Note : Les descriptions sont présentées dans la langue officielle dans laquelle elles ont été soumises.
CA 02192324 2004-08-26
RECOMBINANT VIRUS AND RELATED METHOD OF QUANTITATING SAME
Field of the Inventt'on
The invention relates generally to methods for quantitating virus
following nucleic acid amplification. The invention also relates to
genetically
tagged retroviral nucleic acid capable of being distinguished from the wild
type
viral nucleic acid:
Background of the Invention
Quantitative PCR has been used to measure the relative levels of RNA .
and DNA from a variety of different samples. It is possible, at times, to find
a direct correlation between the amount of starting target material and the
amount of PCR product (Mullis and Faloona, Methods Enrymol. 155:335-50
(1987); Ferre, F., PCR Methods Applic. 2:1-9 (1992); Sardelli, A.D.,
Amplifications: A Forum for PCR Users (9):1-5 (1993)). However, this is
often not the case for clinical samples due to the presence of inhibitors of
PCR
in samples and differing efficiencies in sample recovery and kinetics of PCR
(Holodniy et al. , J. Clin. ' Micro. 29: 676-679 ( 1991 ); Beutler et al. ,
BioTechniques 9:166 (1990); Franchis et al., Nucl. Acids Res. 16:10355
(1988); Coutl~e et ~al., J. Infect. Dis_ 164:817-818 (1991)). The use of PCR
as a quantitative assay often presents problems. For instance, small
variations
in amplification efficiency can change the yield of the product and make it
difficult to accurately estimate the amount present in the starting material
(Gilliland et al., Proc. Natl. Acad. Sci. USA 87:2725-2729 (1990)). To avoid
these problems, several laboratories have described the use of internal
WO 95/34684 PCT/US94106631
_7_
standards in PCR (Gilliland et al. , Proc. Natl. Acad. Sci. USA 87:2725-2729
(1990); Wang et al. , Proc. Natl. Acad. Sci. USA 86:9717-9721 ( 1989);
Becker-Andre et al., Nucl. Acids Res. 17:9437-9446 (1990); Chelly et al.,
Eur. J. Biochem. 187:691-698 (1990); Bergenhem et al., Proc. Natl. Acad.
Sci. USA 89:8798-8802 (1992); Aoki-Sei et al., AIDS Res. Human
Retro. 8:1263-1270 (1992); Siebert et al., Nature 359:557-558 (1992)).
Generally, the internal standard DNA or RNA share the same primers as the
target DNA or RNA, but will contain either a deletion or an insertion so that
the products obtained from the standard and target can be distinguished.
A variation in the use of an internal control is the competitive PCR
procedure (Gilliland et al., Proc. Natl. Acad. Sci. USA 87:2725-2729 (1990)).
In this method, varying known amounts of the internal standards are added to
equal aliquots of the sample containing the unknown target sequence. The
internal standard and the target sequence compete equally for primer binding
and amplification in the PCR. Variables such as the efficiency of
amplification and the number of cycles will have the same effect on both
templates. Equal amounts of products will be formed when the initial
concentrations of the templates are equal. Experimentally, the ratio of
products formed can be determined and the equivalence point can be
calculated. This method has been successfully employed to quantify the
amount of HIV-1 RNAs in clinical samples (Bagnarelli et al., J. Med. Virol.
34:89-95 (1991); Menzo et al., J. Clin. Microbiol. 30:1752-1757 (1992)).
However, this method does not control the variations in RNA recovery from
sample to sample. Similarly, viral DNA isolation is often incomplete and
control of the amount of DNA would be of great use.
In the present invention, the inventors have developed a modified
method in which an infectious tagged virus is used as the source of competitor
nucleic acid. The tagged virus is a mutant or variant of the virus suspected
of being in the sample. Different amounts of the tagged virus can be added
to equal aliquots of the sample containing an unknown amount of virus,
followed by nucleic acid extraction and amplification carried out in a manner
WO 95/34684 PCT/US94/06631
-3
that allows for relatively precise quantitation of the amount of viral nucleic
acid present in the sample.
Summary of the Invention
The inventors have developed an assay to measure the viral nucleic
acid in any sample using a mutant (tagged) virus as an internal control. The
mutant virus has a sequence tag in a region of the genome. To utilize this
virus as an internal control, a dilution or dilutions of this virus are added
to
aliquots of samples to be measured, arid nucleic acid is isolated, amplified,
and
quantitated.
Amplification is performed with primers selected to include the
sequences capable of amplifying sequence containing the tag in the externally
added virus. The amplification product from the control virus can be
differentiated from the virus present in the sample. The amount of viral
nucleic acid present in the sample is calculated after the amplified products
are
detected. Unlike other quantitative amplification assays, such as conventional
PCR, this internally controlled virion amplification assay eliminates errors
introduced by variable recovery during the viral nucleic acid purification
step,
therefore, enhancing the accuracy of the assay.
Accordingly, a preferred embodiment of the present invention is a
method for quantitating the amount of virus present in a sample, the method
comprising the steps of: introducing into said sample a composition comprising
a virus containing a genetically tagged viral nucleic acid; co-isolating said
wild
type and said tagged nucleic acid from the sample; amplifying said wild type
and said tagged nucleic acid from said sample; and quantitating said wild type
and said tagged nucleic acid.
The invention further provides a genetically tagged retroviral nucleic
acid comprising a tag sequence in a highly conserved region of said retroviral
nucleic acid, wherein said tag occurs between the retroviral primer-binding
and gag initiation sites.
2~~232~
-3a-
Accordingly, a preferred embodiment of the present invention is a method for
quantifying an amount of a wild type virus present in a samplederived from a
mammal,
amphibian, reptile or bird, the method comprises the steps of: adding into an
aliquot of the
sample, as an internal control, a composition comprising a specific amount of
a genetically
tagged virus containing a genetically tagged nucleic acid having a genetic tag
sequence
provided by mutating a conserved region of a wild type nucleic acid of the
wild type virus with
a deletion, insertion or substitution; co-isolating the wild type nucleic acid
and the genetically
tagged nucleic acid, respectively, from the wild type and the genetically
tagged virus in the
sample; amplifying in vitro the wild type nucleic acid and the genetically
tagged nucleic acid
from the sample to provide amplified wild type nucleic acid and amplified
tagged nucleic acid;
quantitating the ratio of the amount of the amplified wild type nucleic acid
to the amplified
tagged nucleic acid provided in the amplifying step; and repeating the entire
procedure with
different dilutions of the genetically tagged virus, wherein the ratio of the
amplified wild type
nucleic acid to the genetically tagged nucleic acid, quantitated as described
above, is
proportional to the ratio of wild type virus to the genetically tagged virus
in the sample. The
wild type and the mutant viral nucleic acids are distinguishable and can be
quantitated after
amplification, and the growth of the genetically tagged virus is not effected
by the presence of
the tag sequence.
In a further embodiment is provided a genetically tagged virus, comprising a
genetically tagged viral nucleic having a genetic tag sequence provided by
mutating a
conserved region of a corresponding wild type viral nucleic acid with a
deletion, insertion or
substitution, wherein the wild type and the mutant viral nucleic acids are
distinguishable and
can be quantified after amplification.
In yet a further embodiment the invention provides a genetically tagged
retroviral
?5 nucleic acid comprising a tag sequence in a highly conserved region of the
retroviral nucleic
acid, wherein the tag occurs between the retroviral primer-binding and gag
initiation sites.
A
WO 95!34684 PCT/US94/06631
219232
-4-
Brief Description of the Figures
Figure 1 depicts the use of cDNA synthesized from mutant virus
(VX-46) RNA as competitor in PCR. RNA isolated from the mutant virus ,
containing 100 pg of p24 antigen were used to synthesize cDNA in a 60 ~1
reaction. Two microliters of the cDNA were used in the PCR containing
various amounts of competitor wild type DNA (pAl) containing HIVN1r4.3
sequences from 501 to 1448. The PCR was carried out and the products were
hybridized with a 3?P-probe and autoradiographed as described in Materials
and Methods. The copy numbers of competitor DNA present in the reactions
were 106 (lane 1), 5 x 105 (lane 2), 105 (lane 3), 5 x 10' (lane 4) 104
(lane 5), 103 (lane 6) 102 (lane 7) and 0 (lane 8). The sizes shown on the
right
were the PCR products in by from mutant and wild type sequences
respectively.
