Note : Les descriptions sont présentées dans la langue officielle dans laquelle elles ont été soumises.
CA 02222823 1997-12-22
COMPOSITIONS OF SLAP-130, A SLP-76 ASSOCIATED PROTEIN,
AND METHODS OF USE THEREFOR
5 Back~round of the Invention
Engagement of the T cell antigen receptor (TCR) results in the activation of protein
tyrosine kinases (PTK) and the subsequent tyrosine phosphorylation of numerous proteins
(Howe, L.R. and Weiss, A. (1995) Trends Biochem. Sci. 20:59-64; see also Perlmutter, R.M.
et al. (1993) ,4nnu. Rev. Immunol. 11:451-499; and Chan, A.C. et al. (1994) Annu. Rev.
Immunol. 12:555 592). Efforts to characterize substrates ofthe TCR induced PTK activity
led to the cloning of a 76 kDa protein termed SLP-76 (for SH2-domain-containing Leukocyte
Protein of 76 kDa). SLP-76 was originally identified based upon its ability to interact with
the protein Grb2, an adaptor molecule involved in coupling signal transduction pathways
(Motto, D. et al. (1994) J. Biol. Chem. 269:21608-21613; Reif, K. et al. (1994) J. Biol. Chem.
269:14081-14087; Buday, L. etal. (1994)J Biol. Chem. 269:9019-9023; and Sieh, M. etal.
(1994) Mol. Cell. Biol. 14:4435 4442).
Molecular cloning of SLP-76 cDNAs (human and mouse) revealed that the SLP-76
protein comprises an acidic amino-terminal region, a proline-rich central region and a
carboxy-terminal SH2 domain (Jackman J.K. et al. (1995) J. Biol. Chem. 270:7029-7032).
Northern analysis demonstrated that SLP-76 mRNA is expressed exclusively in peripheral
blood leukocytes, spleen and thymus (Jackman, J.K et al. (1995) supra). Insight into the
function of SLP-76 in T cells came from experiments showing that overexpression of SLP-76
augments TCR-mediated signals that lead to the induction of IL-2 gene promoter activity
(Motto, D.G. et al. (1996) J. Exp. Med. 183:1937-1943; Wu, J. et al. (1996) Immunity _:593-
602). Interestingly, three distinct regions of SLP-76 that are responsible for protein-protein
interactions in T cells are required for the augmentation of IL-2 promoter activity by
overexpression of SLP-76 (Fang, N. et al. (1996) J. Immunol M 57:3769-3773; Wardenburg,
J.B. et al. (1996) J. Biol. Chem. 271 :19641-19644). These data suggest that SLP-76
functions as a link between proteins that regulate signals generated by TCR ligation.
Certain SLP-76-associated proteins that participate with SLP-76 in transducing
signals from the TCR to the nucleus have been identified. Examples include the
protooncogene Vav, which associates with the amino-terminal acidic region of SLP-76 in a
phosphotyrosine dependent manner (Wu, J. et al. (1996) Immunity _:593-602; Onodera, H. et
al. (1996) J. Biol. Chem. 271:22225-22230; Tuosto, L. et al. (1996) J. Exp. Med. 184:1161-
1167). Identification and characterization of other proteins capable of interacting with SLP-
76 will be important for understanding the role of SLP-76 in T cell activation and,
accordingly, for designing approaches to modulate this process.
CA 02222823 1997-12-22
Summary of the Invention
Nucleic acid molecules encoding a novel protein, termed SLAP-130, that interactswith the leukocyte protein SLP-76, have now been isolated and characterized. The nucleotide
sequence of a SLAP-130 cDNA, and predicted amino acid sequence of SLAP-130 protein,
are shown in Figure 1 (and in SEQ ID NOs: 1 and 2, respectively). SLAP-130 is
predomin~ntly expressed in hematopoietic cells, is a substrate for the TCR-stimulated protein
tyrosine kinases and was identified based upon its ability to interact with the src homology 2
(SH2) domain of SLP-76. Overexpression of SLAP-130 (limini~hes TCR induced activation
of a promoter containing three NFAT sites in a T cell line and blocks the augmentation of
10 activity of this promoter that is seen when SLP-76 is overexpressed in these T cells,
indicating that SLAP-130 can function as a negative regulator of signals that activate IL-2
gene transcription. This invention pertains to isolated compositions of SLAP-130 protein and
isolated nucleic acid sequences encoding SLAP-130, other compositions related thereto and
methods of use thereof.
One aspect of the invention pertains to isolated nucleic acid molecules encodingSLAP-130, or fragments thereof. In one embodiment, the invention provides an isolated
nucleic acid molecule comprising a nucleotide sequence encoding SLAP-130 protein. In
another embodiment, the invention provides an isolated nucleic acid molecule comprising a
nucleotide sequence encoding a protein, wherein the protein (i) comprises an amino acid
20 sequence at least 60 % homologous (more preferably 70%, 80%, 90% or 95% homologous)
to the amino acid sequence of SEQ ID NO: 2 and (ii) associates with the SH2 domain of
SLP-76 or modulates T cell receptor mediated sign~ling. In yet another embodiment, the
invention provides an isolated nucleic acid molecule which hybridizes under stringent
conditions to a nucleic acid molecule comprising the nucleotide sequence of SEQ ID NO: 1.
25 In yet another embodiment, the invention provides an isolated nucleic acid molecule
comprising the nucleotide sequence of SEQ ID NO: 1 or encoding the amino acid sequence
of SEQ ID NO: 2. Isolated nucleic acid molecules encoding SLAP-130 fusion proteins and
isolated antisense nucleic acid molecules are also encompassed by the invention.Another aspect of the invention pertains to vectors, such as recombinant expression
30 vectors, containing an nucleic acid molecule of the invention and host cells into which such
vectors have been introduced. In one embodiment, such a host cell is used to produce SLAP-
130 protein by culturing the host cell in a suitable medium. If desired, SLAP-1 ~0 protein can
be then isolated from the host cell or the medium.
Still another aspect of the invention pertains to isolated SLAP-130 proteins, or35 portions thereof. In one embodiment, the invention provides an isolated SLAP-130 protein,
or a portion thereof that interacts with SLP-76. In another embodiment, the invention
provides an isolated protein that comprises an amino acid sequence homologous to the amino
acid sequence of SEQ ID NO: 2 and associates with the SH2 domain of SLP-76 or modulates
T cell receptor mediated sign~ling In still other embodiments, the invention provides an
CA 02222823 1997-12-22
isolated protein comprising the amino acid sequence of SEQ ID NO: 2. SLAP-130 fusion
proteins are also encompassed by the invention.
The SLAP-130 proteins of the invention, or fragments thereof, can be used to prepare
anti-SLAP-130 antibodies. Accordingly, the invention further provides an antibody that
specifically binds SLAP-130 protein. In one embodiment, antibodies ofthe invention are
polyclonal antibodies. In another embodiment, antibodies of the invention are monoclonal
antibodies. In yet another embodiment, the antibodies are labeled with a detectable
substance.
The SLAP-130-encoding nucleic acid molecules of the invention can be used to
10 prepare nonhuman transgenic ~nim~l~ which contain cells carrying a transgene encoding
SLAP-130 protein or a portion of SLAP-130 protein. Accordingly, such transgenic ~nim~l~
are also provided by the invention. In one embodiment, a SLAP-130 transgene is integrated
randomly into the genome of an animal. Alternatively, the SLAP-130-encoding nucleic acid
molecules of the invention also can be used to make homologous recombinant ~nim~l~ (e.g,
15 "knockout ~nimzll~"), in which a SLAP-130 transgene (or portion thereof) is integrated at a
specific location within the genome of the animal by homologous recombination (e.g., to
alter or disurpt an endogenous gene encoding endogenous SLAP-130 protein).
Another aspect of the invention pertains to methods for detecting the presence of
SLAP-130 activity in a biological sample. To detect SLAP-130 activity, the biological
20 sample is contacted with an agent capable of detecting SLAP-130 activity, such as SLAP- 130
protein (such as a labeled anti-SLAP-130 antibody) or SLAP-130 mRNA (such as a labeled
nucleic acid probe capable of hybridizing to SLAP-130 mRNA) such that the presence of
SLAP-130 activity is detected in the biological sample.
Still another aspect of the invention pertains to methods for modulating SLAP-130
25 activity in a cell. To modulate SLAP-130 activity in a cell, the cell is contacted with an agent
that modulates SLAP-130 activity such that SLAP-130 activity in the cell is modulated. In
one embodiment, the agent inhibits SLAP-130 activity. In another embodiment, the agent
stimulates SLAP-130 activity. In one embodiment, the agent modulates the activity of
SLAP-130 protein (e.g., the agent can be an antibody that specifically binds to SLAP-130
30 protein). In another embodiment, the agent modulates transcription of a SLAP-130 gene or
translation of a SLAP-130 mRNA (e.g, the agent can be a nucleic acid molecule having a
nucleotide sequence that is antisense to the coding strand of the SLAP- 130 mRNA or the
SLAP-130 gene).
Still another aspect of the invention pertains to methods for identifying agents that
35 modulate an interaction between SLAP-130 and SLP-76. In these methods, SLAP-130 (or a
SLP-76-interacting portion thereof) is combined with SLP-76 (or a SLAP-130-interacting
portion thereof, such as the SLP-76 SH2 domain) in the presence and absence of a test
compound. The degree of interaction between SLAP-130 and SLP-76 is determined in the
presence and absence of the test compound. A modulatory agent is identified based upon the
CA 02222823 1997-12-22
-4-
ability of the test compound to increase or decrease (e.g., stimulate or inhibit) the degree of
interaction between SLAP-130 and SLP-76 (as compared to the degree of interaction in the
absence of the test compound).
S Brief Description of the Drawings
Figure 1 shows the cDNA sequence and deduced amino acid sequence of human
SLAP-130 (SEQ ID NOs: 1 and 2, respectively). The coding region corresponds to
nucleotides 31-2379. The region encompassing a peptide having the amino acid sequence
PPNVDLTK (SEQ ID NO: 4)iS indicated by an underline.
Figure 2 is a photograph of a Northern blot analysis of polyA+ RNA from the
indicated tissues hybridized to a SLAP-130 nucleic acid probe, demonstrating expression of
SLAP-130 mRNA in the lymphoid co~llpalllllent.
Figure 3A is a photograph of an immunoprecipitation/Western blot experiment
demonstrating the Jurkat T cells transiently transfected with pEF/SLAP-130 (encoding a
FLAG epitope-tagged SLAP-130 fusion protein) express a 130 kDa protein reactive with
anti-FLAG antibody.
Figure 3B a photograph of an immunoprecipitation/Western blot experiment
demonstrating the Jurkat T cells transfected with pEF/SLAP-130 (encoding a FLAG epitope-
tagged SLAP-130 fusion protein) and stimulated with pervanadate express a 130 kDa protein
that can be immunoprecipitated by the SLP-76 SH2 domain.
Figure 4 is a photograph of an immunoprecipitation/Western blot experiment
demonstrating that SLAP-130 and SLP-76 associate in Jurkat T cells. Lysates from Jurkat
cells were subjected to immunoprecipitation with anti-SLP-76 antiserum and then
immunoblotted with both anti-SLP-76 and anti-SLAP-13 antiserum.
Figure SA is a bar graph depicting the luciferase reporter gene activity in Jurkat T
cells cotransfected with an NFAT luciferase reporter construct and either pEF (control
vector), pEF/SLP-76 (a SLP-76 expression vector), pEF/SLAP-130 (a SLAP-130 expression
vector) or both pEF/SLP-76 and pEF/SLAP-130, demonstrating that overexpression of
SLAP-130 ~limini~hes transcriptional activation through the NFAT response element.
Figure SB is a photograph of an immunoblot experiment depicting the expression of
FLAG epitope-tagged constructs in the transfected Jurkat cells of Figure SA.
Immunoblotting was performed with anti-FLAG antibodies.
Detailed Description of the Invention
This invention pertains to compositions related to the SLP-76 associated proteinSLAP-130, and methods of use thereof. A cDNA encoding SLAP-130 was isolated based on
the ability of the SLAP-130 protein to interact with the SH2 domain of SLP-76 (see Example
1). Analysis ofthe tissue distribution of SLAP-130 revealed that SLAP-130 mRNA is
expressed in peripheral blood Iymphocytes, thymus and spleen but not in a variety of non-
CA 02222823 1997-12-22
lymphoid tissues (see Example 2). SLAP-130 protein has been expressed recombinantly in
m~mm~ n cells as a fusion protein with an epitope tag, and this fusion protein can be
precipitated by the SH2 domain of SLP-76 (see Example 3). Native SLAP-130 associates
with SLP-76 in vivo, as demonstrated by coimmunoprecipitation of SLAP-130 and SLP-76
with either anti-SLAP-130 antiserum or anti-SLP-76 antiserum (see Example 4).
Overexpression of SLAP-130 in a T cell line inhibits TCR-induced activation of a promoter
containing Nuclear Factor of Activated T cell (NFAT) binding sites and, furthermore, blocks
the augmentation of NFAT-cont~ining promoter activity that is seen when SLP-76 is
overexpressed in these cells, indicating that at least under certain conditions SLAP-130 can
10 function as a negative regulator of TCR-mediated signaling (see Example 5).
The invention encompasses, for example, isolated SLAP-130 proteins, as well as
fragments and fusion proteins thereof, antibodies that bind to SLAP-130, isolated nucleic
acid molecules encoding SLAP-130, as well as fragments thereof and antisense nucleic acid
molecules, SLAP-130 vectors and host cells, transgenic ~nim~l~ carrying a SLAP-130
15 transgene, methods of detecting or modulating SLAP-130 activity in a cell and methods of
identifying agents that modulate the interaction between SLAP-130 and SLP-76.
So that the invention may be more readily understood, certain terms are first defined.
As used herein, the term "SLP-76" refers to a 76 kDa, leukocyte-specific protein, the
human and mouse forms of which have the amino acid sequences disclosed in Jackman, J.K.
20 etal.(l995) J. Biol. Chem. 270:7029-7032.
As used herein, the term "src homology 2 domain"(abbreviated as SH2 domain) refers
to a protein domain, typically of about 100 amino acids in length and conserved among a
variety of cytoplasmic signaling proteins (including SLP-76), that binds phosphotyrosine
containing peptides. For a review article on SH2 domains, see Koch, C.A. et al. (1991)
25 Science 252:668-674 (which also discloses and compares the amino acid sequences of many
different SH2 domains). The SH2 domain of human SLP-76 comprises approximately the
region encompassing amino acid residues 420 to 514 (as disclosed in Jackman, J.K. et al.
(199~) supra), the amino acid sequence of which is shown in SEQ ID NO: 3.
As used herein, the term "nucleic acid molecule" is intended to include DNA
30 molecules (e.g, cDNA or genomic DNA) and RNA molecules (e.g, mRNA). The nucleic
acid molecule may be single-stranded or double-stranded, but preferably is double-stranded
DNA.
As used herein, an "isolated nucleic acid molecule" refers to a nucleic acid molecule
that is free of gene sequences which naturally flank the nucleic acid in the genomic DNA of
35 the organism from which the nucleic acid is derived (i.e., gene sequences that are located
adjacent to the isolated nucleic molecule in the genomic DNA of the organism from which
the nucleic acid is derived). For example, in various embodiments, the isolated SLAP-130
nucleic acid molecule may contain less than about 5 kb, 4kb, 3kb, 2kb, 1 kb, 0.5 kb or 0.1 kb
of nucleotide sequences which naturally flank the nucleic acid molecule in genomic DNA of
CA 02222823 1997-12-22
the cell from which the nucleic acid is derived. Moreover, an "isolated" nucleic acid
molecule, such as a cDNA molecule, may be free of other cellular material.
As used herein, the term "hybridizes under stringent conditions" is intended to
describe conditions for hybridization and washing under which nucleotide sequences at least
60 % homologous to each other typically remain hybridized to each other. Preferably, the
conditions are such that at least sequences at least 65 %, more preferably at least 70 %, and
even more preferably at least 75 % homologous to each other typically remain hybridized to
each other. Such stringent conditions are known to those skilled in the art and can be found
in Current Protocols in Molecular Biology, John Wiley & Sons, N.Y. (1989), 6.3.1-6.3.6. A
preferred, non-limiting example of stringent hybridization conditions are hybridization in 6X
sodium chloride/sodium citrate (SSC) at about 45~C, followed by one or more washes in
0.2 X SSC, 0.1% SDS at 50-65~C.
As used herein, a "naturally-occurring" nucleic acid molecule refers to an RNA or
DNA molecule having a nucleotide sequence that occurs in nature (e.g., encodes a natural
1 5 protein).
As used herein, an "antisense" nucleic acid comprises a nucleotide sequence which is
complementary to a "sense" nucleic acid encoding a protein, e.g, complementary to the
coding strand of a double-stranded cDNA molecule, complementary to an mRNA sequence
or complementary to the coding strand of a gene. Accordingly, an antisense nucleic acid can
hydrogen bond to a sense nucleic acid.
As used herein, the term "coding region" refers to regions of a nucleotide sequence
comprising codons which are translated into amino acid residues, whereas the term
"noncoding region" refers to regions of a nucleotide sequence that are not translated into
amino acids (e.g, 5' and 3' untranslated regions).
As used herein, the term "vector" refers to a nucleic acid molecule capable of
transporting another nucleic acid to which it has been linked. One type of vector is a
"plasmid", which refers to a circular double stranded DNA loop into which additional DNA
segments may be ligated. Another type of vector is a viral vector, wherein additional DNA
segments may be ligated into the viral genome. Certain vectors are capable of autonomous
replication in a host cell into which they are introduced (e.g, bacterial vectors having a
bacterial origin of replication and episomal m~mm~ n vectors). Other vectors (e.g, non-
episomal m:~mm~ n vectors) are integrated into the genome of a host cell upon introduction
into the host cell, and thereby are replicated along with the host g~nJme. Moreover, certain
vectors are capable of directing the expression of genes to which they are operatively linked.
Such vectors are referred to herein as "recombinant expression vectors" or simply "expression
vectors". In general, expression vectors of utility in recombinant DNA techniques are often
in the form of plasmids. In the present specification, "plasmid" and "vector" may be used
interchangeably as the plasmid is the most commonly used form of vector. However, the
invention is intended to include such other forms of expression vectors, such as viral vectors
CA 02222823 1997-12-22
(e.g, replication defective retroviruses, adenoviruses and adeno-associated viruses), which
serve equivalent functions.
As used herein, the term "host cell" is intended to refer to a cell into which a nucleic
acid of the invention, such as a recombinant expression vector of the invention, has been
5 introduced. The terms "host cell" and "recombinant host cell" are used interchangeably
herein. It should be understood that such terms refer not only to the particular subject cell but
to the progeny or potential progeny of such a cell. Because certain modifications may occur
in succeeding generations due to either mutation or environmental influences, such progeny
may not, in fact, be identical to the parent cell, but are still included within the scope of the
10 term as used herein.
As used herein, a "transgenic animal" refers to a non-human animal, preferably amAmmAI, more preferably a mouse, in which one or more of the cells of the animal includes a
"transgene". The term "transgene" refers to exogenous DNA which is integrated into the
genome of a cell from which a transgenic animal develops and which remains in the genome
15 of the mature animal, for example directing the expression of an encoded gene product in one
or more cell types or tissues of the transgenic animal.
As used herein, a "homologous recombinant animal" refers to a type of transgenicnon-human animal, preferably a mAmmAl, more preferably a mouse, in which an endogenous
gene has been altered by homologous recombination between the endogenous gene and an
20 exogenous DNA molecule introduced into a cell of the animal, e.g., an embryonic cell of the
animal, prior to development of the animal.
As used herein, an "isolated protein" refers to a protein that is substantially free of
cellular material or culture medium when isolated from cells or produced by recombinant
DNA techniques, or chemical precursors or other chemicals when chemically synthesized. In
25 one embodiment ofthe invention, an isolated SLAP-130 protein is prepared by expressing
the protein in non-mAmmAlian cells (e.g, yeast or bacterial host cells) such that the isolated
SLAP-130 protein is substantially free of other mAmmAIiAn cellular material.
As used herein, the term "antibody" is intended to include immunoglobulin molecules
and immunologically active portions of immunoglobulin molecules, i. e., molecules that
30 contain an antigen binding site which specifically binds (immunoreacts with) an antigen, such
as Fab and F(ab')2 fragments. The terms "monoclonal antibody" and "monoclonal antibody
composition", as used herein, refer to a population of antibody molecules that contain only
one species of an antigen binding ~lt~ capable of immunoreacting with a particular epitope of
an antigen. A monoclonal antibody composition thus typically displays a single binding
35 affinity for a particular antigen with which it immunoreacts.
