Note : Les descriptions sont présentées dans la langue officielle dans laquelle elles ont été soumises.
CA 02286335 2004-07-02
77586-12
1
DIAGNOSIS OF HISTOPhASMOSIS USING ANTIGENS
SPECIFIC FOR H. CAPSUhATUM
BACKGROUND OF THEINVENTION
The present invention generally relates to methods
of detection of a fungus and fungal infections through
the use of protein antigens specific for the fungus.
This invention also relates to methods for identifying such
antigens, to antibodies raised against these antigens, to
the use of such antigens and/or antibodies in assay
methods for the determination of the presence of the
fungus or diseases caused by the fungus in humans, other
animals, plants, food, feed, and inorganic materials such
as soil or air. The invention also relates to assay kits
suitable for carrying aut such diagnostic methods. In a
preferred embodiment, the invention particularly relates
to the fungus Histoplasma capsulatum (hereinafter H.
capsu.~atum) and the infections caused by this fungus,
histoplasmosis.
Rapid, positive detection of fungi has long been
difficult because antibodies which are made to fungi are
generally nonspecific. That is, these antibodies often
cross-react with other fungi. This problem is thought to
be due to the abundance of highly immunogenic
carbohydrate antigenic determinants which are present,
for example, in the fungal cell wall. The cross-reactive
nature of fungal antigens is exemplified by previously
known approaches to develop diagnostic methods to
identify infections of H. capsulatum.
H. capsulatum is a pathogenic dimorphic fungus that
grows as multicellular mycelia in nature and as
unicellular budding yeasts in humans and animals.
Inhalation of airborne propagules results in a
morphological transformation to the yeast form which
causes pulmonary infection and occasional progressive
disease, particularly in immunosuppressed patients.
CA 02286335 1999-10-14
WO 98/46738 - . PCT/US98/07728
2
Histoplasmosis is highly endemic in the Ohio and
Mississippi valleys in the United States, and it is also
widely distributed in Latin America, southern Europe,
Asia, Australia and Africa.
The diagnosis of histoplasmosis in humans is often
suggested by results of a careful clinical evaluation and
radiologic studies, but laboratory tests are necessary to
confirm the diagnosis. Isolation of the organism from
blood or tissue provides a definitive diagnosis.
Serological tests are also important diagnostic tools for
histoplasmosis. The most widely available tests are the
immunodiffusion assay, which detects antibodies to heat-
sensitive glycoproteins called H and M antigens, and the
more sensitive complement fixation test, which is
traditionally performed with yeast and mycelial antigens.
More sensitive antibody assays such as radio-immunoassay
and enzyme immunoassay have been used to detect IgM and
IgG antibodies to crude fungal extracts. See, generally,
references 39, 40, and 41.
Attempts to develop antibody serology tests for
diagnosis of histoplasmosis have been hampered by poor
specificity caused by immunologic cross-reactivity
between various fungal species. The problem of cross-
reactivity to other fungi may be worsened in the
diagnosis of histoplasmosis by the fact that H.
capsulatum is taxonomically closely related to two other
pathogens, Coccidioides immitis, and Blastomyces
dermatitidis. See Kwon-Chung, Science 177:368-369
(1972), and McGinnis et al., Mycotaxon 8:157-164 (1979).
These fungi, which may be present along with H.
capsulatum, cause coccidiomycosis and blastomycosis,
diseases with etiologies similar to histoplasmosis.
While H. capsulatum, C. immitis, and B. derma titidis are
known as imperfect fungi due to their rare or nonexistent
sexual stage, studies have shown that H. capsulatum and
B. dermatitidis are in the same telomorph genus,
CA 02286335 2006-02-23
77586-12
3
Ajellomyces, and those two fungi may be in the same
taxonomic family as C. immi.tis, the Gymnoascaceae, order
Onygenales, of the Ascomycetes. Another fungal pathogen,
Candida sp., is also an ascomycete. See generally, Kwan-
Chung et al., Medical Mycolocry, Lea and Febiger,
Philadelphia (1992).
~In view of the cross-reactivity and poor specificity
common with fungal antibodies, there is a need for
improved methods for identifying antigens which are
specific to a target fungus. Such antigens are useful in
diagnosis of diseases caused by the fungus and in
determining the presence or absence of the fungus.
SUMMARY OF THE INVENTION
It is therefore an object of the invention to
develop methods suitable for identifying protein antigens
specific to a target fungus and, particularly, to H.
capsulatum.
It is also an object to develop assays and assay
reagents k~aving improved specificity for identifying
target fungal antigens and antibodies, and for the
diagnosis of diseases caused by a target fungus and,
particularly, by H. capsulatum.
Therefore, the present invention is directed to a
method for identifying a protein antigen of a target
fungus.. A cDNA gene expression library is obtained for
the target fungus, and the library is expressed to form
an array of target-fungus proteins. Antisera to the
target fungus and to a nontarget fungus are also
obtained, each of which comprises antibodies to the
target fungus and nontarget fungus, respectively. The
nontarget fungus has at least one antigenic determinant
(e. g. a protein determinant or glycoprotein determinant)
in common (i.e. shared with) the target fungus. A protein
antigen specific to the target fungus is then identified
by identifying a~target-fungus protein which is bound by
CA 02286335 2006-04-07
77586-12
4
the antibodies to the target fungus, but which is not
substantially bound by antibodies to the nontarget fungus.
That is, while antibodies to the target fungus are
immunoreactive with the identified protein antigen,
antibodies to the nontarget fungus are not substantially
immunoreactive with the identified protein antigen.
The invention is further directed to a method for
determining the presence or absence of H. capsulatum
antibodies in a mammal, the method comprising: contacting
an antibody-containing sample from the mammal with a protein
antigen of H. capsulatum which has an amino acid sequence
that includes a portion at least five amino acids in length
of the amino acid sequence set forth in SEQ ID NO: 3, and
which portion is bound by antibodies to H. capsulatum but
which is not substantially bound by antibodies to
Coccidioides immitis, Blastomyces dermatitidis and
Candida sp., and determining whether an antibody in the
sample immunoreacts with the protein antigen of
H. capsulatum.
The invention is further directed to A kit for
determining the presence or absence of H. capsulatum
antibodies in an antibody-containing sample from a mammal
comprising: (a) a protein antigen of H. capsulatum which
has an amino acid sequence that includes a portion at least
five amino acids in length of the amino acid sequence set
forth in SEQ ID NO: 3, and which portion is bound by
antibodies to H. capsulatum but which is not substantially
bound by antibodies Coccidioides immitis, Blastomyces
dermatitidis and Candida sp., and (b) instructions for
determining whether an antibody in the sample from said
mammal immunoreacts with the protein antigen of H.
capsulatum, wherein the determining step comprises a method
as defined in any one of claims 1 to 6.
CA 02286335 2006-02-23
77586-12
4a
fihe invention is also directed to,substantiafly
purified or isolated antibodies or antibody fragments.
In one embodiment, the antibody or antibody fragment is
l0 immunoreactive with a protein antigen identified
according to the aforementioned method. In another
embodiment, the antibody or antibody fragment is
immunoreactive with an antigen of H. capsulatum, but
which is not substantially immunoreactive with antigens
15 of each of Coccidioides immi tis, Blastomyces dermati tidis
or Candida sp. In a further embodiment, antibody or
antibody fragment is immunoreactive with a protein
antigen having the amino acid sequence set forth in SEQ
ID NO: 3 or with a portion thereof that is specific to H.
20 capsulatum.
The invention is directed, moreover, to a method for
determining the presence or absence of a..target-fungus
antibody in a vertebrate such as a mammal. In one
embodiment, the method comprises obtaining an antibody-
25 containing sample from the vertebrate, contacting the
sample with a target-fungus protein antigen, and determining
whether an antibody in the sample immunoreacts with the
target-fungus protein antigen. In an alternative
embodiment directed to determining the presence or
3o absence of antibodies to H. capsulatum in a mammal, the
method comprises obtaining an antibody-containing sample
from the mammal, contacting. the sample with a protein
antigen of H. capsulatum which is bound by antibodies to
H. capsulatum but which is not substantially bound by
35 antibodies to each of Coccidioides immitis, Blastomyces
CA 02286335 2004-07-02
77586-12
dermatitidis or Candida sp., and determining whether an
antibody in the sample immunoreacts with the protein
antigen of H. capsu3atum. In an additional embodiment
for determining antibodies to H. capsulatum, the method
5 comprises obtaining an antibody-containing sample from
the mammal, contacting the sample with a protein antigen
having an amino acid sequence as set forth in SEQ ID NO:
3, and determining whether an antibody in the sample
immunoreacts with the protein antigen.
The invention is further directed to a method for
determining the presence or absence of a target-fungus
protein antigen in a sample. The method generally
comprises obtaining a sample to be tested for the
presence or absence of the target-fungus protein antigen,
contacting the sample with an antibody or antibody
fragment which is immunoreactive with a target-fungus
protein antigen, and determining whether the antibody or
antibody fragment immunoreacts with the target-fungus protein
antigen. As directed to determining the presence or
absence of a H. capsu3atum protein antigen in a mammal,
the method comprises obtaining a sample to be tested for
the presence or absence of the H. capsu3atum protein
antigen, contacting the sample with an antibody or
antibody fragment which is immunoreactive with an antigen
of H. capsu3atum, but which is not substantially
immunoreactive with antigens of each of Coccidioides
immitis, Blastomyces dermatitidis ox Candida sp.,, and
determining whether the antibody or antibody fragment
immunoreacts with the H. capsulatum protein antigen. In
an alternative method fox determining the presence or
absence of a H. capsu~atum protein antigen in a mammal,
the method comprises obtaining a sample to be tested for
the presence or absence of the H. capsulatum protein
antigen, contacting the sample with an antibody or
antibody fragment which is immunoreactive with a protein
CA 02286335 1999-10-14
WO 98/46738 . . PCT/US98/07728
6
antigen having an amino acid sequence as set forth in SEQ
ID NO: 3, and determining whether the antibody or
antibody fragment immunoreacts with the protein antigen.
The invention is additionally directed to a kit that
includes a reagent selected from, in one embodiment, one
or more of the following: (i) a target-fungus protein
antigen identified according to the aforementioned
method, (ii) a fragment of a target-fungus protein
antigen identified according to the aforementioned method
wherein the fragment is bound by antibodies to the target
fungus but is not substantially bound by antibodies to
the nontarget fungus, and (iii) a target-fungus antibody
or antibody fragment which immunoreacts with a target-
fungus protein antigen identified according to the
aforementiond method. In an alternative embodiment, the
reagent is selected from one or more of the following:
(i) a protein antigen of H. capsulatum which is bound by
H. capsulatum antibodies but which is not substantially
bound by antibodies to each of Coccidioides immitis,
Blastomyces dermatitidis or Candida sp., (ii) a fragment
of a H. capsulatum protein antigen wherein the fragment
is bound by antibodies to H. capsulatum but is not
substantially bound by antibodies to each of Coccidioides
immitis, Blastomyces dermatitidis or Candida sp., and
(iii) an antibody or antibody fragment which is
immunoreactive with a H. capsulatum protein antigen but
which is not substantially immunoreactive with antigens
of each of Coccidioides immitis, Blastomyces dermatitidis
or Candida sp.. In yet another embodiment, the reagent is
selected from: (i) a protein antigen having an amino acid
sequence as set forth in SEQ ID N0:3, (ii) a protein
antigen that includes a portion of the amino acid
sequence as set forth in SEQ ID N0:3 wherein the included
portion is bound by antibodies to H. capsulatum but is
not substantially bound by antibodies to each of
Coccidioides immitis, Blastomyces dermatitidis or Candida
CA 02286335 2006-02-23
77586-12
7
sp., (iii) an antibody or antibody fragment which is
immunoreactive with a protein antigen having the amino
acid sequence set forth in SEQ ID NO: 3, and (iv) an
antibody or antibody fragment which is immunoreactive
with a protein antigen that includes a portion of the
amino acid sequence set forth in SEQ ID NO: 3 wherein the
included portion is bound by antibodies to H. capsulatum
but is not substantially bound by antibodies to each of
Coccidioides immitis, Blastomyces dermatitidis or Candida
sp.. The kit also includes instructions for directing
the use of the reagent for determining the presence or
absence of the target fungus in a sample. In one
embodiment, the instructions direct the use of the
reagent for determining whether a mammal is presently
infected or has been previously infected with the target
fungus. In another embodiment in which the reagent is an
antibody, the instructions direct the use of the antibody
reagent for determining the presence or absence of an
antigen in a nonvertebrate sample or environment, such as
a~plant, food, feed, feed component, air, water, or other
fluid sample.
