa and wNo).
Dengue interference by wMel and wMelPop in mosquitoes
As shown in Fig. 54, dengue virus interference is generated by both wMel and
10 wMelPop-CLA in mosquitoes.
EXAMPLE 6
A WOLBACHIA SYMBIONT IN AEDES AEGYPTI LIMITS INFECTION
WITH DENGUE, CHIKUNGUNYA AND PLASMODIUM
15 Materials and Methods
Mosquitoes
Five different A. aegypti lines were used including the original inbred
wMelPop-CLA
infected line (PGYP1) and its tetracycline-cured counterpart PGYP1.tet (see
Example
2). A genetically diverse line derived from PGYP1, named PGYP1.out was
generated
20 by backcrossing PGYP1 for three generations to Fl males of 52
independent field-
collected isofemale lines from Cairns, Australia. A further two generations of
backcrossing were conducted with F2 field-collected material before the colony
was
used in experiments. This backcrossing scheme is expected to replace 96.9% of
the
original inbred genotype. A tetracycline-cured counterpart (PGYPl.out.tet, -
Wolb)
25 was generated by antibiotic treatment of backcrossed adults, followed by
two
generations of recovery and recolonization with gut bacteria as previously
described
(see Example 2). A genetically diverse wild type line was also generated at
the same
time from field-collected material sourced from 245 ovitraps across seven
suburbs of
Cairns, Australia in late 2008 and named Caims3. For the malaria experiments,
a
30 susceptible A. fluviatilis strain (Rodrigues et al., 2008) was used in
parallel with
PGYP1 .out (+ Wolb) and PGYP1.out.tet (-Wolb) A. aegypti mosquitoes. Insects
CA 02707880 2010-06-17
66
were kept in a controlled environment insectary at 25 C, ¨80% RH and a 12 hour
light regime. Larvae were maintained with fish food pellets (Tetramin, Tetra)
and
adults were offered 10% sucrose solution, ad libitum. Adult females were
bloodfed
on human volunteers for egg production. Three to five day old female
mosquitoes
were used for the DENV and malaria infection experiments. Seven day old
females
were used for the CHIKV experiments.
Viruses
Dengue virus
Dengue virus serotype 2 (DENV-2) (92T) was isolated from human serum collected
from a patient from Townsville, Australia, in 1992. Virus stocks were passaged
five
times in Aedes albopictus cell line (C6/36) grown in RPMI 1640 medium
supplemented with 10% fetal calf serum (FCS), penicillin (100 g/ml),
streptomycin
(100 pg/m1), and lx glutamax (Invitrogen), and maintained at 28 C.
Supernatants
were collected 5 days after infection, separated into 0.5 ml aliquots, and
then frozen
at -80 C. Virus used in microinjection experiments was obtained from thawed
stocks
of above and had a titer of 107.6 CCID50 per ml. To prepare the DENV-2 for
oral
feeding, the frozen virus stock was passaged once more through C6/36 cells and
the
supernatant was harvested at 5 days and then mixed directly with blood to
formulate
a bloodmeal for feeding. Virus solution with higher titer (108.85 CCID50/m1)
was
obtained by harvesting the viral supernatant and the intracellular virus from
cell
lysates.
Chikungunya virus
CHIKV strain 061 1 3879, isolated from a viremic traveler returning from
Mauritius to
Victoria, Australia in 2006 was provided by the Victorian Infectious Diseases
Research Laboratory, Melbourne, Australia. Cultures were grown at 37 C in Vero
(African green monkey kidney) cells for 4 days before the supernatant was
harvested
and frozen at -80 C. This CHIKV stock was passaged once more in Vero cells and
the virus was concentrated from 1.8 L of infected culture supernatant via
ultracentrifugation at 10 000 g for 17 hrs at 4 C. Pelleted virus was
resuspended in 20
CA 02707880 2010-06-17
67
ml of Opti-MEM reduced serum medium (Gibco BRL , Invitrogen, California)
supplemented with 10% FCS before aliquots of the prepared virus were frozen at
-
80 C. The stock concentration had a final viral titer of 108.0 CCID50/ml.
Exposure of mosquitoes to viruses
Intrathoracic Injection with DENV-2
Female mosquitoes were briefly anesthetized with CO2 and placed on a glass
plate
over ice. Insects were handled with forceps under a dissecting scope and
injected into
their thorax (pleural membrane) with a pulled glass capillary and a handheld
microinjector (Nanoject II, Drummond Sci.). Sixty-nine nanolitres of DENV-2
stock
was injected into each mosquito, which corresponds to approx. 2,750 virus
particles/
mosquito. After injection mosquitoes were transferred to 1L plastic cages
within
polystyrene boxes and these boxes were maintained inside an environmentally
controlled incubator 12:12 (L:D) h, 27 C and 70% RH . Sucrose solution and
apple
slices were provided on top of each cage. Mosquitoes were collected from each
cage
5 and 14 days after infection and 5 dpi (days postinfection) samples were
dissected
into abdomen and thorax plus head. Samples were placed on dry ice and then
transferred to -80 C until RNA extraction (see below). Fourteen days after
thoracic
injection eight mosquitoes were collected from each cage, briefly anesthetized
with
CO2 and placed on a glass plate over ice. Wings and legs were removed with
forceps
and their mouthparts were introduced into a lcm piece of polypropylene tubing
(0.61
x 0.28 mm, Microtube Extrusions, NSW, Australia) filled with light mineral oil
(Novak et al., 1995). Females were allowed to salivate into these capillaries
for 5
minutes at room temperature, and then the capillaries were rinsed into 20 jil
of fetal
calf serum with a Hamilton syringe. Samples were centrifuged at 14,000 g for 2
minutes and kept frozen (-80 C) for further virus detection using a cell
culture
enzyme immunoassay (CCEIA). Mosquito whole bodies were frozen on dry ice and
kept at -80 C for quantitative PCR virus detection.
Oral Feeding with DENV-2 and CHIKV
Mosquitoes were starved for 24 hrs and then transferred to 1L or 2.5L plastic
feeding
CA 02707880 2010-06-17
68
containers. Prior to feeding. DENV-2 was harvested from C6/36 cell culture
supernatant and diluted 1:5 in defibrinated sheep's blood. For the CHIKV
experiments, frozen aliquots of stock virus were rapidly thawed, and diluted
in
washed defibrinated sheep blood and 1% sucrose. Blood-virus mixtures were
maintained at 37 C for 1 h and 4 h for DENV-2 and CHIKV, respectively, using
membrane feeders (Rutledge etal., 1964) and covered with a porcine intestine
as the
membrane. After feeding, mosquitoes were anesthetized using CO2 and partially
and
non-engorged mosquitoes were discarded. Fully engorged mosquitoes were
maintained on a 15% sucrose solution at 12:12 (L:D) h, 27-28 C and 70% RH. To
determine DENV-2 infection and dissemination rates, up to 40 mosquitoes were
processed separately at 7 and 14 d post-exposure. To follow the replication
and
dissemination of CHIKV, 10-30 mosquitoes were processed on days 0, 2, 4, 7, 10
and
14 post-exposure. Mosquitoes were anesthetized using CO2, and the legs (for
DENV-
2) and legs and wings (for CHIKV) from each mosquito were removed, and these
and
the remaining body and head were stored separately at -80 C. Samples were
processed using the CCE1A method (DENV-2) or qRT-PCR (CHIKV) described
below. Differences in the frequency of DENV-2 infection and dissemination
between
mosquito lines were analyzed using chisquare goodness of fit tests after the 7
or 14 d
extrinsic incubation period for DENV-2 and at 14d for CHIKV (Zar, 1999).
Cell culture enzyme immunoassays
Titration of DENV-2 and CHIKV stocks and blood/virus mixtures was performed
using a CCEIA method similar to that previously described (Broom et al.,
1998). For
DENV-2, C6/36 cell monolayers (60-90% confluent) in 96-well plates were
inoculated with 50 ill/well of virus dilutions and plates were incubated at 28
C with
5% CO2 for 5 d. Cell monolayers then were fixed and examined for DENV-2
antigens using a cocktail of flavivirus cross-reactive monoclonal antibodies
(4G4 and
4G2) (Hall et al., 1991). For CHIKV, all titrations were performed in Vero
cells,
which were incubated at 37 C with 5% CO2. After 7 d plates were examined for
cytopathic effect (CPE), which was confirmed using the CCEIA and the broadly
reactive alphavirus monoclonal antibody, B10.
CA 02707880 2010-06-17
69
Plasmodium gallinaceum
Two to three day-old White Leghorn chickens were infected through
intraperitoneal
or intradermal injection of Plasmodium gallinaceum 8A strain parasitized blood
(Rodrigues et al., 2008). Parasitemia was determined every other day through
Giemsa-stained blood smears. Ten microscopic fields were examined under
immersion oil to count one hundred red blood cells and determine the ratio of
infected cells. Presence of gametocytes and rising parasitemia was ensured in
order to
enhance the chance of mosquito infection. Before infection mosquitoes were
deprived of sugar solution overnight and on the next morning chickens were
placed
on top of the cages and mosquitoes were fed for about 45 minutes. Only
bloodfed
female mosquitoes were kept for further observations. Four independent
experiments
were performed with independent cohorts. Seven days after bloodfeeding
mosquitoes
had their midguts dissected in 1X PBS and after staining the midguts with 0.2%
Mercurochrome solution oocysts were counted under a microscope (D1C, 100X).
Fifteen days after infection mosquitoes were collected and DNA was extracted
(Qiagen Blood & Tissue kit) for Plasmodium detection. For P. gallinaceum
detection
around 1 ng of genomic DNA was used in quantitative PCR reactions as described
below. Primers for the Plasmodium spp. 18S ssu rRNA gene (Schneider and
Shahabuddin, 2000) were used for the parasite sequence amplification and A.
aegypti
Actin primers were used as a host control gene (see primer sequences in Table
6).
Analyses were performed with qGENE (Joehanes and Nelson, 2008) and Mann
Whitney-U tests (STATISTICA V8, StatSoft, Inc.) to compare relative abundance
between lines.
Quantitative DENY PCR analysis
Individual frozen mosquito whole bodies or body parts were placed into 2 ml
screw
cap vials with a glass bead (2 mm diameter, Sigma-Aldrich). 200 I of Trizol
(Invitrogen) was added and the sample homogenized for 150 s using a Mini
BeadBeater (Biospec Products). Tubes were incubated at room temperature for 5
min, 40 I of chloroform was added to each tube and samples were thoroughly
CA 02707880 2010-06-17
vortexed for 10 s. Tubes were centrifuged for 15 min at 14,000 g at 4 C and
the
supernatant containing the RNA was transferred to new tubes. RNA was
precipitated
by adding 40 I of isopropanol and incubated at -20 C overnight. Samples were
centrifuged at 12,000 g for 10 min at 4 C to pellet the RNA. Pellets were
washed
5 with 200 L of 70% ethanol and after centrifugation (7,500 xg for 5 min
at 4 C)
ethanol was removed and pellets were dried for 10 mm in a fume hood. RNA was
resuspended in 25 L of RNAse-free milli-Q water and tubes were incubated for
10
min at 56 C. Samples were maintained at -80 C until further analysis. cDNA
synthesis was based on the protocol described by Richardson (Richardson et
al.,
10 2006), which allowed us to determine both the genomic (+ RNA) and
replicative
(anti-genomic) virus forms (- RNA). Briefly, 0.5 g of each RNA (2 g for
saliva
samples) was mixed with 0.625 M of either the DENV-2 NS5 forward or reverse
primer (see Table 6) plus 0.2 mM dNTPs in separate cDNA reactions. Samples
were
incubated at 86 C for 15 min and 5 min on ice, then 5X first strand buffer and
100U
15 of Superscript III (Invitrogen) was added to a total volume of 20 I.
Samples were
incubated at 25 C for 10 mm, followed by 42 C for 50 min and 10 min at 95 C to
inactivate the transcriptase. Negative controls (no template) were included in
each
reaction. For DENV-2 detection, cDNA samples were diluted 1:10 with milli-Q
water. The qPCR reaction consisted of 2 pl of the diluted cDNAs, 5 I of Sybr
Green
20 mix (Invitrogen) and 1 M of each primer (see above), in 10 p.1 total
volume.
Reactions were performed in duplicate in a Rotor-gene thermal cycler (Corbett
Life
Sciences) with the following conditions: 50 C 2min, 95 C 2min, 45 cycles (95 C
5 s,
60 C 5 s, 72 C 10 s) followed by the melting curve (68 C to 95 C). Melting
curves
for each sample were analyzed after each run to check specificity. A standard
curve
25 was created by cloning the DENV-2 NS5 fragment into pGEMOT-Easy
(Promega).
After linearization with Pst I the plasmid was serially diluted into known
concentrations and run in parallel, in order to determine the absolute number
of
DENV-2 copies contained in each sample. Mann-Whitney U tests were employed
(STATISTICA V8, StatSoft, Inc.) to examine the effect of Wolbachia infection
on
30 dengue number for each for each paired strain combination (PGYP1 x
PGYP1.tet;
PGYP1.out x PGYP1.out.tet) x body part (whole, abdomen, thorax) x age (5 or 14
d)
CA 02707880 2010-06-17
71
post inoculation. The tests were based on the means from each of 4
independently
replicated experiments.
CHIKV qRT-PCR Analysis
Individual frozen mosquito bodies and heads or legs and wings were homogenized
for 3 mm in 1 ml of Opti-MEM reduced serum medium respectively using glass
beads and a mechanical homogenizer (Spex Industries, Edison, NJ). The
supernatant
from each sample was removed for potential virus isolation and stored at -80
C. The
remaining mosquito pellet from each sample was resuspended in equal volumes
(200
I) of Opti-MEM reduced serum medium and TRIzol LS reagent (Invitrogen Life
Technologies, California) and homogenized again as described above. After
incubation at room temperature for 5 min and addition of 40 I of chloroform,
the
entire homogenate for each sample was then vortexed for 15 sec and transferred
to a
pre-spun Phase Lock GeITM Heavy tube (5 Prime, GmbH, Germany). The lysed
contents of each tube were allowed to settle for 5 min at room temperature and
organic and aqueous phases were separated by centrifugation at 16 000 g for 10
min
at room temperature. Aqueous phases were recovered from each tube before total
RNA was extracted at room temperature using a modification of the RNeasy Mini
Kit protocol (Qiagen, Australia) and on column-DNase treatment. RNA was eluted
from the column with 301.11 of RNasefree H20 and a final centrifugation step
for 1
min. All RNA samples were stored at - 80 C prior to analysis by qRT-PCR. RNA
standards were produced for the relative quantification of CHIKV RNA copy
numbers normalized to RNA levels of the ribosomal A. aegypti housekeeping gene
RpS 17 (see Table 6).
Immune Genes
PGYP1.out and PGYP1.out.tet mosquitoes were analyzed by RT-qPCR for a
selection of immune genes. Two biologically independent cohorts often sugar-
fed, 5-
6 day old, female mosquitoes were collected and analyzed from each mosquito
line.
Total RNA was extracted from whole mosquitoes using TRI REAGENT (Molecular
Research Center, Inc.) or RiboZol (AMRESCO). The RNA samples were DNase
CA 02707880 2010-06-17
72
treated (Promega) and reverse transcribed using random primers and SuperScript
III
Reverse Transcriptase (Invitrogen). Quantitative PCR was carried out as per
Platinum
SYBR Green protocol (Invitrogen). The sequences of the primers used for qPCR
are
detailed in Table 6. Primer sequences for REL1, REL2, CECG and DEFC were
obtained elsewhere (Xi etal., 2008) and the other primers were designed using
gene
sequences obtained from VectorBase. The temperature profile of the qPCR was 95
C
for 2 min, 50 C for 2 min and 40 cycles of 95 C for 10 s, 60 C for 10 sand 72
C for
20 s. The house-keeping gene RpS17 (Cook et al., 2006) was used to normalize
expression. Target gene to house-keeping gene ratios were obtained for each
biological replicate using QGene 4.2 (Joehanes and Nelson, 2008). Treatment
effects
on the expression ratios were examined using Mann Whitney-U tests in
STATISTICA V8 (StatSoft, Inc.) and fold change was calculated by the REST
method (Pfaffl et al., 2002).
