Note : Les descriptions sont présentées dans la langue officielle dans laquelle elles ont été soumises.
CA 02291477 1999-11-18
WO 98/53065 PCT/US98110188
HUMAN SEMAPHORIN E AND POLYNUCLEOTIDES ENCODING IT
This application is a continuation-in-part of application Ser. No. 08/858,834,
filed
May 19, 1997, which is a divisional application of application Ser. No.
08/702,080, filed
August 23,1996, and issued as U.S. Pat. No. 5,654,173 on August 5, 1997, all
of which are
incorporated by reference herein.
FIELD OF THE INVENTION
The present invention provides novel polynucleotides and proteins encoded by
such poly nucleotides, along with therapeutic, diagnostic and research
utilities for these
polynucleotides and proteins.
BACKGROUND OF THE INVEhfTION
Technology aimed at the discovery of protein factors (including e.g.,
cytokines,
such as lymphokines, interferons, CSFs and interleukins) has matured rapidly
over the
past decade. The now routine hybridization cloning and expression cloning
techniques
clone novel polynucleotides "directly" in the sense that they rely on
information directly
2 0 related to the discovered protein (i.e., partial DNA/amino acid sequence
of the protein
in the case of hybridization cloning; activity of the protein in the case of
expression
cloning). More recent "indirect" cloning techniques such as signal sequence
cloning, which
isolates DNA sequences based on the presence of a now well-recognized
secretory leader
sequence motif, as well as various PCR-based or low stringency hybridization
cloning
2 5 techniques, have advanced the state of the art by making available large
numbers of
DNA/amino acid sequences for proteins that are known to have biological
activity by
virtue of their secreted nature in the case of leader sequence cloning, or by
virtue of the
cell or tissue source in the case of PCR-based techniques. It is to these
proteins and the
polynucleotides encoding them that the present invention is directed.
35
CA 02291477 1999-11-18
WO 98!53065 PCT/US98110188
SUMMARY OF THE INVENTION
In one embodiment, the present invention provides a composition comprising an
isolated polynucleotide selected from the group consisting of:
(a) a polynucleotide comprising the nucleotide sequence of SEQ ID
N0:1;
(b) a polynucleotide comprising the nucleotide sequence of SEQ ID
NO:l from nucleotide 245 to nucleotide 2497;
(c) a polynucleotide comprising the nucleotide sequence of SEQ ID
NO:1 from nucleotide 299 to nucleotide 2497;
(d) a polynucleotide comprising the nucleotide sequence of SEQ ID
N0:1 from nucleotide 154 to nucleotide 430;
(e) a polynucleotide comprising the nucleotide sequence of the full-
length protein coding sequence of clone BR533 4 deposited under accession
number ATCC 98146;
(f) a polynucleotide encoding the full-length protein encoded by the
cDNA insert of clone BR533_4 deposited under accession number ATCC 98146;
(g) a polynucleotide comprising the nucleotide sequence of a mature
protein coding sequence of clone BR533_4 deposited under accession number
ATCC 98146;
2 0 (h) a polynucleotide encoding a mature protein encoded by the cDNA
insert of clone BR533_4 deposited under accession number ATCC 98146;
(i) a polynucleotide encoding a protein comprising the amino acid
sequence of SEQ ID N0:2;
(j) a polynucleotide encoding a protein comprising a fragment of the
2 5 amino acid sequence of SEQ ID N0:2 having biological activity, the
fragment
comprising eight consecutive amino acids of SEQ ID N0:2;
(k) a polynucleotide which is an allelic variant of a polynucleotide of
(a)-(h) above;
(1) a polynucleotide which encodes a species homologue of the protein
3 0 of (i} or (j) above ; and
(m) a polynucleotide that hybridizes under stringent conditions to any
one of the polynucleotides specified in (a)-(j).
Preferably, such polynucleotide comprises the nucleotide sequence of SEQ ID
N0:1 from nucleotide 245 to nucleotide 2497; the nucleotide sequence of SEQ ID
N0:1
2
CA 02291477 1999-11-18
WO 98153065 PCT/US98/10188
from nucleotide 299 to nucleotide 2497; the nucleotide sequence of SEQ ID N0:1
from
nucleotide 154 to nucleotide 430; the nucleotide sequence of the full-length
protein coding
sequence of clone BR533 4 deposited under accession number ATCC 98146; or the
nucleotide sequence of a mature protein coding sequence of clone BR533_4
deposited
under accession number ATCC 98146. In other preferred embodiments, the
polynucleotide encodes the full-length or a mature protein encoded by the cDNA
insert
of clone BR533_4 deposited under accession number ATCC 98146. In yet other
preferred
embodiments, the present invention provides a polynucleotide encoding a
protein
comprising the amino acid sequence of SEQ ID N0:2 from amino acid 1 to amino
acid 62.
In further preferred embodiments, the present invention provides a
polynucleotide
encoding a protein comprising a fragment of the amino acid sequence of SEQ iD
N0:2
having biological activity, the fragment preferably comprising eight (more
preferably
twenty, most preferably thirty) consecutive amino acids of SEQ ID N0:2, or a
polynucleotide encoding a protein comprising a fragment of the amino acid
sequence of
SEQ ID N0:2 having biological activity, the fragment comprising the amino acid
sequence
from amino acid 370 to amino acid 379 of SEQ ID N0:2.
Other embodiments provide the gene corresponding to the cDNA sequence of SEQ
ID N0:1.
In other embodiments, the present invention provides a composition comprising
2 0 a protein, wherein said protein comprises an amino acid sequence selected
from the group
consisting of:
(a) the amino acid sequence of SEQ ID NO:2;
(b) the amino acid sequence of SEQ ID N0:2 from amino acid 1 to
amino acid 62;
2 5 (c} fragments of the amino acid sequence of SEQ ID N0:2 comprising
eight consecutive amino acids of SEQ ID N0:2; and
(d) the amino acid sequence encoded by the cDNA insert of clone
BR533_4 deposited under accession number ATCC 98146;
the protein being substantially free from other mammalian proteins. Preferably
such
3 0 protein comprises the amino acid sequence of SEQ ID N0:2 or the amino acid
sequence
of SEQ ID N0:2 from amino acid 1 to amino acid 62. In further preferred
embodiments,
the present invention provides a protein comprising a fragment of the amino
acid
sequence of SEQ ID N0:2 having biological activity, the fragment preferably
comprising
eight (more preferably twenty, most preferably thirty) consecutive amino acids
of SEQ ID
3
CA 02291477 1999-11-18
WO 98/53065 PCT/US98/10188
N0:2, or a protein comprising a fragment of the amino acid sequence of SEQ ID
N0:2
having biological activity, the fragment comprising the amino acid sequence
from amino
acid 370 to amino acid 379 of SEQ ID N0:2.
In certain preferred embodiments, the polynucleotide is operably linked to an
expression control sequence. The invention also provides a host cell,
including bacterial,
yeast, insect and mammalian cells, transformed with such polynucleotide
compositions.
Also provided by the present invention are organisms that have enhanced,
reduced, or
modified expression of the genes) corresponding to the polynucieotide
sequences
disclosed herein.
Processes are also provided for producing a protein, which comprise:
(a) growing a culture of the host cell transformed with such
polynucleotide compositions in a suitable culture medium; and
(b) purifying the protein from the culture.
The protein produced according to such methods is also provided by the present
invention.
Protein compositions of the present invention may further comprise a
pharmaceutically acceptable carrier. Compositions comprising an antibody which
specifically reacts with such protein are also provided by the present
invenrion.
Methods are also provided for preventing, treating or ameliorating a medical
2 0 condition which comprises administering to a mammalian subject a
therapeutically
effective amount of a composition comprising a protein of the present
invention and a
pharmaceutically acceptable carrier.
BRIEF DESCRIPTION OF THE DRAWINGS
2 5 Figures 1A and 1B are schematic representations of the pED6 and pNOTs
vectors,
respectively, used for deposit of clones disclosed herein.
DETAILED DESCRIPTION
ISOLATED PROTEINS AND POLYNUCLEOTIDES
3 0 Nucleotide and amino acid sequences, as presently determined, are reported
below for each clone and protein disclosed in the present application. The
nucleotide
sequence of each clone can readily be determined by sequencing of the
deposited clone
in accordance with known methods. The predicted amino acid sequence (both full-
length
and mature forms) can then be determined from such nucleotide sequence. The
amino
4
CA 02291477 1999-11-18
WO 98/53065 PCT/US98I10188
acid sequence of the protein encoded by a particular clone can also be
determined by
expression of the clone in a suitable host cell, collecting the protein and
determining its
sequence. For each disclosed protein applicants have identified what they have
determined to be the reading frame best identifiable with sequence information
available
at the time of filing.
As used herein a "secreted" protein is one which, when expressed in a suitable
host
cell, is transported across or through a membrane, including transport as a
result of signal
sequences in its amino acid sequence. "Secreted" proteins include without
limitation
proteins secreted wholly (e.g., soluble proteins) or partially (e.g. ,
receptors) from the cell
in which they are expressed. "Secreted" proteins also include without
limitation proteins
which are transported across the membrane of the endoplasmic reticulum.
Clone "BR533 4"
A polynucleotide of the present invention has been identified as clone
"BR533_4".
BR533 4 was isolated from a human fetal kidney cDNA library using methods
which are
selective for cDNAs encoding secreted proteins (see U.S. Pat. No. 5,536,637),
or was
identified as encoding a secreted or transmembrane protein on the basis of
computer
analysis of the amino acid sequence of the encoded protein. BR533_4 is a full-
length clone,
including the entire coding sequence of a secreted protein (also referred to
herein as
2 0 "BR533_4 protein")
The nucleotide sequence of BR533 4 as presently determined is reported in SEQ
ID N0:1. What applicants presently believe to be the proper reading frame and
the
predicted amino acid sequence of the BR533 4 protein corresponding to the
foregoing
nucleotide sequence is reported in SEQ ID N0:2. Amino acids 6 to 18 are a
predicted
2 5 leader/signal sequence, with the predicted mature amino acid sequence
beginning at
amino acid 19.
The EcoRI/NotI restriction fragment obtainable from the deposit containing
clone
BR533 4 should be approximately 2850 bp.