Other features, objects and advantages of the
present invention will be in part apparent to those
skilled in the art and in part pointed out hereinafter.
Moreover, as the patent and
non-patent literature relating to the subject matter
disclosed and/or claimed herein is substantial, many
relevant references are available to a skilled aritsan
that will provide further instruction with respect to
such subject matter.
CA 02286335 2004-07-02
77586-12
8
BRIEF DESCRIPTION OF THE DRAWINGS
FIG. 1 shows a comparison of the deduced amino
acid sequence encoded by GH17 with threonine-rich regions
of: (A) cellulase from the thermophilic bacterium
Caldocellum saccharolyticum (SEQ ID NO: 4); (B), Leishimania
surface antigen (SEQ ID N0: 5); and (C), integumentary mucin
from Xenopus Iaevis (SEQ ID NO: 6) using the NCBI BLAST
analysis program. Identical residues are indicated with a
(~), and conserved residues are marked with a (~)
FIG. 2 shows a hydropathy plot of the protein
encoded by GH17. Hydropathy analysis was performed by the
method of Hopp and Woods. Hydropathy values were averaged
for a window of six amino acid residues. Positive numbers
indicate hydrophilicity. The point of highest
hydrophilicity (Average hydrophilicity=2.08, between
residues 155-160) is marked with a broken vertical line.
FIG. 3 shows a Southern blot of genomic DNA of
H. capsulatum probed with labeled cDNA insert from clone
GH17. Genomic DNA was digested with EcoRI (lane 1), Pstl
(lane 2), and Sacl (lane 3), electrophoresed on a 1o agarose
gel, and transferred to nylon membrane. The membrane was
probed with peroxidase-labeled cDNA insert of GH17 and
washed under high-stringency conditions.
FIG. 4 shows the results of an immunoblot analysis
of the immunoreactivity and specificity of the
~-galactosidase fusion protein of the recombinant clone GH17.
The immunoreactive fusion protein band is indicated by an
arrow. FIG. 4A shows a representative immunoblot
demonstrating the immunoreactivity of the fusion protein.
Bacterial cell-lysates from cells infected with GH17 were
separated by SDS-PAGE and electrophoretically transferred to
CA 02286335 2004-07-02
77586-12
8a
nitrocellulose paper. The blot was developed with individual
sera from patients with histoplasmosis (Lanes 1-18). 16 of
18 sera had strong antibody reactivity with the fusion
protein, and
CA 02286335 1999-10-14
WO 98/46738 - . ~ PCT/US98/07728
9
two sera were weakly reactive (Lanes 6 and 9). Lane 19
was developed with a murine monoclonal antibody to ~i-
galactosidase. FIG. 4B demonstrates the antigenic
specificity of recombinant H. capsulatum clone GH17,~-
galactosidase fusion protein by immunoblot analysis.
Lanes in various panels were developed as follows: Panel
A, with sera from dogs infected with B. dermatitidis
(n=6); B, with human sera from patients infected with B.
dermatitidis (n=5); C, with human sera from patients
infected with Candida albicans (n=5); D, with human sera
from patients infected with Coccidioides immitis (n=12);
E, with human histoplasmosis serum pool and anti-~i-
galactosidase antibody, respectively.
FIG. 5 shows an SDS-PAGE and immunoblot analysis of
expression of GH17-his in pPROEX-lT"' protein expression
vector. In FIG. 5A, 10% SDS-PAGE was loaded with E. coli
extract without IPTG induction (lane 1), and after IPTG
induction for 3 hr (lane 2). The immunoblots were
developed with human histoplasmosis serum pool (1:500),
enzyme-labeled anti-human IgG secondary antibody, and
substrate. FIG. 5B shows immunoblot analysis of eluted
fractions of GH17-his fusion protein separated by
preparative SDS-PAGE in the model 491 BioRad Prep Cell.
Aliquots (10.1) from the Prep Cell fractions were
separated by SDS-PAGE on 12% gels, immunoblotted, and
developed as described for Fig. 5a. Lane 1, IPTG induced
E. coli extract (2~.1); Lanes 2-4 contain positive
fractions from the Prep Cell.
FIG. 6 shows an immunoblot analysis of H. capsulatum
yeast antigen extract developed with: lane 1, mouse
antibody to GH17-his fusion protein (1:500); lane 2,
normal mouse serum (1:500); and lane 3, mouse antibodies
to H. capsulatum yeast extract (1:500).
CA 02286335 1999-10-14
WO 98/46738 ~ - PCT/US98/07728
DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS
The present invention is directed toward protein
antigens which are specific to a target fungus, to
methods of obtaining such antigens, to antibodies to such
5 antigens, and to assays employing such antigens and
antibodies.
An antigen specific to a particular target fungus is
identified by a) obtaining a cDNA gene expression library
for the target fungus, b) expressing target fungal
10 proteins from the cDNA gene expression library, c)
obtaining antisera to the target fungus which has
antibodies to the target fungus, d) obtaining antisera to
the nontarget fungus which has antibodies to the
nontarget fungus and e) identifying a target-fungus
protein which is bound by the antibodies to the target
fungus, but which is not substantially bound by the
antibodies to the nontarget fungus.
The steps of the above method need not be performed
in any particular order. In a preferred embodiment of
the above method, the cDNA expression library is first
screened with an antisera to the target fungus. Clones
which are highly reactive to the target fungus are thus
identified, and these selected clones are then screened
with antisera to the nontarget fungus. The clones which
produce a protein which is bound by antibodies in the
antisera to the target fungus but not by antibodies in
the antisera to other microorganisms (e. g. nontarget
fungi) are then identified. Various manipulations known
in the art can utilize these clones to produce and
substantially purify the protein antigens encoded by the
clones. The protein antigens can then be used as
discussed below.
The procedures disclosed herein which involve the
molecular manipulation of nucleic acids are known to
those skilled in the art. See generally Fredrick M.
Ausubel et al. (1995), "Short Protocols in Molecular
CA 02286335 1999-10-14
WO 98/46738 - . PCT/US98/07728
11
Biology", John Wiley and Sons, and Joseph Sambrook et al.
(1989), "Molecular Cloning, A Laboratory Manual", second
ed., Cold Spring Harbor Laboratory Press.
A used herein, the term "target fungus" (p1. "target
' 5 fungi") denotes any fungus for which there is a
particular interest. Examples of target fungi are fungi
which are pathogens of animals or plants, allergens, food
spoiling agents, or food sources. Preferred target fungi
include Ascomycetes. More preferred target fungi are
those fungi in the genus Gymnoascaceae. Even more
preferred fungi are those in the genus Ajellomyces, and
the most preferred target fungus is H. capsulatum. A
"nontarget fungus" may be any fungus that is desired to
be distinguished from the target fungus, for
identification or diagnostic purposes, by an immunoassay.
In general, the nontarget fungus includes at least one
antigenic determinant in common with the target fungus.
As such, the nontarget fungus can cross react with an
antibody that recognizes this shared antigenic
determinant. Exemplary nontarget fungi may be selected
from fungi known to cause a disease with similar symptoms
as the target fungus.
The cDNA gene expression library of the target
fungus may be obtained from a commercial source or
prepared by methods known in the art, using an
appropriate morphological stage of the target fungus. An
easily culturable stage such as mycelium is preferred.
Common vectors used for this purpose are plasmid,
bacteriophage, and mammalian cells. A preferred
expression library is one utilizing a phage such as
bacteriophage ~gtll, with poly(A)+ mRNA.
The target fungus proteins are expressed by any
method known in the art. For the preferred ~gtll
expression library, the proteins are generally expressed
by induction with IPTG.
CA 02286335 1999-10-14
WO 98/46738 ~ . PGT/US98/07728
12
Antisera to the target fungus may be obtained in any
manner known in the art. Preferably such antisera are
obtained by preparing an antigen which will, upon
immunization of an animal with the fungus, yield an
antisera which contains a population of antibodies which,
in sum, will immunoreact to many antigens of the target
fungus. An unfractionated preparation of the target
fungus is thus a preferred antigen preparation. However,
a fractionated preparation could also be employed. When
the target fungus is pathogenic to vertebrates which are
capable of mounting an immunological response to the
fungus, the preferred screening antisera is serum from
infected individuals. A more preferred screening
antisera is pooled serum from several infected
individuals. Antisera to the nontarget fungus can be
obtained by methods similar to the methods used to
prepare antisera to the target fungus.
Target-fungal proteins which are bound by the
target-fungus antibodies but which are not substantially
bound by the nontarget-fungus antibodies can be
identified by screening each of the antisera by
appropriate immunological assays known in the art. The
terms "immunoreact", "bind", "are bound to" or
grammatical derivations thereof are used interchangeably
herein, and refer to the capability of an antibody or an
antibody fragment to specifically attach to an antigen at
the antibody's Fab binding site. Exemplary screening
assays include precipitin assays and label-based assays.
Preferably, the antigen is identified from the expressed
cDNA gene expression library by blotting the expressed
proteins (e. g. from phage plaques) onto membranes then
screening the membranes with the antisera made to each
fungus.
The degree of immunological cross-reactivity for the
identified target-fungus protein (generally referred to
herein as a target-fungus specific antigen) is preferably
CA 02286335 2004-07-02
77586-12
13
sufficiently low so that tests that detect the antigen or
antibodies to the antigen are useful for reliably
distinguishing the fungus from nontarget fungi. The
degree of imrnunological cross-reactivity with nontarget
fungi and/or other microorganisms of interest, when
assessed by immunoassay (for example Western blot or
ELISA)~, is preferably less than about 10%, more
preferably less than about 5%, still mare preferably less
than about 2%, even more preferably less than about 1%,
and most preferably less than about 0.1%.
The identified target-fungus specific protein
antigen is more specifically characterized as follows;
with the various aspects defining the protein to be
considered both independently and in combination. The
target fungus-specific protein antigen is preferably
substantially free from non-protein determinants such as
carbohydrates, phosphorylcholine, and/or other moieties
which, when attached to or otherwise associated with the
protein, would reduce the immunological specificity of
the protein.
The term "specific" is used herein to denote an
antigen which is not present in nontarget fungi. When
referring to an antibody or to an assay, "specific"
denotes a substantial lack of cross-reactivity with
nontarget fungi. As an example, an antigen of a target
fungus which infects mammals would be specific if
antibodies in serum prodwced by a target fungus-infected
vertebrate bound to the antigen, but sera produced in
vertebrates which are infected with a nontarget fungus do
not substantially cross-react with the antigen. The
extent of cross-reactivity can be mare specifically
characterized with regard to a set (i.e. group or
population) of samples being evaluated. In a sample
population known to comprise the target-fungus antigen or
antibodies to the antigen, the presence of the antigen or
antibody is correctly determined in preferably at least
CA 02286335 1999-10-14
WO 98/46738 - - PCT/US98/07728
14
about 90% of the samples, more preferably in at least
about 95% of the samples and most preferably in at least
about 99% of the samples. Conversely, in a sample
population known to both (i) lack the target fungus
antigens or antibodies thereto and (ii) comprise a
nontarget fungus antigen or antibodies thereto, the
absence of the target fungus antigen or antibody thereto
is correctly determined in preferably at least about 90%
of the samples, more preferably in at least about 95% of
the samples and most preferably in at least about 99% of
the samples. As another example, an antigen on a plant
pathogenic fungus is specific if antisera made to that
antigen does not substantially cross-react with antigens
on other nontarget fungi which might be present in the
same environment as the plant pathogenic fungus.