Figure 2 depicts data of an estimation of the RNA isolated from the
mutant virus VX-46. The amount of radioactivity present in bands
corresponding to wild type and mutant PCR products were estimated by
exposing it to a storage Phosphor screen and quantitated using a Molecular
Dynamics PhosporImager (Johnston et al. , Electrophoresis 11:355-360
(1990)). The ratio between the amount of radioactivity present in wild type
(pAl) and mutant (VX-46) DNA bands was plotted against the amount of wild
type DNA used in the PCR. The mutant viral RNA was isolated from virus
containing 100 pg (Panel A), 25 pg (Panel B) and 500 fg (Panel C) of p24
antigen respectively. The data derived from Figure 1 is shown in Panel A.
The RNA isolated from virus containing 25 pg (Panel B) and 500 fg (Panel C)
of p24 were used to synthesize cDNA in a 40 ~.I reaction and 3 ~l of cDNA
were used in competitive PCR. Based on the method described by Menzo et
al. (Memo et al., J. Clin. Microbiol. 30:1752-1757 (1992)), it was calculated
that 2 ~.1 of cDNA in (Panel A) has 9500, 3 ~.l of cDNA in (Panel B) has 5200
and 3 ~l of cDNA in (Panel C) has 120 copies respectively.
219224
WO 95/34684 PCT/US94/06631
-S-
Figure 3 depicts ICVPCR for the estimation of HIV-1 RNA in a
human patient's plasma.
Panels A and B. To 100 ~,l aliquots of patient's plasma,
different dilutions of mutant virus (VX-46) containing 0 (lane 1), 30
(lane 2), 3 (lane 3) 0.3 (lane 4) and 0.03 (lane 5) pg of p24 antigen were
added. RNA isolation, cDNA synthesis and PCR werc: carried out as
described in Materials and Methods. The size of DNA products from mutant
(148) and wild type (123) are shown on the right. Panels A and B were
plasma from two different human patients.
Panel C. The radioactivity present in each band was quantitated using
a Molecular Dynamics PhosporImager. The ratio between the radioactivity
present in mutant and patient DNA bands was plotted against the amount of
mutant viral RNA added to the patient's plasma during RNA isolation. The
mutant viral RNA copy numbers were calculated using the average value
(2900 copies of RNA per pg of p24 antigen) obtained with the data shown in
Figure 2. Patient-1 (o ----- o) has 8,800 copies and the patient-2 (o ----- o)
has 1600 copies of RNA in 100 ~,l of plasma.
Figure 4 depicts data demonstrating the reproducibility of ICVPCR
Panel A. To 100 ~,l aliquots of patient's plasma, different
dilutions of mutant virus (VX-46) containing 0 (lane 1), 24 (lanes 2
and 6), 2.4 (lane 3 and 7) 0.24 (lane 4 and 8) and 0.024 (lane 5 and 9) pg of
p24 antigen were added. RNA isolation, cDNA synthesis, PCR and gel
analysis for lanes I to 5 and 6 to 9 were carried out by two separate
experiments on different days. The size of DNA products from mutant (148)
2S and wild type (123) are shown on the right.
Panel B. The radioactivity present in each band was quantitated
and plotted as described in Materials and methods. The data for (o ----- o)
were from lanes 2 to 5 and the data for (o ---- o) were from the lanes 6 to 9.
WO 95/34684 2 i g ~ 3 ~ ~ PCT/US94/06631
-6-
Detailed Description of the Preferred Embodiments
1. Introduction
The invention provides methods to measure the viral nucleic acid in a
sample from individuals using a mutant (tagged) virus as an internal control.
Preferred embodiments provide an infectious tagged virus. The mutant virus
has a sequence tag in a conserved region of the genome. To utilize this virus
as an internal control, a dilution or dilutions of this virus are added to
aliquots
of samples to be measured, nucleic acid is isolated and amplified with primers
capable of amplifying sequence containing the tag in the externally added
virus. The amplification product from the control virus can be differentiated
from the virus present in the sample. The amount of viral nucleic acid present
in the sample is calculated after the amplified products are detected.
"Amplification," as used herein, refers to any in vitro process for
increasing the number of copies of a nucleotide sequence or sequences.
Nucleic acid amplification results in the incorporation of nucleotides into
DNA
or RNA. As used herein, one amplification reaction may consist of many
rounds of DNA replication. For example, one PCR reaction may consist
of 30-100 "cycles" of denaturation or replication. Typical techniques for
carrying out amplification include, but are not limited to PCR (see, for
example, U.S. Pat. Nos. 4,683,195 and 4,683,202), LCR (Barany, Proc. Natl.
Acad. Sci. USA 88:189-193 (1991), repair chain reaction (RCR) and 3SR (see,
for example, European Patent Publication No. 373,960), including specific
kinds of 3SR, such as, nucleic acid based amplification (NASBA),
transcription mediated amplification (TMA) and strand displacement
amplification (SDA).
The term "primer" refers generally to a nucleic acid molecule capable
of hybridizing to the template nucleic acid and priming polymerization on the
template. The term is to be construed to encompass, but not be limited to,
deoxyribonucleic acid or derivatives thereof.
CA 02192324 ~nna,_Og-26
As used herein, the term "template" refers to a nucleic acid molecule
that a nucleotide polymerise will use for the polymerization. The template
moleaile may be polymerized either partially or fully having either all of its
nucleotide residues polymerization copied or having any number of its residues
polymerization copied. In one preferred embodiment the nucleic acid template
is comprised of ribonucleic acid and that the polymerise be reverse
transcriptase. In another preferred embodiment the template be DNA and the
polymerise is a DNA-did-DNA-polymerise, such as Taq polymerise.
"Nucleotide," as used herein, is a term of art that refers to a base-
sugsr~hosphate combination. Nucleotides are the monomeric units of nucleic
acid polymers, i.e., of DNA and RNA. The term includes ribonucleoside
triphosphates, such as rATP, rCTP, rGTP, or rUTP, and deoxyribonucleotide
triphosphates, such as dATP, dCTP, dGTP, or dTTP. A "nucleoside" is a
base-sugar combination, i.e., a nucleotide tacking phosphate. It is recognized
in the art that there is a certain interchangeability in the usage of the
titans
"nucleoside" and "nucleotide"
By "PCR" is meant herein the polymerise chain reaction (PCR) .
technique, disclosed by Mullis in the U.S. Pat. Nos. 4,6$3,195 (Mullis et al.)
and 4,683,202. In .the PCR technique,
preferably short oligontide pcirners am prepared which maoclt opposite
ends of a desired sequence. The sequence between the primers need not be
known, A sample of DNA (or RNA) is extracted and denatured (pt~eferably
by heat). Then, oligonucleotide primers are added in molar excess, along
y~rith
dNTPs and a polymerise (preferably Taq polymerise, which is stable to heat).
~5 The DNA is repliccaitted, then again denatured. This results in two "long
products," which begin with the respective primers, and the two original
strands (per duplex DNA molecule). The reaction mixwre is then returned to
polymerizing conditions (e.g., by lowering the temperature, inactivating a
denaturing agent, or adding more polymerise), and a second cycle initiated.
The second cycle provides the two original strands, the two tong products
from cycle 1, two new long products (replicated from the origins! strands),
WO 95134684 21 g ~ 3 2 ~ PCT/US94/06631
_g_
and two "short products" replicated from the long products. The short
products have the sequence of the target sequence (sense or antisense) with a
primer at each end. On each additional cycle, an additional two long products
are produced, and a number of short products equal to the number of long and
short products remaining at the end of the previous cycle. Thus, the number
of short products grows exponentially with each cycle. This amplification of
a specific nucleic acid sequence allows the quantitation of extremely small
quantities of DNA.
The term "3SR" as used herein refers to a method of target nucleic
acid amplification also known as the "self-sustained sequence replication"
system as described in European Patent Publication No. 373,960 (published
June 20, 1990).
The term "LCR" as used herein refers to a method of target nucleic
acid amplification also known as the "ligase chain reaction" as described by
Barany, Proc. Natl. Acad. Sci. USA 88:189-193 (1991).
The terms "tag" or "tagged" as used herein to describe a genetic
sequence refer generally a nucleic acid sequence that is derived from a wild
type virus or is synthesized from the sequence of a wild type virus and which
differs from the sequence of the wild type virus nucleic acid by comprising a
sequence insertion, deletion, or point mutation, or any combination of these
mutations, such that the tagged nucleic acid can be differentiated from the
wild
type virus from which it is derived or a wild type virus of the same species.
A tagged virus is a virus comprising a tagged nucleic acid sequence. The tag
may in certain instances code for amino acid sequences that create a tagged
protein as compared to a protein in the wild type virus.
Amplification in the methods of the invention can be performed using
any of the amplification techniques known in the art, particularly those
described and defined in the forgoing.