The nucleotide sequence disclosed herein for BR533 4 was searched against the
3 0 GenBank and GeneSeq nucleotide sequence databases using BLASTN/BLASTX and
FASTA search protocols. BR533_4 demonstrated at least some similarity with
sequences
identified as AA043044 (zk53h08.r1 Soares pregnant uterus NbHPU Homo sapiens
cDNA
clone 4865915'), AA160999 {zq41d11.r1 Stratagene hNT neuron (#937233) Homo
sapiens
cDNA clone 632277 5' similar to TR 6854332 6854332 SEMAPHORIN E), AB000220
5
CA 02291477 1999-11-18
WO 98/53065 PCT/US98/10188
(Human mRNA for semaphorin E, complete cds.), F14663 (S.scrofa mRNA; expressed
sequence tag (5'; clone c7b01)), N38844 (yy80d10.s1 Homo sapiens cDNA clone
279859 3'),
Q87442 (Human semaphorin III cDNA), and X85994 (M.musculus mRNA for semaphorin
E). The predicted amino acid sequence disclosed herein for BR533_4 was
searched against
the GenPept and GeneSeq amino acid sequence databases using the BLASTX search
protocol. The predicted BR533_4 protein demonstrated at least some similarity
to
sequences identified as AB00022 (1777307 (Accession #: AB000220) semaphorin E
[Homo
Sapiens]), 871380 (871380 (Accession #: 871380) Human semaphorin III protein),
U38276
(semaphorin III family homolog [Homo sapiens]), and X85994 (MMRNASEME_1
semaphorin E [Mus musculus]). Semaphorins are a diverse family of molecules
that may
provide local signals to specify territories that are not accessible to
growing axons.
Members of the semaphorin gene family appear to act as growth cone guidance
signals
in both invertebrates and vertebrates. Based upon sequence similarity, BR533_4
proteins
and each similar protein or peptide may share at least some activity. The
TopPredII
computer program predicts two potential transmembrane domains within the BR533
4
protein sequence, one centered around amino acid 320 and another around amino
acid
120 of SEQ ID N0:2.
Deposit of Clones
2 0 Clone BR533 4 was deposited on August 22,1996 with the American Type
Culture
Collection (10801 University Boulevard, Manassas, Virginia 20110-2209 U.S.A.)
as an
original deposit under the Budapest Treaty and were given the accession number
ATCC
98146, from which the BR533_4 clone comprising a particular polynucleotide is
obtainable.
All restrictions on the availability to the public of the deposited material
will be
2 5 irrevocably removed upon the granting of the patent, except for the
requirements
specified in 37 C.F.R. ~ 1.808(b), and the term of the deposit will comply
with 37 C.F.R.
~ 1.806. Each clone has been transfected into separate bacterial cells (E.
coli) in this
composite deposit.
The BR533_4 clone can be removed from the vector in which it was deposited by
3 0 performing an EcoRI/NotI digestion (5' site, EcoRI; 3' site, Notl) to
produce the
appropriate fragment for such clone. The BR533_4 clone was deposited in either
the pED6
or pNOTs vector depicted in Figures 1A and 1B, respectively. The pED6dpc2
vector
{"pED6") was derived from pED6dpcl by insertion of a new polylinker to
facilitate
eDNA cloning (Kaufman et al., 1991, Nucleic Acids Res. 19: 4485-4490); the
pNOTs vector
6
CA 02291477 1999-11-18
WO 98/53065 PCTIUS98/10188
was derived from pMT2 (Kaufman et al., 1989, Mol. Cell. Biol. 9: 946-958) by
deletion of
the DHFR sequences, insertion of a new polylinker, and insertion of the M13
origin of
replication in the CIaI site. In some instances, the deposited clone can
become "flipped"
(i.e., in the reverse orientation) in the deposited isolate. In such
instances, the cDNA insert
can still be isolated by digestion with EcoRI and NotI. However, NotI will
then produce
the 5' site and EcoRI will produce the 3' site for placement of the cDNA in
proper
orientation for expression in a suitable vector. The cDNA may also be
expressed from the
vectors in which they were deposited.
Bacterial cells containing a particular clone can be obtained from the
composite
deposit as follows:
An oligonucleotide probe or probes should be designed to the sequence that is
known for that particular clone. This sequence can be derived from the
sequences
provided herein, or from a combination of those sequences. The sequence of an
oligonucleotide probe that was used to isolate or to sequence each full-length
clone is
identified below, and should be most reliable in isolating the clone of
interest.
Clone Probe Sequence
BR533 4 SEQ ID N0:3
2 0 In the sequences listed above which include an N at position 2, that
position is occupied
in preferred probes/primers by a biotinylated phosphoaramidite residue rather
than a
nucleotide (such as , for example, that produced by use of biotin
phosphoramidite (1-
dimethoxytrityloxy-2-(N-biotinyl-4-aminobutyl)-propyl-3-O-(2-cyanoethyl)-(N,N-
diisopropyl)-phosphoramadite) (Glen Research, cat. no. 10-1953)).
2 5 The design of the oligonucleotide probe should preferably follow these
parameters:
(a) It should be designed to an area of the sequence which has the fewest
ambiguous bases ("N's"), if any;
(b) It should be designed to have a T", of approx. 80 ° C (assuming
2° for each
3 0 A or T and 4 degrees for each G or C).
The oligonucieotide should preferably be labeled with g-32P ATP (specific
activity 6000
Ci/mmole} and T4 polynucleotide kinase using commonly employed techniques for
labeling oligonucleotides. Other labeling techniques can also be used.
Unincorporated
label should preferably be removed by gel filtration chromatography or other
established
7
CA 02291477 1999-11-18
WO 98/53065 PCT/iJS98/10188
methods. The amount of radioactivity incorporated into the probe should be
quantitated
by measurement in a scintillation counter. Preferably, specific activity of
the resulting
probe should be approximately 4e+6 dpm/pmole.
The bacterial culture containing the pool of full-length clones should
preferably
be thawed and 100 ltl of the stock used to inoculate a sterile culture flask
containing 25 ml
of sterile L-broth containing ampicillin at 100 ug/ml. The culture should
preferably be
grown to saturation at 37°C, and the saturated culture should
preferably be diluted in
fresh L-broth. Aliquots of these dilutions should preferably be plated to
determine the
dilution and volume which will yield approximately 5000 distinct and well-
separated
colonies on solid bacteriological media containing L-broth containing
ampicillin at 100
ug/ml and agar at 1.5% in a 150 mm petri dish when grown overnight at
37°C. Other
known methods of obtaining distinct, well-separated colonies can also be
employed.
Standard colony hybridization procedures should then be used to transfer the
colonies to nitrocellulose filters and lyse, denature and bake them.
The filter is then preferably incubated at 65°C for 1 hour with gentle
agitation in
6X SSC (20X stock is 175.3 g NaCI/liter, 88.2 g Na citrate/liter, adjusted to
pH 7.0 with
NaOH) containing 0.5% SDS,100 lxg/ml of yeast RNA, and 10 mM EDTA
(approximately
10 mL per 150 mm filter). Preferably, the probe is then added to the
hybridization mix at
a concentration greater than or equal to 1e+6 dpm/mL. The filter is then
preferably
2 0 incubated at 65°C with gentle agitation overnight. The filter is
then preferably washed in
500 mL of 2X SSC/0.5% SDS at room temperature without agitation, preferably
followed
by 500 mL of 2X SSC/0.1% SDS at room temperature with gentle shaking for 15
minutes.
A third wash with 0.1X SSC/0.5% SDS at 65°C for 30 minutes to 1 hour is
optional. The
filter is then preferably dried and subjected to autoradiography for
sufficient time to
2 5 visualize the positives on the X-ray film. Other known hybridization
methods can also
be employed.
The positive colonies are picked, grown in culture, and plasmid DNA isolated
using standard procedures. The clones can then be verified by restriction
analysis,
hybridization analysis, or DNA sequencing.
3 0 Fragments of the proteins of the present invention which are capable of
exhibiting
biological activity are also encompassed by the present invention. Fragments
of the
protein may be in linear form or they may be cyclized using known methods, for
example,
as described in H.U. Saragovi, et al., Bio/Technology 10, 773-778 (1992} and
in R.S.
McDowell, et al., ]. Amer. Chem. Soc.114, 9245-9253 (1992), both of which are
incorporated
8
CA 02291477 1999-11-18
WO 98/53065 PCT/US98/10188
herein by reference. Such fragments may be fused to carrier molecules such as
immunoglobulins for many purposes, including increasing the valency of protein
binding
sites. For example, fragments of the protein may be fused through "linker"
sequences to
the Fc portion of an immunoglobulin. For a bivalent form of the protein, such
a fusion
could be to the Fc portion of an IgG molecule. Other immunoglobulin isotypes
may also
be used to generate such fusions. For example, a protein - IgM fusion would
generate a
decavalent form of the protein of the invention.
The present invention also provides both full-length and mature forms of the
disclosed proteins. The full-length form of the such proteins is identified in
the sequence
listing by translation of the nucleotide sequence of each disclosed clone. The
mature
forms) of such protein may be obtained by expression of the disclosed full-
length
polynucleotide (preferably those deposited with ATCC) in a suitable mammalian
cell or
other host cell. The sequences) of the mature forms) of the protein may also
be
determinable from the amino acid sequence of the full-length form.
The present invention also provides genes corresponding to the polynucleotide
sequences disclosed herein. "Corresponding genes" are the regions of the
genome that
are transcribed to produce the mRNAs from which cDNA polynucleotide seduences
are
derived and may include contiguous regions of the genome necessary for the
regulated
expression of such genes. Corresponding genes may therefore include but are
not limited
2 0 to coding sequences, 5' and 3' untranslated regions, alternatively spliced
exons, introns,
promoters, enhancers, and silencer or suppressor elements. The corresponding
genes can
be isolated in accordance with known methods using the sequence information
disclosed
herein. Such methods include the preparation of probes or primers from the
disclosed
sequence information for identification and/or amplification of genes in
appropriate
2 5 genomic libraries or other sources of genomic materials. An "isolated
gene" is a gene that
has been separated from the adjacent coding sequences, if any, present in the
genome of
the organism from which the gene was isolated.
Organisms that have enhanced, reduced, or modified expression of the genes)
corresponding to the polynucleotide sequences disclosed herein are provided.
The
3 0 desired change in gene expression can be achieved through the use of
antisense
polynucleotides or ribozymes that bind and/or cleave the mRNA transcribed from
the
gene (Albert and Morris,1994, Trends Pharmacol. Sci. 15(7): 250-254; Lavarosky
et al., 1997,
Biochem. MoI. Med. 62(I): 11-22; and Hampel,1998, Prog. Nucleic Acid Res. Mol.
Biol. 58: 1-
39; all of which are incorporated by reference herein). Transgenic animals
that have
9
CA 02291477 1999-11-18
WO 98153065 PCT/US98/10188
multiple copies of the genes) corresponding to the polynucleotide sequences
disclosed
herein, preferably produced by transformation of cells with genetic constructs
that are
stably maintained within the transformed cells and their progeny, are
provided.
Transgenic animals that have modified genetic control regions that increase or
reduce
gene expression levels, or that change temporal or spatial patterns of gene
expression, are
also provided (see European Patent No. 0 649 464 Bl, incorporated by reference
herein).