Target-fungus specific protein antigens with such
cross-reactivity can be varied from the identified
protein antigen, but will preferably have an amino acid
sequence which has a sequence identity or, alternatively,
a homology of at least about 75%, more preferably at
least about 90%, even more preferably at least about 95%
and most preferably at least about 98% relative to the
amino acid sequence of the identified protein antigen or,
alternatively, as encoded by the cDNA clone thereof.
In a preferred embodiment the target fungus is H.
capsulatum. Preferred nontarget fungi are C. immitis, B.
dermatitidis, and Candida sp. H. capsulatum proteins
expressed from a cDNA expression library are screened,
preferably by immunoblot, against antisera to H.
capsu~atum and at least one of the nontarget fungi. The
antisera are preferably provided by pooled sera from
individuals infected with the target and nontarget fungi.
Where the target fungus is H. capsulatum, a preferred
protein antigen has the amino acid sequence set forth as
SEQ ID N0:3. (See example). In another embodiment, the
protein is a H. capsulatum-specific protein antigen and
CA 02286335 1999-10-14
VliO 98/46738 - - PCT/US98/07728
has an amino acid sequence which includes at least a
portion of the amino acid sequence set forth as SEQ ID
N0:3 which is specific for H. capsulatum, the included
portion being, in a preferred protein, at least 5 amino
- 5 acids in length. The H. capsulatum-specific antigen
identified in this manner is not substantially cross-
reactive with antisera to the nontarget fungus. (See
Example).
The target-fungus specific antigen, identified for
10 example by the afore-described screening protocols, can
be isolated and produced in substantially purified form
according to methods known in the art. Briefly, the cDNA
clone corresponding to the identified target-fungus
specific antigen, or more generally any nucleic acid
15 polymer encoding the target-fungus specific protein
antigen, can be incorporated into an expression vector
for recombinant production of the protein antigen, as
discussed below.
The nucleic acid polymer can have the cDNA
nucleotide sequence of the isolated cDNA clone. The
nucleic acid polymer can, alternatively, have a mRNA
nucleotide sequence corresponding to the cDNA sequence.
Where the target fungus is H. capsulatum, the nucleic
acid polymer preferably has the cDNA nucleotide sequence
set forth as SEQ ID N0:2 or a mRNA nucleotide sequence
corresponding to the sequence set forth as SEQ ID N0:2.
In an additional embodiment, the nucleic acid
polymer can encode a fungus-specific protein antigen and
have an nucleotide sequence which includes at least a
portion of the nucleotide sequence of the isolated cDNA,
the included portion being at least 15 base pairs in
length. In a further embodiment, the nucleic acid
polymer can be at least 15 base pairs in length and
encode a fungus-specific protein antigen having an amino
acid sequence which has a sequence identity or,
alternatively, a homology of at least about 75%, more
CA 02286335 1999-10-14
WO 98/46738 - . PCT/US98/07728
16
preferably at least about 90%, even more preferably at
least about 95% and most preferably at least about 98%
relative to the amino acid sequence encoded by the
isolated cDNA.
The above-disclosed nucleic acid polymer which
encodes a fungus-specific protein antigen is preferably
used to create a vector which is used, for example, to
replicate or translate the nucleic acid polymer.
Translation of the nucleic acid polymer is preferably
accomplished by an expression vector by methods known in
the art. The expression vector can be, for example, a
hybrid plasmid, a virus, or other nucleic-acid-polymer
construct which is suitable for use in expressing the
antigen in a eukaryotic or prokaryotic host-cell, in
vitro, according to methods known in the art. In the case
of H. capsulatum, preferred expression vectors are ~gtll
and the pProEX'"-1 protein expression system, which
produces a fusion protein containing 6 histidines.
A host cell can be transformed with the above-
disclosed vector for recombinant production of the target
fungus-specific protein antigen. The host cell can be,
for example, a bacterial host cell such as E. coli, a
yeast cell, a mammalian cell, or any other suitable host
cell in which the antigen can be expressed and from which
the antigen can be substantially isolated and purified.
The isolated fungus-specific protein antigen can be
utilized to produce an antibody specific for the antigen.
The antigenic protein or fragment against which the
antibody is raised and to which the antibody binds is
preferably substantially purified, and is further
characterized as set forth above, with the various
aspects defining the protein antigen to be considered
both independently and in combination.
The antibody may be a mono-specific antibody. The
monospecific antibody may be a monoclonal antibody
produced, for example, by the method of Galfre et al.,
CA 02286335 1999-10-14
WO 98/46738 - - PCT/US98/07728
17
Nature 266:550 (1977). Alternatively, the monospecific
antibody may be a recombinant antibody produced, for
example, by the method of Lowman et al, Biochemistry
30:10832-10838 (1991).
The antibody can also be a polyclonal antibody. The
polyclonal antibody can be prepared by immunizing a
mammal such as a mouse or rabbit with the fungus-specific
antigen and subsequently isolating the serum therefrom to
obtain an antiserum that contains the polyclonal
antibodies. If the fungus is a pathogen of a vertebrate
animal, such as H. capsulatum, polyclonal antibodies
reactive to the specific antigen are generally produced
in the serum of an infected animal. That serum may be
collected and utilized as a polyclonal antiserum to the
fungus .
The target fungus-specific antigen, and antibodies
made to that specific antigen can be utilized in assays
to determine the presence or absence, in a sample, of
antigens or antibodies which are indicative of or
diagnostic for the target fungus.
Any portion of the antigen which is specific for the
fungus may be utilized for identifying the target fungus
in a sample, and specific peptide sequences as small as
five amino acids in length may be easily obtained by
methods known in the art. These specific fragments may,
for example, be used alone or they may be engineered by
methods known in the art to be part of a fusion protein,
preferably comprising two domains, a first domain that
includes at least a portion of the amino acid sequence
encoded by the nucleic acid polymer, the included portion
being at least 5 amino acids in length, and a second
domain that includes the amino acid sequence of another
protein or polypeptide. In a preferred embodiment, the
second domain includes the amino acid sequence of a
protein from the expression vector, such as i3-
galactosidase or other protein incorporated in an
CA 02286335 1999-10-14
WO 98/46738 - . PCT/US98/07728
18
expression system, which may facilitate expression and/or
subsequent purification of the expressed antigen from the
host-cell lysate.
In the case of a fungus disease of humans and other
animals, the tests will preferably allow one to
distinguish the fungal disease from other clinical
conditions, especially from other fungal infections.
Without being bound to a particular theory not
specifically required in the claims, the target-fungus
specific antigens result from the above-disclosed method
because the expressed proteins from the cDNA expression
library do not contain carbohydrate moieties which would
be present in fungal antigen preparations prepared by
prior art methods. Prior art methods of immunizing
vertebrates with components of the target fungus
generally failed to identify specific antigens because
the immune system of the immunized vertebrate would mount
an immune response to the antigenic carbohydrate moieties
of the immunogen target fungus. However, the
carbohydrate moieties of the immunogen target fungus are
often also present in the nontarget fungi, thus leading
to cross-reactivities with the nontarget fungi. In
particular, fungi which are closely related
taxonomically, such as H. capsulatum and B. dermatitidis,
generally have more antigenic determinants in common than
fungi which are less closely related, such as H.
capsulatum and Agaricus bisporus, the common cultivated
mushroom. As such, the present method is particularly
suited for developing immunoassays for target fungi which
might be confused for closely related nontarget fungi.
In the preferred embodiment, a test for
histoplasmosis developed with an antigen specific for H.
capsulatum (as in the Example) allows a determination of
the presence or absence of antibodies to H. capsulatum
which do not immunoreact with nontarget fungi present in
the sample -- particularly Coccidioides immitis,
CA 02286335 1999-10-14
WO 98/46738 ~ . PCT/US98/07728
19
Blastomyces dermatiditis, and/or Candida species. Thus,
the invention as applied to H. capsulatum provides
diagnostic methods (i.e., assays) for determining whether
a mammal has been infected with H. capsulatum. These
methods, combined with clinical observations and findings
based on known and/or on later-developed techniques,
facilitate diagnosis of histoplasmosis.
One embodiment of the assay method as applied to a
target fungus is referred to herein as an antibody assay.
This method comprises detecting the presence or absence
of antibodies to a target fungus-specific antigen in a
sample obtained from a vertebrate. The presence or
absence of the target fungus-specific antibodies are
detected by contacting the sample with an antigen
specific to the target fungus and determining whether the
sample contains antibodies that bind to the target
fungus-specific antigen. The preferred antigen is
further characterized as set forth above, with the
various aspects defining the antigen to be considered
both independently and in combination. Exemplary
antibody assays, discussed in more detail below, include
precipitin-based immunoassays, indirect label-based
immunoassays, direct label-based immunoassays and
inhibition/competitive-type label-based immunoassays.
The presence of target fungus-specific antibodies in a
sample obtained from the mammal is evidence of current
and/or past exposure or infection with the target fungus.
In an alternative embodiment, referred to herein as an
antigen assay, the method comprises detecting the
presence or absence of antigens specific to the target
fungus in a sample. The presence or absence of target
fungus-specific antigens is detected by contacting the
sample with an antibody capable of binding to a target
fungus-specific antigen and determining whether the
antibody binds to the target fungus-specific antigen.
The preferred target fungus-specific antibody is as set
CA 02286335 1999-10-14
WO 98/46738 - . PCT/US98/07728
forth above, with the various aspects defining the
antibody to be considered both independently and in
combination. The target fungus-specific antigen being
detected is further characterized as set forth above,
5 with the various aspects defining the antigen to be
considered both independently and in combination.
Exemplary antigen assays, discussed in more detail below,
include precipitin-based immunoassays, indirect label-
based immunoassays, direct label-based immunoassays and
10 inhibition/competitive-type label-based immunoassays.
The presence of antigens specific to the target fungus in
a sample is evidence of the presence of the target fungus
in the sample.
As applied to H. capsulatum, the detection of
15 antibodies which bind to the H. capsulatum-specific
antigen in a sample from a mammal is evidence of past ar
current infection with H. capsulatum. Similarly, the
detection of H. capsulatum-specific antigens in a sample
from a mammal is strong evidence of current infection
20 with H. capsulatum.
The following additional concerns are applicable to
either of the aforementioned antibody assay or antigen
assay as applied to a target fungus such as H.
capsulatum. The mammals from which a sample is obtained
are preferably humans, domestic livestock and/or pets
which are suspected of being or known to be susceptible
to fungal infection by the target fungus (e.g. H.
capsulatum). The sample can be a blood sample, a plasma
sample, a serum sample, a urine sample, a sputum sample,
a saliva sample or any other biological sample obtained
from the mammal which is suspected of potentially having
antibodies to the target fungus (e.g. H. capsulatum) or
having target-fungus (e. g. H. capsulatum) antigens.
The sample can be pretreated prior to testing the
sample in the assay. Exemplary pretreatment steps can
include concentrating the sample and/or eliminating
CA 02286335 1999-10-14
WO 98/46738 ~ . PCT/US98/07728
21
interfering substances (e. g. acid in urine or rheumatoid
factors in serum). Other pretreatment steps will be
apparent to a person of skill in the art. Moreover,
additionally or alternatively to detecting whether
antigen-antibody binding occurs in either of the
aforementioned general methods, the extent of such
binding can be quantitatively determined using methods
known in the art.
