Note : Les descriptions sont présentées dans la langue officielle dans laquelle elles ont été soumises.
- ~==
¦ CA 02220l23 l997-ll-04
WO96/34891 PCT~S95/09058
~MaN CEEMQ~ N~ ~ETA-8, ~ ~H ~ r~K ~ N~ BETA-1
AND MACROP~AGE INFT-~MM~TORY PROTEIN-4
This application is a continuation-in-part of pending
application serial number 08/446,881 filed in the United
States Patent and Trademark O~ice on May 5, 1995.
This invention relates to newly identified
polynucleotides, polypeptides encoded by such
polynucleotides, the use of such polynucleotides and
polypeptides, as well as the production of such
polynucleotides and polypeptides. More particularly, the
polypeptides o~ the present invention have been putatively
identified as human rh~mokine Beta-8 (Ck~-8), macrophage
inflammatory protein-~ (MIP-4) and rhpmnkine Beta-1 (Ck~-1).
The invention also relates to inhibiting the action of such
polypeptides.
rhemokines~ also re~erred to as intercrine cytokines,
are a subfamily of structurally and ~unctionally related
cytokines. These molecules are 8-10 kd in size. In yeneral,
ch~mokines ~h~ h~ t 20~ to 75~ homology at the amino acid
level and are characterized by four conserved cysteine
residues that form two disul~ide bonds. Based on the
arrangement of the first two cysteine residues, rh~m~kines
CA 02220l23 l997-ll-04
W O 96/34891 PCT~US9~/09058
have been classi~ied into two sub~amilies, alpha and beta.
In the alpha su~amily, the ~irst two cysteines are separated
by one amino acid and hence are re~erred to as the "C-X-CI'
suh~amily. In the beta sub~amily, the two cysteines are in
an adjacent position and are, there~ore, re~erred to as the
"C-C" sub~amily. Thus ~ar, at least eight dif~erent members
of this ~amily have been i~Pnt;fied in hllm~n~
The intercrine cytokines Pxh;hit a wide variety o~
~unctions. A h~llm~k ~eature is their ability to elicit
chemotactic migration o~ distinct cell types, including
monocytes, neutrophils, T lymphocytes, basophils and
~ibroblasts. Many rh~m~kines have proin~lammatory activity
and are involved in multiple steps during an in~lammatory
reaction. These activities include stimulation o~ hist~mi n~
release, lysosomal enzyme and leukotriene release, increased
adherence o~ target immllne cells to endoth~ l cells,
F~n h~n ce d hi n~ing o~ complement proteins, in~lllr~l expression
o~ granulocyte adhesion molecules and complement receptors,
and respiratory burst. In addition to their involvement in
ini~lammation, certain ~h~m~kinF~s have been shown to ~Chi h;t
other activities. For e a mple, macrophage in~lammatory
protein 1 (MIP-l) is able to suppress hematopoietic stem cell
proli~eration, platelet ~actor-4 (PF-4) is a potent inhihitor
o~ endoth~li~l cell growth, Interleukin-8 (IL-8) promotes
proli~eration o~ keratinocytes, and GRO is an autocrine
growth ~actor ~or m~l ~n~m~ cells.
In light o~ the diverse biological activities, it is not
~u~Lising that ~h~mokines have been implicated in a num~er
o~ physiological and disease conditions, including lymphocyte
tra~icking, wound h~l ing, hematopoietic regulation and
immllnQlogical disorders such as allergy, asthma and
arthritis. An example o~ a hematopoietic lineage regulator
is MIP-l. MIP-l was originally identi~ied as an endotoxin-
induced proin~lammatory cytokine produced ~rom macrophages.
Subsequent studies have shown that MIP-l is composed o~ two
_
CA 02220123 1997-11-04
WO96/34891 PCT~S95/09058
.
di~erent, but related, proteins MIP-l~ and MIP-l~. Both
MIP-l~ and MIP-l~ are chemo-attractants for macrophages,
monocytes and T lymphocytes. Interestingly, biochemical
puri~ication and subsequent sequence analysis o~ a multi-
potent stem cell inh;hitor (SCI) revealed that SCI is
identical to MIP-l~. Furthermore, it has been shown that
MIP-l~ can counteract the ability of MIP-l~ to suppress
hematopoietiC stem cell proli~eration. This ~inding leads to
the hypothesis that the primary physiological role o~ MIP-l
is to regulate hematopoiesis in bone marrow, and that the
proposed in~lammatory ~unction is secon~A~y. The mode o~
action o~ MIP-l~ as a stem cell ; nh; hi tor relates to its
ability to block the cell cycle at the Gl/S interphase.
Furthermore, the i nhi bitory e~ect o~ MIP-l~ seems to be
restricted to immature ~loge1itor cells and it is actually
stimlllAtory to late ~oye~1itors in the presence o~
granulocyte macrophage-colony stimulating ~actor (GM-CSF).
Several groups have cloned what are likely to be the
human homologs o~ MIP-l~ and MIP-l~. In all cases, cDNAs
were isolated ~rom libraries prepared against activated T-
cell RNA.
MIP-l proteins can be detected in early wound
in~lammation cells and have been shown to induce production
o~ IL-l and IL-6 ~rom wound ~ibroblast cells. In addition,
puri~ied native MIP-l (comprising MIP-l, MIP-l~ and MIP-l~
polypeptides) causes acute in~lammation when injected either
subcutaneously into the ~ootpads o~ mice or intracist~n~lly
into the cerebrospinal ~luid o~ rabbits (Wolpe and Cerami,
1989, FASEB J. 3:2565-73). In addition to these pro-
in~lammatory properties o~ MIP-l, which may be direct or
indirec~, M~ ~s been ~-e~e~ duri~g the early
in~lammatory phases o~ wound healing in an experim~ntAl mouse
model employing sterile wound chambers (Fahey, et al., l990,
Cytokine, 2:92). For example, PCT application WO 92/05198,
~iled by Chiron Corporation, discloses a DNA molecule which
--3--
CA 02220l23 l997-ll-04
WO96/34891 PCT~S95/090~8
is active as a template ~or pro~ncin~ m~mm~ n macrophage
in~lammatory proteins (MIPs) in yeast.
The murine MIP-l~ and MIP-l~ are distinct but closely
related cytokines. Partially puri~ied mixtures o~ the two
proteins a~ect neutrophil ~unction and cause local
in~lammation and ~ever. MIP-l~ has been expressed in yeast
cells and puri~ied to ho,,,oy~eity~ Structural analysis
con~irmed that MIP-l~ has a very Simi 1~ secnn~y and
tertiary structure to PF-4 and IL-8 with which it shares
limited sequence homology. It has also been ~mon~trated
that MIP-l~ is active in vivo to protect mouse stem cells
~rom subsequent in vitro k; 11 in~ by tritiated thymidine.
MIP-l~ was also ~hown to ~nh~nce the proli~eration o~ more
committed progenitor granulocyte macrophage colony-~orming
cells in response to granulocyte macrophage colony-
stimulating ~actor (Clemens, J.M., et al., Cytokine~ 4:76-82
(1992)).
The polypeptides of the present invention, Ck~-l,
originally re~erred to as MIP-l~ in the parent patent
application, is a new member o~ the ~ ch~nkine ~amily based
on amino sequence homology. The Ck~-8 polypeptide,
originally re~erred to as MIP-3 in the parent application, is
also a new m~mh~ 0~ the ~ rhem~kine ~amily based on the
amino acid sequence homology.
In accordance with one aspect o~ the present invention,
there are provided novel mature polypeptides which are human
Ck~-8, human MIP-4 and human Ck~-l as well as biologically
active and diagnostically or therapeutically use~ul
~ragments, ~n~l ogs and derivatives thereo~.
In accordance with another aspect o~ the present
invention, there are provided i~olated nucleic acid molecules
encoding such polypeptides, including mRNAs, DNAs, cDNAs,
genomic DNA as well as biologically active and diagnostically
or therapeutically use~ul ~ragments, analogs and derivatives
thereo~.
_
CA 02220123 1997-11-04
WO 96/34891 PCT/US95/09058
In accor~Ance with yet a further aspect of the present
invention, there is provided a process for producing such
polypeptides by rec~mhinAnt techniques which c~,.~lises
culturing recomhinAnt prokaryotic and/or eukaryotic host
cells, contAin~ng nucleic acid sequences, under conditions
promoting expression of said proteins and subsequent recovery
of said proteins.
In accordance with yet a further aspect of the present
invention, there is provided a process for utilizing such
polypeptides, or polynucleotides ~nc~Ai ng such polypeptides
for therapeutic purposes, for PYAmrle, to protect bone marrow
stem cells from chemotherapeutic agents during chemotherapy,
to remove leukemic cells, to stimml1~te an immllnP response, to
regulate hematopoiesis and lymphocyte tra~icking, to treat
psoriasis, solid tumors, to PnhAnre host de~enses against
resistant chronic and acute infection, and to stimmllAte wound
healing.
In accordance with yet a further aspect of the present
invention, there are provided anti ho~i es against such
polypeptides.
In accordance with yet another aspect of the present
invention, there are provided antagonists to such
polypeptides, which may be used to inhihit the action of such
polypeptides, ~or example, to ~ nhi hi t production of IL-1 and
TNF-~, to treat aplastic AnPmi~, myelodysplastic syndrome,
asthma and arthritis.
In accordance with yet another aspect of the present
invention, there are also provided nucleic acid probes
comprising nucleic acid molecules o~ su~icient length to
speci~ically hybridize to the Ck~-8, Ck~-1 and MIP-4 nucleic
acid se~encles.
In accordance with still another aspect of the present
invention, there are provided diagnostic assays ~or detecting
diseases related to the underexpression and overexpression of
=
CA 02220123 1997-11-04
Wos6/34891 PCT~S9~/09058
the polypeptides and ~or detecting mutations in the nucleic
acid sequences encoding such polypeptides.
In accordance with yet another aspect of the present
invention, there is provided a process ~or utilizing such
polypeptides, or polynucleotides Pnco~tng such polypeptides,
as research reagents ~or in vitro purposes related to
scienti~ic research, synthesis o~ DNA and manu~acture o~ DNA
vectors, ~or the purpose o~ developing therapeutics and
diagnostics ~or the treatment o~ human disease.
These and other aspects o~ the present invention should
be apparent to those skilled in the art ~rom the t~rhtn~S
herein.
The ~ollowing drawings are illustrative o~ embodiments
o~ the invention and are not meant to limit the scope of the
invention as encomr-7ssed by the cl~7tm~
FIG. 1 displays the cDNA se~uence Pnco~-7ing Ck~-8 and the
corresponding deduced amino acid sequence. The initial 21
amino acids represents the putative leader sequence. All the
signal sequences were as determined by N-terminal peptide
seq~7Pnctng o~ the baculovirus expressed protein.
FIG. 2 displays the cDNA sequence Pncor7ing Ck~-l and the
correspon~7in~ deduced amino acid sequence. The initial l9
amino acids represent the leader sequence.
FIG. 3 displays the cDNA sequence encoding MIP-4 and the
corresponntn~ deduced amino acid sequence. The initial 20
amino acids represent the leader sequence.
FIG. 4 illustrates the amino acid homology between Ck~-8
(top) and h7~man MIP-l~ ~bottom). The ~our cysteines
characteristic o~ all c~emokines are shown.
FIG. 5 displays two amino acid sequences wherein, the
top sequence is the human MIP-4 amino acid sequence and the
bottom sequence is human MIP-l~ (Human Tonsillar lymphocyte
LD78 Beta protein precursor).
FIG. 6 illustrates the amino acid sequence alignmPnt
between Ck~-l (top) and human MIP-l~ (bottom).
CA 02220l23 l997-ll-04
WO96J34891 PCT~S95logos8
FIG. 7 is a photograph of a gel ln which Ck~-1 has been
electrophoresed a_ter the expression o_ HA-tagged Ck~-1 in
COS cells.
FIG. 8 is a photograph o~ a SDS-PAGE gel a_ter
expression and purification of Ck~-1 in a baculovirus
expression system.
FIG. 9 is a photograph of an SDS-PAGE gel after
expression and a three-step purification o~ Ck~-8 in a
baculovirus expression system.
FIG. 10. The ch~mo~cttractant activity of Ck~-8 was
determined with chemotaxis assays using a 48-well
microchamber device (Neuro Probe, Inc.). The experim~nt~l
procedure was as described in the manufacturers m~nll~l For
each concentration of Ck~-8 tested, migration in 5 high-power
fields was ~X~mi ne~. The results presented represent the
average values obt~in~ _rom two indep~n~nt eXperim~nt~
The rh~mn~cttractant activity on THP-1 (A) cells and human
PBMCs (8) is shown.
FIG. 11. ~h~nge in intracellular calcium concentration
in response to Ck~-8 was determined using a Hitachi F-2000
luorescence spectrophotometer. Bacterial expressed Ck~-8
was added to Indo-1 loaded THP-1 cells to a ~inal
concentration o~ 50 nM and the intracellular level of calcium
concentration was monitored.
FIG. 12. The monocyte cell line THP-1 was treated for
16 hours with LPS (0.1-10 ng/ml) or Ck~-8 (to 50 ng/ml).
Tissue culture supernatants were subjected to ELISA analysis
to quantify the secretion of TNF-~.
FIG. 13. Human peripheral blood monocytes purified by
elutriation were treated ~or 16 hours with increasing amounts
of Ck~-8 (produced by baculovirus). Tissue culture
supernatants were subjected to ELISA analysis to quanti~y the
secretion o~ TNF-~, IL-6, IL-1, GM-CSF, and granulocyte-
colony stimulating factor (G-CSF).
CA 02220l23 lss7-ll-04
O96/34891 PCT~S9~/09058
FIG. 14. A low density population of mouse bone marrow
cells was plated (1,500 cells/dish) in agar rnn~ning medium
with or without the indicated ch~mokines (100 ng/ml), but in
the presence o~ IL-3 (5 ng/ml), SCF (100 ng/ml), IL-1~ ~10
ng/ml), and M-CSF (5 ng/ml). The data shown represents the
average obt~ n~ ~rom two indepPn~nt experiments (each
performed in duplicate). Colonies were counted 14 days after
plating. The number o~ colonies generated in the presence of
ch~mnkines is expressed as a mean percentage of those
produced in the absence o~ any added ch~mnkines.
FIG. 15 illustrates the effect of Ck~-8 and Ck~-1 on
mouse bone marrow colony formation by HPP-CFC (A) and LPP-CFC
(B).
FIG. 16 illustrates the effect of baculovirus-expressed
Ck~-1 and Ck~-8 on M-CFS and SCF-stimulated colony formation
o~ freshly isolated bone marrow cells.
FIG. 17 illustrates the e~ect of Ck~-8 and Ck~-1 on IL-
3 and SCF-stim~ ted proliferation and di~ferentiation o~ the
lin~population of bone marrow cells.
FIG. 18. Effect of Ck~-8 and Ck~-1 on the generation o~
GR-1 and Mac-1 (surface markers) positive population of cells
~rom lin~ population of bone marrow cells. lin~ cells were
incubated in growth medium supplemented with IL-3 (5 ng/ml)
and SCF (100 ng/ml) alone (a) and Ck~-8 (50 ng/ml) (b) or
Ck~-1 (50 ng/ml). Cells were then st~ine~ with Monoclon~l
antibodies against myeloid differentiation GR.1, Mac-1, Sca-
1, and CD45R surface antigens and analyzed by FACScan. Data
is presented as percentage o~ positive cells in both large
(A) and small (B) cell populations.
FIG. 19 illustrates that the presence o~ Ck~-8 (+)
;nhih;ts bone marrow cell colony formation in response to IL-
3, M-CSF and GM-CSF.
FIG. 20. Dose response o~ Ck~-8 inhihits bone marrow
cell colony formation. Cells were isolated and treated as in
Figure 19. The treated cells were plated at a density of
CA 02220123 1997-11-04
WO96/34891 PCT~S95/09058
l,000 cells/dish in agar-based colony formation assays in the
presence o~ IL-3, GM-CSF or M-CSF (5 ng/ml) with or without
Ck~-8 at l, lO, 50 and lO0 ng/ml. The data is presented as
colony ~ormation as a percentage o~ the nllmher o~ colonies
formed with the speci~ic ~actor alone. The data is depicted
as the average of duplicate ~i ~h~s with error bars indicating
the st~n~d deviation.