In preferred embodiments of this invention, the nucleic acid is
amplified using PCR as described herein. Suitable PCR primers are prepared
by means known to those of ordinary skill in the art, for example by cloning
CA 02192324 2004-08-26
_g_
and restriction of appropriate sequences, or by direct chemical synthesis. For
example, one may employ the phosphotriester method described by Narang et
al., Meth. Enzymol. 68:90 (1979) and U.S. Pat. No. 4,356,270.
Alternatively, one may use the phosphodiester method
S disclosed in Brown et al., Meth. Enzymol. 68:109 (1979).
Other methods include the phosphoramidite method disclosed
in Beaucage et al., Tetrahedron Letts. 22:1859-1862 (1981), and the solid
support method in U.S. Pat. No. 4,458,066. The primers may also be
labeled, if desired, by incorporating means detectable by spectroscopic,
photochemical, biochemical, immunochemical, or chemical means. For
example, the primer may include 'ZP, fluorescent dyes, electron-dense
reagents, enzymes (as commonly used in ELISAs), biotin, or haptens or
proteins for which antisera or monoclonal antibodies are available. The label
should be selected to withstand denaturing conditions if it is to be attached
directly to the primer.
When the nucleic acid strand to be amplified has been separated from
contaminating material, it is ready to be used as a template for the synthesis
of additional nucleic acid strands. This synthesis can be performed using any
suitable method. The reaction is generally conducted in a buffered aqueous
solution, preferably at a pH of 2-9, most preferably about 8. Preferably, a
molar excess (for cloned nucleic acid, usually about 1000:1 primer/template,
and for genomic or viral nucleic acid, usually about 108:1 primeraemplate) of
the two oligonucleotide primers is added to the buffer containing the
separated
template strands. It is understood, however, that the amount of
complementary strand may not be known, so the amount of primer relative to
the amount of complementary strand cannot be determined with certainty. A
large molar excess is preferred to improve the efficiency of the process.
These conditions are to be considered general guidelines for carrying out the
reaction. Skilled artisan will understand how to carry out this reaction using
a variety of buffers and conditions in view of the state of the art.
WO 95/34684 219 2 3 2 ~ PCT/US94/06631
-10-
The deoxyribonucleoside triphosphates dATP, dCTP, dGTP and dTTP
are also added to the synthesis mixture in adequate amounts and the resulting
solution is heated to about 90-100°C for about 1 to 10 minutes,
preferably
from 1 to 4 minutes. After heating, the solution is allowed to cool to room
temperature, which is preferred for the primer hybridization. To the cooled
mixture is added a polymerization agent, and the reaction is conducted under
conditions known in the art. This synthesis reaction may occur at from room
temperature up to a temperature above which the polymerization agent no
longer functions efficiently. Thus, for example, if an E. coli DNA polymerise
is used as the polymerizing agent, the maximum temperature is generally no
greater than about 40°C. Most conveniently, the reaction using E. coli
polymerise occurs at room temperature. Where greater stringency is desired,
the reaction is performed using the thermostable enzyme Taq polymerise at
elevated temperature.
The polymerization agent may be any compound or system which will
function to accomplish the synthesis of primer extension products from
nucleotide triphosphates, including enzymes. Suitable enzymes for this
purpose include, for example, E. coli DNA polymerise I, Klenow fragment
of E. coli DNA polymerise I, T4 DNA polymerise, and other available DNA
polymerises, reverse transcriptase, and other enzymes, including heat-stable
enzymes such as Taq polymerise, which will facilitate combination of the
nucleotides in the proper manner to form the primer extension products which
are complementary to each nucleic acid strand. Generally, the synthesis will
be initiated at the 3' end of the primer and chain elongation of the newly
synthesized strand will proceed in the 5' direction, until synthesis
terminates,
producing molecules of different lengths. There may be agents, however,
which initiate synthesis at the S' end and proceed in the other direction,
using
the same process as described above: use of such agents in the process of the
invention is also to be considered within the scope of this invention.
The newly synthesized nucleic acid-complementary strand and the
original nucleic acid strand form a double-stranded molecule which is used in
2.~ 9232.
WO 95134684 PCT/US94/06631
-11-
the succeeding steps of the process. In the next step, the strands of the
duplex
molecule are separated using any of the procedures described above to provide
single-stranded molecules.
New nucleic acid is synthesized on the single-stranded molecules.
Additional polymerization agent, nucleotides and primers may be added if
necessary for the reaction to proceed under the conditions prescribed above.
Again, the synthesis will be initiated at one end of the oligonucleotide
primers
and will proceed along the single strands of the template to produce
additional
nucleic acid. After this step, half of the extension product will consist of
the
specific nucleic acid sequence bounded by the two primers.
The steps of strand separation and extension product synthesis can be
repeated as often as needed to produce the desired quantity of the specific
nucleic acid sequence. As will be described in further detail below, the
amount of the specific nucleic acid sequence produced will accumulate in the
exponential fashion.
If desired, one may amplify the target sequence in two stages, using
nested primers. This variation may be used as a means for increasing the
specificity of the reaction. The primer binding regions are selected so that
the
second set (arresting primers) bind to regions of the nucleic acid sequence
between the primer binding regions for the first set (thus insuring that the
second set binding regions will be amplified if present). The amplification
process may be terminated at any time once a detectable quantity of
polynucleotide has accumulated.
IL Methods for Quantitaling Virus
The methods and tagged virus and viral nucleic acid of the invention
are useful for the quantitation of viral nucleic acid and viral particles.
Accordingly, a preferred embodiment of the present invention is a
method for quantitating the amount of virus present in a sample, the method
comprising the steps of: introducing into said sample a composition comprising
~~ 9~32~
WO 95/34684 PCT/US94/06631
-12-
a virus containing a genetically tagged viral nucleic acid; co-isolating said
wild
type and said tagged nucleic acid from the sample; amplifying said wild type
and said tagged nucleic acid from said sample; and quantitating said wild type
and said tagged nucleic acid following nucleic acid amplification.
In an embodiment of the method for quantitating the amount of virus
present in a sample, the sample is obtained from an individual suspected to be
infected by a virus.
As used herein, the term "individual" refers generally to a single
specimen or member of an organism-group or species. The term is to be
construed to encompass, but not be limited to, mammals, birds, reptiles and
amphibians, but is especially directed to humans.
As used herein, the terms "isolating" and "providing" generally refer
to preparing a compound to be tested or analyzed in a manner suitable for the
test or analysis, or preparing an extract containing a compound to analyzed or
tested. The terms are intended to encompass crude cell lysates and extracts
containing nucleic acid as well as substantially purified nucleic acid. The
term
"co-isolating" encompasses the meaning of "isolating" and also refers to the
isolation of more than one compound from a sample substantially
simultaneously, and particularly refers to the isolation of more than one
nucleic acid.
The methods of the invention are generally applicable to the accurate
quantitation of any virus. For the DNA viruses, the methods of the invention
provide an internal control for the quantitation of viral DNA, some of which
degrades or is otherwise lost during isolation or manipulation. The internal
control allows the skilled artisans to make an accurate determination of the
virus titer or DNA quantity in the sample or individual.
Similarly, for the RNA viruses, the methods of the invention provide
an internal control for the quantitation of viral RNA. The lability and
sensitivity of RNA to degradation due to, for example, the ubiquity of RNases
is well known. The invention is particularly useful for the quantitation of
viral
2I 92324
WO 95/34684 PCT/US94/06631
-13-
RNA or viral titer. Methods directed to RNA virus quantitation are preferred
in the invention.
Viral nucleic acids of the invention can be isolated using any of the
many methods known in the art for isolation. For example, RNA may be
isolated by any of the many techniques known and used in the art. See, for
example Chomczynski et al., Anal. Biochem. 1b2:156 (1987). DNA can be
isolated, for example, by phenol extraction and ethanol precipitation.
Moreover, skilled artisans will be able to readily develop alternative
techniques for synthesizing and amplifying cDNA based on the methods of the
invention. DNA may be isolated by phenol extraction followed by ethanol
precipitation.
It is preferred that the viral nucleic acid be isolated prior to
amplification. Isolation can be achieved using any of the many nucleic acid
purification methods known in the art. However, it is not essential that the
nucleic acids be purified. Nucleic acids of the invention need only be
provided in a form that is capable of being amplified. For example,
amplification may be carried out in situ or may be carried out in an a crude
cell or sample lysate. Skilled artisans will understand how to perform in situ
PCR in cells suspected of being infected.