The antibody assays of the present invention can be
more specifically characterized according to a variety of
formats set forth below and/or known in the art. One
approach includes the use of precipitin-based
immunoassays. For example, the presence or absence of
the antibodies can be detected by layering a first
solution including the target fungus-specific antigen
over the undiluted (i.e., neat) sample or over a second
solution including the sample, the layered solution
typically being formed in a container such as a test-
tube, and observing the layered solution for the
formation or the lack of formation of a precipitate
comprising bound antigen and antibody. The amount of
target fungus-specific antigen in the first solution is
preferably an amount which is necessary, on average, to
form a precipitate with samples drawn from a vertebrate
known to contain antibodies to the target fungus. The
steps of this approach can, alternatively, be repeated,
in parallel or in series, using various amounts of the
target fungus-specific antigen in the first solution,
with the amount of antigen in the solution varying over a
range which includes an amount which is about, on
average, necessary to form a precipitate with samples
drawn from mammals known to have histoplasmosis.
Precipitin-based immunoassays can also be carried out in
gels such as agar or polyacrylamide gels or their
equivalents known in the art, by methods typically
referred to as immunodiffusion, immunoelectrophoresis,
CA 02286335 1999-10-14
WO 98/46738 . PCT/US98/07728
22
counterimmunoelectrophoresis and/or rocket
electrophoresis, among others. For example, the presence
or absence of the antibodies are detected by placing a
first solution including the target fungus-specific
antigen in a gel or in a well adjacent to a gel, placing
the undiluted sample or a second solution including the
sample, in a gel or in a well adjacent to a gel, allowing
the target fungus-specific antigen and antibodies to
diffuse in the gel, and observing the gel for the
formation or the lack of formation of a precipitate
comprising bound antigen and antibody. Turbidometric or
nephelometric-type assay formats can also be employed.
Precipitin-based immunoassays offer the advantage of not
requiring a solid-phase matrix, and as such, may be
suited for particular applications known in the art (e. g.
automated systems).
Another approach for the antibody assay of the
present invention includes the use of label-based assay
techniques, including direct, indirect and/or
inhibition/competitive radioimmunoassays, enzyme.-linked
immunoabsorbant assays (ELISA), immunofluorescent assays,
immunochromatographic assays, and other techniques known
in the art. For example, the presence or absence of the
antibodies can be detected using an indirect label-based
immunoassay by immobilizing the target fungus-specific
antigen on a solid-phase, contacting the immobilized
antigen with the undiluted sample or with a solution
including the sample to allow any target fungus-specific
antibody which may be present in the sample to
specifically bind to the immobilized antigen, thereby
forming a first immobilized complex which includes either
solid-phase/target fungus-specific antigen or solid-
phase/target fungus-specific antigen/antibody depending
on whether the target fungus-specific antibody was
present in the sample, washing the first immobilized
complex to remove any unbound target fungus antibody
CA 02286335 1999-10-14
WO 98/46738 - . PCT/US98/07728
23
and/or other serum components, contacting the first
immobilized complex with a detectable secondary antibody
capable of binding to the target fungus-specific
antibody, thereby forming a second immobilized complex
which includes either solid-phase/target fungus-specific
antigen or solid-phase/target fungus-specific
antigen/antibody/secondary-antibody depending on whether
target fungus antibody was present in the sample, washing
the second immobilized complex to remove any unbound
secondary antibody, and detecting the presence or absence
of the secondary antibody on the second immobilized
complex. The detectable secondary antibody can be
labeled according to methods known in the art or later
developed. For example, the secondary antibody can be a
radiolabeled antibody (e.g. an antibody labeled with a
gamma-emitting lzSl isotope) which is detected by
radiographic methods or with instruments such as counters
which measure the level of radioactivity present. The
secondary antibody can also be an enzyme-conjugated
antibody (e. g. an antibody conjugated with alkaline
phosphatase, horseradish peroxidase, or other enzyme)
which is detected by contacting the enzyme-conjugated
antibody with a color-producing enzyme substrate. The
secondary antibody can alternatively be tagged with
biotin (or an equivalent) or with a fluorochrome (e. g.
fluorescein and rhodamine) or a dye or other colored
substance (e. g. colloidal gold) which can be detected
visually or by known spectroscopic methods.
In another example of an indirect label-based
immunoassay, the presence or absence of target fungus-
specific antibodies can be detected using a Western blot
format. This method is particularly advantageous in that
it includes a step for separating the target fungus-
specific antigen from other proteins in the sample in
which it is present (e. g. for isolating recombinantly-
produced target fungus-specific antigen present in a
CA 02286335 1999-10-14
WO 98/46738 ~ - PCT/ITS98/07728
24
host-cell lysate). This method includes
electrophoretically separating a target fungus-specific
protein antigen electrophoretically, transferring the
separated protein antigen to a solid-phase membrane (e. g.
a nitrocellulose or nylon membrane), contacting the
solid-phase/target fungus-specific antigen complex with
an undiluted sample or with a solution including the
sample to allow any target fungus-specific antibody which
may be present in the sample to bind to the antigen, and
to form a first complex which includes either solid-
phase/target fungus-specific antigen or solid-
phase/target fungus-specific antigen/antibody, depending
on whether antibody was present in the sample, washing
the first complex to remove any unbound antibody,
contacting the first complex with a detectable secondary
antibody capable of binding to the solid phase-bound
antibody, thereby forming a second immobilized complex
which includes either solid-phase/target fungus-specific
antigen or solid-phase/target fungus-specific
antigen/antibody/secondary-antibody depending on whether
target fungus-specific antibody was present in the
sample, washing the second immobilized complex to remove
any unbound secondary antibody, and detecting the
presence or absence of the secondary antibody on the
second immobilized complex. The detectable secondary
antibody can, for example, be radiolabeled, enzyme-
conjugated, tagged with a fluorochrome, or dyed as
described above.
The presence or absence of target fungus-specific
antibodies can, in another exemplary method, be detected
using a direct label-based immunoassay. This method
includes immobilizing a first anti-immunoglobulin
antibody (e. g. IgG) capable of binding to the target
fungus antibody being detected on a solid-phase (e. g.
beads, membrane, matrix, etc.), contacting the
immobilized anti-immunoglobulin antibody with an
CA 02286335 1999-10-14
WO 98/46738 - - PCTNS98/07728
undiluted sample or with a solution including the sample
to form a first complex which includes either solid-
phase/anti-immunoglobulin-antibody or solid-phase/anti-
immunoglobulin-antibody/target fungus-specific antibody,
5 depending on whether target fungus-specific antibody was
present in the sample, washing the first complex,
contacting the first complex with a labeled target
fungus-specific antigen to allow any target fungus-
specific antibody present in the first complex to bind to
10 the target fungus-specific antigen and to form a second
complex comprising either solid-phase/anti-
immunoglobulin-antibody or solid-phase/anti-
immunoglobulin-antibody/target fungus-specific
antibody/target fungus-specific antigen, depending on
15 whether target fungus-specific antibody was present in
the sample, washing the second complex to remove any
unbound labeled target fungus-specific antigen, and
detecting whether the labeled target fungus-specific
antigen is present or absent in the second complex. The
20 target fungus-specific antigen can be labeled according
to methods now known in the art or later developed,
including, for example, being radiolabeled, enzyme-
conjugated, tagged with a fluorochrome, dyed or otherwise
associated with a colored material, as described above.
25 The presence or absence of target fungus-specific
antibodies can, in a further exemplary method, be
detected using a inhibition/competitive label-based
immunoassays. This method includes establishing a
baseline reading for a control assay by immobilizing a
target fungus-specific antigen on a solid-phase,
contacting the immobilized target fungus-specific antigen
with a detectable (e. g. labeled) target fungus-specific
antibody to form a control complex including solid-
phase/target fungus-specific-antibody/detectable target
fungus-specific antibody, washing the control complex to
remove any unbound detectable target fungus-specific
CA 02286335 1999-10-14
WO 98!46738 - . PCT/US98/07728
26
antibody therefrom, and detecting the baseline level of
target fungus-specific antibody bound to the immobilized
target fungus-specific antigen on the control complex.
The method further includes, in a separate, independent
test assay, immobilizing a target fungus-specific antigen
on a solid-phase, contacting the immobilized target
fungus-specific antigen with both (1) a detectable (e. g.
labeled) target fungus-specific antibody and (2) an
undiluted sample or with a solution including the sample
to allow any target fungus-specific antibody which may be
present in the sample to bind to at least some of the
immobilized target fungus-specific antigen and to thereby
form a test complex in which at least some of the bound
detectable target fungus-specific antibody may have been
competitively inhibited from binding to the immobilized
target fungus-specific antigen, depending on whether
target fungus-specific antibody was present in the
sample, washing the test complex to remove any unbound
target fungus-specific antibody, detecting the level of
detectable-target fungus-specific antibody bound to the
test complex, and comparing the level of detectable-
target fungus-specific antibody bound to the test complex
to the baseline level of detectable target fungus-
specific antibody bound to the control complex, a
decrease in such level indicating the presence of target
fungus-specific antibody in 'he sample. The detectable
target fungus-specific antibody can, for example, be
radiolabeled, enzyme-conjugated, tagged with a
fluorochrome, dyed or otherwise associated with a colored
material as described above.
The approaches set forth above for determining the
presence or absence of antibodies to target fungus-
specific antibody in a sample are to be considered
exemplary and non-limiting of the many formats known in
the art by which a sample suspected of including
antibodies is contacted with an antigen and the presence
CA 02286335 1999-10-14
WO 98/46738 ~ . ~ PCT/US98/07728
27
or absence and/or quantitative extent of antigen-antibody
binding is determined. Moreover, the exact sequence of
steps is not narrowly critical and can be varied as is
appropriate in the art. Certain steps may be omitted
altogether and/or combined with other steps. For
example, the sample and labeled antigen can, in some
assay formats, be added together. As another example,
assays may not require a washing step to remove unbound
antibodies. Assays such as immunochromatographic assays
where reactants flow across and/or through the solid
phase are exemplary. Certain additional steps may also
be added, in series and/or in parallel combination, to
the aforementioned steps, as appropriate in the art. For
example, the assays can optionally include one or more
blocking steps or proteins or detergents in the diluent
to decrease the non-specific binding of antibodies,
primary or secondary, to the solid-phase. The assays of
the invention can also be automated, with appropriate
modifications to the described steps. All of the above
antibody assays are effective in detecting target fungus-
specific antibodies for any fungus, including H.
capsulatum, which is capable of eliciting an antibody
response in a vertebrate.
The antigen assays of the present invention are
useful in any situation where a determination of the
presence or absence of a target fungus is desired.
Examples include the determination of the presence of a
target fungus in an animal or plant suspected of being
infected with the target fungus, in a food or feed
suspected of being contaminated with the target fungus,
in inorganic materials such as soil or air for the
determination of the presence of an allergenic or
pathogenic target fungus, and for the identification of a
specific target fungus where the identity of the fungus
is unknown.