Various aspects of the invention are described in further detail in the following
subsections:
CA 02222823 1997-12-22
-8-
I. Isolated Nucleic Acid Molecules
One aspect of the invention pertains to isolated nucleic acid molecules that encode
SLAP-130, or fragments thereof. Most preferably, an isolated nucleic acid molecule ofthe
invention comprises the nucleotide sequence shown in SEQ ID NO: 1. Nucleotides 31 -2379
5 ofthe sequence of SEQ ID NO: 1 correspond to the coding region ofthe human SLAP-130
cDNA. Nucleotides 1-30 correspond to a 5' untranslated (5' UT) region, whereas nucleotides
2380 to 2400 correspond to a 3' untranslated (3' UT) region. In certain embodiments, an
isolated nucleic acid fragment of the invention is at least 1100 nucleotides in length. More
preferably the fragment is at least 1200, 1300, 1400, 1500, 1600, 1800, 1900, 2000, 2100,
2200 or 2300 nucleotides in length. The invention further encompasses nucleic acid
molecules that differ from SEQ ID NO: 1 (and fragments thereof) due to degeneracy of the
genetic code and thus encode the same SLAP-130 protein as that encoded by SEQ ID NO: 1.
Accordingly, in another embodiment, an isolated nucleic acid molecule of the invention has a
nucleotide sequence encoding a protein having an amino acid sequence shown in SEQ ID
1~ NO:2.
U.S. Patent Application Serial No. 08/774,061, to which this application claims
priority, also discloses SLAP-130 cDNA and deduced protein sequences as SEQ ID NOs: 1
and 2, respectively. The sequences in USSN 08/774,061 differ slightly from those in the
instant application due to a minor sequencing error. More specifically, a stretch of three
20 guanines was read as four guanines, which altered the deduced amino acid sequence at the C-
terminus ofthe SLAP-130 protein (the last 13 amino acids of SEQ ID NO: 2 of USSN08/774,061 are replaced with the last 30 amino acids of SEQ ID NO: 2 of the instant
application). Resequencing also revealed two additional amino acid sequence differences
between SEQ ID NO: 2 of USSN 08/774,061 and SEQ ID NO: 2 of the instant application, at
2~ position 273 (a proline to leucine change) and position 526 (an asparagine to lysine change),
which likely represent polymorphisms between cell types. All such polymorphisms are
encompassed by the invention. The sequences of SEQ ID NOs: 1 and 2 of the instant
application represent human T cell cDNA and protein, respectively.
A nucleic acid molecule having the nucleotide sequence of SEQ ID NO: 1, or a
30 portion thereof, can be isolated using standard molecular biology techniques and the
sequence information provided herein. For example, a human SLAP-130 cDNA can be
isolated from a cDNA library (e.g., prepared from human blood cells (commercially available
fronl Stratagene) or from human T Iymphocytes or the human T cell line Jurkat) using all or
portion of SEQ ID NO: 1 as a hybridization probe and standard hybridization techniques
3~ (e.g., as described in Sambrook, J., et al. Molecular Cloning: A Laboratory Manual. 2nd,
ed., Cold Spring Harbor Laboratory, Cold Spring Harbor, NY, 1989). Moreover, a nucleic
acid molecule encompassing all or a portion of SEQ ID NO: 1 can be isolated by the
polymerase chain reaction using oligonucleotide primers designed based upon the sequence
of SEQ ID NO: 1. For example, mRNA can be isolated from human cells (e.g, by the
CA 02222823 1997-12-22
_ 9 _
guanidinium-thiocyanate extraction procedure of Chirgwin et al. (1979) Biochemis~ry 18:
5294-5299) and cDNA can be prepared using reverse transcriptase (e.g, Moloney MLV
reverse transcriptase, available from Gibco/BRL, Bethesda, MD; or AMV reverse
transcriptase, available from Seikagaku America, Inc., St. Petersburg, FL). Synthetic
5 oligonucleotide primers for PCR amplification can be designed based upon the nucleotide
sequence shown in SEQ ID NO: 1. A nucleic acid of the invention can be amplified using
cDNA or, alternatively, genomic DNA, as a template and appropriate oligonucleotide primers
according to standard PCR amplification techniques. The nucleic acid so amplified can be
cloned into an appropl;ate vector and characterized by DNA sequence analysis. Furthermore,
10 oligonucleotides corresponding to a SLAP-130 nucleotide sequence can be prepared by
standard synthetic techniques, e.g, using an automated DNA synthesizer.
In addition to the human SLAP-130 nucleotide sequence shown in SEQ ID NO: 1, it
will be appreciated by those skilled in the art that DNA sequence polymorphisms that lead to
changes in the amino acid sequences of SLAP-130 may exist within a population (e.g, the
15 human population). Such genetic polymorphism in the SLAP-130 gene may exist among
individuals within a population due to natural allelic variation. Such natural allelic variations
can typically result in 1 -5 % variance in the nucleotide sequence of the a gene. Any and all
such nucleotide variations and resulting amino acid polymorphisms in SLAP-130 that are the
result of natural allelic variation and that do not alter the functional activity of SLAP- 130 are
20 intended to be within the scope of the invention. Moreover, nucleic acid molecules encoding
SLAP-130 proteins from other species, and thus which have a nucleotide sequence that
differs from the human sequence of SEQ ID NO: 1 but that is related to the human sequence,
are intended to be within the scope of the invention. Nucleic acid molecules corresponding to
natural allelic variants and nonhuman homologues ofthe human SLAP-130 cDNA ofthe25 invention can be isolated based on their homology to the human SLAP-130 nucleic acid
molecule disclosed herein using the human cDNA, or a portion thereof, as a hybridization
probe according to standard hybridization techniques under stringent hybridization
conditions. Accordingly, in another embodiment, an isolated nucleic acid molecule of the
invention hybridizes under stringent conditions to the nucleic acid molecule comprising the
30 nucleotide sequence of SEQ ID NO: 1. In certain embodiment, the nucleic acid is at least
1100, 1200, 1300, 1400, 1500, 1600, 1800, 1900,2000,2100,2200Or2300nucleotidesinlength. Preferably, an isolated nucleic acid molecule of the invention that hybridizes under
stringent conditions to the sequence of SEQ ID NO: 1 corresponds to a naturally-occurri~lg
nucleic acid molecule. In on embodiment, the nucleic acid encodes natural human SLAP-130
35 protein. In another embodiment, the nucleic acid molecule encodes a natural murine
homologue of human SLAP-130 protein, such as mouse SLAP-130 protein.
In addition to naturally-occurring allelic variants of the SLAP-130 sequence that may
exist in the population, the skilled artisan will further appreciate that changes may be
introduced by mutation into the nucleotide sequence of SEQ ID NO: 1, thereby leading to
CA 02222823 1997-12-22
- 10-
changes in the amino acid sequence of the encoded protein, without altering the functional
activity ofthe SLAP-130 protein. For example, nucleotide substitutions leading to amino
acid substitutions at "non-essential" amino acid residues may be made in the sequence of
SEQ ID NO: 1. A "non-essential" amino acid residue is a residue that can be altered from the
5 wild-type sequence of SLAP-130 (e.g, the sequence of SEQ ID NO: 2) without altering the
functional activity of SLAP-130, such as its ability to associate with SLP-76 or its ability to
modulate T cell receptor mediated sign~ling, whereas an "essential" amino acid residue is
required for functional activity. Accordingly, another aspect of the invention pertains to
nucleic acid molecules encoding SLAP-130 proteins that contain changes in amino acid
residues that are not essential for SLAP-130 activity. Such SLAP-130 proteins differ in
amino acid sequence from SEQ ID NO: 2 yet retain SLAP-130 activity. In one embodiment,
the isolated nucleic acid molecule comprises a nucleotide sequence encoding a protein,
wherein the protein comprises an amino acid sequence at least 60 % homologous to the
amino acid sequence of SEQ ID NO: 2 and associates with the SH2 domain of SLP-76 or
15 modulates T cell receptor mediated signaling. Preferably, the protein encoded by the nucleic
acid molecule is at least 70 % homologous to SEQ ID NO: 2, more preferably at least 80 %
homologous to SEQ ID NO: 2, even more preferably at least 90 % homologous to SEQ ID
NO: 2, and most preferably at least 95 % homologous to SEQ ID NO: 2.
To determine the percent homology of two amino acid sequences (e.g, SEQ ID NO: 220 and a mutant form thereof), the sequences are aligned for optimal comparison purposes (e.g,
gaps may be introduced in the sequence of one protein for optimal alignment with the other
protein). The amino acid residues at corresponding amino acid positions are then compared.
When a position in one sequence (e.g, SEQ ID NO: 2) is occupied by the same or a similar
amino acid residue as the corresponding position in the other sequence (e.g, a mutant form of
25 SLAP-130), then the molecules are homologous at that position (i.e., as used herein amino
acid "homology" is equivalent to amino acid identity or similarity). As used herein, an amino
acid residue is "similar" to another amino acid residue if the two amino acid residues are
members of the same family of residues having similar side chains. Families of amino acid
residues having similar side chains have been defined in the art, including basic side chains
30 (e.g, lysine, arginine, histidine), acidic side chains (e.g, aspartic acid, glutamic acid),
uncharged polar side chains (e.g, glycine, asparagine, glutamine, serine, threonine, tyrosine,
cysteine), nonpolar side chains (e.g, alanine, valine, leucir.e, isoleucine, proline,
pheny1~1~nine, methionine, tryptophan), beta-branched si~e chains (e.g, threonine, valine,
isoleucine) and aromatic side chains (e.g, tyrosine, phenylalanine, tryptophan, histidine).
35 The percent homology between two sequences, therefore, is a function of the number of
identical or similar positions shared by two sequences (i. e., % homology = # of identical or
similar positions/total # of positions x 100).
An isolated nucleic acid molecule encoding a SLAP-130 protein homologous to the
protein of SEQ ID NO: 2 can be created by introducing one or more nucleotide substitutions,
CA 02222823 1997-12-22
additions or deletions into the nucleotide sequence of SEQ ID NO: 1 such that one or more
amino acid substitutions, additions or deletions are introduced into the encoded protein.
Mutations can be introduced into SEQ ID NO: 1 by standard techniques, such as site-directed
mutagenesis and PCR-mediated mutagenesis. Preferably, conservative amino acid
substitutions are made at one or more non-essential amino acid residues. A "conservative
amino acid substitution" is one in which the amino acid residue is replaced with an amino
acid residue having a similar side chain. Families of amino acid residues having similar side
chains are defined above. Thus, a nonessential amino acid residue in SLAP-130 protein is
preferably replaced with another amino acid residue from the same side chain family.
10 Alternatively, in another embodiment, mutations can be mtroduced randomly along all or part
of a SLAP-130 coding sequence, such as by saturation mutagenesis, and the resultant mutants
can be screened for their ability to interact with SLP-76 (e.g., using a GST-SLP-76-SH2
fusion protein) to identify mutants that retain SLP-76-interacting ability.
Following mutagenesis of SEQ ID NO: 1, the encoded mutant protein can be
15 expressed recombinantly in a host cell and the ability of the mutant protein to interact with
SLP-76 can be determined using an in vitro interaction assay. For example, a recombinant
SLAP-130 protein (e.g, a mutated or truncated form of SEQ ID NO: 2) can be radiolabeled
and incubated with a GST-SLP-76-SH2 fusion protein. Glutathione-sepharose beads are then
added to the mixture to precipitate the SLAP-130-GST-SLP-76-SH2 complex, if such a
20 complex is formed. After washing the beads to remove non-specific binding, the amount of
radioactive protein associated with the beads is determined and compared to the amount of
radioactive protein rem~ining in the eluate to thereby determine whether the SLAP-130
protein is capable of interacting with the SLP-76 SH2 domain.
Moreover, the nucleic acid molecule of the invention can comprise only a portion of
25 the coding region of SEQ ID NO: 1, for example a fragment encoding a biologically active
portion of SLAP-130. The term "biologically active portion of SLAP-130" is intended to
include, for example, portions of SLAP-130 that retain the ability to associate with SLP-76 or
modulate T cell receptor signaling. The ability of a portion of SLAP-130 to interact with
SLP-76 can be determined using an assay described in further detail in Example 3. Briefly,
30 to determine the ability of a portion of SLAP-130 to associate with the SLP-76 SH2 domain,
a nucleic acid molecule encoding the portion of SLAP-130 can be cloned into an expression
vector, the expression vector can be introduced into Jurkat T cells, the T cells can be
stimulated with an activ~.c. of a protein tyrosine kinase, such as pervanadate, and
imml]noprecipitations can be carried out using a SLP-76 SH2 domain fusion protein (e.g, a
35 fusion protein comprising the SLP-76 SH2 domain, the amino acid sequence of which is
shown in SEQ ID NO: 3, and glutathione-S-transferase (GST)). The ability ofthe SLAP-130
protein, or portion thereof, to be immunoprecipitated by the SLP-76 SH2 domain fusion
protein (e.g, SLP-76 SH2/GST) indicates that the SLAP-130 protein, or portion thereof,
associates with the SH2 domain of SLP-76.
CA 02222823 1997-12-22
The ability of a portion of SLAP-130 to modulate T cell receptor signaling can be
determined using an assay described in further detail in Example 5. Briefly, to determine the
ability of a portion of SLAP-130 to modulate T cell receptor sign~ling, a nucleic acid
molecule encoding the portion of SLAP-130 can be cloned into an expression vector, the
S expression vector can be cotransfected into Jurkat T cells with an ~plop~iate reporter gene
construct for measuring T cell receptor signaling (e.g., an IL-2 promoter reporter gene
construct or a reporter gene construct cont~ining NFAT sites), the T cells can be stimulated
with an activator of a protein tyrosine kinase, such as pervanadate, and reporter gene activity
in the presence and absence ofthe portion of SLAP-130 can be evaluated. The ability ofthe
10 SLAP-130 protein, or portion thereof, to be modulate reporter gene activity indicates that the
SLAP-130 protein, or portion thereof, to modulate T cell receptor signaling. In view of the
foregoing, the invention encompasses isolated nucleic acid fragments encoding biologically
active fragments of SLAP-130, such as fragments of the nucleic acid molecule of SEQ ID
NO: 1 and nucleic acid molecules encoding fragments of the protein of SEQ ID NO: 2.
Another aspect of the invention pertains to isolated nucleic acid molecules that are
antisense to the coding strand of a SLAP-130 mRNA or gene. An antisense nucleic acid of
the invention can be complementary to an entire SLAP-130 coding strand, or to only a
portion thereof. In one embodiment, an antisense nucleic acid molecule is antisense to a
coding region of the coding strand of a nucleotide sequence encoding SLAP-130. In another
embodiment, the antisense nucleic acid molecule is antisense to a noncoding region of the
coding strand of a nucleotide sequence encoding SLAP-130. In certain embodiments, the
antisense nucleic acid is at least 1100, 1200, 1300, 1400, 1500, 1600, 1800, 1900, 2000,
2100, 2200 or 2300 nucleotides in length.
Given the coding strand sequences encoding SLAP-130 disclosed herein (e.g.,
nucleotides 31-2379 of SEQ ID NO: 1), antisense nucleic acids ofthe invention can be
designed according to the rules of Watson and Crick base pairing. The antisense nucleic acid
molecule may be complementary to the entire coding region of SLAP-130 mRNA, or
alternatively can be an oligonucleotide which is antisense to only a portion of the coding or
noncoding region of SLAP-130 mRNA. For example, the antisense oligonucleotide may be
complementary to the region surrounding the translation start site of SLAP-130 mRNA. An
antisense oligonucleotide can be, for example, about 15, 20, 25, 30, 35, 40, 45 or 50
nucleotides in length. An antisense nucleic acid of the invention can be constructed using
chemical synthesis and enzymatic ligation reactions using procedures known in the art. For
example, an antisense nucleic acid (e.g., an antisense oligonucleotide) can be chemically
synthesized using naturally occurring nucleotides or variously modified nucleotides designed
to increase the biological stability of the molecules or to increase the physical stability of the
duplex formed between the antisense and sense nucleic acids, e.g, phosphorothioate
derivatives and acridine substituted nucleotides can be used. Alternatively, the antisense
nucleic acid can be produced biologically using an expression vector into which a nucleic
CA 02222823 1997-12-22
- 13 -
acid has been subcloned in an antisense orientation (i.e., RNA transcribed from the inserted
nucleic acid will be of an antisense orientation to a target nucleic acid of interest, described
further in the following subsection).
In another embodiment, an antisense nucleic acid of the invention is a ribozyme.5 Ribozymes are catalytic RNA molecules with ribonuclease activity which are capable of
cleaving a single-stranded nucleic acid, such as an mRNA, to which they have a
complementary region. A ribozyme having specificity for a SLAP-130-encoding nucleic acid
can be designed based upon the nucleotide sequence of a SLAP-130 cDNA disclosed herein
(i.e., SEQ ID NO: 1). For example, a derivative of a Tetrahymena L-19 IVS RNA can be
10 constructed in which the base sequence of the active site is complementary to the base
sequence to be cleaved in a SLAP-130-encoding mRNA. See for example Cech et al. U.S.
Patent No. 4,987,071; and Cech et al. U.S. Patent No. 5,116,742. Alternatively, SLAP-130
mRNA can be used to select a catalytic RNA having a specific ribonuclease activity from a
pool of RNA molecules. See for example Bartel, D. and Szostak, J.W. (1993) Science 261:
1411-1418.
Yet another aspect of the invention pertains to isolated nucleic acid molecules
encoding SLAP-130 fusion proteins. Such nucleic acid molecules, comprising at least a first
nucleotide sequence encoding a SLAP-130 protein, polypeptide or peptide operatively linked
to a second nucleotide sequence encoding a non-SLAP-130 protein, polypeptide or peptide,
20 can be prepared by standard recombinant DNA techniques. SLAP-130 fusion proteins are
described in further detail below in subsection III.
II. Recombinant Expression Vectors and Host Cells
Another aspect of the invention pertains to vectors, preferably recombinant expression
25 vectors, cont~ining a nucleic acid encoding SLAP-130 (or a portion thereof). The expression
vectors of the invention comprise a nucleic acid of the invention in a form suitable for
expression of the nucleic acid in a host cell, which means that the recombinant expression
vectors include one or more regulatory sequences, selected on the basis of the host cells to be
used for expression, which is operatively linked to the nucleic acid sequence to be expressed.
30 Within a recombinant expression vector, "operably linked" is intended to mean that the
nucleotide sequence of interest is linked to the regulatory sequence(s) in a manner which
allows for expression of the nucleotide sequence (e.g., in an in vitro transcription/translation
system or in a host cell when the vector is introduced into the host cell). The telm
"regulatory sequence" is intended to includes promoters, enhancers and other expression
35 control elements (e.g, polyadenylation signals). Such regulatory sequences are described, for
example, in Goeddel; Gene Expression Technology: Methods in Enzymology 185, Academic
Press, San Diego, CA (1990). Regulatory sequences include those which direct constitutive
expression of a nucleotide sequence in many types of host cell and those which direct
expression of the nucleotide sequence only in certain host cells (e.g, tissue-specific
CA 02222823 1997-12-22
-14-
regulatory sequences). It will be appreciated by those skilled in the art that the design of the
expression vector may depend on such factors as the choice of the host cell to be transformed,
the level of expression of protein desired, etc. The expression vectors of the invention can be
introduced into host cells to thereby produce proteins or peptides, including fusion proteins or
5 peptides, encoded by nucleic acids as described herein (e.g, SLAP-130 proteins, mutant
forms of SLAP-130 proteins, SLAP-130 fusion proteins and the like).
The recombinant expression vectors of the invention can be designed for expression
of SLAP-130 protein in prokaryotic or eukaryotic cells. For example, SLAP-130 can be
expressed in bacterial cells such as E. coli, insect cells (using baculovirus expression vectors)
10 yeast cells or m~mm~lian cells. Suitable host cells are discussed further in Goeddel, Gene
Expression Technology: Methods in Enzymology 185, Academic Press, San Diego, CA
(1990). Alternatively, the recombinant expression vector may be transcribed and translated
in vitro, for example using T7 promoter regulatory sequences and T7 polymerase.