Tagging and preparation of viruses that are useful as internal controls,
and application of these tagged viruses in the methods of the invention, has
broad applicability to a wide range of viruses. For example, it is preferred
in
the methods of the invention that viruses are selected from the group
consisting of: herpesviruses (i.e., herpes simplex virus 1 and 2, varicella-
zoster virus, cytomegalovirus, Epstein-Barr virus), papovaviruses (i.e.,
papillomaviruses and polyomaviruses), enteroviruses, rotaviruses, Norwalk
Group of viruses, coronaviruses, enteric adenovirus, astroviruses, small round
viruses, picorna-parvovirus-like, mini-reovirus, influenza viruses,
paramyxoviruses (i.e., parainfluenza virus, respiratory syncytial virus, and
mumps virus), measles virus, subacute sclerosing panencephalitis (SSPE),
rubella (German measles), arboviruses (i.e., members of the families of
PCT/US94/06631
WO 95/34684 ,
-14-
Toggaviridae and Bunyaviridae, as well as arboviruses that cause fevers, rash,
arthralgia, arboviruses that cause encephalitis, and arboviruses that cause
hemorrhagic fevers), rhabdoviruses, Marburg viruses, Ebola viruses, vesicular
stomatitis virus, arenaviruses (i.e., Junin virus in Argentina, Machupo virus
in Bolivia, and Lassa fever in West Africa), hepatitis viruses (i.e.,
hepatitis A,
hepatitis B, hepatitis C, and hepatitis delta), reoviruses and rhinoviruses.
Skilled artisans will understand that the methods of the invention can
be used with both RNA and DNA viruses, and that the conditions used in any
particular embodiment may depend in part on the nature of the nucleic acid of
the genome. For example, the nucleic acid from DNA viruses can be isolated
and directly amplified according to the methods of the invention or any
amplification method known in the art, such as PCR. Moreover, for example,
it is preferred that RNA viruses are reverse transcribed prior to
amplification
of their genomic nucleic acid. In this way reverse transcribed DNA can serve
as the template for the synthesis of amplification products using any of the
amplification reactions known in the art, and particularly PCR. However, it
will be clear to skilled artisans that the same methods may be used for RNA
and DNA viruses. For instance, if the nucleic acid being amplified for the
quantitation of virus is mRNA, then the same method can be used for all
viruses which synthesize mRNA.
A. Retroviral and RNA Virus Quantitation Methods
The following are preferred embodiments of the invention for being
generally methods of quantitating RNA virus nucleic acid and particles.
In one embodiment of the invention the wild type viral nucleic acid is
RNA, particularly retroviral RNA.
In another embodiment the viral RNA of the invention is retroviral
RNA derived from an animal naturally capable of being infected by a
retrovirus.
WO 95/34684 PCT/US94/06631
2I ~23z~
-15-
It is contemplated that the retroviral nucleic acids useful in the methods
and constructs of the invention include, but are not limited to those derived
from retroviruses, such as of the genus Cisternavirus A; Oncovirus B,
including mouse mammary tumor viruses (MMTV-S (Bittner's virus),
MMTV-P (GR virus), MMTV-L); Oncovirus C, such as Rous sarcoma virus,
Rous-associated virus, chicken sarcoma viruses, leukosis viruses,
reticuloendotheliosis viruses, pheasant viruses, murine sarcoma viruses,
murine leukosis virus G (Gross or AKR virus), murine leukosis viruses (MLV-
F, MLV-M, MLV-R (Friend, Maloney, Rauscher viruses)), murine radiation
leukemia virus, murine endogenous viruses, rat leukosis virus, feline leukosis
viruses, feline sarcoma virus, feline endogenous virus (RD114), hamster
leukosis virus (HLV), porcine leukosis virus, bovine leukosis virus, primate
sarcoma viruses (woolly monkey, gibbon, ape), primate sarcoma-associated
virus, primate endogenous viruses (baboon endogenous virus, stumptail
monkey virus, MAC-1, owl monkey virus (OMC-1)); Oncovirus D, including
reptilian viruses, such as the viper virus, and non-reptilian viruses such as
Mason-Pfizer monkey virus (MPMV), langur virus, and squirrel monkey
virus; Lentivirus E, including Visna virus of sheep and Maedi virus; and
Spumavirus F, including foamy viruses of primates, cats, humans, and bovids.
It is preferred that the nucleic acids of the invention be derived from
any of the human retroviruses, particularly the human T cell leukemia viruses
and human immunodeficiency viruses, as well as from hepatitis viruses A, B,
C and delta.
It is most preferred in the methods of the invention that the retroviral
RNA is derived from a virus selected from the group consisting of HTLV-I,
HTLV-2, HIV-1 and HIV-2.
Further virus nucleic acids of the invention include ones derived from:
Caulimoviruses, avian myoblastosis virus, simian immunodeficiency viruses,
feline immunodeficiency viruses, and equine infectious anemia viruses.
Such viral nucleic acids will be particularly useful with the methods of
the invention in veterinary practice and human clinical practice.
WO 95/34684 ~ ~ ~ PCT/US94/06631
-16-
The methods of the invention preferably have a step which uses a
virion particle as an internal control.
Preferred methods are provided to measure the HIV-I RNA in a sample
from a patient using an infectious mutant virus as an internal control. For
example, in a preferred method a mutant virus, having an insert, deletion or
point mutation in a conserved region (the "tagged region") of the viral genome
is constructed. To utilize this virus as an internal control, it is preferred
that
different dilutions of this virus are added to aliquots of a sample to be
measured. In these methods it is more preferred that the sample contain or be
blood, plasma or serum. It is most preferred that the sample comprises
plasma. RNA is isolated from the sample and reverse transcribed to cDNA.
Amplification is performed with primers selected to include the sequences on
either side of the tagged region contained in the externally added virus. The
DNA product from the control virus having the tagged region has a different
nucleotide composition than that from the virus present in the sample. The
amount of viral RNA present in a sample is calculated after the amplified
products are separated by gel electrophoresis. An advantage to this method
is it eliminates errors introduced by variable recovery during the nucleic
acid
purification step, therefore, enhancing the accuracy of the assay.
B. Samples Suspected to Contain Virus
Samples of the invention include, but are not limited to, any tissue,
cell or fluid obtained from an individual that can potentially contain virus
or
viral nucleic acid, such as, for example, blood, cerebrospinal fluid, saliva,
lymphatic fluid, seminal fluid, vaginal fluid, serum, plasma, lymphoid or
lymphocyte cells, especially B cells, T cells, monocytes, polymorphonuclear
cells and macrophages, epithelial cell, especially nasopharyngeal and upper
respiratory tract epithelium, labial epithelium, tumor cells, respiratory
secretion, especially nasopharyngeal secretions, brain tissue, virus vesicle
tissue, fluid and associated matter, wart tissue, fluid and associated matter,
219~32Q.
WO 95/34684 PCT/US94/06631
-17-
feces, urine, pleural and pericardial fluid, milk, salivary gland tissue,
negri
body fluid, cells and associated matter, and hepatic cells.
Samples of the invention can be derived from many sources. It is
preferred that the sample used in the methods is obtained from a mammal,
particularly a mammal that is capable of being naturally infected by a
retrovirus.
It is more preferred that the sample is obtained from a mammal
selected from the group consisting of: murids, leporids, equids, cervids,
suids,
ovids, bovids, felids, canids, mustelids, pongids and humans.
It is preferred in the methods that the amplification of said quantitating
step comprises the step of performing polymerise chain reaction.
The quantitating step of the methods of the invention preferably utilize
a polymerise chain reaction, particularly following a reverse transcription
reaction step. Skilled artisans will be able to modify the reaction mixture
and
reagents to achieve useful reverse transcriptase activity using methods known
in the art. Skilled artisans will be able to use any of the reverse
transcription
reaction mixes known in the art. See, for example, U.S. Patent
No. 5,183,949 in which a reaction mixture is disclosed in Figure 1 in that
patent.
It is preferred that the sample of the methods comprises blood and/or
plasma.
Accordingly, a sample can be collected from individuals suspected of
being infected by virus. It is most preferred that the sample comprises plasma
that can be separated by centrifugation and stored until use. Aliquots of
serial
dilutions of a tagged virus can be added to the sample, and the mixed nucleic
acid from tagged and wild type virus is co-isolated. It is preferred that the
nucleic acid is precipitated by addition of an equal volume of alcohol and
carrier tRNA. Nucleic acid is then recovered, preferably by centrifugation,
washed and dissolved in buffer.
Samples used in the methods of the invention can be obtained by any
of the various techniques known and employed in the art for obtaining tissues
WO 95/34684 PCT/US94/06631
-18-
and fluids, including, but not being limited to, punch biopsying, swabbing,
tissue aspiration, lavage, scraping and phlebotomization. It is contemplated
by the invention that the tissue can be used directly for the extraction of
protein or nucleic acid, or can be maintained in culture prior to such
extractions. Cultured cells of the invention may comprise primary cells or
immortalized cell lines. See, for example, Jat P.S. and Sharp, P.A., J. Virol.