Immunofluorescence
Following the removal of legs and wings, 14 dpi mosquitoes were fixed
overnight at
4 C in 4% (w/v) paraformaldehyde in PBS, containing 0.5% (v/v) Triton X-100.
Fixed mosquitoes were dehydrated in an ethanol series of 50, 70, 90, 95, 100%
ethanol, followed by two toluene treatments and then infiltrated with paraffin
wax
(Paraplast-Xtra, McCormick Scientific) at 60 C. Paraffin-embedded mosquitoes
were
sectioned using a rotary microtome to obtain 8 gm sections that were adhered
to
superfrost plus slides (Menzel-Glaser). Slides were dried, deparaffinated in
100%
xylene, rehydrated in an ethanol series and then washed in PBS-T before being
blocked overnight in 2% (w/v) bovine serum albumin (BSA) in PBS-T at 4 C.
Sections were then incubated simultaneously for 1 hour with antirabbit WSP
(1:100)
and anti-dengue (1:10) 4G4 or anti-Plasmodium CSP (Krettli etal., 1988)
antibodies
(1:100) (both monoclonal, developed in mouse), diluted in blocking solution.
Tissue
sections were washed twice with PBS-T and the slides were then incubated
simultaneously with Alexa-conjugated secondary antibodies (Alexa-488 developed
in
rabbit or Alexa-594, developed in mice, respectively, Molecular Probes,
Invitrogen)
diluted 1:1000 each in blocking solution for 1 h at room temperature. After
two
CA 02707880 2010-06-17
73
washes in PBS-T, the slides were incubated in DAP1 for 10 min, rinsed in PBS-T
and
then mounted using an antifading reagent (ProLong, Invitrogen). lmmunostaining
was analyzed with a Zeiss Axio Imager II epifluorescence microscope equipped
with
an Axiocam camera, using the same exposure conditions for each filter channel.
Photos are representative of at least 10 mosquitoes of each treatment.
Fluorescence in situ hybridization
FISH was done using a modified protocol adapted from GeneDetect.com. Briefly,
paraffin-embedded mosquitoes were sectioned and de-paraffinated as described
above. Sections were then dehydrated in an ethanol series and hybridised
overnight at
37 C in a hybridization buffer containing 4X SSC, 50% formamide, 250 mg/ml
dextran sulfate, 250 gg/m1poly(A), 250 gg/m1tRNA, 250ug/m1 salmon sperm DNA,
100mM DTT and 0.5X Denhardt's solution and 200 ng of Wolbachia specific 16S
rRNAprobes (W2: 5 ' - CTTCTGTGAGTACCGTCATTATC-3' and W3: 5'-
AACCGACCCTATCCCTTCGAATA-3') labelled at the 3' end with rhodamine.
Both probes are 100% homologous to both wMelPop and wFlu. Following overnight
hybridizations, sections were washed twice in lx SSC containing 10 mM DTI' and
twice in 0.5X SSC containing 10 mM DTT for 15 min each at 55 C, followed by a
10
min wash at 0.5X SSC containing 10 mM DTT and 1 jig/m1 DAPI. Slides were
briefly rinsed in water, mounted using an antifading reagent (ProLong,
Invitrogen)
and observed and photographed as described in the immunofluorescence method.
Western blot analysis
Total protein from 5 mosquitoes of each treatment was extracted using protein
lysis
buffer containing 50mM Tris pH 7.4, 140mM NaC1, 0.5% (v/v) Triton X- 100,
1.5 g/m1DNAseI and protease inhibitors (Roche). Samples were boiled for 10 min
in the presence of protein loading buffer, run on a 12% Laemmli SDS gel and
transferred to a nitrocellulose membrane (Immobilon-P, Millipore) through the
semidry Transblot SD (BioRad). Because the 4G4 antidengue antibody recognizes
a
conformational epitope, -mercaptoethanol was omitted from the sample loading
buffer. Membranes were blocked with 5% non-fat dried milk in TBS-T overnight
at 4
CA 02707880 2010-06-17
74
C, and then probed with antiwsp polyclonal antibody (Braig et al., 1998)
(diluted
1:1,000 in 5% (w/v) skim milk in TBS-T) or anti-dengue (4G4) monoclonal
antibody
(1:100 dilution) for lh at room temperature. After 3 washes in TBS-T,
membranes
were incubated with anti-rabbit or anti-mouse IgG alkaline phosphatase
conjugated
antibody (Sigma) (1:4,000) for lh, respectively. Following washing in TBS-T
blots
were developed with NBT/BCIP (Promega). Western blots on Wolbachia-infected
mosquitoes revealed a single band around 26 kDa that corresponds with the
correct
molecular weight of wsp (25540Da) (Braig et aL, 1998), whereas the 4G4
antibody
revealed a band of around 50 kDa in dengue-positive mosquitoes.
Wolbachia density in Aedes spp. mosquitoes
A standard curve was created by cloning a Wolbachia wsp gene fragment (Braig
et
al., 1998) into pGEM T-Easy (Promega). After linearization with Pst I the
plasmid
was serially diluted into known concentrations and run in parallel, in order
to
determine the absolute number of Wolbachia copies contained in each mosquito
sample. Mann-Whitney U tests were employed (STATISTICA V8, StatSoft, Inc.) to
examine the density of Wolbachia in both mosquito species.
PCR amplification of Wolbachia sequences from A. fluviatilis
The Wolbachia surface protein gene wsp was amplified using the primers 81F and
691R that amplify a wide range of Wolbachia strains (Braig et al., 1998). PCR
cycling conditions were as follows: 94 C 3 min, (94 C 30 s, 52 C 30 s, 68 C 90
s) x
35 cycles, then 68 C 10 min. The reaction mixture contained 625 nM of each
primer,
125 jiA4 dNTPs, 1.5 mM MgSO4, 20 ng of mosquito DNA and 0.5 !IL of proof-
reading Elongase enzyme mix (Invitrogen) in a final volume of 25 jil. PCR
products
were separated in 1% agarose gels and stained with ethidium bromide. Six
independent PCR amplicons were cloned into the pGEM T Easy vector (Promega)
and six clones were sequenced with T7 and M1 3R universal primers using the AB
Big Dye terminator Version 3.1 kit with fluorescent sequencing (FS), AmpliTaq
DNA polymerase (Perkin-Elmer) and analysed on (AB) 3730x1 -96 capillary
sequencer. Sequencing was done at the Australian Genome Research Facility
CA 02707880 2010-06-17
(AGRF). Sequence similarity searches were performed using the BLAST algorithm
(Altschul et al., 1997) at NCBI, and a phylogenetic tree was constructed using
DNAstar (Lasergene). A partial wsp gene sequence from wFlu has been deposited
in
GenBank (Accession number GQ917108).
5
Relative quantification of CHIKV RNA copy numbers
RNA standards were produced for the relative quantification of CHIKV RNA copy
numbers normalized to RNA levels of the ribosomal A. aegypti housekeeping gene
RpS17. Firstly, a CHIKV RNA synthetic transcript was produced by RT-PCR
10 amplification of a 588 bp fragment from the CHIKV strain 06113879 using
primers
designed from its deduced partial El structural gene sequence (GenBank
accession
number EU404186) (see Table 6). The one-step RT-PCR was performed using the
Superscript III One- Step RT-PCR System with PlatinumO Tag High Fidelity
(Invitrogen Life Technologies, California) according to the manufacturer's
15 instructions with 400 nM of each primer and 5 ul of CHIKV RNA in a final
reaction
volume of 50 ul. Amplification was performed in an Eppendorf Mastercycler
epgradient S (Eppendorf, Germany) and included one cycle at 50 C for 15 min
for
reverse transcription, an inactivation step at 94 C for 2 min, 40 cycles of 94
C for 2
min, 59 C for 30 sec and 68 C for 2.5 min and final extension at 68 C for
5min.
20 Amplicon DNA was purified using the QIAquick Gel Extraction Kit (Qiagen,
Australia) and supplied instructions and then cloned into the plasmid vector
pGEMS-T Easy (Promega). After the presence and orientation of the insert DNA
was verified by nucleotide sequencing, the plasmid was linearized for in vitro
RNA
transcription by digestion with Spel. Synthetic RNA transcripts were then
prepared
25 using the Riboprobeg T7 System (Promega) before multiple treatments with
DNase
1 (RQ1 RNase-Free DNase; Promega Corporation, WI, USA). The final CHIKV
transcript of 654 bp was stored in single use aliquots at -80 C and RNA levels
were
determined by spectrophotometry immediately prior to use. For the housekeeping
gene RpS17 RNA standard, total RNA from whole A. aegypti mosquitoes was
30 extracted as before with the exception that on-column DNase treatment
was omitted.
In this instance, RNA was DNase treated and stored as described for the CHIKV
CA 02707880 2010-06-17
76
RNA transcript. To enable a direct comparison of CHIKV RNA copy numbers in
prepared mosquito body plus head, and legs plus wings samples, two specific
one-
step qRT-PCR real-time TaqMan assays were developed targeting the CHIKV El
and A. aegypti RpS17 genes respectively. Both were performed using the ABI
7500
Fast Real-Time PCR System (PE Applied Biosystems, Foster City, Calfomia) and
all
reaction mixes, amplification parameters, result analysis and CHIKV primer and
probe sequences were used as previously reported. Primers and dual labelled
probe
(5' -FAMCAGGAGGAGGAACGTGAGCGCAG-TAMRA-3') for the Rp S17
housekeeping assay were derived from the A. aegypti RpS17 gene sequence ¨
GenBank accession number AY927787. Standard curves for qRT-PCRs were
generated using triplicate 15-fold serial dilutions of either the CHIKV T7 RNA
transcript or the prepared RpS17 reference RNA. Equivalent CHIKV RNA copy
numbers normalized to reference RpS17 RNA levels were then calculated for the
CHIKV infected mosquito samples by comparing threshold cycle numbers (Ct) with
the respective standards.
Results
Wolbachia and Dengue virus
We tested the effect of Wolbachia on vector competence in two mosquito genetic
backgrounds: the original inbred PGYP I line, which was stably transinfected
with
wMelPop-CLA (see Example 2) and the same strain after 5 generations of
backcrossing to the Fl progeny of wild-caught A. aegypti, collected in Cairns,
Australia and named PGYP1.out. These mosquito strains were compared to
tetracycline-treated counterparts that were genetically identical but lacked
the
Wolbachia infection, named PGYP1.tet and PGYPI .out.tet, respectively. In
addition,
a wild-type strain of A. aegypti established from field-collected material in
Cairns,
Australia (Caims3) was used as an additional negative control.
Mosquitoes were fed an artificial blood meal spiked with DENV-2 in four
independent experiments to examine possible interactions with Wolbachia. The
presence of DENV-2 in whole mosquito bodies was examined 7 and 14 days post
CA 02707880 2010-06-17
77
exposure using a cell culture enzyme immunoassay (CCEIA) (Knox et al., 2003).
In
three separate experiments no Wolbachia-infected mosquitoes (PGYP1.out) tested
positive for DENV-2, but DENV-2 infection rates in Wo/bachia-uninfected
mosquitoes (PGYP1.out.tet and Cairns3) ranged from 30-100% (Table 3, Exp 1-3).
The body viral infection rates in PGYP1.out.tet mosquitoes ranged from 30-100%
after 7 d and 48-97% after 14 d, while the body viral infection rates in
Cairns3 ranged
from 50-95% after 7 d and 57-95% after 14 d. The disseminated viral infection
rates
measured through the presence of virus in mosquito legs in tetracycline-
treated A.
aegypti ranged from 10-23 and 37-43% after 7 and 14 d respectively.
Disseminated
infections in Wolbachia-free wildtype Cairns3 strain of A. aegypti ranged from
5-
13% and 20-33% after 7 and 14 d, respectively (Table 3) (P< 0.001, chi-
square). In
one experiment (Table 3, Exp 4) when mosquitoes were fed the highest titer
(107.8
Logs) of DENV-2 a small number of Wolbachia-infected mosquitoes tested
positive
for DENV-2 at both 7 and14 days post infection (5 and 8%, respectively) but
this was
significantly fewer than Wolbachia uninfected controls (63-78% and 70-75%,
respectively) (P< 0.001, chi-square). To provide a more conservative test of
Wolbachia-mediated interference, mosquitoes were intrathoracically injected
with
DENV-2. These experiments circumvented the midgut barrier to infection
(Woodring
et al., 1996) and allowed for the delivery of a repeatable inoculating dose
(around
2,750 infectious particles/mosquito) of DEN V-2 that produced consistent high-
titre
infections in control mosquitoes. Accumulation of genomic (+RNA) and anti-
genomic (-RNA) RNA strands was assessed at 5 and 14 d post-injection by
quantitative real time PCR using DENV-2 specific primers (Richardson etal.,
2006).
At both time points, the amount of DENV-2 RNA present was reduced by up to 4
logs in both the PGYP1 and PGYP1.out Wolbachia-infected strains compared to
their paired tetracycline treated counterparts (Figure 23, Table 5).
Furthermore, when
mosquito saliva collected from mosquitoes 14 d post injection was tested for
the
presence of infectious virus by CCEIA, none of the Wolbachia-infected
mosquitoes
samples tested positive for virus. A dramatic reduction in viral protein
synthesis was
also observed by immunofluorescent microscopy (IFA) (Figure 24A-F) and Western
blot analysis (Figure 28). Double immunofluorescent staining of paraffin
sections of
CA 02707880 2010-06-17
78
Wolbachia-uninfected control mosquitoes 14 days post-injection showed DEN V-2
infection predominantly in mosquito fat body as well as ommatidia (Figure 24A-
F)
and nervous system. DENV-2 was not detected in any of these tissues in
Wolbachia-
infected mosquitoes (PGYP1 and PGYP1.out) whereas Wolbachia was clearly
visible
in the fat tissue, ommatidia (Figure 24), brain, ovaries, and Malpighian
tubules. Only
in a few rare individuals was DENV-2 detected in patches of fat tissue in
PGYP1.out
mosquitoes. However in these cases Wolbachia and DENV-2 were not co-localized
in the same cells and DENV-2 was only seen in occasional patches of cells that
were
not infected with Wolbachia (Figure 24G). The presence of DENV-2 in some
injected PGYP1.out mosquitoes was also confirmed by Western blot (Figure 28A).
Wolbachia and chikungunya virus
We then went on to determine if the virus interference phenotype would extend
to the
alphavirus CHIKV. The virus strain used in the experiments contained the
alanine to
valine mutation in the membrane fusion glycoprotein El gene (El- A226V), which
has been linked to increased infectivity in A. albopictus. An Australian
population of
A. aegypti was recently shown to also be a highly efficient laboratory vector
of this
virus strain. Mosquitoes were exposed to a blood/virus mixture containing
106.4
CCID50/m1 of CHIKV, and at various timepoints post exposure, mosquitoes were
processed for quantification of the number of viral RNA copies using qPCR and
CHIKV-specific primers and probes. Immediately after feeding, the number of
CHIKV genomic (+ RNA) RNA copies in the body and head were comparable for all
three lines, suggesting that they imbibed similar amounts of virus (Table 4).