Expression of proteins in prokaryotes is most often carried out in E. coli with vectors
15 cont~ining constitutive or inducible promotors directing the expression of either fusion or
non-fusion proteins. Fusion vectors add a number of amino acids to a protein encoded
therein, usually to the amino terminus of the recombinant protein. Such fusion vectors can
serve one or more purposes: 1) to increase expression of recombinant protein; 2) to increase
the solubility of the recombinant protein; 3) to aid in the purification of the recombinant
20 protein by acting as a ligand in affinity purification; 4) to provide an epitope tag to aid in
detection and/or purification of the protein; and/or 5) to provide a marker to aid in detection
of the protein (e.g., a color marker using ,B-galactosidase fusions). Often, in fusion
expression vectors, a proteolytic cleavage site is introduced at the junction of the fusion
moiety and the recombinant protein to enable separation of the recombinant protein from the
25 fusion moiety subsequent to purification of the fusion protein. Such enzymes, and their
cognate recognition sequences, include Factor Xa, thrombin and enterokinase. Typical fusion
expression vectors include pGEX (Pharmacia Biotech Inc.; Smith, D.B. and Johnson, K.S.
(1988) Gene 67:31-40), pMAL (New England Biolabs, Beverly, MA) and pRIT5 (Pharmacia,
Piscataway, NJ) which fuse glutathione S-transferase (GST), maltose E binding protein, or
30 protein A, respectively, to the target recombinant protein. Recombinant proteins also can be
expressed in eukaryotic cells as fusion proteins for the same purposes discussed above.
Examples of suitable inducible non-fusion E. coli expression vectors include pTrc
(Amann et al., (1988) Gene 69:301-315) and ~Er 1 ld (Studier et al., Gene Expression
Technology: Methods in Enzymology 185, Academic Press, San Diego, California (1990) 60-
35 89). Target gene expression from the pTrc vector relies on host RNA polymerasetranscription from a hybrid trp-lac fusion promoter. Target gene expression from the pET
1 ld vector relies on transcription from a T7 gnlO-lac fusion promoter mediated by a
coexpressed viral RNA polymerase (T7 gnl). This viral polymerase is supplied by host
CA 02222823 1997-12-22
- 15 -
strains BL21(DE3) or HMS174(DE3) from a resident ~ prophage harboring a T7 gnl gene
under the transcriptional control of the lacUV 5 promoter.
One strategy to maximize recombinant protein expression in E. coli is to express the
protein in a host bacteria with an impaired capacity to proteolytically cleave the recombinant
5 protein (Gottesm~n, S., Gene Expression Technology: Methods in Enzymology 185,Academic Press, San Diego, California (1990) 119-128). Another strategy is to alter the
nucleic acid sequence of the nucleic acid to be inserted into an expression vector so that the
individual codons for each amino acid are those preferentially utilized in E. coli (Wada et al.,
(1992) Nuc. Acids Res. 20:2111 -2118). Such alteration of nucleic acid sequences of the
10 invention can be carried out by standard DNA synthesis techniques.
In another embodiment, the SLAP-130 expression vector is a yeast expression vector.
Examples of vectors for expression in yeast S. cerivisae include pYepSec 1 (Baldari. et al.,
(1987) EMBO J. 6:229-234), pMFa (Kurjan and Herskowitz, (1982) Cell 30:933-943),pJRY88 (Schultz et al., (1987) Gene 54:113-123), and pYES2 (Invitrogen Corporation, San
15 Diego, CA).
Alternatively, SLAP-130 can be expressed in insect cells using baculovirus
expression vectors. Baculovirus vectors available for expression of proteins in cultured
insect cells (e.g, Sf 9 cells) include the pAc series (Smith et al., (1983) Mol. Cell Biol.
3:2156-2165) and the pVL series (Lucklow, V.A., and Summers, M.D., (1989) Virology
170:31-39).
In yet another embodiment, a nucleic acid of the invention is expressed in m~mm~lian
cells using a m~mm~lian expression vector. Examples of m~mm~lian expression vectors
include pCDM8 (Seed, B., (1987) Nature 329:840) and pMT2PC (K~llfm~n et al. (1987),
EMBO J. 6:187-195). When used in m~mm~lian cells, the expression vector's control
functions are often provided by viral regulatory elements. For example, commonly used
promoters are derived from polyoma, Adenovirus 2, cytomegalovirus and Simian Virus 40.
A preferred m~mm~ n expression vector for expressing SLAP-130 is pEF-BOS
(Mi7ll~him~, S. et al. (1990) Nucl. Acids Res. 18:5322) (discussed further in the Examples).
In another embodiment, the recombinant m~mm~ n expression vector is capable of
directing expression of the nucleic acid preferentially in a particular cell type (e.g, tissue-
specific regulatory elements are used to express the nucleic acid). Tissue-specific regulatory
elements are known in the art. Non-limiting examples of suitable tissue-specific promoters
include lymphold specific promoters (Calame and Eaton (1988) Adv. Immunol. 43:235-275),
in particular promoters of T cell receptors (Winoto and Baltimore (1989) EMBO J. 8:729-
733) and immunoglobulins (Banerji et al. (1983) Cell 33:729-740; Queen and Baltimore
(1983) Cell 33:741-748), the albumin promoter (liver-specific; Pinkert et al. (1987) Genes
Dev. 1:268-277), neuron-specific promoters (e.g, the neurofilament promoter; Byrne and
Ruddle (1989) Proc. Natl. Acad. Sci. USA 86:5473-5477), pancreas-specific promoters
(Edlund et al. (1985) Science 230:912-916), and m~mm:~ry gland-specific promoters (e.g,
CA 02222823 1997-12-22
- 16-
milk whey promoter; U.S. Patent No. 4,873,316 and European Application Publication No.
264,166). Developmentally-regulated promoters are also encompassed, for example the
murine hox promoters (Kessel and Gruss (1990) Science 249:374-379) and the a-fetoprotein
promoter (Campes and Tilghman (1989) Genes Dev. 3:537-546).
S Moreover, inducible regulatory systems for use in m~mm~ n cells are known in the
ar~, for example systems in which gene expression is regulated by heavy metal ions (see e.g,
Mayo et al. (1982) Cell 29:99-108; Brinster et al. (1982) Nature 296:39-42; Searle et al.
(1985) Mol. Cell. Biol. 5:1480-1489), heat shock (see e.g, Nouer et al. (1991) in Heat Shock
Response, e.d. Nouer, L., CRC, Boca Raton, FL, ppl67-220), hormones (see e.g, Lee et al.
10 (1981) Nature 294:228-232; Hynes et al. (1981) Proc. Natl. Acad. Sci. USA 78:2038-2042;
Klock et al. (1987) Nature 329:734-736; Israel & K~llfm~n (1989) Nucl. Acids Res. 17:2589
2604; and PCT Publication No. WO 93/23431), FK506-related molecules (see e.g, PCT
Publication No. WO 94/18317) or tetracyclines (Gossen, M. and Bujard, H. (1992) Proc.
Natl. ~lcad. Sci. USA 89:5547-5551; Gossen, M. et al. (1995) Science 268:1766-1769; PCT
15 Publication No. WO 94/29442; and PCT Publication No. WO 96/01313). Accordingly, in
another embodiment, the invention provides a recombinant expression vector in which
SLAP-130 DNA is operatively linked to an inducible eukaryotic promoter, thereby allowing
for inducible expression of SLAP-130 in eukaryotic cells.
The invention further provides a recombinant expression vector comprising a DNA
20 molecule of the invention cloned into the expression vector in an antisense orientation. That is,
the DNA molecule is operatively linked to a regulatory sequence in a manner which allows for
expression (by transcription of the DNA molecule) of an RNA molecule which is antisense to
SLAP-130 mRNA. Regulatory sequences operatively linked to a nucleic acid cloned in the
antisense orientation can be chosen which direct the continuous expression of the antisense
25 RNA molecule in a variety of cell types, for instance viral promoters and/or enhancers, or
regulatory sequences can be chosen which direct constitutive, tissue specific or cell type specific
expression of antisense RNA. The antisense expression vector can be in the form of a
reeom~inant plasmid, phagemid or attenuated virus in which antisense nucleic acids are
produced under the control of a high efficiency regulatory region, the activity of which can be
30 ~letermined by the cell type into which the vector is introduced. For a discussion of the
regulation of gene expression using antisense genes see Weintraub, H. et al., Antisense RNA as
a molecular tool for genetic analysis, Reviews - Trends in Genetics, Vol. 1 (1) 1986.
Another aspect of the invention pertains to recombinant host cells into which a vector,
preferably a recombinant expression vector, of the invention has been introduced. A host cell
3~ may be any prokaryotic or eukaryotic cell. For example, SLAP-130 protein may be
expressed in bacterial cells such as E. coli, inseet eells, yeast or m~mm~ n eells (sueh as
Jurkat T cells, Chinese hamster ovary cells (CHO) or COS cells). Other suitable host cells
are known to those skilled in the art. Vector DNA can be introduced into prokaryotic or
eukaryotic cells via conventional transformation or transfection techniques. As used herein,
CA 02222823 l997-l2-22
-17-
the terms "transformation" and "transfection" are intended to refer to a variety of art-
recognized techniques for introducing foreign nucleic acid (e.g., DNA) into a host cell,
including calcium phosphate or calcium chloride co-precipitation, DEAE-dextran-mediated
transfection, lipofection, or electroporation. Suitable methods for transforming or
5 transfecting host cells can be found in Sambrook et al. (Molecular Cloning. A Laboratory
Manual, 2nd Edition, Cold Spring Harbor Laboratory press (1989)), and other laboratory
manuals.
For stable transfection of m~mm:~lian cells, it is known that, depending upon the
expression vector and transfection technique used, only a small fraction of cells may integrate
10 the foreign DNA into their genome. In order to identify and select these integrants, a gene
that encodes a selectable marker (e.g, resistance to antibiotics) is generally introduced into
the host cells along with the gene of interest. Preferred selectable markers include those
which confer resistance to drugs, such as G418, hygromycin and methotrexate. Nucleic acid
encoding a selectable marker may be introduced into a host cell on the same vector as that
15 encoding SLAP-130 or may be introduced on a separate vector. Cells stably transfected with
the introduced nucleic acid can be identified by drug selection (e.g, cells that have
incorporated the selectable marker gene will survive, while the other cells die).
A host cell of the invention, such as a prokaryotic or eukaryotic host cell in culture,
can be used to produce (i.e., express) SLAP-130 protein. Accordingly, the invention further
20 provides methods for producing SLAP-130 protein using the host cells of the invention. In
one embodiment, the method comprises culturing the host cell of invention (into which a
recombinant expression vector encoding SLAP-130 has been introduced) in a suitable
medium until SLAP-130 is produced. In another embodiment, the method further comprises
isolating SLAP-130 from the medium or the host cell. In its native form SLAP-130 protein is
25 thought to be an intracellular protein and, accordingly, recombinant SLAP-130 protein can be
expressed intracellularly in a recombinant host cell and then isolated from the host cell, e.g,
by lysing the host cell and recovering the recombinant SLAP-130 protein from the lysate.
Alternatively, recombinant SLAP-130 protein can be prepared as a extracellular protein by
operatively linking a heterologous signal sequence to the amino-terminus of the protein such
30 that the protein is secreted from the host cells. In this case, recombinant SLAP-130 protein
can be recovered from the culture medium in which the cells are cultured.
Certain host cells of the invention can also be used to produce nonhuman transgenic
~nim~l~ For example, in one embodiment, a host cell of the inven[iJn is a fertilized oocyte
or an embryonic stem cell into which SLAP-130-coding sequences have been introduced.
35 Such host cells can then be used to create non-human transgenic ~nim~l~ in which exogenous
SLAP-130 sequences have been introduced into their genome or homologous recombinant
~nim~ in which endogenous SLAP-130 sequences have been altered. Such ~nim~l~ areuseful for studying the function and/or activity of SLAP-130 and for identifying and/or
evaluating modulators of SLAP-130 activity. Accordingly, another aspect ofthe invention
CA 02222823 1997-12-22
-18-
pertains to nonhuman transgenic ~nim~ls which contain cells carrying a transgene encoding a
SLAP-130 protein or a portion of a SLAP-130 protein. In a subembodiment, of the
transgenic animals of the invention, the transgene alters an endogenous gene encoding an
endogenous SLAP-130 protein (e.g, homologous recombinant ~nim~l~ in which the
endogenous SLAP-130 gene has been functionally disrupted or "knocked out", or the
nucleotide sequence of the endogenous SLAP-130 gene has been mutated or the
transcriptional regulatory region of the endogenous SLAP- 130 gene has been altered).
- A transgenic animal ofthe invention can be created by introducing SLAP-130-
encoding nucleic acid into the male pronuclei of a fertilized oocyte, e.g, by microinjection,
10 and allowing the oocyte to develop in a pseudopregnant female foster animal. The human
SLAP-130 cDNA sequence of SEQ ID NO: 1 can be introduced as a transgene into thegenome of a non-human animal. Alternatively, a nonhuman homologue of the human SLAP-
130 gene, such as a mouse SLAP-130 gene, can be isolated based on hybridization to the
human SLAP-130 cDNA and used as a transgene. Intronic sequences and polyadenylation
15 signals can also be included in the transgene to increase the efficiency of expression of the
transgene. A tissue-specific regulatory sequence(s) can be operably linked to the SLAP-130
transgene to direct expression of SLAP-130 protein to particular cells. Methods for
generating transgenic ~nim~l~ via embryo manipulation and microinjection, particularly
~nim~ls such as mice, have become conventional in the art and are described, for example, in
20 U.S. Patent Nos. 4,736,866 and 4,870,009, both by Leder e~ al., U.S. Patent No. 4,873,191
by Wagner et al. and in Hogan, B., Manipulating the Mouse Embryo, (Cold Spring Harbor
Laboratory Press, Cold Spring Harbor, N.Y., 1986). Similar methods are used for production
of other transgenic animals. A transgenic founder animal can be identified based upon the
presence ofthe SLAP-130 transgene in its genome and/or expression of SLAP-130 mRNA in
25 tissues or cells of the ~nim~ls A transgenic founder animal can then be used to breed
additional :~lnim~l~ carrying the transgene. Moreover, transgenic ~nim:~ls carrying a transgene
encoding SLAP-130 can further be bred to other transgenic ~nim~l~ carrying othertransgenes.
To create a homologous recombinant animal, a vector is prepared which contains at
30 least a portion of a SLAP-130 gene into which a deletion, addition or substitution has been
introduced to thereby alter, e.g, functionally disrupt, the endogenous SLAP-130 gene. The
SLAP-130 gene may be a human gene (e.g, from a human genomic clone isolated from a
human genomic library screened wl.n .he cDNA of SEQ ID NO: 1), but more preferably, is a
non-human homologue of a human SLAP-130 gene. For example, a mouse SLAP-130 gene35 can be isolated from a mouse genomic DNA library using the human SLAP-130 cDNA of
SEQ ID NO: 1 as a probe. The mouse SLAP-130 gene then can be used to construct ahomologous recombination vector suitable for altering an endogenous SLAP-130 gene in the
mouse genome. In a preferred embodiment, the vector is designed such that, upon
homologous recombination, the endogenous SLAP-130 gene is functionally disrupted (i.e.,
CA 02222823 1997-12-22
- 19-
no longer encodes a functional protein; also referred to as a "knock out" vector).
Alternatively, the vector can be designed such that, upon homologous recombination, the
endogenous SLAP-130 gene is mutated or otherwise altered but still encodes functional
protein (e.g, the upstream regulatory region can be altered to thereby alter the expression of
5 the endogenous SLAP-130 protein). In the homologous recombination vector, the altered
portion ofthe SLAP-130 gene is flanked at its 5' and 3' ends by additional nucleic acid ofthe
SLAP-130 gene to allow for homologous recombination to occur between the exogenous
SLAP-130 gene carried by the vector and an endogenous SLAP-130 gene in an embryonic
stem cell. The additional fl~nking SLAP-130 nucleic acid is of sufficient length for
10 successful homologous recombination with the endogenous gene. Typically, several
kilobases of fl~nking DNA (both at the 5' and 3' ends) are included in the vector (see e.g.,
Thomas, K.R. and Capecchi, M. R. (1987) Cell 51 :503 for a description of homologous
recombination vectors). The vector is introduced into an embryonic stem cell line (e.g., by
electroporation) and cells in which the introduced SLAP-130 gene has homologously
recombined with the endogenous SLAP-130 gene are selected (see e.g, Li, E. et al. (1992)
Cell 69:915). The selected cells are then injected into a blastocyst of an animal (e.g, a
mouse) to form aggregation chimeras (see e.g, Bradley, A. in Teratocarcinomas and
Embryonic Stem Cells: A Practical Approach, E.J. Robertson, ed. (IRL, Oxford, 1987) pp.
113-152). A chimeric embryo can then be implanted into a suitable pseudopregnant female
foster animal and the embryo brought to term. Progeny harboring the homologouslyrecombined DNA in their germ cells can be used to breed ~nim~l~ in which all cells of the
animal contain the homologously recombined DNA by germline transmission of the
transgene. Methods for constructing homologous recombination vectors and homologous
recombinant ~nim~l.s are described further in Bradley, A. (1991) Current Opinion in
Biotechnology _:823-829 and in PCT International Publication Nos.: WO 90/11354 by Le
Mouellec et al.; WO 91/01140 by Smithies et al.; WO 92/0968 by Zijlstra et al.; and WO
93/04169 by Berns et al.
In addition to the foregoing, the skilled artisan will appreciate that other approaches
known in the art for homologous recombination can be applied to the instant invention.
Enzyme-assisted site-specific integration systems are known in the art and can be applied to
integrate a DNA molecule at a predetermined location in a second target DNA molecule.
Examples of such enzyme-assisted integration systems include the Cre recombinase-lox
targe. ~ystem (e.g., as described in Baubonis, W. and Sauer, B. (1993) Nucl. Acids Res.
21:2025-2029; and Fukushige, S. and Sauer, B. (1992) Proc. Natl. Acad. Sci. USA 89:7905-
7909) and the FLP recombinase-FRT target system (e.g., as described in Dang, D.T. and
Perrimon, N. (1992) Dev. Genet. 13:367 375; and Fiering, S. et al. (1993) Proc. Natl. Acad.
Sci. USA 90:8469-8473). Tetracycline-regulated inducible homologous recombination
systems, such as described in PCT Publication No. WO 94/29442 and PCT Publication No.
WO 96/01313, also can be used.
CA 02222823 1997-12-22
- 20 -
III. Isolated SLAP-130 Proteins and Anti-SLAP-130 Antibodies
Another aspect of the invention pertains to isolated SLAP-130 proteins, and portions
thereof, such as biologically active portions, as well as peptide fragments suitable as
immunogens to raise anti-SLAP-130 antibodies. In one embodiment, the invention provides
an isolated preparation of SLAP-130 protein. Preferably, the SLAP-130 protein has an amino
acid sequence shown in SEQ ID NO: 2. In other embodiments, the SLAP-130 protein is
substantially homologous to SEQ ID NO: 2 and retains the functional activity of the protein
of SEQ ID NO: 2 yet differs in amino acid sequence due to natural allelic variation or
10 mutagenesis, as described in detail in subsection I above. Accordingly, in another
embodiment, the SLAP-130 protein is a protein which comprises an amino acid sequence at
least 60 % homologous to the amino acid sequence of SEQ ID NO: 2 and that interacts with
SLP-76. Preferably, the protein is at least 70 % homologous to SEQ ID NO: 2, more
preferably at least 80 % homologous to SEQ ID NO: 2, even more preferably at least 90 %
15 homologous to SEQ ID NO: 2, and most preferably at least 95 % homologous to SEQ ID
NO: 2.
The invention further provides a portion of a SLAP-130 protein that interacts with
SLP-76. The SLAP-130 protein interacts with the SH2 domain of SLP-76 and it is known
that SH2 domains recognize phosphotyrosine-containing binding sites. Based on analysis of
20 the amino acid sequence of SLAP-130, tyrosine residues can be identified as potential SLP-
76 SH2 domain binding sites (when the tyrosine residue of SLAP-130 is phosphorylated).
Accordingly, peptides encompassing tyrosine-cont~ining regions of SLAP-130 are provided
by the invention and can be prepared by standard peptide synthesis techniques. Preferably,
the tyrosine-cont~ining peptide is at least 5 amino acids in length and more preferably at least
25 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20 amino acid residues in length. An in
vitro interaction assay (such as an assay l]tili7ing a GST-SLP-76-SH2 fusion protein) can be
used to determine the ability of such peptides, when phosphorylated on tyrosine, to interact
with the SLP-76 SH2 domain.