In addition, organisms are provided in which the genes) corresponding to the
polynucleotide sequences disclosed herein have been partially or completely
inactivated,
through insertion of extraneous sequences into the corresponding genes) or
through
deletion of all or part of the corresponding gene(s). Partial or complete gene
inactivation
can be accomplished through insertion, preferably followed by imprecise
excision, of
transposable elements (Plasterk,1992, Bioessays 14(9): 629-633; Zwaal et
al.,1993, Proc. Natl.
Acad. Sci. USA 90(16): 7431-7435; Clark et al., '1994, Proc. Nati. Acad. Sci.
i.ISA 91(2): 719-722;
all of which are incorporated by reference herein), or through homologous
recombination,
preferably detected by positive/negative genetic selection strategies (Mansour
et al., 1988,
Nature 336: 348-352; U.S. Patent Nos. 5,464,764; 5,487,992; 5,627,059;
5,631,153; 5,614, 396;
~r,6a.6,491; and 5,679,523; all of which are incorporated by reference
h~reXn). These
organisms with altered gene expression are preferably eukaryotes and more
preferably
are mammals. Such organisms are useful for the development of non-human models
for
2 0 the study of disorders involving the corresponding gene(s), and for the
development of
assay systems for the identification of molecules that interact with the
protein products)
of the corresponding gene(s).
Where the protein of the present invention is membrane-bound (e.g., is a
receptor),
the present invention also provides for soluble forms of such protein. In such
forms part
2 5 or all of the intracellular and transmembrane domains of the protein are
deleted such that
the protein is fully secreted from the cell in which it is expressed. The
intracellular and
transmembrane domains of proteins of the invention can be identified in
accordance with
known techniques for determination of such domains from sequence information.
Proteins and protein fragments of the present invention include proteins with
3 0 amino acid sequence lengths that are at least 25%(more preferably at least
50%, and most
preferably at least 75%) of the length of a disclosed protein and have at
least 60% sequence
identity (more preferably, at least 75% identity; most preferably at least 90%
or 95%
identity) with that disclosed protein, where sequence identity is determined
by comparing
the amino acid sequences of the proteins when aligned so as to maximize
overlap and
CA 02291477 1999-11-18
WO 98/53065 PCTIUS98/10188
identity while minimizing sequence gaps. Also included in the present
invention are
proteins and protein fragments that contain a segment preferably comprising 8
or more
(more preferably 20 or more, most preferably 30 or more) contiguous amino
acids that
shares at least 75% sequence identity (more preferably, at least 85% identity;
most
preferably at least 95% identity) with any such segment of any of the
disclosed proteins.
Species homologues of the disclosed polynucleotides and proteins are also
provided by the present invention. As used herein, a "species homologue" is a
protein or
polynucleotide with a different species of origin from that of a given protein
or
polynucleotide, but with significant sequence similarity to the given protein
or
polynucleotide. Preferably, polynucleotide species homologues have at least
60% sequence
identity (more preferably, at least 75% identity; most preferably at least 90%
identity) with
the given polynucleotide, and protein species homologues have at least 30%
sequence
identity (more preferably, at least 45% identity; most preferably at least 60%
identity) with
the given protein, where sequence identity is determined by comparing the
nucleotide
sequences of the polynucleotides or the amino acid sequences of the proteins
when
aligned so as to maximize overlap aizd irier.tity v,-hile mirin~izing sedvence
gaps. Sper~ie:
homologues may be isolated and identified by making suitable probes or primers
from
the sequences provided herein and screening a suitable nucleic acid source
from the
desired species. Preferably, species homologues are those isolated from
mammalian
2 0 species. Most preferably, species homologues are those isolated from
certain mammalian
species such as, for example, Pan troglodytes, Gorilla gorilla, Pongo
pygmaeus, Hylobates
concolor, Macaca mulatto, Pnpio papio, Papio hamadryas, CercopitYtecus
aethiops, Cebus eapucinus,
Aotus trivirgatus, Sanguinus Oedipus, Microcebccs murinces, Mus musculus,
Rattus norvegicus,
Cricetulus griseus, Fetis catus, Mustela vison, Cants familiaris, Oryctolagus
cuniculus, Bos taurus,
2 5 Ovis cries, Sus scrota, and Equics caballtes, for which genetic maps have
been created
allowing the identification of syntenic relationships between the genomic
organization of
genes in one species and the genomic organization of the related genes in
another species
(O'Brien and Seuanez, 1988, Ann. Rev. Genet. 22: 323-351; O'Brien et aL, 1993,
Nature
Genetics 3:103-112; johansson et al., 1995, Genomics 25: 682-690; Lyons et
al., 1997, Nature
3 0 Genetics 15: 47-56; O'Brien et al.,1997, Trends in Genetics 13(10): 393-
399; Carver and Stubbs,
1997, Genome Research 7:1123-1137; all of which are incorporated by reference
herein).
The invention also encompasses allelic variants of the disclosed
polynucleotides
or proteins; that is, naturally-occurring alternative forms of the isolated
polynucleotides
11
CA 02291477 1999-11-18
WO 98153065 PCTIUS98/10188
which also encode proteins which are identical or have significantly similar
sequences to
those encoded by the disclosed polynucleotides. Preferably, allelic variants
have at least
60% sequence identity {more preferably, at least 75% identity; most preferably
at least 90%
identity) with the given polynucleotide, where sequence identity is determined
by
compat~ing the nucleotide sequences of the polynucleotides when aligned so as
to maximize
overlap and identity while minimizing sequence gaps. Allelic variants may be
isolated and
identified by making suitable probes or primers from the sequences provided
herein and
screening a suitable nucleic acid source from individuals of the appropriate
species.
The invention also includes polynucleotides with sequences complementary to
those of the polynucleotides disclosed herein.
The present invention also includes polynucleotides that hybridize under
reduced
stringency conditions, more preferably stringent conditions, and most
preferably highly
stringent conditions, to polynucleotides described herein. Examples of
stringency
conditions are shov:m in the table below: highly stringent conditions are
those that are at
least as stringeW as, for example, conditions A-F; stringent conditions are at
least as
stringent as, for ee:a:nple, cor< iitions G--T.; and.reduced stringency
condition~ are at least
as stringent as, for example, conditions M-R.
12
CA 02291477 1999-11-18
WO 98153065 PCT/US98/10188
StringencyPolynucleotideHybrid Hybridization TemperatureWash
ConditionHybrid Length and Temperature
(bp)$ Buffer' and Buffer'
A DNA:DNA ~ 50 65C; lxSSC -or- 65C; 0.3xSSC
42C; lxSSC, 50% formamide
B DNA:DNA <50 TR*; lxSSC Ta*; lxSSC
C DNA:RNA z 50 67C; lxSSC -or- 67C; 0.3xSSC
45C; lxSSC, 50% formamide
D DNA:RNA <50 T"*; lxSSC Tp*; lxSSC
E RNA:RNA >_ 50 70C; lxSSC -or- 70C; 0.3xSSC
50C; lxSSC, 50% formamide
F RNA:RNA <50 T,*; lxSSC TF*; lxSSC
G DNA:DNA z 50 65C; 4xSSC -or- 65C; lxSSC
42C; 4xSSC, 50% formamide
H DNA:DNA <50 TH*; 4xSSC Tt,*; 4xSSC
I DNA:RNA - 50 67C; 4xSSC -or- 67C; lxSSC
45C; 4xSSC, 50% formamide
J DNA:RNA <50 ' T~*; 4xSSC T~*; 4xSSC
I
K RNA:RNA ! a 70C; 4xSSC-or- 67C; lxSSC
50 50"C; 4xSS'" 50%
formamide
L RNA:RNA <50 T~.'; 2xSSC T~*; 2xSSC
M DNA:DNA ~ 50 SOC; 4xSSC -or- 50C; 2xSSC
40C; 6xSSC, 50% formamide
N DNA:DNA <50 T,~*; 6xSSC TN*; 6xSSC
O DNA:RNA ~ 50 55C; 4xSSC -or- 55C; 2xSSC
42C; 6xSSC, 50% formamide
P DNA:RNA <50 T,,*; 6xSSC T,~*; 6xSSC
Q RNA:RNA >_ 50 60C; 4xSSC -or- 60C; 2xSSC
45C; 6xSSC, 50% formamide
2 R RNA:RNA <50 TR*; 4xSSC TH*; 4xSSC
0
$: The hybrid length is that anticipated for the hybridized regions) of the
hybridizing polynucleotides. When
hybridizing a polynucleotide to a target polynucleotide of unknown sequence,
the hybrid length is assumed
to be that of the hybridizing polynucleotide. When polynucleotides of known
sequence are hybridized, the
2 5 hybrid length can be determined by aligning the sequences of the
polynucleotides and identifying the region
or regions of optimal sequence complementarity.
': SSPE (lxSSPE is 0.15M NaCI, lOmM NaH,POa, and 1.25mM EDTA, pH 7.4) can be
substituted for SSC
{lxSSC is O.15M NaCI and l5mM sodium citrate) in the hybridization and wash
buffers; washes are
performed for 15 minutes after hybridization is complete.
3 0 *TB - TR: The hybridization temperature for hybrids anticipated to be less
than 50 base pairs in length should
be 5-10°C less than the melting temperature (Tm) of the hybrid, where
Tm is determined according to the
following equations. For hybrids less than 18 base pairs in length,
Tm(°C) = 2(# of A + T bases) + 4(# of G +
C bases). For hybrids between 18 and 49 base pairs in length, Tm(°C) =
81.5 + 16.6(log~o[Na']) + 0.41(%G+C)
(600/N), where N is the number of bases in the hybrid, and [Na'] is the
concentration of sodium ions in the
3 5 hybridization buffer ([Na'] for lxSSC = 0.165 M).
13
CA 02291477 1999-11-18
WO 98/53065 PCT/US98/10188
Additional examples of stringency conditions for polynucleotide hybridization
are
provided in Sambrook, J., E.F. Fritsch, and T. Maniatis, 1989, Molecular
Cloning: A
Laboratnn~ Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor,
NY,
chapters 9 and 11, and Current Protocols in Molecular Biolog~~,1995, F.M.
Ausubel et al., eds.,
John Wiley & Sons, Inc., sections 2.10 and 6.3-6.4, incorporated herein by
reference.
Preferably, each such hybridizing polynucleotide has a length that is at least
25%(more preferably at least 50%, and most preferably at least 75%) of the
length of the
polynucleotide of the present invention to which it hybridizes, and has at
least 60%
sequence identity (more preferably, at least 75% identity; most preferably at
least 90% or
95% identity) with the polynucleotide of the present invention to which it
hybridizes,
where sequence identity is determined by comparing the sequences of the
hybridizing
polynucleotides when aligned so as to maximize overlap and identity while
minimizing
sequence gaps.
The isolated polynucleotide of the invention may be operably linked to an
expression control sequence such as the pMT2 or pED expression vectors
disclosed in
Kaufman et al., Nucleic Acids Res. 19, 4485-4490 (1991), in order to produce
the protein
recombinantly. Many suitable expression control sequences are known in the
art. General
methods of expressing recombinant proteins are also known and are exemplified
in R.