CA 02286335 1999-10-14
WO 98/46738 . PCT/US98/07728
28
The antigen assays of the present invention can be
more specifically characterized according to a variety of
formats set forth below and/or known in the art. One
approach includes the use of precipitin-based
immunoassays. For example, the presence or absence of
the target fungus-specific antigens in the sample can be
detected by layering a first solution including the
target fungus-specific antibody over the undiluted sample
or over a second solution including the sample, the
layered solution typically being formed in a container
such as a test-tube, and observing the layered solution
for the formation or the lack of formation of a
precipitate comprising bound antigen and antibody. The
amount of target fungus-specific antibody in the first
solution is preferably an amount which is necessary, on
average, to form a precipitate with samples previously
known to comprise the target fungus. The steps of this
approach can, alternatively, be repeated, in parallel or
in series, using various amounts of the target fungus-
specific antibody in the first solution, with the amount
of antibody in the solution varying over a range which
includes an amount which is about, on average, necessary
to form a precipitate with samples previously known to
contain the target fungus-specific antigen. Precipitin-
based immunoassays can also be carried out in gels such
as agar or polyacrylamide gels or their equivalents known
in the art, by methods typically referred to as
immunodiffusion, immunoelectrophoresis,
counterimmunoelectrophoresis and/or rocket
electrophoresis, among others. For example, the presence
or absence of the antigens are detected by placing a
first solution including the target fungus-specific
antibody in a gel or in a well adjacent to a gel, placing
the undiluted sample or a second solution including the
sample, in a gel or in a well adjacent to a gel, allowing
the target fungus-specific antibody and antigens to
CA 02286335 1999-10-14
WO 98/46738 - . ~ PCT/US98/07728
29
diffuse within the gel and observing the gel for the
formation or the lack of formation of a precipitate
comprising bound antigen and antibody.
Another approach for the antigen assay of the
present invention includes the use of label-based assay
techniques, including direct, indirect and/or
inhibition/competitive radioimmunoassays, enzyme-linked
immunoabsorbant assays (ELISA), immunofluorescent assays,
immunochromatographic assays, and other techniques known
in the art. For example, the presence or absence of the
antigens can be detected in a direct sandwich-type format
by immobilizing target fungus-specific antibody on a
solid-phase, contacting the immobilized antibody with an
undiluted sample or with a solution including the sample
to allow any target fungus-specific antigen which may be
present in the sample to bind to the immobilized
antibody, thereby forming a first immobilized complex
which includes either solid-phase/target fungus-specific
antibody or solid-phase/target fungus-specific
antibody/target fungus-specific antigen, depending on
whether the target fungus-specific antigen was present in
the sample, washing the first immobilized complex to
remove any unbound target fungus-specific antigen,
contacting the complex with a detectable secondary
antibody capable of binding to a different epitope on the
target fungus-specific antigen, thereby forming a second
immobilized complex which includes either solid-
phase/target fungus-specific antibody or solid-
phase/target fungus-specific antibody/target fungus-
specific antigen/secondary-antibody, depending on whether
target fungus-specific antigen was present in the sample,
washing the second immobilized complex to remove any
unbound secondary antibody, and detecting the presence or
absence of the secondary antibody on the second
immobilized complex. The secondary antibody can, for
CA 02286335 1999-10-14
WO 98/46738 - . PCT/US98/07728
example, be radiolabeled, enzyme-conjugated, tagged with
a fluorochrome or dyed as described above.
In another example of an indirect label-based
immunoassay, the presence or absence of target fungus-
5 specific antigen can be detected using a Western blot
format. This method includes electrophoretically
separating proteins contained in the sample in a gel
(e. g. such as a polyacrylamide gel), electrophoretically
transferring the separated proteins to a solid-phase
10 . membrane (e.g. a nitrocellulose membrane), contacting the
separated proteins with an unlabeled target fungus-
specific antibody to allow any target fungus-specific
antigen which may have been present in the sample to bind
to the antibody and form a first complex with includes
15 either solid-phase/target fungus-specific antigen or
solid-phase/target fungus-specific antigen/target fungus-
specific antibody, depending on whether target fungus-
specific antigen was present in the sample, washing the
first complex to remove unbound target fungus-specific
20 antibody, contacting the first complex with a detectable
secondary antibody to form second complex which includes
either solid-phase/target fungus-specific antigen or
solid-phase/target fungus-specific antigen/target fungus-
specific antibody/secondary-antibody, depending on
25 whether target fungus-specific antigen was present in the
sample, and detecting the presence or absence of the
secondary antibody bound to the antigen in the second
complex. The secondary antibody can, for example, be
radiolabeled, enzyme-conjugated, tagged with biotin or an
30 equivalent thereto, a fluorochrome, dyed or otherwise
associated with a colored material as described above.
In an exemplary direct Western blot immunoassay, the
presence or absence of the antigens in the sample can be
detected using a method which includes
electrophoretically separating proteins contained in the
sample in a gel (e. g. such as a polyacrylamide gel),
CA 02286335 1999-10-14
WO 98/46738 - . PCT/US98/07728
31
transferring the separated proteins to a solid-phase
membrane (e. g. a nitrocellulose or nylon membrane),
contacting the transferred proteins with a detectable
target fungus-specific antibody to allow any target
fungus-specific antigen which may have been present in
the sample to bind to the target fungus-specific antibody
and form a complex which includes either gel/target
fungus-specific antigen or gel/target fungus-specific
antigen/target fungus-specific antibody, washing any
unbound target fungus-specific antibody away from the gel
and detecting the presence or absence of labeled target
fungus-specific antibody bound to the antigen in the gel.
The target fungus-specific antibody can, for example, be
radiolabeled, enzyme-conjugated, tagged with a
fluorochrome or dyed, as described above.
Alternatively, the presence or absence of the
antigens in a sample can be detected in an
inhibition/competitive-type format by mixing a solution
including a detectable (e. g. labeled) target fungus-
specific antibody with the undiluted sample or with a
solution including the sample to allow any target fungus-
specific antigen which may be present in the sample to
bind with the detectable target fungus-specific antibody
and to form a test solution which includes either unbound
detectable target fungus-specific antibody or a
detectable target fungus-specific antibody/target fungus-
specific antigen complex depending on whether target
fungus-specific antigen was present in the sample. The
method further includes immobilizing a target fungus-
specific antigen on a solid-phase, contacting the
immobilized target fungus-specific antigen with the test
solution to allow any unbound detectable target fungus-
specific antibody present in the test solution to bind
with the immobilized target fungus-specific antigen and
form an immobilized complex including solid-phase/target
fungus-specific antigen or solid-phase/target fungus-
CA 02286335 1999-10-14
WO 98/46738 - . PCT/US98/07728
32
specific antigen/detectable target fungus-specific
antibody depending on whether target fungus-specific
antigen was present in the sample, washing the solid-
phase to remove any unbound target fungus-specific
antibody, and measuring the presence or absence of the
detectable target fungus-specific antibody on the
immobilized complex. The detectable antibody can be
radiolabeled, enzyme-conjugated, tagged with a
fluorochrome or dyed, as described above. In an
alternative variation on this type of format, an antigen
assay can include immobilizing a target fungus-specific
antibody on a solid-phase, contacting the immobilized
antibody with both (1) a detectable (e. g. labeled) target
fungus-specific antigen and (2) an undiluted sample or a
solution including the sample to allow any target fungus-
specific antigen which may be present in the sample to
bind to at least some of the immobilized target fungus-
specific antibody and to thereby form a test complex in
which at least some of the detectable target fungus-
specific antigen may have been competitively inhibited
from binding to the immobilized target fungus-specific
antibody, depending on whether target fungus-specific
antigen was present in the sample, washing the test
complex to remove any unbound target fungus-specific
antigen, and detecting the level of detectable target
fungus-specific antigen bound to the test complex. If
desired, the level of detectable target fungus-specific
antigen bound to the test complex can be compared to a
baseline level of detectable target fungus-specific
antigen bound to a control complex, with a decrease in
such level indicating the presence of target fungus-
specific antigen in the sample. The detectable target
fungus-specific antigen can, for example, be
radiolabeled, enzyme-conjugated, tagged with biotin or an
equivalent thereto, a fluorochrome, dyed or otherwise
associated with a colored material as described above.
CA 02286335 1999-10-14
WO 98/46738 - - PCT/US98/07728
33
The approaches set forth above for determining the
presence or absence of target fungus-specific antigens in
a sample are to be considered exemplary and non-limiting
of the many formats known in the art by which a sample
suspected of including antigens is contacted with an
antibody and the presence or absence and/or quantitative
extent of antigen-antibody binding is determined.
Moreover, the exact sequence of steps is not narrowly
critical and can be varied as is appropriate in the art.
Certain steps may be omitted altogether and/or combined
with other steps. For example, the sample and labeled
antigen can, in some assay formats, be added together.
As another example, assays may not require a washing step
to remove unbound antibodies. Assays such as
immunochromatographic assays where reactants flow across
and/or through the solid phase are exemplary. Certain
additional steps may also be added, in series and/or in
parallel combination, to the aforementioned steps, as
appropriate in the art. For example, the assays can
optionally include one or more blocking steps to decrease
the non-specific binding of antibodies, primary or
secondary, to the solid-phase. The assays of the
invention can also be automated, with appropriate
modifications to the described steps. A11 of the above
antigen assays are effective in detecting target fungus-
specific antigens for any fungus, including H.
capsula tum.
Kits are provided which are suitable for use in
performing the aforementioned assay methods to facilitate
diagnosis of histoplasmosis in humans and other mammals.
In one embodiment, an assay kit of the present invention
can include labeled and/or unlabeled target fungus-
specific antigen, as described above, in quantities
sufficient to carry out the assays of the present
invention. In another embodiment, an assay kit can
include labeled and/or unlabeled antibodies to an target
CA 02286335 1999-10-14
WO 98/46738 - . PCT/US98/07728
34
fungus-specific antigen, as described above, in
quantities sufficient to carry out the assays of the
present invention. In a further embodiment, an assay kit
of the present invention can include both labeled and/or
unlabeled target fungus-specific antigen and labeled
and/or unlabeled antibody thereto, each as described
above, in quantities sufficient to carry out the assays
of the present invention. In any of the aforementioned
embodiments, an assay kit can also further comprise known
positive and/or negative control samples, other reagents
useful in carrying out the assays of the present
invention (e. g. radiolabeled secondary antibodies and/or
enzyme-conjugated secondary antibodies along with the
corresponding color-producing enzyme substrate
therefore), and instructions for carrying out the assay
methods. Kits as provided above may be utilized for any
target fungus, including H. capsulatum.
The following example illustrates the invention, but
is not to be taken as limiting the various aspects of the
invention so illustrated.
Example
MOLECULAR CLONING AND CHARACTERIZATION OF A
RECOMBINANT HISTOPLASMA CAPSULATUM ANTIGEN
FOR ANTIBODY DIAGNOSIS OF HUMAN HISTOPLASMOSIS
MATERIALS AND METHODS
Fungi and culture conditions. H. capsulaturr~ G217B,
a North American isolate, was obtained from the American
Type Culture Collection (ATCC #26032, Rockville, MD).
Mycelial-phase organisms were cultured in a shaking water
bath at 25°C in broth containing 2°s glucose and 1% yeast
extract. Yeast-phase organisms were grown at 37°C in HMM
broth (Gibco-BRL, Gaithersburg, MD) supplemented with
18.2 g of glucose, 1.0 g of glutamic acid (per liter),
adjusted to pH 7.5 (17}.
CA 02286335 1999-10-14
WO 98/46738 - - ~ PCT/US98/07728
Human and animal sera. Human sera were obtained
from patients with well-documented histoplasmosis (n=18),
coccidioidomycosis {n=12), and candidiasis (n=5).
Coccidioidomycosis sera were generously provided by Dr.
5 Demothenes Pappagianis, University of California School
of Medicine (Davis, CA). The histoplasmosis sera were
obtained from patients with acute and chronic disease and
from patients with disseminated infections {with positive
bone marrow and/or blood cultures) associated with AIDS.
10 The laboratory diagnosis of histoplasmosis infections was
based on culture and biopsy results and/or serology tests
(immunodiffusion and complement fixation with yeast and
mycelial antigens). Blastomycosis sera from humans
(n=5) and dogs (n=6) with documented clinical infections
15 and sera from rabbits immunized with Blastomyces
dermatitidis antigens or whole yeast cells (n = 3) were a
gift from Dr. Gene Scalerone (Idaho State College,
Pocatello, ID).
Control human sera were obtained from healthy
20 residents of St. Louis, MO. A histoplasmosis serum pool
was prepared with sera {n=12) from patients with proven
histoplasmosis.