SLAP-130 proteins are preferably produced by recombinant DNA techniques. For
30 example, a nucleic acid molecule encoding the protein is cloned into an expression vector (as
described above), the expression vector is introduced into a host cell (as described above) and
the SLAP-130 protein is expressed in the host cell. The SLAP-130 protein can then be
isolated from the cells by an appropriate purification scheme using standard protein
purification techniques. Alternative to recombinant expression, a SLAP-130 polypeptide can
35 be synthesized chemically using standard peptide synthesis techniques. Moreover, native
SLAP-130 protein can be isolated from cells (e.g, human T cells or the human T cell line
Jurkat), for example using an SLP-76 SH2 fusion protein to precipitate SLAP-130 from cell
lysates (described further in the Examples) or by immunoprecipitation using an anti-SLAP-
130 antibody.
CA 02222823 1997-12-22
The invention also provides SLAP-130 fusion proteins. As used herein, a SLAP-130"fusion protein" comprises a SLAP-130 polypeptide operatively linked to a non-SLAP-130
polypeptide. A "SLAP-130 polypeptide" refers to a polypeptide having an amino acid
sequence corresponding to SLAP-130 protein, or a peptide fragment thereof, whereas a "non-
S SLAP-130 polypeptide" refers to a polypeptide having an amino acid sequence
corresponding to another protein. Within the fusion protein, the term "operatively linked" is
intended to indicate that the SLAP-130 polypeptide and the non-SLAP-130 polypeptide are
fused in-frame to each other. The non-SLAP-130 polypeptide may be fused to the N-
terminus or C-terminus of the SLAP-130 polypeptide. Examples of fusion proteins include
epitope-tagged SLAP-130 proteins, such as SLAP-130 that has been fused in frame to the
FLAGTM epitope (see Example 3) and glutathione-S-transferase fusion proteins in which the
SLAP-130 sequence (or a portion thereof) is fused to the C-terminus ofthe GST sequences.
Such fusion proteins can facilitate the detection and/or purification of recombinant SLAP-
130. A fusion protein of the invention may comprise the entire SLAP-130 protein or only a
15 portion ofthe SLAP-130 protein.
Preferably, a SLAP-130 fusion protein of the invention is produced by standard
recombinant DNA techniques. For example, DNA fragments coding for the different
polypeptide sequences are ligated together in-frame in accordance with conventional
techniques, for example employing blunt-ended or stagger-ended termini for ligation,
20 restriction enzyme digestion to provide for appropriate termini, filling-in of cohesive ends as
appropriate, alkaline phosphatase treatment to avoid undesirable joining, and enzymatic
ligation. In another embodiment, the fusion gene can be synthesized by conventional
techniques including automated DNA synthesizers. Alternatively, PCR amplification of gene
fragments can be carried out using anchor primers which give rise to complementary
25 overhangs between two consecutive gene fragments which can subsequently be annealed and
reamplified to generate a chimeric gene sequence (see, for example, Current Protocols in
Molecular Biology, eds. Ausubel et al. John Wiley & Sons: 1992). Moreover, many
expression vectors are commercially available that already encode a fusion moiety (e.g, a
GST polypeptide). A SLAP-130-encoding nucleic acid can be cloned into such an
30 expression vector such that the fusion moiety is linked in-frame to the SLAP-130 protein.
An isolated SLAP-130 protein, or fragment thereof, can be used as an immunogen to
generate antibodies that bind SLAP-130 using standard techniques for polyclonal and
monoclonal antibody preparation. The SLAP-130 protem ~an be used to generate antibodies
or, alternatively, an antigenic peptide fragment of SLAP-130 can be used as the immunogen.
35 An antigenic peptide fragment of SLAP-130 typically comprises at least 8 amino acid
residues of the amino acid sequence shown in SEQ ID NO: 2 and encompasses an epitope of
SLAP-130 such that an antibody raised against the peptide forms a specific immune complex
with SLAP-130. Preferably, the antigenic peptide comprises at least 10 amino acid residues,
more preferably at least 15 amino acid residues, even more preferably at least 20 amino acid
CA 02222823 1997-12-22
residues, and most preferably at least 30 amino acid residues. Preferred epitopes
encompassed by the antigenic peptide are regions of SLAP-130 that are located on the
surface of the protein, e.g., hydrophilic regions. A standard hydrophobicity analysis of the
SLAP-130 protein sequence shown in SEQ ID NO: 2 can be performed to identify such
5 hydrophilic regions.
A SLAP-130 immunogen typically is used to prepare antibodies by immunizing a
suitable subject, (e.g., rabbit, goat, mouse or other m~mm~l) with the immunogen. An
appropriate immunogenic preparation can contain, for examples, recombinantly expressed
SLAP-130 protein or a chemically synthesized SLAP-130 peptide. The preparation can
10 further include an adjuvant, such as Freund's complete or incomplete adjuvant, or similar
immunostimulatory agent. Immunization of a suitable subject with an immunogenic SLAP-
130 preparation induces a polyclonal anti-SLAP-130 antibody response.
Accordingly, another aspect ofthe invention pertains to anti-SLAP-130 antibodies.
Polyclonal anti-SLAP-130 antibodies can be prepared as described above by immunizing a
suitable subject with a SLAP-130 immunogen. The anti-SLAP-130 antibody titer in the
immunized subject can be monitored over time by standard techniques, such as with an
enzyme linked immunosorbent assay (ELISA) using immobilized SLAP-130. If desired, the
antibody molecules directed against SLAP-130 can be isolated from the m~mm~l (e.g, from
the blood) and further purified by well known techniques, such as protein A chromatography
to obtain the IgG fraction. At an appropriate time after immunization, e.g., when the anti-
SLAP-130 antibody titers are highest, antibody-producing cells can be obtained from the
subject and used to prepare monoclonal antibodies by standard techniques, such as the
hybridoma technique originally described by Kohler and Milstein (1975, Nature 256:495-
497) (see also, Brown et al. (1981) J. Immunol 127:539-46; Brown et al. (1980) JBiol Chem
255:4980-83;Yeh etal. (1976) PNAS 76:2927-31;andYeh etal. (1982) Int. J. Cancer
29:269-75), the more recent human B cell hybridoma technique (Kozbor et al. (1983)
Immunol Today 4:72), the EBV-hybridoma technique (Cole et al. (1985), MonoclonalAntibodies and Cancer Therapy, Alan R. Liss, Inc., pp. 77-96) or trioma techniques. The
technology for producing monoclonal antibody hybridomas is well known (see generally R.
H. Kenneth, in Monoclonal Antibodies: A New Dimension In Biological Analyses, Plenum
Publishing Corp., New York, New York (1980); E. A. Lerner (1981) Yale J. Biol. Med.,
54:387-402; M. L. Gefter et al. (1977) Somatic Cell Genet., 3:231-36). Briefly, an immortal
cell line (typically a myeloI.la) is fused to lymphocytes (typically splenocytes) from a
m~mm:~l immunized with a SLAP-130 immunogen as described above, and the culture
supernatants of the resulting hybridoma cells are screened to identify a hybridoma producing
a monoclonal antibody that binds SLAP-130.
Any of the many well known protocols used for fusing lymphocytes and immortalized
cell lines can be applied for the purpose of generating an anti-SLAP-130 monoclonal
antibody (see, e.g, G. Galfre et al. (1977) Nature 266:55052; Gefter et al. Somatic Cell
CA 02222823 1997-12-22
-23-
Genet., cited supra; Lerner, Yale J. Biol. Med., cited supra; Kenneth, Monoclonal Antibodies,
cited supra). Moreover, the ordinary skilled worker will appreciate that there are many
variations of such methods which also would be useful. Typically, the immortal cell line
(e.g, a myeloma cell line) is derived from the same m~mm~ n species as the lymphocytes.
5 For example, murine hybridomas can be made by fusing Iymphocytes from a mouse
immunized with an immunogenic preparation of the present invention with an immortalized
mouse cell line. Preferred immortal cell lines are mouse myeloma cell lines that are sensitive
to culture medium containing hypoxanthine, aminopterin and thymidine ("HAT medium").
Any of a number of myeloma cell lines may be used as a fusion partner according to standard
techniques, e.g., the P3-NS1/1-Ag4-1, P3-x63-Ag8.653 or Sp2/O-Agl4 myeloma lines.
These myeloma lines are available from the American Type Culture Collection (ATCC),
- Rockville, Md. Typically, HAT-sensitive mouse myeloma cells are fused to mouse
splenocytes using polyethylene glycol ("PEG"). Hybridoma cells resulting from the fusion
are then selected using HAT medium, which kills unfused and unproductively fusedmyeloma cells (unfused splenocytes die after several days because they are not transformed).
Hybridoma cells producing a monoclonal antibody of the invention are detected by screening
the hybridoma culture supern~t~nt~ for antibodies that bind SLAP-130, e.g., using a standard
ELISA assay.
Alternative to preparing monoclonal antibody-secreting hybridomas, a monoclonal
anti-SLAP-130 antibody can be identified and isolated by screening a recombinantcombinatorial immunoglobulin library (e.g., an antibody phage display library) with SLAP-
130 to thereby isolate immunoglobulin library members that bind SLAP-130. Kits for
generating and screening phage display libraries are commercially available (e.g, the
Pharmacia Recombinant Phage Antibody System, Catalog No. 27-9400-01; and the Stratagene
Sur~ZAPTM Phage Display Kit, Catalog No. 240612). Additionally, examples of methods
and reagents particularly amenable for use in generating and screening antibody display
library can be found in, for example, Ladner et al. U.S. Patent No. 5,223,409; Kang et al.
International Publication No. WO 92/18619; Dower et al. International Publication No. WO
91/17271; Winter et al. International Publication WO 92/20791; Markland et al. International
Publication No. WO 92/15679; Breitling et al. International Publication WO 93/01288;
McCafferty et al. International Publication No. WO 92/01047; Garrard et al. International
Publication No. WO 92/09690; Ladner et al. International Publication No. WO 90/02809;
Fuchs et al. (1991) Bio/Technology 9:1370-1372; Hay et al. (1992) Hum Antibod
Hybridomas 3:81-85; Huse et al. (1989) Science 246:1275-1281; Griffiths et al. (1993)
EMBO J 12:725-734; Hawkins et al. (1992) JMol Biol 226:889-896; Clarkson et al. (1991)
Nature 352:624-628; Gram et al. (1992) PNAS 89:3576-3580; Garrad et al. (1991)
Bio/Technology 9: l 373-1377; Hoogenboom et al. (1991) Nuc Acid Res 19:4133-4137;
Barbas et al. (1991) PNAS 88:7978-7982; and McCafferty et al. Nature (1990) 348:552-554.
CA 02222823 1997-12-22
- 24 -
Additionally, recombinant anti-SLAP-130 antibodies, such as chimeric and
hllm:~ni7ed monoclonal antibodies, comprising both human and non-human portions, which
can be made using standard recombinant DNA techniques, are within the scope of the
invention. Such chimeric and hllm~ni7ed monoclonal antibodies can be produced by5 recombinant DNA techniques known in the art, for example using methods described in
3~obinson et al. International Patent Publication PCT/US86/02269; Akira, et al. European
Patent Application 184,187; Taniguchi, M., European Patent Application 171,496; Morrison
et al. European Patent Application 173,494; Neuberger et al. PCT Application WO 86/01533;
Cabilly et al. U.S. Patent No. 4,816,567; Cabilly et al. European Patent Application 125,023;
Better et al. (1988) Science 240:1041-1043; Liu et al. (1987) PNAS 84:3439-3443; Liu et al.
(1987)J. Immunol. 139:3521-3526; Sunetal. (1987)PNAS84:214-218;Nishimuraetal.
(1987) Canc. Res. 47:999-1005; Wood et al. (1985) Nature 314:446 449; and Shaw et al.
(1988)J. Natl CancerInst. 80:1553-1559); Morrison, S. L. (1985) Science 229:1202-1207;
Oi et al. (1986) BioTechniques 4:214; Winter U.S. Patent 5,225,539; Jones et al. (1986)
Nature 321 :552-525; Verhoeyan et al. (1988) Science 239: 1534; and Beidler et al. (1988) J.
Immunol. 141:4053-4060.
An anti-SLAP-130 antibody (e.g., monoclonal antibody) can be used to isolate SLAP-
130 protein by standard techniques, such as affinity chromatography or immunoprecipitation.
An anti-SLAP-130 antibody can facilitate the purification of natural SLAP-130 from cells
and of recombinantly-produced SLAP-130 expressed in host cells. Moreover, an anti-SLAP-
130 antibody can be used to detect SLAP-130 protein (e.g., in a cellular Iysate or cell
supernatant). Detection may be facilitated by coupling (i.e., physically linking) the antibody
to a detectable substance. Accordingly, in one embodiment, an anti-SLAP-130 antibody of
the invention is labeled with a detectable substance. Examples of detectable substances
include various enzymes, prosthetic groups, fluorescent materials, luminescent materials and
radioactive materials. Examples of suitable enzymes include horseradish peroxidase, alkaline
phosphatase, ~-galactosidase, or acetylcholinesterase; examples of suitable prosthetic group
complexes include streptavidin/biotin and avidin/biotin; examples of suitable fluorescent
materials include umbelliferone, fluorescein, fluorescein isothiocyanate, rhodamine,
dichlorotriazinylamine fluorescein, dansyl chloride or phycoerythrin; an example of a
luminescent material includes luminol; and examples of suitable radioactive material include
125I 131I 35S or 3H.
IV. Pharmaceutical Compositions
SLAP-130 modulators ofthe invention (e.g., SLAP 130 inhibitory or stimulatory
agents, including SLAP-130 proteins and antibodies) can be incorporated into pharmaceutical
compositions suitable for a~mini.~tration. Such compositions typically comprise the
modulatory agent and a ph~rm~ceutically acceptable carrier. As used herein the term
"pharmaceutically acceptable carrier" is intended to include any and all solvents, dispersion
CA 02222823 1997-12-22
-25-
media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents,
and the like, compatible with pharmaceutical ~lmini~tration. The use of such media and
agents for pharmaceutically active substances is well known in the art. Except insofar as any
conventional media or agent is incompatible with the active compound, use thereof in the
5 compositions is contemplated. Supplementary active compounds can also be incorporated
into the compositions.
A pharmaceutical composition of the invention is formulated to be compatible with its
intended route of ~tlmini~tration. For example, solutions or suspensions used for parenteral,
intradermal, or subcutaneous application can include the following components: a sterile
10 diluent such as water for injection, saline solution, fixed oils, polyethylene glycols, glycerine,
propylene glycol or other synthetic solvents; antibacterial agents such as benzyl alcohol or
methyl parabens; antioxidants such as ascorbic acid or sodium bisulfite; chelating agents such
as ethylenediaminetetraacetic acid; buffers such as acetates, citrates or phosphates and agents
for the adjustment of tonicity such as sodium chloride or dextrose. pH can be adjusted with
15 acids or bases, such as hydrochloric acid or sodium hydroxide. The parenteral preparation
can be enclosed in ampoules, disposable syringes or multiple dose vials made of glass or
plastic.
Ph~ çeutical compositions suitable for injectable use include sterile aqueous
solutions (where water soluble) or dispersions and sterile powders for the extemporaneous
20 plepalation of sterile injectable solutions or dispersion. For intravenous ~(lministration,
suitable carriers include physiological saline, bacteriostatic water, Cremophor ELTM (BASF,
Parsippany, NJ) or phosphate buffered saline (PBS). In all cases, the composition must be
sterile and should be fluid to the extent that easy syringability exists. It must be stable under
the conditions of manufacture and storage and must be preserved against the cont~min~ting
25 action of microorganisms such as bacteria and fungi. The carrier can be a solvent or
dispersion medium containing, for example, water, ethanol, polyol (for example, glycerol,
propylene glycol, and liquid polyetheylene glycol, and the like), and suitable mixtures
thereof. The proper fluidity can be maintained, for example, by the use of a coating such as
lecithin, by the maintenance of the required particle size in the case of dispersion and by the
30 use of surfactants. Prevention of the action of microorg~ni.~m~ can be achieved by various
antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, ascorbic
acid, thimerosal, and the like. In many cases, it will be preferable to include isotonic agents,
for example, sugars, polyalcohols such as mamtol, sorbitol, sodium chloride in the
composition. Prolonged absorption of the injectable compositions can be brought about by
35 including in the composition an agent which delays absorption, for example, aluminum
monostearate and gelatin.
Sterile injectable solutions can be prepared by incorporating the active compound in
the required amount in an appropriate solvent with one or a combination of ingredients
enumerated above, as required, followed by filtered sterilization. Generally, dispersions are
CA 02222823 1997-12-22
-26-
prepared by incorporating the active compound into a sterile vehicle which contains a basic
dispersion medium and the required other ingredients from those enumerated above. In the
case of sterile powders for the preparation of sterile injectable solutions, the preferred
methods of preparation are vacuum drying and freeze-drying which yields a powder of the
active ingredient plus any additional desired ingredient from a previously sterile-filtered
solution thereof.
Oral compositions generally include an inert diluent or an edible carrier. They can be
enclosed in gelatin capsules or compressed into tablets. For the purpose of oral therapeutic
~-lmini~tration, the active compound can be incorporated with excipients and used in the form
10 of tablets, troches, or capsules. Oral compositions can also be prepared using a fluid carrier
for use as a mouthwash, wherein the compound in the fluid carrier is applied orally and
swished and expectorated or swallowed. Pharmaceutically compatible binding agents, and/or
adjuvant materials can be included as part of the composition. The tablets, pills, capsules,
troches and the like can contain any of the following ingredients, or compounds of a similar
15 nature: a binder such as microcrystalline cellulose, gum tragacanth or gelatin; an excipient
such as starch or lactose, a disintegrating agent such as alginic acid, Primogel, or corn starch;
a lubricant such as magnesium stearate or Sterotes; a glidant such as colloidal silicon dioxide;
a sweetening agent such as sucrose or saccharin; or a flavoring agent such as peppermint,
methyl salicylate, or orange flavoring.
In one embodiment, the active compounds are prepared with carriers that will protect
the compound against rapid elimin~tion from the body, such as a controlled release
formulation, including implants and microencapsulated delivery systems. Biodegradable,
biocompatible polymers can be used, such as ethylene vinyl acetate, polyanhydrides,
polyglycolic acid, collagen, polyorthoesters, and polylactic acid. Methods for preparation of
25 such formulations will be apparent to those skilled in the art. The materials can also be
obtained commercially from Alza Corporation and Nova Pharmaceuticals, Inc. Liposomal
suspensions (including liposomes targeted to infected cells with monoclonal antibodies to
viral antigens) can also be used as pharmaceutically acceptable carriers. These may be
prepared according to methods known to those skilled in the art, for example, as described in
30 U.S. PatentNo. 4,522,811.
V. Methods of the Invention
Anothel a,pect of the invention pertains to methods of using the various SLAP- 130
compositions of the invention. For example, the invention provides a method for detecting
35 the presence of SLAP-130 activity in a biological sample. The method involves contacting
the biological sample with an agent capable of detecting SLAP-l 30 activity, such as SLAP-
130 protein or SLAP-130 mRNA, such that the presence of SLAP-130 activity is detected in
the biological sample. A preferred agent for detecting SLAP-130 mRNA is a labeled nucleic
acid probe capable of hybridizing to SLAP-130 mRNA. The nucleic acid probe can be, for
CA 02222823 1997-12-22
example, the SLAP-130 cDNA of SEQ ID NO: 1, or a portion thereof sufficient to
specifically hybridize under stringent conditions to SLAP-130 mRNA. A preferred agent for
detecting SLAP-130 protein is a labeled antibody capable of binding to SLAP-130 protein.
Antibodies can be polyclonal, or more preferably, monoclonal. An intact antibody, or a
fragment thereof (e.g, Fab or F(ab')2) can be used. The term "labeled", with regard to the
probe or antibody, is intended to encompass direct labeling of the probe or antibody by
coupling (i.e., physically linking) a detectable substance to the probe or antibody, as well as
indirect labeling of the probe or antibody by reactivity with another reagent that is directly
labeled. Examples of indirect labeling include detection of a primary antibody using a
10 fluorescently labeled secondary antibody and end-labeling of a DNA probe with biotin such
that it can be detected with fluorescently labeled streptavidin. The term "biological sample"
is intended to include tissues, cells and biological fluids. For example, techniques for
detection of SLAP-130 mRNA include Northern hybridizations and in situ hybridizations.
Techniques for detection of SLAP-130 protein include enzyme linked immunosorbent assays
15 (ELISAs), Western blots, immunoprecipitations and immunofluorescence.
The invention further provides methods for identifying agents that modulate an
interaction between SLAP-130 and SLP-76. In one embodiment, the method comprises:
(a) combining:
(i) a SLAP-130 protein, or SLP-76-interacting portion thereof; and
(ii) SLP-76, or a SLAP-130-interacting portion thereof;
in the presence and absence of a test compound;
(b) determining the degree of interaction between (i) and (ii) in the presence and
absence of the test compound; and
(c) identifying an agent that modulates an interaction between SLAP-130 and SLP-76.