59:746 (1986).
It may be advantageous to prepare cell lysates in the quantitating step
in the methods of the invention. Cell lysates in the present invention can be
simply prepared using, for example, chemical cytolysis, biological cytolysis
and physical cytolysis, including maceration, trituration, alkaline lysis,
detergent lysis, osmotic lysis, freeze-thaw lysis, and sonication.
If the sample in the methods comprises cells, the cells can be isolated
in any of the many ways known in the art for isolating cells. Skilled artisans
will recognize that cells may be obtained from an individual and used directly
or maintained in culture prior to being used in the methods of the invention.
Cells that are maintained in culture prior to being used in the methods may be
maintained, for example, in standard tissue culture medium, such as MEM
medium containing 10% fetal calf serum. Skilled artisans will recognize
methods known in the art that are useful for stimulating the cells prior to
use
in the methods of the invention.
Cell numbers of isolated cells may be determined by methods known
in the art, such as, for example, enumeration by culture counter or using a
microscope and reticle (hemocytometer). See, for example, Butler, W.B.,
Analytical Biochem. 141:70-73 (1984).
WO 95134684 219 ~ 3 2 4- PCT/US94/06631
-19-
C. Nucleic Acid Detection And Quantitation Methods
1. Amplification
Any method of nucleic acid amplification can be used in the
amplification step in the methods of the invention. Preferred amplification
reactions used in the methods of the invention include, for example, PCR
(U.S. Pat. Nos. 4,683,195 and 4,683,202, 3SR (European Patent Application
No. 373,960), LCR (Barany, Proc. Natl. Acad. Sci. USA 88:189-193 (1991),
RCR and 3SR (see, for example, European Patent Publication No. 373,960),
including specific kinds of 3SR, such as, NASBA, TMA and SDA.
It is preferred that the amplification step of the methods further
comprises the step of performing a nucleic acid amplification chain reaction.
As used herein the term "nucleic acid amplification chain reaction"
refers generally to any in vitro process for increasing the number of copies
of
a nucleotide sequence or sequences via a chain reaction, including, for
example, PCR (see, for example, U.S. Pat. Nos. 4,683,195 and 4,683,202),
LCR (Barany, Proc. Natl. Acad. Sci. USA 88:189- I 93 ( 1991 ), and RCR.
As discussed in the forgoing, the nature of the viral nucleic acid being
obtained may dictate the preferred method by which it is obtained. In other
words, amplification of DNA and RNA may require different techniques to be
applied.
Reverse transcription can be used in the methods for the amplification
of RNA virus genomic RNA or mRNA from any virus.
Amplification reactions can be used to quantitate the level of wild type
virus or viral nucleic acid, quantitate the level of tagged virus or viral
nucleic
added to a sample, and to quantitate the level of tagged virus or viral
nucleic
added to a sample.
Amplification products can be analyzed and quantitated using
techniques known in the art, such as gel electrophoresis analysis. In a
preferred embodiment, PCR amplification product analysis is carried out as
WO 95/34684 PCT/US94/06631
2~.9~~'~~-
-20-
follows. A volume of PCR product is hybridized with a labelled
oligonucleotide probe capable of hybridizing to the PCR product. The
products are separated, preferably on a polyacrylamide gel and the probed
products are detected, preferably by autoradiography (see, for example,
Psallidopoulos et al., J. Virol. 63: 4626-4631 (1989)). The amount of label
present in each separated product is quantitated using techniques known in the
art, preferably by using optical or radiometric scanning (see, for example,
Johnston et al. , Electrophoresis 11:355-360 ( 1990)). The amount of label
present in each product sample is estimated and the ratio between the amount
of label present in tagged and the wild type DNA bands is plotted against the
input mutant viral RNA. Using this technique, the amount of viral RNA
present in the samples is determined in the number of copies of RNAs per unit
volume of sample obtained from the individual infected with virus.
It is preferred that a competitor internal control plasmid DNA is used
in the reaction to estimate the amount of cDNA from the tagged virus
following amplification. For example, to establish and standardize the assay,
cDNA from tagged virus is PCR amplified in the presence of different amount
of another control DNA. The different control DNA is selected so that the
predicted DNA PCR products can be differentiated, preferably by size.
It is preferred that the quantitating step of the methods of the invention
further comprises the step of co-isolating both of said wild type RNA and said
tagged RNA. It is more preferred that the genetically tagged viral RNA
comprises sequence derived from a retrovirus, particularly a retrovirus
naturally capable of infecting an animal. It is most preferred that the
retrovirus is a human retrovirus, particularly a retrovirus selected from the
group consisting of HTLV-I, HTLV-II, HIV-1 and HIV-2.
Based on the approximate mass of the viral particle, which is known
in the art or can be determined using methods known in the art (Bourinbaiar,
A.S., Nature 349:111 (1991); Bourinbaiar, A.S., Weight of HIV AIDS Res.
Human Retrov. 8:1545 (1992)), such as quantitative centrifugation, the
quantity of virus and viral nucleic acid in any sample or preparation can be
CA 02192324 X004-08-26
. . .. .2 1
determined. Moreover, the copy numbers of viral nucleic acids can also be
determined.
It would be understood by skilled artisans that detection and
quantitation of polymers synthesized by amplification can be enhanced by
labeling nucleotide monomers that will be incorporated into the polymerization
products. One skilled in the art will immediately recognize that these
labeling
materials will also be useful to label the polymerization products following
their synthesis and any compounds that are useful for the detection and
quantitation of the polymerization products, such as, for example,
hybridization probes.
It is preferred that the quantirating step of the methods further
comprises introducing a hybridization probe into said wild type and said
tagged DNA products of the polymerise chain reaction.
It is preferred in the methods that the oligonucleotide is a labelled
hybridization probe.
It is pt'efernd that in the methods of the invention that the quantitating
step further comprises ..the step of separating the DNA polymen~se chain
reaction products. It more preferred that the separating step further
comprises
electrophoresis of the DNA products.
A preferred embodiment of the amplifying step of the above genetic
methods further comprises the steps of: isolating RNA from the sample;
contacting the RNA with at least one primer capable of priming cDNA
synthesis; synthesizing first strand cDNA from the primers; contacting the
cDNA with at least one primer capable of priming extension product synthesis;
synthesizing primer extension products from the primers; and, amplifying the
extension products using polymerise chain reaction to yield amplified nucleic
acid.
Skilled artisans will be readily able to make primers useful for
amplification, such as PCR primers. Certain primers can be obtained
3D commercially or can be synthesized with a DNA synthesizer, such as, for
example, an Applied Biosystems Inc DNA synthesizer (Foster City, CA).
WO 95/34684 PCT/US94/06631
2'92~2~
-22-
Skilled artisans will readily recognize techniques by which levels of
nucleic acid amplification can be detected, determined or quantitated such as,
for example, by measurement of labeled nucleotides incorporated in the
nucleic acid polymerized, measuring the number of certain residues in the
nucleic acid polymerized or spectrographically measuring the absorptivity of
the nucleic acid polymerized. Skilled artisans will also recognize numerous
hybridization techniques whereby the amplification and polymerization can be
detected, determined or quantitated, such as, for example, by chromatographic
separation of polymerized products followed by hybridization with a labeled
nucleic acid (See, for example, Haymes, et al. (in: Nucleic Acid
Hybridization, A Practical Approach) IRL Press, Washington, DC (1985)).
Another technique that may be employed to determine the level of
amplification and polymerization is by labelling the primer nucleic acid and
detecting a shift in the level of incorporated label to unincorporated label
over
time.
It will be understood by skilled artisans that the quantitation step or
steps of the invention can be enhanced by labeling the detection or
quantitation
means. For example, detection and quantitation of polymers synthesized by
amplification can be enhanced by labeling nucleotide monomers that will be
incorporated into the amplification products. One skilled in the art will
immediately recognize that labeling materials will also be useful to label the
amplification products following their synthesis. Skilled artisans will know
which compounds are useful for the detection and quantitation of amplification
products, such as, for example, hybridization probes. Label will also be
useful to enhance the detection and quantitation of an antibody used in the
methods of the invention. Labels useful in the methods of the present
invention include, but are not limited to, fluorescers, ligands, chromophores,
chromogens, luminescers, including chemoluminescers and bioluminescers,
and radionuclides. Skilled artisans will be able to select an appropriate
label
for any given means of detection, such means including for example,
nucleotide monomers, oligonucleotides, antibodies, lectins, streptavidin-
biotin,
~.~ ~~~24.