The
median number of copies then decreased in all three lines on days 2, prior to
it
increasing in the PGYP1.out.tet and Cairns3 mosquitoes to its highest level at
day
14-post exposure. The day 14 infection rates were 87% and 79% for the
PGYP1.out.tet and Cairns3 controls and 17% for the Wolbachia infected
PGYP1.out
line (P < 0.001, chi-square). In all three groups, CHIKV RNA was detected in
the
legs and wings immediately after feeding, as percentage of dissemination
(Table 4).
This may represent either direct contact between the legs and/or wings and the
blood/virus mixture or a rupture of the mesenteron, which released virus
directly in
CA 02707880 2010-06-17
79
the hemolymph (Turell, 1988). After day 0, CHIKV was not detected in the legs
and
wings of any PGYP1.out (+ Wolb) mosquitoes. In contrast, on all days post
exposure,
virus was detected in the legs and wings of PGYP.out.tet and Cainis3 control
mosquitoes (- Wolb) and by day 14, the virus was detected in the legs and
wings of
100% and 90%, respectively, of mosquitoes which had positive bodies and heads
(P
= 0.125, chi-square).
Wolbachia and Plasmodium
Considering that the viral interference effect appeared robust for two
unrelated
arboviruses we then went on to test for the effect on the protozoan parasite
P.
gallinaceum. While not a human pathogen, this species of malaria parasite is
known
to be able to infect A. aegypti mosquitoes in the laboratory.
Wolbachiainfected and
uninfected A. aegypti mosquitoes (PGYP1.out and PGYP1.out.tet strains) as well
as
a susceptible strain of Aedes fluviatilis were fed in parallel on P.
gallinaceum
infected chickens. A. fluviatilis has a broad geographical distribution in
Latin
America and has been used in the laboratory as a safe avian malaria (P.
gallinaceum)
model vector, as it does not naturally transmit DENV or yellow fever virus
(Tason de
Camargo and Krettli, 1981). Seven days post-feeding on infected chickens,
mosquito
midguts were dissected and the number of Plasmodium oocysts counted. The
presence of wMelPop-CLA Wolbachia significantly reduced the oocyst load in A.
aegypti mosquitoes (P<0.0001, Mann-Whitney U test) (Figure 25A and 25B) by 67
to 88%, in four independent experiments, in comparison to tetracycline treated
mosquitoes. Furthermore, the proportion of mosquitoes that contained oocysts
in the
midgut was significantly lower in PGYP1.out (43%), than in PGYP1.out.tet (74%)
or
A. fluviatilis (88%). To quantify the difference in parasite loads, fifteen
days after
infection mosquitoes were collected and the DNA was extracted. The relative
abundance of Plasmodium genomic DNA was measured by the 18S ssu rRNA gene
(Schneider and Shahabuddin, 2000) and normalized to the mosquito Actin gene
using
qPCR and the results showed the same pattern of interference as observed from
oocyst count data. In PGYP1.out mosquitoes Plasmodium genomic DNA was 26-fold
less abundant than in PGYP1.out.tet lines (Figure 25C). Immunofluorescence
CA 02707880 2010-06-17
analysis using an anti-CSP (Plasmodium circumsporozoite protein) monoclonal
antibody shows the presence of mature oocysts in both mosquito species (Figure
29B), but very rarely in Wolbachia-infected mosquitoes.
5 When we incubated the mosquito sections with an anti-Wolbachia (wsp)
antibody we
serendipitously discovered a Wolbachia infection in A. fluviatilis mosquitoes
indicating that this species of mosquito was naturally infected with
Wolbachia. PCR
using Wolbachia general wsp primers (Braig et al., 1998; Zhou et al., 1998)
amplified a fragment from all A. fluviatilis tested. Sequence of the amplified
DNA
10 indicated that this Wolbachia strain (named wFlu) belongs to the
Wolbachia B
supergroup and is distantly related to wMelPop-CLA. qPCR analysis revealed
that
the density of wFlu in A. fluviatilis is about 20-fold lower than the density
of
wMelPop-CLA in A. aegypti (Figure 30). We then examined the tissue
localization of
Wolbachia in both mosquito species and whereas wMelPop-CLA is distributed
15 throughout most tissues of the mosquito including the fat body, anterior
midgut,
muscle, nervous tissue, malpighian tubules and ovaries, wFlu is present only
in
ovaries, malpighian tubules and less frequently in the head, but absent from
ommatidia (Figures 26 and 31).
20 Immunity genes
To examine whether resistance of Wolbachia infected mosquitoes to pathogen
infection may be related to stimulation or priming of the mosquito innate
immune
system, we quantified the expression of a sample of immune genes. It was
recently
demonstrated that some immune genes are differentially regulated in A. aegypti
25 mosquitoes infected with dengue virus (Xi etal., 2008). Interestingly,
regulation of
the immune pathway genes in these mosquitoes was also stimulated by their
natural
gut microbiota and rearing mosquitoes aseptically, and so depleting their
bacterial
flora, resulted in a 2-fold increase of dengue virus in the midgut (Xi et al.,
2008). We
chose a subset of the genes that were shown to be upregulated upon dengue
virus
30 infection to assess the effect of Wolbachia infection on the mosquito
immune system.
CA 02707880 2010-06-17
81
The expression levels of eleven immune pathway genes in the wMelPop-CLA
infected PGYP1.out and its uninfected control line were compared for two
independently reared cohorts of mosquitoes (Figure 27). In each of the
experiments
four genes encoding representatives of the immune effector molecules cecropin,
defensin, thio-ester containing proteins (TEP) and C-type lectins were
significantly
upregulated in the presence of wMelPop-CLA, whereas FREP18 (fibrinogenrelated
protein 18) levels remained unchanged (Figure 27 A and B). In contrast, while
a
statistically significant (P <0.05) differential mRNA expression between
mosquitoes
with and without Wolbachia was observed for a subset of the genes from the
Toll,
IMD and Jak/STAT signaling pathways (Figure 27C Experiment 1- Rel 1A and
SOCS36E; Figure 27D Experiment 2 ¨ IMD and Rel 2) these differences were
inconsistent across the two experiments, suggesting that the variation between
cohorts was greater than any differences induced by Wolbachia. In addition, in
these
cases the fold-change of mRNA expression was low (below 2- fold), whereas the
effector genes were induced as much as 100-fold by the presence of Wolbachia
(Figure 27A and 27B). These results indicate that the presence of wMelPop-CLA
in
mosquitoes stimulates expression of at least some immune effector genes,
although a
clear stimulation of the classical innate immune signaling pathways was not
repeatably identified.
EXAMPLE 7
A VIRULENT WOLBACHIA INFECTION DECREASES THE VIABILITY
OF THE DENGUE VECTOR AEDES AEGYPTI DURING PERIODS OF
EMBRYONIC QUIESCENCE
Materials and Methods
Mosquito strains and maintenance
wMelPop-infected PGYP1 and tetracycline-cleared PGYP1.tet strains of Aedes
aegypti (see Example 2) were maintained at 25 C, 75-85% relative humidity,
with a
12:12 h light:dark photoperiod. Larvae were reared in plastic trays (30 x 40 x
8 cm)
at a set density of 150 larvae in 3 L distilled water, and fed 150 mg fish
food
(TetraMin Tropical Tablets, Tetra, Germany) per pan every day until pupation.
CA 02707880 2010-06-17
82
Adults were kept in screened 30 x 30 x 30 cm cages, and provided with constant
access to 10% sucrose solution and water. Females (5 days old) were blood-fed
using
human blood for egg production. For routine colony maintenance, eggs from
PGYP1
were hatched 5-7 days post-oviposition (i.e. without prolonged desiccation) to
initiate
the next generation. All fitness experiments with PGYP1 were conducted at G20
to
G22 post transinfection.
Pre-imaginal Development and Survivorship
Eggs (120 hold) from PGYP1 and PGYP1.tet strains were hatched synchronously in
nutrient-infused deoxygenated water for 1 h. After hatching, individual first
instar
larvae (n= 156 per strain) were placed into separate plastic 30 mL plastic
cups with
mL of water, and fed 1 mg powdered TetraMin suspended in distilled water each
day until pupation. The number of days spent in each pre-imaginal life stage
(i.e., 1st,
2 3rd
and 4th instars, pupae), mortality at each stage, and sex of eclosing adults
were
15 recorded every 24 h. Stage-specific development and eclosion times for
each strain
were compared using Mann-Whitney U(MWU) tests conducted in Statistica Version
8 (StatSoft, Tulsa, OK).
Adult Wing Length Measurements
20 As an indicator of adult body size, wing lengths of PGYP1 and PGYP1.tet
mosquitoes (n = 50 of each sex) derived from the pre-imaginal development time
assay were measured (Nasci, 1986). Wing lengths of males and females from each
strain were compared using MWU tests.
Viability of quiescent embryos over time
PGYP1 and PGYP1.tet females were blood-fed on human blood, and 96 h post-blood
meal isolated individually for oviposition in plastic Drosophila vials with
wet filter
paper funnels. After oviposition, egg papers were kept wet for 48 h, after
which time
they were removed from vials, wrapped individually in paper towel, and
conditioned
for a further 72 h at 25 C and 75-85% relative humidity. Egg batches were then
moved to their respective storage temperature of 18 C, or 25 C in glass
desiccator
CA 02707880 2010-06-17
83
jars; maintained at a constant relative humidity of 85% with a saturated KC1
solution
(Winston and Bates 1960). For each temperature, 20 oviposition papers from
each
strain were hatched at seven time points at 7 day-intervals (5 to 47 days post-
oviposition) by submersion in nutrient-infused deoxygenated water for 48 h. To
hatch
any remaining eggs, oviposition papers were dried briefly then submersed for a
further 5 days and before the final number of hatched larvae was recorded.
Regression analysis was used to detect trends in the viability of eggs from
each strain
overtime. MWU tests were used to compare viability of eggs between strains at
the
same storage age.
Lifetime Productivity Measurements
Replicate 30 x 30 x 30 cm cages containing 200 individuals of each sex from
PGYP1
and PGYP1.tet strains were maintained over multiple gonotrophic cycles, with
ad
libitum access to 10% sucrose solution and water, for the duration of their
lifespan.
During each cycle, females were provided with a human blood meal for 2 x 10
min
periods on consecutive days, and 96 h post-blood meal a random sample of
females
(n = 48) was collected from each cage and isolated individually for
oviposition.
Following a set 24 h period for oviposition, females were returned to their
respective
cages and the proportion of females laying eggs determined. Eggs were
conditioned
and hatched 120 h post-oviposition as described above, and the total number of
eggs
(fecundity) and hatched larvae (fertility) from each female were recorded. To
ensure
that gravid females not sampled for oviposition could also lay eggs every
cycle,
oviposition cups were introduced into each stock cage (96 h post-blood meal)
for a
period of 48 h. Females were then blood fed to initiate the next gonotrophic
cycle.
Cages were sampled until all females in the population were dead, which
occurred
after 7 and 16 gonotrophic cycles for PGYP1 and PGYP1.tet strains
respectively. To
ensure PGYP I .tet females did not become depleted of sperm, young males (3
days
old) were supplemented to this cage after 8 gonotrophic cycles. An analysis of
covariance (ANCOVA) was used to examine the relationship between mosquito
fecundity/fertility and the covariates mosquito age and infection status.
Regression
CA 02707880 2010-06-17
84
analysis was used to detect trends in fecundity/fertility of mosquitoes from
each
strain over their lifespan. Student's 1-test was used to compare the
fecundity/fertility
of mosquitoes from both strains of the same age.
Results
Pre-imaginal Development and Adult Size
No significant differences in development times for larval stages of wMelPop-
infected PGYP I or tetracycline-cleared PGYP1.tet males (Figure 32A) were
found
(MWU, P> 0.05 for all comparisons). In contrast, the mean development time for
male PGYP1 pupae (64.88 1.38 h) was significantly greater relative to
PGYP1.tet
(57.00 1.25 h) (MWU, U= 1892.00, P <0.001), resulting in a longer cumulative
time to eclosion for this strain (MWU, U= 1484.50, P <0.001). For females
(Figure
328), development times for immature stages were not significantly different
between strains; except for third instar larvae where PGYP1 development times
were
increased by 5 h relative to PGYP1.tet (MWU, U= 1929.00, P = 0.013). Despite
this delay, eclosion times for PGYP1 females were not significantly different
from
PGYP1.tet (MWU, U= 2185.50, P = 0.15). Overall, the survivorship of immature
stages from both strains to adulthood was identical (96.15%).
A comparison of the wing lengths of newly emerged adults from both strains
revealed a minor, yet statistically significant adult size cost to wMelPop
infection for
both sexes (Figure 33). Wing lengths of PGYP1 males (2.36 0.01 mm, n = 50)
were significantly shorter than those of PGYP1.tet males (2.46 0.02 mm, n=
50)
(MWU, U= 661.50, P <0.0001). A smaller size difference (MWU, U= 955.00, P =
0.04) was found between PGYP1 females (3.03 0.03 mm, n= 50) and PGYP1.tet
females (3.09 0.03 mm, n = 50).
Viability of quiescent embryos over time
The viability of quiescent embryos from the wMelPop-infected PGYP1 strain
decreased over time at 25 C and 18 C, whereas viability of embryos from of
the
tetracycline-treated PGYP1.tet strain was relatively stable at both storage
CA 02707880 2010-06-17
temperatures (Figure 34). At 25 C (Figure 34A), there was no significant
difference
in embryonic viability between PGYP1 (80.93 5.12%) and PGYP1.tet strains
(74.96 4.37%) at 5 days post oviposition (MWU, U= 146.50, P = 0.1478). As
quiescent embryos aged, however, PGYP1 embryonic viability decreased rapidly
5 over time (R2 = 0.6539, F1,140 = 260.73, P <0.0001), such that by 40 days
post
oviposition very few PGYP1 eggs hatched (0.44 0.24%). In contrast, PGYP1.tet
embryonic viability remained relatively constant over time (R2 = 0.0005,
F1,140 =
0.07, P = 0.7897) with ¨ 75% of quiescent eggs hatching at each time point. An
analogous trend was observed at 18 C (Figure 34B), where initially hatch rates
were
10 comparable between the two strains, but subsequently a greater loss in
embryonic
viability was observed for PGYP I (R2 = 0.4035, Fi,140 = 93.34, P < 0.0001)
relative
to PGYP1.tet (R2 = 0.0803, F1,140 = 12.05, P <0.001). This was particularly
evident
at 12 days post oviposition where embryonic viability declined more rapidly in
PGYP1 (9.88 2.96%) compared to PGYP1.tet (68.06 4.12 %) after being moved
15 to a cooler storage temperature (MWU, U= 5.00, P <0.0001).
Reproductive Output over Lifespan
PGYP1 and PGYP 1 .tet females had similar reproductive outputs in terms of the
number of eggs oviposited and the number of viable larvae hatched per female
during
20 their first gonotrophic cycle (Figure 35A and B). However, during
subsequent cycles
both fecundity (Figure 35A) and fertility (Figure 35B) of PGYP1 females
decreased
at an accelerated rate relative to those from the PGYP1.tet strain (ANCOVA, P
<
0.0001 for both comparisons). As PGYP1 females aged, the average number of
larvae produced per female decreased such that by the second cycle a 15% cost
to
25 reproductive output was observed relative to uninfected PGYP1.tet
females, which
progressively declined to a 40% cost by the fifth cycle (t-tests, P < 0.05 for
all
comparisons). A large proportion ofPGYP1 females that were randomly sampled
for
oviposition at the six and seventh gonotrophic cycles did not produce eggs
(Figure
35C), leading to a further decline in fecundity and fertility of this strain
(Figure 35A
30 and B). This appeared to be due to defects in feeding behaviour, as many
of these
older PGYP I females were observed to be unsuccessful in obtaining a blood
meal
CA 02707880 2010-06-17
86
(data not shown). Such a dramatic decrease in oviposition rates was not
evident for
PGYP1.tet females as they aged (Figure 35C).