25 Isolated SLAP-130 and/or SLP-76 proteins may be used in the method, or, alternatively, only
portions of SLAP-130 and/or SLP-76 may be used. For example, an isolated SLP-76 SH2
domain (or a larger subregion of SLP-76 that includes the SH2 domain) can be used as the
SLAP-130-interacting portion of SLP-76. Likewise, an isolated SH2 binding domain of
SLAP-130 (e.g., a peptide comprising a phosphotyrosine that interacts with the SLP-76 SH2
30 domain) can be used as the SLP-76-interacting portion of SLAP-130. In a preferred
embodiment, one or both of (i) and (ii) are fusion proteins, such as GST fusion proteins (e.g.,
GST-SLP-76-SH2 can be used as the SLAP-130-interacting portion of Fyn). The degree of
interaction between (i) and (ii) can be determined, for example, by labeling one of the
proteins with a detectable substance (e.g, a radiolabel), isolating the non-labeled protein and
35 qu~~ Lillg the amount of detectable substance that has become associated with the non-
labeled protein. The assay can be used to identify agents that either stimulate or inhibit the
interaction between SLAP-130 and SLP-76. An agent that stimulates the interaction between
SLAP-130 and SLP-76 is identified based upon its ability to increase the degree of
interaction between (i) and (ii) as compared to the degree of interaction in the absence of the
CA 02222823 1997-12-22
-28-
agent, whereas an agent that inhibits the interaction between SLAP-130 and SLP-76 is
identified based upon its ability to decrease the degree of interaction between (i) and (ii) as
compared to the degree of interaction in the absence of the agent. Assays systems for
identifying agents that modulate SH2 domain-ligand interactions that can be adapted to
SLAP-130/SLP-76 in accordance with the present invention are described further in U.S.
Patent No. 5,352,660 by Pawson.
Yet another aspect of the invention pertains to methods of modulating SLAP-130
activity in a cell. The modulatory methods of the invention involve contacting the cell with
an agent that modulates SLAP-130 activity such that SLAP-130 activity in the cell is
10 mo~ te~l The agent may act by modulating the activity of SLAP-130 protein in the cell or
by mocll~ ing transcription of the SLAP-130 gene or translation of the SLAP-130 mRNA.
As used herein, the term "modlll~tin~" is intended to include inhibiting or decreasing SLAP-
130 activity and stimulating or increasing SLAP-130 activity. Accordingly, in one
embodiment, the agent inhibits SLAP-130 activity. An inhibitory agent may function, for
15 example, by directly inhibiting SLAP-130 activity, by inhibiting an interaction between SLP-
76 and SLAP-130, by inhibiting SLP-76/SLAP-130-mediated sign~ling, and/or by inhibiting
TcR/CD3/SLP-76/SLAP-130-mediated signaling. In another embodiment, the agent
stimulates SLAP-130 activity. A stimulatory agent may function, for example, by directly
stimulating SLAP-130 activity, by promoting an interaction between SLP-76 and SLAP-130,
20 by promoting SLP-76/SLAP-130-mediated sign~ling, and/or by promoting TcR/CD3/SLP-
76/SLAP- 130-mediated signaling .
A. Inhibitory Agents
According to a modulatory method of the invention, SLAP-130 activity is inhibited in
a cell by contacting the cell with an inhibitory agent. Inhibitory agents of the invention can
be, for example, intracellular binding molecules that act to inhibit the expression or activity
of SLAP-130. As used herein, the term "intracellular binding molecule" is intended to
include molecules that act intracellularly to inhibit the expression or activity of a protein by
30 binding to the protein itself, to a nucleic acid (e.g, an mRNA molecule) that encodes the
protein or to a second protein with which the first protein normally interacts (e.g., molecules
that bind to SLP-76 to thereby inhibit the interaction between SLP-76 and SLAP-130).
Examples of intracellular binding molecules, described in further de~all below, include
antisense SLAP-130 nucleic acid molecules (e.g., to inhibit translation of SLAP-130 mRNA),
35 intracellular anti-SLAP-130 antibodies (e.g., to inhibit the activity of SLAP-130 protein),
molecules that mimic an SH2 binding site of SLAP-130 (e.g, to inhibit the interaction of
SLAP-130 with the SH2 domain of SLP-76) and dominant negative mutants ofthe SLAP-
130 protein.
CA 02222823 1997-12-22
- 29 -
In one embodiment, an inhibitory agent of the invention is an antisense nucleic acid
molecule that is complementary to a gene encoding SLAP-130, or to a portion of said gene,
or a recombinant expression vector encoding said antisense nucleic acid molecule. The use
of antisense nucleic acids to downregulate the expression of a particular protein in a cell is
well known in the art (see e.g., Weintraub, H. et al., Antisense RNA as a molecular tool for
genetic analysis, Reviews - Trends in Genetics, Vol. 1(1) 1986; Askari, F.K. and McDonnell,
W.M. (1996) N. Eng J. Med. 334:316-318; Bennett, M.R. and Schwartz, S.M. (1995)
Circulation 92:1981-1993; Mercola, D. and Cohen, J.S. (1995) Cancer Gene Ther. 2:47-59;
Rossi, J.J. (1995) Br. Med. Bull. 51 :217-225; Wagner, R.W. (1994) Nature 372:333-335).
10 An antisense nucleic acid molecule comprises a nucleotide sequence that is complementary to
the coding strand of another nucleic acid molecule (e.g., an mRNA sequence) and
accordingly is capable of hydrogen bonding to the coding strand of the other nucleic acid
molecule. Antisense sequences complementary to a sequence of an mRNA can be
complementary to a sequence found in the coding region of the mRNA, the 5' or 3'15 untranslated region of the mRNA or a region bridging the coding region and an untranslated
region (e.g., at the junction of the 5' untranslated region and the coding region). Furthermore,
an antisense nucleic acid can be complementary in sequence to a regulatory region of the
gene encoding the mRNA, for instance a transcription initiation sequence or regulatory
element. Preferably, an antisense nucleic acid is designed so as to be complementary to a
20 region preceding or spanning the initiation codon on the coding strand or in the 3'
untranslated region of an mRNA. An antisense nucleic acid for inhibiting the expression of
SLAP-130 protein in a cell can be designed based upon the nucleotide sequence encoding the
SLAP-130 protein (e.g., SEQ ID NO: 1, or a portion thereof), constructed according to the
rules of Watson and Crick base pairing.
An antisense nucleic acid can exist in a variety of different forms. For example, the
antisense nucleic acid can be an oligonucleotide that is complementary to only a portion of a
SLAP-130 gene. An antisense oligonucleotides can be constructed using chemical synthesis
procedures known in the art. An antisense oligonucleotide can be chemically synthesized
using naturally occurring nucleotides or variously modified nucleotides designed to increase
30 the biological stability of the molecules or to increase the physical stability of the duplex
formed between the antisense and sense nucleic acids, e.g. phosphorothioate derivatives and
acridine substituted nucleotides can be used. To inhibit SLAP-130 expression in cells in
culture, one or more antisense oligon.~ eotides can be added to cells in culture media,
typically at about 200 llg oligonucleotide/ml.
Alternatively, an antisense nucleic acid can be produced biologically using an
expression vector into which a nucleic acid has been subcloned in an antisense orientation
(i e., nucleic acid transcribed from the inserted nucleic acid will be of an antisense orientation
to a target nucleic acid of interest). Regulatory sequences operatively linked to a nucleic acid
cloned in the antisense orientation can be chosen which direct the expression of the antisense
CA 02222823 1997-12-22
RNA molecule in a cell of interest, for instance promoters and/or enhancers or other
regulatory sequences can be chosen which direct constitutive, tissue specific or inducible
expression of antisense RNA. For example, for inducible expression of antisense RNA, an
inducible eukaryotic regulatory system, such as the Tet system (e.g, as described in Gossen,
M. and Bujard, H. (1992) Proc. Natl. Acad. Sci. USA 82:5547-5551; Gossen, M. et al. (1995)
Science 268:1766-1769; PCT Publication No. WO 94/29442; and PCT Publication No. WO
96/01313) can be used. The antisense expression vector is prepared as described above for
recombinant expression vectors, except that the cDNA (or portion thereof) is cloned into the
vector in the antisense orientation. The antisense expression vector can be in the form of, for
10 example, a recombinant plasmid, phagemid or attenuated virus. The antisense expression
vector is introduced into cells using a standard transfection technique, as described above for
recombinant expression vectors.
In another embodiment, an antisense nucleic acid for use as an inhibitory agent is a
ribozyme. Ribozymes are catalytic RNA molecules with ribonuclease activity which are
15 capable of cleaving a single-stranded nucleic acid, such as an mRNA, to which they have a
complementary region (for reviews on ribozymes see e.g., Ohkawa, J. et al. (1995) J. Biochem.
118:251 258; Sigurdsson, S.T. and Eckstein, F. (1995) Trends Biotechnol. 13:286 289; Rossi,
J.J. (1995) Trends Biotechnol. 13:301-306; Kiehntopf, M. et al. (1995) J. Mol. Med. 73:65-71).
A ribozyme having specif1city for SLAP-130 mRNA can be designed based upon the nucleotide
20 sequence of the SLAP-130 cDNA. For example, a derivative of a Tetrahymena L-l 9 IVS RNA
can be constructed in which the base sequence of the active site is complementary to the base
sequence to be cleaved in a SLAP-130 mRNA. See for example U.S. Patent Nos. 4,987,071 and
5,116,742, both by Cech et al. Alternatively, SLAP-130 mRNA can be used to select a catalytic
RNA having a specific ribonuclease activity from a pool of RNA molecules. See for example
25 Bartel, D. and Szostak, J.W. (1993) Science 261: 1411 -1418.
Another type of inhibitory agent that can be used to inhibit the expression and/or activity
of SLAP-130 in a cell is an intracellular antibody specific for the SLAP-130 protein. The use of
intracellular antibodies to inhibit protein function in a cell is known in the art (see e.g, Carlson,
J. R. (1988) Mol. Cell. Biol. 8:2638-2646; Biocca, S. et al. (1990) EMBO J. 2:101-108; Werge,
30 T.M. et al. (1990) FEBSLetters 274:193-198; Carlson, J.R. (1993) Proc. Natl. Acad. Sci. USA
90:7427-7428; Marasco, W.A. et al. (1993) Proc. Natl. Acad. Sci. USA 2_:7889-7893; Biocca,
S. et al. (1994) Bio/Technology 12:396-399; Chen, S-Y. et al. (1994) Human Gene Therapy
5:595 6' 1; Duan, L et al. (1994) Proc. Natl. Acad. Sci. USA 21 :5075-5079; Chen, S-Y. et al.
(1994) Proc. Natl. Acad. Sci. USA 91:5932-5936; Beerli, R.R. et al. (1994) J. Biol. Chem.
35 262:23931 -23936; Beerli, R.R. et al. (1994) Biochem. Biophys. Res. Commun. 204:666-672;
Mh:~shilk~r, A.M. et al. (1995) EMBO J. 14:1542 1551; Richardson, J.H. et al. (1995) Proc.
Natl. Acad. Sci. USA 22:3137-3141; PCT Publication No. WO 94/02610 by Marasco et al., and
PCT Publication No. WO 95/03832 by Duan et al.).
CA 02222823 1997-12-22
- 31 -
To inhibit protein activity using an intracellular antibody, a recombinant expression
vector is prepared which encodes the antibody chains in a form such that, upon introduction
of the vector into a cell, the antibody chains are expressed as a functional antibody in an
intracellular compartment of the cell. For inhibition of SLAP-130 activity according to the
5 inhibitory methods of the invention, an intracellular antibody that specifically binds the
SLAP-130 protein is expressed in the cytoplasm ofthe cell. To prepare an intracellular
antibody expression vector, antibody light and heavy chain cDNAs encoding antibody chains
specific for the target protein of interest, e.g, SLAP-130, are isolated, typically from a
hybridoma that secretes a monoclonal antibody specific for the SLAP-130 protein.Hybridomas secreting anti-SLAP-130 monoclonal antibodies, or recombinant anti-SLAP-130
monoclonal antibodies, can be prepared as described above. Once a monoclonal antibody
specific for SLAP-130 protein has been identified (e.g, either a hybridoma-derived
monoclonal antibody or a recombinant antibody from a combinatorial library), DNAs
encoding the light and heavy chains of the monoclonal antibody are isolated by standard
molecular biology techniques. For hybridoma derived antibodies, light and heavy chain
cDNAs can be obtained, for example, by PCR amplification or cDNA library screening. For
recombinant antibodies, such as from a phage display library, cDNA encoding the light and
heavy chains can be recovered from the display package (e.g, phage) isolated during the
library screening process. Nucleotide sequences of antibody light and heavy chain genes
from which PCR primers or cDNA library probes can be prepared are known in the art. For
example, many such sequences are disclosed in Kabat, E.A., et al. (1991) Sequences of
Proteins of Immunological Interest, Fifth Edition, U.S. Department of Health and Human
Services, NIH Publication No. 91-3242 and in the "Vbase" human germline sequencedatabase.
Once obtained, the antibody light and heavy chain sequences are cloned into a
recombinant expression vector using standard methods. To allow for cytoplasmic expression
of the light and heavy chains, the nucleotide sequences encoding the hydrophobic leaders of
the light and heavy chains are removed. An intracellular antibody expression vector can
encode an intracellular antibody in one of several different forms. For example, in one
embodiment, the vector encodes full-length antibody light and heavy chains such that a full-
length antibody is expressed intracellularly. In another embodiment, the vector encodes a
full-length light chain but only the VH/CH1 region of the heavy chain such that a Fab
fragment is expressed intracellularly. In the most preferred embodiment, the ~rector encod~,s a
single chain antibody (scFv) wherein the variable regions of the light and heavy chains are
linked by a flexible peptide linker (e.g, (Gly4Ser)3) and expressed as a single chain molecule.
To inhibit SLAP-130 activity in a cell, the expression vector encoding the anti-SLAP-130
intracellular antibody is introduced into the cell by standard transfection methods, as
discussed hereinbefore.
CA 02222823 1997-12-22
Other inhibitory agents that can be used to inhibit the activity of a SLAP-130 protein
are chemical compounds that inhibit the interaction between SLAP-130 and SLP-76. Such
compounds can be identified using screening assays that select for such compounds, as
described in detail above. Additionally or alternatively, compounds that inhibit the
S interaction of SLAP-130 with the SLP-76 SH2 domain can be designed using approaches
known in the art. SH2 domains are known to interact with phosphotyrosine-containing
peptides, with the specificity of a particular SH2 domain for a target binding site being
influenced by the amino acid residues surrounding the phosphotyrosine residue (see e.g,
Songyang, Z. et al. (1993) Cell 72:767-778). A consensus motif for the binding site of the
10 SLP-76 SH2 domain can be determined using methods known in the art (see Songyang, Z. et
al. (1993) Cell 72:767-778). Based on the amino acid sequence of a consensus motif for the
SLP-76 SH2 domain binding site, potential SH2 binding sites within SLAP-130 can be
identified.
A competitive inhibitor of SLAP-130/SLP-76 SH2 interactions can be designed based
15 on the amino acid sequence(s) of an SH2 binding site(s) of SLAP-130 or the amino acid
sequence of a consensus SH2 binding motif for SLP-76. In one embodiment, such aninhibitory molecule comprises a nonhydrolyzable phosphonopeptide having an appropriate
amino acid sequence for recognition by the SLP-76 SH2 domain. In this compound, the
tyrosine residue within the SH2 binding site is replaced with phosphonomethyl-phenylalanine
20 (Pmp), a nonnatural analogue of phosphotyrosine that is resistant to hydrolysis by
phosphatases. Nonhydrolyzable phosphonopeptide inhibitors of SH2 domain interactions can
be prepared as described in Domchek, S.M. et al. (1992) Biochemistry 31 :9865-9870. Such
nonhydrolyzable phosphonopeptides can competitively inhibit the interaction between the
SLP-76 SH2 domain and its target phosphotyrosine-containing binding site within SLAP-130
25 and, moreover, are proteolytically stable (i. e., the phosphonopeptide is resistant to the action
of phosphatases). In other embodiments, an inhibitory molecule can comprise a
peptidomimetic of the SH2 binding site, such as a benzodiazepine mimetic of a dipeptidyl
amide backbone or a boronotyrosine-containing analogue of the phosphotyrosine-containing
SH2 binding site (e.g., as described in PCT Publication WO 95/25118 by Bachovchin).
30 These peptidomimetics can competitively inhibit the interaction between the SLP-76 SH2
domain and its target phosphotyrosine-containing binding site within SLAP-130 yet are
resistant to degradation.
Yet another form of an inhibitory agent of the inv~;n.lon is an inhibitory form of a
SLAP-130 protein, also referred to herein as a dominant negative inhibitor. A dominant
35 negative inhibitor can be a form of a SLAP-130 protein that retains the ability to interact with
the SH2 domain of SLP-76 but that lacks one or more other functional activities such that the
dominant negative form of SLAP-130 cannot participate in normal signal transduction. This
dominant negative form of a SLAP-130 protein may be, for example, a mutated form of
SLAP-130 in which the SH2 binding site that interacts with the SH2 domain of SLP-76 is
CA 02222823 1997-12-22
- 33 -
conserved but in which one or more amino acid residues elsewhere in the protein are mutated.
Such dominant negative SLAP-130 proteins can be expressed in cells using a recombinant
expression vector encoding the mutant SLAP-130 protein, which is introduced into the cell
by standard transfection methods. Mutation or deletion of specific codons within the SLAP-
5 130-encoding cDNA can be performed using standard mutagenesis methods. The mutated
cDNA is inserted into a recombinant expression vector, which is then introduced into a cell to
allow for expression ofthe mutated SLAP-130 protein. The ability ofthe mutant SLAP-130
protein to interact with SLP-76 can be assessed using standard in vitro interaction assays,
such as that using GST-SLP-76-SH2 described above. The effect ofthe mutant SLAP-130
10 protein on normal T cell signal transduction can be assessed, for example, by expressing the
mutant SLAP-130 protein in T cells in culture (e.g., peripheral blood T cells or Jurkat cells),
stimulating the T cells (e.g, using anti-CD3 antibodies) and measuring at least one indicator
of T cell activation (e.g, calcium flux, tyrosine phosphorylation, IL-2 production). A mutant
form of SLAP-130 that retains the ability to interact with SLP-76 but that interferes with
15 normal T cell signal transduction when expressed in the T cell can be selected as a dominant
negative inhibitor of SLAP-130 activity.
B. Stimulatory Agents
According to a modulatory method ofthe invention, SLAP-130 activity is stimulated
in a cell by contacting the cell with a stimulatory agent. Examples of such stimulatory agents
include active SLAP-130 protein and nucleic acid molecules encoding SLAP-130 that are
introduced into the cell to increase SLAP-130 activity in the cell. A preferred stimulatory
agent is a nucleic acid molecule encoding a SLAP-130 protein, wherein the nucleic acid
molecule is introduced into the cell in a form suitable for expression ofthe active SLAP-130
protein in the cell. To express a SLAP-130 protein in a cell, typically a SLAP-130 cDNA is
first introduced into a recombinant expression vector using standard molecular biology
techniques, as described herein. A SLAP-130 cDNA can be obtained, for example, by
amplification using the polymerase chain reaction (PCR) or by screening an appropriate
cDNA library as described herein. Following isolation or amplification of SLAP-130 cDNA,
the DNA fragment is introduced into an expression vector and transfected into target cells by
standard methods, as described herein.
Other stimulatory ~gt,i1ts that can be used to stimulate the activity of a SLAP-130
protein are chemical compounds that stimulate SLAP-130 activity in cells, such as
compounds that promote the interaction between SLAP-130 and SLP-76. Such compounds
can be identified using screening assays that select for such compounds, as described in detail
above.
CA 02222823 1997-12-22
- 34 -
In addition to use of an agent that modulates the expression or activity of SLAP-130
protein, the modulatory methods of the invention can involve the use of one or more
additional agents that modulate T cell activation. For example, the modulatory methods of
the invention can involve the use of an agent that modulates SLAP-130 activity in
5 combination with an agent that modulates tyrosine phosphorylation in T cells (e.g, an agent
that inhibits protein tyrosine kinase activity, such as herbimycin A, or a derivative or
analogue thereofl, an agent that modulates intracellular calcium levels in T cells (e.g., a
calcium ionophore), a phorbol ester (e.g, PMA), a cytokine that modulates T cell activation
(e.g, IL-2 and/or IL-4) and the like. Various agents that modulate T cell activation are
10 known in the art.