FIG. 21. Induction o~ apoptosis by Ck~-8 and Ck~-l in
the presence or absence o~ hematopoietic growth ~actors.
Mouse bone marrow cells were flushed from both the femur and
tibia, separated on a ~icol density gradient and monocytes
removed by plastic adherence. The resulting population o~
cells were then incubated overnight in an M~M-based medium
supplemented with IL-3 t5 ng/ml), GM-CSF (5 ng/ml), M-CSF (lO
ng/ml) and G-CSF (lO ng/ml) with or without the addition of
Ck~-8 (50 ng/ml) or Ck~-l (250 ng/ml). In addition, cells
were cultured in medium alone, with or without Ck~-8 and Ck~-
l. After 24 hours, cells were harvested and processed ~or
apoptosis using the boehringer m~nnh~m cell death ELISA kit.
Data is shown as percentage increase abo~e background with
the backylo~d considered as the amount of apoptosis
occurring in the cultures incubated in the presence o~ each
o~ the growth ~actors.
FIG. 22. Expression o~ RNA ~nro~ n~ Ck~-8 in human
monocytes. Total RNA ~rom ~resh elutriated monocytes was
isolated and treated with lO0 U/ml hu rIFN-g. lO0 ng/ml LPS,
or both RNA ~8 ~g) ~rom each treatment was separated
electrophoretically on a l.2~ agarose gel and trans~erred to
a nylon ~ dne. Ck~-8 mR~A was quanti_ied by probing with
2P-labeled cDN~ and the bands on the resulting autoradiograph
wer2 ~uar.t fied densitGmetrlcally.
In accordance with an aspect o~ the present invention,
there are provided isolated nucleic acids (pol~nucleotides)
which encode for the mature polypeptides having the deduced
amino acid sequence o~ Figures l, 2 and 3 (SEQ ID No. 2, 4
CA 02220123 1997-11-04
WO 96/34891 PCT/US9a/09058
and 6, respectively) or for the mature Ck~-8 polypeptide
encoded by the cDNA of the clone(s) deposited as ATCC Deposit
No. 75676 on February 9, 1994, and _or the mature MIP-4
polypeptide encoded by the cDNA o~ the clone deposited as
ATCC Deposit No. 75675 on February 9, 1994 and _or the mature
Ck~-1 polypeptide encoded by the cDNA o~ the clone deposited
as ATCC Deposit No. 75572, deposited on October 13, 1993.
Polynucleotides rnrq~i ng polypeptides of the present
invention are structurally related to the pro-in_lammatory
supergene "intercrine" which is in the cytokine or ch~mnkine
~amily. Both Ck~-8 and MIP-4 are MIP-l homologues and are
more homologous to MIP-l~ than to MIP-l~. The polynucleotide
encoding _or Ck~-8 was derived from an aortic endothelium
cDNA library and Cont~; n~ an open rr~i ng ~rame encoding a
polypeptide o~ 120 amino acid residues, which rxh; h; ts
signi~icant homology to a number of rhem~kinP5. The top
match is to the human macrophage in~lammatory protein 1
alpha, showing 36~ nt;ty and 66~ sim;l~nity (~igure 4).
The polynucleotide rnco~;n~ for MIP-4 was derived ~rom
a human adult lung cDNA library and ront~;n~ an open r~; ng
~rame encoding a polypeptide o~ 89 amino acid r~ , which
~hi hi ts signi~icant homology to a number o~ rhrm~k;n~5. The
top match is to the human tonsillar lymphocyte LD78 beta
protein, showing 60~ identity and 89~ s;m;l~ity (_igure 5).
Furthermore, the $our cysteine residues occurring in all
rhrmnkines in a characteristic moti~ are conserved in both
clone~s). The fact that the _irst two cysteine residues in
the genes are in adjacent positions classifies them as "C-C"
or ~ subfamily o~ rhemokines. In the other su~amily, the
"CXC" or ~ sub~amily, the _irst two cysteine residues are
separated by one amino acid.
The polynucleotide encoding _rom Ck~-l contains and open
reading _rame encoding a polypeptide of 93 amino acids of
which the _irst 19 are a leader sequence such that the mature
polypeptide cont~in~ 74 amino acid residues. Ck~-1 exhi~its
--10--
CA 02220123 1997-11-04
WO96/34891 PCT~S9~/09058
significant homology to human macrophage inflammatory protein
~ with 48% identity and 72~ sim;l~ity over a stretch of 80
amino acids. Further, the four cysteine residues comprising
a characteristic motif are conserved.
The polynucleotides of the present invention may be in
the form of RNA or in the form of DNA, which DNA includes
cDNA, genomic DNA, and synthetic DNA. The DNA may be double-
stranded or single-stranded, and if single stranded may be
the coding strand or non-coding (anti-sense) strand. The
coding sequence which ~nco~s the mature polypeptides may be
identical to the coding sequence shown in Figures 1, 2 and 3
(SEQ ID No. 1, 3 and 5) or that of the deposited clone~s) or
may be a different coding sequence which co~ing sequence, as
a result of the rP~lln~ncy or degeneracy of the genetic code,
encodes the same, mature polypeptides as the DNA of Figure 1,
2 and 3 (SEQ ID No. 1, 3 and 5) or the deposited cDNA(s).
The polynucleotides which ~nco~ for the mature
polypeptides of Figures 1, 2 and 3 (SEQ ID No. 2, 4 and 6) or
for the mature polypeptides encoded by the deposited cDNA~s)
may include: only the coding sequence for the mature
polypeptide; the coding sequence for the mature polypeptides
and additional ro~i ng sequence such as a leader or secretory
sequence or a ~ otein sequence; the coding sequence for
the mature polypeptides (and optionally additional ro~; ng
sequence) and non-coding sequence, such as introns or non-
coding sequence 5' and/or 3' of the ro~i ng sequence for the
mature polypeptides.
Thus, the term "polynucleotide encoding a polypeptide"
encompasses a polynucleotide which includes only coAi ng
sequence for the polypeptide as well as a polynucleotide
which includes additional ro~i ng and/or non-coding sequence.
The present invention further relates to variants of the
hereinabove described polynucleotides which encode for
fragments, analogs and derivatives of the polypeptide having
the deduced amino acid sequence of Figures 1, 2 and 3 (SEQ ID
--11--
CA 02220123 1997-11-04
WO96/34891 PCT~S95/09058
No. 2, 4 and 6) or the polypeptides encoded by the cDNA of
the deposited clone(s). The variants of the polynucleotides
may be a naturally occurring allelic variant of the
polynucleotides or a non-naturally occurring variant of the
polynucleotides.
Thus, the present invention includes polynucleotides
ro~ing the same mature polypeptides as shown in Figures l,
2 and 3 (SEQ ID No. 2, 4 and 6) or the same mature
polypeptides encoded by the cDNA of the deposited clone(s) as
well as variants of such polynucleotides which variants
encode for a frA~m~nt, derivative or analog of the
polypeptides of Figures l, 2 and 3 (SEQ ID No. 2, 4 and 6) or
the polypeptides ~nco~ by the cDNA of the deposited
clone(s). Such nucleotide variants include deletion
vari sts, substitution variants and addition or insertion
variants.
As her~nAhove indicated, the polynucleotide may have a
coding sequence which is a naturally occurring allelic
variant of the coding sequence shown in Figures l, 2 and 3
(SEQ ID No. l, 3 and 5) or of the coding sequence of the
deposited clone(s). As known in the art, an allelic variant
is an alternate form of a polynucleotide sequence which may
have a substitution, deletion or addition of one or more
nucleotides, which does not substAnt; Al ly alter the function
of the encoded polypeptide.
The present invention also includes polynucleotides,
wherein the coding sequence for the mature polypeptides may
be fused in the same r~ ng frame to a polynucleotide
sequence which aids in expression and secretion of a
polypeptide from a host cell, for example, a leader sequence
which ~unctions as a secretory sequence ~or controlling
transport of a polypeptide ~rom the cell. The polypeptide
having a leader sequence is a ~L~lotein and may have the
leader sequence cleaved by the host cell to form the mature
form of the polypeptide. The polynucleotides may also encode
-
CA 02220123 1997-11-04
WO 96/34891 PCT/US9~;1090!;8
for a proprotein which is the mature protein plus additional
5' amino acid residues. A mature protein having a
prosequence is a proprotein and is an inactive form of the
protein. once the prosequence is cleaved an active mature
protein r~m~ n ~,
Thus, _or example, the polynucleotides of the present
invention may encode _or a mature protein, or _or a protein
having a prosequence or for a protein having both a
prosequence and a preseguence (leader seguence).
The polynucleotides of the present invention may also
have the coding sequence _used in frame to a marker sequence
which allows _or puri~ication of the polypeptides o~ the
present invention. The marker seguence may be a hexa-
histidine tag supplied by a pQE-9 vector to provide for
puri_ication of the mature polypeptides fused to the marker
in the case of a bacterial host, or, ~or example, the marker
sequence may be a hemaggllltinin (HA) tag when a ~-mm~ n
host, e.g. COS-7 cells, is used. The HA tag corresponds to
an epitope derived ~rom the in~luenza hemagglnti n i n protein
(Wilson, I., et al., Cell, 37:767 (1984)).
The present invention ~urther relates to
polynucleotides which hybridize to the her~in~hove-described
sequences i~ there is at least 50~ and pre~erably 70~
identity between the sequences. The present invention
particularly relates to polynucleotides which hybridize under
stringent conditions to the herPin~hove-described
polynucleotides . As herein used, the term "stringent
conditions" means hybridization will occur only i~ there is
at least 95~ and preferably at least 97~ identity between the
sequences. The polynucleotides which hybridize to the
hereinabove described polynucleotides in a pre~erred
embodiment ~nco~e polypeptides which retain substantially the
same biological ~unction or activity as the mature
polypeptides encoded by the cDNA o~ Figure 1, 2 and 3 (SEQ ID
No. 1, 3 and 5) or the deposited cDNAs.
--13--
CA 02220123 1997-11-04
WO 96/34891 PCT/US9~i/09058
Alternatively, the polynucleotides may be
polynucleotides which has at least 20 bases, pre~erably 30
bases, and more preferably at least 50 bases which hybridize
to a polynucleotide of the present invention and which has an
identity thereto, as her~tn~hove described, and which does
not retain activity. Such polynucleotides may be employed as
probes for the polynucleotides o~ SEQ ID NOS:1, 3 and 5 for
example, for recovery of the polynucleotide or as a
diagnostic probe or as a PCR primer.
The deposit(s) referred to herein will be m~int~in~
under the terms o~ the Budapest Treaty on the International
Recognition of the Deposit o~ Micro-org~ni cm~ for purposes of
Patent Procedure. These deposits are provided merely as
convenience to those o~ skill in the art and are not an
admission that a deposit is required under 35 U.S.C. ~112.
The sequence of the polynucleotides cont~ in the
deposited materials, as well as the amino acid sequence o~
the polypeptides Pnco~ thereby, are incorporated herein by
reference and are controlling in the event of any con~lict
with description o~ seql~Pn~Ps herein. A license may be
required to make, use or sell the deposited materials, and
no such license is hereby granted.
The present invention further relates to Ck~-8, MIP-4
and Ck~-1 polypeptides which have the deduced amino acid
sequence of Figures 1, 2 and 3 (SEQ ID No. 2, 4 and 6) or
which have the amino acid sequence encoded by the deposited
cDNAs, as well as fragment~, analogs and derivatives of such
polypeptides.
The terms "~ragment," "derivative" and "analog" when
re~erring to the polypeptides o~ Figures 1, 2 and 3 (SEQ ID
No. 2, 4 and 6) or that encoded by the deposited cDNA, means
a polypeptide which retains ess~nti~lly the same biological
function or activity as such polypeptide. Thus, an analog
includes a proprotein which can be activated by cleavage of
-14-
CA 02220l23 l997-ll-04
WO 96/34891 PCT/US9~;/0905
the proprotein portion to produce an active mature
polypeptide.
The polypeptides of the present invention may be a
recomhin~nt polypeptide, a natural polypeptide or a synthetic
polypeptide, preferably a re~omhin~nt polypeptide.
The fragment, derivative or analog of the polypeptides
of Figures 1, 2 and 3 ~SFQ ID No. 2, 4 and 6) or that encoded
by the deposited cDNA may be (i) one in which one or more of
the amino acid residues are substituted with a conserved or
non-conserved amino acid residue (preferahly a conserved
amino acid residue) and such substituted amino acid residue
may or may not be one encoded by the genetic code, or (ii)
one in which one or more of the amino acid residues includes
a substituent group, or (iii) one in which the mature
polypeptides are fused with another compound, such as a
compound to increase the half-life of the polypeptide (for
example, polyethylene glycol), or (iv) one in which the
additional amino acids are fused to the mature polypeptides,
such as a leader or secretory sequence or a sequence which is
employed for purification of the mature polypeptides or a
proprotein sequence. Such fragments, derivatives and analogs
are deemed to be within the scope of those skilled in the art
~rom the t~hings herein.
The polypeptides of the present invention are preferably
provided in an isolated form, and preferably are purified to
homogeneity.
The term "gene" or "cistron~ means the segment of DNA
involved in producing a polypeptide chain; it includes
regions preceding and following the coding region (leader and
trailer) as well as intervening sequences (introns) between
individual coding segments (exons).
The term "isolated" means that the material is removed
from its original environment (e.g., the natura~ envi~ t
if it is naturally occurring). For example, a naturally-
occurring polynucleotides or polypeptides present in a living
--15--
CA 02220123 1997-11-04
WO96/34891 PCT~s95/09058
~nim~l is not isolated, but the same polynucleotides or DNA
or polypeptides, separated from some or all of the coexisting
materials in the natural system, is isolated. Such
polynucleotides could be part o_ a vector and/or such
polynucleotides or polypeptides could be part of a
composition, and still be isolated in that such vector or
composition is not part o~ its natural enviro~m~nt.
The present invention also relates to vectors which
include polynucleotides of the present invention, host cells
which are genetically engineered with vectors o_ the
invention and the production of polypeptides o_ the invention
by recomhin~nt techniques.
Host cells are genetically engineered ttransduced or
trans_ormed or trans_ected) with the vectors of this
invention which may be, for ~x~mrle, a cloning vector or an
expression vector. The vector may be, _or example, in the
form o_ a plasmid, a viral particle, a phage, etc. The
engineered host cells can be cultured in c~-lv~lltional
nutrient media modi~ied as d~' iate _or acti~ating
promoters, selecting trans_ormants or amplifying the Ck~-8,
MIP-4 and Ck~-l genes. The culture conditions, such as
temperature, pH and the like, are those previously used with
the host cell selected ~or expression, and will be apparent
to the ordinarily skilled artisan.
The polynucleotides o~ the present invention may be
employed ~or pronllr~ng polypeptides by recomh~n~nt
techniques. Thus, ~or example, the polynucleotide sequence
may be included in any one o~ a variety o~ expression
vehicles, in particular vectors or plasmids ~or expressing a
polypeptide. Such vectors include chromosomal,
n~nch~omosomal and synthetic DNA sequences, e.g.,
derivatives of SV40; bacterial plasmids; phage DNA; yeast
plasmids; vectors derived from combinations o~ plasmids and
phage DNA, viral DNA such as vaccinia, adenovirus, fowl pox
virus, and pseudorabies. However, any other pl ~m~ ~ or
-16-
CA 02220123 1997-11-04
WO 96/34891 PCT/US95/09058
vector may be used as long they are replicable and viable in
the host.
The a~ylo~riate DNA sequence may be inserted into the
vector by a variety of procedures. In yeneral, the DNA
sequence is inserted into an appropriate restriction
~n~onllclease site(s) by procedures known in the art. Such
procedures and others are deemed to be within the scope of
those skilled in the art.
The DNA se~uence in the expression vector is operatively
lirked to an appropriate expression control sequence(s)
(promoter) to direct mRNA synthesis. As representative
examples of such promoters, there may be mentioned: LTR or
SV40 promoter, the E coli. ac or trD, the phage 1 Amh~ PL
promoter and other promoters known to control expression of
genes in prokaryotic or eukaryotic cells or their viruses.
