Note : Les descriptions sont présentées dans la langue officielle dans laquelle elles ont été soumises.
CA 02237059 1998-OS-26
WO 97/20575 PCT/ETS96/19454
TARGETED ADENOVIRUS VECTORS
BACKGROUND OF THE INVENTION
Federal Fundin~,Legend
This work was supported by grants from the National
Institutes of Health (R0) 5025505) and the US Army-DAMD (17
94-J-4398). The Federal Government has certain rights in this
invention.
Meld of the Invention
The present invention relates generally to the fields
of molecular biology and gene theapy. More specifically, the
present invention relates to the production of recombinant
adenoviral vectors with modified fibers for the purpose of cell-
specific targeting.
T)eccriution of the Related Art
Recombinant adenoviruses have demonstrated great
utility in the context of a variety of strategies to accomplish gene
therapy (1-3). One of the principal features of recombinant
adenoviruses resulting in their frequent use relates to the unique
ability of these vectors to accomplish direct in vivo gene
delivery. In this regard, recombinant adenoviral vectors have
been shown to be capable of efficient gene transfer to
parenchyma) cells of various organs including the lung, the brain,
the pancreas, the gall bladder, the liver, and others (4-12). This
has allowed the utilization of recombinant adenoviral vectors as
an approach to treat inherited genetic diseases, such as cystic
fibrosis, whereby the delivered vector may be contained within
the target organ (4-13). In addition, the ability of the adenoviral
CA 02237059 1998-OS-26
WO 97/20575 PC'T/US96/I9454
vector to accomplish in situ tumor transduction has allowed the
development of a variety of anti-cancer gene therapy approaches
for loco-regional disease (14-18, 45). Again, these approaches
have been directed towards non-disseminated disease, whereby
vector containment favors tumor cell-specific transduction.
Despite the versatility of the adenoviral vector in
these contexts, the full utility of the recombinant virions for l n
vivo gene transfer applications is not currently exploitable. This
is because the promiscuous tropism of the virus allows
widespread, unrestricted tissue transduction after systemic in
vivo vector delivery (19, 20). Thus, approaches based upon
vascular vector delivery to specific organ sites would be
undermined by ectopic, non-targeted cellular transduction. This
biologic feature of the virion has thus limited gene therapy
approaches to the aforementioned Ioco-regional or compart-went
disease models whereby anatomic containment favors some level
of selective target cell transduction.
Adenoviruses as vectors for~ene theraRX
The approach of direct intramuscular injection,
whether of naked DNA or of viral vectors, as a method for in vivo
gene transfer in various genetic diseases suffers from practical
limitations. The injection of the large mass of skeletal tissue
would be impractical in a clinical context. However, the problems
associated with intramuscular injection could be avoided by the
targeted delivery to muscle cells of an intravenously
administered vector. Adenoviral vectors can accomplish in vivo
gene delivery to a variety of organs after intravenous injection.
In these instances, gene transfer frequencies have been
sufficiently high to correct inherited metabolic abnormalities in
various murine models. Thus, adenoviral vectors fulfill two
requirements of an intravenously administered vector for gene
therapy: systemic stability and the ability to accomplish iong-
term gene expression following high efficiency transduction of
muscle cells. However, adenoviruses suffer from the
disadvantage that the widespread distribution of the adenovirus
cellular receptor precludes the targeting of specific cell types.
This lack of tropism of adenoviral vectors would result in a
2
CA 02237059 1998-05-26
WO 97/20575 PC'T/US96/19454
decrease in the efficiency of transduction, as the number of virus
particles available for delivery to the target cells would be
decreased by sequestration by nontarget cells. Furthermore, this
would allow ectopic expression of the delivered gene, with
unknown and possibly deleterious consequences. Therefore a
means must be developed to redirect the tropism of the
adenovirus vector specifically to target cells to permit gene
delivery uniquely to organs affected.
Another recognized problem with the use of existing
i0 adenovirus vectors deleted only in the El region of the genome is
that the low-level expression of late adenovirus gene products
triggers an immune response in the host. This is manifested as
an inflammatory immune attack on the transduced cells which
leads to transient expression of the transgene and precludes
repeated gene transfer with the same vector. A further problem
associated with the current generation of adenovirus vectors is
that the insert capacity is presently limited to about 7.5 kb,
whereas many genes cDNA's are much greater in length.
A strategy to overcome this limitation would be the
modification of the cell binding domains of the adenovirus to
allow interaction with cellular receptors in a specific manner.
Adenovirus interacts with eucaryotic cells by virtue of specific
receptor recognition by domains in the knob portion of the fiber
protein (21-23) which protrude from each of the twelve vertices
of the icosahedral capsid.
The prior art is deficient in the lack of effective
means to produce recombinant adenovirai vectors with modified
fibers for purposes of cell-specific targeting. The present
invention fulfills this longstanding need and desire in the art.
SUMMARY OF THE INVENTION
As a further step towards the development of a
tropism-modified virus, the present invention discloses a novel
genetic method to introduce modified fiber genes into adenoviral
particles. The described methods provide a rapid and facile
means to produce recombinant adenoviral vectors with modified
3
CA 02237059 1998-OS-26
WO 97/20575 PC~'/US96/19454
fibers for purposes of cell-specific targeting. To expand the
utility of recombinant adenoviruses for gene therapy
applications, methods to alter native vector tropism to achieve
cell-specific transduction would be beneficial. To this end, '
genetic methods are developed to alter the cell recognition
domain of the fiber binding protein based upon the generation of
fiber-ligand fusions. To incorporate these modified fiber proteins
into mature virions, a system has been developed based upon
homologous DNA recombination. In this strategy, a fiber-deleted,
propagation-defective "fiber rescue" plasmid was designed for
recombination with a shuttle vector encoding a variant fiber
gene. Incorporation of a luciferase reporter gene into the rescue
plasmid provided an additional means of monitoring the viability
of progeny viruses. Recombination between the rescue and
shuttle plasmids allows rectification of the defect in the rescue
plasmid resulting in the derivation of recombinant virus
containing the variant fiber gene contained by the shuttle
plasmid.
To establish this method, a recombinant adenovirus
was constructed containing a fiber with a silent mutation by co
transfection of 293 cells with the fiber rescue plasmid and
shuttle plasmid encoding the fiber variant. Thus, this two
plasmid system allows for the generation of adenoviral vectors
containing variant fiber genes. This method provides a rapid and
facile means of generating tropism-modified recombinant
adenoviruses with fiber-ligand fusions for purposes of cell-
specif c targeting.
In one embodiment of the present invention, there is
provided a modified adenoviral vector containing fiber gene
variants.
The present invention also described the
development of a tropism-modified virus and a novel genetic
method to introduce modified fiber genes into adenoviral
particles. In addition, that incorporation of a chimeric fiber can
alter the tropism profile of the derived virus is shown. This
method provides a rapid and facile means to produce
recombinant adenoviral vectors with modified fibers and the
4
CA 02237059 1998-OS-26
WO 97/20575 PCT/ITS96/19454
derivation of additional fiber modifications for purposes of cell-
specific targeting via tropism-modified adenoviral vectors.
The present invention also describes a method based
upon homologous DNA recombination between two plasmids. A
fiber-deleted, propagation-defective rescue plasmid has been
designed for recombination with a shuttle plasmid encoding a
variant fiber gene. Recombination between the two plasmids
results in the derivation of recombinant viruses containing the
variant fiber gene. A recombinant adenovirus containing a fiber
gene with a silent mutation was constructed. In addition, an
adenoviral vector containing chimeric fibers composed of the tail
and shaft domains of adenovirus serotype ~ and the knob
domain of serotype 3 was generated. This odification was
shown to alter the receptor recognition profile of the virus
containing the fiber chimera. Thus, this two plasmid system
allows for the generation of adenoviral vectors containing
variant fibers. This method provides a rapid and facile means of
generating fiber-modified recombinant adenoviruses. In
addition, this system can be used to develop adenoviral vectors
with modified tropism for cell-specific targeting.
The present invention further discloses the
development of a targeted adenovirus created by ablating
endogenous viral tropism and introducing novel tropism. These
two goals were achieved by employing a neutralizing anti-fiber '
antibody, or antibody fragment, chemically conjugated to a cell-
specific ligand. The folate receptor which is overexpressed on
the surface of a variety of malignant cells was used. Therefore,
folate was conjugated to the neutralizing Fab fragment of an anti-
fiber monoclonal antibody. This Fab-folate conjugate was
complexed with an adenoviral vector carrying the luciferase
reporter gene and was shown to redirect adenoviral infection of
target cells via the folate receptor at a high efficiency.
Furthermore, when complexed with an adenoviral vector
carrying the gene for herpes simplex virus thymidine kinase, the
Fab-folate conjugate mediated the specific killing of cells which
overexpress the folate receptor. The present invention thus
represents the first demonstration of the retargeting of a
5
CA 02237059 1998-OS-26
WO 97/20575 PC~'/US96/19454
recombinant adenoviral vector via a non-adenoviral cellular
receptor.
In another embodiment of the present
invention, there is provided a fiber rescue system useful in
constructiing adenoviral vectors possessing modified fiber genes,
said adenoviral vectors modified by introducing ligands into the '
target cell binding domains of the adenoviral fiber so as to
modify viral tropism, said fiber rescue system comprising: (a) a
fiber shuttle plasmid containing: ( 1 ) a plasmid origin of
replication, (2) an antibiotic resistance gene, and (3) a fragment
of an adenovirai genome containing the fiber gene and flanking
DNA sequences; and (b) a rescue plasmid containing: ( 1 ) a
complete copy of the circularized adenovirus genome and the
adenoviral fiber gene replaced by a plasmid origin of replication
and antibiotic resistance gene, wherein said fiber shuttle plasmid
is co-transfected with said rescue plasmid into a host cell; and
wherein an intact viral genome is obtained by performing
homologous DNA recombination between homologous regions of
the shuttle plasmid and the rescue plasmid providing a modified
adenovirus with an modified fiber gene.
In another embodiment of the present invention,
there is provided a method of making a recombinant adenovirus
having a modified fiber gene, comprising the steps of:
incorporating a plasmid origin of replication, an antibiotic
resistance gene, and a fragment of an adenoviral genome
containing the fiber gene and flanking DNA sequences into a fiber
shuttle plasmid; constructing a rescue plasmid comprising a
plasmid origin of replication, an antibiotic resistance gene, and a
complete copy of the circularized adenovirus genome and the
adenoviral fiber gene replaced by a plasmid origin of replication
and antibiotic resistance gene; co-transfecting said fiber shuttle
vector with said rescue plasmid into a host cell; obtaining an
intact viral genome by performing homologous DNA
recombination between homologous regions of the shuttle
plasmid and the rescue plasmid so as to generate a modified
adenovirus with an intact fiber gene.
6
CA 02237059 1998-OS-26
WO 97/20575 PC.'T/US96/19454
In yet another embodiment of the present invention,
there is provided a targeted adenovirus lacking endogenous viral
tropism but having a novel tropism, said adenovirus comprising:
(I) a neutralizing anti-fiber antibody, or antibody fragment, or
fusions thereof, linked to a cell specific attachment moiety to
form a conjugate; and (2) an adenoviral vector containing a
reporter gene, wherein said conjugate is complexed with said
vector to form a targeted adenovirus redirected to infect target
cells via the cell-specific ligand.
In still yet another embodiment of the present
invention, there is provided a method of making a targeted
adenovirus lacking endogenous viral tropism but having a novel
tropism, comprising the steps of: linking a neutralizing anti-fiber
antibody, or antibody fragment, or fusions thereof, to a cell
specific attachment moiety to form a conjugate; and complexing
said conjugate with an adenoviral vector containing a reporter
gene so as to form a recombinant adenoviral vector which can
bind to a target cell via a non-adenoviral cellular receptor.
Other and further aspects, features, and advantages
of the present invention will be apparent from the following
description of the presently preferred embodiments of the
invention given for the purpose of disclosure.
BRIEF DESCRIPTION OF THE DRAWINGS
So that the matter in which the above-recited
features, advantages and objects of the invention, as well as
others which will become clear, are attained and can be
understood in detail, more particular descriptions of the
invention briefly summarized above may be had by reference to
certain embodiments thereof which are illustrated in the
appended drawings. These drawings form a part of the
specification. It is to be noted, however, that the appended
drawings illustrate preferred embodiments of the invention and
- 35 therefore are not to be considered limiting in their scope.
Figure 1 shows the pathway of adenovirus entry
into cells.
7
CA 02237059 1998-OS-26
WO 97/20575 PC'T/US96/19454
Figure 2 shows the strategy to incorporate a
heterologous peptide ligand at the knob domain of adenoviral
fiber. This strategy involves the genetic modification of the fiber
to generate a chimeric protein consisting of mature trimeric fiber, '
peptide linker, and an added physiologic iigand at the knob
domain to target the adenovirus into heterologous cellular entry
pathways.