WO 95/34684 PCT/US94/06631
-23-
oligonucleotide intercalating agents and peptides, such as those useful for
nucleic acid binding. Skilled artisans will be able to use such means of
detection using techniques known in the art. See, for example, Sambrook
(Sambrook et al., Molecular Cloning - A Laboratory Manual (2d ed.), Cold
Spring Harbor Labs, Cold Spring Harbor, N. Y. ( 1989)).
Different concentrations or titers of viral nucleic acids or particles can
be used in order to generate standard curves to which the wild type particle
or nucleic acid quantities can be prepared. See, for example, Stryer, L.
Biochemistry, 2nd Edition, W.H. Freeman and Co., San Francisco, CA (1981)
for a general discussion of enzyme kinetics and inhibition; Remington's
Pharmaceutical Sciences, 18 Edition, Mack Publishing Co., Easton, PA (1990)
for a general discussion of displaying graphical data. Skilled artisans will
be
easily able to determine the quantity of viral particles per unit volume of
the
sample obtained from the individual. This will allow the wild type viral titer
to be determined. In a clinical setting, knowledge of the viral titer is
valuable
information upon which to base the efficacy of treatment and the health of the
individual. For example, the methods of the present invention will provide to
the numerous individuals suffering from HIV infection, an important method
for determining the efficacy of their therapies and the course of their
infection.
The methods provide a convenient way to accurately quantify the viral burden
in an individual.
2. Hybridization
Nucleic acid of the invention can also be quantitated using
hybridization techniques known in the art. Using these methods tagged nucleic
acid molecules can be readily differentiated from wild type nucleic acid
molecules. The nucleic acids of the present invention can be quantitated using
hybridization techniques, such as for example, Northern and Southern blotting
and RNase protection assays. For examples of nucleic acid hybridization
techniques, see Meinkoth et al. , Anal. Biochem. 1.8:267-284 (1984); Haymes,
WO 95/34684 ~ ~ j PCT/US94J06631
-24-
et al. (In: Nucleic Acid Hybridization, A Practical Approach. IRL Press,
Washington, DC (1985), Melton, et al., Nucl. AcidsRes. 12:7035-7056 (1984)
and Sambrook, et al. , Molecular Cloning--A Laboratory Manual, (Second
Edition), Cold Spring Harbor Labs, Cold Springs Harbor, N.Y. (1989).
3. Antibody Techniques
Sequence tags present within open reading frames will be transcribed
in viral RNAs, which can be translated so that the modified peptide produced
can be detected and quantitated using an antibody. Certain of the tagged
molecules will have novel epitopes engineered into them so that commercially
available antibodies may be used for detection and quantitation. For example,
the coding sequence for a heterologous epitope known to be recognized by a
certain antibody can be fused to the coding sequence for a viral protein. In
this way the tagged protein can be detected and quantitated. Using a second
antibody specific for a viral epitope that is disturbed by the inserted tag,
the
skilled artisan can determine the level of wild type viral protein. Another
example of an antibody quantitation method relies on the difference in
molecular weight between the tagged protein and the wild type protein.
Western blotting and immunoprecipitation are convenient for quantitating these
two proteins and measuring their levels. These translation/antibody detection
techniques will allow the skilled artisan to determine the level of in vitro
synthesized wild type and tagged protein.
In vitro translation may be carried out using any of the methods known
in the art, such as reticulocyte lysate translation.
The term "antibody", as used herein, refers to both monoclonal
antibodies which are a substantially homogenous population and to polyclonal
antibodies which are heterogenous populations. Antibodies may be from any
immunoglobulin class, including IgG, IgM, IgE, IgA, IgD and any subclass
thereof. The term "antibody", as used herein, is also meant to include both
natural intact molecules and fragments thereof, such as, for example, Fab and
WO 95/34684 PCTlUS94/06631
-25-
F(ab')2, which are capable of binding antigen or hapten, as well as fusion
constructs capable of binding antigen or hapten comprising immunoglobulin
fragments and fragments of other molecules. The term "antibody" is also to
be construed to include humanized antibodies of various other species as well
as immunoglobulins or fusions therefrom expressed in a prokaryotic cell.
Both monoclonal and polyclonal antibodies to wild type and tagged
protein will be made according to methods well known in the art. See, for
example, Ausubel et al., Current Protocols in Molecular Biology, published
by Current Protocols, pp. 11.4.2-11.13.4 (1993). Hybridomas may be created
using the cells of the present invention for the production of monoclonal
antibodies. See, for example, Kohler et al., Eur. J. Immuno. 6:292 (1976).
Antibodies may be generated against wild type and tagged proteins.
Moreover, antibodies to wild type protein can be isolated from cells and
tissues where they naturally occur.
It is contemplated by the present invention that substantially purified
wild type and tagged protein will be useful in immunoassays. One skilled in
the art can readily use substantially purified protein of the invention as the
starting point to develop immunoassays using methods known in the art, such
as, for example, radioimmunoassays, sandwich assays and immunodiffusion
assays. See, for example, Kohler et al. , Nature 256:495 ( 1975); Kohler
et al., Eur. J. Immunol. 6:511 (1976); Kohler et al., Eur. J. Immunol. 6:292
(1976); Hammerling et al. , In Monoclonal Antibodies and T Cell Hybridomas,
pp. 563-681, Elsevier, N (1981); Sambrook et al., Molecular Cloning- A
Laboratory Manual, (Second Edition), Cold Spring Harbor Labs, Cold Spring
Harbor, N.Y. (1989), especially Chapter 18 which outlines methods useful
with substantially purified protein or antibodies raised to substantially
purified
protein. One method commonly known in the art is to make polyclonal or
monoclonal antibodies to substantially purified proteins. See, for example,
Harlowe, E. and Lane, D., Antibodies a Laboratory Manual, Cold Spring
Harbor Laboratories, 1988.
WO 95/34684 PCT/US94/06631
21.9232
-26-
4. Restriction Analysis
In an embodiment of the invention, the tagged nucleic acid can be
distinguished from the wild type nucleic acid by restriction analysis. General
approaches to restriction analysis include a method whereby the wild type
virus contains a restriction site or sites which the tagged virus does not
contain. Alternatively, the tagged virus can contain a restriction site or
sites
which the wild type virus does not contain. Novel sites can be engineered into
the tag sequence using methods well known by skilled artisans (see, for
example, Sambrook et al. , Molecular Cloning - A Laboratory Manual (2d
ed.), Cold Spring Harbor Labs, Cold Spring Harbor, N.Y. (1989) and
Rodriguez et al., Recombinant DNA Techniques: An Introduction, The
Benjamin/Cummings Publishing Co., Ontario (1983)). Following
amplification, the novel site or sites can be digested with restriction
endonuclease using techniques known in the art (see, for example, Sambrook
et al., Molecular Cloning - A Laboratory Manual (2d ed.), Cold Spring
Harbor Labs, Cold Spring Harbor, N.Y. (1989) and Rodriguez et al.,
Recombinant DNA Technigues: An Introduction, The Benjamin/Cummings
Publishing Co., Ontario (1983)). Following digestion, the nucleic acid
fragments can be separated, such as by, for example, gel electrophoresis, and
the amounts of amplified nucleic in each band can be quantitated. It will be
a simple matter to distinguish between the tagged and wild type viral nucleic
acid, since the number and/or size of the products from the nucleic acids will
be different.
A novel restriction site can be constructed in the tagged virus using
insertion of a linker containing the site, point mutation to construct a site
or
deletion to join two regions an create a site. Moreover, the skilled artisan
can
select restriction sites to delete. This will also create a tagged virus
having a
different restriction pattern and restriction map to enable the skilled
artisan to
distinguish the tagged nucleic acid from the wild type nucleic acid.
As used herein the term "novel site" refers to a site which does not
occur in the wild type viral genome at the position of the engineered site.
WO 95/34684
219 2 ~ 2 ~. --S94106631
-27-
However, the restriction site may exist somewhere else in the wild type viral
genome.
In a preferred embodiment a infrequently occurring restriction site is
constructed in the sequence tag. It is more preferred that the infrequently
occurring restriction site is present only once in the tagged nucleic acid and
is not present in the wild type virus. These constructs will yield a two band
restriction pattern for the tagged virus and a single, larger band for the
wild
type virus.
III. Genetically Tagged Viral Nucleic Acids and Viral Particles
As used herein, the term "substantially pure" or "substantially purified"
is meant to describe a compound which is substantially free of any compound
associated with the compound in its natural state. For example, a protein
which is substantially free from other proteins, nucleic acids, lipids and
carbohydrates is considered to be substantially pure or purified. The term is
further mean to describe a compound which is homogenous by one or more
criteria of purity or homogeneity used by those of skill in the art. The terms
"substantially pure" or "substantially purified" as use herein are not meant
to
exclude artificial, synthetic, or semi-synthetic mixtures or hybrids.