The expression vector also contains a ribosome hin~ing site
for translation initiation and a transcription terminator.
The vector may also include d~' ~liate se~uences ~or
amplifying expr~ssion.
In addition, the expression vectors preferably cont~in
a gene to provide a phenotypic trait for selection of
transformed host cells such as dihydrofolate reductase or
neomycin resistance for eukaryotic cell culture, or such as
tetracycline or ampicill in resistance in E. coli.
The vector cnnt~inin~ the a~lup,iate DNA se~uence as
herein~hove described, as well as an appropriate promoter or
control sequence, may be employed to trans~orm an d~lo~iate
host to permit the host to express the protein.
As representative examples of a~lu~iate hosts, there
may be mentioned: bacterial cells, such as E. coli,
Streptomyces, S~lmnn~lla Ty~himurium; ~ungal cells, such as
yeast; insect cells such as Droso~hila S2 and S~9;
adenoviruses; ~nim~l cells such as CHO, COS or Bowes
melanoma; plant cells, etc. The selection of an d~' ~iate
-17-
CA 02220123 1997-11-04
WO 96/34891 PCT/US95/09058
host is ~em~ to be within the scope o~ those skilled in the
art ~rom the t~chings herein.
More particularly, the present invention also includes
reromhin~nt constructs comprising one or more o~ the
se~l~nc~s as broadly described above. The constructs
comprise a vector, such as a plasmid or viral vector, into
which a sequence o~ the invention has been inserted, in a
~orward or reverse orientation. In-a pre~er~ed ~sp~ct sr th~s
embo~im~nt, the construct ~urther c~--~ ises regulatory
seauences, including, ~or example, a ~Iu---uLer, operably
linked to the sequence. Large numbers of suitable vectors
and promoters are known to those o~ skill in the art, and are
r~mme~cially av~ hle~ The ~ollowing vectors are provided
by way of example. Bacterial: pQE70, pQ~60, pQE-9 (Qiagen),
pbs, pD10, phagescript, psiX174, pbluescript SK, pBSKS,
pNH8A, pNH16a, pNH18A, pNH46A (Stratagene); pTRC99a, pKK223-
3, pKK233-3, pDR540, pRIT5 (Pharmacia). Bukaryotic: pWLN~O,
pSV2CAT, pOG44, pXT1, pSG (Stratagene) pSV~3, pBPV, pMSG,
pSVL tPharmacia). However, any other pl~mi~ or vector may
be used as long as they are replicable and viable in the
host.
Promoter regions can be selected ~rom any desired gene
using CAT (chlor~mph~nicol trans~erase) vectors or other
vectors with selectable markers. Two a~u~iate vectors are
PKK232-8 and PCM7. Particular named bacterial promoters
include lacI, lacZ, T3, T7, gpt, l~mh~ PR, PL and trp.
Eukaryotic ~ -uLers include CMV imm~ te early, B V
thymidine kinase, early and late SV40, LTRs ~rom retrovirus,
and mouse metallothionein-I. Selection o~ the ~y~LO~ iate
vector and promoter is well within the level o~ ordinary
skill in the art.
In a further embo~iment~ the present invention relates
to host cells ront~ining the above-described construct. The
host cell can be a higher eukaryotic cell, such as a
m~mm~lian cell, or a lower eukaryotic cell, such as a yeast
-18-
CA 02220123 1997-11-04
WO96/34891 PCT~Ss~/09058
cell, or the host cell can be a prokaryotic cell, such as a
bacterial cell. Introduction of the construct into the host
cell can be effected by calcium phosphate transfection, DEA~-
Dextran mediated transfection, or electroporation ~Davis, L.,
Dibner, M., Battey, I., Basic Methods in Molecular Biology,
~1986)).
The constructs in host cells can be used in a
conventional m~nnP~ to produce the gene product encoded by
the recombinant sequence. Alternatively, the polypeptides o~
the invention can be synthetically produced by conventional
peptide synthesizers.
Mature proteins can be expressed in m~mn~~ n cells,
yeast, bacteria, or other cells under the control of
appropriate promoters. Cell-free translation systems can
also be employed to produce such proteins using RNAs derived
from the DNA constructs of the present invention.
Appropriate cloning and expression vectors for use with
prokaryotic and eukaryotic hosts are described by Sambrook,
et al., Molecular Cloning: A Laboratory ~nllAl, Second
Edition, Cold Spring Harbor, N.Y., ~1989), the disclosure of
which is hereby incorporated by reference.
Transcription of the DNA encoding the polypeptides of
the present in~ention by higher eukaryotes is increased by
inserting an Pnh~ncer sequence into the vector. ~nhAncers
are cis-acting elPmPnts o~ DNA, usually about from lO to 300
bp that act on a promoter to increase its transcription.
EAxamples including the SV40 ~nh~ncer on the late side of the
replication origin bp lO0 to 270, a cytomegalovirus early
promoter enh~ncer, the polyoma PAnh~ncer on the late side of
the replication origin, and adenovirus enhancers.
Generally, recombinant expression vectors will include
origins o~ replication and selectable markers permitting
transformation of the host cell, e.g., the ampic;ll~ n
resistance gene o~ E coli and S. cerevisiae TRPl gene, and
a promoter derived from a highly-expressed gene to direct
--19--
CA 02220l23 l997~ 04
WO 96/34891 PCT/US9~/09058
transcription of a downstream structural sequence. Such
promoters can be derived from operons ~nco~i n~ glycolytic
enzymes such as 3-phosphoglycerate kinase ~PGK), ~-_actor,
acid phosphatase, or heat shock proteins, among others. The
heterologous structural sequence is assembled in a~ iate
phase with translation initiation and termination sequences,
and pre~erably, a leader sequence capable of directing
secretion of translated protein into the periplasmic space or
extracellular medium. Optionally, the heterologous sequence
can encode a fusion protein including an N-terminal
identification peptide imparting desired characteristics,
e.g., st~h;l~zation or simpli_ied puri_ication of expressed
recombinant product.
Useful expression vectors for bacterial use are
constructed by inserting a structural DNA sequence encoding
a desired protein together with suitable translation
initiation and termination signals in operable r~A~ ng phase
with a functional promoter. The vector will comprise one or
more phenotypic selectable markers and an origin of
replication to ensure maintenance of the vector and to, if
desirable, provide ampli~ication within the host. Suitable
prokaryotic hosts ~or trans~ormation include E coli,
Bacillus subtilis, Salmonella tvDhimurium and various species
within the yenera Psell~n~nn~, Streptomyces, and
Staphylococcus, although others may also be employed as a
matter o~ choice.
As a representative but nonl im~ ting example, use~ul
expression vectors ~or bacterial use can comprise a
selectable marker and bacterial origin o~ replication derived
~rom comm~cially available plasmids comprising genetic
elements o~ the well known cloning vector pBR322 (ATCC
37017). Such commercial vectors include, _or ~mple,
pKK223-3 (Pharmacia Fine Chemicals, Uppsala, Sweden) and GEM1
(Promega Biotec, Madison, WI, USA). These pBR322 "back~one"
sections are combined with an a~L~yriate promoter and the
-20-
CA 02220l23 l997-ll-04
WO96/34891 PCT~S95/09058
structural sequence to be expressed. F o l l o w i n g
trans~ormatiOn o~ a suitable host strain and growth of the
host strain to an a~ru~Liate cell density, the selected
promoter is induced by ay~ u~riate means (e.g., temperature
shift or chemical induction) and cells are cultured ~or an
additional period.
Cells are typically harvested by centri~ugation,
disrupted by physical or chemical means, and the resulting
crude extract ret~t n~ ~or ~urther purification.
Microbial cells employed in expression of proteins can
be disrupted by any convenient method, including ~reeze-thaw
cycling, sonication, mechanical disruption, or use o~ cell
lysing agents, such methods are well known to those skilled
in the art.
Various m~mm~ 1 t ~n cell culture systems can also be
employed to express re~omh~nAnt protein. Bxamples of
m~mm~ l ian expression system.s include the COS-7 lines o~
monkey kidney ~ibroblasts, described by Gluzman, Cell, 23:175
(1981), and other cell lines c~p~hle of expressing a
compatible vector, ~or ~mple~ the C127, 3T3, CHO, HeLa and
BHK cell lines . MAmm~ n expression vectors will c~-"~ r ise
an origin o~ replication, a suitable promoter and ~nh~nc~,
and also any necessary ribosome h; n~ing sites,
polyadenylation site, splice donor and acceptor sites,
transcriptional termination sequences, and 5~ nktng
nontranscribed sequences. ~NA sequences derived ~rom the
SV40 splice, and polyadenylation sites may be used to provide
the required nontranscribed genetic elements.
Ck~-8, MIP-4 and Ck~-l are recovered and purified ~rom
recombinant cell cultures by methods including ~ont um
sulfate or ethanol precipitation, acid extraction, anion or
cation ~h~nge chromatography, phosphocellulose
chromatography, hydrophobic interaction ch~omatography,
a~finity chromatography hydroxylapatite chromatography and
lectin chromatography. Protein refolding steps can be used,
-21-
CA 02220123 1997-11-04
W O 96/34891 PCT~US9~/09058
as necessary, in completing con~iguration o~ the mature
protein. Finally, high per~ormance liquid chromatography
(HPLC) can be employed ~or ~inal puri~ication steps.
The polypeptides o~ the present invention may be a
naturally puri~ied product, or a product o~ chemical
synthetic procedures, or produced by recomhin~nt techniques
~rom a prokaryotic or eukaryotic host (~or example, by
bacterial, yeast, higher plant, insect and m~mm~ n cells in
culture). Depending upon the host employed in a recomh~ n~nt
production procedure, the polypeptides o~ the present
invention may be glycosylated with m~ 1 i An or other
eukaryotic carbohydrates or may be non-glycosylated.
Polypeptides o~ the invention may also include an initial
methionine amino acid residue.
The polypeptides o~ the present invention may be
employed in a variety o~ ;m~nn~egulatory and in~lammatory
~unctions and also in a number o~ disease conditions. Ck~-8,
MIP-4 and Ck~-l are in the rhpmnkine ~amily and there~ore
they are rhPmo~ttractants ~or leukocytes ~such as monocytes,
neutrophils, T lymphocytes, eosinophils, basophils, etc.).
Northern Blot analyses show that Ck~-8, MIP-4 and Ck~-1
are expressed pre~nm~n~ntly is tissues o~ haemopoietic
origin.
Ck~-8 is shown to play an important role in the
regulation o~ the ~mmlln~ response and in~lammation. In
Figure 22, it is shown that lipopoly~r~h~ide ;n~ P~ the
expression of Ck~-8 ~rom human monocytes. Accordingly, in
response to the presence o~ an endotoxin, Ck~-8 is expressed
~rom monocytes and, there~ore, ~m;n;~tration of Ck~-8 may be
employed to regulate the imm~ne response o~ a host.
As illustrated in Figure 10, the ~hpmn~ttractant
activity o~ Ck~-8 on THP-1 cells ~A) and PBMCs ~B) is
signi~icant. Ck~-8 also induces signi~icant calcium
mnhi 1 i zation in THP-1 cells (Figure 11) showing that Ck~-8
has a biological e~ect on monocytes. Further, Ck~-8
-22-
CA 02220l23 l997-ll-04
WO96/34891 PCT~S95/09058
produces a dose dependent chemotactic and calcium
mobilization response in human monocytes.
Accordingly, Ck~-8, MIP-4 and Ck~-1 can be employed to
~acilitate wound h~ling by controlling in~iltration o~
target immlln~ cells to the wound area. In a sim~ ashion,
the polypeptides o~ the present invention can ~nh~nce host
de~enses against chronic in~ections, e.g., mycobacterial, via
their attraction and activation o~ microbicidal leukocytes.
Further, the polypeptides o~ the present invention may
be employed in anti-tumor therapy since there is evidence
that rh~mnkine expressing cells injected into tumors have
caused regression o~ the tumor, ~or example, in the treatment
o~ Karposi sarcoma. An analysis o~ Figures 12 and 13
illustrate that Ck~-8 in~nc~ THP-1 cells to secrete TNF-~,
which is a known agent ~or regressing L~-.o~s. 250 ng/ml of
Ck~-8 induces the production and secretion o~ 1200
picograms/ml o~ TNF-~. Ck~-8 also signi~icantly in~llr~c
human monocytes to secrete other tumor and cancer ;nh; h; ting
agents such as IL-6, IL-1 and G-CSF. Also, Ck~-8, MIP-4 and
Ck~-1 stimulate the invasion and activation o~ host de~ense
ttumoricidal) cells, e.g., cytotoxic T-cells and macrophages
via their chemotactic activity, and in this way may also be
employed to treat solid tumors.
The polypeptides may also be employed to ;nh; ht t the
proli~eration and di~erentiation o~ hematopoietic cells and
there~ore may be employed to protect bone marrow stem cells
~rom chemotherapeutic agents during chemotherapy. Figures 14
and 15 illustrate that Ck~-8 and Ck~-1 inhi hi t colony
~ormation of low proli~erative pot~nti~l colony ~orming
cells, and that Ck~-8 is a potent and speci~ic inhihitor of
LPP-CFC colony growth. Figure 16 illustrates that Ck~-l
speci~ically inhihits M-CSF-stimulated colony ~ormation,
while Ck~-8 does not. However, as also shown, both Ck~-8 and
Ck~-1 signi~icantly inhibit growth or di~erentiation o~ bone
marrow cells. This antiproli~erative e~ect allows a greater
-
-23-
CA 02220123 1997-11-04
WO 96/34891 PCT/US95/090~8
exposure to chemotherapeutic agents and, there_ore, more
effective chemotherapeutic tr~tm~nt.
The inhihitory effect o~ the Ck~-l and Ck~-8
polypeptides on the subpopulation of committed ~yel~itor
cells, (for example granulocyte, and macrophage/monocyte
cells) may be employed therapeutically to inh~hit
proliferation of leukemic cells.
In Figures 17, 18 and 19 the committed cells of the cell
lineages utilized were removed and the resulting population
of cel]s were contacted with Ck~-l and Ck~-8. Ck~-l causes
a decrease in the Mac-l positive population o~ cells by
nearly 50~, which is consistent with the results of Figure 16
which shows Ck~-l induces ~nhihition of M-CSF responsive
colony-forming cells. Ck~-8, as shown in Figure 19, inhihit5
the ability of committed ~loye~itor cells to form colonies in
response to IL-3, GM-CSF and M-CSF. Further, as shown in
Figure 20, a dose response of Ck~-8 is shown to ;nh;htt
colony formation. This inh;hition could be due to a ~peci~ic
blockage of the differPnt;~tive signal mediated by these
~actors or to a cytotoxic effect on the ~Loy~..itor cells.
Another employment of the polypeptides is the inh;h;tion
of T-cell proliferation via ~nh; hi tion of IL-2 biosynthesis,
~or example, in auto-immlln~ diseases and lymphocytic
leukemia .
Ck~-8, MIP-4 and Ck~-l may also be employed _or
inhibiting epidermal keratinocyte proliferation _or psoriasis
(keratinocyte hyper-proliferation) since Langerhans cells in
skin have been _ound to produce MIP-l~.
Ck~-8, MIP-4 and Ck~-l may be employed to prevent
scarring during wound healing both via the recruitment of
debris-cleaning and connective tissue-promoting inflammatory
cells and by control of excessive TGF~-mediated fibrosis In
addition, these polypeptides may be employed to treat stroke,
thrombocytosis, plllm~n~ry emboli and myeloproliferative
-24-
CA 02220123 1997-11-04
WO96/34891 PCT~S95/09058
disorders, since Ck~-8, MIP-4 and Ck~-l increase vascular
perm~h;lity.
Ck~-8 may also be employed to treat leukemia and
abnormally proliferating cells, for example tumor cells, by
in~ncing apoptosis. Ck~-8 induces apoptosis in a population
of hematopoietic progenitor cells as shown in Figure 21.