Isolation of H. capsulatum DNA. Genomic DNA from
yeast cells was isolated essentially as previously
25 described (17,34). Briefly, yeast cells were pelleted
and resuspended in TE buffer {10 mM Tris, pH 8.0; 1 mM
EDTA). SDS was added to 1°s final concentration. DNA was
extracted using phenol-chloroform, ethanol precipitated,
and washed with 70% ethanol.
30 Mouse sera. Antibodies to yeast antigen or to a
histidine fusion protein of the recombinant clone GH17
(GH17-his, see below) were produced in 6-week-old female
BALB/c mice by foot-pad injection of 10 ~.g of yeast
antigen or purified GH17-his in FCA followed by a second
35 injection of antigen in IFA 4 weeks later. Sera were
collected 1 week after the booster immunization.
CA 02286335 1999-10-14
WO 98/46738 - . PGT/US98/07728
36
Yeast antigen. Yeast cells were suspended in 0.01M
Tris buffer (pH 8.3) containing protease inhibitors (1 mM
phenyl methyl sulfonyl fluoride, 1 mM EDTA, 25 ~.g/ml N-
tosyl-L-phenylalanine chloromethyl ketone, and 25 ~,g/ml
N-a-p-tosyl-L-lysine chloromethyl ketone (all from Sigma
Chemical Company, St. Louis, MO). The yeast homogenate
was rocked at 4°C overnight and centrifuged at 15,000 x g
for 10 min. The protein concentration in the supernatant
was measured with a commercial kit (BCA; Pierce Chemical
Co. , Rockford, IL) .
Screening of a gene expression library and selection
of recombinant closes. A ~gtll cDNA library was custom-
synthesized (Clontech Lab. Inc., Palo Alto, CA) using
Poly(A)' mRNA derived from the mycelial stage of the G217B
strain of H. capsulatum. This library has a recombinant
frequency of over 90% after amplification. The DNA
insert size range is 0.6-4.5 kb with an average size of
1.6 kb. The library was immunoscreened to identify H.
capsulatum-specific clones essentially as previously
described (5,6). Clones that were reactive with
antibodies in the histoplasmosis serum pool but not
reactive with a normal human serum pool were selected and
purified by repeated cycles of immunoselection. The
reactivity of serum pools to fusion proteins expressed by
purified recombinant phage was studied by plaque-dot
immunoblot analysis as previously described (5). PCR was
employed to amplify the cDNA inserts of selected
recombinant ~gtl1 clones with the GenAmp DNA
amplification kit (Perkin Elmer-Cetus, Norwalk, CT) as
previously described (31). DNA dot hybridization was
performed using peroxidase-labeled DNA fragments (14) to
assess homology between the selected clones.
Southern blot analysis and DNA sequencing. H.
capsulatum genomic DNA (5 ~.g) was cut with selected
restriction endonuclease enzymes. Digestion products
were electrophoresed in a 1% agarose gel and transferred
CA 02286335 1999-10-14
WO 98/46738 ~ . ~ PCT/US98/07728
37 -
to Hybond-N+ nylon transfer membrane (Amersham, Arlington
Heights, IL) by standard techniques, and blots were
probed with labeled cDNA insert of GH17 (26).
~gtll DNA purified from GH17 was digested with EcoRI
and ligated into p8luescript II SK- (Strategene Cloning
Systems, La Jolla, CA) by standard methods (26), and
plasmid DNA was prepared for DNA sequencing. The
dideoxynucleotide chain termination method (32) was used
for double stranded DNA sequencing using the TaqTrack
Sequencing System (Promega Corporation, Madison, WI) with
T3 and T7 pBluescript primers and with synthetic
oligonucleotides.
The PC/GENE DNA Sequence Analysis Software
(Intelligenetics, Mountain View, CA) and the BLAST
Program (NCBI, NLM, NIH, Bethesda, MD) were used to
analyze nucleotide and deduced amino acid sequences and
to determine sequence homologies with previously reported
sequences in the GenBankTM data base.
Expression and purification of GH17 in the pPROEX~-1
Protein Expression system. The cDNA insert of the
recombinant clone GHI7 was subcloned directionally into
the plasmid expression vector pPROEXTM-1 (Gibco-BRL) to
produce a fusion protein containing 6 histidines. GH17
fusion protein (GH17-his) was purified from bacterial
lysates by continuous-elution electrophoresis using a
BioRad Prep Cell (BioRad Laboratories, Hercules, CA).
Briefly, a 10-ml overnight culture of Escherichia coli
(BL21 strain) cells containing the recombinant plasmid
GH17 was inoculated into 700 ml NZCYM medium (Gibco-BRL)
containing 50 ~.g ampicillin per ml (Sigma). Cultures
were grown at 37°C with shaking to OD6oo of 1Ø IPTG
(final concentration, 0.3 mM) was then added, and the
culture was grown for an additional 5 h, after which the
cells were pelleted and resuspended in 1:50 v/v of lysis
buffer (10 mM Na2HP04, 30 mM NaCl, 0.25% Tween 20, 10 mM
EDTA, 10 mM EGTA, pH 7.0). The cells were frozen at -20°C
overnight. Cells were thawed in cold water and lysed by
CA 02286335 1999-10-14
WO 98146738 - . PCT/US98/07728
38
mild sonication. Cellular debris was removed by
centrifugation at 10,000 x g for 15 min. A 12%
polyacrylamide gel was poured per the manufacturer's
protocol for the BioRad Model 491 Prep Cell. Ten ml of
sample in 1:1 loading buffer (0.0625M Tris-HC1, pH 6.8,
loo glycerol, 0.025°s bromphenol blue) was loaded and the
gel was run for 8 hrs at 12W constant power. Three ml
fractions were collected and run on 12°s SDS-PAGE minigels
(21). Western blots (35) were performed with the
histoplasmosis human serum pool to identify fractions
that contained the GH17 fusion protein. Three
consecutive fractions containing the band of interest
were selected, pooled, and dialyzed versus PBS, pH 7.2.
The dialyzed protein was concentrated with a membrane
concentrator (Centriplus,'r"' Amicon, Beverly, MA) and the
protein concentration was measured with a commercial kit
(BCA; Pierce Chemical Co.)
Immunoblot analysis of recombinant fusion proteins.
E. coli Y1090 was infected at high density with
recombinant phage on a thin layer of agarose over LB-agar
to achieve confluent lysis, and synthesis of fusion
proteins encoded by cDNA inserts was induced with IPTG-
impregnated filters. The agarose layer containing
bacterial lysate and fusion protein was then gently
scrapped off and dissolved in SDS-PAGE sample buffer.
SDS-PAGE was performed as described by Laemmli (21) at
135 V in 8% reducing gels. After SDS-PAGE, proteins were
transferred electrophoretically (35) to nitrocellulose
membranes. Membranes were then incubated in monoclonal
antibody to ~i-galactosidase (Promega Biotech, Madison,
WI) or in canine or human sera diluted 1:500 in PBS/T for
3 h at 37°C. Membranes were washed in PBS/T and incubated
with alkaline phosphatase conjugated goat anti-mouse,
anti-dog or anti-human IgG (Promega) for 1 h at 37°C.
After washing, membranes were developed with NBT/BCIP.
Immunoblot analysis was carried out with H.
capsulatum yeast extract to identify the native
CA 02286335 2006-02-23
77586-12
39
antigens) that correspond to the recombinant clone GH17.
Yeast extract was separated by SDS-PAGE on 5-25% gradient
slab gels and processed as described above with mouse
antibody to GH17-his.
RESULTS
Selection of ~gtl1 clones that express H.
capsulatum-specific antigens. Approximately, 500,000
phage plaques from an H. capsulatum-mycelia phase cDNA
expression library were immunoscreened with a
histoplasmosis serum pool and a normal control. serum pool
made from sera obtained from healthy residents of St.
Louis who had no history of histoplasmosis. Twenty
clones selected in the initial screen were rescreened
with individual histoplasmosis sera. Eight highly
immunoreactive clones were identified. These were again
tested by plaque-dot immunoblots with sera from patients
with other non-H. capsulatum fungal infections, including
C. immitis, B. dermatitidis, and Candida sp. Four clones
that were reactive with antibodies in sera from
histoplasmosis patients and not reactive with antibodies
from patients with other fungal infections were selected
for further study. DNA dot hybridization studies showed
that all four clones hybridized to each other even under
high stringency conditions. The four
clones designated as GH2, GH17, GH22 and GH23 produced a
similar size R-galactosidase fusion protein with an
apparent Mr of 140,000 vs. 116 kDa for unfused
galactosidase.
Molecular characterization of recombiaaat
Histoplasma clones. The cDNA inserts of clones GH2, 17
and 22 were sequenced. All three clones contained
identical 5' ends and an identical 633 by open reading
frame (ORF). That ORF is disclosed herein as SEQ ID
N0:2. The three clones had variable amounts of
untranslated DNA at the 3' ends (GH2- 260 bp; GH17- 142
CA 02286335 2004-07-02
77586-12
bp; and GH22-166 bp). The complete nucleotide sequence
of GH17 (GenBankTM Accession number U27588) is disclosed
herein as SEQ TD N0:1. The deduced amino acid sequence
of the translated protein is disclosed herein as SEQ ID
5 N0:3. The presumed initiation codon 36 by downstream
from the 5' end is the first ATG in the ORF. The
sequence also has a purine (adenine) in the -3 position
(Kozak's rule), a prerequisite for an initiation codon
(19). The initiation codon is followed by a hydrophobic
10 sequence (predicted by hydropathy analysis, Fig. 2) which
is consistent with a signal peptide sequence. Two
potential signal peptidase cleavage sites were identified
by the method of von Heijne (37) which predicts cleavage
after residues 20 and 24. The sequence also contains a
15 predicted transmembrane helix from amino acid 2 to 28
(28). The 3' non-coding region has a poly (A) tail of 14
bp. The ORF codes for a protein of 211 amino acids with
a predicted size of 23.5 kDa and a calculated pI of 4.15.
There are three potential N-glycosylation sites in the
20 predicted amino acid sequence; these are located in the
hydrophilic domains of the protein (boxed areas, Fig. 1).
The GH17 sequence does not exhibit significant similarity
to any proteins present in GenBank/EMBL sequence
databases except for the similarity of the threonine-rich
25 region to other threonine rich sequences such as
cellulase of Caldoce~lum saccharolyticum (25), Xenopus
laevis integumentary mucin (12), and a Leishmania surface
antigen (27) (Fig. 1).
Southern blot analysis was performed to-identify
30 genomic fragments carrying the genes) encoding the
recombinant clone GH17. When DNA was cut with EcoRI and
PstI and probed with labeled cDNA insert of GH17, bands
were detected at 4.9 lcb and 5.5 kb, respectively (Fig.
3). The probe hybridized to two bands (8.5 kb and 5.0
35 kb) in SacI digested DNA. However, recombinant clone
GH17 has an internal SacI site. These results suggest a
single location in the H. capsulatum genome for GHl7.
CA 02286335 1999-10-14
WO 98!46738 - - PCT/US98/07728
41
Sensitivity and specificity of IgG antibodies to
recombinant H. capsulatum proteins. Immunoreactivity of
recombinant H. capsulatum proteins produced by clones
GH2, 17, 22, 23 was assessed by Western blot with sera
from patients with a variety of fungal infections. Most
sera from histoplasmosis patients had easily visible
antibody reactivity with all 4 recombinant proteins
(Table l, Fig. 4A). The sensitivity of Western blot with
these clones for histoplasmosis sera ranged from 89-100%
(Table l, Fig. 4A). None of these clones was recognized
by sera from humans and animals infected with other fungi
(Fig. 4B).