Figure 3 shows a schematic of fiber-GRP ligand
fusion protein construction. T7 vaccinia expression vectors were
constructed to contain wild-type fiber of adenovirus type S only
{pTFSF), fiber and ten amino acid linker only (pTFSFB), and the
fiber-GRP fusion construct (pTFSFB-GRP). T7 ~ro: T7 promoter;
T7 Ter: T7 RNA polyerase transcription ter ination site; B:
BamH 1 restriction site.
i5 Figure 4 shows an evaluation of adenoviral fiber
protein variants. Figure 4A shows HeLa cell lysates transfected
with fiber fusion constructs were immunoprecipitated with anti-
GRP or anti-fiber AF7A antibodies. Western blots were then
performed on boiled samples using anti-fiber mAb 4D2. Figure
4B shows lysates of HeLa cell transfected with fiber fusion
constructs were immunoprecipitated with three anti-fiber
antibodies: 4D2, AF7A, and 2A6. Western blots were then
probed with an anti-GRP antibody.
Figure 5 shows a determination of the quaternary
structure of the fiber-GRP fusion protein. Boiled and unboiled
HeLa cell lysates transfected with three fiber constructs were
analyzed by western blot using anti-fiber mAb 4D2 which
recognizes both fiber monomers and trimers.
Figure 6 shows the biosynthesis of the fiber-GRP
fusion protein. HeLa cells seeded on glass coverslips were
transfected with four different T7 expression vectors. After 24
hours, the HeLa cells were fixed, permeabilized, and incubated
with anti-fiber mAb 4D2 which recognizes both fiber monomers
and trimers, anti-fiber mAb 2A6 which recognizes fiber trimers
only, or a polyclonal antibody directed against the GRP peptide.
Figure 7 shows the accessibility of the GRP ligand in
the fiber-GRP trimer. To determine whether the GRP ligand in
8
CA 02237059 1998-OS-26
WO 97/20575 PCT/US96/19454
the native form of the fiber-GRP fusion protein was accessible to
binding, an immunoblot assay was performed. Boiled (B) and
unboiled (U) HeLa cell Iysates transfected with either pTFSFB or
pTFSFB-GRP were separated by SDS-PAGE, transferred to a PVDF
membrane and probed with anti-fiber mAb 4D2 or anti-GRP
antibodies.
Figure 8 shows the construction of a fiber rescue
plasmid for generation of adenoviral vectors with fiber variants.
The schema for construction of the fiber rescue plasmid pVKS is
depicted. This plasmid contains an adenoviral genome derived
from the recombinant adenovirus Ad51uc3, although it is deleted
for the fiber gene. The deleted fiber is replaced with a "stuffer"
segment representing a bacterial plasmid backbone. The fiber
defect prevents the generation of viable adenoviral progeny after
transfection of mammalian cells with the rescue plasmid.
Furthermore, its size exceeds the packaging constraints of the
adenoviral capsid.
Figure 9 shows the construction of a fiber shuttle
plasmid for generation of adenoviral vectors with fiber variants.
The schema for construction of the fiber shuttle plasmid
pNEB.PK3.6 is depicted. This plasmid contains the adenoviral
fiber gene plus flanking regions of the adenoviral genome.
Figure IO shows the construction of a mutant fiber
gene containing a functionally silent mutation. The 3' end of the
fiber gene corresponds to the knob domain of the fiber protein.
PCR-mutagenesis was employed to generate a single base
substitution (C to G) which creates a silent mutation resulting in a
novel recognition site for the restriction endonuclease Fspl.
Figure 11 shows the schema for generation of an
adenoviral vector containing fiber variants employing i n v i v o
homologous recombination. Recombination between the fiber
rescue plasmid, pVKS, and the shuttle plasmid, pNEB.PK.FSP,
would be predicted to yield the depicted recombinant adenoviral
genome. This recombinant genome would contain the fiber
- 35 variant gene originating from the shuttle plasmid.
Figure 12 shows the analysis of recombinant
adenovirus containing fiber variant generated by two plasmid
9
CA 02237059 1998-OS-26
WO 97/20575 PCT/US96/19454
system. Figure I2A shows the predicted map of restriction
endonuclease recognition sites for Ad51uc3 and the fiber variant
derivative, Ad51uc3.FSP. Figure 12B shows an analysis of ,
genomic DNA derived from Ad5Iuc3 (lane 2) and Ad51uc3.FSP
(lane 3) by restriction endonuclease digestion with Fspl. Lane 1 ,
represents DNA size markers. Arrowheads indicate FspI
restriction fragments of 11, 8 and 3 kb. The 11 kb fragment in
the Ad5iuc3 Fspl digest (lane 2) is replaced by 8 and 3 kb
fragments in the Ad51uc3.FSP digest (lane 3), indicating the
7 0 presence of a novel restriction site in the recombinant genome.
Figure 13 shows the schema for construction of the
plasmid, pNEB.PK.FS/3, which contains a chimeric fiber gene
encoding the tail and shaft domains of Ad5 and the knob of Ad3.
Figure 14 shows an analysis of recombinant
adenovirus containing chimeric fibers. Figure 14A: Predicted
maps of DraI and Scal restriction endonuclease recognition sites
for Ad5-Luc 3 and Ad5/3-Luc 3. The filled box represents the
fiber gene. Figure I4B: Analysis of genomic DNA derived from
Ad5-Luc 3 and Ad5/3-Luc 3. Lane 1: Ad5-Luc 3 - ScaI; lane 2:
Ad5/3-Luc 3 - ScaI; lane 3: 1 kb marker; lane 4: Ad5-Luc 3 -
DraI; lane 5: Ad5/3-Luc 3 - DraI. Arrowheads indicate restriction
fragments of 24.5, 12.6, 9.8, 3 and 2.8 kb.
Figure 15 shows the type-specific inhibition of
adenovirus infectivity by recombinant knobs. 293 cells were
preincubated with either type 5 (Figure I5A) or type 3 (Figure
15B) knob at the indicated concentrations for 10 minutes at room
temperature to allow receptor binding. Ad5-Luc 3 or Ad513-Luc
3 were then added at a multiplicity of infection of 10 and
incubation was continued for another 30 minutes at room
temperature. The viruses were aspirated and complete medium
was added before transferring the cells to 37°C. After 30 hours,
the cells were lysed and luciferase activity was determined.
Luciferase activity is given as a percentage of the activity in the '
absence of blocking by recombinant knob. Points represent the
mean of two determinations.
Figure 16 shows that the anti-knob mAb 1D6.14 and
its Fab fragment neutralize adenoviral infection. Anti-knob
CA 02237059 1998-OS-26
WO 97/20575 PCT/US96/I9454
mAbs were generated after immunization of BALB/c mice with
AdS, followed by two rounds of immunization with recombinant
Ad5 knob (Henry, et al., J. Virol. 68, 5239-5246 (1994). On the
basis of its high affinity binding to recombinant Ad5 knob in an
ELISA and its ability to neutralize Ad5 infection of HeLa cells as
determined in an endpoint CPE assay, one clone, designated
1D6.14, was chosen for further study. This mAb was purified
using an ImmunoPure IgG purification kit (Pierce}. Fab
fragments were purified from intact 1D6.14 using an
ImmunoPure Fab purification kit (Pierce). After dialysis against
PBS, the concentrations of the purified mAb and Fab fragments
were determined using the Bio-Rad protein assay. Varying
dilutions of intact anti-knob mAb 1D6.14, the Fab fragment or an
irrelevant antibody (mouse IgG) were incubated at room
temperature in a total volume of 20 ml HBS with 108 particles of
AdCMVLuc, an adenoviral vector which expresses firefly
luciferase from the CMV promoter. The expression of luciferase
activity in cells infected with this vector is directly proportional
to the number of infecting virus particles. After 30 minutes, the
volume was increased to 1 ml with DMEM/F-I2 + 2% FCS and the
complexes were added to 6-well plates containing 80% confluent
HeLa cell monolayers previously rinsed with PBS. After
incubation for 24 hours at 37°C, the cells were lysed and extracts
assayed for luciferase activity using a Iuciferase assay system
(Promega). The protein concentration of the lysates was
determined to permit normalization of the data, which are
expressed as relative light units per mg of cellular protein.
Results are the mean of triplicate experiments.
Figure 17 shows the redirection of adenoviral
infection mediated by the conjugate of folate with the Fab
fragment of neutralizing mAb ID6.14. Carboxyl groups of folate
were coupled to amine groups of the Fab fragment of mAb
' 1D6.14 by a carbodiimide procedure, as described by Kranz, et
al., Proc. Nat. Acad. Sci. USA 92, 9057-9061 (1995). Immunoblot
analysis employing mouse anti-folic acid ascites fluid (Sigma}
revelaled the success of the conjugation. The ability of the Fab-
folate conjugate to recognize the folate receptor was confirmed in
11
CA 02237059 1998-OS-26
WO 97!20575 PCT/US96/19454
a competition binding assay conducted in triplicate using [3H]-
folate (Amersham; specific activity = 47 Ci/mmol) and KB cells
rinsed well with PBS to remove excess folate present in the
culture medium. Next, the amount of 1D6.14 Fab or Fab-folate
(0.5 mg) which gave maximum inhibition of infection by 108
particles of AdCMVLuc was determined. This optimal dose of Fab
or Fab-folate was then incubated with 108 particles of
AdCMVLuc at room temperature in a total volume of 20 ml HBS.
After 30 minutes, the complexes were diluted to 1 mI with
folate-free RPMI 1640 (ffRPMI; Gibco-BRL)+ 2% FCS and added in
triplicate to 6-well plates containing 80% confluent KB cells which
had been washed with PBS. Prior to infection, the target cells
had been passaged twice in ffRPMI. After incubation for 24
hours at 37°C, the cells were iysed and extracts assayed for
luciferase activity as described. For folate inhibition studies, KB
cells were preincubated for 30 minutes at room temperature in 3
ml ffRPMI + i0% FCS containing 50 mg folate, and the
AdCMVLuc-Fab-folate complex was added to the cells in 1 ml
ffRPMI + 2% FCS containing 50 mg folate. Results are the mean of
triplicate experiments.
Figure 18 shows the targeted killing of cells by an
adenoviral vector redirected via the folate receptor. KB cells
were plated in 96 well plates at 10,000 cells per well. The
following day, cells were either left uninfected or treated at an
moi of 10 with AdCMVHSV-TK alone or complexed with the
previously determined optimal neutralizing amount of ID6.14
Fab, Fab or Fab-folate as described for Figure 21 (n=8). Half of
the samples were treated 24 hours post-infection with ffRPMI +
IO% FCS containing the prodrug GCV at a concentration of 20 mM;
the remaining cells were given only ffRPMI + 10% FCS. Cell
viability was determined 6 days later using a colorimetric cell
proliferation assay that measured the conversion of a tetrazolium
salt to formazan by viable cells as described by the manufacturer .
(Cell Titer 96 Aqueous Non-radioactive MTS Cell Proliferation
Assay; Promega). Briefly, 20 ml of assay mixture were added to
each well of cells and the plates incubated for 1-4 hrs at 37°C
before absorbance was measured at 490 nm in a 96 well plate
12
CA 02237059 1998-OS-26
WO 97/20575 PCT/US96/19454
reader (Molecular Devices). In these experiments KB cells were
plated on the day of the assay in ffRPMI to generate a standard
curve. CeIIs were removed by trypsinization and plated in
triplicate wells at the following densities: 50,000; 20,000;
10,000; 5,000; 2,000; and 0 cells per well. From the standard
curve, viable cell numbers could be calculated for experimental
groups using the SOFTmax computer software (Molecular
Devices).
DETAILED DESCRIPTION OF THE INVENTION
Definitions
As used herein, the terms "fiber gene" and "fiber
variant" refers to the gene encoding the adenovirus fiber protein
and a modification thereof.
As used herein, the term "fiber rescue plasmid,"
refers to a plasmid which lacks a viable fiber gene, after
homologous recombination with another plasmid but can acquire
such. As used herein, the term "shuttle plasmid
or shuttle vector" refers to a plasmid which can contribute a
viable fiber gene to a fiber deficient rescue plasmid.
As used herein, the term "silent mutation" refers to a
mutation which does not change the protein encoded by the
gene's open reading frame.
As used herein, the term "mature trimeric fiber"
refers to a fiber which possesses the native tertiary
conformation.
As used herein, the term "peptide linker" refers to
short peptide serving as a spacer between the fiber and the
ligand.
As used herein, the term "physiologic Iigand" refers to
a ligand for a cell surface receptor.