The polypeptides of the present invention, and
polynucleotides ~nCo~ing such polypeptides, may be employed
as research reagents for in vi tro purposes related to
scientific research, synthesis of DNA and manufacture of DNA
vectors, and for the purpose of developing therapeutics and
diagnostics for the treatment of human disease. For example,
Ck~-l and Ck~-8 may be employed for the ~p~n~ion of immature
hematopoietic ~loye~itor cells, for example, granulocytes,
macrophages or monocytes, by temporarily preventing their
differentiation. These bone marrow cells may be cultured in
vi tro .
Fra~m~nt~ of the full length Ck~-8, MIP-4 or Ck~-l genes
may be used as a hybridization probe for a cDNA library to
isolate the full length gene and to isolate other genes which
have a high sequence si m; 1 ~ity to the gene or si mi 1
biological activity. Preferably, however, the probes have at
least 30 bases and may cnnt~in, for example, 50 or more
bases. The probe may also be used to i~ntify a cDNA clone
corresponding to a full length transcript and a genomic clone
or clones that contain the complete genes including
regulatory and promotor regions, exons, and introns. An
example of a screen ~~ ises isolating the coding region of
the genes by using the known DNA sequence to synthesize an
oligonucleotide probe. Labeled oligonucleotides having a
sequence complementary to that of the genes of the present
invention are used to screen a library of human cDNA, genomic
DNA or mRNA to determine which m~m~s of the library the
probe hybridizes to.
-25-
CA 02220l23 l997-ll-04
O 96/34891 PCTrUS9~/09058
This invention is also related to the use o~ the Ck~-8,
MIP-4 and Ck~-l gene as part of a diagnostic assay for
detecting diseases or suscept; h;l; ty to diseases related to
the presence of m~t~t;ons in the nucleic acid sequences.
Such diseases are related to under-expression o~ the
rhPmnkine polypeptides.
Individuals carrying mutations in the Ck~-8, MIP-4 and
Ck~-1 may be detected at the DNA level by a variety of
techniques. Nucleic acids for diagnosis may be obt~ineA _rom
a patient's cells, such as from blood, urine, saliva, tissue
biopsy and autopsy material. The genomic DNA may be used
directly $or detection or m y be amplified enzymatically by
using PCR (Saiki et al., Nature, 324:163-166 (1986)) prior to
analysis. RNA or cDNA may also be used $or the same purpose.
As an example, PCR primers compl~m~nt~y to the nucleic acid
~nroA;ng Ck~-8, MIP-~ and Ck~-1 can be used to identify and
analyze Ck~-8, MIP-4 and Ck~-1 mutations. For ~r~ e,
deletions and insertions can be detected by a change in size
of the amplified product in cnmr~ison to the norm~l
genotype. Point mutations can be iA~nt~fied by hybridizing
amplified DNA to radiolabeled Ck~-8, MIP-4 and Ck~-1 RNA or
alternatively, radiolabeled Ck~-8, MIP-4 and Ck~-1 antisense
DNA seqnPnr~fi Per$ectly matched sequences can be
disting~ h~r9 $rom mismatched duplexes by RNase A digestion
or by di~$erences in melting temperatures.
Genetic testing based on DNA sequence differences may be
achieved by detection o$ alteration in electrophoretic
mobility of DNA $ragments in gels with or without denaturing
agents. Small sequence deletions and insertions can be
visualized by high resolution gel electrophoresis. DNA
$ragments o$ di$$erent sequences may be disting~ h~A on
denaturing ~ormamide gradient gels in which the m oh;l ities of
dif~erent DNA ~ragments are retarded in the gel at dif$erent
positions according to their specific melting or partial
CA 02220l23 Iss7-ll-04
WO96/34891 PCT~S95/09058
melting temperatures (see, e.g., Myers et al., Science,
230:1242 ~1985)).
Sequence ch~nges at specific locations may also be
revealed by nuclease protection assays, such as RNase and S1
protection or the chemical cleavage method (e.g., Cotton et
al., PNAS, USA, 85:4397-4401 ~1985)).
Thus, the detection of a specific DNA sequence may be
achieved by methods such as hybridization, RNase protection,
chemical cleavage, direct DNA se~lPncing or the use of
restriction enzymes, (e.g., Restriction Fragment Length
Polymorphisms (RFLP)) and Sol~the~n blotting of genomic DNA.
In addition to more conventional gel-electrophoresis and
DNA seqn~ncing, mutations can also be detected by in situ
analysis.
The present invention also relates to a Ai~gnostic assay
for detecting altered levels of Ck~-8, MIP-4 and Ck~-l
protein in various tissues since an over-expression of the
proteins rnmr~ed to normal control tissue samples may detect
the presence of a disease or suscept;h;l;ty to a disease, for
example, a tumor. Assays used to detect levels of Ck~-8,
MIP-4 and Ck~-1 protein in a sample derived from a host are
well-known to those of skill in the art and include
radioimm~no~ssays, competitive-hinAing assays, Western Blot
analysis, ELISA assays and "sandwich" assay. An ELISA assay
(Coligan, et al., Current Protocols in Tmmllnology, 1(2),
Chapter 6, (1991)) initially comprises preparing an ~ntihoAy
specific to the Ck~-8, MIP-4 and Ck~-1 antigens, preferably
a monoclonal antibody. In addition a reporter ~ntihody is
prepared against the monoclonal ~nt;hody. To the reporter
antibody is attached a detectable reagent such as
radioactivity, fluorescence or, in this example, a
horseradish peroxidase enzyme. A sample is removed from a
host and incubated on a solid support, e.g. ~ polystyrene
dish, that binds the proteins in the sample. Any free
protein hi nAing sites on the dish are then covered by
-27-
CA 02220l23 l997-ll-04
WO 96/34891 PCT/US95/09058
incubating with a non-specific protein like BSA. Next, the
monoclonal ~nt~ho~y is ;n~nh~ted in the dish during which
time the monoclonal ~ntihodies attach to any Ck~-8, MIP-4 and
Ck~-l proteins att~chP~ to the polystyrene dish. A11 unhound
monoclonal antibody is washed out with buf~er. The reporter
~nt; hody linked to horseradish peroxidase is now placed in
the dish resulting in hi n~ing of the reporter ~ntih~dy to any
monoclonal ~ntihody bound to Ck~-8, MIP-4 and Ck~-1.
Unatt~chP~ reporter antibody is then washed out. Peroxidase
substrates are then added to the dish and the amount o~ color
developed in a given time period is a measul~...~,.t of the
amount of Ck~-8, MIP-4 and Ck~-l protein present in a given
volume o~ patient sample when romp~ed against a st~n~d
curve.
A competition assay may be employed wherein ~ntihodies
specific to Ck~-8, MIP-4 and Ck~-1 are att~chP~ to a solid
support and labeled Ck~-8, MIP-4 and Ck~-l and a sample
derived ~rom the host are passed over the solid support and
the amount of label detected, ~or example by liquid
s~in~ tion chromatography, can be correlated to a quantity
o~ protein in the sample.
A ~sandwich~ assay is sim; 1~ to an ELISA assay. In a
"sandwich" assay Ck~-8, MIP-4 and Ck~-l is passed over a
solid support and binds to ~nt;hody att~rh~ to a solid
support. A second antibody is then bound to the Ck~-8, MIP-4
and Ck~-l. A third ~nt;ho~y which is labeled and specific to
the second ~nt;ho~y is then passed over the solid support and
binds to the second antibody and an amount can then be
quanti~ied.
This invention provides a method ~or i~Pnt;fication o~
the receptors ~or the ~hPmnk;np polypeptides. The gene
encoding the receptor can be identified by numerous methods
known to those o~ skill in the art, for example, ligand
p~nn;ng and FACS sorting tColigan, et al., Current Protocols
in Immun., 1(2), Chapter 5, ~1991)). Prefera_ly, expression
-28-
CA 02220123 1997-11-04
WO 96/34891
PCT/US95/09n58
cloning is employed wherein polyadenylated RNA is prepared
~rom a cell responsive to the polypeptides, and a cDNA
library created from this RNA is divided into pools and used
to transfect COS cells or other cells that are not responsive
to the polypeptides. Transfected cells which are grown on
glass slides are exposed to the labeled polypeptides. The
polypeptides can be labeled by a variety of means including
iodination or inclusion of a recognition site for a site-
specific protein kinase. Following fixation and incubation,
the slides are subjected to autoradiographic analysis.
Positive pools are identi_ied and sub-pools are prepared and
retransfected using an iterative sub-pooling and rescreening
process, eventually yielding a single clones that encodes the
putative receptor.
As an alternative approach for receptor i~ntification,
the labeled polypeptides can be photoaffinity linked with
cell membrane or extract preparations that express the
receptor molecule. Cross-linked material is resolved by PA OE
analysis and exposed to X-ray film. The labeled complex
contAining the receptors of the polypeptides can be excised,
resolved into peptide fra~m~nt~, and subjected to protein
microseq-~ncing. The amino acid sequence obtAin~ from
microseq~rnci ng would be used to design a set o~ degenerate
oligonucleotide probes to screen a cDNA library to i~ntify
the genes ~nco~ing the putative receptors.
This invention provides a method of screening cu,,~uuuds
to identify agonists and antagonists to the rh~m~kine
polypeptides of the present invention. An agonist is a
compound which has sim~ 1 An biological functions o~ the
polypeptides, while antagonists block such functions.
Chemotaxis may be assayed by placing cells, which are
chemoattracted by either o~ the polypeptides of the present
invention, on top o~ a filter with pores o~ sufficient
diameter to admit the cells ~about 5 ~m). Solutions of
potential agonists are placed in the bottom o~ the chamber
-
--29--
CA 02220123 1997-11-04
WO 96/34891 PCT/US9:~/090~i8
with an appropriate control medium in the upper compA~L-"e.,L,
and thus a concentration gradient of the agonist is measured
by counting cells that migrate into or through the porous
ne over time.
When assaying ~or antagonists, the rhemnkine
polypeptides of the present invention are placed in the
bottom chamber and the potPnt; Al antagonist is added to
determine if chemotaxis of the cells is prevented.
Alternatively, a mAmmAl;An cell or Ill~u~dne preparation
expressing the receptors of the polypeptides would be
incubated with a labeled rh~okine polypeptide, eg.
radioactivity, in the presence of the cul,~,d. The ability
of the compound to block this interaction could then be
measured. When assaying for agonists in this fashion, the
chPmnkines would be absent and the ability of the agonist
itself to interact with the receptor could be measured.
Bxamples of potential Ck~-8, MIP-4 and Ck~-1 antagonists
include Ant; hndies, or in some cases, oligonucleotides, which
bind to the polypeptides. Another example of a potpnti Al
antagonist is a negative ~nm;nAnt m~ltAnt of the polypeptides.
Negative ~nmin~nt mllt~nt~ are polypeptides which bind to the
receptor of the wild-type polypeptide, but fail to retain
biological activity.
Antisense constructs prepared using antisense tPchnnlogy
are also potential antagonists. Antisense technology can be
used to control gene expression through triple-helix
formation or antisense DNA or RNA, both o~ which methods are
based on ~; n~i ng of a polynucleotide to DNA or RNA. For
example, the 5' coding portion o~ the polynucleotide
seguence, which encodes ~or the mature polypeptides o~ the
present invention, is used to design an antisense RNA
oligonucleotide o~ ~rom about 10 to 40 base pairs in length.
A DNA oligonucleotide is designed to be complPmentA~y to a
region o~ the gene involved in transcription (triple- helix,
see Lee et al., Nucl. Acids Res., 6:3073 ~1979)j Cooney et
-30-
- CA 02220l23 l997-ll-04
W096/34891 PCT~S9S/09058
al, Science, 241:4~6 (1988); and Dervan et al., Science, 251:
1360 (1991)), thereby preventing transcription and the
production o~ the ~hPmokine polypeptides. The antisense RNA
oligonucleotide hybridizes to the mRNA in vivo and blocks
translation of the mRNA molecule into the polypeptides
(antisense - Okano, J. Neurochem., 56:560 (1991);
Oligodeoxynucleotides as Antisense Tnh; h; tors of Gene
Expression, CRC Press, Boca Raton, ~L (1988)). The
oligonucleotides described above can also be delivered to
cells such that the antisense RNA or DNA may be expressed in
vivo to inh; h; t production of the ~h~mnkine polypeptides.
Another potPnt;~l chemnk; ne antagonist is a peptide
derivative of the polypeptides which are naturally or
synthetically modified analogs of the polypeptides that have
lost biological ~unction yet still recognize and bind to the
receptors o~ the polypeptides to thereby ef~ectively block
the receptors. ~xamples of peptide derivatives include, but
are not limited to, small peptides or peptide-like molecules.
The antagonists may be employed to treat disorders which
are either MIP-induced or ~nh~nced~ for example, auto-;m~lne
and chronic in~lammatory and infective diseases. ~xamples of
auto-;m~ne diseases include multiple sclerosis, and insulin-
dep~n~Pnt diabetes.
The antagonists may also be employed to treat in~ectious
diseases including silicosis, sarcoidosis, idiopathic
pnlmnn~y fibrosis by prevPnt;ng the recruitment and
activation of mnnonll~lear phagocytes. They may also be
employed to treat idiopathic hyper-eosinophilic syndrome by
preventing eosinophil production and migration. kndotoxic
shock may also be treated by the antagonists by preventing
the migration o~ macrophages and their production of the
ch~mnkine polypeptides of the present invention.
The antagonists may also be employed ~or treating
atherosclerosis, by preventing monocyte infiltration in the
artery wall.
-31-
CA 02220l23 lss7-ll-04
WO96/34891 PcT~S95/09058
The antagonists may also be employed to treat hist~mine-
mediated allergic reactions and imm~ln~logical disorders
including late phase allergic reactions, chronic urticaria,
and atopic denmatitis by inh;h;ting chPm~k;ne-;n~nce~ mast
cell and basophil degranulation and release o~ hist~m; n~,
IgE-mediated allergic reactions such as allergic asthma,
rhinitis, and eczema may also be treated.
The antagonists may also be employed to treat chronic
and acute infl~mm~tion by preventing the attraction o~
monocytes to a wound area. They may also be employed to
regulate normal plllmnn~ry macrophage populations, since
chronic and acute in~lammatory pnlmrn~ry diseases are
associated with se~uestration o~ mnn~nllrlear phagocytes in
the lung.
Antagonists may also be employed to treat rheumatoid
arthritis by prev~nt;ng the attraction of monocytes into
synovial ~luid in the joints of patients. Monocyte influx
and activation plays a signi~icant role in the pathogenesis
of both degenerative and in~lammatory arthropAthies.
The antagonists may be employed to inter~ere with the
deleterious cascades attributed primarily to IL-l and TNF,
which prevents the biosynthesis o~ other in~lammatory
cytokines. In this way, the antagonists may be employed to
ev~llt in~lammation. The antagonists may also be employed
to ;nh; h; t prostaglAn~in-indep~n~nt ~ever ~n~l~c~ by
ch~mr~kines .
The antagonists may also be employed to treat cases o~
bone marrow failure, for example, aplastic Anrm;~ and
myelodysplastic syndrome.
The antagonists may also be employed to treat asthma and
allergy by preventing eosinophil acc-~ml~lAt;on in the lung.
The antagonists may also be employed to treat subepithPl; Al
basement m~ ~le fibrosis which is a prom;n~nt feature o~
the asthmatic lung.
-32-
-
CA 02220123 1997-11-04
WO 96/34891 PCT/US95/09058
The antagonists may be employed in a composition with a
pharmaceutically acceptable carrier, e.g., as hereinafter
described.
The rh~m~kine polypeptides and agonists and antagonists
may be employed in romhin~tion with a suitable pharmaceutical
carrier. Such compositions com~rise a therapeutically
effective amount of the polypeptide, and a pharmaceutically
acceptable carrier or excipient. Such a carrier includes but
is not limited to ~1 inP~ buffered ~l;ne, dextrose, water,
glycerol, ethanol, and comht nA tions thereof. The formulation
should suit the mode of ~mint ~tration.
The invention also provides a pharmaceutical pack or kit
comprising one or more rontAin~s filled with one or more of
the ingredients of the pharmaceutical compositions of the
in~ention. A~sociated with such contAin~(s) can be a notice
in the form prescribed by a gov~rnm~ntAl agency regulating
the manufacture, use or sale of pharm~r~l~ticals or biological
products, which notice reflects a~-o~al by the agency of
manufacture, use or sale for human A~mini~tration. In
addition, the polypeptides and agonists and antagonists may
be employed in conjunction with other therapeutic compounds.