CA 02286335 2004-07-02
77586-12
42
TABLE 1. Sensitivitya and Specificity Immunoblot
of with
Recombinant H, capsu3a tum Clones
Clones
Serum Source
GH2 GH17 GH22 GH23
Histoplasmosis
Human 18/18b 18/18 16/18 16/18
Blstomycosis
Dog 0/6 0/6 0/6 0/6
Rabbit 0/3 0/3 0/3 0/3
Human 0/5 0/5 0/5 0/5
Coccidioidomycosis
Human 0/12 0/12 0/12 0/12
Candidiasis
Human 0/5 0/5 0/5 0/5
Uninfected Controls
Human 0/12 0/I2 0/12 0/12
aImmunoreactivity was assessed by immunoblot with ~i-
galactosidase fusion proteins.
bNo. of sera reactive/no. of sera tested.
CA 02286335 1999-10-14
WO 98/46738 - . PCT/US98/07728
43
Expression of aAl7 in pPROEX~'-1 expression vector.
The cDNA insert of GH17 was expressed as histidine fusion
in the pPROEXT"' -1 protein expression system. Plasmid
pPROEX-1 consists of a Trc promotor for high level
expression in E. coli, a prokaryotic ribosome binding
site, and a 6X His affinity tag for ease of purification.
A fusion protein with an apparent size of 32 kDa was
evident by SDS-PAGE and immunoblot (Fig. 5A). GH17-his
failed to bind to a metal affinity column. Therefore,
the fusion protein was purified from bacterial lysates by
continuous-elution electrophoresis using a BioRad
PrepCell. Western blots were performed to select
fractions of interest by immunoblotting with a human
histoplasmosis serum pool (Fig. 5B). Three consecutive
fractions containing the band of interest were selected,
pooled and dialyzed. This yielded a total of 500 ~.g of
purified protein from approximately 700 ml of bacterial
culture.
Pilot studies were carried out to test the purified
GH17-his protein in an ELISA format (data not shown).
Unfortunately, ELISA based on the GH17-his protein was
less sensitive and specific than the recombinant
immunoblot assay with the GH17-,Q-galactosidase fusion
protein. This lowered specificity and sensitivity is
believed to be due to cross-reactivity to the
- polyhistidine component of the GH17-his protein.
Iumnunoblot analysis of mouse antibodies to
recombinant antigen. Sera from mice immunized with
CA 02286335 1999-10-14
WO 98/46738 - . PCT/US98107728
44
GH17-his bound to a 60 kDa native H. capsulatum yeast
antigen by Western blot (Fig. 6). This antigen was not
recognized by pre-immune mouse sera.
DISCUSSION
The experiments of this Example demonstrate that H.
capsulatum-specific antigens can be identified, cloned,
characterized, and produced using recombinant DNA
methodologies and other methods, as described: A
recombinant H. capsulatum antigen was shown to have
highly specific and sensitive immunodiagnostic potential.
Recombinant clones that expressed H. capsulatum-
specific antigens were identified by several cycles of
differential immunoscreening, and the most immunoreactive
and specific clone (GH17) was selected for more detailed
studies. GH17 codes for the most promising recombinant
diagnostic antigen for histoplasmosis that has been
identified to date. GH17 codes for a protein that
corresponds to a 60 kDa native H. capsulatum antigen.
There are three potential N-glycosylation sites [Asn-
Asn/Lys-Thr] in the predicted amino acid sequence of GH17
(boxed areas, Fig. 1). Glycosylation at these sites
could account for the difference between the predicted
polypeptide mass of 23.5 kDa and the observed size of the
native yeast protein recognized by the mouse antibodies
to GH17 histidine fusion protein (60 kDa).
The protein encoded by GH17 is highly antigenic in
humans with histoplasmosis. Chou-Fasman predictions
CA 02286335 1999-10-14
WO 98!46738 - . ~ PCT/US98/07728
based on the deduced amino acid sequence of GH17 (7)
indicate that the protein is rich in potential B cell
epitopes. These predictions are based principally on the
hydrophilic character and accessibility of highly charged
5 and exposed polar residues that comprise the turns and
alpha helices within the predicted GH17 protein (13,20).
Our results with human sera are consistent with these
predictions. GH17 produced a 140 kDa fusion protein that
was recognized in Western blots by 18 of 18 sera from
10 patients with histoplasmosis.
In contrast to previous serological work with H.
capsulatum (15, 16, 36, 40, 41) the GH17 recombinant
immunoblot assay appears to have excellent specificity
for histoplasmosis.
15 _________________________________
As shown in the Example, the present invention
provides a method to isolate specific fungal antigens.
In particular, the present invention offers significant
advantages over prior art fungal antigens, antibodies and
20 diagnostic methods employing the same. The specificity
of the present target fungus antigens and antibodies make
them particularly advantageous for reliable determination
of the presence of the target fungus or antibodies which
are specific to the target fungus. As applied to target
25 fungi which are pathogens of vertebrates, such as H.
capsulatum, use of antigens and antibodies of the present
invention are useful for providing reliable evidence of
CA 02286335 1999-10-14
WO 98/46738 - . - PCT/US98/07728
46 -
present or past infection with H. capsulatum. Other
features, objects and advantages of the present invention
will be apparent to those skilled in the art. The
explanations and illustrations presented herein are
intended to acquaint others skilled in the art with the
invention, its principles, and its practical application.
Those skilled in the art may adapt and apply the
invention in its numerous forms, as may be best suited to
the requirements of a particular use. Accordingly, the
specific embodiments of the present invention as set
forth are not intended as being exhaustive or limiting of
the invention.
REFERENCES
1. Ajello, J. 1971. Coccidioidomycosis and
histoplasmosis: a review of their epidemiology and
geographical distribution. Mycopathol. Appl.
45:221-230.
2. Bauman, D. S., and C. D. Smith. 1975. Comparison
of immunodiffusion and complement fixation tests in
the diagnosis of histoplasmosis. J. Clin.
Microbiol. 2:77-80.
3. Buechner, H. A., J. H. Seabury, and C. C. Campbe 11.
1973. The current status of serologic, immunologic,
and skin tests in the diagnosis of pulmonary
mycoses. Chest 63:259-270.
4. Chandler, J.W., T. R. Smith, and W. M. Newberry.
1969. Immunology of mycoses. II. Characterization
CA 02286335 1999-10-14
WO 98/46738 - - PCT/US98/07728
47
of the immunoglobulin and antibody responses in
histoplasmosis. J. Infect. Dis. 119:247-254.
5. Chandrashekar, R., K. Masood, R. M. Alvarez, A. F.
Ogunrinade, R. Lujan, F. Richards, and G. J. Weil.
1991. Molecular cloning and characterization of
recombinant parasite antigens for immunodiagnosis of
onchocerciasis. J. Clin. Invest. 8:1460-1466.
6. Chandrashekar, R., K. C. Curtis, R. M. Ramzy, F.
Liftis, 8. W. Li, and G. J. Weil. 1994. Molecular
cloning of Brugia malayi antigens for diagnosis of
lymphatic filariasis. Mol. Biochem. Parasitol.
64:261-271.
7. Chou, P. Y., and G. Fasman. 1978. Prediction of
the secondary structure of proteins from their amino
acid sequence. Adv. Enzymol. Relat. Areas Mol.
Biol. 47:145-147.
8. Edwards, P. Q., and E. L. Billings. 1971. World-
wide pattern of skin sensitivity to histoplasmin.
Am. J. Trop. Med. Hyg. 20:288-319.
9. George, R. B., R. S. Lambert, M. J. Bruce, T. W.
Pickering, and R. M. Wolcott. 1981.
Radioimmunoassay: a sensitive screening test for
histoplasmosis and blastomycosis. Am. Rev. Resp.
Dis. 124:407-410.
10. Goodwin, Jr., R., and R. M. Prez. 1978.
Histoplasmosis. Am. Rev. Respir. Dis. 117:929-955.
CA 02286335 1999-10-14
WO 98/46738 - . ~ PCT/US98/07728
48
11. Goodwin, R. A., Jr., and R. M. Des Perez. 1979.
Histoplasmosis: State of the art. Am. Rev. Resp.
Dis. 119:247-254.
12. Hauler, F. and W. Hoffman. 1992. P-domains as
shuffled cysteine-rich modules in integumentary
mucin C.1 (FIM-C.1) from Xenopus Iaevis.
Polydispersity and genetic polymorphism. J. Biol.
Chem. 267:24620-24624.
13. Hopp, T. P. 1986. Methods for identifying antigenic
determinants and other interaction sites. J.
Immunol. Methods. 88:1-18.
14. Kafatos, F. C., C. W. Jones, and A. Efstratiadis.
1979. Determination of nucleic acid sequence
homologies by a dot hybridization procedure.
Nucleic Acids Res. 7:1541-1552.
15. Kaufman L., and E. Reiss. 1986. Serodiagnosis of
fungal diseases. p 446-466. In Rose, N.R., H.
Friedman, and J. L. Fahey. Manual of Clinical
Laboratory Immunology. 3rd edition. American Society
for Microbiology, Washington, D.C.
16. Kaufman, L. 1992. Laboratory methods for the
diagnosis and confirmation of systemic mycoses.
Clin. Infect. Dis. 14:S23-529.
17. Keath, E. J., A. A. Painter, G. S. Kobayashi, and G.
Medoff. 1989. Variable expression of a yeast-
phase-specific gene in Histoplasma capsulatum
strains differing in thermotolerance and virulence.
Infect. Immun. 57:1384-1390.
CA 02286335 1999-10-14
WO 98146738 ~ - ~ PCT/US98/07728
49
18. King, R. 1982. Histoplasmosis in Australia. Aust.
Med. J. 2:550-551.
19. Kozak, M. 1986. Point mutations define a sequence
flanking the AUG initiator codon that modulates
translation by eukaryotic ribosomes. Cell 44:283-
292.
20. Kyte, J., and R. F. Doolittle. 1982. A simple
method for displaying the hydropathic character of
a
protein. J. Mol. Biol. 157:105-132.
21. Laemmli, U. K. 1970. Cleavage of structural
proteins during the assembly of the head of
bacteriophage T4. Nature 227:680-685.
22. Lambert, R. S., and R. B. George. 1987. Evaluation
of enzyme immunoassay as a rapid screening test for
histaplasmosis and blastomycosis. Am. Rev. Resp.
Dis. 136:316-319.
23. Lobos, E., N. Weiss, M. Karam, H. R. Taylor, E. A.
Ottesen, and T. B. Nutman. 1991. An immunogenic
Onchocerca volvulus antigen: A specific and early
marker of infection. Science 51:1603-1605.
24: Lustigman, S., B. Brotman, T. Huima, and A. M.
Prince. 1991. Characterization of an Onchocerca
volvulus cDNA clone encoding a genus-specific
antigen present in infective larvae and adult worms.
Mol. Biochem. Parasitol. 45:65-76.
25. Luthi, E., Jasmat, N. B., R. A. Grayling, D. R.
Love, and P. L. Hergquist. 1991. Cloning, sequence
analysis, and expression in Escherichia coli of a
CA 02286335 1999-10-14
WO 98/46?38 - . ~ PCT/US98/07?28
50 - _
gene coding for a beta-mannose from the extremely
thermophilic bacterium Caldocellum saccharolyticum.
Appl. Environ. Microbiol. 57:694-700.
26. Maniatis, T. E., F. Fritsch, and J. Sambrook. 1982.
Molecular cloning: A laboratory manual. Cold Spring
Harbor Laboratory, Cold Spring Harbor, NY.
27. Murray, P. J. and T. W. Spithill. 1991. Variants of
a Leishmania surface antigen derived from a
multigenic family. J. Biol. Chem. 266:24477-24484.
28. Rao, M. J. K., and Argos, P. 1986. A
conformational preference parameter to predict
helices in integral membrane proteins. Biochem.
Biophys. Acta. 869:197-214.