As used herein, the term "stuffer segment" refers to
irrelevant DNA used to create functionally relevant spacing of a
- 35 plasmid.
It is an object of the present invention to expand the
tropism of adenoviruses by incorporating novel ligands into the
13
CA 02237059 1998-OS-26
WO 97/20575 PCT/US96/19454
fiber cell binding domain without requiring the means to
incorporate the modified fiber into mature virions.
It is an object of the present invention to modify the
tropism of recombinant adenoviral vectors using genetic methods
to alter the adenoviral fiber cell-binding protein.
It is another object of the present invention to
generate an adenovirus with modified fiber gene using a two-
plasmid rescue system for derivation of adenoviral fiber
recombinants.
It is an additional object of the present invention to
design a fiber rescue system to allow construction of adenoviral '
vectors possessing modified fiber genes. Using such a fiber
rescue system, a person with ordinary skill in this art would be
able to accomplish the introduction of ligands into the target cell
binding domains of the adenoviral fiber to modify viral tropism.
In accordance with the above-mentioned objects,
there is provided by a fiber rescue system useful in constructiing
adenoviral vectors possessing modified fiber genes, said
adenoviral vectors modified by introducing ligands into the
target cell binding domains of the adenoviral fiber so as to
modify viral tropism, said fiber rescue system comprising: (a) a
fiber shuttle plasmid containing: {1) a plasmid origin of
replication, (2) an antibiotic resistance gene, and (3) a fragment
of an adenoviral genome containing the fiber gene and flanking
DNA sequences; and (b) a rescue plasmid containing: ( 1 ) a
complete copy of a circularized adenovirus genome and the
adenoviral fiber gene replaced by a plasmid origin of replication
and antibiotic resistance gene, wherein said fiber shuttle plasmid
is co-transfected with said rescue plasmid into a host cell; and
wherein an intact viral genome is obtained by performing
homologous DNA recombination between homologous regions of
the shuttle plasmid and the rescue piasmid providing a modified
adenovirus with an modified fiber gene. '
In the fiber rescue system of the present invention,
the plasmid origin of replication and the antibiotic resistance -
gene would be well known to those having ordinary skill in this
art. As will be apparent to those in this art, the fiber rescue
14
CA 02237059 1998-OS-26
WO 97/20575 PC'd'/fJS96/19454
system of the present invention, the fiber rescue plasmid may
also contain a gene encoding a therapeutic protein.
The present invention is also directed to a method of
making a recombinant adenovirus having a modified fiber gene,
comprising the steps of: incorporating a plasmid origin of
replication, an antibiotic resistance gene, and a fragment of an
adenoviral genome containing the fiber gene and flanking DNA
sequences into a fiber shuttle plasmid; inserting a plasmid origin
of replication, an antibiotic resistance gene, a complete copy of a
circularized adenovirus genome and the adenoviral fiber gene
replaced by a plasmid origin of replication and antibiotic
resistance gene into a rescue plasmid; co-transfecting said fiber
shuttle vector with said rescue plasmid into a host cell; obtaining
an intact viral genome by performing homologous DNA
recombination between homologous regions of the shuttle
plasmid and the rescue plasmid so as to generate a modified
adenovirus with an intact fiber gene. The fiber rescue plasmid
may further contain a gene encoding a therapeutic protein. The
modified adenovirus fiber as prepared herein retains its ability
to trimerize and retains its native biosynthesis profile.
The present invention is also directed to a targeted
adenovirus lacking endogenous viral tropism but having a novel
tropism, said adenovirus comprising: { 1 ) a neutralizing anti-fiber
antibody, or antibody fragment, or fusions thereof, linked to a
cell specific attachment moiety to form a conjugate; and (2) an
adenoviral vector containing a reporter gene, wherein said
conjugate is complexed with said vector to form a targeted
adenovirus redirected to infect target cells via the cell-specific
Iigand. Preferably, the cell specific attachment moiety is selected
from the group consisting of physiological ligands, anti-receptor
antibodies or cell specific peptides.
In addition, the adenoviral vector may further contain a
therapeutic gene. In one embodiment, the therapeutic gene is
the herpes simplex virus-thymidine kinase gene.
The present invention is also directed to a method of
making a targeted adenovirus lacking endogenous viral tropism
but having a novel tropism, comprising the steps of: linking a
CA 02237059 1998-OS-26
WO 97/20575 PC'T/US96/19454
neutralizing anti-fiber antibody, or antibody fragment, or fusions
thereof, to a cell specific attachment moiety to form a conjugate;
and complexing said conjugate with an adenoviral vector
containing a reporter gene so as to form a recombinant
adenoviral vector which can bind to a target cell via a non-
adenoviral cellular receptor.
The present invention is also directed to a method of
killing tumor cells in an individual in need of such treatment,
comprising the steps of: pretreating said individual an effective
amount of the adenoviral vector of the present invention; and
administering ganciclovir to said individual.
Mechanisms by which adenoviruses accomplish infection
Following intravenous administration of the
'l 5 adenovirus vector, three distinct sequential steps are required
for targeted expression of the therapeutic gene in specific cells:
(1) attachment of the adenovirus vector to specific receptors on
the surface of the target cell; (2) internalization of the virus; and
(3) transfer of the gene to the nucleus where it can be expressed.
Thus any attempt to modify the tropism of an adenovirus vector
must retain its ability to perform these three functions
efficiently. Furthermore, the modification of adenovirus tropism
must be approached with knowledge of the biology of adenovirus
infection (Figure 1 ). It has recently been shown that the globular
carboxy-terminal "knob" domain of the adenovirus fiber protein
is the ligand for attachment to the adenovirus cellular receptor,
the first step in infection. A trimeric fiber protein protrudes
from each of the 12 vertices of the icosahedral viral particle
where it is attached noncovalently to the penton base. The
amino-terminal tail is separated from the knob domain by a long
rod-Iike shaft comprising a 15-amino acid residue motif repeated
22 times in human adenovirus types 2 and 5. The knob is both
necessary and sufficient for virion binding to host cells.
Following attachment, the next step in adenovirus infection is
internalization of the virion by receptor-mediated endocytosis.
This process is mediated by the interaction of Arg-Gly-Asp (RGD)
sequences in the penton base with secondary host cell receptors,
i6
CA 02237059 1998-OS-26
WO 97/20575 PCT/US96/19454
integrins avb3 and avb5. Post-internalization, the virus is
localized within the cellular vesicle system, initially in clathrin-
coated vesicles and then in cell endosomes. Acidification of the
endosomes allows the virions to escape and enter the cytosol.
This step has been hypothesized to occur via a pH-induced
alteration in the hydrophobicity of the adenoviral capsid proteins
which allows their interaction with the cell vesicle membrane.
The virion then localizes to the nuclear pore and its genome is
translocated to the nucleus of the host cell. This understanding
of the adenovirus entry pathway is required to modify the
tropism of adenoviral vectors to permit the targeting of specific
cell types.
Adenoviral cellular binding ~d internalization uncoupled from
subseduent steps in infection.
Modification of the tropism of the adenoviral vector
so that it recognizes and binds to a novel receptor on specific
target cells requires that the vector still be able to accomplish the
distal steps of internalization and gene transfer. The basic design
of a molecular conjugate vector consists of plasmid DNA attached
to a macromolecule ligand which can be internalized by the cell
type of interest. To accomplish this, a molecular conjugate vector
contains two distinct functional domains: a DNA binding domain
which is composed of a polycation such as polylysine and a ligand
domain which binds to a specific cell surface receptor. The
efficiency of gene transfer was idiosyncratic due to endosome-
entrapment of the conjugate-DNA complex after internalization.
To overcome this limitation, a replication-deficient adenovirus
was incorporated into the conjugate design to capitalize on its
ability to accomplish endosome disruption. Incorporation of the
adenovirus into the vector configuration dramatically augmented
the gene transfer efficiency of the vector based upon the ability
of the complex to avoid entrapment in the cell vesicle system.
However, the introduction of the adenovirus into the system
- 35 undermined one of the theoretical attributes of this vector: the
ability to accomplish targeted, cell-specific gene delivery based
upon the incorporated ligand domain. To overcome this
17
CA 02237059 1998-OS-26
WO 97/20575 PCT/US96/19454
limitation, an anti-fiber antibody was derived which could
specifically block adenoviral binding and entry into target cells.
It was hypothesized that coating the complex with antibody
would block adenoviral binding, thus permitting targeted gene
delivery exclusively via the ligand domain. In these studies, it
was shown that the use of antibody-coated, binding-incompetent
adenovirus did not decrease the overall levels of gene expression
observed. Despite entry via an alternate internalization pathway,
fiber binding was not required for the adenovirus to mediate
endosornal vesicle disruption being routed through a non-
adenoviral pathway, the virus accomplished efficient post-
internalization entry events. Hence, the processes of adenoviral
binding and subsequent entry steps are not functionally linked.
It should therefore be possible to reroute recombinant
i5 adenoviral vectors through heterologous cellular entry pathways
in a similar manner while retaining their desirable downstream
entry properties.
The ability of adenoviral vectors to accomplish
efficient gene transfer after internalization through a non
adenoviral entry pathway would be of particular importance in
gene therapy. In this regard, it has been shown that the ability
of adenoviral vectors to transduce mature muscle fibers is very
poor, no greater than in vivo transduction by naked DNA. This
phenomenon has been correlated with a developmental
downregulation of the adenoviral internalization receptors,
integrins avb3 and avb5, in mature muscle cells. This problem
could therefore be resolved by achieving internalization of the
adenovirus vector by an alternate pathway independent of these
integrins.
Tropism-modified viral vectors constructed to achieve targ_ to ed.
~eII-specific gene delivery
Attempts to modify the tropism of adenoviral vectors
must be considered in the light of strategies which have been
utilized to modify the cell-binding specificity of other viral
vectors. In this context, most work to date has focused on
altering retroviral vectors to allow cell-specific transduction.
18
CA 02237059 1998-OS-26
WO 97!20575 PCT/US96/i9454
Infection of host cells with retroviral vectors results from specific
binding of the viral envelope glycoprotein to receptor molecules
on the cell surface. The host and tissue specificity of a retroviral
vector are defined by the cell surface receptors which it is able to
recognize. Thus, ecotropic retroviruses can only infect cells of
one species, or even only one cell-type of one species.
Conversely, amphotropic retroviruses have a broad host range
and can infect different cell types of different species. These
differences are a result of structural variations of the envelope
glycoprotein which determine the binding specificity for cellular
receptors. Therefore, targeting of retroviral vectors has been -
attempted by introducing alternate envelope giycoproteins or
modifying the retroviral envelope glycoprotein to confer new
binding specificity.
i 5 There are two aspects to consider in the modification
of adenoviral tropism: ( 1 ) ablation of endogenous tropism; and
(2) introduction of novel tropism. It is necessary for
adenoviruses to retain their endogenous tropism in order to form
plaques in normal packaging cell lines. Disclosed herein is the
creation of a tropism-expanded adenoviral vector; that is, a
vector with the capacity to achieve binding to a non-native
receptor which would allow cell-specific gene transfer after
systemic in vivo delivery. After achieving this goal, it would
then become practically feasible to accomplish the ablation of
native tropism.
The following examples are given for the purpose of
illustrating various embodiments of the invention and are not
meant to limit the present invention in any fashion.
F~'~A.MPLE 1
Modifying the tropism of recombinant adenovi_ralvec_tors bY
genetic methods to alter the adenovirus fiber cell-bindingnrotein
One strategy to derive a tropism-modified
recombinant adenovirus is directed towards genetic modification
of the fiber protein to accomplish incorporation of heterologous
cell-binding ligands, which could then mediate adenoviral entry
by alternate receptor pathways. This approach capitalizes on the
19
CA 02237059 1998-OS-26
WO 97/20575 PCT1US96/19454
knowledge that the endogenous cell-binding ligand of adenovirus
is localized within the knob portion of the fiber protein. The
strategy was therefore to localize the novel cell-binding ligand in
the analogous position, thereby accomplishing two goals: ( 1 ) the
novel cell-binding ligand would be localized in the region of the
endogenous ligand, which is likely to be favorable for interaction
with the cognate cellular receptor; and (2) the novel-cell binding
Iigand would be removed from other adenoviral capsid proteins,
whose function might be important in distal, post-binding entry
functions. The genetic incorporation of heterologous peptides
required consideration of the strict structural limitations of the
fiber quaternary configuration. In this regard, the fiber protein
is synthesized initially as a monomer which elf-trimerizes by
virtue of intermolecular, non-covalent interactions, initiated at
the carboxy terminus of the molecule. After trimerization, the
amino terminus of the native fiber can insert into the penton
base. Thus, additions to the knob portion of the fiber,
corresponding to the carboxy terminus of the molecule, could
potentiaIiy impair trimer formation and prevent incorporation of
chimeric fiber molecules into the mature adenoviral capsid. In
addition to these considerations, it was important to achieve a
final quaternary configuration whereby the incorporated ligand
was localized on the exterior of the mature fiber trimer. Hence, it
was not apparent that added ligands would be localized outside '
the molecular structure of the knob and thus accessible to
achieve target cell binding. With these considerations in mind,
fiber-ligand fusion proteins were created by genetically
incorporating into the fiber gene heterologous sequences
encoding peptides with physiologic ligand functions (Figure 2).