The pharmaceutical compositions may be A~mini ~tered in
a convenient m~nne~ such as by the topical, intravenous,
intraperitoneal, intramuscular, intratumor, sllhr~lt~neous,
intranasal or intradermal routes. The pharmaceutical
compositions are ~mini~tered in an amount which is effective
for treating and/or prophylaxis of the specific indication.
In ~eneral, the polypeptides will be ~mi ni tered in an
amount of at least about 10 ~g/kg body weight and in most
cases they will be ~mi ni ~tered in an amount not in excess of
about 8 mg/Kg body weight per day. In most cases, the dosage
is from about 10 ~g/kg to about 1 mg/kg body weight daily,
taking into account the routes of A~mi ni strati~n, symptoms,
~ etc.
-33-
CA 02220l23 l997-ll-04
WO96/34891 PCT~S95/09058
The rh~m~kine polypeptides, and agonists or antagonists
which are polypeptides, may be employed in accordance with
the present invention by expression o~ such polypeptides i~
vivo, which is o~ten re~erred to as "gene therapy. n
Thus, ~or example, cells ~rom a patient may be
engineered with a polynucleotide (DNA or RNA) encoding a
polypeptide ex vivo, with the engineered cells then being
provided to a patient to be treated with the polypeptide.
Such methods are well-known in the art. For example, cells
may be engineered by procedures known in the art by use o~ a
retroviral particle cont~;ning RNA ~nco~;ng a polypeptide of
the present invention.
Similarly, cells may be engineered in vivo ~or
expression of a polypeptide in vivo by, ~or example,
procedures known in the art. As known in the art, a prn~llc~r
cell ~or pro~ll~;ng a retroviral particle cnnt~;ning RNA
encoding the polypeptide o~ the present invention may be
~m; n; ~tered to a patient ~or engineering cells in vivo and
expression of the polypeptide in ~ivo. These and other
methods ~or ~m~n~ ~tering a polypeptide o~ the present
invention by such method should be apparent to those skilled
in the art from the teachings o~ the present invention. For
example, the expression vehicle ~or engineering cells may be
other than a retrovirus, ~or example, an adenovirus which may
be used to engineer cells in vivo a~ter comh;n~t;on with a
suitable delivery vehicle.
The retroviral pl ~cm~ ~ vectors may be derived ~rom
retroviruses which include, but are not limited to, Moloney
Murine Sarcoma Virus, Moloney Murine Leukemia Virus, spleen
necrosis virus, Rous Sarcoma Virus and Harvey Sarcoma Virus.
In a pre~erred embodiment the retroviral expression
vector, pMV-7, is ~lanked by the long terminal repeats (LTRs)
o~ the Moloney murine sarcoma virus and cont~;n~ the
selectable drug resistance gene neo under the regulation o~
the herpes simplex virus (HSV) thymidine kinase (tk)
CA 02220l23 l997-ll-04
W O 96/34891 PCTrUS9~/09058
promoter. Unique BcoRI and HindIII sites ~acilitate the
introduction o~ coding sequence (Kirschmeier, P.T. et al.,
DNA, 7:219-25 ~1988)).
The vectors include one or more suitable promoters which
include, but are not limited to, the retroviral LTR; the SV40
promoter; and the human cyto~egalovirus (CMV) promoter
described in Miller, et al., Biotechniaues, Vol. 7, No. 9,
980-990 (1989), or any other promoter (e.g., cellular
promoters such as eukaryotic cellular promoters including,
but not limited to, the histone, pol III, and ~-actin
promoters). The selection of a suitable promoter will be
apparent to those skilled in the art ~rom the te~rh~ngs
cont~i n e~ herein.
The nucleic acid seauence encoding the polypeptide o~
the present invention is under the control o~ a suitable
promoter which includes, but is not limited to, viral
thymidine kinase promoters, such as the Herpes Simplex
thymidine kinase promoter; retroviral LTRs, the ~-actin
promoter, and the native ~lu,,,oLer which controls the gene
encoding the polypeptide.
The retroviral plasmid ~ector is employed to transduce
packaging cell lines to ~orm producer cell lines. Bxamples
o~ packaging cells which may be trans~ected include, but are
not limited to, the PE501, PA317 and GP+aml2. The vector may
transduce the packaging cells through any means known in the
art. Such means include, but are not limited to,
electroporation, the use o~ liposomes, and CaPO4
precipitation.
The producer cell line generates in~ectious retroviral
vector particles which include the nucleic acid sequence(s)
encoding the polypeptides. Such retroviral vector particles
then may be employed, to transduce eukaryotic cells, either
in vi tro or in vivo . The transduced eukaryotic cells will
express the nucleic acid sequence(s) encoding the
polypeptide. Bukaryotic cells which may be transduced,
.
-3 5 -
CA 02220123 1997-11-04
096/34891 PCT~S95/090~8
include but are not limited to, fibroblasts and endot
cells.
The se~uences o~ the present invention are also valuable
for chromosome i~ntification. The sequence is specifically
targeted to and can hybridize with a particular location on
an individual human chromosome. Moreover, there is a current
need for identifying particular sites on the chromosome. Few
chromosome marking reagents based on actual sequence data
(repeat polymorph; ~ms) are presently av~ ~le for marking
chromosomal location. The mapping of DNA to chromosomes
according to the present invention is an important first step
in correlating those seqll~nc~s with genes associated with
diseafie .
Briefly, sequences can be mapped to chromosomes by
preparing PCR primers (preferably 15-25 bp) _rom the cDNA.
Computer analysis of the cDNA is used to rapidly select
primers that do not span more than one exon in the genomic
DNA, thus complicating the amplification process. These
primers are then used for PCR screening of somatic cell
hybrids rnnt~;ning individual human chromosomes. Only those
hybrids ront~;ni ng the human gene correspon~ing to the primer
will yield an amplified _ragment.
PCR mapping of somatic cell hybrids is a rapid procedure
for assigning a particular DNA to a particular chromosome.
Using the present invention with the same oligonucleotide
primers, sublocalization can be achieved with pAn~l,c o~
fra~m~n~ from specific chromosomes or pools of large genomic
clones in an analogous m~n~e~. Other mapping strategies
that can similarly be used to map to its chromosome include
in situ hybridization, prescr~n;ng with labeled flow-sorted
chromosomes and preselection by hybridization to construct
chromosome specific-cDNA libraries.
Fluorescence in situ hybridization (FISH) o_ cDNA clones
to a met~Arh~e chromosomal spread can be used to provide a
precise chromosomal location in one step. This technique can
-36-
CA 02220123 1997-11-04
WO96/34891 PCT~S95/09058
be used with cDNA as short as 500 or 600 bases. For a review
of this technique, see Verma et al., Human a~ - o",osomes: a
of Basic Techniques, Pely~l,.~lL Press, New York (1988)
Once a sequence has been mapped to a precise chromosomal
location, the physical position of the sequence on the
chromosome can be correlated with genetic map data. Such
data are found, for example, in V. McKusick, ~n~lian
Inheritance in Man (aV~ le on line through Johns Hopkins
University Welch Medical Library). The relationship between
genes and diseases that have been mapped to the same
chromosomal region are then i~nt;fied through linkage
analysis (coinheritance o~ physically adjacent genes).
Next, it is necessary to determine the differences in
the cDNA or genomic sequence between affected and unaffected
individuals. If a mutation is observed in some or all of the
affected indiv~ 1 s but not in any normal individuals, then
the mutation is likely to be the causative agent of the
disease.
With current resolution of physical mapping and genetic
mapping techniques, a cDNA precisely localized to a
chromosomal region associated with the disease could be one
o~ between 50 and 500 pot~nt;~l causative genes. (This
assumes l m~g~h~Qe mapping resolution and one gene per 20
kb).
The polypeptides, their fra~m~nts or other derivative~,
or analogs thereof, or cells expressing them can be used as
an tmmllnngen to produce ~ntihodies thereto. These ~ntihsA;es
can be, for example, polyclonal or monoclonal ~nt;hodies. The
present invention also includes ~h;m~ic, single chain and
hnm~nized ~nt;ho~; es, as well as Fab ~ragments, or the
product of an Fab expression library. Various procedures
known in the art may be used for the production of such
antibodies and ~ragments.
~ Antibodies generated against the polypeptides
correspon~ing to a sequence of the present invention or its
.
-37-
CA 02220123 1997-11-04
O 96/34891 PCT~US9~/09058
in vivo receptor can be obt~inPA by direct injection of the
polypeptides into an ~nim~l or by ~mini~tering the
polypeptides to an ~ntm~l, preferably a nnnhl-m~n The
antibody so obt~ineA will then bind the polypeptides itsel~.
In this ~nn~r, even a seguence PnCoAing only a ~ragment o~
the polypeptides can be used to generate ~nt;hoAies hinAing
the whole native polypeptides. Such ~ntihodies can then be
used to isolate the polypeptides ~rom tissue expressing that
polypeptide.
For preparation o~ monoclonal antibodies, any technique
which provides ~ntihoA;es produced by continuous cell line
cultures can be used. ~xamples include the hybridoma
technique (Kohler and Milstein, 1975, Nature, 256:495-497),
the trioma technique, the human B-cell hybridoma technique
(Kozbor et al., 1983, Tmmllnology Today 4:72), and the ~BV-
hybridoma technique to produce human monoclonal antihoA;es
(Cole, et al., 1985, in Monoclonal ~ntihoAies and Cancer
Therapy, Alan R. Liss, Inc., pp. 77-96).
Techniques described ~or the production o~ single chain
antibodies (U.S. Patent 4,946,778) can be adapted to produce
single chain antibodies to imml~nogenic polypeptides products
o~ this invention. Also, transgenic mice may be used to
express ~ll~~n; zed ~ntihodies to im~llnogenic polypeptide
products o~ this invention.
The present invention will be ~urther described with
re~erence to the ~ollowing examplesi however, it is to be
understood that the present invention is not limited to such
examples. All parts or amounts, unless otherwise speci_ied,
are by weight.
In order to _acilitate underst~nAing of the _ollowing
examples certain frequently occurring methods and/or terms
will be described.
"Plasmids" are desiynated by a lower case p preceded
and/or _ollowed by capital letters and/or numbers. The
starting plasmids herein are either co~ ~cially av~ hl e,
-38-
I CA 02220l23 l997-ll-04
WO96/34891
PCT~S95/09058
publicly available on an unrestricted basis, or can be
constructed ~rom aV~ hl e plasmids in accord with published
procedures. In addition, eguivalent plasmids to those
described are known in the art and will be apparent to the
ordinarily skilled artisan.
"Digestion" of DNA refers to catalytic cleavage of the
DNA with a restriction enzyme that acts only at certain
sequences in the DNA. The various restriction enzymes used
herein are comm~rcially av~ hl e and their reaction
conditions, co~actors and other reguirPm~nts were used as
would be known to the ordinarily skilled artisan. For
analytical purposes, typically l ~g o~ plasmid or DNA
~ragment is used with about 2 units o~ enzyme in about 20 ~l
of bu~er solution. For the purpose o~ isolating DNA
~ragments ~or plasmid construction, typically 5 to 50 ~g of
DNA are digested with 20 to 250 units of enzyme in a larger
volume. A~ u~iate bu~fers and substrate amounts ~or
particular restriction enzymes are speci~ied by the
manu~acturer. Incubation times o~ about l hour at 37 C are
ordinarily used, but may vary in accordance with the
supplier's instructions. A~ter digestion the reaction is
electrophoresed directly on a polyacrylamide gel to isolate
the desired fragment.
Size separation o~ the cleaved ~ra~nts is per~onmed
using 8 percent polyacrylamide gel described by Goeddel, D.
et al ., Nucleic Acids Res., B:4057 ~1980).
"Oligonucleotides" re~ers to either a single stranded
polydeoxynucleotide or two complementary polydeoxynucleotide
strands which may be chemically synthesized. Such synthetic
oligonucleotides have no 5' phosphate and thus will not
ligate to another oligonucleotide without ~i ng a phosphate
with an ATP in the presence o~ a kinase. A synthetic
oligonucleotide will ligate to a ~ragment that has not been
dephosphorylated.
-
CA 02220l23 l997-ll-04
WO96/34891 PCT~S9S/09058
"Ligation" refers to the process of ~orming
phosphodiester bonds between two dou~le stranded nucleic acid
~r~ nts (Maniatis, T., et al., Id., p. 146). Unless
otherwise provided, ligation may be accompli~h~ using known
bu~fers and conditions with 10 units to T4 DNA ligase
(~ligase") per 0.5 ~g of d~ ' u~imately equimolar amounts o~
the DNA fra~nt~ to be ligated.
Unless otherwise stated, transformation was performed as
described in the method of Graham, F. and Van der Eb, A.,
Virology, 52:456-457 (1973).
ExamDle 1
Bacterial Expression and Purification of CkB-8
The DNA sequence encoding Ck~-8, ATCC # 75676, was
initially amplified using PCR oligonucleotide primers
corre8pnn~ ng to the 5' and 3' end sequences of the processed
Ck~-8 protein (minus the signal peptide sequence) and the
vector sequences 3' to the Ck~-8 gene. Additional
nucleotides correspon~i ng to Bam HI and XbaI were added to
the 5' and 3' seqllYnc~s respectively. The 5' oligonucleotide
primer has the sequence 5' TCAGGATCCGT~A~A~GATGCAGA 3~ (SEQ
ID No. 7) cont~n~ a BamHI restriction enzyme site followed
by 18 nucleotides of Ck~-8 co~i ny sequence starting from the
presumed termi~al amin~ aei~ u~ the pr~e~s~ pFUt~i~.
3~ sequence 5' CGCTCTAGAGTA~AACGACGGCC~GT 3' (SEQ ID No. 8)
cont~ ns compl~t~y sequences to an XbaI site. The
restriction enzyme sites correspond to the restriction enzyme
sites on the bacterial expression vector PQE-9 (Qiagen, Inc.,
Chatsworth, CA). PQE-9 encodes ~ntihtotic resistance (Amp'),
a bacterial origin of replication (ori), an IPT&-regulatable
promoter operator (P/O), a ribosome hin~ing site (RBS), a 6-
His tag and restriction enzyme sites. pQE-9 is then digested
with BamHI and XbaI The amplified sequences are ligated
into PQE-9 and are inserted in frame with the sequence
encoding for the histidine tag and the RBS. The liyation
-40-
CA 02220l23 l997-ll-04
WO 96/34891 PCT/US9~;/09058
mixture is then used to transform E. coli strain M15/rep4
av~ilAhle from Qiagen. M15/rep4 rnnt~tn~ multiple copies o~
the plasmid pR~P4, which expresses the lacI repressor and
also confers kanamycin resi~tance (Ranr). Transformants are
i~nttfied by their ability to grow on ~3 plates and
ampic;llin/kanamycin resistant colonies are selected.
Plasmid DNA is isolated and confirmed by restriction
analysis. Clones cont~tntng the desired constructs were
grown overnight ~O/N) in liguid culture in ~3 media
supplemented with both Amp (100 ug/ml) and Kan (25 ug/ml).
The O/N culture is used to inoculate a large culture at a
ratio of 1:100 to 1:250. The cells are grown to an optical
density 600 (O.D.~) of between 0.4 and 0.6. IPTG
("Isopropyl-~-D-thiogalacto pyrano~ide") is then added to a
_inal concentration of 1 mM. IPTG induces by inactivating
the lacI repressor, clearing the P/O lP~tng to increased
gene expression. Cells are grown an extra 3 to 4 hour~.
Cells are then harvested by centrifugation. The cell pellet
is solllhtli~ed in the chaotropic agent 6 Molar Gll~nt~tnp HCl.
After clarification, solubilized Ck~-8 is purified from thi~
solution by chromatography on a Nickel-~hPl~te column under
conditions that allow for tight htn~tng by proteins
cont~tntn~ the 6-His tag (Hochuli, E. et al., J.