The modulatory methods of the invention can be performed in vitro (e.g, by culturing
the cell with the agent or by introducing the agent into cells in culture) or, alternatively, in
vivo (e.g., by a~mini.stering the agent to a subject or by introducing the agent into cells of a
15 subject, such as by gene therapy). For practicing the modulatory method in vitro, cells can be
obtained from a subject by standard methods and incubated (i.e., cultured) in vitro with a
modulatory agent of the invention to modulate SLAP-130 activity in the cells. For example,
peripheral blood mononuclear cells (PBMCs) can be obtained from a subject and isolated by
density gradient centrifugation, e.g, with Ficoll/Hypaque. Specific cell populations can be
20 depleted or enriched using standard methods. For example, monocytes/macrophages can be
isolated by adherence on plastic. T cells can be enriched for example, by positive selection
using antibodies to T cell surface markers, for example by incubating cells with a specific
primary monoclonal antibody (mAb), followed by isolation of cells that bind the mAb using
magnetic beads coated with a secondary antibody that binds the primary mAb. Specific cell
25 populations (e.g, T cells) can also be isolated by fluorescence activated cell sorting according
to standard methods. Monoclonal antibodies to T cell-specif1c surface markers known in the
art and many are commercially available. If desired, cells treated in vitro with a modulatory
agent of the invention can be re~(lministered to the subject. For a~1ministration to a subject, it
may be preferable to first remove residual agents in the culture from the cells before
30 ~(lministering them to the subject. This can be done for example by a Ficoll/Hypaque
gradient centrifugation of the cells. For further discussion of ex vivo genetic modification of
cells followed by rea(lministration to a subject, see also U.S. Patent No. 5,399,346 by W.F.
Anderson et al.
For practicing the modulatory method in vivo in a subject, the modulatory agent can
35 be ~ministered to the subject such that SLAP-130 activity in cells ofthe subject is
mod~ te-l The term "subject" is intended to include living or~nisms in which an immune
response can be elicited. Preferred subjects are m~mm~ls. Examples of subjects include
hllm~n~, monkeys, dogs, cats, mice, rats, cows, horses, goats and sheep.
CA 02222823 1997-12-22
For stimulatory or inhibitory agents that comprise nucleic acids (including
recombinant expression vectors encoding SLAP-130 protein, antisense RNA, intracellular
antibodies or dominant negative inhibitors), the agents can be introduced into cells of the
subject using methods known in the art for introducing nucleic acid (e.g, DNA) into cells in
5 vivo. Examples of such methods encompass both non-viral and viral methods, including:
Direct Injection: Naked DNA can be introduced into cells in vivo by directly
injecting the DNA into the cells (see e.g., Acsadi et al. (1991) Nature 332:815-818; Wolff et
al. (1990) Science 247:1465-1468). For example, a delivery apparatus (e.g, a "gene gun")
for injecting DNA into cells in vivo can be used. Such an apparatus is commercially
10 available (e.g., from BioRad).
Cationic Lipids: Naked DNA can be introduced into cells in vivo by complexing the
DNA with cationic lipids or encapsulating the DNA in cationic liposomes. Examples of
suitable cationic lipid formulations include N-[-1-(2,3-dioleoyloxy)propyl]N,N,N-
triethylammonium chloride (DOTMA) and a 1: 1 molar ratio of 1,2-dimyristyloxy-propyl-3-
15 dimethylhydroxyethylammonium bromide (DMRIE) and dioleoyl phosphatidylethanolamine(DOPE) (see e.g., Logan, J.J. et al. (1995) Gene Therapy _:38-49; San, H. et al. (1993)
Human Gene Therapy 4:781-788).
Receptor-Mediated DNA Uptake: Naked DNA can also be introduced into cells in
vivo by complexing the DNA to a cation, such as polylysine, which is coupled to a ligand for
20 a cell-surface receptor (see for example Wu, G. and Wu, C.H. (1988) J. Biol. Chem.
263:14621, Wilson et al. (1992) J. Biol. Chem. 267:963-967; and U.S. Patent No. 5,166,320).
Binding of the DNA-ligand complex to the receptor facilitates uptake of the DNA by
receptor-mediated endocytosis. A DNA-ligand complex linked to adenovirus capsids which
naturally disrupt endosomes, thereby releasing material into the cytoplasm can be used to
25 avoid degradation of the complex by intracellular lysosomes (see for example Curiel et al.
(1991) Proc. Natl. Acad. Sci. USA 88:8850; Cristiano et al. (1993) Proc. Natl. Acad. Sci.
USA 90:2122-2126).
Retrovir2~ses: Defective retroviruses are well characterized for use in gene transfer for
gene therapy purposes (for a review see Miller, A.D. (1990) Blood 76:271). A recombinant
30 retrovirus can be constructed having a nucleotide sequences of interest incorporated into the
retroviral genome. Additionally, portions of the retroviral genome can be removed to render
the retrovirus replication defective. The replication defective retrovirus is then packaged into
virions which can be used to infect a target cell through the use of a helper Vil.l~ by standard
techniques. Protocols for producing recombinant retroviruses and for infecting cells in vitro
35 or in vivo with such viruses can be found in Current Protocols in Molecular Biolo~y,
Ausubel, F.M. et al. (eds.) Greene Publishing Associates, (1989), Sections 9.10-9.14 and
other standard laboratory manuals. Examples of suitable retroviruses include pLJ, pZIP,
pWE and pEM which are well known to those skilled in the art. Examples of suitable
packaging virus lines include ~Crip, ~Cre, ~2 and ~Am. Retroviruses have been used to
CA 02222823 1997-12-22
- 36 -
introduce a variety of genes into many different cell types, including epithelial cells,
endothelial cells, Iymphocytes, myoblasts, hepatocytes, bone marrow cells, in vitro and/or in
vivo (see for example Eglitis, et al. (1985) Science 230:1395-1398; Danos and Mulligan
(1988) Proc. Natl. Acad. Sci. USA 85:6460-6464; Wilson et al. (1988) Proc. Natl. Acad. Sci.
USA 85:3014-3018; Armentano et al. (1990) Proc. Natl. Acad. Sci. USA 87:6141-6145;
Huber et al. (1991) Proc. Natl. Acad. Sci. USA 88:8039-8043; Ferry et al. (1991) Proc. Natl.
Acad. Sci. USA 88:8377-8381; Chowdhury et al. (1991) Science 254:1802-1805; van
Beusechem et al. (1992) Proc. Natl. Acad. Sci. USA 89:7640-7644; Kay et al. (1992) Human
Gene Therapy 3:641-647; Dai et al. (1992) Proc. Natl. Acad. Sci. USA 89:10892-10895; Hwu
10 etal. (1993)J. Immunol. 150:4104-4115; U.S. PatentNo. 4,868,116; U.S. PatentNo.
4,980,286; PCT Application WO 89/07136; PCT Application WO 89/02468; PCT
Application WO 89/05345; and PCT Application WO 92/07573). Retroviral vectors require
target cell division in order for the retroviral genome (and foreign nucleic acid inserted into
it) to be integrated into the host genome to stably introduce nucleic acid into the cell. Thus, it
15 may be necessary to stimulate replication of the target cell.
Adenoviruses: The genome of an adenovirus can be manipulated such that it encodes
and expresses a gene product of interest but is inactivated in terms of its ability to replicate in
a normal lytic viral life cycle. See for example Berkner et al. (1988) BioTechniques 6:616;
Rosenfeld et al. (1991) Science 252:431-434; and Rosenfeld et al. (1992) Cell 68:143-155.
20 Suitable adenoviral vectors derived from the adenovirus strain Ad type 5 dl324 or other
strains of adenovirus (e.g, Ad2, Ad3, Ad7 etc.) are well known to those skilled in the art.
Recombinant adenoviruses are advantageous in that they do not require dividing cells to be
effective gene delivery vehicles and can be used to infect a wide variety of cell types,
including airway epithelium (Rosenfeld et al. (1992) cited supra), endothelial cells
25 (Lemarchand et al. (1992) Proc. Natl. Acad. Sci. USA 89:6482-6486), hepatocytes (Herz and
Gerard (1993) Proc. Natl. Acad. Sci. USA 90:2812-2816) and muscle cells (Quantin et al.
(1992) Proc. Natl. Acad. Sci. USA 89:2581-2584). Additionally, introduced adenoviral DNA
(and foreign DNA contained therein) is not integrated into the genome of a host cell but
remains episomal, thereby avoiding potential problems that can occur as a result of
30 insertional mutagenesis in situations where introduced DNA becomes integrated into the host
genome (e.g, retroviral DNA). Moreover, the carrying capacity of the adenoviral genome for
foreign DNA is large (up to 8 kilobases) relative to other gene delivery vectors (Berkner et al.
cited supra; Haj-Ahmand and Graham (1986) ~. I irol. 57:267). Most replication-defective
adenoviral vectors currently in use are deleted for all or parts of the viral E1 and E3 genes but
35 retain as much as 80 % of the adenoviral genetic material.
Adeno-Associated Viruses: Adeno-associated virus (AAV) is a naturally occurring
defective virus that requires another virus, such as an adenovirus or a herpes virus, as a helper
virus for efficient replication and a productive life cycle. (For a review see Muzyczka et al.
Curr. TopicsinMicro. andImmunol. (1992) 158:97 129). Itisalsooneofthefewviruses
CA 02222823 1997-12-22
- 37 -
that may integrate its DNA into non-dividing cells, and exhibits a high frequency of stable
integration(seeforexampleFlotteetal. (1992) Am. J. Respir. Cell. Mol. Biol. 7:349-356;
Samulski et al. (1989) J. Virol. 63:3822-3828, and McT ~llghlin et al. (1989) J. Virol.
62:1963-1973). Vectors containing as little as 300 base pairs of AAV can be packaged and
5 can integrate. Space for exogenous DNA is limited to about 4.5 kb. An AAV vector such as
that described in Tratschin et al. (1985) Mol. Cell. Biol. 5:3251-3260 can be used to introduce
DNA into cells. A variety of nucleic acids have been introduced into different cell types
using AAV vectors (see for example Hermonat et al. (1984) Proc. Natl. Acad. Sci. USA
81:6466-6470; Tratschin et al. (1985) Mol. Cell. Biol. 4:2072-2081; Wondisford et al. (1988)
Mol. ~ndocrinol. 2:32-39;Tratschinetal. (1984)~ Virol. 51:611 619;andFlotteetal.(1993)J. Biol. Chem. 268:3781-3790).
The efficacy of a particular expression vector system and method of introducing
nucleic acid into a cell can be assessed by standard approaches routinely used in the art. For
example, DNA introduced into a cell can be detected by a filter hybridization technique (e.g,
Southern blotting) and RNA produced by transcription of introduced DNA can be detected,
for example, by Northern blotting, RNase protection or reverse transcriptase-polymerase
chain reaction (RT-PCR). The gene product can be detected by an appropfiate assay, for
example by immunological detection of a produced protein, such as with a specific antibody,
or by a functional assay to detect a functional activity of the gene product.
A modulatory agent, such as a chemical compound that modulates the SLAP-
130/SLP-76 interaction, can be ~(lmini~tered to a subject as a pharrnaceutical composition.
Such compositions typically comprise the modulatory agent and a pharmaceuticallyacceptable carrier. As used herein the term "pharmaceutically acceptable carrier" is intended
to include any and all solvents, dispersion media, coatings, antibacterial and antifungal
agents, isotonic and absorption delaying agents, and the like, compatible with pharmaceutical
~mini~tration. The use of such media and agents for pharmaceutically active substances is
well known in the art. Except insofar as any conventional media or agent is incompatible
with the active compound, use thereof in the compositions is contemplated. Supplementary
active compounds can also be incorporated into the compositions. Pharmaceutical
compositions can be prepared as described above in subsection IV.
As demonstrated in Example 5, overexpression of SLAP-130 in a T cell line inhibits
TCR-induced ac.i~ ation of a promoter containing NFAT sites and, furthermore, blocks the
augmentation of activity of this promoter that is seen when SLP-76 is overexpressed in these
cells, indicating that at least under certain conditions SLAP-130 can function as a negative
regulator of TCR-mediated signaling. Accordingly, modulation of SLAP-130 activity may
be beneficial in a variety of clinical situations in which is desirable to modulate T cell
immune responses, including immunodeficiencies, infectious diseases (e.g, viral infections),
cancer, autoimmune diseases, transplantations (e.g, graft rejection or graft-versus-host
CA 02222823 1997-12-22
-38-
disease) and allergies, as discussed further below. The overexpression experiments implicate
SLAP-130 as a negative regulator of TCR-mediated sign~ling, suggesting that, under
al~plopl;ate conditions, downregulation of SLAP-130 activity would stimulate TCR-mediated
si~;n~ling, whereas upregulation of SLAP-130 would inhibit TCR-mediated sign~ling.
Accordingly, in preferred modulatory methods ofthe invention, a SLAP-130 inhibitory agent
is used to stimulate T cell activation, whereas a SLAP-130 stimulatory agent is used to inhibit
T cell activation. It should be appreciated however, that under different conditions or in
different cell environments, SLAP-130 may also have positive effects and, therefore,
modulatory methods in which a SLAP-130 stimulatory agent is used to stimulate T cell
10 activation or a SLAP-130 inhibitory agent is used to inhibit T cell activation are also
encompassed by the invention.
Immunodeficiencies: Stimulation of T cell activation through the use of a modulatory
agent that modulates SLAP-130 activity may be beneficial in a variety of clinical disorders
characterized by general or specific immunodeficiency, including human immunodeficiency
15 virus infection and congenital immunodeficiency diseases.
~nfectious Diseases: Stimulation of T cell activation through the use of a modulatory
agent that modulates SLAP-130 activity may be beneficial in a variety of infectious disease,
as a means to promote a T cell response against the infectious agent. Such infectious diseases
include bacterial, viral, fungal and parasitic infections.
Cancer: Stimulation of T cell activation through the use of a modulatory agent that
modulates SLAP-130 activity may be beneficial in a variety of malignancies, as a means to
promote a T cell response against malignant cells. Alternatively, for T cell leukemias and
lymphomas, inhibition of T cell activation through use of a modulatory agent that modulates
SLAP-130 activity may be beneficial, as a means to inhibit growth or progression of these
25 malignancies.
Autoimmune Diseases: Inhibition of T cell activation through the use of a modulatory
agent that modulates SLAP-130 activity may be beneficial in a variety of autoimmune
disorders, as a means to downregulate T cell response against autoantigens. It is well known
in the art that many autoimmune disorders are the result of inappropriate activation of T cells
30 that are reactive against self tissue and that promote the production of cytokines and
autoantibodies involved in the pathology of the diseases. Non-limiting examples of
autoimmune diseases and disorders having an autoimmune component that may be treated
according to the modulatory methods of the invention include diabetes mellitus, arthritis
(including rheumatoid arthritis, juvenile rheumatoid arthritis, osteoarthritis, psoriatic
35 arthritis), multiple sclerosis, myasthenia gravis, systemic lupus erythematosis, autoimmune
thyroiditis, dermatitis (including atopic dermatitis and eczematous dermatitis), psoriasis,
Sjogren's Syndrome, including keratoconjunctivitis sicca secondary to Sjogren's Syndrome,
alopecia areata, allergic responses due to arthropod bite reactions, Crohn's disease, aphthous
CA 02222823 1997-12-22
- 39 -
ulcer, iritis, conjunctivitis, keratoconjunctivitis, ulcerative colitis, asthma, allergic asthma,
cutaneous lupus erythematosus, scleroderma, vaginitis, proctitis, drug eruptions,
leprosy reversal reactions, erythema nodosum leprosum, autoimmune uveitis, allergic
encephalomyelitis, acute necrotizing hemorrhagic encephalopathy, idiopathic bilateral
5 progressive sensorineural hearing loss, aplastic anemia, pure red cell anemia, idiopathic
thrombocytopenia, polychondritis, Wegener's granulomatosis, chronic active hepatitis,
Stevens-Johnson syndrome, idiopathic sprue, lichen planus, Crohn's disease, Graves
ophthalmopathy, sarcoidosis, primary biliary cirrhosis, uveitis posterior, and interstitial lung
fibrosis.
The efficacy of a modulatory agent in ameliorating autoimmune diseases can be tested
in an animal models of human diseases. Such animal models include experimental allergic
encephalomyelitis as a model of multiple sclerosis, the NOD mice as a model for diabetes,
the mrl/lpr/lpr mouse as a model for lupus erythematosus, murine collagen-induced arthritis
as a model for rheumatoid arthritis, and murine experimental myasthenia gravis (see Paul ed.,
Fundamental Immunology, Raven Press, New York, 1989, pp. 840-856). A modulatory (i. e.,
stimulatory or inhibitory) agent of the invention is ~mini~tered to test ~nim~l~ and the course
of the disease in the test :~nim~l~ is then monitored by the standard methods for the particular
model being used. Effectiveness of the modulatory agent is evidenced by amelioration of the
disease condition in ~nim~ treated with the agent as compared to untreated animals (or
20 ~nim~l~ treated with a control agent).
Transplantation: Inhibition of T cell activation through the use of a modulatory agent
that modulates SLAP-130 activity may be beneficial in transplantation, as a means to
downregulate T cell responses against an allograft or to inhibit graft-versus-host disease.
Accordingly, the modulatory methods of the invention can be used both in solid organ
25 transplantation and in bone marrow transplantation.
Allergies: Allergies are mediated through IgE antibodies whose production is
regulated by the activity of T cells and the cytokines produced thereby. Accordingly, the
modulatory methods of the invention can be used to inhibit T cell activation as a means to
downregulate allergic responses. A modulatory agent may be directly ~lmini~tered to the
30 subject or T cells may be obtained from the subject, contacted with an modulatory agent ex
vivo, and re~(lmini~tered to the subject. Moreover, in certain situations it may be beneficial to
co~mini~ter to the subject the allergen together with the modulatory agent or cells treated
with the modulatory agent to desensitize the allergen-specific respollse.
3~ In addition to the foregoing disease situations, the modulatory methods of the
invention may be used for other purposes. For example, the modulatory methods that result
in increased T cell activation can be used in the production of T cell cytokines in vitro.
Furthermore, the modulatory methods of the invention may be applied to vaccinations to
promote T cell responses to an antigen of interest in a subject. That is, a modulatory agent of
CA 02222823 1997-12-22
- 40 -
the invention may be used in combination with a vaccine to promote T cell responses against
the vaccinating antigen.
This invention is further illustrated by the following examples which should not be
5 construed as limiting. The contents of all references, patents and published patent
applications cited throughout this application are hereby incorporated by reference.
EXAMPLE 1: Cloning and Characterization of a SLAP-130 cDNA
To facilitate purification of molecules that associates with the SH2 domain of SLP-76,
a variant of the Jurkat T cell line, JA2/SLP-SH2, was established which expresses a chimeric
surface protein consisting of the extracellular and transmembrane domains of the HLA-A2
molecule in frame with the SH2 domain of SLP-76. The SH2 domain of SLP-76 was
amplified by PCR using the oligonucleotides GGGAGATCTGA
15 GAATTCATTAAATGAAGAG (SEQ ID NO: S) and CCCAGATCTGCACTGGTATC
TGGAACCTCG (SEQ ID NO: 6) cont:~ining Bgl II restriction sites for litigation of this
fragment in frame with the cDNA of HLA-A2 present in pcDNA3/A2/CD45. In this and all
subsequent examples, Jurkat T cells were maintained in RPMI 1640 medium supplemented
with 10% fetal calf serum, penicillin (1000 U/ml), streptomycin (1000 U/ml), and glutamine
20 (20 mM), whereas the JA2/SLP-SH2 Jurkat variant was maintained in the above medium
suppiemented with 2 mg/ml geneticin, (GIBCO, Gaithersburg, MD).