The initial analysis confirmed that: ( i ) the fiber
fusion genes produce a chimeric fiber molecule capable of
maturing into a normal trimeric quaternary configuration; and
(2) the fiber fusion genes express a chimeric fiber molecule
whereby the heterologous ligand is localized on the exterior of
the trimeric molecule. Achievement of these goals, even in a
limited context, predicts that further analysis would identify the
CA 02237059 1998-OS-26
WO 97/20575 PCT/US96/19454
optimal Iigands from the standpoints of cell binding and
internalization.
EXAMPLE 2
Constructnon of a fa.b_er gene encoding a peptide ligand
The first step in the creation of a fiber-ligand fusion
protein was site-directed mutagenesis of the 3' end of the wild-
type adenovirus type 5 fiber gene which had been cloned into
the T7 vaccinia expression vector pTF7.5 under the control of the
70 T7 promoter, resulting in vector pTFSF (Figure 3). A unique
B a m HI restriction site was introduced at the 3' end of the fiber
gene to facilitate subsequent cloning of oligonucleotides encoding
the test Iigands. Sequences encoding a 10 amino acid linker
region (ProSerAlaSerAlaSerAlaSerAlaPro) were then inserted
immediately upstream of the B a m HI site to: { 1 ) minimize any
possible steric constraints between the fiber protein and the
heterologous peptide to be added; and (2) present the test ligand
extended away from the body of the fiber protein. The vector
containing this modified fiber gene was designated pTFSFB. A
fiber-ligand fusion gene was engineered by cloning sequences
encoding the terminal decapeptide of the gastrin-releasing
peptide, GRP, into the B a m HI site, resulting in vector pTFSFB
GRP. This ligand was chosen because of: ( I ) its small size; and {2)
its ability to be internalized into its target cell by receptor
mediated endocytosis.
EXAMPLE 3
Expression of genetically modified fiber protein
In order to express the wild-type or modified fiber
proteins, 80°!o confluent HeLa cells in Opti-MEM 1 reduced serum
medium (Gibco-BRL) were first incubated for 1 hour at 37°C with
a recombinant vaccinia virus which expresses T7 RNA
polymerase. The infected cells were then transfected with
vectors pTFSF, pTFSFB or pTFSFB-GRP using Lipofectin (Gibco
- 35 BRL) according to the manufacturer's instructions. After 24
hours, cells were washed with phosphate-buffered saline, pH 7.4
(PBS) and scraped into Tris-EDTA buffer, (10 mM Tris-HCI, 1 mM
21
CA 02237059 1998-OS-26
WO 97/20575 PCT/US96/19454
EDTA; pH 8.0) prior to sonication for a total of 2 minutes.
Clarified lysates were used as the source of recombinant fiber.
To confirm the expression of a fiber-GRP fusion
protein, lysates from vaccinia-infected HeLa cells which had been
transfected either with plasmid pTFSFB or with plasmid pTFSFB
GRP were immunoprecipitated according to standard techniques
with a mouse monoclonal anti-fiber antibody (4D2, 2A6 or AF7A)
or with a rabbit anti-human GRP antibody (DAKOPATTS). The
immune complexes were resuspended in 2x SDS-PAGE sample
buffer containing urea and denatured by boiling before being
electrophoresed on a 10% SDS-polyacrylamide gel. The separated
proteins were transferred on to a PVDF membrane {BioRad
Laboratories) and probed with either anti-fiber antibody 4D2 or
anti-GRP antibody. An alkaline phosphatase-conjugated goat
anti-mouse or -rabbit antibody (Southern Biotechnology) was
employed as the secondary antibody prior to detection with
NBTBCIP.
As shown in Figure 4A, a protein precipitated with
the anti-GRP antibody from HeLa cells transfected with plasmid
pTFSB-GRP, which encodes the fiber-GRP construct, is the size of
the mature fiber and is recognized by an anti-fiber mAb. This
protein was identical in size to the protein precipitated from
pTFSB-GRP-transfected cells with mAb AF7A, which recognizes
fiber trimers only. Moreover, the anti-GRP antibody failed to
precipitate a protein of similar size from HeLa cells transfected
with plasmid pTFSB, which encodes the fiber-linker construct
only. These results indicate that piasmid pTFSB-GRP expressed a
fiber-GRP fusion protein. To confirm this, lysates from HeLa cells
transfected with plasmid pTFSB-GRP or pTFSB were
immunoprecipitated with the three different anti-fiber mAbs
prior to Western blot analysis with the anti-GRP antibody. Figure
4B shows that a protein recognized by both anti-fiber and anti-
GRP antibodies was present in the lysate of HeLa cells transfected
with plasmid pTFSB-GRP, which encodes the fiber-GRP construct,
but was absent from the lysate of HeLa cells transfected with
plasmid pTFSB. Thus, this construct was capable of expressing a
fiber-GRP fusion protein in a eukaryotic system.
22
CA 02237059 1998-05-26
WO 97/20575 PCT/US96/19454
EXAMPLE 4
Quaternary structure of fiber protein variants in vaccinia vector-
infected cells.
Correct fiber protein folding is absolutely required for
incorporation of the fiber protein into the vertices of nascent
adenovirus capsids. Since the aim is to construct a recombinant
adenovirus with a genetically modified fiber, it was first
important to determine whether incorporation of exogenous
peptides to the carboxy terminus of fiber still allowed proper
fiber protein folding into the native quaternary configuration.
Preservation of the quaternary structure or trimerization of the
fiber-ligand fusion protein would theoretically be indicative of
proper adenovirus capsid assembly with the modified fiber
proteins.
To determine the quaternary structure of the fiber
protein variants, boiled and unboiled samples of lysates of HeLa
cells transfected with plasmids pTFSF, pTFSFB or pTFSFB-GRP
were electrophoresed on a 4-20% gradient Tris-CI gel. Upon
boiling, the fiber protein is dissociated to a monomeric form,
whereas unboiled fiber migrates as a trimer. The separated
proteins were transferred to a PVDF membrane and subjected to
Western blot analysis employing anti-fiber mAb 4D2 which
recognizes both fiber monomers and trimers. Figure 5 shows
that boiled fiber-GRP fusion protein migrated as the monomeric
form of the protein whereas unboiled fiber-GRP fusion protein
migrated as a trimer. This indicates that it is possible to add
exogenous sequences to the carboxy terminus of the fiber
protein, at least as Iarge as twenty-two amino acids, without
perturbing the quaternary structure of the protein. Thus, the
derived fiber-Iigand fusion gene retains the requisite quaternary
configuration characteristics for its incorporation into assembled
adenoviral capsids.
- 35 EXAMPLE S
Biosynthesis of fiber protein variants in vaccinia vector-infected
cells
23
CA 02237059 1998-OS-26
WO 97/20575 PCT/US96/19454
In order for the fiber protein to be properly
incorporated into the vertices of adenoviral capsids it must be
transported from the cytoplasm to the nucleus, where it
accumulates prior to virion assembly. To determine whether the
fiber-GRP fusion protein was able to achieve nuclear localization,
HeLa cells seeded on glass coverslips were transfected with
plasmids pTF, the parental vector, pTFSF, which expresses wild-
type fiber, pTFSFB, which expresses the fiber-linker construct, or
pTFSFB-GRP, which expresses the fiber-GRP ligand construct.
After 24 hours, the cells were fixed with 3°l0 (v/v)
paraformaldehyde in PBS, pH 7.4, and permeabilized with
methanol prior to analysis by indirect immunofluorescence with
anti-fiber mAbs 4D2 and 2A6 or an anti-GRP antibody being
used as the primary antibodies. FITC-conjugated goat anti-
mouse or -rabbit antibody {Sigma) was employed as the
secondary antibody and fluorescent cells were visualized under a
fluorescence microscope (Figure 6).
Fluorescent staining of the nuclei of HeLa cells
transfected with plasmids pTFSF, pTFSFB and pTFSFB-GRP was
observed when anti-fiber mAbs were used as the primary
probes. Further, when anti-GRP antibody was employed, nuclear
fluorescence was only detected in HeLa cells transfected with
pTFSB-GRP. These findings demonstrate that the fiber-GRP
fusion protein correctly localized to the nucleus of cells in which
it was expressed. Therefore it is possible to add exogenous
sequences to the carboxy terminus of the fiber protein without
perturbing the pattern of biosynthesis of the protein.
Acce~sibility of the GRP Iigand in the native form of the fiber-
GRP fusion rn otein
Having demonstrated that it is possible to add short
peptide sequences to the carboxy terminus of the adenovirus .
fiber protein without impairing either the biosynthesis or the
proper folding of the protein, it was determined whether the GRP
ligand is localized on the fiber protein externally as desired. If
the GRP Iigand, or any other ligand, is used to redirect adenoviral
24
CA 02237059 1998-05-26
WO 97/20575 PCT/CTS96/19454
vectors, it is imperative that the ligand be externally accessible
to its cellular receptor. In order to determine whether the GRP
ligand in the trimeric form of the fiber-GRP fusion protein was
exposed, an immunoblot assay was performed. Boiled and
unboiled lysates from IieLa cells transfected with pTFSFB or
pTFSFB-GRP were probed with either anti-fiber mAb 4D2, which
recognizes both fiber trimers and monomers, or anti-GRP
antibody. In this assay, unboiled lysates should have intact
trimeric fiber proteins, while boiling denatures this quaternary
structure, yielding monomers.
As shown in Figure 7, when boiled and unboiled
lysates containing the modified fiber with the linker only
(pTFSFB) were subjected to Western blot analysis and probed
with 4D2, a monomer and trimer band were detected for the
boiled and unboiled samples, respectively. When the same
samples were probed with anti-GRP antibody, no bands could be
detected, due to the absence of ligand in this construct. When
boiled and unboiled cell lysates containing the fiber-GRP fusion
protein were probed with 4D2, a monomer and trimer band were
detected, respectively. When the same samples were probed
with an anti-GRP antibody, a monomer band could be detected in
the boiled sample and a trimer band could be detected in the
unboiled sample. These results indicate that not only is the GRP
ligand in the fiber-GRP fusion protein accessible to binding in the
monomeric form of the protein, but the ligand is also exposed
and accessible to binding in the native or trimeric form of the
protein.
These studies demonstrated several properties of the
fiber-ligand fusion protein, including that ( I ) the protein retains
its ability to trimerize; (2) the protein retains its native
biosynthesis profile; and (3) the protein presents the added
ligand in an exterior, surface-exposed localization. These studies
- demonstrate the feasibility of introducing heterologous peptide
ligands into the cell-binding domain of the adenoviral fiber
protein in a manner consistent with the derivation of functional
chimeric adenoviral particles.
CA 02237059 1998-OS-26
WO 97/20575 PCT/US96/19454
EXAMPLE 7
Modifying the tropism of recombinant a enoviral vectors using
genetic methods to alter the adenoviral fiber cell-binding protein
The tropism of recombinant adenoviral vectors has
been altered by incorporating heterologous Iigands into the fiber
protein by creating genetic fusion constructs. The data presented
above shows the incorporation small peptide ligands into the
carboxy terminus of the adenoviral fiber protein. The limits of
Iigand size which can be incorporated in this manner can be
determined. Whereas a small peptide (GRP) was initially
incorporated as a novel ligand domain for the fiber, other types '
of Iigands, of larger size and more complex configuration, need to
be incorporated into a chimeric fiber to achieve a tropism-
rnodified adenoviral vector useful for gene therapy.
Conventional recombinant-DNA methodologies would not be
amenable to facile derivation of recombinant adenovirai genomes
incorporating the chimeric fiber genes for functional screening
purposes. Therefore, the alternate methodology of the present
invention was developed which allows rapid construction of
fiber-modified virions. These vectors are confirmed for the
successful incorporation of chimeric fiber proteins with distinct
target binding specificities. These studies result in the derivation
of a series of tropism-modified adenoviral vectors based upon
genetic modification of the fiber protein.
EXAMPLE 8
Construction of recombinant plasmids
A fiber rescue plasmid was constructed for
recombination with shuttle plasmids containing fiber variants.