Kaufman, Methods in Enzymology 185, 537-566 (1990). As defined herein
"operably
2 0 linked" means that the isolated polynucleotide of the invention and an
expression control
sequence are situated within a vector or cell in such a way that the protein
is expressed
by a host cell which has been transformed (transfected) with the ligated
polynucleotide/expression control sequence.
A number of types of cells may act as suitable host cells for expression of
the
2 5 protein. Mammalian host cells include, for example, monkey COS cells,
Chinese Hamster
Ovary (CHO) cells, human kidney 293 cells, human epidermal A431 cells, human
Co1o205
cells, 3T3 cells, CV-1 cells, other transformed primate cell lines, normal
diploid cells, cell
strains derived from in vitro culture of primary tissue, primary explants,
HeLa cells,
mouse L cells, BHK, HL-60, U937, HaK or Jurkat cells.
3 0 Alternatively, it may be possible to produce the protein in lower
eukaryotes such
as yeast or in prokaryotes such as bacteria. Potentially suitable yeast
strains include
Saccharomyces cerevisiae, Schizosaccharomyces pombe, KIuyveromyces strains,
Candida, or any
yeast strain capable of expressing heterologous proteins. Potentially suitable
bacterial
strains include Escherichia coli, BaciIhes subtilis, Salmonella typhimurium,
or any bacterial
14
CA 02291477 1999-11-18
WO 98153065 PCT/US98I10188
strain capable of expressing heterologous proteins. If the protein is made in
yeast or
bacteria, it may be necessary to modify the protein produced therein, for
example by
phosphorylation or glycosylation of the appropriate sites, in order to obtain
the functional
protein. Such covalent attachments may be accomplished using known chemical or
enzymatic methods.
The protein may also be produced by operably linking the isolated
polynucleotide
of the invention to suitable control sequences in one or more insect
expression vectors,
and employing an insect expression system. Materials and methods for
baculovirus/insect cell expression systems are commercially available in kit
form from,
e.g., invitrogen, San Diego, California, U.S.A. {the MaxBac~ kit), and such
methods are
well known in the art, as described in Summers and Smith, Texas Agricultural
Experiment
Station Bulletin No. 1555 (1987), incorporated herein by reference. As used
herein, an
insect cell capable of expressing a polynucleotide of the present invention is
"transformed."
The protein of the invention may be prepared by culturing transformed host
cells
under culture conditions suitable to express the recombinant protein. The
resulting
expressed protein may then be purified from such culture (i.e., from culture
medium or
cell extracts) using known purification processes, such as gel filtration and
ion exchange
chromatography. The purification of the protein may also include an affinity
column
2 0 containing agents which will bind to the protein; one or more column steps
over such
affinity resins as concanavalin A-agarose, heparin-toyopearl~ or Cibacrom blue
3GA
Sepharose~; one or more steps involving hydrophobic interaction chromatography
using
such resins as phenyl ether, butyl ether, or propyl ether; or immunoaffinity
chromatography.
2 5 Alternatively, the protein of the invention may also be expressed in a
form which
will facilitate purification. For example, it may be expressed as a fusion
protein, such as
those of maltose binding protein (MBP), glutathione-S-transferase (GST) or
thioredoxin
(TRX). Kits for expression and purification of such fusion proteins are
commercially
available from New England BioLab (Beverly, MA), Pharmacia (Piscataway, N))
and
3 0 InVitrogen, respectively. The protein can also be tagged with an epitope
and
subsequently purified by using a specific antibody directed to such epitope.
One such
epitope ("Flag") is commercially available from Kodak (New Haven, CT).
Finally, one or more reverse-phase high performance liquid chromatography (RP-
HPLC) steps employing hydrophobic RP-HPLC media, e.g., silica gel having
pendant
CA 02291477 1999-11-18
WO 98/530b5 PCT/US98/10188
methyl or other aliphatic groups, can be employed to further purify the
protein. Some or
all of the foregoing purification steps, in various combinations, can also be
employed to
provide a substantially homogeneous isolated recombinant protein. The protein
thus
purified is substantially free of other mammalian proteins and is defined in
accordance
with the present invention as an "isolated protein."
The protein of the invention may also be expressed as a product of transgenic
animals, e.g., as a component of the milk of transgenic cows, goats, pigs, or
sheep which
are characterized by somatic or germ cells containing a nucleotide sequence
encoding the
protein.
The protein may also be produced by known conventional chemical synthesis.
Methods for constructing the proteins of the present invention by synthetic
means are
known to those skilled in the art. The synthetically-constructed protein
sequences, by
virtue of sharing primary, secondary or tertiary structural and/or
conformational
characteristics with proteins may possess biological properties in common
therewith,
including protein activity. Thus, they may be employed as biologically active
or
immunological substitutes for natural, purified proteins in screening of
therapeutic
compounds and in immunological processes for the development of antibodies.
The proteins provided herein also include proteins characterized by amino acid
sequences similar to those of purified proteins but into which modification
are naturally
2 0 provided or deliberately engineered. For example, modifications in the
peptide or DNA
sequences can be made by those skilled in the art using known techniques.
Modifications
of interest in the protein sequences may include the alteration, substitution,
replacement,
insertion or deletion of a selected amino acid residue in the coding sequence.
For
example, one or more of the cysteine residues may be deleted or replaced with
another
2 5 amino acid to alter the conformation of the molecule. Techniques for such
alteration,
substitution, replacement, insertion or deletion are well known to those
skilled in the art
(see, e.g., U.S. Patent No. 4,518,584). Preferably, such alteration,
substitution, replacement,
insertion or deletion retains the desired activity of the protein.
Other fragments and derivatives of the sequences of proteins which would be
3 0 expected to retain protein activity in whole or in part and may thus be
useful for screening
or other immunological methodologies may also be easily made by those skilled
in the art
given the disclosures herein. Such modifications are believed to be
encompassed by the
present invention.
16
CA 02291477 1999-11-18
WO 98/53065 PCT/US98/10188
USES AND BIOLOGICAL ACTIVITY
The polynucleotides and proteins of the present invention are expected to
exhibit
one or more of the uses or biological activities (including those associated
with assays
cited herein) identified below. Uses or activities described for proteins of
the present
invention may be provided by administration or use of such proteins or by
administration
or use of polynucleotides encoding such proteins (such as, for example, in
gene therapies
or vectors suitable for introduction of DNA).
Research Uses and Utilities
The polynucleotides provided by the present invention can be used by the
research
community for various purposes. The polynucleotides can be used to express
recombinant protein for analysis, characterization or therapeutic use; as
markers for
tissues in which the corresponding protein is preferentially expressed (either
constitutively or at a particular stage of tissue differentiation or
development or in disease
states); as molecular weight markers on Southern gels; as chromosome markers
or tags
(when labeled) to identify chromosomes or to map related gene positions; to
compare
with endogenous DNA sequences in patients to identify potential genetic
disorders; as
probes to hybridize and thus discover novel, related DNA sequences; as a
source of
information to derive PCR primers for genetic fingerprinting; as a probe to
"subtract-out"
2 0 known sequences in the process of discovering other novel polynucleotides;
for selecting
and making oligomers for attachment to a "gene chip" or other support,
including for
examination of expression patterns; to raise anti-protein antibodies using DNA
immunization techniques; and as an antigen to raise anti-DNA antibodies or
elicit another
immune response. Where the polynucleotide encodes a protein which binds or
potentially
2 5 binds to another protein (such as, for example, in a receptor-ligand
interaction), the
polynucleotide can also be used in interaction trap assays (such as, for
example, those
described in Gyuris et al., 1993, Cell 75: 791-803 and in Rossi et al., 1997,
Proc. NatI. Acad.
Sci. LISA 94: 8405-8410, all of which are incorporated by reference herein) to
identify
polynucleotides encoding the other protein with which binding occurs or to
identify
3 0 inhibitors of the binding interaction.
The proteins provided by the present invention can similarly be used in assay
to
determine biological activity, including in a panel of multiple proteins for
high-
throughput screening; to raise antibodies or to elicit another immune
response; as a
reagent (including the labeled reagent) in assays designed to quantitatively
determine
17
CA 02291477 1999-11-18
WO 98153065 PCT/US98110188
levels of the protein (or its receptor) in biological fluids; as markers for
tissues in which
the corresponding protein is preferentially expressed (either constitutively
or at a
particular stage of tissue differentiation or development or in a disease
state); and, of
course, to isolate correlative receptors or ligands. Where the protein binds
or potentially
binds to another protein (such as, for example, in a receptor-ligand
interaction), the
protein can be used to identify the other protein with which binding occurs or
to identify
inhibitors of the binding interaction. Proteins involved in these binding
interactions can
also be used to screen for peptide or small molecule inhibitors or agonists of
the binding
interaction.
Any or all of these research utilities are capable of being developed into
reagent
grade or kit format for commercialization as research products.
Methods for performing the uses listed above are well known to those skilled
in
the art. References disclosing such methods include without limitation
"Molecular
Cloning: A Laboratory Manual", 2d ed., Cold Spring Harbor Laboratory Press,
Sambrook,
J., E.F. Fritsch and T. Maniatis eds., 1989, and "Methods in Enzymology: Guide
to
Molecular Cloning Techniques", Academic Press, Berger, S.L. and A.R. Kimmel
eds.,1987.
Nutritional Uses
Polynucleotides and proteins of the present invention can also be used as
2 0 nutritional sources or supplements. Such uses include without limitation
use as a protein
or amino acid supplement, use as a carbon source, use as a nitrogen source and
use as a
source of carbohydrate. In such cases the protein or polynucleotide of the
invention can
be added to the feed of a particular organism or can be administered as a
separate solid
or liquid preparation, such as in the form of powder, pills, solutions,
suspensions or
2 5 capsules. In the case of microorganisms, the protein or polynucleotide of
the invention
can be added to the medium in or on which the microorganism is cultured.
Cytokine and Cell Proliferation/Differentiation Activity
A protein of the present invention may exhibit cytokine, cell proliferation
(either
3 0 inducing or inhibiting) or cell differentiation (either inducing or
inhibiting) activity or may
induce production of other cytokines in certain cell populations. Many protein
factors
discovered to date, including all known cytokines, have exhibited activity in
one or more
factor dependent cell proliferation assays, and hence the assays serve as a
convenient
confirmation of cytokine activity. The activity of a protein of the present
invention is
18
CA 02291477 1999-11-18
WO 98/53065 PCT/US98/10188
evidenced by any one of a number of routine factor dependent cell
proliferation assays
for cell lines including, without limitation, 32D, DA2, DA1G, T10, B9, B9/11,
BaF3,
MC9/G, M+ (preB M+), 2E8, RBS, DA1, 123, T1165, HT2, CTLL2, TF-1, Mo7e and
CMK.