Chromatography 411:177-184 (1984)). Ck~-8 (95~ pure) is
eluted from the column in 6 molar gl~nt~tn~ HCl pH 5.0 and
~or the purpose o~ renaturation adjusted to 3 molar guanidine
HCl, lOOmM sodium phosphate, 10 mmolar glutathione (reduced)
and 2 = olar glutathione (oxidized). After incubation in
this solution for 12 hours the protein is dialyzed to 10
mmolar sodium phosphate.
ExamPle 2
Bacterial ExPression and Purification of MIP-4
The DNA seguence encoding MIP-4, ATCC # 75675, was
initially amplified using PCR oligonucleotide primers
-41-
CA 02220l23 l997-ll-04
WO96/34891
PCT~S95/09058
corresp~ntting to the 5' and 3' seqllt~nr~s of the processed
MIP-4 protein (minus the signal peptide sequence).
Additional nucleotides corresponding to Bam HI and XbaI were
added to the 5' and 3' end sequences respectively. The 5'
oligonucleotide primer has the sequence 5'
TCAGGAT~-l~l~CACaA~l-l w lACC 3' ~SBQ ID No. 9) contAtns a
BamXI restriction enzyme site followed by 18 nucleotides of
MIP-4 coding sequence starting from the presumed terminal
amino acid of the processed protein codon; The 3' sequence 5'
CGCTCTAGAGTA~AACGACGGCCAGT 3' ~S~Q ID No. lO) contains
compl~mentAry seqll~nres to an XbaI site. The re~triction
enzyme sites correspond to the restriction enzyme sites on
the bacterial expression vector pQE-9 (Qiagen, Inc.,
Chatsworth, CA). pQE-9 ~nco~t~ Antthtotic resistance ~Amp'),
a bacterial origin of replication ~ori), an IPTG-regulatable
promoter operator ~P/O), a ribosome htntltng site (~3S), a 6-
His tag and restriction enzyme sites. pQE-9 was then
digested with BamXI and XbaI and the amplified se~lenc~s were
ligated into pQE-9 and inserted in frame with the sequence
encoding for the histidine tag and the RBS. The ligation
mixture was then used to transform E coli strain avAilAhle
~rom Qiagen. Ml5/rep4 contains multiple copies of the
plAcmid pREP4, which expresses the lacI repressor and al~o
con~ers kanamycin resistance (Kanr). Transformants are
identified by their ability to grow on LB plates and
ampicillin/kanamycin resistant colonies were selected.
Plasmid DNA was isolated and confirmed by restriction
analysis. rlOn~S cont~inlng the desired constructs were
grown overnight (O/N) in liquid culture in LB media
supplemented with both Amp (lO0 ug/ml) and ~an (25 ug/ml).
The O/N culture is used to inoculate a large culture at a
ratio of l:lO0 to l:250 The cells were grown to an optical
density 600 (O.D.~) of between 0.4 and 0.6. IPTG
("Isopropyl-B-D-thiogalacto pyranoside") was then added to a
final concentration of 1 mM. IPTG induces by inactivating
-42-
CA 02220l23 Iss7-ll-04
WO96/34891 PCT~S95/09058
the lacI repressor, clearing the P/O leading to increased
gene expression. Cells were grown an extra 3 to 4 hours.
Cells were then harvested ~y centri_ugation. The cell pellet
was solubilized in the chaotropic agent 6 Molar Guanidine
HCl. After clarification, solubilized MIP-4 was purified
~rom this solution by chromatography on a Nickel-Chelate
column under conditions that allow for tight btn~tng by
proteins rontA~ning the 6-His tag (Hochuli, E. et al., J.
Chromatography 411:177-184 ~1984)). MIP-4 (95~ pure) was
eluted ~rom the column in 6 molar g~lAnt~nP HCl pH S.0 and
for the purpose of renaturation adjusted to 3 molar guanidine
HCl, lOOmM sodium phosphate, 10 mmolar glutathtnne treduced)
and 2 mmolar glutathione (~Y;~7-ed). After incubation in
this solution ~or 12 hours the protein was dialyzed to 10
mmolar sodium phosphate.
Example 3
Bacterial ExDression and Purification o~ Ck~-1
The DNA ~equence encoding CkB-1! ATCC # 75572, is
initially amplified using PCR oligonucleotide primers
correspon~ng to the 5' and 3' end sequences o~ the processed
Ck~-1 protein (minus the signal peptide sequence) and
additional nucleotides corresp~n~ing to Bam HI and XbaI were
added to the 5' and 3' sequences respectively. The 5'
oligonucleotide primer has the sequence 5'
GCCCGCGGAl~L-l~C-l-~ACGGGGACCTTAC 3' (SBQ ID No. 11) contAin~ a
BamHI restriction enzyme site ~ollowed by 15 nucleotides o~
Ck~-l coding se~uence starting ~rom the presumed tenminal
amino acid of the processed protein codon; The 3~ sequence 5'
GCCTGCTCTAGATCAAAGCAGGGAAGCTCCAG 3' ~SEQ ID No. 12) cont~tn~
complementary sequences to an XbaI ~ite, a tran~lation stop
codon and the last 20 nucleotides of Ck~-1 co~tng sequence.
The restriction enzyme sites correspond to the restriction
enzyme sites on the bacterial expression vector PQB-g.
(Qiagen, Inc., Chatsworth, C~). PQE-9 encodes antibiotic
-43-
- -
CA 02220l23 l997-ll-04
WO96/34891 PCT~S95109058
resistance (Ampr), a bacterial origin o~ replic~tio~ (ori), an
IPTG-re~-l~t~hle promoter operator (P/O), a ribosome hin~ing
site (RBS), a 6-His tag and restriction enzyme sites. pQE-9
was then digested with BamHI and XbaI and the ampli~ied
seql~nr~s were ligated into PQE-9 and were inserted in ~rame
with the sequence encoding ~or the histt~ine tag and the RBS.
The ligation mixture was then used to trans~orm ~. coli
strain aV~ hl e ~rom Qiagen under the tr~em~k M15/rep 4.
M15/rep4 contains multiple copies o~ the plasmid pREP4, which
expresses the lacI repressor and also con~ers kanamycin
resistance (Kanr). Trans~o~ Ls are iA~ntified by their
ability to grow on LB plates and ampic;llin/kanamycin
resistant colonies were selected. Plasmid DNA was isolated
and con~irmed by restriction analysis. Clones cnn~tningthe
desired constructs were grown overnight (0/N) in liquid
culture in LB media supplemented with both Amp (100 ug/ml)
and Kan (25 ug/ml~. The 0/N culture is used to inoculate a
large culture at a ratio o~ 1:100 to 1:250. The cells were
grown to an optical density 600 (O D.~) o~ between 0.4 and
0.6. IPTG (nIsG~lu~yl-B-D-thiogalacto pyranosiden) was then
added to a ~inal concentration o~ 1 mM. IPTG ;n~llr~s by
inactivating the lacI repressor, clearing the P/O l~Ai ng to
increased gene expression. Cells were grown an extra 3 to 4
hours. Cells were then harvested by centri~ugation. The
cell pellet was solubilized in the chaotropic agent 6 Molar
Gn~ni Ai n~ HCl. A~ter clari~ication, solubilized Ck~-l was
puri~ied ~rom this solution by chromatography on a Nickel-
Chelate column under conditions that allow ~or tight hi n~ing
by proteins cont~ining the 6-His tag (Hochuli, E. et al., J.
~h~omatoqra~hy 411:177-184 (1984)). Ck~-l (95~ pure) was
eluted ~rom the column in 6 molar guanidine HCl pH 5.0 and
~or the purpose of renaturation adjusted to 3 molar guanidine
HCl, lOOmM sodium phosphate, 10 mmolar glutathione (reduced)
and 2 mmolar glutathione (oxidized). A~ter incubation in
3 CA 02220123 1997-11-04
WO96134891 PCT~S95/09058
this solution for 12 hours the protein was dialyzed to lO
mmolar sodium phosphate.
ExamPle 4
~xPression of Recomh;nAnt CkB-8 in COS cells
The expression of plasmid, CMV-Ck~-8 HA is derived from
a vector pcDNAI/AmP (Invitrogen) contA~n~ng: l) SV40 origin
of replication, 2) ampic;l1~ n resistance gene, 3) E.coli
replication origin, 4) CMV ~u.,.~Ler followed by a polyl;nk~r
region, a SV40 intron and polyadenylation site. A DNA
fragment encoding the entire Ck~-8 precursor and a HA tag
fused in frame to its 3' end is cloned into the polyiinker
region of the vector, therefore, the rernmhin~nt protein
expression is directed under the CMV promoter. The HA tag
correspond to an epitope derived from the influenza
hemagglutinin protein as previously described (I. Wilson, et
al., Cell, 37:767 (1984)). The infusion of HA tag to the
target protein allows easy detection of the recnmh~nAnt
protein with an Ant~hody that recognizes the HA epitope.
The plasmid construction strategy is described as
follow:
The DNA sequence encoding for Ck~-8, ATCC # 75676, is
constructed by PCR u~ing two primer~: the 5' primer 5'
GGAAAGCTTATGAA w l~-l~l~CT 3' (SEQ ID No. 13) rontA~nC a
HindIII site followed by 18 nucleotides of Ck~-8 coding
sequence starting from the initiation codon; the 3' sequence
5' CGCTCTAGATCAAGCGTA~l~-Lw ~A~l~lAl w ~lAAl-l-~-l-l-~-l-w l~-l-l
GATCC 3' (SEQ ID No. 14) cont~n~ compl~m~ntA~y sequences to
an Xba I site, translation stop codon, HA tag and the last 20
nucleotides of the Ck~-8 coding sequence (not including the
stoF c~d~n). The~ef~, ~he ~P~ p~d~lct ~Qnt~~ Z~
site, Ck~-8 co~ ng sequence ~ollowed by HA tag fused in
frame, a translation termination stop codon next to the HA
tag, and an XbaI site. The PCR amplified DNA fragment and
the vector, pcDNAI/Amp, are digested with HindIII and XbaI
CA 02220123 1997-11-04
W O 96/34891 PCTrUS9~/09058
restriction enzyme and ligated. The ligation mixture is
trans~ormed into E. coli strain SURE (Stratagene Cloning
Systems, La Jolla, C~) the transformed culture is plated on
ampi~;l1; n media plates and resistant colonies are selected.
Plasmid DNA is isolated from trans_ormant~ and ~mi n~ by
restriction analysis ~or the presence of the correct
~ragment. For expression of the reromhin~nt Ck~-8, COS cells
are transfected with the expression vector by DBAE-DEXTRAN
method (J. Sambrook, E. ~ritsch, T. Maniatis, Molecular
Cloning: A Laboratory ~nll~l, Cold Spring Laboratory Press,
(1989)). The expression of the Ck~-8-HA protein is detected
by radiolabPll ing and immllnsprecipitation method (B. Harlow,
D. Lane, Antihodies: A Laboratory ~nll~l, Cold Spring Harbor
Laboratory Press, (1988)). Cells are labelled ~or 8 hours
with 35S-cysteine two days post transfection. Culture media
are then collected and cells are lysed with detergent (RIPA
bu~er (150 mM NaCl, 1~ NP-40, 0.1~ SDS, 1~ NP-40, 0.5% DOC,
50mM Tris, pH 7.5) (Wilson, I. et al., Id. 37:767 (1984)).
Both cell lysate and culture media are precipitated with a HA
speci~ic monoclonal ;~nti ht~y. Proteins precipitated are
analyzed on 15~ SDS-PAGE gels.
ExamDle 5
ExPression o~ RecombinAnt ~IP-4 in COS cells
The expression o~ pl ~ ~mi ~, CMV-MIP-4 HA iS derived _rom
a vector pcDNAI/Amp (Invitrogen) ron~;ntng: 1) SV40 origin
of replication, 2) ampic;ll; n resistance gene, 3) E.coli
replication origin, 4) C~V promoter ~ollowed by a polyl~nk~
region, a SV40 intron and polyadenylation site. A DNA
_ragment encoding the entire MIP-4 precursor and a H~ tag
~used in frame to its 3' end is rl on~ into the polylinker
region o~ the vector, there~ore, the recomh~n~nt protein
expression is directed under the CMV promoter. The HA tag
correspond to an epitope derived ~rom the influenza
hemagglutinin protein as previously described (I. Wilson, et
-46-
CA 02220123 1997-11-04
WO 96134891 PCT/US9~i/09058
al., Cell, 37:767 ~1984)). The in~usion of HA tag to the
target protein allows easy detection o~ the reromh~n~nt
protein with an ~nt; hoAy that recognizes the HA epitope.
The plasmid construction strategy is described as
~ollow:
The DNA sequence encoding MIP-4, ATCC # 75675, is
constructed by PCR using two primers: the 5' primer 5'
GGA~AGC-l-lATGAAGGGCCTTGCAGCTGCC 3' (SEQ ID No. 15) ront~;n~ a
HindIII site ~ollowed by 20 nucleotides o~ MIP-4 coding
sequence starting ~rom the initiation codoni the 3' sequence
5' CGCTCTAGATCAABCGTA~l~-l~A~L~lAl~lAGGCATTCAGCTTCAGGTC
3' (SEQ ID No. 16) contains compl~m~nt~Ty sequences to an Xba
I site, translation stop codon, HA tag and the last 19
nucleotides o~ the MIP-4 roA; ng sequence ~not including the
stop codon). There~ore, the PCR product ront~;nc a HindIII
site, MIP-4 co~; ng sequence ~ollowed by HA tag ~used in
~rame, a translation termination stop codon next to the HA
tag, and an XbaI site. The PCR ampli~ied DNA ~ragment and
the vector, pcDNAI/Amp, are digested with HindIII and X_aI
restriction enzyme and ligated. The ligation mixture is
trans~ormed into E. coli strain SURE (Stratagene Cloning
Systems, La Jolla, CA) the trans~ormed culture is plated on
ampir;ll; n media plates and resistant colonies are selected.
Plasmid DNA is isolated ~rom trans~ormants and ~m; nP~ by
restriction analysis ~or the presence of the correct
~ragment. For expression o~ the recomh~n~nt MIP-4, COS cells
are trans~ected with the expression vector by DEAE-DEXTRAN
method (J. Sambrook, E. Fritsch, T. Maniatis, Molecular
Cloning: A Laboratory M~n~ , Cold Spring Laboratory Press,
(1989)). The expression o~ the MIP-4-HA protein is detected
by radiolabelling and ;m~noprecipitation method (E. Harlow,
D. Lane, Ant;hndies: A Laboratory ~nnAl, Cold Spring ~hoT
Laboratory Press, (1988)). Cells are labelled ~or 8 hours
with 35S-cysteine two days post trans~ection. Culture media
are then collected and cells are lysed with detergent (RIPA
-47-
CA 02220123 1997-11-04
WO96/34891 PCT~S9~/09058
bu~er (150 mM NaCl, l~ NP-40, 0.1% SDS, 1% NP-40, 0.5% DOC,
SOmM Tris, pH 7.5) (Wilson, I. et al., Id. 37:767 ~1984)).
Both cell lysate and culture media are precipitated with a HA
speci~ic monoclonal ~ntihody~ Proteins precipitated are
analyzed on 15% SDS-PAGE gels.
Example 6
Ex~ression o~ Recsmbinant C~-l in COS cells
The expression o~ ~lA~m;d, CMV-Ck~-l HA is derived ~rom
a vector pcDNAI~Amp (Invitrogen) rnnt~ining l) SV40 origin
o~ replication, 2) ampic;lltn resistance gene, 3) E.coli
replication origin, 4) CMV promoter ~ollowed by a polylinker
region, a SV40 intron and polyadenylation site. A DNA
~ragment encodiny the entire Ck~-l precursor and a HA tag
~used in ~rame to its 3' end was cloned into the polylink~
region o~ the vector, there~ore, the r~cnmhi n~nt protein
expression is directed under the CMV ~ ~",~Ler. The HA tag
correspond to an epitope derived ~rom the in~luenza
hemaggll~tin;n protein as previously described ~I. Wilson, et
al., Cell, 37:767 (1984)). The in~usion o~ HA tag to the
target protein allows easy detection of the recomhin~nt
protein with an antibody that recognizes the HA epitope.