The A2 epitope of the JA2/SLP-SH2 chimeric protein enabled the isolation of
proteins associated with the SLP-76 SH2 domain by large scale immunoprecipitation with
anti-A2 mAb CR11 -351 (a gift of C. Lutz, University of Iowa, Iowa City, IA). JA2/SLP-
25 SH2 cells were stimulated with pervanadate for m~im~l tyrosine phosphorylation ofnumerous proteins in T cells and lysed in NP40 lysis buffer. A large scale anti-A2
immunoprecipitation of the pervanadate stimulated JA2/SH2 cells was subjected to SDS-
PAGE, transferred to polyvinylidene difluoride membrane (Millipore, Bedford, MA), and
visualized by Ponceau S staining. A single major species of approximately 130 kDa was
30 excised and subjected to tryptic digestion and reverse phase high performance liquid
chromatography for protein sequencing. Individual peptides were sequenced using a Procise
492 Protein Sequencer (Perkin Elmer, Foster City, CA).
One peptide sequence, PPNVLJL rK (SEQ ID NO: 4), was represented in the dbEST
database by an Expressed Sequence Tag (EST) clone that was obtained from Genome
Systems, Inc., St. Louis, MO (I.M.A.G.E. consortium ID# 241254). This clone was then
sequenced completely, revealing an open reading frame of 1074 base pairs. A region of this
clone was amplified with primers CCACCAAATGTTGACCTGA CGAAATTC (SEQ ID
NO: 7) and TCTGGGAGGTAGGCTTGGGAC (SEQ ID NO: 8), and then used to screen a
human thymus ~gtlO cDNA library (#NL1127a, Promega, Madison, WI).
CA 02222823 1997-12-22
- 41 -
A cDNA clone cont~inin~; 370 base pairs of the EST sequence and an additional 1008
base pairs of 5' coding sequence was isolated and found to contain a putative start site, 27
bases downstream of a stop codon, suggesting that the clone contained the 5' coding sequence
of ppl30. The rem~ining 3' cDNA was amplified from Jurkat cDNA by 3' RACE (rapidamplification of cDNA ends) using a SLAP- 130 specific primer (GATGCTGATGATGGTT
TCCCTGCTCCTC; SEQ ID NO: 9) and the universal primer included in the Marathon
cDNA Amplification Kit (Clontech, Palo Alto, CA). The nucleotide and predicted amino
acid sequence ofthe entire isolated SLAP-130 cDNA is shown in Figure 1 (and SEQ ID
NOs: 1 and 2, respectively). The region encompassing the peptide cont~ining the sequence
10 PPNVDLTK is indicated by an underline. Independent amplification of this region, as well
as the entire coding sequence of SLAP-130 from Jurkat total RNA, was performed by reverse
transcription-polymerase chain reaction(RT-PCR) using the GeneAmp kit (Perkin Elmer,
Norwalk, CT) to confirm the sequence of the cDNA.
The complete open reading frame consists of 2349 bp (nucleotides 31 -2379 of SEQ1~ ID NO: 1), translating to a protein of 783 amino acids with an abundance of proline (13%),
acidic (15%), and basic (15%) residues. This protein was designated SLAP-130 for SLP-76
associated ~hosphoprotein of 130 kDa.
EXAMPLE 2: Tissue Distribution of SLAP-130 mRNA
Northern blot analysis of human mRNA from multiple tissues was performed to
determine the tissue distribution of SLAP-130. Northern blot analysis was performed
following the protocols included with the Human Multiple Tissue Northern (MTN) Blots I
and II (Clontech). The PCR fragment utilized to screen the ~gtlO cDNA library was labeled
25 with [a-32P]dCTP (Amersham, Arlington Heights, IL) by random priming using anOligolabeling Kit (Pharmacia Biotech) and utilized for hybridization to poly A+ RNA of
tissues represented in the MTN blots. Hybridization with SLAP-130 mRNA was detected by
autoradiography .
The results of the Northern blot analysis are shown in Figure 2. The results
30 demonstrate that SLAP-130 mRNA is expressed in hematopoietic tissues (peripheral blood
mononuclear cells, spleen, and thymus) but not in non-lymphoid tissues (colon, small
intestines, ovary, testis, prostate, pancreas, kidney, skeletal muscle, liver, lung, placenta,
brain, .le rt). Additionally, the entire coding sequence was amplified as a single product
from total Jurkat RNA, demonstrating expression in this human T cell line.
3~
EXAMPLE 3: Immunoprecipitation of Epitope-Tagged Recombinant SLAP-130
In this example, the isolated cDNA described in Example 1 was expressed
recombinantly in m:~mm;~ n cells as an epitope-tagged fusion protein and
CA 02222823 1997-12-22
- 42 -
immunoprecipated, via the epitope-tag, to analyze the size of the expressed protein.
Translation of the open reading frame of the isolated SLAP-130 clone predicted a protein
with an appal~lll molecular mass of only 86 kDa (i.e., smaller than the native 130 kDa SLAP-
130 protein). However, the presence of multiple stop codons fl~nking either side of the
coding sequence suggested that we had isolated the full length cDNA encoding the native
130 kDa, SLP-76 associated protein. As described further below, this was confirmed by
generating an epitope (FLAG) tagged version of SLAP-130 cDNA for transient expression in
Jurkat T cells (pEF/SLAP-130) and immunoprecipation ofthe fusion protein, which
demonstrated that a 130 kDa protein was produced in m~mm~ n cells by expression of the
10 isolated cDNA.
The pEF-BOS expression vector containing the full length cDNA of SLAP-130 with
an amino-terminal FLAG-tag (pEF/SLAP-130) was generated by PCR amplification ofthe
amino-terminal 1350 nucleotides of SLAP-130 with primers CGGGATCCGCGA
AATATAACACGGGGGGC (SEQ ID NO: 10) and CGGGATCCGTCTATCCTTGA
15 CTCATCTCTGCTG (SEQ ID NO: 11). A BamHI site in the 5' primer and an internal XbaI
site at position 1350 were utilized for ligation ofthis portion of SLAP-130 in frame with the
FLAG epitope tag in pEF/SLP-76 (Motto, D.G. et al. (1996) J. Exp. Med M83:1937 1943).
The rem~inin~; 3' cDNA was joined to the FLAG tagged 5' sequence by overlap extension
PCR to generate the full length SLAP-130 cDNA (pEF/SLAP-130).
Jurkat T cells were transiently transfected with pEF/SLAP-130 and the FLAG
epitope-tagged SLAP-130 protein was precipitated using either an anti-FLAG mAb M2
(International Biotechnologies Inc., New Haven, CT).or a SLP-76 SH2 domain GST fusion
protein. The cells were either left unstimulated or stimulated with pervanadate (Secrist, J.P.
et al. (1993) J. Biol Chem. 268:5886-5893) for 1 min. and then lysed in NP40 lysis buffer
25 (1% NP40, 150 mM NaCI, 10 mM Tris, pH 7.4) including protease inhibitors (50 ~lg/ml
leupeptin, 50 ~lg/ml pepstatin A, 1 mM PMSF) and phosphatase inhibitors 400 IlM sodium
v~n~ te, 10 mM sodium fluoride, 10 mM sodium pyrophosphate). For immuno-
precipitations, antibodies were conjugated to GammaBind Plus Sepharose (Pharmacia
Biotech, Uppsala, Sweden) for 2 h at 4~C and washed extensively in lysis buffer. Lysates
30 were subjected to precipitation with the antibodies or GST fusion protein for 2 h at 4~C.
Immune complexes were washed 4 times in high salt Iysis buffer (500 mM NaCI), resolved
by SDS-PAGE, and subjected to immunoblot analysis with the indicated antibody and the
applol)liate horseradish peroxidase-conjugated secondary antibody (Bio-Rad Laboratorie~,
Hercules, CA) for detection with ECL reagent (Amersham Corp. Arlington Heights, IL).
The results of the anti-FLAG mAb immunoprecipitation experiment are shown in
Figure 3A. In this experiment, whole cell lysates of 1 x 106 Jurkat cells transfected with
pEF/SLAP-130 (lane 2) or vector control (pEF) (lane 1) were subjected to western blot
analysis with anti-FLAG mAb (2,ug/ml) followed by goat anti-mouse HRP conjugate
(1:10,000). The data demonstrate that transfection of Jurkat T cells with pEF/SLAP-130
CA 02222823 1997-12-22
- 43 -
results in the expression of a protein reactive with anti-FLAG mAb which migrates with an
a~pale,ll molecular mass of 130 kDa (lane 2). This protein does not appear in lysates of cells
transfected with control vector DNA (lane 1).
The results of the precipitation experiment using the SLP-76 SH2 domain GST fusion
5 protein are shown in Figure 3B. In this experiment, Jurkat T cells transfected with
pEF/SLAP-130 were left unstimulated (lanes 1, 3, 5, 6) or stimulated (lanes 2, 4, 7) for 1 min
with pervanadate (PV). Whole cell lysates prepared from 3 x 107 cells were incubated with
GST fusion protein encoding the SH2 domain of SLP-76 (GSTSH2; lanes 3, 4) or an
analogous fusion protein containing a loss of function SLP-76 SH2 domain (GSTR448K;
lanes 1, 2). Precipitation ofthe epitope tagged SLAP-130 was determined by
immunoblotting with anti-FLAG mAb. The results show that the SLP-76 SH2 domain fusion
protein precipitates the epitope tagged SLAP- 130 from pervanadate stimulated Jurkat cells
(lane 4), but not from resting cells (lane 3) transfected with pEF/SLAP-130. A loss of
function mutant of the SLP-76 SH2 domain when expressed as a GST fusion protein
(GSTR448K) fails to associate with FLAG-SLAP-130 in either resting or pervanadate
stimulated cells (lane 1 and 2). The protein precipitated by the wild type SLP-76 SH2
domain migrates identically to a protein detected by anti-FLAG immunoblot analysis of
whole cell lysates (lane 6) or an anti-FLAG immunoprecipitate (lane 5) from Jurkat cells
transfected with pEF/SLAP-130. Additionally, anti-phosphotyrosine western blot of a
GSTSH2 precipitate from untransfected PV stimulated Jurkat cells demonstrates that the 130
kDa protein associated with the SH2 domain of SLP-76 migrates with the same
electrophoretic mobility as SLAP-130 (lane 7).
EXAMPLE 4: Association of SLAP-130 and SLP-76 in T cells
To determine whether endogenous SLAP-130 and SLP-76 associate in vivo in T cells,
coimmunoprecipitation experiments were performed. Immunoprecipitations and
immunoblots were carried out as described in Example 3, except that an anti-SLAP-130
sheep antiserum was generated by immunization of sheep with a GST fusion proteincont~ining amino acids 1-340 of human SLAP-130 and anti-SLP-76 sheep antiserum also
was generated by inoculation of sheep with a GST fusion protein containing amino acids 136-
235 of SLP-76 (Motto, D.G. et al. (1996) J. Exp. Med. 183: 1937-1943). The results of this
experiment is shown in Figure 4.
To determine if SLAP-130 and SLP-76 associate within cells, lysates were prepared
from resting and pervanadate stimulated Jurkat cells. Lysates from 3 x 107 Jurkat T cells
were subjected to immunoprecipitation with either pre-immune serum (lane l) or anti-SLAP-
130 antiserum (lane 2). These immune complexes, in addition to whole cell lysates prepared
from 1 x 106 Jurkat cells (lane 3), were subjected to western blot analysis with anti-SLAP-
130 antiserum (1 :250) followed by rabbit anti-sheep HRP conjugate (1: 10,000).
CA 02222823 1997-12-22
- 44 -
Additionally, whole cell Iysates were prepared from 5x 107 unstimulated (lane 4) or
pervanadate stimulated (lane 5) Jurkat T cells and were subjected to immunoprecipitation
with anti-SLP-76 antiserum and then immunoblotted with both anti-SLP-76 and anti-SLAP-
76 antiserum.
The results demonstrate that the anti-SLAP-130 antiserum, but not pre-immune
serum, precipitates a protein of 130 kDa from Jurkat T cells (see Fig. 4, lanes 1 and 2).
There is some SLAP-130 found in SLP-76 immunoprecipitates from resting Jurkat cells (lane
4). This is consistent with our finding of low levels of a tyrosine phosphorylated protein
which migrates at 130 kDa associating with SLP-76 in unstimulated Jurkat (Motto, D.G. et
10 al. (1996) J. Exp. Med. 183:1937 1943). The amount of SLAP-130 which associates with
SLP-76 increases following stimulation of Jurkat with pervanadate (lane 5). Together the
data from figure 3 (discussed in Example 3) and figure 4 (discussed in this Example) support
the notion that SLAP-130 associates with SLP-76 in cells, in a phosphotyrosine dependent
fashion, through the SLP-76 SH2 domain.
EXAMPLE 5: Overexpression of SLAP-130 in T cells
Overexpression of SLP-76 has been shown to augment TCR signaling cascades
leading to IL-2 promoter activity (Motto, D.G. et al. ( 1996) J Exp. Med. 183:1937-1943;
20 Wu, J. et al. (1996) Immunity 4:593-602). A functional SH2 domain of SLP-76 is required
for its activity in Jurkat T cells (Motto, D.G. et al. (1996) J. Exp. Med. 183:1937 1943;
Wardenburg, J.B. et al. (1996) J. Biol. Chem. 271 :19641-19644). To determine the effect of
SLAP-130 on signals generated by TCR ligation, Jurkat cells were transiently transfected
with pEF/SLAP-130 (described above in Example 3) or a control vector and a luciferase
25 reporter construct driven by the NFAT response element.
For the transfections, the cells were washed twice in PBS, suspended in cytomix (120
mM KCI; 0.15 mM CaC12; 10 mM K2HPO4/KH2PO4, pH 7.6; 25 mM Hepes, pH 7.6; 2 mM
EGTA, pH 7.5; 5 mM MgC12; 2 mM ATP; and 5 mM glutathione) (van den Hoff, M.J. et al.
(1992) Nucl. Acids. Res. 20:2902) at a concentration of 2 x 107 cells per 400 ,ul cytomix per
30 cuvette with the plasmid DNAs discussed below, and transfected at 250 mV, 960 ~lF using
Gene Pulser (Bio-Rad). Transfected cells were allowed to recover for 24 h prior to
manipulation in each experiment.
NFAT reporter gene .Is~ays were performed by cotransfecting 2 x 107 cells with 40 llg
ofthe parental control vector pEF-BOS (Mi71lshim~, S. et al. (1990) Nucl. Acids Res.
35 18:5322) or the SLP-76 expression vector pEF/SLP-76 or the SLAP-130 expression vector
pEF/SLAP- 130 plus 20 llg of the reporter gene construct NFAT-luc (Northrop, J.P. et al.
(1993) J. Biol. Chem. 268:2917-2923), which contains a triplicate ofthe nuclear factor of
activated T cells (NFAT) response element upstream of the luciferase gene (gift of G.
Crabtree, Stanford University, Palo Alto, CA). Following transfection, triplicate samples of 5
CA 02222823 1997-12-22
- 45 -
x 105 cells were stimulated for 10 h with the indicated stimuli. Each sample was lysed in 100
~g of lysis buffer (1% Triton X-100, 110 mM K2HPO4, 15 mM KH2PO4, 5 mM DTT, pII
7.8) for 10 min at room temperature and added to 100 ,ul of 2 x luciferase assay buffer (200
mM K2HPO4, 30 mM KH2PO4, 20 mM MgCl2, 10 mM ATP, pH 7.8). Samples were mixed
5 with 100 ~1 of 1 mM luciferin (Sigma Chemical Co., St. Louis, MO) and immediately
assayed for luciferase activity using a Monolight 2010 luminometer (Analytical
Luminescence Laboratory, San Diego, CA).
The results of the cotransfection experiments are shown in Figures 5A. For this
experiment, 24 hours following transfection, the cells were stimulated with media, anti-TCR
mAb C305 (ascites 1: 1000) (gift of A. Weiss, UCSF, San Francisco, CA), anti-TCR mAb
plus PMA (50 ng/ml), or PMA plus ionomycin (1 ~lM) for 10 h and then assayed forluciferase activity using a luminometer. Data are presented in the bar graph as light units of
luciferase activity after treatment with the indicated stimuli. The results shown in Figure 5A
demonstrate that, as previously reported, SLP-76 alone augments T cell receptor signaling.
In contrast to the effect of SLP-76 on T cell sign~ling, however, overexpression of SLAP-130
results in (limini~hed NFAT activity following TCR ligation. Furthermore, co-transfection of
SLAP-130 and SLP-76 reveals that overexpression of SLAP-130 blocks the augmentation of
TCR stimulated promoter activity by SLP-76.
Expression of the FLAG-tagged cDNAs in the transfected cells was confirmed by
immunoblotting whole cell lysates with anti-FLAG mAb, the results of which are shown in
Figure 5B. Expression of the epitope tagged constructs in the transfected cells was
determined by lysing 1 x 106 transfected cells in NP40 lysis buffer and immunoblotting with
anti-FLAG mAb as described above in Example 3.
Several reports demonstrate that overexpression of SLP-76 markedly augments TCR
derived signals leading to activation of transcription factors for the IL-2 gene (Motto, D.G. et
al. (1996) J. Exp. Med. 183: 1937-1943; Wu, J. et al. (1996) Immunity _:593-602; Fang, N. et
al. (1996)J. Immunol. 157:3769 3773; Wardenburg, J.B. etal. (1996)J. Biol. Chem.271 :19641-19644). Since this effect of SLP-76 has been shown to require a functional SH2
domain (Motto, D.G. et al. (1996) J. Exp. Med. 183:1937-1943; Wardenburg, J.B. et al.
(1996) J. Biol. Chem. 271 :19641-19644), we initially hypothesized that molecules
associating with the SLP-76 SH2 domain would also act as positive regulators of TCR
sign~ling. It is, therefore, a surprising and unexpected discovery that overexpression of
SLAP-130 appears to interfere with TCR-induced NFAT activation in Jurkat cells and,
additionally, blocks the ability or transfected SLP-76 to augment TCR responses.
EQUIVALENTS
Those skilled in the art will recognize, or be able to ascertain using no more than
routine experimentation, many equivalents to the specific embodiments of the invention
described herein. Such equivalents are intended to be encompassed by the following claims.
SEQUENCE LISTING
(1) GENERAL INFORMATION:
(i) APPLICANT: Koretzky, G.A. et al.
(ii) TITLE OF INVENTION: Compositions of SLAP-130, a SLP-76 Associated
Protein, and Methods of Use Therefor
(iii) NUMBER OF SEQUENCES: 11
(iv) CORRESPONDENCE ADDRESS:
(A) ADDRESSEE: LAHIVE & COCKFIELD
(B) STREET: 28 State Street
(C) CITY: Boston
(D) STATE: Massachusetts
(E) COUNTRY: USA
(F) ZIP: 02109-1875
(v) COMPUTER READABLE FORM:
(A) MEDIUM TYPE: Floppy disk
(B) COMPUTER: IBM PC compatible
(C) OPERATING SYSTEM: PC-DOS/MS-DOS
(D) SOFTWARE: PatentIn Release #1.0, Version #1.25
(vii) PRIOR APPLICATION DATA:
(A) APPLICATION NUMBER: US 08/832,222
(B) FILING DATE: 3-APR-1997
(vii) PRIOR APPLICATION DATA:
(A) APPLICATION NUMBER: US 08/774,061
(B) FILING DATE: 23-DEC-1996
(viii) ATTORNEY/AGENT INFORMATION:
(A) NAME: Kara, Catherine J.