The activity of a protein of the invention may, among other means, be measured
by the following methods:
Assays for T-cell or thymocyte proliferation include without limitation those
described in: Current Protocols in Immunology, Ed by J. E. Coligan, A.M.
Kruisbeek, D.H.
Margulies, E.M. Shevach, W Strober, Pub. Greene Publishing Associates and
Wiley-
Interscience (Chapter 3, In Vitro assays for Mouse Lymphocyte Function 3.1-
3.19; Chapter
7, Immunologic studies in Humans}; Takai et al., J. Immunol. 137:3494-3500,
1986;
Bertagnolli et al., J. immunol. 145:1706-1712, 1990; Bertagnolli et al.,
Cellular Immunology
133:327-341, 1991; Bertagnolli, et al., J. Immunol. 149:3778-3783, 1992;
Bowman et al., J.
Immunol. 152: 1756-1761, 1994.
Assays for cytokine production and/or proliferation of spleen cells, lymph
node
cells or thymocytes include, without limitation, those described in:
Polyclonal T cell
stimulation, Kruisbeek, A.M. and Shevach, E.M. In Current Protocols in
Immunology. J.E.e.a.
Coligan eds. Vol 1 pp. 3.12.1-3.12.14, John Wiley and Sons, Toronto. 1994; and
Measurement of mouse and human Interferon y, Schreiber, R.D. In Current
Protocols in
2 0 Immunology. J.E.e.a. Coligan eds. Vol 1 pp. 6.8.1-6.8.8, John Wiley and
Sons, Toronto.1994.
Assays for proliferation and differentiation of hematopoietic and
lymphopoietic
cells include, without limitation, those described in: Measurement of Human
and Murine
Interleukin 2 and Interleukin 4, Bottomly, K., Davis, L.S. and Lipsky, P.E. In
Current
Protocols in Immunology. J.E.e.a. Coligan eds. Vol 1 pp. 6.3.1-6.3.12, John
Wiley and Sons,
2 5 Toronto. 1991; deVries et al., J. Exp. Med. 173:1205-1211, 1991; Moreau et
al., Nature
336:690-692, 1988; Greenberger et al., Proc. Natl. Acad. Sci. U.S.A. 80:2931-
2938, 1983;
Measurement of mouse and human interleukin 6 - Nordan, R. In Current Protocols
in
Immunology. J.E.e.a. Coligan eds. Vol 1 pp. 6.6.1-6.6.5, John Wiley and Sons,
Toronto. 1991;
Smith et al., Proc. Natl. Acad. Sci. U.S.A. 83:1857-1861, 1986; Measurement of
human
3 0 Interleukin 11- Bennett, F., Giannotti, J., Clark, S.C. and Turner, K. J.
In Current Protocols
in Immunology. J.E.e.a. Coligan eds. Vol 1 pp. 6.15.1 John Wiley and Sons,
Toronto. 1991;
Measurement of mouse and human Interleukin 9 - Ciarletta, A., Giannotti, J.,
Clark, S.C.
and Turner, K.J. In Current Protocols in Immunology. J.E.e.a. Coligan eds. Vol
1 pp. 6.13.1,
john Wiley and Sons, Toronto. 1991.
19
CA 02291477 1999-11-18
WO 98/530b5 PCT/CJS98/10188
Assays for T-cell clone responses to antigens (which will identify, among
others,
proteins that affect APC-T cell interactions as well as direct T-cell effects
by measuring
proliferation and cytokine production) include, without limitation, those
described in:
Current Protocols in Immunology, Ed by J. E. Coligan, A.M. Kruisbeek, D.H.
Margulies,
E.M. Shevach, W Strober, Pub. Greene Publishing Associates and Wiley-
Interscience
(Chapter 3, In Vitro assays for Mouse Lymphocyte Function; Chapter 6,
Cytokines and
their cellular receptors; Chapter 7, Immunologic studies in Humans);
Weinberger et al.,
Proc. Natl. Acad. Sci. USA 77:6091-6095, 1980; Weinberger et al., Eur. J.
Immun.
11:405-411, 1981; Takai et al., J. Immunol. 137:3494-3500, 1986; Takai et al.,
J. Immunol.
140:508-512, 1988.
Immune Stimulatin og r Suppressing Activity
A protein of the present invention may also exhibit immune stimulating or
immune suppressing activity, including without limitation the activities for
which assays
are described herein. A protein may be useful in the treatment of various
immune
deficiencies and disorders (including severe combined immunodeficiency
(SCID}), e.g.,
in regulating (up or down) growth and proliferation of T and/or B lymphocytes,
as well
as effecting the cytolytic activity of NK cells arid other cell populations.
These immune
deficiencies may be genetic or be caused by viral (e.g., HIV) as well as
bacterial or fungal
2 0 infections, or may result from autoimmune disorders. More specifically,
infectious
diseases causes by viral, bacterial, fungal or other infection may be
treatable using a
protein of the present invention, including infections by HIV, hepatitis
viruses,
herpesviruses, mycobacteria, Leishmania spp., malaria spp. and various fungal
infections
such as candidiasis. Of course, in this regard, a protein of the present
invention may also
2 5 be useful where a boost to the immune system generally may be desirable,
i.e., in the
treatment of cancer.
Autoimmune disorders which may be treated using a protein of the present
invention include, for example, connective tissue disease, multiple sclerosis,
systemic
lupus erythematosus, rheumatoid arthritis, autoimmune pulmonary inflammation,
3 0 Guillain-Barre syndrome, autoimmune thyroiditis, insulin dependent
diabetes mellitis,
myasthenia gravis, graft-versus-host disease and autoimmune inflammatory eye
disease.
Such a protein of the present invention may also to be useful in the treatment
of allergic
reactions and conditions, such as asthma (particularly allergic asthma) or
other respiratory
problems. Other conditions, in which immune suppression is desired (including,
for
CA 02291477 1999-11-18
WO 98153065 PCT/US98110188
example, organ transplantation), may also be treatable using a protein of the
present
invention.
Using the proteins of the invention it may also be possible to immune
responses,
in a number of ways. Down regulation may be in the form of inhibiting or
blocking an
immune response already in progress or may involve preventing the induction of
an
immune response. The functions of activated T cells may be inhibited by
suppressing T
cell responses or by inducing specific tolerance in T cells, or both.
Immunosuppression
of T cell responses is generally an active, non-antigen-specific, process
which requires
continuous exposure of the T cells to the suppressive agent. Tolerance, which
involves
inducing non-responsiveness or anergy in T cells, is distinguishable from
immunosuppression in that it is generally antigen-specific and persists after
exposure to
the tolerizing agent has ceased. Operationally, tolerance can be demonstrated
by the lack
of a T cell response upon reexposure to specific antigen in the absence of the
tolerizing
agent.
Down regulating or preventing one or more antigen functions (including without
limitation B lymphocyte antigen functions (such as , for example, B7)), e.g.,
preventing
high level lymphokine synthesis by activated T cells, will be useful in
situations of tissue,
skin and organ transplantation and in graft-versus-host disease (GVHD). For
example,
blockage of T cell function should result in reduced tissue destruction in
tissue
2 0 transplantation. Typically, in tissue transplants, rejection of the
transplant is initiated
through its recognition as foreign by T cells, followed by an immune reaction
that destroys
the transplant. The administration of a molecule which inhibits or blocks
interaction of
a B7 lymphocyte antigen with its natural ligand(s) on immune cells (such as a
soluble,
monomeric form of a peptide having B7-2 activity alone or in conjunction with
a
2 5 monomeric form of a peptide having an activity of another B lymphocyte
antigen (e.g., B7-
1, B7-3) or blocking antibody), prior to transplantation can lead to the
binding of the
molecule to the natural ligand(s) on the immune cells without transmitting the
corresponding costimulatory signal. Blocking B lymphocyte antigen function in
this
matter prevents cytokine synthesis by immune cells, such as T cells, and thus
acts as an
3 0 immunosuppressant. Moreover, the lack of costimulation may also be
sufficient to
anergize the T cells, thereby inducing tolerance in a subject. Induction of
long-term
tolerance by B lymphocyte antigen-blocking reagents may avoid the necessity of
repeated
administration of these blocking reagents. To achieve sufficient
immunosuppression or
21
CA 02291477 1999-11-18
WO 98/53065 PCT/US98110188
tolerance in a subject, it may also be necessary to block the function of a
combination of
B lymphocyte antigens.
The efficacy of particular blocking reagents in preventing organ transplant
rejection or GVHD can be assessed using animal models that are predictive of
efficacy in
humans. Examples of appropriate systems which can be used include allogeneic
cardiac
grafts in rats and xenogeneic pancreatic islet cell grafts in mice, both of
which have been
used to examine the immunosuppressive effects of CTLA4Ig fusion proteins in
vivo as
described in Lenschow et aL, Science 257:789-792 (1992) and Turka et al.,
Proc. Natl. Acad.
Sci USA, 89:11102-11105 (1992). In addition, murine models of GVHD (see Paul
ed.,
Fundamental Immunology, Raven Press, New York, 1989, pp. 846-847) can be used
to
determine the effect of blocking B lymphocyte antigen function in vivo on the
development
of that disease.
Blocking antigen function may also be therapeutically useful for treating
autoimmune diseases. Many autoimmune disorders are the result of inappropriate
activation of T cells that are reactive against self tissue and which promote
the production
of cytokines and autoantibodies involved in the pathology of the diseases.
Preventing the
activation of autoreactive T cells may- reduce or eliminate disease symptoms.
Administration of reagents which block costimulation of T cells by disrupting
receptor:ligand interactions of B lymphocyte antigens can be used to inhibit T
cell
2 0 activation and prevent production of autoantibodies or T cell-derived
cytokines which
may be involved in the disease process. Additionally, blocking reagents may
induce
antigen-specific tolerance of autoreactive T cells which could lead to long-
term relief from
the disease. The efficacy of blocking reagents in preventing or alleviating
autoimmune
disorders can be determined using a number of well-characterized animal models
of
2 5 human autoimmune diseases. Examples include murine experimental autoimmune
encephalitis, systemic lupus erythmatosis in MRL/Ipr/Ipr mice or NZB hybrid
mice,
murine autoimmune collagen arthritis, diabetes mellitus in NOD mice and BB
rats, and
murine experimental myasthenia gravis (see Paul ed., Fundamental Immunology,
Raven
Press, New York, 1989, pp. 840-856).
3 0 Upregulation of an antigen function (preferably a B lymphocyte antigen
function),
as a means of up regulating immune responses, may also be useful in therapy.
Upregulation of immune responses may be in the form of enhancing an existing
immune
response or eliciting an initial immune response. For example, enhancing an
immune
response through stimulating B lymphocyte antigen function may be useful in
cases of
22
CA 02291477 1999-11-18
WO 98153065 PCT/US98110188
viral infection. In addition, systemic viral diseases such as influenza, the
common cold,
and encephalitis might be alleviated by the administration of stimulatory
forms of B
lymphocyte antigens systemically.