EXAMPLE 8
WOLBACHIA INFECTION REDUCES BLOOD-FEEDING SUCCESS IN
THE DENGUE FEVER MOSQUITO, AEDES AEGYPTI
Materials and Methods
Mosquito rearing
For all experiments two laboratory lines of Aedes aegypti were used, the Aedes
aegypti PGYP1 line, previously generated by transinfection with wMelPop and
its
Wolbachia cured control line, PGYP1.tet (see Example 2). Mosquitoes were
reared at
26 2 C, RH 75% with 12h:12h light/dark cycle. Larvae were fed 0.1mg/larvae of
TetraMin Tropical Tablets once per day. Females were separated from males at
the
pupal stage and placed into 300mm3 cages for emergence at a density of 400
individuals per cage. The females were fed 10% sucrose solution ad libitum
until the
day before feeding trials.
Confirmation of infection status
Mosquito lines were screened to confirm presence (PGYP1) or absence
(PGYP1.tet)
of infection every two generations using a PCR based assay. Five days after
eclosion,
DNA was extracted from 10 females using DNeasy spin columns (QIAGEN,
Australia), following the Manufacturer's protocol. PCR was then carried out
using
primers for the IS5 transposable element present in Wolbachia (see Example 1).
Reaction conditions were as follows: 0.01-0.09 jig of each DNA sample, 2111 of
10x
Buffer, 0.51.11 1mM dNTPs, 0.5 I of 20 11M IS5 primers, 0.1411 Taq DNA
polymerase and water up to 20111. Samples were denatured for three minutes at
94 C
then cycled 34 times for 30 seconds at 94 C, 30 seconds at 55 C and one minute
at
72 C. This cycle was followed by a final 10-minute extension at 72 C in a MJ
Research PTC-200 Peltier Thermal Cycler (Geneworks Pty Ltd, SA). Presence of
the
expected size product was then confirmed by agarose gel electrophoresis.
CA 02707880 2010-06-17
87
Preparation for feeding trials
Experiments were conducted with five, 26 and 35-day-old adult mosquitoes.
Behaviours were measured in either small populations (proportion of population
fed,
number and length of attempted bites) or for single mosquitoes depending on
feasibility (response time to human, blood-meal weight). The afternoon prior
to each
trial the required number of mosquitoes were removed from their rearing cages
and
stored in mesh-covered holding buckets at a density of five mosquitoes per
bucket.
At the same time an additional population of five mosquitoes were set aside to
replace any mosquitoes that died during the starvation period. Mosquitoes were
starved of sucrose but given access to water for ¨ 16 hours until trials began
the next
morning. Prior to each trial, mosquitoes were transferred from holding buckets
into a
645cm3 cage and allowed to acclimate for 5 minutes. All human volunteers
cleaned
both of their forearms with 70% isopropyl alcohol wipes, rinsed their forearms
with
distilled water and dried them with paper towel, and placed latex gloves on
both their
hands before feeding.
Population trials
All population trials were carried out in two cages placed next to one
another. One
cage contained five PGYP1 mosquitoes and the adjacent cage contained five
PGYP1.tet mosquitoes. The position (left or right) of the two lines was
randomised
throughout the experiment. Volunteers inserted their left and right arms into
the
respectively into the two cages and rested their hands on buckets placed
within each
cage. Both the volunteer and an external assistant monitored the number of
attempted
bites each mosquito made on the volunteer's forearm. An attempted bite was
recorded when a mosquito landed and actively attempted to probe the
volunteer's
skin at a location. A single mosquito could probe multiple times at a single
location,
but if a mosquito moved to a new position and attempted to probe again this
new
location was recorded as another attempted bite. Mosquitoes in both cages were
monitored for 15 minutes before the volunteer shook their arms and withdrew
both
arms from the cages. Mosquito abdomens were examined for presence of a blood
meal and the proportion of the population that imbibed a blood meal was
recorded.
CA 02707880 2010-06-17
88
This experiment was replicated with six volunteers (3 female, 3 male) x 4
replicate
trials for each of the three adult mosquito age classes.
Individual trials
A single mosquito from each line was separately aspirated into on a pre-
weighed
1.5ml Eppendorf tube and weighted on a Satorius BP211D balance (Selby
Biolabs).
Each mosquito was then released simultaneously into the adjacent 645mm3 cages.
Randomisation of cage position, mosquito settlement time and trial length were
as
per population trials. The volunteer inserted his arms into the cage and the
times at
which mosquito's made their first attempted bite (host-seeking time) were
recorded
by the volunteer into a voice recorder (Olympus VN-1100). After the trial,
mosquitoes were transferred back into the tubes they were originally weighed
in and
the tubes were re-weighed. The weight of the blood-meal imbibed by each
mosquito
was then calculated. The volunteer (male) hosted four groups of 10 mosquitoes
from
each of the three age classes.
Statistical analysis
All analysis was conducted using STATISTICA v8 (StatSoft, Inc). The variables,
host-seeking time and blood-meal weight were normally distributed. The number
of
attempted bites was transformed by square root to achieve normality. The role
of
infection and age on these variables was examined using general linear mixed
models. The role of human volunteer was not examined as there were only 6
replicate
individuals and they were internally controlled. When infection status was
significant, t-tests were then used to further identify specific differences
between
infected and uninfected lines within each of the three age classes. The
proportion of
mosquitoes obtaining a blood meal did not respond to transformation and so non-
parametric Mann Whitney U-tests tests were employed instead of linear models
to
examine differences between infected and uninfected mosquitoes for all three
ages.
Results
Host seeking
CA 02707880 2010-06-17
89
If the Wolbachia infected mosquitoes were hungrier than uninfected
counterparts
they might be more rapid in their response to an offered human forearm. Over
the
short distances in a laboratory cage environment, infected mosquitoes were no
different to uninfected controls (F = 0.10, df= 1, P = 0.77) in the time it
took them to
land on the human volunteer and initiate an "attempted bite" (Figure 36). Age
of the
mosquitoes was also not a significant determinant of time to first "attempted
bite" (F
= 0.99, df= 2, P = 0.43). These data suggest that wMelPop does not alter
mosquito
capacity to sense and respond to human hosts in the laboratory.
"Attempted biting"
The number of "attempted bites" made by infected mosquitoes was examined as a
possible indicator of hunger. As per our methods, an attempted bite included
both
probing and attempted probing in a particular region on the arm. Given the
cage
sizes and numbers of mosquitoes involved we could not visually differentiate
between a probing event that broke the skin and one that did not. See the
subsequent
associated study by Moreira et al. for dissection of biting behaviour into
successful
and unsuccessful probing events (see Example 9). Infection status (F = 13.37,
df= 1,
P = 0.014), age of mosquitoes (F = 5.72, df= 2, P = 0.021), and the
interaction
between age and infection status (F = 5.76, df = 2, P = 0.021) were
significant
determinants in the number of attempted bites made. In particular, Wolbachia-
infected mosquitoes at 26 (t = -3.70, df= 238, P <0.001) and 35 days of age (t
= -
5.35, df= 235, P < 0.001) attempted to bite more than their uninfected
counterparts
(Figure 37). This was not the cased for five-day-old mosquitoes (t = -1.12, df
236, P
= 0.26). The significant interaction between infection status and age as
reported
above is seen in the increase in biting attempts by infected mosquitoes in the
older
age classes (Figure 37). For example, if we directly compare infected 26-day-
old
versus 35-day-old mosquitoes we see an increase (t = -2.70, df= 235, P =
0.0073) in
the mean number of attempted bites while this is not the case for uninfected
mosquitoes (t = 1.72, df= 238, P = 0.085). Lastly, we also measured the length
of
time each mosquito spent on an attempted bite (data not shown), which was not
influenced by infection status (F = 0.75, df= 1, P = 0.45) or age (F = 1.68,
df= 2, P
CA 02707880 2010-06-17
= 0.26) of the mosquitoes. These data suggest that as Wolbachia infected
mosquitoes
age they are exhibiting a greater number of attempted bites than uninfected
mosquitoes, but are not spending more time on any one attempt. In a subsequent
study (see Example 9), it was shown that Wolbachia infected mosquitoes were
5 actually less likely to pierce the skin and obtain a blood meal compared
with
uninfected mosquitoes and that this effect worsened with age.
Blood meal acquisition
Blood-meal weight (Figure 38) was examined as a measure of feeding success in
the
10 infected mosquitoes. Linear models revealed that blood-meal weight could
be
partially explained by the infection status (F = 87.07, df = 1, P <0.001) and
age of
mosquito (F = 16.87, df = 2, P <0.001). There was also a significant
interaction
between age and infection status (F = 5.59, df = 2, P = 0.004). The blood-meal
weight of wMelPop-infected mosquitoes was smaller than uninfected mosquitoes
for
15 all ages examined, (5d, t = -2.80, df = 67, P = 0.007; 26 d, t = -7.15,
df = 67, P <
0.001; 35d, t = -6.09, df = 66, P <0.001) with the differential increasing
with age
(Figure 38). If infected mosquitoes were on average smaller than their
uninfected
counterparts, then smaller blood-meal weights would also be expected. A
comparison
of average weights of the infected and uninfected mosquitoes' pre-blood meal
20 indicated there were no size differences between the lines, PGYP I and
PGYP I .tet (df
= 204, t = 1.57, P = 0.11). The median proportion of mosquitoes that imbibed a
blood
meal (Figure 39) was also reduced for infected 26 (Z = 4.10, P < 0.001) and 35-
day-
old (Z = 5.39, P <0.001), but not 5-day-old (Z = 0.83, P = 0.74) mosquitoes
relative
to uninfected. These data indicate that as Wolbachia infected mosquitoes age,
an
25 increasing proportion of the population fails to successfully obtain a
blood meal and
that when they do feed the meals are smaller.
Behavioural observations
Normally during biting a mosquito may probe unsuccessfully, but will
ultimately
30 insert its stylet into a host. In this study, infected mosquitoes were
observed in which
the proboscis repeatedly bent as the mosquito pushed its head towards the skin
while
CA 02707880 2010-06-17
91
probing. This phenotype appeared to be correlated with old age and poor
ability to
obtain a blood meal. Due to its correlation with old age, the behaviour was
not
observed in the study until much of the other work was completed, hence its
quantification and correlation with biting success is reported in another
study (see
Example 9).
EXAMPLE 9
HUMAN PROBING BEHAVIOUR OF AEDES AEGYPTI WHEN
INFECTED WITH A LIFE-SHORTENING STRAIN OF WOLBACHIA
Materials and Methods
Mosquitoes
Aedes aegypti mosquitoes, wMelPop infected (PGYP1) and its Tetracycline-cured
counterpart (PGYP1.tet) (see Example 2), were kept in a controlled environment
insectary at 25 C and 80% RH. Larvae were maintained with fish food pellets
(Tetramin, Tetra) and adults were offered 10% sucrose solution, ad libitum.
Adult
females were fed on human blood for egg production and eggs were dried for at
least
96 h prior to hatching.
Behaviour assays
Fertilized and non-blood fed females of different ages (5, 15, 26 and 35 days
old)
were used in all behaviour experiments. Sucrose solutions were removed from
cages
on the night before the experiments. Forty females were used per age and per
infectious status. Single mosquitoes were transferred to a transparent Perspex
cage
(25 cm3) and filmed through a digital camera with 6mm Microlens (IEEE-1394,
Point Grey Research) mounted on a tripod. Mosquitoes were given about five
minutes to settle within the cage before a human gloved-hand was inserted into
the
cage. A window of about 15 cm2 was cut of the upper part of the latex glove in
order
to delineate the probing field.
Movies were recorded (QuickTime Player) for a maximum of 10 minutes or until
blood was seen within the mosquito midgut and subsequentially watched for time
CA 02707880 2010-06-17
92
calculations. Two electronic timers were used, one for recording pre-probing
time
and the second for probing time. Pre-probing time was defined and the time
since the
mosquito has landed on the bare hand area until the insertion of mouthparts
into the
human skin. Probing time is defined as the initial insertion of insect
mouthparts until
blood can be seen within the mosquito midgut through the abdominal pleura
(Ribeiro
et al., 1984). Timing stopped when mosquitoes left the bare hand area or
withdrew
their mouthparts before taking blood and began again when the mosquito came
back
or after subsequent stylet penetration. If blood was not found by the end of
10
minutes, we defined this case as unsuccessful probing and it was measured as a
proportion. Movies were also used to visualize additional abnormal phenotypes
as the
uttering action of mosquito body while landed on top of the human hand, and
named
"shaky". Furthermore, the inability of mosquitoes to insert their mouthparts
due to a
bendy proboscis (Example 8) was also analysed.
Mosquito Saliva collection
Mosquitoes of different ages (5, 26 and 35-days-old) and infectious status
were
starved overnight (without sucrose solution or water). On the following
morning
mosquitoes were briefly anesthetized with CO2 and placed on a glass plate over
ice.
Wings and legs were removed with forceps and their proboscis introduced into a
lcm
piece of polypropylene tubing (0.61 x 0.28mm, Microtube Extrusions, NSW,
Australia) (see Ribeiro et al., 1984). Females were allowed to salivate for 5
minutes
and then the diameter of the saliva droplets was measured through an ocular
micrometer at 40X magnification. Volumes were calculated via the sphere
formula
(Novak et al., 1995). Saliva was then collected into 20 L of 0.05mM Tris-HC1
pH
7.5 by attaching the needle of a 10 L Hamilton syringe and rinsing the tubing
content a few times. Samples were centrifuged at 14,000g for 2 minutes and
kept
frozen (-80 C) in 20 1_, of 0.05mM Tris-HC1, pH 7.5 for enzymatic assay (see
below).
Apyrase Assay
Saliva samples (8 L) were transferred, in duplicates, into individual wells of
a plastic
CA 02707880 2010-06-17
93
96-well ELISA plate (NUNC Maxisorp). For the blank, 8 ttL of the 0.05mM Tris
buffer was added to the wells. To each well, 100 tiL was added of a mixture
containing 100mM NaC1, 50mM Tris¨HC1 (pH 8.95), 5mM CaC12, 2mM ATP and
20 mM B-Mercapthanol. The plate was incubated at 37 C for 10 min and then the
reaction was immediately stopped, by adding 25uL of acid molybdate solution
(1.25% ammonium molybdate in 2.5mM H2SO4). Immediately after termination of
the reaction, 24 of a reducing solution (0.11mM NaHS03, 0.09mM Na2S03 and
8mM 1-amino-2-naphthol-4-sulphonic acid) was added to each well and the plate
was incubated at 37 C for 20 min (Novak et al., 1995). Plates were read at a
FLUOstar OPTIMA ELISA plate reader (BMG Technologies) at 660nm. Readings
were quantified by comparison with an inorganic phosphate standard curve (1,
0.5,
0.25, 0.125, 0.06125, 0.03125, 0.015625 mM of sodium phosphate).
PCR confirmation of mosquito infection status and saliva screening
Wolbachia infection was confirmed through PCR to detect both mosquito (apyrase
gene: ApyF: 5'-TTTCGACGGAAGAGCTGAAT-3' and ApyR: 5'-
TCCGTTGGTATCCTCGTTTC-3') and Wolbachia (IS5 -F: 5'-
CTGAAATTTTAGTACGGGGTAAAG-3' and 1S5-R: 5'-
CAAGCATATTCCCTCTTTAAC-3') sequences. Saliva screening to check the
presence of Wolbachia was done via PCR (with IS5 primers) using saliva samples
of
infected and non-infected mosquitoes. Mosquito sequences in this case were
detected
with primers for the ribosomal protein gene RpS17 (Cook et al., 2006).
Statistical analysis
In all cases, general linear models were employed to examine the effects of
the
variables age and infection status and their interaction with one another.