(B) REGISTRATION NUMBER: 41,106
(C) REFERENCE/DOCKET NUMBER: BBI-067CPCA
(ix) TELECOMMUNICATION INFORMATION:
(A) TELEPHONE: (617)227-7400
(B) TELEFAX: (617)227-5941
(2) INFORMATION FOR SEQ ID NO:1:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 2400 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: double
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: cDNA
( ix) FEATURE:
(A) NAME/KEY: CDS
(B) LOCATION: 31. .2379
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:1:
TAGGATGGAA AGGCAGATGT A~AGTCCCTC 30
ATG GCG AAA TAT AAC ACG GGG GGC AAC CCG ACA GAG GAT GTC TCA GTC 78
Met Ala Lys Tyr Asn Thr Gly Gly Asn Pro Thr Glu Asp Val Ser Val
5 10 15
AAT AGC CGA CCC TTC AGA GTC ACA GGG CCA AAC TCA TCT TCA GGA ATA 126
Asn Ser Arg Pro Phe Arg Val Thr Gly Pro Asn Ser Ser Ser Gly Ile
20 25 30
CAA GCA AGA AAG AAC TTA TTC AAC AAC CAA GGA AAT GCC AGC CCT CCT 174
Gln Ala Arg Lys Asn Leu Phe Asn Asn Gln Gly Asn Ala Ser Pro Pro
35 40 45
GCA GGA CCC AGC AAT GTA CCT AAG TTT GGG TCC CCA AAG CCA CCT GTG 222
Ala Gly Pro Ser Asn Val Pro Lys Phe Gly Ser Pro Lys Pro Pro Val
50 55 60
GCA GTC AAA CCT TCT TCT GAG GAA AAG CCT GAC AAG GAA CCC AAG CCC 270
Ala Val Lys Pro Ser Ser Glu Glu Lys Pro Asp Lys Glu Pro Lys Pro
65 70 75 80
CCG TTT CTA AAG CCC ACT GGA GCA GGC CAA AGA TTC GGA ACA CCA GCC 318
Pro Phe Leu Lys Pro Thr Gly Ala Gly Gln Arg Phe Gly Thr Pro Ala
85 90 95
AGC TTG ACC ACC AGA GAC CCC GAG GCG AAA GTG GGA TTT CTG AAA CCT 366
Ser Leu Thr Thr Arg Asp Pro Glu Ala Lys Val Gly Phe Leu Lys Pro
100 105 110
GTA GGC CCC AAG CCC ATC AAC TTG CCC AAA GAA GAT TCC A~A CCT ACA 414
Val Gly Pro Lys Pro Ile Asn Leu Pro Lys Glu Asp Ser Lys Pro Thr
115 120 125
TTT CCC TGG CCT CCT GGA AAC AAG CCA TCT CTT CAC AGT GTA AAC CAA 462
Phe Pro Trp Pro Pro Gly Asn Lys Pro Ser Leu His Ser Val Asn Gln
130 135 140
GAC CAT GAC TTA AAG CCA CTA GGC CCG AAA TCT GGG CCT ACT CCT CCA 510
Asp His Asp Leu Lys Pro Leu Gly Pro Lys Ser Gly Pro Thr Pro Pro
145 150 155 160
ACC TCA GAA AAT GAA CAG AAG CAA GCG TTT CCC AAA TTG ACT GGG GTT 558
Thr Ser Glu Asn Glu Gln Lys Gln Ala Phe Pro Lys Leu Thr Gly Val
165 170 175
AAA GGG AAA TTT ATG TCA GCA TCA CAA GAT CTT GAA CCC AAG CCC CTC 606
Lys Gly Lys Phe Met Ser Ala Ser Gln Asp Leu Glu Pro Lys Pro Leu
180 185 190
TTC CCC AAA CCC GCC TTT GGC CAG AAG CCG CCC CTA AGT ACC GAG AAC 654
Phe Pro Lys Pro Ala Phe Gly Gln Lys Pro Pro Leu Ser Thr Glu Asn
195 200 205
TCC CAT GAA GAC GAA AGC CCC ATG AAG AAT GTG TCT TCA TCA AAA GGG 702
Ser His Glu Asp Glu Ser Pro Met Lys Asn Val Ser Ser Ser Lys Gly
210 215 220
TCC CCA GCT CCC CTG GGA GTC AGG TCC AAA AGC GGC CCT TTA AAA CCA 750
Ser Pro Ala Pro Leu Gly Val Arg Ser Lys Ser Gly Pro Leu Lys Pro
225 230 235 240
GCA AGG GAA GAC TCA GAA AAT AAA GAC CAT GCA GGG GAG ATT TCA AGT 798
Ala Arg Glu Asp Ser Glu Asn Lys Asp His Ala Gly Glu Ile Ser Ser
245 250 255
TTG CCC TTT CCT GGA GTG GTT TTG A~A CCT GCT GCG AGC AGG GGA GGC 846
Leu Pro Phe Pro Gly Val Val Leu Lys Pro Ala Ala Ser Arg Gly Gly
260 265 270
CTA GGT CTC TCC AAA AAT GGT GAA GAA AAA AAG GAA GAT AGG AAG ATA 894
Leu Gly Leu Ser Lys Asn Gly Glu Glu Lys Lys Glu Asp Arg Lys Ile
275 280 285
GAT GCT GCT AAG AAC ACC TTC CAG AGC AAA ATA AAT CAG GAA GAG TTG 942
Asp Ala Ala Lys Asn Thr Phe Gln Ser Lys Ile Asn Gln Glu Glu Leu
290 295 300
GCC TCA GGG ACT CCT CCT GCC AGG TTC CCT AAG GCC CCT TCT AAG CTG 990
Ala Ser Gly Thr Pro Pro Ala Arg Phe Pro Lys Ala Pro Ser Lys Leu
305 310 315 320
ACA GTG GGG GGG CCA TGG GGC CAA AGT CAG GAA AAG GAA AAG GGA GAC 1038
Thr Val Gly Gly Pro Trp Gly Gln Ser Gln Glu Lys Glu Lys Gly Asp
325 330 335
AAG AAT TCA GCC ACC CCG AAA CAG AAG CCA TTG CCT CCC TTG TTT ACC 1086
Lys Asn Ser Ala Thr Pro Lys Gln Lys Pro Leu Pro Pro Leu Phe Thr
340 345 350
TTG GGT CCA CCT CCA CCA AAA CCC AAC AGA CCA CCA AAT GTT GAC CTG 1134
Leu Gly Pro Pro Pro Pro Lys Pro Asn Arg Pro Pro Asn Val Asp Leu
355 360 365
ACG AAA TTC CAC AAA ACC TCT TCT GGA AAC AGT ACT AGC AAA GGC CAG 1182
Thr Lys Phe His Lys Thr Ser Ser Gly Asn Ser Thr Ser Lys Gly Gln
370 375 380
ACG TCT TAC TCA ACA ACT TCC CTG CCA CCA CCT CCA CCA TCC CAT CCG 1230
Thr Ser Tyr Ser Thr Thr Ser Leu Pro Pro Pro Pro Pro Ser His Pro
385 390 395 400
GCC AGC CAA CCA CCA TTG CCA GCA TCT CAC CCA TCA CAA CCA CCA GTC 1278
Ala Ser Gln Pro Pro Leu Pro Ala Ser His Pro Ser Gln Pro Pro Val
405 410 415
CCA AGC CTA CCT CCC AGA AAC ATT-AAA CCT CCG TTT GAC CTA AAA AGC 1326
Pro Ser Leu Pro Pro Arg Asn Ile Lys Pro Pro Phe Asp Leu Lys Ser
420 425 430
CCT GTC AAT GAA GAC AAT CAA GAT GGT GTC ACG CAC TCT GAT GGT GCT 1374
Pro Val Asn Glu Asp Asn Gln Asp Gly Val Thr His Ser Asp Gly Ala
435 440 445
GGA AAT CTA GAT GAG GAA CAA GAC AGT GAA GGA GAA ACA TAT GAA GAC 1422
Gly Asn Leu Asp Glu Glu Gln Asp Ser Glu Gly Glu Thr Tyr Glu Asp
450 455 460
ATA GAA GCA TCC AAA GAA AGA GAG AAG AAA AGG GAA AAG GAA GAA AAG 1470
Ile Glu Ala Ser Lys Glu Arg Glu Lys Lys Arg Glu Lys Glu Glu Lys
465 470 475 480
AAG AGG TTA GAG CTG GAG AAA AAG GAA CAG AAA GAG AAA GAA AAG AAA 1518
Lys Arg Leu Glu Leu Glu Lys Lys Glu Gln Lys Glu Lys Glu Lys Lys
485 490 495
GAA CAA GAA ATA AAG AAG AAA TTT AAA CTA ACA GGC CCT ATT CAA GTC 1566
Glu Gln Glu Ile Lys Lys Lys Phe Lys Leu Thr Gly Pro Ile Gln Val
500 505 510
ATC CAT CTT GCA AAA GCT TGT TGT GAT GTC AAA GGA GGA AAG AAT GAA 1614
Ile His Leu Ala Lys Ala Cys Cys Asp Val Lys Gly Gly Lys Asn Glu
515 520 525
CTG AGC TTC AAG CAA GGA GAG CAA ATT GAA ATC ATC CGC ATC ACA GAC 1662
Leu Ser Phe Lys Gln Gly Glu Gln Ile Glu Ile Ile Arg Ile Thr Asp
530 535 540
AAC CCA GAA GGA AAA TGG TTG GGC AGA ACA GCA AGG GGT TCA TAT GGC 1710
Asn Pro Glu Gly Lys Trp Leu Gly Arg Thr Ala Arg Gly Ser Tyr Gly
545 550 555 560
TAT ATT AAA ACA ACT GCT GTA GAG ATT GAC TAT GAT TCT TTG AAA CTG 1758
Tyr Ile Lys Thr Thr Ala Val Glu Ile Asp Tyr Asp Ser Leu Lys Leu
565 570 575
AAA AAA GAC TCT CTT GGT GCC CCT TCA AGA CCT ATT GAA GAT GAC CAA 1806
Lys Lys Asp Ser Leu Gly Ala Pro Ser Arg Pro Ile Glu Asp Asp Gln
580 585 590
GAA GTA TAT GAT GAT GTT GCA GAG CAG GAT GAT ATT AGC AGC CAC AGT 1854
Glu Val Tyr Asp Asp Val Ala Glu Gln Asp Asp Ile Ser Ser His Ser
595 600 605
CAG AGT GGA AGT GGA GGG ATA TTC CCT CCA CCA CCA GAT GAT GAC ATT 1902
Gln Ser Gly Ser Gly Gly Ile Phe Pro Pro Pro Pro Asp Asp Asp Ile
610 615 620
TAT GAT GGG ATT GAA GAG GAA GAT GCT GAT GAT GGT TTC CCT GCT CCT 1950
Tyr Asp Gly Ile Glu Glu Glu Asp Ala Asp Asp Gly Phe Pro Ala Pro
625 630 635 640
CCT AAA CAA TTG GAC ATG GGA GAT GAA GTT TAC GAT GAT GTG GAT ACC 1998
Pro Lys Gln Leu Asp Met Gly Asp Glu Val Tyr Asp Asp Val Asp Thr
645 650 655
TCT GAT TTC CCT GTT TCA TCA GCA GAG ATG AGT CAA GGA ACT AAT TTT 2046
Ser Asp Phe Pro Val Ser Ser Ala Glu Met Ser Gln Gly Thr Asn Phe
660 665 670
GGA AAA GCT AAG ACA GAA GAA AAG GAC CTT AAG AAG CTA AAA AAG CAG 2094
Gly Lys Ala Lys Thr Glu Glu Lys Asp Leu Lys Lys Leu Lys Lys Gln
675 680 685
GAA AAA GAA GAA AAA GAC TTC AGG AAA AAA TTT AAA TAT GAT GGT GAA 2142
Glu Lys Glu Glu Lys Asp Phe Arg Lys Lys Phe Lys Tyr Asp Gly Glu
690 695 700
ATT AGA GTC CTA TAT TCA ACT AAA GTT ACA ACT TCC ATA ACT TCT AAA 2190
Ile Arg Val Leu Tyr Ser Thr Lys Val Thr Thr Ser Ile Thr Ser Lys
705 710 715 720
AAG TGG GGA ACC AGA GAT CTA CAG GTA AAA CCT GGT GAA TCT CTA GAA 2238
Lys Trp Gly Thr Arg Asp Leu Gln Val Lys Pro Gly Glu Ser Leu Glu
725 730 735
GTT ATA CAA ACC ACA GAT GAC ACA AAA GTT CTC TGC AGA AAT GAA GAA 2286
Val Ile Gln Thr Thr Asp Asp Thr Lys Val Leu Cys Arg Asn Glu Glu
740 745 750
GGG AAA TAT GGT TAT GTC CTT CGG AGT TAC CTA GCG GAC AAT GAT GGA 2334
Gly Lys Tyr Gly Tyr Val Leu Arg Ser Tyr Leu Ala Asp Asn Asp Gly
755 760 765
GAG ATC TAT GAT GAT ATT GCT GAT GGC TGC ATC TAT GAC AAT GAC TAG 2382
Glu Ile Tyr Asp Asp Ile Ala Asp Gly Cys Ile Tyr Asp Asn Asp *
770 775 780
CACTCAACTT TGGTCATT 2400
(2) INFORMATION FOR SEQ ID NO:2:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 783 amino acids
(B) TYPE: amino acid
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: protein
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:2:
Met Ala Lys Tyr Asn Thr Gly Gly Asn Pro Thr Glu Asp Val Ser Val
1 5 10 15
~sn Ser Arg Pro Phe Arg Val Thr Gly Pro Asn Ser Ser Ser Gly Ile
Gln Ala Arg Lys Asn Leu Phe Asn Asn Gln Gly Asn Ala Ser Pro Pro
Ala Gly Pro Ser Asn Val Pro Lys Phe Gly Ser Pro Lys Pro Pro Val
Ala Val Lys Pro Ser Ser Glu Glu Lys Pro Asp Lys Glu Pro Lys Pro
~ro Phe Leu Lys Pro Thr Gly Ala Gly Gln Arg Phe Gly Thr Pro Ala
~er Leu Thr Thr Arg Asp Pro Glu Ala Lys Val Gly Phe Leu Lys Pro
100 105 110
Val Gly Pro Lys Pro Ile Asn Leu Pro Lys Glu Asp Ser Lys Pro Thr
115 120 125
Phe Pro Trp Pro Pro Gly Asn Lys Pro Ser Leu His Ser Val Asn Gln
130 135 140
Asp His Asp Leu Lys Pro Leu Gly Pro Lys Ser Gly Pro Thr Pro Pro
145 150 155 160
~hr Ser Glu Asn Glu Gln Lys Gln Ala Phe Pro Lys Leu Thr Gly Val
165 170 175
~ys Gly Lys Phe Met Ser Ala Ser Gln Asp Leu Glu Pro Lys Pro Leu
180 185 190
Phe Pro Lys Pro Ala Phe Gly Gln Lys Pro Pro Leu Ser Thr Glu Asn
195 200 205
Ser His Glu Asp Glu Ser Pro Met Lys Asn Val Ser Ser Ser Lys Gly
210 215 220
Ser Pro Ala Pro Leu Gly Val Arg Ser Lys Ser Gly Pro Leu Lys Pro
225 230 235 240
~la Arg Glu Asp Ser Glu Asn Lys Asp His Ala Gly Glu Ile Ser Ser
245 250 255
~eu Pro Phe Pro Gly Val Val Leu Lys Pro Ala Ala Ser Arg Gly Gly
260 265 270
Leu Gly Leu Ser Lys Asn Gly Glu Glu Lys Lys Glu Asp Arg Lys Ile
275 280 285
Asp Ala Ala Lys Asn Thr Phe Gln Ser Lys Ile Asn Gln Glu Glu Leu
290 295 300
Ala Ser Gly Thr Pro Pro Ala Arg Phe Pro Lys Ala Pro Ser Lys Leu
305 310 315 320
~hr Val Gly Gly Pro Trp Gly Gln Ser Gln Glu Lys Glu Lys Gly Asp
325 330 335
~ys Asn Ser Ala Thr Pro Lys Gln Lys Pro Leu Pro Pro Leu Phe Thr
340 345 350
Leu Gly Pro Pro Pro Pro Lys Pro Asn Arg Pro Pro Asn Val Asp Leu
355 360 365
Thr Lys Phe His Lys Thr Ser Ser Gly Asn Ser Thr Ser Lys Gly Gln
370 375 380
Thr Ser Tyr Ser Thr Thr Ser Leu Pro Pro Pro Pro Pro Ser His Pro
385 390 395 400
~la Ser Gln Pro Pro Leu Pro Ala Ser His Pro Ser Gln Pro Pro Val
405 410 415
~ro Ser Leu Pro Pro Arg Asn Ile Lys Pro Pro Phe Asp Leu Lys Ser
420 425 430
Pro Val Asn Glu Asp Asn Gln Asp Gly Val Thr His Ser Asp Gly Ala
435 440 445
Gly Asn Leu Asp Glu Glu Gln Asp Ser Glu Gly Glu Thr Tyr Glu Asp
450 455 460
Ile Glu Ala Ser Lys Glu Arg Glu Lys Lys Arg Glu Lys Glu Glu Lys
465 470 475 480
~ys Arg Leu Glu Leu Glu Lys Lys Glu Gln Lys Glu Lys Glu Lys Lys
485 490 495
~lu Gln Glu Ile Lys Lys Lys Phe Lys Leu Thr Gly Pro Ile Gln Val
500 505 510
Ile His Leu Ala Lys Ala Cys Cys Asp Val Lys Gly Gly Lys Asn Glu
515 520 525
Leu Ser Phe Lys Gln Gly Glu Gln Ile Glu Ile Ile Arg Ile Thr Asp
530 535 540
Asn Pro Glu Gly Lys Trp Leu Gly Arg Thr Ala Arg Gly Ser Tyr Gly
545 550 555 560
~yr Ile Lys Thr Thr Ala Val Glu Ile Asp Tyr Asp Ser Leu Lys Leu
565 570 575
~ys Lys Asp Ser Leu Gly Ala Pro Ser Arg Pro Ile Glu Asp Asp Gln
580 585 590
Glu Val Tyr Asp Asp Val Ala Glu Gln Asp Asp Ile Ser Ser His Ser
595 600 605
Gln Ser Gly Ser Gly Gly Ile Phe Pro Pro Pro Pro Asp Asp Asp Ile
610 615 620
Tyr Asp Gly Ile Glu Glu Glu Asp Ala Asp Asp Gly Phe Pro Ala Pro
625 630 635 640
~ro Lys Gln Leu Asp Met Gly Asp Glu Val Tyr Asp Asp Val Asp Thr
645 650 655
~er Asp Phe Pro Val Ser Ser Ala Glu Met Ser Gln Gly Thr Asn Phe
660 665 670
Gly Lys Ala Lys Thr Glu Glu Lys Asp Leu Lys Lys Leu Lys Lys Gln
675 680 685
Glu Lys Glu Glu Lys Asp Phe Arg Lys Lys Phe Lys Tyr Asp Gly Glu
690 695 700
Ile Arg Val Leu Tyr Ser Thr Lys Val Thr Thr Ser Ile Thr Ser Lys
705 710 715 720
~ys Trp Gly Thr Arg Asp Leu Gln Val Lys Pro Gly Glu Ser Leu Glu
725 730 735
~al Ile Gln Thr Thr Asp Asp Thr Lys Val Leu Cys Arg Asn Glu Glu
740 745 750
Gly Lys Tyr Gly Tyr Val Leu Arg Ser Tyr Leu Ala Asp Asn Asp Gly
755 760 765
Glu Ile Tyr Asp Asp Ile Ala Asp Gly Cys Ile Tyr Asp Asn Asp
770 775 780
(2) INFORMATION FOR SEQ ID NO:3:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 95 amino acids
(B) TYPE: amino acid
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: peptide
(v) FRAGMENT TYPE: internal
(xl) SEQUENCE DESCRIPTION: SEQ ID NO:3:
Glu Glu Trp Tyr Val Ser Tyr Ile Thr Arg Pro Glu Ala Glu Ala Ala
1 5 10 15
Leu Arg Lys Ile Asn Gln Asp Gly Thr Phe Leu Val Arg Asp Ser Ser
Lys Lys Thr Thr Thr Asn Pro Tyr Val Leu Met Val Leu Tyr Lys Asp
Lys Val Tyr Asn Ile Gln Ile Arg Tyr Gln Lys Glu Ser Gln Val Tyr
Leu Leu Gly Thr Gly Leu Arg Gly Lys Glu Asp Phe Leu Ser Val Ser
65 70 75 80
Asp Ile Ile Asp Tyr Phe Arg Lys Met Pro Leu Leu Leu Ile Asp
(2) INFORMATION FOR SEQ ID NO:4:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 8 amino acids
(B) TYPE: amino acid
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: peptide
(v) FRAGMENT TYPE: internal
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:4:
Pro Pro Asn Val Asp Leu Thr Lys
(2) INFORMATION FOR SEQ ID NO:5:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 30 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: oligonucleotide
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:5:
GGGAGATCTG AGAATTCATT AAATGAAGAG 30
(2) INFORMATION FOR SEQ ID NO:6:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 30 base pairs
(B) TYPE: nuclelc acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: oligonucleotide
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:6:
CCCAGATCTG CACTGGTATC TGGAACCTCG 30
(2) INFORMATION FOR SEQ ID NO:7:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 27 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: oligonucleotide
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:7:
CCACCAAATG TTGACCTGAC GA~ATTC 27
(2) INFORMATION FOR SEQ ID NO:8:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 21 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: oligonucleotide
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:8:
TCTGGGAGGT AGGCTTGGGA C 21
(2) INFORMATION FOR SEQ ID NO:9:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 28 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: oligonucleotide
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:9:
GATGCTGATG ATGGTTTCCC TGCTCCTC 28
(2) INFORMATION FOR SEQ ID NO:10:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 29 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: oligonucleotide
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:10:
CGGGATCCGC GAAATATAAC ACGGGGGGC 29
(2) INFORMATION FOR SEQ ID NO:ll:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 33 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: oligonucleotide
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:ll:
CGGGATCCGT CTATCCTTGA CTCATCTCTG CTG 33