Alternatively, anti-viral immune responses may be enhanced in an infected
patient
by removing T cells from the patient, costimulating the T cells in vitro with
viral antigen-
pulsed APCs either expressing a peptide of the present invention or together
with a
stimulatory form of a soluble peptide of the present invention and
reintroducing the in
vitro activated T cells into the patient. Another method of enhancing anti-
viral immune
responses would be to isolate infected cells from a patient, transfect them
with a nucleic
acid encoding a protein of the present invention as described herein such that
the cells
express all or a portion of the protein on their surface, and reintroduce the
transfected
cells into the patient. The infected cells would now be capable of delivering
a
costimulatory signal to, and thereby activate, T cells in vivo.
In another application, up regulation or enhancement of antigen function
(preferably B lymphocyte antigen function) may be useful in the induction of
tumor
immunity. Tumor cells (e.g., sarcoma, melanoma, lymphoma, leukemia,
neuroblastoma,
carcinoma) transfected with a nucleic acid encoding at least one peptide of
the present
invention can be administered to a subject to overcome tumor-specific
tolerance in the
subject. If desired, the tumor cell can be transfected to express a
combination of peptides.
2 0 For example, tumor cells obtained from a patient can be transfected ex
vivo with an
expression vector directing the expression of a peptide having B7-2-like
activity alone, or
in conjunction with a peptide having B7-1-like activity and/or B7-3-like
activity. The
transfected tumor cells are returned to the patient to result in expression of
the peptides
on the surface of the transfected cell. Alternatively, gene therapy techniques
can be used
2 5 to target a tumor cell for transfection in vivo.
The presence of the peptide of the present invention having the activity of a
B
lymphocyte antigens} on the surface of the tumor cell provides the necessary
costimulation signal to T cells to induce a T cell mediated immune response
against the
transfected tumor cells. In addition, tumor cells which lack MHC class I or
MHC class II
3 0 molecules, or which fail to reexpress sufficient amounts of MHC class I or
MHC class II
molecules, can be transfected with nucleic acid encoding all or a portion of
(e.g., a
cytoplasmic-domain truncated portion) of an MHC class I a chain protein and
~i~
microglobulin protein or an MHC class II a chain protein and an MHC class II
(3 chain
protein to thereby express MHC class I or MHC class II proteins on the cell
surface.
23
CA 02291477 1999-11-18
WO 98/53065 PCT/US98/10188
Expression of the appropriate class I or class II MHC in conjunction with a
peptide having
the activity of a B lymphocyte antigen (e.g., B7-1, B7-2, B7-3) induces a T
cell mediated
immune response against the transfected tumor cell. Optionally, a gene
encoding an
antisense construct which blocks expression of an MHC class II associated
protein, such
as the invariant chain, can also be cotransfected with a DNA encoding a
peptide having
the activity of a B lymphocyte antigen to promote presentation of tumor
associated
antigens and induce tumor specific immunity. Thus, the induction of a T cell
mediated
immune response in a human subject may be sufficient to overcome tumor-
specific
tolerance in the subject.
The activity of a protein of the invention may, among other means, be measured
by the following methods:
Suitable assays for thymocyte or splenocyte cytotoxicity include, without
limitation, those described in: Current Protocols in Immunology, Ed by J. E.
Coligan, A.M.
Kruisbeek, D.H. Margulies, E.M. Shevach, W Strober, Pub. Greene Publishing
Associates
and Wiley-Interscience (Chapter 3, In Vitro assays for Mouse Lymphocyte
Function 3.1-
3.19; Chapter 7, Immunologic studies in Humans); Herrmann et al., Proc. Natl.
Acad. Sci.
USA 78:2488-2492, 1981; Herrmann et al., J. Immunol. 128:1968-1974, 1982;
Handa et al.,
J. Immunol. 135:1564-1572,1985; Takai et al., J. Immunol. 137:3494-3500,1986;
Takai et al.,
J. Immunol. 140:508-512, 1988; Herrmann et al., Proc. Natl. Acad. Sci. USA
78:2488-2492,
2 0 1981; Herrmann et al., J. Immunol. 128:1968-1974, 1982; Handa et al., J.
Immunol.
135:1564-1572, 1985; Takai et al., J. Immunol. 137:3494-3500, 1986; Bowmanet
al., J.
Virology 61:1992-1998; Takai et al., J. Immunol. 140:508-512, 1988;
Bertagnolli et al.,
Cellular Immunology 133:327-341, 1991; Brown et al., J. Immunol. 153:3079-
3092, 1994.
Assays for T-cell-dependent immunoglobulin responses and isotype switching
2 5 (which will identify, among others, proteins that modulate T-cell
dependent antibody
responses and that affect Thl/Th2 profiles) include, without limitation, those
described
in: Maliszewski, J. Immunol. 144:3028-3033, 1990; and Assays for B cell
function: In vitro
antibody production, Mond, J.J. and Brunswick, M. In Current Protocols in
Immunology.
J.E.e.a. Coligan eds. Vol 1 pp. 3.8.1-3.8.16, John Wiley and Sons, Toronto.
1994.
3 0 Mixed lymphocyte reaction (MLR) assays (which will identify, among others,
proteins that generate predominantly Th1 and CTL responses) include, without
limitation,
those described in: Current Protocols in Immunology, Ed by J. E. Coligan, A.M.
Kruisbeek,
D.H. Margulies, E.M. Shevach, W Strober, Pub. Greene Publishing Associates and
Wiley-
Interscience (Chapter 3, In Vitro assays for Mouse Lymphocyte Function 3.1-
3.19; Chapter
24
CA 02291477 1999-11-18
WO 98/53065 PCTIUS98/10188
7, Immunologic studies in Humans); Takai et al., J. Immunol. 137:3494-3500,
1986; Takai
et al., J. Immunol. 140:508-512, 1988; Bertagnolli et al., j. Immunol.
149:3778-3783, 1992.
Dendritic cell-dependent assays (which will identify, among others, proteins
expressed by dendritic cells that activate naive T-cells) include, without
limitation, those
described in: Guery et al., j. Immunol. 134:536-544, 1995; Inaba et al.,
journal of
Experimental Medicine 173:549-559, 1991; Macatonia et al., Journal of
Immunology
154:5071-5079, 1995; Porgador et al., Journal of Experimental Medicine 182:255-
260, 1995;
Nair et al., Journal of Virology 67:4062-4069, 1993; Huang et al., Science
264:961-965,
1994; Macatonia et al., Journal of Experimental Medicine 169:1255-1264, 1989;
Bhardwaj
et al., Journal of Clinical Investigation 94:797-807, 1994; and Inaba et al.,
Journal of
Experimental Medicine 172:631-640, 1990.
Assays for lymphocyte survival/apoptosis (which will identify, among others,
proteins that prevent apoptosis after superantigen induction and proteins that
regulate
lymphocyte homeostasis) include, without limitation, those described in:
Darzynkiewicz
et al., Cytometry 13:795-808,1992; Gorczyca et al., Leukemia 7:659-670,1993;
Gorczyca et
al., Cancer Research 53:1945-1951, 1993; Itoh et al., Cell 66:233-243, 1991;
Zacharchuk,
journal of Immunology 145:4037-4045, 1990; Zamai et al., Cytometry 14:891-897,
1993;
Gorczyca et al., International Journal of Oncology 1:639-648, 1992.
Assays for proteins that influence early steps of T-cell commitment and
2 0 development include, without limitation, those described in: Antica et
al., Blood
84:111-117, 1994; Fine et al., Cellular Immunology 155:111-122, 1994; Galy et
al., Blood
85:2770-2778, 1995; Toki et al., Proc. Nat. Acad Sci. USA 88:7548-7551, 1991.
Hematopoiesis Re ug latin Activity
2 5 A protein of the present invention may be useful in regulation of
hematopoiesis
and, consequently, in the treatment of myeloid or lymphoid cell deficiencies.
Even
marginal biological activity in support of colony forming cells or of factor-
dependent cell
lines indicates involvement in regulating hematopoiesis, e.g. in supporting
the growth and
proliferation of erythroid progenitor cells alone or in combination with other
cytokines,
3 0 thereby indicating utility, for example, in treating various anemias or
for use in
conjunction with irradiation/chemotherapy to stimulate the production of
erythroid
precursors and/or erythroid cells; in supporting the growth and proliferation
of myeloid
cells such as granulocytes and monocytes/macrophages (i.e., traditional CSF
activity)
useful, for example, in conjunction with chemotherapy to prevent or treat
consequent
CA 02291477 1999-11-18
WO 98/53065 PCT/US98/10188
myelo-suppression; in supporting the growth and proliferation of
megakaryocytes and
consequently of platelets thereby allowing prevention or treatment of various
platelet
disorders such as thrombocytopenia, and generally for use in place of or
complimentary
to platelet transfusions; and/or in supporting the growth and proliferation of
hematopoietic stem cells which are capable of maturing to any and all of the
above-
mentioned hematopoietic cells and therefore find therapeutic utility in
various stem cell
disorders (such as those usually treated with transplantation, including,
without
limitation, aplastic anemia and paroxysmal nocturnal hemoglobinuria}, as well
as in
repopulating the stem cell compartment post irradiation/chemotherapy, either
in-vivo or
ex-vivo (i.e., in conjunction with bone marrow transplantation or with
peripheral
progenitor cell transplantation (homologous or heterologous)) as normal cells
or
genetically manipulated for gene therapy.
The activity of a protein of the invention may, among other means, be measured
by the following methods:
Suitable assays for proliferation and differentiation of various hematopoietic
lines
are cited above.
Assays for embryonic stem cell differentiation (which will identify, among
others,
proteins that influence embryonic differentiation hematopoiesis) include,
without
limitation, those described in: Johansson et al. Cellular Biology 15:141-151,
1995; Keller et
2 0 al., Molecular and Cellular Biology 13:473-486, 1993; McClanahan et al.,
Blood
81:2903-2915, 1993.
Assays for stem cell survival and differentiation {which will identify, among
others, proteins that regulate lympho-hematopoiesis) include, without
limitation, those
described in: Methylcellulose colony forming assays, Freshney, M.G. In Culture
of
2 5 Hematopoietic Cells. R.I. Freshney, et aI. eds. Vol pp. 265-268, Wiley-
Liss, Inc., New York,
NY. 1994; Hirayama et al., Proc. Natl. Acad. Sci. USA 89:5907-5911, 1992;
Primitive
hematopoietic colony forming cells with high proliferative potential, McNiece,
LK. and
Briddell, R.A. In Culture of Hematopoietic Cells. R.I. Freshney, et al. eds.