Models
demonstrating significance for the variable infection status were then
followed by
individual t-tests examining the differences between infected and uninfected
mosquitoes for each age class. The proportion of infected and uninfected
mosquitoes
that obtained blood meals were examined using Mann-Whitney U tests instead of
linear models, given the deviation of the data from normality. Chi-square 2 X
2
CA 02707880 2010-06-17
94
contingency tests were employed to examine the relationship between observed
behavioural traits and lack of feeding success. The correlation between these
traits
was quantified using a cox-proportional hazards model for age, with the
behavioural
traits and lack of blood meal success covariates. All statistical analyses
were carried
out in STAT1STICA v8 (StatSoft, Inc. Tulsa, OK).
Results
Pre-probing time
We measured the time mosquitoes spent from first contact with a human
volunteer
until the insertion of the insect's mouthparts as a measure of pre-probing
time. All
feeding trials were carried out with individual mosquitoes, which had been
starved
prior to the assay, at four adult ages (5, 15, 26 and 35-days-old). Mosquitoes
that
never successfully achieved a blood meal were excluded from this analysis.
Overall
both age (df= 3, F = 13.73, P <0.0001) and infection status (df= 1, F = 23.18,
P <
0.0001) had a significant effect on the length of pre-probing time. On average
infected mosquitoes spend more time pre-probing especially as they age (Figure
40).
This change with age is clearly exhibited by a significant interaction between
the
variables age and infection status (df= 3, F = 8.11, P <0.0001). At five days
of age
infected and uninfected mosquitoes do not differ in their pre-probing time
(df= 78, t
= 0.63, P = 0.52), which lasted on average 11 seconds. Uninfected mosquitoes
maintained the same foraging time as they aged, while wMelPop insects
exhibited a
steady and significant increase (15d: df= 75, t = -3.37, P = 0.0012; 26d: df=
63, t = -
4.17, P =0.014; 35d: df= 48, t = -2.25, P = 0.0034), reaching a mean length of
45 sec
by 35 days of age (Figure 40).
Probing time
In the same feeding trials described above, the length of time between
insertion of
mouthparts and the first visible sign of blood in the abdominal pleura
(Ribeiro etal.,
1984) was recorded as probing time for the mosquitoes. As with pre-probing
time,
the variables of age (df= 3, F = 11.36, P <0.0001), infection status (df= 1, F
=
29.46, P <0.0001) and the interaction (df= 3, F = 10.56, P <0.0001) between
these
CA 02707880 2010-06-17
two variables were highly significant. Infected and uninfected mosquitoes did
not
differ in their probing time (¨ 33 sec) at 5 (df = 78, t = -0.46, P = 0.64)
and 15 (df =
75, t = 1.43, P = 0.15) days of age (Figure 41). In contrast, infected
mosquitoes at 26
(df = 63, t= -3.76, P < 0.001) and 35 (df = 48, t= -4.06, P < 0.001) days of
age took
5 significantly longer during probing, exhibiting up to a seven-fold
increase in their
probing time relative to uninfected mosquitoes (Figure 41).
Blood meal acquisition
In the assays detailed above we then compared the ability of infected and
uninfected
10 mosquitoes to obtain blood meals (Figure 42) using Mann-Whitney U tests.
At 5 (Z =
0, P = 1) and 15 (Z = 0, P = I) days of age infected and uninfected mosquitoes
did
not differ in their success. At 26 (Z = -2.39, P = 0.020) and 35 (Z = -2.39, P
= 0.020)
days of age infected mosquitoes were less successful at obtaining blood meals
in
comparison to their uninfected counterparts.
Number of probings
It is important to note that as infected mosquitoes aged, the frequency of
events
where they pierced the skin did not increase despite failed attempts at
feeding (Figure
43). A general linear model revealed that age (df = 3, F = 20.47, P < 0.0001),
infection (df = 3, F = 29.12, P <0.0001) and age X infection (df = 3, F =
27.18, P <
0.0001) were significant determinants of the number of probings. Subsequent t-
tests
comparing the number of probings between infected and uninfected mosquitoes at
each of the age points (data not shown), however, demonstrated that only 35
day old
(df = 1, t = -8.44, P <0.0001) mosquitoes differed. In this case, uninfected
females
probed more on average per session (1.05 0.05) than wMelPop infected
mosquitoes
(0.3 0.073). This is due to other behaviours, which impaired the infected
mosquitoes to feed (see below).
Additional behavioural phenotypes
In other work we have reported the appearance of a "bendy" proboscis in
association
with wMelPop, which was the inability of the mosquito to properly orient its
CA 02707880 2010-06-17
96
mouthparts and insert the stylet into the skin (Example 8). During the feeding
trials
in this study we quantified the occurrence of this trait. The bendy proboscis
was
never observed in any of the uninfected mosquitoes regardless of age, nor was
it
present in 5 day-old infected mosquitoes. The trait first appeared at a low
level
(2.5%) in 15 day-old mosquitoes and rose to a frequency of 65% by 35 days of
age
(Figure 44). Another phenotype observed, although in lower frequencies, was
the
jittering action of the insect body (named here as "shaky") when the mosquito
was
sitting on top of the human hand (Figure 44). The association between each of
these
traits and lack of success in blood meal acquisition was explored using 2 X 2
contingency tests in each of the age classes where the trait was expressed.
There was
a significant association between the failure to obtain a blood meal and both
the
bendy phenotype (26d: df = 1, x2 = 14.1, P = 0.0002; 35d: df = 1, x2 = 11.8, P
--
0.0006) and the shaky phenotype (35d: df= 1, x2 = 4.2, P = 0.038). Using
survival
analysis we obtained estimates of the correlation between lack of feeding
success and
the bendy phenotype (0.63) and the shaky phenotype (0.19). These correlations
reveal
the presence of a relationship between the traits and success in feeding, but
do not
completely explain lack of success. There are mosquitoes in the older age
classes that
fail to feed and that are not shaky or bendy. To discard any possibility that
this other
abnormal phenotypes were due to the lack of blood feeding, which could have
physiologically compromised the mosquitoes we also blood fed females of both
groups when they were 3 to 5-days-old and then after 38 days evaluated their
feeding
behaviour. None of the wMelPop mosquitoes were able to feed and all presented
the
bendy proboscis, although all the tetracycline-treated mosquitoes successfully
imbibed blood (data not shown).
Saliva volume and apyrase activity
To check whether the probing behaviour and the additional phenotypes we
observed
were due to differences in saliva volume and salivary gland apyrase activity
we
measured both traits in infected and uninfected mosquitoes at three adult
ages.
Apyrase activity (Figure 45A) did not differ in infected and uninfected
mosquitoes
regardless of age (df = 1, F = 0.44, P = 0.51). Infection status (df = 1, F =
11.99, P <
CA 02707880 2010-06-17
97
0.01) and age (df= 2, F = 14.54, P <0.0001), however, were determinants of
saliva
volume (Figure 45B) and on average infected mosquitoes produced less saliva.
When saliva volumes of infected and uninfected mosquitoes were compared to
each
other for each age class, only the 26 days old mosquitoes were significantly
different
(df 1, t = -2.9, P < 0.01).
Evidence of Wolbachia in the saliva
In an attempt to interpret the effects of Wolbachia on host-feeding behaviour
we
tested for the presence of Wolbachia in the saliva and salivary glands of
infected
mosquitoes. PCR amplification of the Wolbachia wsp gene or mosquito apyrase
has
shown only the presence of Wolbachia in salivary glands, but not in saliva
(Figure
46. The transposable element IS5, present in at least 13 copies within the
bacteria
genome (Wu et al., 2004), was also used in extra samples as a very sensistive
PCR
target (N=16 of each group) but no amplification was obtained . These results
are
supported by the size of the intracellular Wolbachia (around 1jtm in diameter)
(Min
and Benzer, 1997) and the diameter of mosquito salivary ducts (also about 1
jtm)
(Janzen and Wright, 1971), which indicate that even if Wolbachia was able to
be
present in the secreted salivary fluid it would be unlikely to be able to
freely move
through the salivary ducts.
EXAMPLE 10
UNIQUE GENETIC FEATURES OF THE LIFE-SHORTENING
WMELPOP-CLA WOLBACHIA STRAIN
We have recently sequenced the complete wMelPop and wMelPop-CLA genomes
and we have identified, by using a comparative genomics approach, a series of
mutations that have occurred during the 3 years in cell culture. These
mutations are
part of the wMelPop-CLA strain present in the transinfected Aedes aegypti
mosquitoes.
The wMelPop-CLA strain has at least 5 major genetic differences with the
original
wMelPop strain. These differences include gene insertions, deletions and
single
CA 02707880 2010-06-17
98
nucleotide polymorphisms (SNPs). The combination of these 5 elements is unique
to
wMelPop-CLA and can be used to differentiate this strain from any other
Wolbachia
strain, including very closely related strains such as wMeICS. As a result of
these
genetic differences, the wMelPop-CLA genome is approximately 20952bp smaller
that wMelPop (1247197bp vs 1268149bp).
wMelPop-CLA unique genetic features
SNP in gene WD0200
The gene WD0200 encodes for a hypothetical protein, according to the wMel
genome
annotation (Wu et al., 2004). During the adaptation of wMelPop to mosquito
cell
culture in our laboratory, the sequence of this gene has mutated resulting in
the
substitution of a C residue for a T in wMelPop-CLA (Figure 47). This
nucleotide
change results in the replacement of an aspartic acid (D) for asparagine (N)
in the C-
terminus of the encoded protein. The presence of this mutation has been
confirmed
by PCR and sequencing of the wMelPop and wMelPop-CLA strains.
10bp deletion in gene WD0413
Gene WD0413 encodes an aspartyl-tRNA synthetase (asp,S) [6.1.1.12] involved in
protein biosynthesis. Following the sequencing of wMelPop and wMelPop-CLA
WD0413 we have identified a 10 bp deletion in wMelPop-CLA that was not present
prior to cell culture adaptation (Figure 48).
This 10 bp deletion occurs just before the TGA stop codon and creates a
frameshift
that extends the wMelPop-CLA encoded protein by an extra 10 aminoacids before
a
new stop codon is read (Figure 49).
IS5 element insertion
IS5 insertion elements are common transposable elements identified in several
Wolbachia genomes. The IS5 insertion element is 918 bp long and is constituted
by
two ORFs (OrfA and B), flanked by a terminal inverted repeat. The closely
related
wMel Wolbachia genome, (Wu et al., 2004), contains 13 identical 1S5 elements.
CA 02707880 2010-06-17
99
wMelPop also contains 13 IS5 elements, although 2 of them have translocated
when
compared to wMel.
The novel IS5 insertion present in the wMelPop-CLA strain is located in the
intergenic region between the genes WD0765 and WD0766 (Figure 50). WD0765
encodes a Na/H+ ion antiporter family protein, whereas WD0766 encodes an
ankyrin
domain protein. The role of both proteins in Wolbachia is currently unknown,
although the expression of these two genes is probably affected by the
insertion of
this IS5 element in the middle of their promoter region.
21.6 Kb deletion
The wMelPop-CLA strain contains a 21.6Kb deletion when compared to the
original
wMelPop strain (Figure 51). This deletion includes 13 genes (WD0506 to
WD0518),
whose putative function is listed in Table 7. Since the 2 genes flaking the
deletion
(WD0506 and WD0518) are the result of a duplication event and have similar
sequences, the exact coordinates of the 21.6kb deletion are difficult to
determine.
Several of the genes present in the deletion have homologues elsewhere in the
genome, and 3 of them (WD0512, WD0513 and WD0514) are part of an operon in
those strains (wMel, wMelPop, wMeICS) where the genes are present.
The presence of a similar 21.6Kb deletion was previously described by our
group in
the wAu Wolbachia strain (Iturbe-Ormaetxe et al., 2005), although none of the
other
four wMelPop-CLA unique features have been found in wAu.
We have also identified WD0513 as a potential candidate for horizontal gene
transfer
between mosquitoes and Wolbachia (Woolfit et al., 2009).
Insertion of a G in gene WD0758
Gene WD0758 encodes for a glutaredoxin family protein. This gene contains an
extra
G at position 196 in wMelPop-CLA when compared with its counterpart in
wMelPop. This mutation creates a premature stop codon in wMelPop-CLA and as a
consequence, the WD0758 protein is 46 residues shorter in wMelPop-CLA than in
CA 02707880 2010-06-17
100
wMelPop (Figure 52). The effect of this mutation on the function of WD0758 is
currently unknown.
PCR characterization of unique wMelPop-CLA features
Three of the 5 described genetic features that distinguish wMelPop-CLA from
its
predecessor wMelPop can be easily identified and diagnosed by PCR, as shown in
Figure 53. The identification of the SNP in WD0200 and the insertion of a G in
WD0758 require PCR-amplification and sequencing.
DISCUSSION
The use of an in vitro cell culture system provided an ideal means to examine
the
adaptation of Wolbachia to a novel host environment. This approach contrasts
with
directly transferring Wolbachia between insects, where selective forces are
presumably different and more complex, and where longer insect generation
times,
vertical transmission, and the labour intensive nature of rearing live insects
make
selection for transinfected lines challenging.
The initial difficulty in establishing wMelPop infection in the Aedes
albopictus cell
line Aa23 demonstrated that wMelPop was not naturally pre-adapted for growth
in
mosquito cells. Following stable infection of Aa23 and serial passage for
several
years, wMelPop was successfully established in Aedes aegypti RML-12 and
Anopheles gambiae MOS-55 cell lines, two species that are not naturally
infected by
Wolbachia (Curtis and Sinkins, 1998; Kittayapong etal., 2000; Rasgon and
Scott,
2004; Ricci et al., 2002; Tsai et al., 2004).Transfer of wMelPop between Aa23
and
these two mosquito cell lines occurred much more readily than the initial
transfer
from D. melanogaster to Aa23, potentially due to (i) a higher infective dose
of
wMelPop purified from Aa23 and used for transfer; and (ii) a smaller
divergence in
intracellular environments among these mosquito cell lines as opposed to the
initial
transfer from Drosophila. The cell line-adapted Wolbachia displayed reduced
infectivity and maternal transmission when injected back into its original
Drosophila
host. It grew to lower densities and showed phenotypic shifts for both life-
shortening
CA 02707880 2010-06-17
101
and CI expression. Taken together, these results provide evidence for the
active
genetic adaptation of wMelPop to mosquito cell lines during long-term serial
passage.
A comparison of results from this study, with simulations from recent
theoretical
models that examine the potential of life-shortening Wolbachia to modify
mosquito
population age structure (Brownstein etal., 2003; Rasgon et al., 2003),
suggests that
wMelPop should be able to initiate a population invasion of A aegypti. Given
the
relationship that exists between mosquito survival and vectorial capacity
(Garett,
1964; MacDonald, 1957), if the longevity of adults A aegypti can be
approximately
halved under field conditions, as observed in our laboratory experiments, then
the
introduction of life-shortening Wolbachia strains would be predicted to reduce
pathogen transmission and the incidence of human disease.
Vertically inherited parasites like Wolbachia are predicted to evolve towards
reduced
virulence over time (Lipsitch and Moxon, 1997). Unlike chemical insecticides,
biological agents that induce mortality in late life, such as wMelPop or
entomopathogenic fungi, are expected to impose relatively weak selection
pressures
for the evolution of resistance (Thomas and Reed, 2007). This is because the
majority of individuals in the population are able to initiate several
reproductive
cycles prior to death, minimizing costs to reproductive output. Moreover,
since the
initial description of wMelPop in D. melanogaster over ten years ago, no signs
of
resistance to life-shortening have emerged in laboratory stocks.