The pl ~F~i ~ construction strategy is described a~
~ollows:
The DNA sequence encoding Ck~-l, ATCC # 75572, was
constructed by PCR using t~o primers: the 5' primer 5'
GGAAAGCTTATGAAGAl-L~C~l~GCTGC 3' (SEQ ID No. 17) cont~ins a
HindIII site ~ollowed by 20 nucleotides o~ Ck~-l coding
sequence starting ~rom the initiation codon; the 3' sequence
5' CGCT~T~TC~AGCGTA~L~-l~GA~l~lAl~-lA~-l-l~-l~-l-l~Al~-l~-l-
3' (SEQ ID No. 18) ront~in~ compl~m~nt~ny sequences to an XbaI site, translation stop codon, HA tag and the last 19
nucleotides o~ the Ck~-l coding sequence (not including the
stop codon). There~ore, the PCR product cont~in~ a HindIII
site, Ck~-l coding sequence ~ollowed by an HA tag ~used in
-48-
CA 02220123 1997-11-04
WO 96/34891
- PCT/US9a/09058
frame, a translation termination stop codon next to the HA
tag, and an XbaI site. The PCR amplified DNA ~ragment and
the vector, pcDNAI/Amp, were digested with HindIII and XbaI
restriction enzyme and ligated. The ligation mixture was
transformed into E. coli strain SURE (Stratagene Cloning
Systems, La Jolla, CA) the transformed culture was plated on
ampic~ll;n media plates and resistant colonies were selected.
Plasmid DNA was isolated from transformants and P~m~ nP~ by
restriction analysis for the presence of the correct
fragment. For expression of the re~Qmh~n~nt Ck~-l, COS cells
were transfected with the expression vector by DEAE-DBXTRAN
method (J. Sambrook, E. Fritsch, T. ~n~ ~t~, Molecular
Cloning: A Laboratory ~n~l~ l, Cold Spring Laboratory Press,
(1989)). The expression of the Ck~-1 HA protein was detected
by radiolabelling and ~m~lnoprecipitation method (E. Harlow,
D. Lane, ~nt~hodies: A Laboratory M~nll~l, Cold Spring ~rho~
Laboratory Press, (1988)). Cells were labelled ~or 8 hours
with 35S-cysteine two days post transfection. Culture media
were then collected and cells were lysed with detergent (RIPA
buffer (150 mM NaCl, 1% NP-40, 0.1~ SDS, 1~ NP-40, 0.5% DOC,
50mM Tris, pH 7.5) (Wilson, I. et al., Id. 37:767 (1984)).
Both cell lysate and culture media were precipitated with a
HA speci~ic monoclonal ~n~; hody. Proteins precipitated were
analyzed on 15% SDS-PAGE gels.
Exam~le 7
~xPression Pattern o~ Ck~-8 in human tissue
Northern blot analysis was carried out to P~m~ne the
levels of expression of Ck~-8 in human tissues. Total
cellular RNA samples were isolated with RNAzol~ B system
(Biotecx Laboratories, Inc., Houston, TX 77033). About 10ug
of total RN~ isolated ~rom each human tissue specified is
separated on 1% agarose gel and blotted onto a nylon ~ilter
(Sambrook, Fritsch, and Maniatis, Molecular Cloning, Cold
Spring Harbor Press, (1989)). The labeling reaction is done
-49-
CA 02220123 1997-11-04
W096/34891 PCT~S95109058
according to the Stratagene Prime-It kit with 5Ong DNA
~ragment. The labeled DNA is puri~ied with a Select-G-50
column. (5 Prime - 3 Prime, Inc. Boulder, CO). The ~ilter
is then hybridized with radioactive labeled ~ull length Ck~-8
gene at l,OOO,OOO cpm/ml in 0.5 M NaPO4, pH 7.4 and 7% SDS
overnight at 65 C. A~ter wa~h twice at room temperature and
twice at 60 C with 0.5 x SSC, 0.1% SDS, the ~ilter is then
exposed at -70 C overnight with an intensi~ying screen.
~xample 8
Expression Pattern o~ MIP-4 in human cells
Northern blot analysis wa~ carried out to ~X~mi n~ the
levels o~ expression o~ MIP-4 in human cells. Total cellular
RNA samples were isolated with RNAzol~ B system (Biotecx
Laboratories, Inc., Houston, TX). About lOug o~ total RNA
isolated ~rom each human tissue speci~ied was separated on 1%
agarose gel and blotted onto a nylon ~ilter (Sa"~look,
Fritsch, and M~niatis, Molecular Cloning, Cold Spring ~ho~
Press, (1989)). The labeling reaction was done according to
the Stratagene Prime-It kit with SOng DNA ~ragment. The
labeled DNA wa5 puri~ied with a Select-G-50 column. (5 Prime
- 3 Prime, Inc., Boulder, CO). The ~ilter was then
hybridized with radioactive labeled ~ull length MIP-4 gene at
1,OOO,OOO cpm/ml in O.5 M NaPO4, pH 7.4 and 7% SDS overnight
at 65 C. A~ter wash twice at room temperature and twice at
60 C with 0.5 x SSC, 0.1% SDS~ the ~ilter was then exposed at
-70 C overnight with an intensi~ying screen.
~xam~le 9
Expression Pattern o~ Ck~-l in hum n tissue
Northern blot analysis was carried out to ~mi ne the
levels o~ expression o~ Ck~-l in human tissues. Total
cellular RNA samples were isolated with RNAzol~ B system
(Biotecx ~aboratories, Inc. Houston, TX). About lOug o~
total RNA isolated ~rom each hum.an tissue speci~ied was
-50-
CA 02220l23 l997-ll-04
WO96/34891 PCT~S95/09058
separated on 1~ agarose gel and blotted onto a nylon filter
(Sambrook, Fritsch, and Maniatis, Molecular Cloninq, Cold
Spring ~rhor Press, (1989)). The labeling reaction was done
according to the Stratagene Prime-It kit with 5Ong DNA
fragment. The labeled DNA was purified with a Select-G-50
column. (5 Prime - 3 Prime, Inc., Boulder, CO). The filter
was then hybridized with radioactive labeled full length Ck~-
1 gene at 1,000,000 cpm/ml in 0.5 M NaPO~, pH 7.4 and 7% SDS
overnight at 65 C. After wash twice at room temperature and
twice at 60 C with 0.5 x SSC, 0.1% SDS, the filter was then
exposed at -70 C overnight with an intensifying screen. The
message RNA for Ck~-1 is ablln~nt in spleen.
ExamPle 10
ExPression and Purification of ~hPmnkine Ck~-8 usinq a
baculovirus exPression sYstem.
SF9 cells were infected with a recomhin~nt baculovirus
designed to express the Ck~-8 cDNA. Cells were infected at
an MOI of 2 and cultured at 28~C for 72-96 hours. Cellular
debris from the infected culture was removed by low speed
centri~ugation. Protease inh; hi tor cocktail was added to the
supernatant at a final concentration of 20 ~g/ml Pefabloc SC,
1 ~g/ml leupeptin, 1 ~g/ml E-64 and 1 mM EDTA. The level of
Ck~-8 in the supernatant was monitored by loading 20-30 ~l of
supernatant only 15% SDS-PAGE gels. Ck~-8 was detected as a
visible 9 Kd band, corresponding to an expression level of
several mg per liter. Ck~-8 was further purified thlo~h a
three-step purification procedure: Heparin ht n~ing affinity
chromatography. Supernatant of baculovirus culture was mixed
with 1/3 volume of buffer cont~ining 100 mM HEPES/MES/NaOAc
pH 6 and filtered through 0.22 ~m membrane. The sample was
then applied to a heparin binding column (HE1 poros 20, Bio-
Perceptive System Inc.). Ck~-08 was eluted at ~Lu~imately
300 mM NaCl in a lin~ gradient of 50 to 500 mM NaCl in 50
mM B PES/MES/NaOAc at pH 6; Cation ~ch~nge chromatography.
-51-
CA 02220l23 l997-ll-04
WO96/34891 PCT/US95/09058
The Ck~8 enriched _rom heparin chromatography was subjected
to a 5-_old dilution with a buffer contAin~ng 50 MM
HEPBS/MES/NaOAc pH 6. The resultant mixture was then applied
to a cation ~chAnge column (S/M poros 20, Bio-Perceptive
System Inc.). Ck~-8 was eluted at 250 mM NaCl in a ltne
gradient o~ 25 to 300 mM NaCl in 50 mM HEPES/MES/NaOAc at pH
6; Size exclusion chromatography. Following the cation
exchange chromatography, Ck~-8 was ~urther puri~ied by
applying to a size exclusion column (HM50, TOSO HAAS, 1.4 x
45 cm). Ck~-8 ~ractionated at a position close to a 13.7Kd
molecular weight stAn~A~d (RNase A), corresp~n~ing to the
dimeric ~orm o~ the protein.
Following the three-step puri~ication described above,
the resultant Ck~-8 was judged to be greater th~n 90~ pure as
determined ~rom comm~Rsie blue stAinin~ o~ an SDS-PAGE gel
(Figure 9).
The puri~ied Ck~-8 was also tested ~or endotoxin/LPS
contAm~nAtion. The LPS content was less thAn 0.1 ng/ml
according to LAL assays (BioWhittaker).
~xamPle 11
E~ect o~ baculovirus-exPressed Ck~-1 and Ck~-8 on M-CSF and
SCF-stimulated colony formation o~ ~reshlY isolated bone
marrow cells.
A low density population o~ mouse bone marrow cells were
incubated in a treated tissue culture dish ~or one hour at
37~C to remove monocytes, macrophages, and other cells that
adhere to the plastic sur~ace. The non-adherent population
o~ cells were then plated (10,000 cells/dish) in agar
cont~; ni ng growth medium ln the presence or absence o~ the
factors shown in Figure 16. Cultures were inrll~Ated for 10
days at 37~C (88~ N2, 5~ CO2, and 7~ ~2) and colonies were
scored under an inverted microscope. Data is expressed as
mean number of colonies and was obtAine~ _rom assays
performed in triplicate.
CA 02220l23 l997-ll-04
WO 96/34891 PCT/US9~/090~8
~xam~le 12
Effect of CkB-8 and CkB-1 on IL-3 and SCF stimulated
proliferation and differentiation of lin-PoPulation of bone
marrow cells.
A population of mouse bone marrow cells enriched in
primitive hematopoietic ~loye~Litors was obt~; n~ using a
negative selection procedure, where the committed cells of
most of the lineages were removed using a panel of monoclonal
antibodies (anti cdllb, CD4, CD8, CD45R, and Gr-1 antigens)
and magnetic beads. The resulting population of cells (Lin~
cells) were plated (5 x 10~ cells/ml) in the presence or
absence of the indicated rh~m~k~n~ (50 ng/ml) in a growth
medium supplemented with IL-3 (5 ng/ml) plus SCF ~100 ng/ml).
After seven days of incubation at 37~C in a humidified
incubator (5% CO2, 7% ~2~ and 88~ N2 environm~nt), cells were
harvested and assayed for the HPP-CFC, and immature
progenitors. In addition, cells were analyzed for the
expression of certain differentiation antigens by FACScan.
Colony data are expressed as mean num.ber of colonies +/- SD)
and were obt~ne~ from assays performed in six ~; ~h~ for
each population of cells (Figure 17).
FxamDle 13
Ck~-8 inhibits colonv ~ormation in response to IL-3, M-CSF,
and GM-CSF.
Mouse bone marrow cells were ~lushed from both the femur
and tibia, separated on a ficol density gradient and
monocytes removed by plastic adherence. The resulting
population of cells were incubated overnight in an MEM-based
medium supplemented with IL-3 (5 ng/ml), GM-CSF ~5 ng/ml), M-
CSF ~10 ng/ml) and G-CSF ~10 ng/ml). These cells were plated
at 1,000 cells/dish in agar-based colony ~ormation assays in
the presence o~ IL-3 (5ng/ml), GM-CSF (5 ng/ml) or M-CSF ~5
ng/ml) with or without Ck~-8 at 50 ng/ml. The data is
presented as colony formation as a percentage of the number
-53-
CA 02220l23 lss7-ll-04
WO96/34891 PCT~S95/09058
o~ colonies ~ormed with the speci~ic $actor alone. Two
experi m~nt ,c are shown with the data depicted as the average
o~ duplicate ~ish~s with error bars indicating the st~n~rd
deviation ~or each experiment (Figure 19).
~xamDle 14
ExPression via Gene Therapy
Fibroblasts are obt~ne~ ~rom a subject by skin biopsy.
The resulting tissue is placed in tissue-culture medium and
separated into small pieces. Small rhllnkc o~ the tissue are
placed on a wet sur~ace of a tissue culture ~lask,
approximately ten pieces are pl~ce~ in each ~lask. The ~lask
is turned upside down, closed tight and le~t at room
temperature over night. A~ter 24 hours at room temperature,
the ~lask is inverted and the chunks o~ tissue remain ~ixed
to the bottom o$ the ~lask and ~rech media (e.g., Ham's F12
media, with 10% FBS, penir-illin and streptomycin, is added.
This is then incubated at 37~C ~or a~lu~imately one week.
At this time, ~resh media is added and subsequently changed
every several days. A~ter an addition~l two weeks in
culture, a ~onol~yer o~ ~ibroblasts ~ . The monolayer is
trypsinized and scaled into larger ~lasks.
pMV-7 (Kirschmeier, P.T. et al, DNA, 7:219-25 (1988)
~lanked by the long terminal repeats o~ the Moloney murine
sarcoma virus, is digested with EcoRI and HindIII and
subsequently treated with cal~ intestinal phosphatace~ The
1 i n~r vector is ~ractionated on agarose gel and puri~ied,
using glass beads.
The cDNA encoding a polypeptide o~ the present inv~ntion
is ampli~ied using PCR primers which correspond to the 5' and
3' end sequences respectively. The 5' primer ront~i ni ng an
BcoRI site and the 3' primer having contains a HindIII site.
Equal quantities o~ the Moloney murine sarcoma virus l~ne~r
backbone and the EcoRI and HimdIII ~ragment are added
together, in the presence o~ T4 DNA ligase. The resulting
mixture is maint~ine~ under conditions a~y~u~riate ~or
CA 02220l23 Iss7-ll-04
WO96t34891 PCT/US9~/09058
ligation of the two fragments. The ligation mixture is used
to transform bacteria ~3101, which are then plated onto agar-
contAining kanamycin ~or the purpose of confirming that the
vector had the gene of interest properly inserted.
The amphotropic pA317 or GP+aml2 packaging cells are
grown in tissue culture to confluent density in Dulbecco's
Modified Fagles Medium (DM~M) with 10~ calf serum (CS),
penicillin and streptomycin. The MSV vector contAi ni ng the
gene is then added to the media and the packaging cells are
transduced with the vector. The packaging cells now produce
infectious viral particles rnntAining the gene (the packaging
cells are now referred to as producer cells).
Fresh media is added to the transduced producer cells,
and subsequently, the media is harvested from a 10 cm plate
of con~luent proAllrP~ cells. The spent media, rontAining the
infectious viral particles, is filtered through a millipore
~ilter to remove detA rh~ producer cells and this media is
then used to infect fibroblast cells. Media is removed from
a sub-confluent plate of fibroblasts and quickly replaced
with the media from the producer cells. This media is
removed and replaced with fresh media. If the titer of virus
is high, then virtually all fibroblasts will be in$ected and
no selection is required. I$ the titer is very low, then it
is necessary to use a retroviral vector that has a selectable
marker, such as neo or his.
The engineered fibroblasts are then injected into the
host, either alone or after having been grown to confluence
on cytodex 3 microcarrier beads. The fibroblasts now produce
the protein product.
Numerous modifications and variations o~ the present
invention are possible in light o~ the above t~rhings and,
therefore, within the scope o~ the appended rl~i m~, the
invention may be practiced otherwise than as particularly
described.
.' CA 02220l23 lsg7-ll-04
WO96/34891 PCT~S9~/09058
S~Qu_N~ LISTING
(1) ~RNRT~L INFORMATION:
(i) APPLICANT: LI, ET AL.