Vol pp. 23-39,
Wiley-Liss, Inc., New York, NY. 1994; Neben et al., Experimental Hematology
22:353-359,
3 0 1994; Cobblestone area forming cell assay, Ploemacher, R.E. In Culture of
Hematopoietic
Cells. R.I. Freshney, et al. eds. Vol pp. 1-21, Wiley-Liss, Inc.., New York,
NY. 1994; Long
term bone marrow cultures in the presence of stromal cells, Spooncer, E.,
Dexter, M. and
Allen, T. In Culture of Hematopoietic Cells. R.I. Freshney, et aI. eds. Vol
pp. 163-179,
Wiley-Liss, Inc., New York, NY. 1994; Long term culture initiating cell assay,
Sutherland,
26
CA 02291477 1999-11-18
WO 98/53065 PCT/US98110188
H.J. In Culture of Hematopoietic Cells. R.I. Freshney, et al. eds. Vol pp. 139-
1b2, Wiley-Liss,
Inc., New York, NY. 1994.
Tissue Growth Activity
A protein of the present invention also may have utility in compositions used
for
bone, cartilage, tendon, ligament and/or nerve tissue growth or regeneration,
as well as
for wound healing and tissue repair and replacement, and in the treatment of
burns,
incisions and ulcers.
A protein of the present invention, which induces cartilage and/or bone growth
in circumstances where bone is not normally formed, has application in the
healing of
bone fractures and cartilage damage or defects in humans and other animals.
Such a
preparation employing a protein of the invention may have prophylactic use in
closed as
well as open fracture reduction and also in the improved fixation of
artificial joints. De
novo bone formation induced by an osteogenic agent contributes to the repair
of
congenital, trauma induced, or oncologic resection induced craniofacial
defects, and also
is useful in cosmetic plastic surgery.
A protein of this invention may also be used in the treatment of periodontal
disease, and in other tooth repair processes. Such agents may provide an
environment
to attract bone-forming cells, stimulate growth of bone-forming cells or
induce
2 0 differentiation of progenitors of bone-forming cells. A protein of the
invention may also
be useful in the treatment of osteoporosis or osteoarthritis, such as through
stimulation
of bone and/or cartilage repair or by blocking inflammation or processes of
tissue
destruction (collagenase activity, osteoclast activity, etc.) mediated by
inflammatory
processes.
2 5 Another category of tissue regeneration activity that may be attributable
to the
protein of the present invention is tendon/ligament formation. A protein of
the present
invention, which induces tendon/ligament-like tissue or other tissue formation
in
circumstances where such tissue is not normally formed, has application in the
healing of
tendon or ligament tears, deformities and other tendon or ligament defects in
humans and
3 0 other animals. Such a preparation employing a tendon/ligament-like tissue
inducing
protein may have prophylactic use in preventing damage to tendon or ligament
tissue, as
well as use in the improved fixation of tendon or ligament to bone or other
tissues, and
in repairing defects to tendon or ligament tissue. De novo tendon/ligament-
like tissue
formation induced by a composition of the present invention contributes to the
repair of
27
CA 02291477 1999-11-18
WO 98153065 PCT/US98/10188
congenital, trauma induced, or other tendon or ligament defects of other
origin, and is also
useful in cosmetic plastic surgery for attachment or repair of tendons or
ligaments. The
compositions of the present invention may provide an environment to attract
tendon- or
ligament-forming cells, stimulate growth of tendon- or ligament-forming cells,
induce
differentiation of progenitors of tendon- or ligament-forming cells, or induce
growth of
tendon/ligament cells or progenitors ex vivo for return in vivo to effect
tissue repair. The
compositions of the invention may also be useful in the treatment of
tendinitis, carpal
tunnel syndrome and other tendon or ligament defects. The compositions may
also
include an appropriate matrix and/or sequestering agent as a carrier as is
well known in
the art.
The protein of the present invention may also be useful for proliferation of
neural
cells and for regeneration of nerve and brain tissue, i.e. for the treatment
of central and
peripheral nervous system diseases and neuropathies, as well as mechanical and
traumatic disorders, which involve degeneration, death or trauma to neural
cells or nerve
tissue. More specifically, a protein may be used in the treatment of diseases
of the
peripheral nervous system, such as peripheral nerve injuries, peripheral
neuropathy and
localized neuropathies, and central nervous system diseases, such as
Alzheimer's,
Parkinson's disease, Huntington's disease, amyotrophic lateral sclerosis, and
Shy-Drager
syndrome. Further conditions which may be treated in accordance with the
present
2 0 invention include mechanical and traumatic disorders, such as spinal cord
disorders, head
trauma and cerebrovascular diseases such as stroke. Peripheral neuropathies
resulting
from chemotherapy or other medical therapies may also be treatable using a
protein of the
invention.
Proteins of the invention may also be useful to promote better or faster
closure of
2 5 non-healing wounds, including without limitation pressure ulcers, ulcers
associated with
vascular insufficiency, surgical and traumatic wounds, and the like.
It is expected that a protein of the present invention may also exhibit
activity for
generation or regeneration of other tissues, such as organs (including, for
example,
pancreas, liver, intestine, kidney, skin, endothelium), muscle {smooth,
skeletal or cardiac)
3 0 and vascular (including vascular endothelium) tissue, or for promoting the
growth of cells
comprising such tissues. Part of the desired effects may be by inhibition or
modulation
of fibrotic scarring to allow normal tissue to regenerate. A protein of the
invention may
also exhibit angiogeruc activity.
28
CA 02291477 1999-11-18
WO 98!53065 PCT/US98110188
A protein of the present invention may also be useful for gut protection or
regeneration and treatment of lung or liver fibrosis, reperfusion injury in
various tissues,
and conditions resulting from systemic cytokine damage.
A protein of the present invention may also be useful for promoting or
inhibiting
differentiation of tissues described above from precursor tissues or cells; or
for inhibiting
the growth of tissues described above.
The activity of a protein of the invention may, among other means, be measured
by the following methods:
Assays for tissue generation activity include, without limitation, those
described
in: International Patent Publication No. W095/16035 (bone, cartilage, tendon);
International Patent Publication No. W095/05846 (nerve, neuronal);
International Patent
Publication No. W091 /07491 (skin, endothelium ).
Assays for wound healing activity include, without limitation, those described
in:
Winter, Epidermal Wound Healing, pps. 71-112 (Maibach, HI and Rovee, DT,
eds.), Year
Book Medical Publishers, Inc., Chicago, as modified by Eaglstein and Mertz, j.
Invest.
Dermatol 71:382-84 (1978).
Activin/Inhibin Activity
A protein of the present invention may also exhibit activin- or inhibin-
related
2 0 activities. Inhibins are characterized by their ability to inhibit the
release of follicle
stimulating hormone (FSH), while activins and are characterized by their
ability to
stimulate the release of follicle stimulating hormone (FSH). Thus, a protein
of the present
invention, alone or in heterodimers with a member of the inhibin a family, may
be useful
as a contraceptive based on the ability of inhibins to decrease fertility in
female mammals
2 5 and decrease spermatogenesis in male mammals. Administration of sufficient
amounts
of other inhibins can induce infertility in these mammals. Alternatively, the
protein of the
invention, as a homodimer or as a heterodimer with other protein subunits of
the inhibin-
~3 group, may be useful as a fertility inducing therapeutic, based upon the
ability of activin
molecules in stimulating FSH release from cells of the anterior pituitary.
See, for example,
3 0 United States Patent 4,798,885. A protein of the invention may also be
useful for
advancement of the onset of fertility in sexually immature mammals, so as to
increase the
lifetime reproductive performance of domestic animals such as cows, sheep and
pigs.
The activity of a protein of the invention may, among other means, be measured
by the following methods:
29
CA 02291477 1999-11-18
WO 98!53065 PCT/US98/10188
Assays for activin/inhibin activity include, without limitation, those
described in:
Vale et al., Endocrinology 91:562-572, 1972; Ling et al., Nature 321:779-
782,1986; Vale et
al., Nature 321:776-779, 1986; Mason et al., Nature 318:659-663, 1985; Forage
et al., Proc.
Natl. Acad. Sci. USA 83:3091-3095, 1986.
Chemotactic/Chemokinetic Activity
A protein of the present invention may have chemotactic or chemokinetic
activity
(e.g., act as a chemokine) for mammalian cells, including, for example,
monocytes,
fibroblasts, neutrophils, T-cells, mast cells, eosinophils, epithelial and/or
endothelial cells.
Chemotactic and chemokinetic proteins can be used to mobilize or attract a
desired cell
population to a desired site of action. Chemotactic or chemokinetic proteins
provide
particular advantages in treatment of wounds and other trauma to tissues, as
well as in
treatment of localized infections. For example, attraction of lymphocytes,
monocytes or
neutrophils to tumors or sites of infection may result in improved immune
responses
against the tumor or infecting agent.
A protein or peptide has chemotactic activity for a particular cell population
if it
can stimulate, directly or indirectly, the directed orientation or movement of
such cell
population. Preferably, the protein or peptide has the ability to directly
stimulate directed
movement of cells. Whether a particular protein has chemotactic activity for a
population
2 0 of cells can be readily determined by employing such protein or peptide in
any known
assay for cell chemotaxis.
The activity of a protein of the invention may, among other means, be measured
by the following methods:
Assays for chemotactic activity (which will identify proteins that induce or
prevent
2 5 chemotaxis) consist of assays that measure the ability of a protein to
induce the migration
of cells across a membrane as well as the ability of a protein to induce the
adhesion of one
cell population to another cell population. Suitable assays for movement and
adhesion
include, without limitation, those described in: Current Protocols in
Immunology, Ed by
J.E. Coligan, A.M. Kruisbeek, D.H. Margulies, E.M. Shevach, W.Strober, Pub.
Greene
3 0 Publishing Associates and Wiley-Interscience (Chapter 6.12, Measurement of
alpha and
beta Chemokines 6.12.1-6.12.28; Taub et al. J. Clin. Invest. 95:1370-
1376,1995; Lind et al.
APMIS 103:140-146, 1995; Muller et al Eur. J. Immunol. 25: 1744-1748; Gruber
et al. J. of
Immunol. 152:5860-5867, 1994; Johnston et al. J. of Immunol. 153: 1762-1768,
1994.
CA 02291477 1999-11-18
WO 98/53065 PCT/US98/10188
Hemostatic and Thrombolytic Activity
A protein of the invention may also exhibit hemostatic or thrombolytic
activity.
As a result, such a protein is expected to be useful in treatment of various
coagulation
disorders {including hereditary disorders, such as hemophilias) or to enhance
coagulation
and other hemostatic events in treating wounds resulting from trauma, surgery
or other
causes. A protein of the invention may also be useful for dissolving or
inhibiting
formation of thromboses and for treatment and prevention of conditions
resulting
therefrom (such as, for example, infarction of cardiac and central nervous
system vessels
(e.g., stroke).