Furthermore, our finding that the wMelPop Wolbachia infection eliminates the
ability
of dengue virus to establish a productive infection has significant
implications for
any future control measure based on the use of life-shortening Wolbachia. Life-
shortening effects on mosquitoes would become secondary and only act on any
rare
individuals that might escape the direct interference effect. We could also
presume
that because of the observed effects on dengue virus accumulation that any
mosquitoes that did escape the interference effect despite the presence of
Wolbachia
CA 02707880 2010-06-17
102
would likely have extended extrinsic incubation periods. This in turn would
act
synergistically with the life-shortening effect to eliminate dengue virus
transmission.
Our recent studies have also revealed that, as A. aegypti infected with
wMelPop-CLA
age, they show increasing difficulty in completing the process of blood
feeding
effectively and efficiently. These effects on blood feeding behaviour may
reduce
vectorial capacity and point to underlying physiological changes in Wolbachia-
infected mosquitoes.
Thus, the ability of Wolbachia to spread into A aegypti and A. anopheles
populations
and persist over time may provide an inexpensive approach to dengue and
malaria
control, particularly in urban areas that are less amenable to conventional
control
strategies. Given the ability of wMelPop to induce life-shortening,
cytoplasmic
incompatibility, altered feeding behaviour, and reduced pathogen
susceptibility in a
range of insect hosts, this strategy may be broadly applicable to reduce
pathogen
transmission by other insect disease vectors of medical or agricultural
importance.
The fact that many insect species are infected with Wolbachia raises the
possibility
that Wolbachia-mediated antiviral protection could be a widespread phenomenon.
To
test the generality of Wolbachia-mediated antiviral protection further, the
inventors
used D. simulans and its naturally occurring Wolbachia infections.
Wolbachia strains vary both between host species and within a host species
(see for
example Casiraghi et al., 2005). Naturally occurring Wolbachia strains in D.
melanogaster ubiquitously protect against DCV (see Example 4 and Teixeira et
al.,
2008), however these strains are very closely related (Riegler et al., 2005).
Wolbachia is maternally inherited and therefore has a close association with
its host.
Using D. sunulans fly lines that are naturally infected by different Wolbachia
strains
we showed that some strains did not mitigate virus-induced mortality. Strains
wAu
and wRi protected the CO and DSH host flies respectively. In contrast, neither
wHa
nor wNo protected their host lines from DCV induced mortality. Phylogenetic
CA 02707880 2010-06-17
103
analysis indicates that the D. simulans Wolbachia strains wAu and wRi are most
similar to wMel. Whereas of the phylogenetic supergroup A strains, wHa is the
most
divergent to wMel, and wNo belongs to supergroup B (Zhou et al., 1998;
Casiraghi et
al., 2005). This may suggest that there is a Wolbachia feature involved in
antiviral
protection, which is conserved among strains more closely related to wMel.
With the exception of the Me29 flies infected by wMel, natural host- Wolbachia
combinations were used. The D. simulans Wolbachia strains are known to be
associated with different mitochondrial haplotypes (Ballard, 2000) and we did
not
control for host nuclear genetic background which can have an impact on virus
infection (Teixeira et al., 2008). As a consequence it is not possible to rule
out that
intrinsic variability in susceptibility to virus that is linked to the host
background has
an influence on the outcome of Wolbachia-mediated protection in our
experiments.
Indeed there is variation in the time to death of Wolbachia-free D. simulans
lines
used in this study when challenged with DCV (see Figure 19), although
interestingly
these same Wolbachia-free lines showed similar time to death when challenged
with
FHV (see Figure 21). Antiviral protection was observed in both D. melanogaster
and
D. simulans when infected with wMel. This indicates that antiviral protection
mediated by Wolbachia can be transferred between different host species.
Since protection against DCV was not seen in all the fly lines infected with
the
Wolbachia strains, we tested whether there is specificity in protection
against
different viruses. Infection of D. melanogaster by Wolbachia protected the
flies from
all RNA viruses tested (see Example 4 and Teixeira et al., 2008). Although
each of
these viruses was a non-enveloped, positive sense RNA virus, the viruses come
from
a broad spectrum of virus families. Compared to DCV the most divergent of
these
viruses is FHV. DCV is a member of the Dicistroviridae family and has a single
genomic RNA that is not capped but is polyadenylated (Christian etal., 2005).
The
genome is a bicistronic mRNA from which the structural and non-structural
polyproteins are translated via internal ribosome entry sites (Wilson et aL,
2000;
Johnson and Christian, 1998; Sasaki and Nakashima, 1999). DCV RNA replication
CA 02707880 2010-06-17
104
occurs on membranes derived from the golgi (Cherry et al., 2006). In contrast,
the
nodavirus FHV genome comprises two mRNA sense RNAs which are capped but not
polyadenylated and a third subgenomic RNA is synthesised during replication
(Ball
and Johnson, 1998). FHV genome replication occurs on mitochondrial membranes
(Kopek etal., 2007; Miller et al., 2001). Interestingly, although DCV and FHV
have
distinct infection cycles the same Wolbachia strains protected D. simulans
lines from
both DCV and FHV induced mortality. This suggests that the mechanism of
protection from virus-induced mortality may be common across diverse viruses,
although it is not currently known what the mechanism of viral pathogenesis is
in
flies infected with either DCV or FHV. It remains to be seen whether the same
host-
Wolbachia combinations that do or do not protect against DCV and FHV have
similar outcomes for other viruses, or indeed other types of pathogens.
Concurrent with protection from virus induced mortality in D. melanogaster was
a
delay in accumulation of DCV (see Example 4). Here a similar result was seen
with
wMel protection in D. simulans, the amount of infectious virus accumulated 2
dpi
was significantly lower in Wolbachia infected flies. By 10 dpi the DCV titre
in
Wolbachia infected flies was similar to the day 2 titre for Wolbachia-free
flies. This
may suggest that the resistance to DCV accumulation protects the flies from
DCV
induced mortality, however, the results observed with the D. simulans
Wolbachia
strains complicate this interpretation. The CO flies infected with wAu
survived DCV
infection beyond 30 dpi, whereas the Wolbachia-free flies were clearly
susceptible to
DCV-induced mortality. wAu infected flies had by 10 dpi accumulated high
titres of
DCV and the virus titre remained high at 30 dpi. This shows that wAu infected
flies
were tolerant of DCV infection, that is the virus accumulated but did not
cause
mortality (Schneider and Ayres, 2008). Interestingly, although wRi-infected
DSR
flies were protected from DCV induced mortality, at 2 dpi there was no
difference in
virus accumulation in flies with and without wRi. We cannot rule out that
accumulation was delayed in wRi-infected flies earlier than 2 dpi.
Taken together our results indicate that Wolbachia-mediated antiviral
protection
CA 02707880 2010-06-17
105
could arise in flies in two ways. Wolbachia can interfere with the virus
infection
cycle to delay virus accumulation, that is, it can induce resistance to virus
infection in
the host. In addition Wolbachia infection can protect flies from the
pathogenesis
associated with virus infection, that is, it can increase host tolerance to
virus
infection. The processes or mechanisms involved in resistance and tolerance
may be
the same, independent or overlap. Our results show that Wolbachia strains can
induce
both resistance and tolerance to DCV infection, but importantly prolonged
resistance
is not a requirement for protection against DCV-induced mortality. These
results are
consistent with those reported for FHV in Wolbachia infected D. melanogaster,
where there was no difference in FHV accumulation 6 dpi but Wolbachia
infection
protected flies from FHV induced mortality (Teixeira et al., 2008).
The strains of Wolbachia that mediate antiviral protection were anticipated to
be
present at higher density in infected flies (Giordano etal., 1995; Sinkins et
al., 1995).
We confirmed the density of Wolbachia in the particular fly lines used in this
study
correlated with protection. The density of Wolbachia was assayed in whole
flies as
previous assays have shown that in addition to reproductive tissues somatic
tissues
are commonly infected with Wolbachia (Dobson et al., 1999; Ijichi et al.,
2002).
Further experiments controlling the density of a single strain are required to
determine if high Wolbachia density is a pre-requisite for antiviral
protection.
The mechanisms or processes by which Wolbachia protects the host from virus
are
not yet understood. The correlation of high bacterial density of the strains
that protect
the host suggests that Wolbachia density may be important for antiviral
protection.
Potentially protection may require a threshold of Wolbachia density to be
exceeded,
which would be consistent with protection being a consequence of competition
between the two intracellular microbes for limited host resources. Antiviral
protection may also be dependent on the distribution of Wolbachia between
tissue or
cell types. Wolbachia have been identified in a range of somatic and
reproductive
tissues in insects and are known to display variable tissue tropism depending
on
infecting strain and host combination (Dobson et al., 1999; Ijichi et al.,
2002; Miller
CA 02707880 2010-06-17
106
and Riegler, 2006). Late in infection DCV is widely distributed in Drosophila
tissues
including both reproductive and somatic tissues (Cherry and Perrimon, 2004;
Jousset
etal., 1972; Lautie-Harivel and Thomas-Orillard, 1990), giving abundant
opportunity
for overlap with Wolbachia distribution. However, little is known about the
spread of
virus from the initial infection site or if replication of the virus is
equivalent in all of
the susceptible tissues. It is possible that there are tissues or cell types
that are critical
to virus replication or pathogenesis and that Wolbachia-mediated protection
occurs
by exclusion or regulation of virus in these tissues. In addition, if
particular tissues
are critical for pathogenesis, tolerance may be a result of protection of
those tissues.
The relatively close phylogenetic relationships of the strains that do confer
antiviral
protection compared to non-protective strains, suggests that other features of
the
Wolbachia strains could determine the outcome of virus infection. Protection
via
both resistance and tolerance could be induced by modulation of host antiviral
responses by Wolbachia. For example, proteins from the ankyrin family, which
can
play a role in innate immune pathways, vary considerably both in number and
sequence between Wolbachia strains (Duron et al., 2007; Iturbe-Ormaetxe et
al.,
2005; Walker et al., 2007). Interestingly defence against bacterial infection
in flies
via the melanisation response has been shown to involve both resistance and
tolerance effects (Ayres and Schneider, 2008).
Wolbachia are able to rapidly invade host populations and are often maintained
at
high prevalence in these populations (Turelli and Hoffmann, 1991). In many
cases
this is achieved at least in part by Wolbachia manipulation of host
reproductive
systems to increase the prevalence of infected individuals in the host
population. For
example the Wolbachia strains wRi, wHa and wNo used in this study induce
cytoplasmic incompatibility in D. simulans. However, wAu does not manipulate
host
reproductive systems (Hoffmann et al., 1986; Mercot and Poinsot, 1998; O'Neill
and
Karr, 1990; Turelli and Hoffmann, 1995). In the absence of strong reproductive
parasitism, theory predicts that to be maintained in a host population
Wolbachia must
provide a fitness advantage to the female host (see for example review by
Haine,
CA 02707880 2016-11-22
107
2008). Wo/bachia-mediated protection from viruses and other pathogens
(Panteleev
et al., 2007) may confer this fitness advantage. It is therefore likely that
the
interactions between Wolbachia and viruses such as DCV impact on the
distribution
of both microbes in insect populations.
Throughout the specification the aim has been to describe the preferred
embodiments of the invention without limiting the invention to any one
embodiment
or specific collection of features. It will therefore be appreciated by those
of skill in
the art that, in light of the instant disclosure, various modifications and
changes can
be made in the particular embodiments exemplified without departing from the
scope
of the present invention.
TABLES
Table 1 Effect of male age on cytoplasmic incompatibility. Percent embryo
hatch
standard error and number of replicate crosses are shown for incompatible
crosses
between uninfected PGYP1.tet females and aged PGYP1 males; and control crosses
with aged PGYPLtet males (minimum 2700 embryos total counted per cross).
Cross (Female x Male) Male age
3d 10 d 17d
PGYP I .tet x PGYP I 0.00 0.00% 0.00 0.00% 0.00 0.00%
(n 32) (n = 35) (n = 35)
PGYP1.tet x PGYP1.tet 86.86 3.42% 83.67 2.07% 88.30
3.10%
(n = 34) (n = 33) (n = 32)
108
Table 2. Fly lines and Wolbachia strains
Drosophila simulans line Wolbachia strain Reference
Me29 wMel Poinsot el al., 1998
CO wAu Hoffmann et al., 1996
DSR wRi Hoffmann et at , 1986
0
DSH wHa O'Neill and Karr, 1990
0
N7NO wNo Mercot and Poinsot, 1998
0
0
1-`
0
0
1-`
=.1
109
Table 3. Effect of Wolbachia on DENV-2 infection. A. aegypti were orally
infected with fresh DENV-2 and viral load determined by cell
culture ELISA.
PGYP1.out
PGYP1.out.tet Cairns3
Experiment Log DENV-2 Days post- % body % disseminated
% body Ai disseminated % body % disseminated
per mL infection infection (n) infection (n)
infection (n) infection (n) infection (n) infection (n)
1 6.3 7 0 (25) 0 (25) NA' NA
64 (25) 12 (25) o
14 0 (27) 0 (27) NA NA
57 (30) 23 (30) 0
N)
-.1
0
...1
2 6.0 7 0 (40) 0 (40) 100 (30)
10(30) 95 (40) 5 (40) co
co
0
14 0 (40) 0 (40) 97 (30) 37
(30) 95 (40) 20 (40) N.)
0
1-`
0
I
0
3 5.3 7 0 (40) 0(40) 30 (40) 23
(40) 50 (40) 13 (40) 0,
1
1-`
14 0 (40) 0 (40) 48 (40) 43
(40) 73 (40) 33 (40)
4 7.8 7 5(40) 3 (40) 78 (40) 63
(40) 63 (40) 45 (40)
14 8 (40) 5 (40) 70 (40) 65
(40) 75 (40) 70 (40)
aThis mosquito line was unavailable for experiment 1
110
Table 4. Effect of Wolbaehia on CHIKV infection. A. aegypti were orally
infected with fresh CHIKV and viral load (Logio) determined by quantitative
RT-PCR in mosquito bodies and heads or wings and legs (for viral
dissemination). Median copy number is based only on mosquitoes that were
positive for virus. * indicate P<0.05, ** P <0.01, *** P <0.001 by Mann
Whitney-U tests for the comparisons of PGYP.out and Cairns3 each against
PGYP.out.tet; n.s. non-significant; n.a. not applicable.
PGYP1.out PGYP1.out.tet
Cairns3
Days post Infected Disseminated Median
Percentiles Infected Disseminated Median Percentiles Infected Disseminated
Median Percentiles
Infection (%) (%) copies in (25 - 75%) (%) (%)
copies in (25 and (%) (%) copies in (25 and
Bodies/ Bodies/
75%) Bodies/ 75%)
Heads Heads
Heads 0
(N) (N)
(N)
0
0 100 20 10.2 (10) 10.0-10.4 100 20
10.2 (10) 9.8-10.6 100 10 10.0 (10) 9.8-10.5 N)
-.1
n.s.
n.s. 0
...1
CO
co
2 80 0 9.1(8) 8.5-9.4 50 30
9.6 (5) 9.3-10.2 70 40 9.5(7) 9.2-9.8 0
N.)
1-`
0
1
4 20 0 7.8(2) 7.3-8.2 60 60 10.4(6) 9.7-
10.8 50 30 10.0(5) 9.6-11.7 0
0,
1
*
n.s.
...1
7 10 0 7.3 (1) n.a. 100 100 11.1 (10)
10.8-11.26 100 90 10.39 8.4-10.8
n.a.
(10)
*
0 0 (0) n.a. 60 60 10.8 (6) 10.6-10.9
90 90 10.6 (10) 10.4-11.3
n.a.
n.s.
14 17 0 7.7(3) 6.7-8.0 85 100
11.8 (26) 10.9-11.9 80 90 11.3 (23) 10.3-11.6
**
*
5
CA 02707880 2010-06-17
111
Table 5. Quantification of DENV-2 RNA after intrathoracic injection in
different
mosquito lines. Data from four independent experiments.