For this construction, the commercial plasmid pBR322 was
modified to provide restriction sites of utility. First, the Clal site
was destroyed by Iinearization with Clal, the termini were
blunted by a Klenow enzyme fill-in reaction and the plasmid was
re-circularized. The resultant plasmid, pBR~Cla, was then
digested with Pvul1 and ligated with the Munl linker, 5' .
CCCCAATTGGGG 3', resulting in the plasmid pBR.MUN, which
served as the cloning vector for subsequent constructions. Three
26
CA 02237059 1998-OS-26
WO 97/20575 PCT/US96/19454
distinct segments comprising the adenoviral genome were then
cloned into pBR.MUN. First, a 1.9 kb Ndel-Munl fragment from
the genome of the recombinant adenovirus Ad51uc3 was excised.
This recombinant adenovirus is a replication-competent vector
containing the firefly luciferase gene in place of the deleted E3
region (25) and was provided by F. Graham (McMaster
University, Hamilton, Ontario, Canada). The Ad51uc3 1.9 kb
fragment was cloned into the corresponding sites of pBR.MUN to
create the plasmid pRB.MN2. This plasmid contains a unique Clal
site within the luciferase segment of the cloned Ad51uc3 Ndel-
Munl fragment. This Clal site and a Muni site were then
employed to clone a 4.0 kb Clal-Munl DNA fragment from the
plasmid pJMI7 (26) containing the joined adenoviral inverted
terminal repeats (ITRs). The plasmid pJMl7 contains a full sized
circularized adenoviral genome. Since the Clal site of interest in
pJM 17 overlaps with D a m -methylation sites, to provide
accessibility for Clal digestion the plasmid was isolated from
Dam- E.scherichia coli strain JM110. The resultant plasmid, pAR,
contains the pBR.MUN backbone flanked by two segments of
adenoviral genomic DNA which normally flank the fiber gene in
the Ad51uc3 genome. To complete the construction of the rescue
plasmid, a 30 kb Clal fragment from AdSluc3 genomic DNA was
cloned into the unique Clal site of pAR. After electroporation of
the ligated DNA into E. coli SURE cells (Stratagene, LaJolla, CA),
ampicillin resistant clones were isolated for restriction analysis.
The complete rescue plasmid was designated pVKS as shown in
Figure 8.
A fiber shuttle plasmid was generated for
incorporation of fiber variants into the adenoviral genome by
recombination with the adenoviral fiber rescue plasmid pVKS.
To construct the shuttle plasmid, a 3.6 kb Pacl-Kpnl DNA
fragment of Ad51uc3 DNA was cloned into the corresponding sites
- .of the commercial vector pNEB 193 (New England Bioiabs,
Cambridge, MA). The resulting plasmid, pNEB.PK3.6, contains a
complete copy of the Ad5 fiber gene flanked by two segments of
Ad5Iuc3 DNA of approximately 1.1 kb and 0.8 kb in length as
shown in Figure 9.
27
CA 02237059 1998-OS-26
WO 97/205'75 PCT/US96/19454
To facilitate genetic manipulation of the Ad5 fiber
gene, a master plasmid pBS.FSwt was made as follows: plasmid
pTFSF [24] was digested with Acc65.I, treated with Klenow
enzyme, digested with MunI and ligated with EcoICRi-EcoRI-
digested pBluescript KS II (Stratagene, La Jolla, CA). The
resulting plasmid, pBS.FSwt, contains the full length fiber ORF '
followed by part of the 3' untranslated region of the gene. To
engineer a gene suitable for the construction of fiber fusions, a
unique Fspl restriction site was introduced at the 3' end of the
fiber ORF by PCR-based mutagenesis. Primers FS.F1, 5'-ATG
AAG CGC GCC AGA CCG TCT GAA G-3' and FS.Rl, 5'-TTA GAG CTC
TTG GGC AAT GTA TGA AAA AGT G-3', were used with pTFSF as
a template to amplify the modified fiber gene. The PCR product
was then digested with BgIII and a 0.3 kb DNA fragment was
cloned into BgIII-EcoRV-digested pBS.FSwt resulting in
pBS.FS.LEU. As a result of these modifications, the last GAA
codon of the fiber ORF was mutated into GAG and CTC was added
to the sequence. This resulted in a unique EcoICRI-restriction
site at the 3'-end of the fiber gene. To facilitate the subcioning
of the chimeric fiber gene constructed in pBS.FS.LEU into the
fiber shuttle vector pNEB.PK3.6, a segment of the 3' untranslated
region of the fiber gene was synthesized as two oiigonucleotides
(5'-CTC TAA AGA ATC GTT TGT GTT ATG TTT CAA CGT GTT TAT
TTT TCA ATT GAA GCT TAT-3' and 5'-CGA TAA GCT TCA ATT
GAA AAA TAA ACA CGT TGA AAC ATA ACA CAA ACG ATT CTT
TAG AG-3') and cloned into EcoICRI-ClaI-digested pBS.FS.LEU.
The resulting plasmid, pBS.FS.UTR, was then used for all
subsequent modifications of the fiber gene.
To generate recombinant fiber genes encoding
chimeric fibers consisting of the Ad5 fiber tail and shaft domains
with knob domains derived from other adenoviruses, a plasmid
pSHAFT was made as follows. Two PCR primers (5'-ATG CAC
CAA ACA CAA ATC CCC TCA A-3' and 5'-CTC TTT CCC GGG TTA
GCT TAT CAT TAT TTT TG-3') were used to modify the sequence
of the Ad5 fiber gene coding for the TLWT motif highly
conserved in most characterized mammalian adenovirus fiber
genes [42]. The DNA fragment generated with these primers
28
CA 02237059 1998-05-26
WO 97/20575 PCT/LTS96/i9454
from Ad5-Luc 3 genomic DNA was then digested with NcoI and
cloned into NcoI-EcoICRI-digested pBS.FS.UTR. The plasmid
pSHAFT contains a truncated sequence of the Ad5 fiber gene
with an unique Smal site located next to a Leu codon preceding
the TLWT coding sequence. This plasmid was then used to
- construct a chimeric Ad5/Ad3 fiber gene. For this construction,
a portion of the Ad3 fiber gene coding for the knob domain was
PCR-amplified using plasmid pBR.Ad3Fib (provided by 3.
Chrobozcek, Grenoble, France), and a pair of primers: 5'-TAT GGA
CAG GTC CAA AAC CAG AAG C-3' and 5'-TTT ATT AGT CAT CTT
CTC TAA TAT AGG AAA AGG-3'. The PCR product was then
cloned into SmaI-EcoICRI-digested pSHAFT, resulting in
pBS.FS/3, which contains a chimeric fiber gene coding for the tail
and shaft domains of Ad5 and the knob domain of Ad3 fiber. To
subclone the recombinant fiber gene into the fiber shuttle
vector, a 0.73 kb Ncol-MunI DNA fragment of pBS.FS/3 was
cloned into NcoI-MunI-digested pNEB.PK3.6, resulting in
pNEB.PK.FS/3.
EXAMPLE 9
Muta,~gnesis of adenoviral fiber gene
To create a silent mutation in the adenoviral fiber
gene, a polymerase chain reaction (PCR)-based mutagenesis
method was employed to modify codon Ala-579 of the fiber open
reading frame (ORF) from GCC to GCG. This substitution at
position 1737 of the fiber open reading frame creates a novel
recognition site for the restriction endonuclease Fspl. Two pairs
of primers were designed for this mutagenesis:
primer Fl = 5' AAC AAA ATG TGG CAG TCA AAT AC 3',
primer F2 = 5' CAT ACA TTG C_ GC AAG AAT AAA G 3',
primer Rl = 5' CTT TAT TCT ~'GC GCA ATG TAT G 3', and
primer R2 = 5' TGA TGC ACG ATT ATG ACT CTA CC 3'.
Primers F2 and RI are complementary to the site of
- 35 the mutation; primers F1 and R2 are complementary to DNA
sequences outside the mutation site and designed as partners for
R1 and F2, correspondingly. Generation of the mutation was
29
CA 02237059 1998-OS-26
WO 97/20575 PCTJUS96/19454
accomplished via two sequential PCR reactions. First, primers F1-
R1 and F2-R2 were used with pNEB.PK3.6 to generate two DNA
fragments overlapping at the mutation site. These two fragments
were then employed as a template for a second PCR with primers
F1-R2. The DNA fragment generated via the second PCR reaction
contained the mutated alanine codon (see Figure 10). To transfer '
the mutated segment of the fiber gene into pNEB.PK3.6, the PCR
product was digested with BstXI and Munl. The 0.36 kb fragment
generated was used to replace the analogous segment in
pNEB.PK3.6. The DNA of the new plasmid, pNEB.PK.FSP, was
partially sequenced to confirm the presence of the mutation.
~,XA1V~L~, IO
generation of recombinant adenovirus with a modified fiber gene
After validation of the presence of the silent fiber
mutation, the mutated segment of the fiber gene was
incorporated into the pNEB.PK3.6 fiber shuttle vector. To
construct recombinant adenovirus containing the mutated fiber
gene, the newly generated fiber shuttle plasmid, pNEB.PK.FSP,
and the rescue plasmid, pVKS, were co-transfected into 293 cells.
The schema for the predicted recombination event is shown in
Figure 11. In this strategy, recombination between homologous
regions of the two plasmids would be predicted to yield an intact
viral genome whereby the fiber defect in the rescue plasmid was
rectified. Such a genome would be capable of generating progeny
virions as evidenced by plaque formation. To be successful in
generating progeny virus, the recombination event would thus
require excision of the oversized "stuffer" segment in the deleted
fiber region, as well as incorporation of an intact, functional fiber
into the rescue plasmid.
After initial transfection of 293 cells with the two
plasmid system, CPE was noted in the infected cells, indicating
the presence of infectious viral progeny. Control transfections
with only pVKS or only pNEB.PK.FSP did not yield CPE, confirming
that the component plasmids were not individually capable of
directing viral progeny synthesis. Cells from co-transfected
plates with evidence of viral propagation were lysed to release
CA 02237059 1998-05-26
WO 97/20575 PCT/US96/I9454
virus which was then expanded to permit genomic analysis.
Viral DNA was subjected to restriction endonuclease analysis
with Fspl to confirm the presence of the silent fiber mutation.
The pattern of this digestion corresponded to the pattern
predicted by virtue of incorporation of the mutated fiber gene
(Figure 12A). In this regard, an 1 l kb fragment is noted in
Ad51uc3 genomic DNA digested by Fspi, corresponding to the
right terminus of the viral genome (Figure 12B). In contrast, in
the viral DNA isolated from the co-transfected cells, Fspl
digestion yielded DNA fragments of 8 and 3 kb. This pattern is
predicted based upon the introduction of the additional Fspl site
into the progeny virus by virtue of a reco~binational event
between the fiber shuttle and rescue plasmids. J These findings
are consistent with the concept that an in vivo recombinational
event has resulted in the derivation of a recombinant adenovirus
incorporating the modified fiber protein.
The design of the two plasmid rescue systems
included an incorporated luciferase reporter gene for monitoring
the efficacy of the in vivo homologous recombinational event. In
this regard, the firefly luciferase reporter gene was originally
placed in the context of a deleted E3 domain in the replication-
competent recombinant adenovirus Ad51uc3 (25). In the two
plasmid rescue system, the proximity of the luciferase open
reading frame to the 5' fiber flanking regions would predict its '
involvement in at least a subset of productive recombinational
events. in this regard, progeny virions have demonstrated the
capacity to accomplish efficient transfer of luciferase activity to
heterologous cells, as has been noted with the parent vector (data
not shown). Thus, the incorporation of this reporter gene
provided an additional method of validating the fidelity of the
recombinational events allowing progeny virus derivation.
The present invention facilitates analysis of key
~ parameters relating to the biology of adenoviral capsid assembly.
Thus, one can now determine structural modifications of the fiber
- 35 protein which are compatible with the ability of fiber to assume
its native configuration for assembly of mature particles based
upon association with penton base capsomers (32). In addition,
31
CA 02237059 1998-OS-26
WO 97/20575 PCT/US96/19454
the development of the described fiber rescue system permits
the derivation of adenoviral vectors containing modified fiber
proteins. This step is of key utility in the context of strategies to
develop tropism-modified adenoviruses capable of targeted, cell-
s specific gene delivery. In this regard, genetic methods have been
successfully employed to alter the tropism of retroviral vectors .
towards the goal of cell-specific targeting (34). This has been
accomplished both by pseudotyping (35), as well as by direct
genetic modifications of the envelope giycoprotein of the
'10 retroviral particle (36). In the latter instance, cell specific
targeting has been achieved employing Iigands or single-chain
antibodies in fusion with the envelope glycoprotein as targeting
moieties. Thus, a substantial body of work has validated the
concept of tropism-modification of retrovirai vectors as a means
15 to achieve targeted, cell-specific gene delivery (34).