The invention also provides a genetically tagged retroviral nucleic acid
comprising a tag sequence in a highly conserved region of said retroviral
nucleic acid, for example, wherein said tag occurs between the retroviral
primer-binding and gag initiation sites. For example, it is more preferred
that
a tag is constructed in a well conserved region between the primer binding and
gag initiation sites of retroviruses (Myers et al., Human Retroviruses and
AIDS: A Compilation and Analysis of Nucleic Acid and Amino Acid
Sequences, Los Alamos National Laboratory, Los Alamos, New Mexico
(1992)). It is most preferred that the tag comprises an inserted sequence,
particularly consisting essentially of the sequence:
AGACATCTAGACGCGTCTAGACGCG.
WO 95/34684 PCTIUS94/06631
219~3~4-
-28-
Tagged viral nucleic acids can be constructed using standard
procedures as described in Sambrook et al. (Sambrook et al., Molecular
Cloning: A Laboratory Manual, 2nd ed., Cold Spring Harbor laboratory,
Cold Spring Harbor, New York (1989)). For instance, the tagged region can
be inserted or deleted from a DNA copy of a DNA or RNA virus and these
DNA constructs can be substantially purified. These DNA constructs can also
be transfected into host cell lines so that viral particles can be produced.
It is also preferred that the tag comprises fused nucleic acid said fused
junction being defined by a deletion mutation of a wild type sequence.
If the tag is an insertion, it is preferred that the tag sequence is of a
sufficient length that the wild type and mutant viral DNAs can be separated
and identified after amplification. It is most preferred that an insert tag be
between about 5 and 50 nucleotides in length. The sequence tag can be any
number of nucleotides in length as long as the tag will not interfere with
virus
growth. Virus growth can be easily monitored using techniques known in the
art and taught in the invention.
It is preferred that the retroviral RNA is derived from a retrovirus
capable of naturally infecting an animal.
It is more preferred that the retroviral RNA is derived from human
retroviral RNA selected from the group consisting of HTLV-I, HTLV-II,
HIV-1 and HIV-2.
Viral particles can be prepared following the construction of the tagged
virus. Viral DNA constructs can be transfected into cells and these cells can
be culture to obtain viral particles. These viral particles can be isolated or
used to infect another cell type so that more virus can be grown up. Skilled
artisans will know methods for transfection of these viral constructs, such
as,
for example, calcium phosphate precipitation method (Sambrook et al. ,
Molecular Cloning: A Laboratory Manual, 2nd ed., Cold Spring Harbor
laboratory, Cold Spring Harbor, New York (1989)).
Transfected cells can be maintained using methods well known in the
art for mammalian cell culture, such as maintenance on MEM medium
WO 95/34684 PCT/US94/06631
-29-
containing 10% fetal calf serum, or in RPMI 1640 medium containing 10%
fetal calf serum (Harada et al., Science 229:563-566 (1985)).
For the transfection of HIV DNA constructs it is preferred that 293
cells or other suitable cell types are used, followed by reinfection of MT-2
cells. It is preferred that after transfection, the culture fluid is isolated
and
used to infect cells capable of being infected with virus. Upon establishment
of the infected cells, it is preferred that cell-free virus was harvested,
aliquotted and stored for use in the methods of the invention. It is also
preferred that each aliquot is used only once in any one assay. The amount
of virus in the culture supernatant can be estimated by any of the many
techniques known in the art for quantitating virus titer. For example, HIV-1
titer can be determined by a p24 antigen ELISA assay using Coulter Corp
(Hialeah, FL) reagents following the manufacturer's recommended protocol.
The invention also provides a virion particle comprising the genetically
tagged viral nucleic acids of the invention.
IV. Kits for Quantitating Virus
It is preferred that the kits of the invention be hand-held and
constructed of durable materials and comprising transparent compounds and
reaction chambers so that reaction results can be readily determined by
viewing the kit device. It is more preferred that the kit device comprise a
reaction vessel useful to perform a reaction using a sample and reagents and
reverse transcriptase capable of polymerizing DNA by reverse transcription.
It is more preferred that the reaction vessel be enclosed so that once the
reaction has begun substantially none of the compounds in the reaction can
escape from the kit device.
It is preferred that the kits comprise a convenient plastic container for
holding the various components. 1t is more preferred that the kits comprise
a self contained hand-held assay device whereby samples can be introduced,
tested, results can be obtained, and the contaminated kit device can then be
WO 95/34684 PCT/US94106631
-30-
safely discarded. Those skilled in the art will recognize proper storage and
stabilizing buffers for the reagents in the kits.
One skilled in the art could readily adapt the kits of the present
invention to methods devised using methods of the present invention as a
starting point.
Having now generally described this invention the same will be better
understood by reference to certain specific examples which are included for
the purposes of illustration and are not intended to limit it unless otherwise
specified.
Examples
Summary
The inventors have developed an assay to measure the HIV-I RNA in
patients' plasma or sera using an infectious mutant virus as an internal
control.
The mutant virus, VX-46, has a 25 by insert in a conserved region between
the primer binding and major splice donor sites. To utilize this virus as an
internal control, different dilutions of this virus were added to aliquot of
plasma sample to be measured, RNA was isolated and reverse transcribed to
cDNA. PCR was performed with primers selected to include the sequences
on either side of the insert contained in the externally added virus. The DNA
product from the control virus is 25 by longer than that from the virus
present
in plasma. The amount of viral RNA present in a plasma sample is calculated
after the PCR amplified products are separated by gel electrophoresis. Unlike
other quantitative PCR assays, this internally controlled virion PCR (ICVPCR)
assay eliminates errors introduced by variable recovery during the RNA
purification step, therefore, enhancing the accuracy of the assay.
219~32~
WO 95!34684 pcwr~rtc4din~~a~
-3 I -
Materials and Methods
Cells. 293 cells were obtained from ATCC and maintained in MEM medium
containing 10% fetal calf serum. MT-2 cells were obtained from Dr. D.
Richman through the MAID AIDS research program and were maintained in
RPMI 1640 medium containing 10% fetal calf serum (Harada et al., Science
229:563-566 (1985)).
Generation of Mutant HIV-1 Virus. A well conserved region between
the primer binding and gag initiation sites of HIV-1 was chosen for insertion
(Myers et al. , Human Retroviruses and AIDS: A Compilation and Analysis of
Nucleic Acid and Amino Acid Seguences, Los Alamos National Laboratory,
Los Alamos, N. Mex. (1992)). The plasmid pNL4.3, an infectious molecular
clone of HIV-1 obtained from Dr. M. Martin was used as the starting material
(Adachi et al., J. Virol. 59: 284-291 (1986)). A mutant (VX-46) with the
insert 5' AGACATCTAGACGCGTCTAGACGCG 3' at nucleotide position
715 of pNL4.3 was generated using standard procedures as described in
Sambrook et al. (Sambrook et al. , Molecular Cloning: A Laboratory Manual,
2nd ed., Cold Spring Harbor laboratory, Cold Spring Harbor, New York
(1989)). The HIV-1 nucleotide numbering used is according to HIVNL4.3;
Genbank accession number M 19921. The VX-46 DNA was transfected into
293 cells by the calcium phosphate precipitation method (Sambrook et al.,
Molecular Cloning: A Laboratory Manual, 2nd ed., Cold Spring Harbor
laboratory, Cold Spring Harbor, New York (1989)). Forty eight hours after
transfection, the culture fluid was taken and used to infect MT-2 cells. The
mutant virus grew with similar kinetics as that of wild type virus. Cell free
virus was harvested, aliquotted and stored at -70°C. Each aliquot was
used
once in ICVPCR experiments. The amount of virus in the culture supernatant
was estimated by p24 antigen ELISA assay using Coulter Corp (Hialeah, FL)
reagents following the manufacturer's recommended protocol.
WO 95134684 PCT/US94/06631
-32-
PCR Primers. The ICVPCR primers described in Table 1 were synthesized
with an Applied Biosystems Inc DNA synthesizer (Foster City, CA).
RNA Isolation and cDNA Synthesis. After informed consent had been
obtained, whole blood samples were collected from HIV-I seropositive
patients in the presence of acid-citratedextrose as an anticoagulant. The
plasma was separated by centrifugation and stored at -70°C until use.
Aliquots (100 ~,I) of serial dilutions of the mutant virus, VX-46, were added
to 100 tcl of patient's plasma and RNA was extracted with 4.0 M guanidinium
thiocyanate and phenol in the presence of 180 mM sodium acetate as described
earlier (Chomczynski and Sacchi, Anal. Biochem. 162:156-159 (1987)). The
RNA was precipitated by addition of an equal volume of isopropanol
and 10 ~,g of carrier tRNA (Sigma Chemical Co).