Mosquito
Experiment DPI' Line Mean Copies SEM'
Partb n
Genomic (+) RNA
1 5 PGYP1 T+H 48.58 28.71 5
PGYP1.tet T+H 21368.13 1998.85 5
PGYP1.out T+H 40.69 9.36 5
PGYP1.out.tet T+H 9064.83 2033.46 4
PGYP1 Abd. 6.44 6.44 5
PGYP1.tet Abd. 6357.29 684.98 5
PGYP1.out Abd. 2.22 2.22 5
PGYP1.out.tet Abd. 10753.91 3840.28 4
1 14 PGYP1 Whole 25.24 4.07 2
PGYP1.tet Whole 211350.19 38687.90 8
PGYP1.out Whole 16.48 3.25 7
PGYP 1 .out.tet Whole 231296.71 35561.87 8
2 5 PGYP I T+H 32.16 5.62 4
PGYP1.tet T+H 50433.40 9985.28 5
PGYP1 Abd. 10.58 2.77 4
PGYP I .tet Abd. 10511.37 2342.27 5
2 14 PGYP1 Whole 28.39 24.95 8
PGYP1.tet Whole 269158.77 79320.07 7
3 5 PGYP1 T+H 67.45 28.53 5
PGYP1.tet T+H 105011.05 8693.71 5
PGYP1.out T+H 4406.69 4207.19 5
PGYP1.out.tet T+H 91941.97 33514.55 5
PGYP I Abd. 48.46 4.51 5
PGYP1.tet Abd. 104850.10 21403 .17 5
PGYP1.out Abd. 1907.65 1851.03 5
PGYP1.out.tet Abd. 24685.36 12919.93 4
3 14 PGYP1 Whole 4934.45 1164.91 7
CA 02707880 2010-06-17
112
PGYP1.tet Whole 360293.19 44383.67 7
PGYP 1 .out Whole 10576.99 8870.23 7
PGYP1.out.tet Whole 374720.72 69313.16 7
4 5 PGYPI T+H 222.85 216.20 5
PGYP1.tet T+H 58325.94 17090.05 5
PGYP I .out T+H 25.39 6.15 5
PGYP1.out.tet T+H 44368.94 8846.02 5
PGYP1 Abd. 0 0 5
PGYP1.tet Abd. 9921.17 3210.77 5
PGYP1.out Abd. 0 0 5
PGYP1.out.tet Abd. 18377.48 7324.38 5
4 14 PGYP I .out Whole 19.02 6.05 7
PGYPI.out.tet Whole 173642.11 31279.92 7
Anti-genomic (-) RNA
1 5 PGYP1 T+H 3.31 1.43 5
PGYP1.tet T+H 2894.63 415.72 5
PGYP1.out T+H 2.71 0.67 5
PGYP1.out.tet T+H 2085.81 441.10 4
PGYP1 Abd. 2.02 2.02 5
PGYP1.tet Abd. 1787.10 324.89 5
PGYP1.out Abd. 3.58 1.86 5
PGYP1.out.tet Abd. 2659.96 921.85 4
1 14 PGYP1 Whole 2.30 0.48 2
PGYP1.tet Whole 30003.31 5917.62 8
PGYP I .out Whole 1.89 0.42 7
PGYP1.out.tet Whole 22630.82 3203.45 8
2 5 PGYP1 T+H 10.10 3.26 5
PGYP1.tet T+H 1792.76 566.52 5
PGYP1.out T+H 44.60 16.31 4
PGYP1.out.tet T+H 7507.95 1947.03 5
PGYP1 Abd. 3.31 1.16 4
PGYP1.tet Abd. 2720.41 948.94 5
PGYP1.out Abd. 23.45 4.05 4
CA 02707880 2010-06-17
113
PGYP1.out.tet Abd. 7217.09 3314.48 5
2 14 PGYP1 Whole 560.26 512.60 8
PGYP1.tet Whole 31931.67 9092.21 8
3 5 PGYP1 T+H 28.47 9.64 5
PGYP1.tet T+H 9172.11 2363.80 5
PGYP1 Abd. 35.24 3.88 5
PGYP1.tet Abd. 31911.28 8267.71 5
3 14 PGYP1 Whole 2096.00 752.44 8
PGYP1.tet Whole 72146.55 9500.18 8
PGYP1.out Whole 18011.17 11279.89 8
PGYP1.out.tet Whole 55719.18 8865.57 8
4 5 PGYP1 T+H 7.97 6.06 5
PGYP1.tet T+H 4389.66 956.66 5
PGYP1.out T+H 2.31 0.52 5
PGYP I .out.Tet T+H 4977.24 983.62 5
PGYP1 Abd. 0 0 5
PGYP1.tet Abd. 3108.85 510.51 5
PGYP1.out Abd. 1.57 1.57 5
PGYP1.out.Tet Abd. 4643.40 465.31 5
4 14 PGYP1.out Whole 12.16 4.19 8
PGYP 1 .out.Tet Whole 29279.24 3677.83 8
a DPI=Days post-infection
b T+H= Mosquito Thorax+ Head; Abd. = Abdomen
c SEM= Standard Error of Means
CA 02707880 2010-06-17
114
Table 6. Oligonucleotide sequences. The following table presents the primer
sequences used for DENV-2, Plasmodium gallinaceum, CHIKV and Wolbachia
detections as well as for the immune related genes analysis.
Target Gene Primer Sequence (5'- 3')
SPZ5 (AAEL001929) Fw CGGATTCTCGCCAACGAAGAA
Rv TCTGTTGGTAATGCTGCTGCTGC
REL1 (AAEL007696-RA) Fw TGGTGGTGGTGTCCTGCGTAAC
Rv CTGCCTGGCGTGACCGTATCC
IMD (AAEL010083) Fw AACAGACGCAGCAATCATTCCG
Rv GGACTTAGAAGTTGATCTGGTGCAGTG
REL2 (AAEL007624-RA) Fw GCTCAGTGCTACCGTGGGAAAC
Rv CGGGTTCGCTCTGGCATTTGTC
DOME (AAEL012471) Fw AAGATGTTCGTAACGACTCGGTCATT
Rv GGTGAGATTGTACGTAACATGATCGGTAT
SOCS36E (AAEL000393) Fw CGACAACGTAGGAAGAATAAGCCATT
Rv AGCTGGTAATCTTCTGCAAATCCG
CECG (AAEL015515-RA) Fw TCACAAAGTTATTTCTCCTGATCG
Rv GCTTTAGCCCCAGCTACAAC
DEFC (AAEL003832-RA) Fw TTGTTTGCTTCGTTGCTCTTT
Rv ATCTCCTACACCGAACCCACT
TEP20 (AAEL001794-RB) Fw TTCAGTGGCTTTCAGCAATTCTGTC
Rv GCGATCTGCACTTTGAACAAGCA
CTL (AAEL011619-RA) Fw GCAGTGTATGAATTCGTTCCAATCAACTA
Rv TCCAGGCTTCCAAGAACGTTAGGT
FREP18 (AAEL006704-RA) Fw TTCTGGTGTGTCTGGTGCTATTCAACA
Rv GCTTCCACGAACATGAGGTTCATAGC
RpS17 Fw CACTCCCAGGTCCGTGGTAT
Rv GGACACTTCCGGCACGTAGT
DENV-2 NS5 Fw ACAAGTCGAACAACCTGGTCCAT
Rv GCCGCACCATTGGTCTTCTC
Plasm ssurRNA Fw GCTTCTTAGAGGGACATTGTGTG
Rv GCGTGCAGCCTAGTTCATC
Actin Fw ACCGAGCGTGGCTACTCCTT
Rv AGCGACGTAGCACAGCTTCTC
CA 02707880 2010-06-17
115
Table 7. Genetic differences between -wMelPop and wMelPop-CLA. *The name and
annotation of the genes is based on the annotation of the closely related wMel
genome, fully sequenced by our group (Wu etal., 2004)
Gene* Putative function wMelPop-CLA features
SNP (C to T)
W D0200 Hypothetical protein Aminoacid changed from Asp to
bp deletion In wMelPop-CLA
WD0413 Aspartvi-tRNA synthetase (005) [6.1.1.12] Creates frameshift
and premature stop In WD0413
155 insertion In Intergenic space
WD0765-WD0766 Na+/H+ ion antioorter family protein / ANK domain protein
Affects expression of both genes
G insertion
10 WD0758 Glutaredoxin family protein Creates
frames1)111 and premature stop In WD0758
WD0506 Reverse transcriptase, authentic franieshift Gene absent in
wMelPop-CLA
W00507 DNA repair protein RadC, truncation Gene absent in wMelPop-CLA
W00508 Transcriptional regulator, putative Gene absent in wMelPop-CLA
WD0509 DNA mismatch repair protein MutL-2 Gene absent in wMelPop-CLA
WD0510 Ribortuclease, degenerate Gene absent in wMelPop-CLA
WD0511 Conserved hypothetical protein Gene absent in wMelPop-CLA
WD0512 Hypothetical protein Gene absent in wMelPop-CIA
WD0513 Hypothetical protein Gene absent in wMelPop-
CLA
WD0514 Ankyrin repeat domain protein Gene absent in wMelPop-CIA
WD0515 Reverse transcriptase, interruption-C Gene absent in wMelPop-
C1A
WD0516 lanSPOS.9.10, IS5 family.atI3 Gene absent in wMelPop-CLA
W00517 Trrpoe 155 famlitØ11A Gene absent in wMelPop-CLA
WD0518 Reverse transcriptase, Interruption-N Gene absent in wMelPop-
CLA
CA 02707880 2010-06-17
116
REFERENCES
Allemand, R., Pompanon, F., Fleury, F., Fouillet, P. and Bouletreau, M.
(1994).
Physiol Entomol 19: 1-8.
Altschul, S.F., Madden, T.L., Schaffer, A.A., Zhang, J., Zhang, Z., Miller,
W.,
and Lipman, D.J. (1997). Gapped BLAST and PSI-BLAST: a new generation of
protein database search programs. Nucleic Acids Res 25: 3389-3402.
Ashburner, M. (1989). Drosophila: A Laboratory Manual. Cold Spring Harbor
Laboratory Press, Plainview, NY.
Ashburner, M. and Roote, J. (2000). Laboratory Culture of Drosophila, pp. 585-
599. W. Sullivan, M. Ashburner, and R. S. Hawley (ed.), Drosophila Protocols.
Cold
Spring Harbor Press, Cold Spring Harbor, NY.
Ayres, J. S., Schneider, D. S. (2008). A signaling protease required for
melanization
in Drosophila affects resistance and tolerance of infections. PLoS Bio16: 2764-
2773.
Ball, L. A., Johnson, K. L. (1998). Nodaviruses of insects. In: Miller LK,
Ball LA,
editors. The Insect Viruses. New York: Plenum Publishing Corporation. pp. 225-
267.
Ballard, J.W. (2000). Comparative genomics of mitochondrial DNA in Drosophila
simulans. J Mol Evol 51: 64-75.
Bonatz, A. E., Steiner, H. and Huston, J. P. (1987). J Neurosci Methods 22: 13-
26.
Bourtzis, K., Pettigrew, M. M. and O'Neill, S. L. (2000). Insect Mol Biol. 9:
635.
Boyle, L., O'Neill, S. L., Robertson, H. M. and Karr, T. L. (1993). Science
260:
1796-9.
Braig, H. R., Zhou, W., Dobson, S. L. and O'Neill, S. L. (1998). J
Bacterio1180:
2373.
Broom A. K. etal. (1998). Pathology 30: 286.
Brownstein, J. S., Hett, E. and O'Neill, S. L. (2003). J. Invert. Pathol. 84:
24.
Brun, G. and Plus, N. (1980). The viruses of Drosophila. In: Ashburner M,
Wright
TFR, editors. The Genetics and Biology of Drosophila. New York: Academic
Press.
pp. 625-702.
Casiraghi M., Bordenstein S.R., Baldo L., Lo N., Beninati T. et al. (2005).
Phylogeny of Wolbachia pipientis based on gltA, groEL and ftsZ gene sequences:
clustering of arthropod and nematode symbionts in the F supergroup, and
evidence
CA 02707880 2010-06-17
117
for further diversity in the Wolbachia tree. Microbiology 151: 4015-4022.
Cherry, S., Kunte, A., Wang, H., Coyne, C., Rawson, R. B. et al. (2006). COPI
activity coupled with fatty acid biosynthesis is required for viral
replication. PLoS
Pathog 2: c 1 02.
Cherry, S., Perrimon, N. (2004) Entry is a rate-limiting step for viral
infection in a
Drosophila melanogaster model of pathogenesis. Nat Immunol 5: 81-87.
Christian P.D., Carstens E.B., Domier L., Johnson J.E., Johnson K.N. et aL
(2005). Dicistroviridae. In: Fauquet CM, Mayo MA, Maniloff J, Desselberger U,
Ball LA, editors. Virus taxonomy: Eighth report of the International Committee
on
the Taxonomy of Viruses. San Diego: Elsevier Academic Press. pp. 783-788.
Cook P. E. etal. (2006). Proc. Natl. Acad. Sci. U.S.A. 103: 18060.
Curtis, C. F., and Sinkins, S. P. (1998). Parasitology 116 Suppl: S111-5.
Dobson, S. L., Bourtzis, K., Braig, H. R., Jones, B. F., Zhou, W., Rousset, F.
and
O'Neill, S. L. (1999). Insect Biochem. Mol. Biol. 29: 153-60.
Dobson, S. L., Marsland, E. J., Veneti, Z., Bourtzis, K. and O'Neill, S. L.
(2002).
Appl. Environ. Microbiol. 68: 656-60.
Dobson, S. L. and Rattanadechakul, W. (2001). .1 Med. Entomot 38: 844.
Duron, 0., Boureux, A., Echaubard, P., Berthomieu, A., Berticat, C. et aL
(2007). Variability and expression of ankyrin domain genes in Wolbachia
variants
infecting the mosquito Culex pipiens. J Bacterial 189: 4442-4448.
Dye C. (1992). Annu. Rev. Entomol. 37: I.
Feinberg, M. D., Szumowski, K. M. and Harris, K. M. (2001). R. T. Giberson and
R. S. Demaree Jr (ed.), Microwave Protocols for Microscopy Humana Press,
Totowa, NJ.
Fuery, C. J., Withers, P. C., Hobbs, A. A. and Guppy, M. (1998). Comp Biochem
Physiol A Mol Integr Physiol 119: 469-476.
Garrett-Jones, C. (1964). Nature 204: 1173.
Gerberg, E. J., Barnard, D. R. and Ward, R. A. (1994). Manual for mosquito
rearing and experimental techniques. Lake Charles, La.: American Mosquito
Control
Association.
Gilles, H. M. and Warrell, D. A. (2002). Essential Malariology (Arnold,
London,
CA 02707880 2010-06-17
118
4th ed).
Giordano, R., O'Neill, S. L., Robertson, H. M. (1995) Wolbachia infections and
the expression of cytoplasmic incompatibility in Drosophila sechellia and D.
mauritiana. Genetics 140: 1307-1317.
Grobbelaar, J. H., Morrison, G. J., Baart, E. E. and Moran, V. C. (1967). J
Insect Physiol 13: 1843-1848.
Gubler, D. J. (1997). Dengue and Dengue Hemorrhagic Fever, D. J. Gubler, G.
Kuno, Eds. (CAB International, New York, N.Y.), pp. 1-22.
Haine, E. R. (2008). Symbiont-mediated protection. P R SOC B 275: 353-361.
Hall, R. A., Burgess, G. W., Kay, B. H. and Clancy, P. (1991). Immunol Cell
Biol
69: 47.
Hedges, L. M. and Johnson, K. N. (2008).1 Gen. Virol. 89, 1497-1501.
Hoffmann, A. A., Clancy, D., Duncan, J. (1996). Naturally-occurring Wolbachia
infection in Drosophila simulans that does not cause cytoplasmic
incompatibility.