Despite these advancements in retroviral vector
development, the direct utility of this maneuver with regards to
practical gene therapy approaches is not immediately apparent.
This derives from the fact that retroviruses are highly labile in
20 vivo (37). This phenomenon is understood to reflect effective
humoral-mediated clearance subsequent to intravascular
delivery. It must therefore be recognized that the various
targeting maneuvers are not of a high Level of utility in the
context of strategies designed to accomplish direct, in vivo
25 transduction subsequent to systemic administration. Thus,
despite the acquisition of a targeting capacity, these
modifications have not allowed a more generalized use of
retroviral vectors for transduction of non-localized targets. In
contrast, adenoviruses are highly competent in achieving direct
30 in vivo gene delivery (4,19). Thus, modifications to adenoviral
vectors allowing cell-specific targeting would appear to be of
direct utility in gene therapy approaches. To this end, strategies
have been pursued to achieve modification of the native binding ,
domain of the adenovirus as a means to alter parent virus
35 tropism. The present invention developed the methods required
to incorporate these fiber-ligand chimeras into particles for
derivation of tropism-modified virions.
32
CA 02237059 1998-OS-26
WO 97!20575 PCT/US96/19454
In the present invention, the feasibility of using a two
plasmid rescue system for deriving adenoviral vectors containing
fiber gene variants was demonstrated. This strategy was
undertaken to produce a rapid and facile method for the
derivation of these agents. In this regard, direct cloning in the
context of the large (36 kb) and complex adenoviral genome is
limited by its technical complexity. In addition, whereas
adenoviral pseudotypes have been derived (38), their utility for
cell-specific targeting purposes would be limited, as many of the
various adenoviral serotypes are characterized by the broad
tropism profiles of the major human fiber serotypes (39). Thus,
a strategy of direct genetic modification of the fiber gene as a
means to achieve specific alteration of viral tropism has been
developed. The present invention demonstrates that variant fiber
molecules can be incorporated into mature particles. A person
having ordinary skill would therefore be able to incorporate fiber
variants with targeting potential in mature particles employing
these methods.
E~~.MPLE 11
~''~~struction of a two-plasmid rescue system for derivation of
adenoviral fiber recombinants
Methods were developed to produce recombinant
adenoviral vectors employing in vivo homologous recombination.
These methods are based upon non-infectious adenoviral genome
constructs undergoing recombination in target cells to yield an
infectious viral genome capable of propagation of progeny
virions. Techniques reported to date have included the use of
overlapping linear DNA constructs (29-31 ), as well as the use of
plasmid based systems (26). In the latter instance, a two
plasmid strategy based upon recombination between a "shuttle
plasmid", containing heterologous sequences, and a "rescue
plasmid", providing the required viral functions, has been widely
employed (26).
The latter methodology was employed for the
strategy to generate adenoviral fiber variants of the present
invention. As a first step towards this goal, the fiber rescue
33
CA 02237059 1998-OS-26
WO 97/20575 PCT/US96/19454
plasmid, pVKS, was constructed for recombination with fiber
variant containing constructs (Figure 8). This plasmid, pVKS, was
designed to possess the key attributes of described rescue
plasmid vectors. The fiber rescue plasmid contains a viral
genome joined at the ITRs within a prokaryotic vector backbone.
The adenoviral genorne is deleted for the fiber gene via
substitution with a bacterial plasmid segment. In addition, the
prokaryotic vector backbone "stuffer" segment results in an
oversized, and thus unpackagable, adenoviral genome. Thus, the
plasmid pVKS would not be capable of generating progeny
virions after transfection into eucaryotic cells, due to its size, in
addition to the fact that viral fiber functions are of essential
importance (32, 33) for lateral infection and thus progeny plaque
generation.
The derived rescue plasmid differs in several
additional respects from described adenoviral plasrnid
recombination systems (27-31 ). In this construction, the
adenoviral ElA/B regions were retained to allow replication of
derived recombinant adenoviruses in a variety of cellular targets.
Deletion of this region could be accomplished, however, with the
mandate that viral rescue procedures be carried out in the
context of an E1-transcomplementing cell line, such as 293 (27).
In addition, incorporated within the viral genome of the rescue
plasmid is a luciferase reporter gene. To accomplish this, DNA
segments derived from the recombinant adenovirus Ad51uc3
(25) which contains a firefly luciferase reporter gene in place of
the deleted E3 region were utilized. The luciferase gene was
included to provide an additional means of monitoring progeny
viral competence within the context of the recombinational
system of the present invention.
For employ with the fiber rescue plasmid pVKS, a
fiber shuttle plasmid was also derived. This plasmid was
designed to provide a complete copy of the fiber gene for
generation of recombinant viral genome. To achieve efficient
recombination with the rescue plasmid, the shuttle vector must
contain flanking regions of viral DNA homologous to
corresponding regions in the rescue plasmid. The lengths of
34
CA 02237059 1998-OS-26
WO 97/20575 PCT/IJS96/19454
these flanks require sufficient overlap to provide efficient in vivo
homologous , recombination between the two plasmids. The fiber
shuttle vector pNEB.PK3.6 was thus designed to provide these
functional requirements (Figure 9). In addition, pNEB.PK3.6
contains several unique restriction sites convenient for making
modifications of the fiber gene.
EXAMPLE I2
Cells
293 cells [27] were obtained from Microbix (Toronto,
Canada) and maintained in Dulbecco's modified Eagle's
medium/Ham's F12 (DMEM/FI2) supplemented with 10% fetal
calf serum (FCS) at 37°C and 5% C02.
EXAMPLE I3
F~~pression of Ad5 and Ad3 knobs in E toll
Recombinant adenovirus containing chimeric
Ad5/Ad3 fibers was generated by in vitro recombination
between pVKS and pNEB.PK.F5l3 using methods described
above. To confirm the identity of the rescued virus, its DNA was
characterized by restriction digestion with DraI and ScaI.
The knob domains of Ad5 and Ad3 fibers were
expressed in E. toll with N-terminal 6xHis tags using the pQE30
expression vector {Qiagen, Hilden, Germany). Ad5-Luc 3 DNA
and plasmid pBR.Ad3Fib were used as templates for PCR to
amplify the knob domains of the respective fiber genes. Primers
for these reactions were: FS.F, 5'-TTT AAG GAT TCC GGT GCC ATT
ACA GTA GGA A-3'; FS.R, 5'-TAT ATA AGC TTA TTC TTG GGC
AAT GTA TGA-3'; F3.F, 5'-CTC GGA TCC AAT TCT ATT GCA CTG
AAA AAT AAC-3'; and F3.R, 5'-GGG AAG CTT AGT CAT CTT CTC
TAA TAT AGG AAA AGG-3'. Each pair of primers amplified a
DNA sequence coding for the knob domain plus the last repeat of
the shaft domain of the corresponding fiber polypeptide. Both
PCR products were then digested with BamHI and HindIII and
. 35 cloned into BamHI-HindIII-digested pQE30, resulting in
plasmids pQE.KNOBS and pQE.KNOB3. Recombinant proteins
isolated from E. toll MIS(pREP4) cells harboring pQE.KNOBS and
CA 02237059 1998-OS-26
WO 97/20575 PCT/LTS96/19454
pQE.KNOB3 were purified on Ni-NTA agarose columns (Qiagen,
Hilden, Germany). The ability of both proteins to form
homotrimers was verified by SDS-PAGE of boiled and unboiled
samples as described before [24, 55]. The concentrations of the
purified knobs were determined by the Bradford protein assay
(Bio Rad, Hercules, California} using bovine IgG as the standard. '
EXAMPLE 14
In vitro gene transfer mediated by the ~-ecorz~binant adenovirus
containing chimeric fiber rn otein
The construction of the adenoviral vector containing
the chimeric fiber protein was undertaken to alter receptor
tropism for purposes of targeted gene delivery. In this regard,
adenovirus serotypes 3 and 5 achieve cellular entry via distinct
cell surface receptors [22, 39]. Thus, to validate the functional
utility of constructing the chimeric fiber, that entry of Ad5/3-
Luc 3 occurred via the pathway dictated by the knob domain of
the fiber was demonstrated. As the receptors for type 3 and
type 5 adenoviruses coexist on many types of cells, including
293 cells, it was necessary to be able to validate specific entry
via each pathway. Recombinant serotype 3 and 5 knobs were
expressed in E. coli and SDS-polyacrylamide gel electrophoresis
confirmed that the purified proteins were trimeric (data not
shown). Various concentrations of each recombinant knob were
preincubated with 293 cell monolayers prior to infection with
the parent adenoviral vector Ad5-Luc 3 or the modified
adenovirus Ad5/3-Luc 3. Since both viruses carry the gene
encoding firefly Iuciferase, viral infectivity was measured
indirectly by determination of luciferase activity in the infected
celis. Thus, entry via the adenovirus type 5 receptor was
confirmed employing competition with the recombinant type 5
knob and entry via the adenovirus type 3 receptor was
confirmed by competition with the type 3 knob.
This analysis confirmed that competition with the
recombinant type 5 knob inhibited the infectivity of the parent .
virus Ad5-Luc 3 in a dose-dependent manner. When employed
at a concentration of 100 ug/ml, the type 5 knob inhibited 97Q1o
36
CA 02237059 1998-OS-26
WO 97/20575 PCT/US96/19454
of the maximal luciferase activity, confirming that specific entry
was via the adenovirus type 5 cellular receptor (Figure 15A).
The specificity of this interaction was confirmed in that type 3
fiber knob was not capable of blocking the gene transfer by
Ad5-Luc 3 in competition experiments (Figure 15B). A similar
analysis was then carried out employing the Ad5/3-Luc 3
chimeric virus. In competition experiments employing the type
3 knob, it was observed that the Ad5/3-Luc 3-mediated gene
transfer could be blocked in a dose-dependent manner. At a
concentration of 100 p,g/ml, the type 3 knob inhibited 80% of the
maximal luciferase activity of Ad5/3-Luc 3 (Figure 15B).
Conversely, gene transfer by this modified virus was only
minimally inhibited by high concentrations of type 5 knob
(Figure 15A). These findings thus confirm that Ad5/3-Luc 3,
which contains a chimeric fiber protein with the knob domain
derived from serotype 3, achieved cellular entry via the
adenovirus type 3 pathway. Thus, the overall specificity of viral
entry was dictated exclusively by the knob domain of the
chimeric fiber.
~XAMPLh~ i5
To restrict gene delivery exclusively to the target cells, it is
necessary to prevent the interaction between the knob domain of
the adenovirus fiber and its cellular receptor which plays the
major role in the determination of adenoviral tropism. Since the
specific amino acid residues in the knob which recognize the cell
surface receptor have not yet been identified, it is not currently
possible to ablate this binding site by employing genetic
techniques such as site-directed mutagenesis. However, a
neutralizing anti-knob antibody would be capable of blocking the
primary interaction between the adenovirus fiber and its cognate
cellular receptor. The present invention shows that if such an
antibody were chemically conjugated to a ligand recognizing a
specific cell surface receptor, it targets the adenoviral vector to
this novel receptor.
The first stage in developing the targeted adenoviral
vector of this embodiment of the present invention was therefore
37
CA 02237059 1998-OS-26
WO 97/20575 PCT/US96119454
the generation of a neutralizing anti-knob monoclonal antibody
(mAb). Hybridomas were generated by standard techniques
after immunization of mice with intact Ad5 followed by two
rounds of immunization with purified recombinant Ad5 knob.
Supernatants from these hybridomas were assayed for the
phenotypic characteristics important in modifying adenoviral '
tropism via immunological crosslinking: (l) reactivity with
trimeric recombinant Ad5 knob, as determined in an ELISA; and
(ii) inhibition of Ad5 infection of HeLa cells, as determined by
neutralization of adenoviral cytopathic effect (CPE). On the basis
of its high affinity binding to recombinant Ad5 knob and its
ability to neutralize Ad5 infection of HeLa cells data not shown),
one clone, designated 1D6.14, was chosen for _examination and
the mAb was purified from ascites fluid by affinity
chromatography using an immobilized protein A column.
To develop a targeted adenoviral vector by
immunological methods, it was preferable to employ the Fab
fragment of the antibody rather than the intact immunoglobulin.
In this manner, the two antigen-binding arms of the parent
antibody was prevented from crossiinking different viruses to
form large complexes which might prove refractory to cellular
uptake. Therefore, intact 1D6.14 was digested with papain and
the Fab fragments were purified. As shown in Figure 16, both
the parent antibody and the Fab fragment were capable of
neutralizing adenovirus infection in a dose-dependent manner,
whereas an irrelevant control antibody failed to block infection.