(ii) TITLE OF lNv~NLlON: Human ~hPm~kine Beta-8,
Che~okine Beta-1 and
Macrophage In~lammatory
Protein-4
(iii) NUMBER OF SEQUEN OES: 18
( iV) CoRRR~spoN~N~_ ADDRESS:
(A) AnnRR.~.SRR~ ~RRT-T-~, BYRNE, BAIN, GILFILLAN,
OE CCHI, STEWART & OLSTEIN
(B) STREET: 6 BECKER FARM ROAD
(C) CITY: ROSELAND
(D) STATE: NEW J~RSBY
(B) ~UNl~Y: USA
(F) ZIP: 07068
(V) CO~UL~K REAn~RT~R FORM:
(A) MEDIUM TYPE: 3.5 INCH DI~K~-l-
(B) COh~ U l'~: IBM PS/2
(C) OPERATING SYSTEM: MS-DOS
(D) SOFTWARE: WORD PERFECT 5.1
(vi) ~uKKK~l APPLICATION DATA:
~A) APPLICATION NUMBER:
(B) FILING DATE:
(C) CLASSIFICATION:
(vii) PRIOR APPLICATION DATA:
(A) APPLICATION NUMBER: 08~173,209
(B) FILING DATE: 22 DEC 93
(viii) PRIOR APPLICATION DATA:
(A) APPLICATION h~UMBER: 08/208,339
(B) FILING DATE: 08 MAR 94
(ix) PRIOR APPLICATION DATA:
(A) APPLICATION NUMBER: PCT/US94/07256
(B) FILING DATE: 28 JUNE 1994
(ix) Al-lO~N~/AGENT INFORMATION:
(A) NAME: FERRARO, GREGORY D.
(B) REGISTRATION NUMBER: 36,134
(C) REFEREN OE ~DOCKET NUMBER: 325800-289
(x) TELECOMMUNICATION INFORMATION:
(A) TELEPHONE: 201-994-1700
(B) TELEFAX: 201-994-1744
-56-
CA 02220123 1997-11-04
W O96/34891 PCT~US9a/09058
~2) INFORMATION FOR SEQ ID NO:1:
(i) SEQu KN~ CHARACTERISTICS
(A) LENGTH: 363 BASE PAIRS
(B) TYPE: NUCLEIC ACID
(C) STR~N~ lKI ~..K.~S: SINGLB
(D) TOPOLOGY: LINEAR
(ii) MOLECULE TYPE: cDNA
(xi) SE~u~ DESCRIPTION: SBQ ID NO:l:
ATGAAGGTCT CCGTGGCTGC C~-1~L~1GC CTCATGCTTG TTA~ C~l TGGATCCCAG 60
GCCCGG~l~A CAAAAGATGC AC~r~r-~G TTCATGATGT CAAAGCTTCC ATTGGAAAAT lZ0
CCAGTACTTC TGGACAGATT CCATGCTACT A~~ ~ACT GCTGCATCTC CTACACCCCA 180
CGAAGCATCC ~l~ll~ACT CCTGGAGAGT TACTTTGAAA CGAACAGCGA GTGCTCCAAG 240
C~1~A l~-l-l~L-l~AC CAAoAAGGGG CGA~Il-l~-l GTGCr~rCC CAGTGATAAG 300
CAAGTTCAGG TTTGCATGAG AATGCTGAAG CTGGACACAC GGATCAAGAC CA33AAGAAT 360
TGA 363
(2) INFORMATION FOR SBQ ID NO:2:
(i) SEQu~ CHARACTERISTICS
(A) LENGTH: 120 AMINO ACIDS
(B) TYPE: AMINO ACID
(C) ST~ J.~ ~S:
(D) TOPOLOGY: LINEAR
~ii) MOLECULE TYPE: PROTEIN
(xi) SE~u~N~ DESCRIPTION: SEQ ID NO:2:
Met Lys Val Ser Val Ala Ala Leu Ser Cys Leu Met Lys Val Thr
-20 -15 -10
Ala Leu Gly Ser Gln Ala Arg Val Thr Lys Asp Ala Glu Thr Glu
-5 1 5
Phe Met Met Ser Lys Leu Pro Leu Glu Asn Pro Val Leu Leu Asp
Arg Phe His Ala Thr Ser Ala Asp Cys Cys Ile Ser Tyr Thr Pro
Arg Ser Ile Pro Cys Ser Leu Leu Glu Ser Tyr Phe Glu Thr Asn
Ser Glu Cys Ser Lys Pro Gly Val Ile Phe Leu Thr Lys Lys Gly
Arg Arg Phe Cys Ala Asn Pro Ser Asp Lys Gln Val Gln Val Cys
Met Arg Met Leu Lys Leu Asp Thr Arg Ile Lys Thr Arg Lys Asn
85 90 95
(2) INFORMATION FOR SEQ ID NO:3:
(i) SEQUEN OE CH~RACTERISTICS
(A) LENGTH: 282 BASE PAIRS
-57-
CA 02220123 1997-11-04
WO96/34891 PCT~S95/09OS8
(B) TYPE: NUCLEIC ACID
(C) STR~N~K~NK-S~: SINGLE
(D) TOPOLOGY: TT ~ DT~
(ii) MOLBCULE TYPE: cDNA
(Xl) SEQu~L_ DESCRIPTION: SEQ ID NO:3:
ATGAAGATCT CCGTGGCTGC AAl-~CC~-l-lC l-l~-l~-l~A TCACCATCGC CCTAGGGACC 60
AAGACTGAAT C~-l~l~ACG GGr~rCTTAC CACCC~-L~AG AGTGCTGCTT CACCTACACT 120
ACCTACAAGA TCCCGCGTCA GCGGATTATG GATTACTATG AEACCAACAG CCAGTGCTCC 180
AAGCCCGGAA l-l~l~-l-l~AT CACCAAAAGG GGCCATTCCG TCTGTACCAA CCCCAGTGAC 240
A~l~G~'~C ~rG~rT~TAT CAAGGACATG A~G ~r~rT GA 282
(2) lN~O~MATION FOR SEQ ID NO:4:
(i) ~_QU~N~ CHARACTERISTICS
(A) LENGTH: 93 AMINO ACIDS
(B) TYPE: AMINO ACID
(C) ST~2~Nl)Kl)NKss
(D) TOPOLOGY: LINEAR
(ii) MOLECULE TYPE: PROTEIN
(xi) SE~u~N~ DESCRIPTION: S8Q ID NO:4:
Met Lys Ile Ser Val Ala Ala Ile Pro Phe Phe Leu Leu Ile Thr
-15 -10 -5
Ile Ala Leu Gly Thr Lys Thr Glu Ser Ser Ser Arg Gly Pro Tyr
1 5 10
His Pro Ser Glu Cys Cys Phe Thr Tyr Thr Thr Tyr Lys Ile Pro
Arg Gln Arg Ile Met Asp Tyr Tyr Glu Thr Asn Ser Gln Cys Ser
Lys Pro Gly Ile Val Phe Ile Thr Lys Arg Gly His Ser Val Cys
Thr Asn Pro Ser Asp Lys Trp Val Gln Asp Tyr Ile Lys Asp Met
60 65 70
Lys Glu Asn
(3) INFORMATION FOR SEQ ID NO:5:
(i) SE~u~N~_ CHARACTERISTICS
(A) LENGTH: 270 BASE PAIRS
(B) TYPE: NUCLEIC ACID
(C) STR~ )KI )~Kcs: SINGLE
(D) TOPOLOGY: TT ~ P~R
(ii) MOLECULE TYPE: cDNA
(xi) SEQ~ DESCRIPTION: SEQ ID NO:5:
ATGAAGGGCC TTGCAGCTGC C--l~---l~lC ~-lC~l~lGCA CCATGGCCCT ~-~-l~-l~l 60
-58-
CA 02220l23 l997-ll-04
W O96/34891 PCTAU$95/09058
GCACAAGTTG GTACCAACAA AGAGCTCTGC TGcL-lLL~ ATA~L-l~L-L~ GCAGATTCCA 120
CAAAAGTTCA TAGTTGACTA TTCTGAAACC AGCCCCCAGT GCC~A5CC AG~lL-~LATC 180
CTCCTAACCA AGAGAGGCCG GCAGATCTGT GCTC~GCCr~ ATAAGAAGTG GGTCr~A~ 240
TACATCA~CG ACCTGAAGCT GAATGCCTGA 270
(4) INFORMATION FOR SEQ ID NO:6:
(i) SBQu~N~ CHARACTBRISTICS
(A) LENGTH: 89 AMINO ACIDS
~B) TYPE: AMINO ACID
(C) STRP~v_vN~SS:
(D) TOPOLOGY: T.TNRA~!
(ii) MOLECULB TYPE: PRCTBIN
(xi) SEQu~N~ DESCRIPTION: SEQ ID NO:6:
Met Lys Gly Leu Ala Ala Ala Leu Leu Val Leu Val Cy8 Thr Met
-20 -15 -10
Ala Leu Cys Ser Cys Ala Gln Val Gly Thr Asn Lys Glu Leu Cys
-5 1 5 10
Cys Leu Val Tyr Thr Ser Trp Gln Ile Pro Gln Lys Phe Ile Val
25~sp Tyr Ser Glu Thr Ser Pro Gln Cys Pro Lys Pro Gly Val Ile
Leu Leu Thr Lys Arg Gly Arg Gln Ile Cys Ala Asp Pro Asn Lys
45 50 55
Lys Trp Val Gln Lys Tyr Ile Ser Asp Leu Lys Leu Asn Ala
60 65
(2) lN~O~IATION FOR SEQ ID NO:7:
(i) SBQu_N~_ CHARACT~RISTICS
(A) LENGTH: 26 BASE PAIRS
(B) TYPE: NUCLEIC ACID
( C ) Sl~ N I ~ K I J~l K~ : SINGLE
(D) TOPOLOGY: LINBAR
(ii) MOLECULB TYPE: Oliyonucleotide
(xi) SEQu~N~ DESCRIPTION: SBQ ID NO:7:
TCAGGATCCG Tr~rAA~AGA TGCAGA 26
(2) INFORMATION FOR SEQ ID NO:8:
(i) SEQu~_ CHARACTERISTICS
(A) LENGTH: 26 BASE PAIRS
(B) TYPE: NUCLEIC ACID
(C) STRANv~vN_SS: SINGLB
(D) TOPOLOGY: LINEAR
-59-
-
CA 02220123 1997-11-04
WO96/34891 PCT~S95/09058
(ii) MOLECULE TYPE: Oliyonucleotide
(xi) SEQUEN OE DESCRIPTION: SEQ ID NO:8:
CGCTCTAGAG TAAAA~r~r7 GCCAGT 26
(2) INFORMATION FOR SEQ ID NO:9:
(i) SEQUEN OE CHARACTERISTICS
~A) LENGTH: 27 BASE PAIRS
~B) TYPE: NUCLEIC ACID
~C) STRPNl)Kl)hK-~S: SINGLE
~D) TOPOLOGY: LINBAR
(ii) MOLECULE TYPE: Oligonucleotide
~xi) SEQUEN OE DESCRIPTION: SEQ ID NO:9:
TCAGGATCCT GTGCACAAGT TGGTACC 27
~2) INFORMATION FOR SEQ ID NO:l0:
~i) SEQUEN OE CHARACTERISTICS
(A) LENGTH: 26 BASE PAIRS
(B) TYPE: NUCLEIC ACID
(C) ST~AN~K~ KCS: SINGLB
tD) TOPOLOGY: LINEAR
(ii) MOLECULE TYPE: Oliyonucleotide
(xi) SEQUBN OE DESCRIPTION: SEQ ID NO:l0:
CGCTCTAGAG TAAAACGACG GCCAGT 26
(2) INFORMATION FOR SEQ ID NO:ll:
(i) SEQUEN OE CHARACTERISTICS
(A) LENGTH: 30 BASE PAIRS
(B) TYPE: NUCLEIC ACID
(C) STRANv~vN~SS: SINGLE
(D) TOPOLOGY: T.TNR~T~
(ii) MOLECULE TYPE: Oligonucleotide
(xi) SEQUEN OE DESCRIPTION: SEQ ID NO:ll:
GCCCGCGGAT CCTCCTCACG GGGACCTTAC 30
-60-
CA 02220l23 l997-ll-04
WO96/34891
PCT~S95/09058
(2) INFORMATION FOR SBQ ID NO:12:
(i) SEQu_N~ CHARACThRISTICS
(A) LENGTH: 32 BASE PAIRS
(B) TYPE: NUCLEIC ACID
(C) STRAN~)K~NK~S: SINGLE
(D) TOPOLOGY: T.TNRAR
(ii) MOLECULE TYPE: Oligonucleotide
(xi) SEQu_N~ DESCRIPTION: SBQ ID NO:12:
GCCTGCTCTA GATCAAAGCA GGGAAGCTCC AG 32
(2) INFORMATION FOR SEQ ID NO:13:
(i) SE~u_N~ CHARACTERISTICS
(A) LBNGTH: 27 BASE PAIRS
(B) TYPE: NU T-RIC ACID
(C) STRAh~K~NK~S: SINGLE
(D) TOPOLOGY: LINEAR
(ii) MOLBCULE TYPE: Oligonucleotide
(xi) SEQuh~ DESCRIPTION: SEQ ID NO:13:
GGAAAGCTTA TGAA~~ -C CGTGGCT 27
~2) INFORMATION FOR SEQ ID NO:14:
(i) SEQu~_ CHARACTERISTICS
(A) LBNGTH: 59 BASE PAIRS
(E) TYPE: NUCLEIC ACID
(C) STR~N~N~SS: SINGLE
(D) TOPOLOGY: LINEAR
(ii) MOLECULE TYPE: Oligonucleotide
(xi) SEQu~N~_ DESCRIPTION: SEQ ID NO:14:
CGCTCTAGAT r r-CGTAGT CTGGGACGTC GTATGGGTA~ lC~-l~G TCTTGATCC 59
(2) lN~O~IATION FOR SEQ ID NO:15:
(i) SEQulsNc~ CHARACTERISTICS
(A) LENGTH: 30 BASE PAIRS
(B) TYPE: NUCLEIC ACID
(C) STRANDBDNESS: SINGLE
(D) TOPOLOGY: LINEAR
-61-
CA 02220l23 lss7-ll-04
WO96/348sl PCT~S95/09OS8
~ii) MOLECULE TYPE: Oligonucleotide
(xi) SBQu~ DBSCRIPTION: SEQ ID NO:15:
GGAAAGCTTA TGAAGGGCCT TGCAGCTGCC 30
(2) INFORMATION FOR SEQ ID NO:16:
(i) SE~u~ CHARACTERISTICS
(A) LENGTH: 57 BASE PAIRS
(B) TYPE: NU T~T~IC ACID
(C) STR~NI )~ N~:.C.C:: SINGLE
(D) TOPOLOGY: T.TNRAT~
(ii) MOLECULE TYPE: Oligonucleotide
(xi) SEQu~ DESCRIPTION: SEQ ID NO:16:
CGCTCTAGAT CAABCGTAGT ~-L~ACGTC GTAl~lAG GCATTCAGCT TCAGGTC
57
(2) lN~O~-IATION FOR SEQ ID NO:17:
(i) SEQUEN OE CHARAC-l~RISTICS
(A) LENGTH: 28 BASE PAIRS
(B) TYPE: NUCLEIC ACID
(C) ST}2Z~NI)~ SSS: SINGLE
(D) TOPOLOGY: T.TN~A~
(ii) MOLECULE TYPE: Oligonucleotide
(xi) SE~u~ DESCRIPTION: SEQ ID NO:17:
GGAAAGCTTA TGAAGATTCC GTGGCTGC 28
(2) INFORMATION FOR SEQ ID NO:18:
(i) SEQu~N~ CHARACTERISTICS
tA) LENGTH: 58 BASE PAIRS
(B) TYPE: NUCLEIC ACID
(C) STRAN~N~SS: SINGLE
(D) TOPOLOGY: LINEAR
(ii) MOLECULE TYPE: Oligonucleotide
(xi) SB~u~N~ DESCRIPTION: SEQ ID NO:18:
CGCTCTAGAT CAAGCGTAGT CTGGGACGTC GTATGGGTAG ~-~ ~-L~:~ -J.-l~:.A '~1~;~-1 lG 58
-62-