Heredity. 76: 1-8.
Hoffmann, A. A. and Turelli, M. (1997). S. L. O'Neill, A. A. Hoffmann, J. H.
Werren, Eds. (Oxford University Press, Oxford, UK), pp. 42-80.
Hoffmann, A. A., Turelli, M. and Simmons G. M. (1986). Evolution 40: 692-701.
Holmes, D. S. and Bonner J. (1973). Biochemistry 12: 2330-8.
Huszar, T. and Imler, J. L. (2008). Adv Virus Res 72: 227.
Ijichi, N., Kondo, N., Matsumoto, R., Shimada, M., Ishikawa, H., et al.
(2002).
Internal spatiotemporal population dynamics of infection with three Wolbachia
strains in the adzuki bean beetle, Callosobruchus chinensis (Coleoptera:
Bruchidae).
Appl Environ Microbiol 68: 4074-4080.
Iturbe-Ormaetxe, I., Burke, G. R., Riegler, M. and O'Neill S.L. (2005). J.
Bacteria 187: 5136-45.
Janzen, H.G., Wright, K.A. (1971) Canadian Journal of Zoology. 49: 1343-1345.
Jobling, B. (1987). The mosquito Aedes aegypti. In Anatomical drawings of
biting
flies, B. Jobling, ed. (London, British Museum (Natural History), Welcome
Trust),
pp. 47-80.
CA 02707880 2010-06-17
119
Joehanes, R. and Nelson, J. C. (2008). Bioinformatics 24: 2788.
Johnson, K. N. and Christian, P. D. (1998). J. Gen. Virol. 79: 191-203.
Johnson, K. N. and Christian, P. D. (1996). Arch. Virol. 141: 1509-1522.
Johnson, K. N., Johnson, K. L., Dasgupta, R., Gratsch, T. and Ball, L. A.
(2001).
J. Gen. Virol. 82, 1855-1866.
Jousset, F.X., Plus, N., Croizier, G., Thomas, M. (1972). Existence chez
Drosophila de deux groupes de picomavirus de proprietes serologiques et
biologiques differentes. C R Acad Sci (Paris) 275: 3043-3046.
Kang, L., Ma, X., Cai, L., Liao, S., Sun, L., Zhu, H., Chen, X., Shen, D.,
Zhao, S.
and Li, C. (2003). Heredity 90: 71-6.
Kawada, H. and Takagi, M. (2004). J Medical Entomol 41: 873-881.
Kittayapong, P., Baisley, K. J. Baimai, V. and O'Neill, S. L. (2000). J. Med.
Entomol. 37:340-5.
Knox, T. B., Kay, B. H., Hall, R. A. and Ryan, P. A. (2003). J Med Entomol
40:950.
Kopek, B. G., Perkins, G., Miller, D. J., Ellisman, M. H., Ahlquist, P.
(2007).
Three-dimensional analysis of a viral RNA replication complex reveals a virus-
induced mini-organelle. PLoS Biol 5: e220.
Krettli, A.U., Rocha, E.M., Lopes, J.D., Carneiro, C.R., Kamboj, K.K.,
Cochrane, A.H., and Nussenzweig, R.S. (1988). Circumsporozoite protein of
Plasmodium gallinaceum characterized by monoclonal antibodies. Parasite
Immunol
10, 523-533.
Kuno, G. (1983). In Vitro 19: 707-13.
Lautie-Harivel, N., Thomas-Orillard, M. (1990). Location of Drosophila C virus
target organs in Drosophila host by immunofluorescence technique. Biol Cell
69: 35-
39.
Lighton, J. R. B. (1991). Concise Encyclopedia on Biological and Biomedical
Measurement Systems, (ed. P. A. Payne), pp. 201-208. Oxford: Pergamon Press.
Lighton, J. R. B. and Duncan, F. D. (2002). Ecology 83: 3517-3522.
Lipsitch, M. and Moxon, E. R. (1997). Trends Microbiol. 5: 31.
CA 02707880 2010-06-17
120
Liseichikov, Y. N. and Zakharevskii, A. S. (1978). Bull Exp Biol Med 85: 696-
697.
Lobo, N. F., Clayton, J. R., Fraser, M. J., Kafatos, F. C. and Collins, F. H.
(2006). Nat. Protoc. 1: 1312.
MacDonald, G. (1957). The Epidemiology and Control of Malaria. (Oxford
University Press, London).
Mankin, R. W. (1994). J Am Mosq Control Assoc 10: 302-308.
Marhoul, Z. and Pudney, M. (1972). Trans. R. Soc. Trop. Med. Hyg. 66:183-4.
Mateos, M., Castrezana, S. J., Nankivell, B. J., Estes, A. M., Markow, T. A.
and
Moran, N. A. (2006). Genetics 174: 363-76.
McGraw, E. A., Merritt, D. J., Droller, J. N. and O'Neill, S. L. (2002). Proc.
NatL
Acad. Sci. USA 99: 2918-23.
Mercot, H., and Poinsot, D. (1998). Wolbachia transmission in a naturally bi-
infected Drosophila simulans strain from New-Caledonia. Entomologia
Experimentalis et Applicata 86: 97-103.
Miller, D. J., Schwartz, M. D., Ahlquist, P. (2001) Flock House virus RNA
replicates on outer mitochondrial membranes in Drosophila cells. J Virol 75:
11664-
11676.
Miller, W. J., Riegler, M. (2006). Evolutionary dynamics of wAu-like Wolbachia
variants in neotropical Drosophila spp. Appl Environ Micro biol 72: 826-835.
Min, K. T. and Benzer, S. (1997). Proc. Natl. Acad. Sci. USA 94: 10792-6.
Mitsuhashi, J. and Maramorosch, K. (1964). Contrib. Boyce Thompson Inst. 22:
435-460.
Morrison, A. C., Zielinski-Gutierrez, . E., Scott, T. W. and Rosenberg, R.
(2008). PLoS Med. 5: e68.
Nasci, R. S. (1986). Journal of the American Mosquito Control Association 2:
61-2.
Novak, M. G., Ribeiro, J. M. C. and Hildebrand J. H. (1995). Journal of
Experimental Biology 198: 167.
Nubel, U., Engelen, B., Felske, A., Snaidr, J., Wieshuber, A., Amann, R. I.,
Ludwig, W. and Backhaus, H. (1996). J. Bacteriol. 178: 5636-43.
O'Neill, S. L., Giordano, R., Colbert, A. M., Karr, T. L. and Robertson, H. M.
CA 02707880 2010-06-17
121
(1992). Proc. Natl. Acad. Sci. USA 89:2699-702.
O'Neill, S. L., Karr, T. L. (1990). Bidirectional incompatibility between
conspecific
populations of Drosophila simulans. Nature 348: 178-180.
O'Neill, S. L., Pettigrew, M. M., Sinkins, S. P., Braig, H. R., Andreadis, T.
G.
and Tesh, R. B. (1997). Insect Mol. Biol. 6: 33-9.
Panteleev, D. Y., Goryacheva II, Andrianov, B. V., Reznik, N. L., Lazebny, 0.
E.
et al. (2007) The endosymbiotic bacterium Wolbachia enhances the nonspecific
resistance to insect pathogens and alters behavior of Drosophila melanogaster.
Russian Journal of Genetics 43: 1066-1069.
Pfaffl, M. W. (2001). Nucleic Acids Res. 29: e45.
Pfaffl, M.W., Horgan, G.W., and Dempfle, L. (2002). Relative expression
software
tool (REST) for group-wise comparison and statistical analysis of relative
expression
results in real-time PCR. Nucleic Acids Res 30, e36.
Pittman, G. W., Brumbley, S. M., Allsopp, P. G. and O'Neill, S. L. (2008).
App!.
Environ. Microbiol. 74: 762-7.
Poinsot, D., Bourtzis, K., Markakis, G., Savakis, C., and Mercot H. (1998)
Wolbachia transfer from Drosophila melanogaster into D. simulans: Host effect
and
cytoplasmic incompatibility relationships. Genetics 150: 227-237.
Rasgon, J. L., Styer, L. M. and Scott, T. W. (2003). J. Med. Entomol. 40: 125.
Rasgon, J. L., and Scott, T. W. (2004). 1 Med. Entomol. 41:255-7.
Reynolds, D. R. and Riley, J. R. (2002). Comp Electron Agric 35: 271-307.
Reynolds, K. T., Thomson, L. J. and Hoffmann, A. A. (2003). Genetics 164:
1027-34.
Ribeiro, J.M.C., Rossignol, P.A., Spielman, A. (1984). Journal of Experimental
Biology 108: 1-7.
Ricci, I., Cancrini, G., Gabrielli, S., D'Amelio, S. and Favia, G. (2002). J.
Med.
Entomol. 39: 562-7.
Richardson, J., Molina-Cruz A. and Salazar, M. I. (2006). B. W. 4th., Am J
Trop
Med Hyg. 74: 132.
Riegler, M., Charlat, S., Stauffer, C. and Mercot, H. (2004). Appl. Environ.
Micro biol. 70: 273-9.
CA 02707880 2010-06-17
122
Riegler, M., Sidhu, M., Miller, W. J. and O'Neill, S. L. (2005). Cum. Biol.
15:
1428-1433.
Rigaud, T., Pennings, P. S. and Juchault, P. (2001). J. Invertebr. Pathol.
77:251-7.
Rodrigues, F.G., Santos, M.N., de Carvalho, T.X., Rocha, B.C., Riehle, M.A.,
Pimenta, P.F., Abraham, E.G., Jacobs-Lorena, M., Alves de Brito, C.F., and
Moreira, L.A. (2008). Expression of a mutated phospholipase Az in transgenic
Aedes
fluviatilis mosquitoes impacts Plasmodium gallinaceum development. Insect Mol
Biol 17: 175-183.
Rowley, W. A., Jones, M. D. R., Jacobson, D. W. and Clarke, J. L. (1987). Ann
Entomol Soc Am 80: 534-538.
Rutledge, L. C., Ward, R. A. and Gould, D. J. (1964). Mosq News 24: 407.
Sasaki, J., Nakashima, N. (1999). Translation initiation at the CUU codon is
mediated by the internal ribosome entry site of an insect picorna-like virus
in vitro. J
Virol 73: 1219-1226.
Sbalzarini, I. F. and Koumoutsakos, P. (2005). J Struct Biol 151: 182-195.
Schellenberg J. R. et al. (2001). Lancet 357: 1241.
Schneider, D., and Shahabuddin, M. (2000). Malaria parasite development in a
Drosophila model. Science 288, 2376-2379.
Schneider, D. S., Ayres J. S. (2008). Two ways to survive infection: what
resistance
and tolerance can teach us about treating infectious diseases. Nat Rev Immunol
8:
889-895.
Schneider, I. (1972). Cell lines derived from late embryonic stages of
Drosophila
melanogaster. J Embryol Exp Morph 27: 353-365.
Scotti, P. D. (1980). Microbial Control of Insect Pests J. Kalmakoff, J. F.
Longworth, Eds. (Crown, Wellington) pp. 48-55.
Siler, J. F., Hall, M. W. and Hitchens, A. P. (1926). Philipp. J. Sci. 29: 1.
Simon C. etal. (1994). Annals Entomol. Soc. Am. 87: 651-701.
Sinkins, S. P. (2004). Insect Biochem Mol Biol 34: 723.
Sinkins, S. P., Braig, H. R., O'Neill, S. L. (1995) Wolbachia pipientis:
bacterial
density and unidirectional cytoplasmic incompatibility between infected
populations
CA 02707880 2010-06-17
123
of Aedes albopictus. Experimental Parasitology 81: 284-291.
Sinkins, S. P. and O'Neill, S. L. (2000). Insect Transgenesis: Methods and
Applications, A. M Handler, A. A. James, Eds. (CRC Press, London), pp. 271-
287.
Tason de Camargo, M., and Krettli, A.U. (1981). Aedes fluviatilis (Lutz), a
new
experimental host for Plasmodium gallinaceum Brumpt. The Journal of
Parasitology
64: 924-925.
Teixeira, L., Ferreira, A., and Ashburner, M. (2008) The bacterial symbiont
Wolbachia induces resistance to RNA viral infections in Drosophila
melanogaster.
Plos Biology 6: el 000002. doi:1000010.1001371/journal.pbio.1000002.
Thomas, M. B. and Read, A. F. (2007) Nat. Rev. Microbial. 5: 377.
Tsai, K. H., Lien, J. C., Huang, C. G., Wu, W. J. and Chen, W. J. (2004). J.
Med.
Entomol. 41: 677-83.
Tura, M.J. (1988). Reduced Rift Valley fever virus infection rates in
mosquitoes
associated with pledget feedings. Am J Trop Med Hyg 39: 597-602.
Turelli, M., Hoffmann, A. A. (1991). Rapid spread of an inherited
incompatibility
factor in California Drosophila. Nature 353: 440-442.
Turelli, M., Hoffmann, A. A. (1995) Cytoplasmic incompatibility in Drosophila
simulans: dynamics and parameter estimates from natural populations. Genetics
140:
1319-1338.
Van Meer, M. M., and Stouthamer, R. (1999). Heredity 82: 163-9.
Van Voorhies, W. A., Khazaeli, A. A. and Curtsinger, J. W. (2004). J Appl
Physiol 97: 1915-1922.
Walker, T., Klasson, L., Sebaihia, M., Sanders, M. J., Thomson, N. R. et al.
(2007). Ankyrin repeat domain-encoding genes in the wPip strain of Wolbachia
from
the Culex pipiens group. BMC Biol 5: 39.
Wang X. H. et aL (2006) Science 312: 452-454.
Watts, D. M., Burke, D. S., Harrison, B. A., Whitmire, R. E. and Nisalak, A.
(1987). Am. J. Trap. Med. Hyg. 36: 143.
West, G. B., Woodruff, W. H. and Brown, J. H. (2002). Proc Nail Acad Sci USA
99: 2473-2478.
Williams, C. R. and Kokkinn, M.J. (2005). Physiol. Ecol. 30: 309-316.
CA 02707880 2010-06-17
124
Wilson, J. E., Powell, M.J., Hoover, S.E., Sarnow, P. (2000). Naturally
occurring
dicistronic cricket paralysis virus RNA is regulated by two internal ribosome
entry
sites. Mol Cell Biol 20: 4990-4999.
Winston, P. W. and Bates, D. H. (1960). Ecology 41: 232-237.
Woodring, J. L. Higgs, S. and Beaty, B. J. (1996). The Biology of Disease
Vectors,
B. J. Beaty, W. C. Marquardt, Eds. (University Press of Colorado, Boulder,
CO), pp
51-72.
Woo!fit, M., Iturbe-Ormaetxe, I., McGraw, E. A. and 'Neill, S. L. (2009). Mol.
Biol. Evol. 26: 367-374.
Wu, M. et al. (2004). PLoS Biol. 2: E69.
Xi, Z. and Dobson, S. L. (2005). Appl. Environ. Microbiol. 71: 3199-204.
Xi, Z., Khoo, C. C. and Dobson, S. L. (2005). Science 310: 326.
Xi, Z., Ramirez, J. L. and Dimopoulos, G. (2008). Plos Pathog 4: e1000098.
Yamada, R., Floate, K. D., Riegler, M. and O'Neill, S. L. (2007). Genetics
177:
801-808.
Zabalou, S., Riegler, M., Theodorakopoulou, M., Stauffer, C., Savakis, C. and
Bourtzis, K. (2004). Proc. Natl. Acad. Sci. USA 101:15042-5.
Zar, J. H. (1999). Biostatistical analysis. Prentice Hall, Upper Saddle River,
New
Jersey.
Zhou, W., Rousset, F. and O'Neill, S. L. (1998). Proc. R. Soc. Lond. B.
265:509-
515.