Next, the ability to recognize specific receptors
expressed on the surface of the target cells was introduced. A
conjugate of the vitamin folate and the Fab fragment of the
neutralizing anti-knob mAb was constructed. This was done with
the aim of targeting adenoviruses to the high affinity folate
receptor (Kd 10-g M), which is overexpressed on the surface of
several malignant cell lines, including ovarian, lung and breast .
carcinomas and brain tumors. Folate can be conjugated via its y
carboxylate group to a variety of macromolecules, including .
antibodies, without losing affinity for its cellular receptor. Since
folate and folate-macromolecule conjugates are internalized via
38
CA 02237059 1998-OS-26
WO 97/20575 PC"T/US96/19454
the folate receptor by a mechanism termed potocytosis which
involves nonclathrin-coated caveolae with a diameter of 60 nm,
an adenovirus (diameter 65-80 nm, excluding the fibers) would
be too large to enter this pathway. However, after binding
specifically to the cell surface folate receptors, the adenoviral
vector was able to accomplish internalization by its native
endocytotic pathway mediated by the interaction of the penton
base with secondary host cell receptors, av integrins.
Carboxyl groups of folate were coupled to amine
groups of the Fab fragment of anti-knob mAb 1D6.14 by a
carbodiimide procedure, as described by Kranz, et al., Proc. Natl.
Acad. Sci. USA 92, 9057-9061 (1995). The resulting conjugate,
hereafter referred to as the Fab-folate conjugate, was
characterized both structurally and functionally. The conjugation
of folate to the antibody fragment was verified by SDS-PAGE
under denaturing conditions followed by immunoblot analysis
employing an anti-folate mAb. An alkaline phosphatase-
conjugated secondary antibody specific for the Fc region of
mouse IgG was used to prevent cross-reaction with the Fab
fragment of 1D6.14. The anti-folate antibody reacted specifically
with the Fab-folate conjugate, while failing to recognize the
unconjugated Fab fragment, thus confirming the success of the
conjugation.
The ability of the Fab-folate conjugate to recognize
the folate receptor was evaluated in a competition binding assay
using 3 H-labeled folate and KB cells, a folate receptor-positive
human nasopharyngeal carcinoma cell line. This showed that
binding of the labeled folate to KB cells was inhibited by the Fab
folate conjugate and by a conjugate of folate with the intact
1D6.14 antibody, but not by the antibody alone. Thus, the
conjugation of folate to the Fab fragment of the neutralizing
antibody had not destroyed the ability of folate to bind to its
receptor.
Whether the conjugation of folate to the neutralizing
anti-knob Fab fragment had affected its ability to block
adenovirus infection was then determined. AdCMVLuc, an E1-,
E3-deleted Ad5 vector which expresses firefly luciferase from
39
CA 02237059 1998-OS-26
WO 97/20575 PCT/LJS96/19454
the cytomegalovirus (CMV) promoter, was premixed with various
concentrations of the Fab-folate conjugate prior to infection of
HeLa cell monolayers. Expression of luciferase activity in
infected cells was determined 24 hours post-infection: this value
is directly proportional to the number of infecting virus particles.
The Fab-folate conjugate was confirmed as being capable of
neutralizing adenoviral infection. This neutralization was dose-
dependent, with maximal inhibition occurring with 0.5 mg Fab-
folate.
Having verified the reagents, that the Fab-folate
conjugate was capable of modifying the tropism of an adenoviral
vector to permit specific targeting of the folate receptor was
demonstrated. The adenoviral vector AdCMVLuc was premixed
with the optimal neutralizing concentrations of the unconjugated
Fab fragment or the Fab-folate conjugate prior to infection of KB
cell monolayers maintained in folate-free medium. The level of
luciferase activity was determined 24 hours post-infection. As
shown in Figure 17, AdCMVLuc was able to infect KB cells at a
level such that greater than 107 relative light units were
expressed per microgram of cellular protein. In contrast, the
unconjugated Fab fragment blocked infection of KB cells by
AdCMVLuc by preventing the knob domain of the virus fiber
from binding to its cellular receptor, thus resulting in a 99%
decrement of luciferase expression. However, a high level of
Iuciferase activity was restored when AdCMVLuc was premixed
with the Fab-folate conjugate, indicating that the retargeted virus
was capable of efficient infection. When a competition
experiment was performed in which the target cells were
preincubated in folate-containing medium and the infection
carried out in the presence of excess free folate, the Fab-folate
conjugate failed to mediate infection of KB cells by AdCMVLuc
the free folate saturated the target receptor, preventing the
binding of the viral complex. Thus, the Fab-folate conjugate
redirected adenoviral infection of target cells specifically via the
folate receptor.
To demonstrate the ability of the Fab-folate conjugate
to redirect toxin-mediated cell killing, an EI-deleted Ad5 vector
CA 02237059 1998-OS-26
WO 97/20575 PCT/US96/19454
which expresses the prodrug-activating herpes simplex virus
thymidine kinase (HSV-TK) gene from the CMV promoter was
utilized for infection of KB cells (18). Cells infected with
AdCMVHSV-TK and subsequently treated with ganciclovir (GCV)
demonstrated 73% cell death as expected. In contrast, when
' AdCMVHSV-TK was mixed with the neutralizing Fab only 8% of
the KB cells were eradicated, indicating nearly 90% inhibition of
TK/GCV mediated cell killing due to neutralization of adenoviral
binding. Retargeting of the AdCMVHSV-TK vector with the Fab
folate conjugate restored TK/GCV mediated cell killing with
eradication of almost 40% of the total cell population. This
retargeting was specific for folate, as an excess of folate added to
the AdCMVHSV-TK/Fab-folate infection media resulted in an
inhibition of cell death comparable to that seen with the Fab
alone. Thus, not only could TK/GCV mediated cell killing he
ablated with the neutralizing Fab, but retargeting of the virus via
Fab-folate successfully overcame this inhibition and resulted in
specific tumor cell eradication.
The present invention shows that a vector derived
from AdS, which possessed chimeric fibers composed of the tail
and shaft domains of Ad5 and the knob domain of Ad3,
specifically targeted the Ad3 cellular receptor. This
demonstrated that it is possible to alter the Ad5 receptor
recognition profile and supports the idea that one can develop
adenoviral vectors capable of targeted gene delivery to cells
possessing specific surface receptor molecules. Furthermore, the
present invention demonstrated that by complexing AdCMVLuc
with Fab-folate, viral infection of target cells is specifically
redirected via the folate receptor, resulting in a level of gene
transfer comparable to that achieved by native adenoviral
infection, which is in marked contrast to the inefficient infection
exhibited by retargeted retroviral vectors. Furthermore,
- evidence of the utility of this targeting strategy for cancer gene
therapy was provided by demonstrating that the Fab-folate
- 35 conjugate can modify the tropism of AdCMVHSV-TK to achieve
the killing of tumor cells expressing the folate receptor.
41
CA 02237059 1998-OS-26
WO 97!20575 PCT/CTS96/19454
Since the adenoviral particles targeted to the folate
receptor are too large to be accommodated within caveolae, the
viruses could not have been internalized by potocytosis, the
mechanism by which folate-macromolecule complexes enter cells.
Therefore, that the Fab-folate conjugate redirected adenoviral
infection specifically via the folate receptor indicates that
modification of the first step of Ad infection, attachment of the
knob domain of the fiber to primary cell surface receptors, does
not affect the ability of the virus to accomplish the second step of
infection, internalization. This is supported by the showing that
binding-incompetent adenovirus facilitates molecular conjugate-
mediated gene transfer by the receptor-mediated endocytosis
pathway. In this case, it was shown that binding of the
adenovirus to its native receptor is not a prerequisite for
adenoviral-mediated endosome disruption: thus, the processes of
adenoviral binding and subsequent entry steps are not
functionally linked. This suggests that the range of cell-targeting
ligands which can be employed in the construction of tropism-
modified Ad vectors need not be restricted by the native
internalization pathway of the ligand. The present invention
provides strong evidence that a person having ordinary skill in
this art can generate tropism-modified adenoviral vectors
capable of targeted cell-specific gene delivery via a non-
adenoviral receptor. Such a vector will enormously expand the
potential therapeutic approaches which may be attempted
employing gene therapy strategies.
The following references were cited herein:
l . Jolly, D., in Cancer Gene Therapy, eds. Appleton & Lange,
pp. 51-64, ( 1994).
2. Trapneil, B.C., et al., Current Opinion in Biotechnology
5:617-625, ( 1994).
3. Siegfried., Exp Clin Endocrinol 101:7-11, (1993).
4. Bout, A., et al., Human Gene Therapy 5:3-10, (I994). -
5. La Salle, G.L.G., et al., Science 259:988-990, (1993).
6. Csete, M.E., et al., Transplantation Proceedings 26(2):756- -
757, ( 1994).
7. Maeda, H., et al., Gastroenterology 106:1638-1644, {I994).
42
CA 02237059 1998-OS-26
WO 97/20575 PCT/US96/19454
8. Jaffe, H.A., et aL, Nature Genetics 1:372-378, ( 1992).
9. DeMatteo, R.P., et al.,Annals Of Surgery 222(3):229-242,
( I995).
I0. Mastrangeli, A., et al., Am J Physiol 266:61146-61155,
(1994).
11. Moullier, P., et aL, Kidney International 45:1220-1225,
( 1994).
12. Mitani, K., et al., Human Gene Therapy 5:941-948, {1994).
13. Crystal, R.G., et al., Nature Genetics 8:42-51, (I994).
'10 14. Clayman, G.L., et al., Cancer Gene Therapy 2(2):105-11,
(1995).
15. Liu, T.-J., et al., Cancer Research 54:3662-3667, 0994).
16. Smythe, W.R., et al., Ann Thorac Surg 57:1395-1401,
( i 994).
17. Fujiwara, T., et al., Cancer Reearch 54:2287-2291, (1994).
18. Addison, C.L., et al., Proc Natl Acad Sci 92:8522-8526,
(1995).
19. Strattford-Perricaudet, L., et al., J Clin Invest 90:626-630,
( 1992).
20. Huard, J., et al., Gene Therapy 2:107-115, (1995).
2I. Henry, L.J., et aL, Journal of Virology 68:5239-5246,
( 1994).
22. Stevenson, S.C., et al., J. of Virology 69:2850-2857, (1995).
23. Louis, N., et al., Journal of Virology 68:4104-4106, {1994).
24. Michael, S.L, et al., Gene Therapy, 2:660-669, (1995).
25. Mittal, S.K., et al., Virus Research 28:67-90, (1993).
26. McGrory, W.J., et al., Virology 163:614-617, (1988).
27. Graham, F.L., et al., J Gen Virol 36:59-72, ( I977).
28. Graham, F.L., et al., Methods in Molec. Biology 7:109-128,
( 1991 ).
29. Davidson, D., et al., Journal of Virology 61:1226-1239,
(1987).
30. BaIIay, A., et al., The EMBO Journal 4:3861-3865, (1985).
31. Berkner, K.L., et al., Journal of Virology 61:1213-1220,
(1987).
32. Boudin, M.-L., et al.,Virology 116:589-604, (1982).
43
CA 02237059 1998-OS-26
WO 97/20575 PCTII1S96/19454
33. Falgout, B., et al., Journal of Virology 62:622-625, (1988).
34. Douglas, J.T., et al., Tumor Targeting 1:67-84, (1995).
35. Yee, J.-K., et aL, Methods in Cell Biology 43:99-112, (i994).
36. Kasahara, N., et al., Science 266:1373-i 376, ( I994).
37. Cardoso, J.E., et al., Human Gene Therapy 4:411-418,
{ 1993).
38. Plaat, D., et al., Virology 98:55-62, {1979).
39. Defer, C., et aL, Journal of Virology 64:3661-3673, (1990).
40. Bai M., et al., J. Virol. 67:5198-5205, (1993).
41. Bett A., et al., Proc. Natl. Acad. Sci. USA 91:8802-8806,
( I 994).
42. Chroboczek J., et al.,. Adenovirus fiber, p. 163-200. In The
molecular repertoire of adenoviruses I, W. Doerfler and P.
Bohm (ed.), Springer-Verlag. Berlin/New York, (1995).
43. Chu T.-H., et al., J. Virol. 69:2659-2663, {1995).
44. Chu T.-H., et al., Gene Ther. 1:292-299, ( I994).
45. Clayman G., et al., Cancer Res. 55:1-6, (1995).
46. Cosset F.-L., et al., J. Virol. 69:6314-6322, { 1995).
47. Dong J., et al., J. Virol. 66:7374-7382, (1992).
48. Emi N., et aL, J. Virol. 65:1202-1207, ( 1991 ).
49. Ghosh-Choudhury G., et al., EMBO J. 6:1733-1739, (1987).
50. Greber U., et al., Cell 1993:477-486, {1993}.
51. Han X., et al., Proc. Natl. Acad. Sci. USA 92:9747-9751,
_ (1995).