RNA was recovered by centrifugation, washed with cold 70% ethanol and
dissolved in 8.0 ~1 of DNAse buffer containing 50 mM Tris, pH 8.0, 5 mM
MgCI~ and 10 units of RNAse free DNAse (Boehringer Mannheim
Biochemicals) and incubated at 25°C for 30 min. The DNAse was
inactivated
at 80°C for 10 min and the RNA was used for cDNA synthesis using a cDNA
cycle kit obtained from lnvitrogen Corporation (San Diego, CA). Briefly, 2~,1
of 100 mM methyl mercuric hydroxide was added to 8 ~,1 of RNA and after 5
min incubation at room temperature, 2.5 VI of 0.7 M /3-mercaptoethanol was
added and the reaction was kept on ice. To this was added 4.0 ~,I of SX RT
buffer (0.5 M Tris, pH 8.3, 0.2 M KCI and 50 mM MgCI~), 1.0 ~cl of RNAse
inhibitor, 1.0 ~.1 of 25 mM of dNTPs, 1.0 ~1 of primer ICVPCR-9 (40
pmoles) and 0.5 ~,l of AMV reverse transcriptase (5 units) and it was
incubated at 42°C for one hour. Then the reaction was heated to
95°C for 3
min and cooled on ice for 2 min and 5 more units of reverse transcriptase
were added and the incubation was continued for another hour at 42°C.
Finally, the reaction was heated to 95°C for 3 min and the cDNA was
either
used in the PCR or stored at -20°C.
219232
WO 95/34684 ~T/US94/06631
-33-
PCR. Five microliters of cDNA were used in a reaction containing 10 mM
Tris-HCI, pH 8.3, 50 mM KC1, 1.5 mM MgCI,, 0.001 % gelatin, 0.2 mM
dNTPs, 25 picomoles of primers ICVPCR-16 and 17 (Table 1) and 2.5 units
of Taq DNA polymerase (Perkin-Elmer Cetus) in a final volume of 50 ~,1.
The samples were amplified in a Perkin-Elmer Cetus thermocycler (9600) with
the following PCR cycle program: one cycle: 94°C for 60 sec,
55°C for 10
sec and 72°C for 30 sec; 30 cycles: 94°C for 15 sec, 55°C
for 30 sec
and 72°C for 60 sec and a final incubation at 72°C for 10 min.
The samples
were then stored at 4°C until analysis. The competitor plasmid (pAl)
DNA
used to estimate the amount of cDNA from VX-46 virus contained pNL4.3
nucleotide sequences from 501 to 1448.
Analysis of the PCR Product. Fifteen microliters of PCR product were
hybridized with 5'-3?P labelled oligonucleotide ICVPCR-18 (Table 1) and
separated in a 10% polyacrylamide gel and autoradiographed as described
earlier (Psallidopoulos et al. , J. Virol. 63: 4626-4631 ( 1989)). The amount
of radioactivity present in each band was quantitated using either the
Molecular Dynamics PhosporImager (Sunnyvale, CA) or Fuji Medical Systems
BAS1000 (Stamford, CT) by exposing the gel to a storage phosphor screen as
described by Johnston et al. (Johnston et al. , Electrophoresis 11:355-360
( 1990)) .
Results and Discussion
Estimation of RNA Present in a VX-46 Virus Preparation
RNA was isolated from aliquots of VX-46 virus
containing 100 pg, 25 pg or 500 fg of p24 antigen and cDNA was synthesized
using standard conditions. To establish and standardize the assay, cDNA from
VX-46 virus was PCR amplified in the presence of different amount of
plasmid DNA (pAl) containing pNL4.3 nucleotide sequences from 501
WO 95/34684 ~, ~ PCT/US94/06631
-34-
to 1448. As shown in Fig 1 the primers selected gave the predicted 123 by
and a 148 by DNA PCR products from the wild type and mutant viral
sequences respectively. In some experiments additional minor bands were
seen. Most likely these are heteroduplexes formed between the two expected
bands. Also the unused excess primer from the cDNA synthesis step can
participate in the PCR react-ion and generate a longer product (seen in
Figures 3 and 4). These bands do not interfere with accurate quantitation
because the quantitation by this method is based on relative levels of bands
from target and competitive templates and not on the absolute amounts (Piatak
et al., BioTechniques 14:70-80 (1993)). The amounts of radioactivity in the
specific bands were determined as described in Materials and Methods. The
ratios between the amounts of radioactivity present in wild type and mutant
DNA bands were plotted as described earlier (Bagnarelli et al., J. Med.
Virol. 34:89-95 (1991)). Based on these data (Figure 2), it was calculated
that
285000, 69300 and 1600 copies of RNA were isolated from virus
containing 100 pg, 25 pg and 500 fg of p24 antigen respectively.
Based on the mass of an HIV-I particle, a virus preparation with 100
pg of p24 would be calculated to contain one million HIV particles
(Bourinbaiar, A.S., Nature349:111 (1991); Bourinbaiar, A.S., WeightofHIV
AIDS Res. Human Retrov. 8:1545 (1992)), or two million copies of RNA.
Thus, the copy numbers determined in our experiment represent
approximately 15 % of the theoretical value. This reflects loss of RNA during
extraction and lower than the theoretical yields in the preparation of cDNA.
However the quantitation by competitive PCR relies on the relative levels of
wild type and mutant templates, rather than the absolute amount. Therefore,
once the determination of the amount of RNA in a mutant virus preparation
is made, the recovery of RNA in each ICVPCR experiment does not affect the
outcome of the results.
~'I9~~~~
WO 95134684 PCT/US94/06631
-35-
ICVPCR to Determine the Level of HIV-1 RNA in Plasma
Using this standardized VX-46 virus as the competitor during the RNA
isolation, the amount of HIV-I viral RNA in patient's plasma was estimated.
The results obtained with two different plasma samples are shown in Figure 3.
The amount of radioactivity present in each band was estimated and the ratio
between the amount of radioactivity present in mutant and the wild type
(patient) DNA bands was plotted against the input mutant viral RNA. Using
this technique, the amount of viral RNA present in the samples were
determined to be 88,000 copies of RNAs per ml of plasma of patient 1
and 16,000 copies of RNAs per ml of plasma of patient 2 (Figure 3C).
Next the reproducibility of the ICVPCR method was assessed. The
amount of viral RNA in a plasma sample was estimated by performing the
entire assay on two different days. The amount of RNA by this two estimates
were 60000 and 68000 copies per ml of plasma (Figure 4) demonstrating that
the ICVPCR method is reliably reproducible.
Conclusions
Competitive RNA PCR has been successfully used for the estimation
of the levels of HIV-1 viral RNA present in patient samples (Piatak et al.,
Science259:1749-1754 (1993); Clementi et al., PCRMethodsAppl. 2:191-196
(1993)). In this procedure, the ratio of the amplified products is affected
equally by the factors which influence the PCR. However, it lacks a control
for the RNA purification step. It has been estimated that on average, 36% of
the RNA sample can be lost due to the extraction procedures used (Clementi
et al., PCR Methods Appl. 2:191-196 (1993)). To account for the variable
loss of RNA when gene expression is studied using RNA extracted from cells,
the RNA expressed by the gene under study is often compared to another
RNA species which is constitutively expressed (Green et al., Ce1135:137-148
(1983); Orkin et al., J. Biol. Chem. 259:8679-8681 (1984)). However, such
CA 021°~~~a X004-08-26
- 3~--
a control RNA is not available in plasma. By adopting the modified method
described in this report, the mutant virion RNA can sense the role both as a
control for the RNA extraction procedure as well as a competitive RNA
template in the PCR.
a a . go
eoxy onus
eot a
er equences
se n t
a
Ptimer Segueace Position SEQ ID
in NO
HIVNIr4.3
ICVPCR S' 1'CCC1~GC1TGCCCATAGTA 890-908 SfiQ ID
9 3'
(comple- N0:1
Y)
ICVZ~R-16 5' ATCTCTCGACGCAGGAC? 68I-698 SEQ ID
3'
N0:2
ICVPCR-17 5' GGTC?CGCACCCATCTGT 786-803 SEQ ID
3'
N0:3
ICVPCR 5' ACTAGGGGAGGCTAGAAGGA 765-803 SEQ ID
18 3'
(comple- N0:4
r i
From the forgoing it will be appreciated that, although specific
embodiments of the invention have been described herein for the purposes of
illustration, various modifications may be made without deviating from the
spirit and scope of this invention and the following claims. As examples, the
steps of the preferred embodiments constitute only one form of carrying out
the process in which the invention may be embodied.