29. Rao, A., R. Forgan-Smith, G, Ritchie, H. Sakellaris,
S. Miller, M. Arghyros. 1988. A serendipitous
isolate of Histoplasma capsulatum. Pathology 20:191-
193.
30. Reiss, E., H., H. Hutchinson, L. Pine, D. W.
Zeigler, and L. Kaufman. 1977. Solid-phase
competitive-binding radioimmunoassay for detecting
antibody to the M antigen of histoplasmin. J. Clin.
Microbiol. 6:598-604.
31. Saiki, R. K., D. H. Gelfand, S. Stoffel, S. Scharf,
R. Higuchi, G. T. Horn, R. B. Mullis, and H. A.
Erlich. 1988. Primer-directed enzymatic
amplification of DNA with a thermostable DNA
polymerase. Science 239:489-491.
CA 02286335 1999-10-14
WO 98/46738 - . ~ PCT/US98/07728
51
32. Sanger, F., S. Nicklen, and A. R. Coulson. 1977.
DNA sequencing with chain terminating inhibitors.
Proc. Natl. Acad. Sci. USA. 74:5463-5467.
33. Schwarz, L. 1981. Histoplasmosis. Praeger Science
Press, New York.
34. Spitzer, E. D., E. J. Keith, S. J. Travis, A. A.
Painter, G. S. Kobayashi, and G. Medoff. 1990.
Temperature-sensitive variants of Histoplasma
capsulatum isolated from patients with acquired
immunodeficiency syndrome. J. Infect. Dis. 162:258-
261.
35. Towbin, H., T. Staehelin, and J. Gordon. 1979.
Electrophoretic transfer of proteins from
polyacrylamide gels to nitrocellulose sheets:
procedure and some applications. Proc. Natl. Acad.
Sci. USA. 76:4350-4354.
36. Vijayakumar, B., G. Medoff, G. S. Kobayashi, and W.
L. Sieling. 1985. Cross-reacting human and rabbit
antibodies to antigens of Histoplasma capsulatum,
Candida albicans, and Saccharomyces cerevisiae.
Infect. Immun. 48:806-812.
37. Von Heijne, G. 1986. A new method for predicting
signal sequence cleavage sites. Nucleic Acids Res.
14:4683-4690.
38. Wheat, L. J., R. B. Kohler, M. L. V. French, J.
Garten, A. White, and Z. Brahnni. 1983. IgM and IgG
histoplasmal antibody response in histoplasmosis.
Am. Rev. Resp. Dis. 128:65-70.
CA 02286335 1999-10-14
WO 98/46738 - . ~ PCT/US98/07728
52
39. Wheat L. J., R. B. Kohler, and R. P. Tiwari. 1986.
Diagnosis of disseminated histoplasmosis by
detection of Histoplasma capsulatum antigen in serum
and urine specimens. N. Eng. J. Med. 314:83-88.
40. Wheat L. J., P. Connolly-Stringfield, R. B. Kohler,
P. T. Frame, and M. R. Gupta. 1989. Histop.Iasma
capsulatum polysaccharide antigen detection in
diagnosis and management of disseminated
histoplasmosis in patients with AIDS. Am. J. Med.
87:396-400.
41. Wheat, L. J., R. B. Kohler, R. P. Tiwari, M. Garten,
and M. L. V. French. 1989. Significance of
Histoplasma antigen in the cerebrospinal fluid of
patients with meningitis. Arch. Int. Med. 149:302-
304.
CA 02286335 2000-03-30
53
SEQUENCE LISTING
(1) GENERAL INFORMATION:
(i) APPLICANT: BARNES-JEWISH HOSPITAL
(ii) TITLE OF INVENTION: 3
(iii) NUMBER OF SEQUENCES: METHODS OF OBTAINING ANTIGENS SPECIFIC FOR
FUNGI, ANTIBODIES FOR SUCH ANTIGENTS, AND
DIAGNOSIS OF DISEASE USING SUCH ANTIGENS
AND/OR ANTIBODIES
(iv) CORRESPONDENCE ADDRESS:
1O (A) ADDRESSEE: SMART & BIGGAR
(B) STREET: P.O. BOX 2999, STATION D
(C) CITY: OTTAWA
(D) STATE: ONT
(E) COUNTRY: CANADA
(F) ZIP: K1P 5Y6
(v) COMPUTER READABLE FORM:
(A) MEDIUM TYPE: Floppy disk
(B) COMPUTER: IBM PC compatible
(C) OPERATING SYSTEM: PC-DOS/MS-DOS
2 0 (D) SOFTWARE: ASCII (text)
(vi) CURRENT APPLICATION DATA:
(A) APPLICATION NUMBER: CA 2,286,335
(B) FILING DATE: 15-APR-1998
(C) CLASSIFICATION:
(vii) PRIOR APPLICATION DATA:
(A) APPLICATION NUMBER: US 60/043,332
(B) FILING DATE: 15-APR-1997
(viii) ATTORNEY/AGENT INFORMATION:
(A) NAME: SMART & BIGGAR
3O (B) REGISTRATION NUMBER:
(C) REFERENCE/DOCKET NUMBER: 64725-759
CA 02286335 2000-03-30
53a
(ix) TELECOMMUNICATION INFORMATION:
(A) TELEPHONE: (613)-232-2486
(B) TELEFAX: (613)-232-8440
(2) INFORMATION FOR SEQ ID NO.: 1:
(i) SEQUENCE CHARACTERISTICS
(A) LENGTH: 810
(ii) MOLECULAR TYPE: DNA
1 0 (A) ORGANISM: Histoplasma capsulatum
(viii) POSITION IN GENOME:
CA 02286335 1999-10-14
WO 98/46738 - . PCT/US98/07728
54
(B) MAP POSITION: ...
,(xi} S EQUENCE DESCRIPTION: SEQ ID
NO:1:
ACACAGCATAACAGAAGATC TCTGAAATTG ACAAAAATGAAAACCATTTG CTTGCCTGCT 60
TACTTCAAGCTTCTCTCTTT TCTGTCTGCT ATAGCTGTGACATCTGGAGC AGCTGTTGAC 120
TCCTGTCTCTTAGAATCAAA CTGCCCACCG CCAACAACAACAACGACAAC AACGACAACA 180
ACACCAACACCAACACCAAC ATCAATAATA CCAATAACACCAATAGTACC AGCAAATAAG 240
ACAATTGTGCTTACAACCAC TATTGAGCCT GGGCCAGGCCAGGTTTGGGC GCAAATAGAG 300
GAGATTGATCCTGAACCATA TTATGTTAGA TGGGTCCCTGATCCAACGTT TGCCACGCCT 360
GTTGTACTGCACAATAACAC AGATCTTGTC TTCATGGATGGAAGCAAATC TTTTTATCTC 420
AACTTCGATAACAGCACCTC TGACACGGGT ATTTATTTTGTGAACCTTAA CTCCAACGCT 480
GGTATTAGTCAACTCTATAA GGATAGTGAC AACAAGTTGCTCTGGGGTGG AGCTCAACAA 540
GAGCGGGATGGCTGGATGTG GTGCTTCATG GTCGATCTACAATACCGCAT GTTCTATTCT 600
GACAGTAAATTCGTTGGTTC TCCAAGGGAT TGTGGCCTCTCCTCTGTCTT TTTGACAGAG 660
CGCCCGAGTTGAAACAGCTA TTGTGAGGAG GGGAGCAGTTCTGGACCGGC CGTGCGAAAT 720
AAGTAATGAGTATCAAAGTG TTTCTGTGAT CTATGAAATTTAGAGGGCCA GGATACAATT 780
ATTGATCAACTCCCACAAAA S10
(2) INFORMATION
FOR SEQ
ID N0:2:
(i) SEQUENCE
CHARACTERISTICS:
(A) LENGTH: 631 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: double
(D) TOPOLOGY: linear
(ii) MOLECULE
TYPE:
cDNA to
mRNA
(vi) ORIGINAL
SOURCE:
(A} ORGANISM: Histoplasma Capsulatum
(xi) SEQUENCE
DESCRIPTION:
SEQ ID
N0:2:
ATGAAAACCATTTGCTTGCCTGCTTACTTC AAGCTTCTCTCTTTTCTGTCTGCTATAGCT 60
GTGACATCTGGAGCAGCTGTTGACTCCTGT CTCTTAGAATCAAACTGCCCACCGCCAACA 120
ACAACAACGACAACAACGAACACCAACACC AACACCAACATCAATAATACCAATAACACC 180
AATAGTACCAGCAAATAAGACAATTGTGCT TACAACCACTATTGAGCCTGGGCCAGGCCA 240
CA 02286335 1999-10-14
WO 98/46738 - . ~ PCT/C1S98/07728
GGTTTGGGCGCAAATAGAGG AGATTGATCCTGAACCATAT TATGTTAGAT GGGTCCCTGA 300
TCCAACGTTTGCCACGCCTG TTGTACTGCACAATAACACA GATCTTGTCT TCATGGATGG 360
AAGCAAATCTTTTTATCTCA ACTTCGATAACAGCACCTCT GACACGGGTA TTTATTTTGT 420
GAACCTTAACTCCAACGCTG GTATTAGTCAACTCTATAAG GATAGTGACA ACAAGTTGCT 480
CTGGGGTGGAGCTCAACAAG AGCGGGATGGCTGGATGTGG TGCTTCATGG TCGATCTACA 540
ATAGCGCATGTTCTATTCTG ACAGTAAATTCGTTGGTTCT CCAAGGGATT GTGGCCTCTC 600
CTCTGTCTTTTTGACAGAGC GCCCGAGTTGA 631
(2) INFORMATION
FOR SEQ
ID N0:3:
(i) SEQUENCE
CHARACTERISTICS:
(A) LENGTH: 211 aminoacids
(B) TYPE: amino acid
(C) STRANDEDNESS: le
sing
(D) TOPOLOGY: linear
(ii) MOLECULE
TYPE:
protein
(xi)SEQUENCE DESCRIPTION:
SEQ
ID
N0:3:
Met Lys Thr IleCys Leu ProAla Tyr Phe LysLeu Leu Ser Phe Leu
1 5 10 15
Ser Ala Ile AlaVal Thr SerGly Ala Ala ValAsp Ser Cys Leu Leu
20 25 30
Glu Ser Asn CysPro Pro ProThr Thr Thr ThrThr Thr Thr Thr Thr
35 40 45
Thr Pro Thr ProThr Pro ThrSer Ile Ile ProIle Thr Pro Ile Val
50 55 60
Pro Ala Asn LysThr Ile ValLeu Thr Thr ThrIle Glu Pro Gly Pro
70 75 80
Gly Gln Val TrpAla Gln IleGlu Glu Ile AspPro Glu Pro Tyr Tyr
85 90 95
Val Arg Trp Val Pro Asp Pro Thr Phe Ala Thr Pro Val Val Leu His
100 105 110
Asn Asn Thr Asp Leu Val Phe Met Asp Gly Ser Lys Ser Phe Tyr Leu
115 120 125
Asn Phe Asp Asn Ser Thr Ser Asp Thr Gly Ile Tyr Phe Val Asn Leu
130 135 140
CA 02286335 1999-10-14
WO 98/46738 - . PCT/US98/07728
56
Asn Ser Asn Ala Gly Ile Ser Gln Leu Tyr Lys Asp Ser Asp Asn Lys
145 150 155 160
Leu Leu Trp Gly Gly Ala Gln Gln Glu Arg Asp Gly Trp Met Trp Cys
165 170 175
Phe Met Val Asp Leu Gln Tyr Arg Met Phe Tyr Ser Asp Ser Lys Phe
180 185 190
Val Gly Ser Pro Arg Asp Cys Gly Leu Ser Ser Val Phe Leu Thr Glu
195 200 205
Arg Pro Ser
210