52. Mathias P., et al., J. Virol. 68:6811-6814, (1994).
53. Michael S., et aL, J. Biol. Chem. 268:6866-6869, {1993).
54. Novelli A., et al., J. Biol. Chem. 266:9299-9303, (1991a).
55. Novelli A., et aL, Virology 185:365-376, (1991b).
56. Philipson L., et al., J. Virol. 2:1064-1075, (1968).
57. Russell S., et al., Nucleic Acids Res. 21:1081-1085, ( 1993).
58. Seth P., et al., Pathway of adenovirus entry into cells., p.
I91-195. In R. Crowell and K. Lonberg-Holm (ed.), Virus
attachment and entry into cells. American Society for
Microbiology, Washington, D.C, ( 1986).
59. Somia N., et al., Proc. Natl. Acad. Sci. USA 92:7570-7574,
{ 1995).
60. Takeuchi Y., et al., J. Virol. 68:8001-8007, (1994).
44
CA 02237059 2004-08-17
61. Valsesia-Wittmann S., et al., J. Viral. 68:4609-4619, ( 1994).
62. Weiss R., et al., Virology 76:808-825, ( 1977).
63. Wickham T., et al., Gene Ther. 2:750-756, ( 1995).
64. Wickham T., et al., J. Cell Biol. 127:257-264, ( 1994).
65. Wickham T., et al., Cel173:309-319, (1993).
66. Yee J.-K., et al., Proc. Natl. Acad. Sci. USA 91:9564-9568,
( 1994).
Any patents or publications mentioned in this
specification are indicative of the levels of those skilled in the
art to which the invention pertains.
One skilled in the art will readily appreciate that the
present invention is well adapted to carry out the objects and
obtain the ends and advantages mentioned, as well as those
inherent therein. The present examples along with the methods,
procedures, treatments, molecules, and specific compounds
described herein are presently representative of preferred
embodiments, are exemplary, and are not intended as
limitations vn the scope of the invention. Changes therein and
other uses will occur to those skilled in the art which are
encompassed within the spirit of the invention as defined by the
scope of the claims.
CA 02237059 2006-10-06
SEQUENCE
(1) GENERAL INFORMATION:
(i) APPLICANT:
(A) NAME: The University of Alabama at Birmingham Research
Foundation
(B) STREET: 701 20th Street South
(C) CITY: Birmingham
(D) STATE/PROVINCE: Alabama
(E) COUNTRY: U.S.A.
(F) POSTAL CODE/ZIP: 35924-0111
(G) TELEPHONE:
(I) TELEFAX:
(ii) TITLE OF INVENTION: Targeted Adenovirus Vectors
(iii) NUMBER OF SEQUENCES: 17
(iv) CORRESPONDENCE ADDRESS:
(A) ADDRESSEE: Borden Ladner Gervais LLP
(B) STREET: 1100-100 Queen Street
(C) CITY: Ottawa
(D) STATE/PROVINCE: Ontario
(E) COUNTRY: CANADA
(F) POSTAL CODE/ZIP: K1P 1J9
(v) COMPUTER READABLE FORM:
(A) MEDIUM TYPE: Floppy Disk
(B) COMPUTER: IBM PC compatible
(C) OPERATING SYSTEM: PC-DOS/MS-DOS
(D) SOFTWARE: ASCII (text)
(vi) CURRENT APPLICATION DATA:
(A) APPLICATION NUMBER: CA 2,237,059
(B) FILING DATE: 06-DEC-1996
(vii) PRIOR APPLICATION DATA:
(A) APPLICATION NUMBER: US 60/008,375
(B) FILING DATE: 08-DEC-1995
(viii) ATTORNEY/AGENT INFORMATION:
(A) NAME: Marsman, Kathleen E.
(B) REGISTRATION NUMBER: 10972
(C) REFERENCE/DOCKET NUMBER: PAT 42782W-1
(ix) TELECOMMUNICATION INFORMATION:
(A) TELEPHONE: (613) 237-5160
(B) TELEFAX: (613) 787-3558
(2) INFORMATION FOR SEQ ID N0: 1:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 12
(B) TYPE: nucleic acid
(C) STRANDEDNESS: unknown
(D) TOPOLOGY: unknown
(vi) ORIGINAL SOURCE:
(A) ORGANISM: artificial sequence
46
CA 02237059 2006-10-06
(ix) FEATURE:
(D) OTHER INFORMATION: Munl linker
(xi) SEQUENCE DESCRIPTION: SEQ ID N0: 1:
ccccaattgg gg 12
(2) INFORMATION FOR SEQ ID NO: 2:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 25
(B) TYPE: nucleic acid
(C) STRANDEDNESS: unknown
(D) TOPOLOGY: unknown
(vi) ORIGINAL SOURCE:
(A) ORGANISM: artificial sequence
(ix) FEATURE:
(D) OTHER INFORMATION: forward primer F5.F1
(xi) SEQUENCE DESCRIPTION: SEQ ID N0: 2:
atgaagcgcg ccagaccgtc tgaag 25
(2) INFORMATION FOR SEQ ID NO: 3:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 31
(B) TYPE: nucleic acid
(C) STRANDEDNESS: unknown
(D) TOPOLOGY: unknown
(vi) ORIGINAL SOURCE:
(A) ORGANISM: artificial sequence
(ix) FEATURE:
(D) OTHER INFORMATION: reverse primer F5.R1
(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 3:
ttagagctct tgggcaatgt atgaaaaagt g 31
(2) INFORMATION FOR SEQ ID N0: 4:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 56
(B) TYPE: nucleic acid
(C) STRANDEDNESS: unknown
(D) TOPOLOGY: unknown
(vi) ORIGINAL SOURCE:
(A) ORGANISM: artificial sequence
(ix) FEATURE:
(D) OTHER INFORMATION: segment of the 3 prime untranslated
region of the AdSfiber gene
47
CA 02237059 2006-10-06
(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 4:
tctaaagaat cgtttgtgtt atgtttcaac gtgtttattt ttcaattgaa 50
gcttat 56
(2) INFORMATION FOR SEQ ID N0: 5:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 59
(B) TYPE: nucleic acid
(C) STRANDEDNESS: unknown
(D) TOPOLOGY: unknown
(vi) ORIGINAL SOURCE:
(A) ORGANISM: artificial sequence
(ix) FEATURE:
(D) OTHER INFORMATION: segment of the 3 prime untranslated
region of the Ad5 fiber gene
(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 5:
cgataagctt caattgaaaa ataaacacgt tgaaacataa cacaaacgat 50
tctttagag 59
(2) INFORMATION FOR SEQ ID N0: 6:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 25
(B) TYPE: nucleic acid
(C) STRANDEDNESS: unknown
(D) TOPOLOGY: unknown
(vi) ORIGINAL SOURCE:
(A) ORGANISM: artificial sequence
(ix) FEATURE:
(D) OTHER INFORMATION: primer to modify TLWT motif in Ad5
fiber gene
(xi) SEQUENCE DESCRIPTION: SEQ ID N0: 6:
atgcaccaaa cacaaatccc ctcaa 25
(2) INFORMATION FOR SEQ ID N0: 7:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 32
(B) TYPE: nucleic acid
(C) STRANDEDNESS: unknown
(D) TOPOLOGY: unknown
(vi) ORIGINAL SOURCE:
(A) ORGANISM: artificial sequence
(ix) FEATURE:
(D) OTHER INFORMATION: primer to modify TLWT motif in Ad5
fiber gene
48
CA 02237059 2006-10-06
(xi) SEQUENCE DESCRIPTION: SEQ ID N0: 7:
ctctttcccg ggttagctta tcattatttt tg 32
(2) INFORMATION FOR SEQ ID NO: 8:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 25
(B) TYPE: nucleic acid
(C) STRANDEDNESS: unknown
(D) TOPOLOGY: unknown
(vi) ORIGINAL SOURCE:
(A) ORGANISM: artificial sequence
(ix) FEATURE:
(D) OTHER INFORMATION: primer for part of knob domain in Ad3
fiber gene
(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 8:
tatggacagg tccaaaacca gaagc 25
(2) INFORMATION FOR SEQ ID N0: 9:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 33
(B) TYPE: nucleic acid
(C) STRANDEDNESS: unknown
(D) TOPOLOGY: unknown
(vi) ORIGINAL SOURCE:
(A) ORGANISM: artificial sequence
(ix) FEATURE:
(D) OTHER INFORMATION: primer for part of knob domain in Ad3
fiber gene
(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 9:
tttattagtc atcttctcta atataggaaa agg 33
(2) INFORMATION FOR SEQ ID NO: 10:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 23
(B) TYPE: nucleic acid
(C) STRANDEDNESS: unknown
(D) TOPOLOGY: unknown
(vi) ORIGINAL SOURCE:
(A) ORGANISM: artificial sequence
( ix) FEATURE
(D) OTHER INFORMATION: forward primer to modify Ala-579 to GCG
(xi) SEQUENCE DESCRIPTION: SEQ ID N0: 10:
aacaaaatgt ggcagtcaaa tac 23
49
CA 02237059 2006-10-06
(2) INFORMATION
FOR
SEQ
ID NO:
11:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 22
(B) TYPE: nucleic acid
(C) STRANDEDNESS: unknown
(D) TOPOLOGY: unknown
(vi) ORIGINAL SOURCE:
(A) ORGANISM: artificial sequence
(ix) FEATURE:
(D) OTHER INFORMATION: forward modify Ala-579
primer to to GCG
(xi) SEQUENCE DESCRIPTION: SEQ ID N0:
11:
catacattgcgcaagaataa ag 22
(2) INFORMATION
FOR
SEQ
ID N0:
12:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 22
(B) TYPE: nucleic acid
(C) STRANDEDNESS: unknown
(D) TOPOLOGY: unknown
(vi) ORIGINAL SOURCE:
(A) ORGANISM: artificial sequence
(ix) FEATURE:
(D) OTHER INFORMATION: forward modify Ala-579
primer to to GCG
(xi) SEQUENCE DESCRIPTION: SEQ ID N0:
12:
ctttattcttgcgcaatgta tg 22
(2) INFORMATION
FOR
SEQ
ID N0:
13:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 23
(B) TYPE: nucleic acid
(C) STRANDEDNESS: unknown
(D) TOPOLOGY: unknown
(vi) ORIGINAL SOURCE:
(A) ORGANISM: artificial sequence
(ix) FEATURE:
(D) OTHER INFORMATION: forward modify Ala-579
primer to to GCG
(xi) SEQUENCE DESCRIPTION: SEQ ID N0:
13:
tgatgcacgattatgactct acc 23
(2) INFORMATION
FOR
SEQ
ID N0:
14:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 31
(B) TYPE: nucleic acid
(C) STRANDEDNESS: unknown
CA 02237059 2006-10-06
s
(D) TOPOLOGY: unknown
(vi) ORIGINAL SOURCE:
(A) ORGANISM: artificial sequence
(ix) FEATURE:
(D) OTHER INFORMATION: forward primer F5.F
(xi) SEQUENCE DESCRIPTION: SEQ ID N0: 14:
tttaaggatt ccggtgccat tacagtagga a 31
(2) INFORMATION FOR SEQ ID N0: 15:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 30
(B) TYPE: nucleic acid
(C) STRANDEDNESS: unknown
(D) TOPOLOGY: unknown
(vi) ORIGINAL SOURCE:
(A) ORGANISM: artificial sequence
(ix) FEATURE:
(D) OTHER INFORMATION: reverse primer F5.R
(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 15:
tatataagct tattcttggg caatgtatga 30
(2) INFORMATION FOR SEQ ID NO: 16:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 33
(B) TYPE: nucleic acid
(C) STRANDEDNESS: unknown
(D) TOPOLOGY: unknown
(vi) ORIGINAL SOURCE:
(A) ORGANISM: artificial sequence
(ix) FEATURE:
(D) OTHER INFORMATION: forward primer F3.F
(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 16:
ctcggatcca attctattgc actgaaaaat aac 33
(2) INFORMATION FOR SEQ ID NO: 17:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 36
(B) TYPE: nucleic acid
(C) STRANDEDNESS: unknown
(D) TOPOLOGY: unknown
(vi) ORIGINAL SOURCE:
(A) ORGANISM: artificial sequence
(ix) FEATURE:
51
CA 02237059 2006-10-06
(D) OTHER INFORMATION: forward primer F3.R
(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 17:
gggaagctta gtcatcttct ctaatatagg aaaagg 36
52