The activity of a protein of the invention may, among other means, be measured
by the following methods:
Assay for hemostatic and thrombolytic activity include, without limitation,
those
described in: Linet et al., J. Clin. Pharmacol. 26:131-140, 1986; Burdick et
al., Thrombosis
Res. 45:413-419,1987; Humphrey et al., Fibrinolysis 5:71-79 (1991); Schaub,
Prostaglandins
35:467-474, 1988.
Rece~tor/Li~and Activity
A protein of the present invention may also demonstrate activity as receptors,
receptor ligands or inhibitors or agonists of receptor/ligand interactions.
Examples of
2 0 such receptors and ligands include, without limitation, cytokine receptors
and their
ligands, receptor kinases and their ligands, receptor phosphatases and their
ligands,
receptors involved in cell-cell interactions and their ligands (including
without limitation,
cellular adhesion molecules (such as selectins, integrins and their ligands)
and
receptor/ligand pairs involved in antigen presentation, antigen recognition
and
2 5 development of cellular and humoral immune responses). Receptors and
ligands are also
useful for screening of potential peptide or small molecule inhibitors of the
relevant
receptor/ligand interaction. A protein of the present invention (including,
without
limitation, fragments of receptors and ligands) may themselves be useful as
inhibitors of
receptor/ligand interactions.
3 0 The activity of a protein of the invention may, among other means, be
measured
by the following methods:
Suitable assays for receptor-ligand activity include without limitation those
described in:Current Protocols in Immunology, Ed by J.E. Coligan, A.M.
Kruisbeek, D.H.
Margulies, E.M. Shevach, W.Strober, Pub. Greene Publishing Associates and
31
CA 02291477 1999-11-18
WO 98153065 PCT/US98/10188
Wiley-Interscience (Chapter 7.28, Measurement of Cellular Adhesion under
static
conditions 7.28.1-7.28.22), Takai et al., Proc. Natl. Acad. Sci. USA 84:6864-
6868, 1987;
Bierer et al., J. Exp. Med. 168:1145-1156, 1988; Rosenstein et al., J. Exp.
Med. 169:149-160
1989; Stoltenborg et al., J. Immunol. Methods 175:59-68,1994; Stitt et al.,
Cell 80:661-670,
1995.
Anti-Inflammator~r Activify
Proteins of the present invention may also exhibit anti-inflammatory activity.
The
anti-inflammatory activity may be achieved by providing a stimulus to cells
involved in
the inflammatory response, by inhibiting or promoting cell-cell interactions
(such as, for
example, cell adhesion), by inhibiting or promoting chemotaxis of cells
involved in the
inflammatory process, inhibiting or promoting cell extravasation, or by
stimulating or
suppressing production of other factors which more directly inhibit or promote
an
inflammatory response. Proteins exhibiting such activities can be used to
treat
inflammatory conditions including chronic or acute conditions), including
without
limitation inflammation associated with infection (such as septic shock,
sepsis or systemic
inflammatory response syndrome (SIRS)), ischemia-reperfusion injury, endotoxin
lethality, arthritis, complement-mediated hyperacute rejection, nephritis,
cytokine or
chemokine-induced lung injury, inflammatory bowel disease, Crohn's disease or
resulting
2 0 from over production of cytokines such as TNF or IL-1. Proteins of the
invention may also
be useful to treat anaphylaxis and hypersensitivity to an antigenic substance
or material.
Cadherin/Tumor Invasion Su~pressor Activity
Cadherins are calcium-dependent adhesion molecules that appear to play major
2 5 roles during development, particularly in defining specific cell types.
Loss or alteration
of normal cadherin expression can lead to changes in cell adhesion properties
linked to
tumor growth and metastasis. Cadherin malfunction is also implicated in other
human
diseases, such as pemphigus vulgaris and pemphigus foliaceus (auto-immune
blistering
skin diseases), Crohn's disease, and some developmental abnormalities.
3 0 The cadherin superfamily includes well over forty members, each with a
distinct
pattern of expression. All members of the superfamily have in common conserved
extracellular repeats (cadherin domains), but structural differences are found
in other
parts of the molecule. The cadherin domains bind calcium to form their
tertiary structure
and thus calcium is required to mediate their adhesion. Only a few amino acids
in the
32
CA 02291477 1999-11-18
WO 98153065 PCT/US98/10188
first cadherin domain provide the basis for homophilic adhesion; modification
of this
recognition site can change the specificity of a cadherin so that instead of
recognizing only
itself, the mutant molecule can now also bind to a different cadherin. In
addition, some
cadherins engage in heterophilic adhesion with other cadherins.
E-cadherin, one member of the cadherin superfamily, is expressed in epithelial
cell
types. Pathologically, if E-cadherin expression is lost in a tumor, the
malignant cells
become invasive and the cancer metastasizes. Transfection of cancer cell lines
with
polynucleotides expressing E-cadherin has reversed cancer-associated changes
by
returning altered cell shapes to normal, restoring cells' adhesiveness to each
other and to
their substrate, decreasing the cell growth rate, and drastically reducing
anchorage-
independent cell growth. Thus, reintroducing E-cadherin expression reverts
carcinomas
to a less advanced stage. It is likely that other cadherins have the same
invasion
suppressor role in carcinomas derived from other tissue types. Therefore,
proteins of the
present invention with cadherin activity, and polynucleotides of the present
invention
encoding such proteins, can be used to treat cancer. Introducing such proteins
or
polynucleotides into cancer cells can reduce or eliminate the cancerous
changes observed
in these cells by providing normal cadherin expression.
Cancer cells have also been shown to express cadherins of a different tissue
type
than their origin, thus allowing these cells to invade and metastasize in a
different tissue
2 0 in the body. Proteins of the present invention with cadherin activity, and
polynucleotides
of the present invention encoding such proteins, can be substituted in these
cells for the
inappropriately expressed cadherins, restoring normal cell adhesive properties
and
reducing or eliminating the tendency of the cells to metastasize.
Additionally, proteins of the present invention with cadherin activity, and
2 5 polynucleotides of the present invention encoding such proteins, can used
to generate
antibodies recognizing and binding to cadherins. Such antibodies can be used
to block
the adhesion of inappropriately expressed tumor-cell cadherins, preventing the
cells from
forming a tumor elsewhere. Such an anti-cadherin antibody can also be used as
a marker
for the grade, pathological type, and prognosis of a cancer, i.e. the more
progressed the
3 0 cancer, the less cadherin expression there will be, and this decrease in
cadherin expression
can be detected by the use of a cadherin-binding antibody.
Fragments of proteins of the present invention with cadherin activity,
preferably
a polypeptide comprising a decapeptide of the cadherin recognition site, and
poly-
nucleotides of the present invention encoding such protein fragments, can also
be used
33
CA 02291477 1999-11-18
WO 98/53065 PCTIUS98/10188
to block cadherin function by binding to cadherins and preventing them from
binding in
ways that produce undesirable effects. Additionally, fragments of proteins of
the present
invention with cadherin activity, preferably truncated soluble radherin
fragments which
have been found to be stable in the circulation of cancer patients, and
polynucleotides
encoding such protein fragments, can be used to disturb proper cell-cell
adhesion.
Assays for cadherin adhesive and invasive suppressor activity include, without
limitation, those described in: Hortsch et al. J Biol Chem 270 (32): 18809-
18817, 1995;
Miyaki et al. Oncogene 11: 2547-2552, 1995; Ozawa et al. Cell 63: 1033-1038,
1990.
Tumor Inhibition Activity
In addition to the activities described above for immunological treatment or
prevention of tumors, a protein of the invention may exhibit other anti-tumor
activities.
A protein may inhibit tumor growth directly or indirectly (such as, for
example, via
ADCC). A protein may exhibit its tumor inhibitory activity by acting on tumor
tissue or
tumor precursor tissue, by inhibiting formation of tissues necessary to
support tumor
growth (such as, for example, by inhibiting angiogenesis), by causing
production of other
factors, agents or cell types which inhibit tumor growth, or by suppressing,
eliminating
or inhibiting factors, agents or cell types which promote tumor growth.
2 0 Other Activities
A protein of the invention may also exhibit one or more of the following
additional
activities or effects: inhibiting the growth, infection or function of, or
killing, infectious
agents, including, without limitation, bacteria, viruses, fungi and other
parasites; effecting
(suppressing or enhancing) bodily characteristics, including, without
limitation, height,
2 5 weight, hair color, eye color, skin, fat to lean ratio or other tissue
pigmentation, or organ
or body part size or shape (such as, for example, breast augmentation or
diminution,
change in bone form or shape); effecting biorhythms or caricadic cycles or
rhythms;
effecting the fertility of male or female subjects; effecting the metabolism,
catabolism,
anabolism, processing, utilization, storage or elimination of dietary fat,
lipid, protein,
3 0 carbohydrate, vitamins, minerals, cofactors or other nutritional factors
or component{s);
effecting behavioral characteristics, including, without limitation, appetite,
libido, stress,
cognition {including cognitive disorders), depression (including depressive
disorders) and
violent behaviors; providing analgesic effects or other pain reducing effects;
promoting
differentiation and growth of embryonic stem cells in lineages other than
hematopoietic
34
CA 02291477 1999-11-18
WO 98/53065 PCT/US98/10188
lineages; hormonal or endocrine activity; in the case of enzymes, correcting
deficiencies
of the enzyme and treating deficiency-related diseases; treatment of
hyperproliferative
disorders (such as, for example, psoriasis); immunoglobulin-like activity
(such as, for
example, the ability to bind antigens or complement); and the ability to act
as an antigen
in a vaccine composition to raise an immune response against such protein or
another
material or entity which is cross-reactive with such protein.
ADMINISTRATION AND DOSING
A protein of the present invention (from whatever source derived, including
without limitation from recombinant and non-recombinant sources) may be used
in a
pharmaceutical composition when combined with a pharmaceutically acceptable
carrier.
Such a composition may also contain (in addition to protein and a carrier)
diluents, fillers,
salts, buffers, stabilizers, solubilizers, and other materials well known in
the art. The term
"pharmaceutically acceptable" means a non-toxic material that does not
interfere with the
effectiveness of the biological activity of the active ingredient(s). The
characteristics of the
carrier will depend on the route of administration. The pharmaceutical
composition of
the invention may also contain cytokines, lymphokines, or other hematopoietic
factors
such as M-CSF, GM-CSF, TNF, IL-1, IL-2, IL-3, IL-4, IL-5, IL-6, IL-7, IL-8, IL-
9, IL-10, IL-11,
2 0 IL-12, IL-13, IL-14, IL-15, IFN, TNFO, TNFl, TNF2, G-CSF, Meg-CSF,
thrombopoietin, stem
cell factor, and erythropoietin. The pharmaceutical composition may further
contain other
agents which either enhance the activity of the protein or compliment its
activity or use
in treatment. Such additional factors and/or agents may be included in the
pharmaceutical composition to produce a synergistic effect with protein of the
invention,
2 5 or to minimize side effects. Conversely, protein of the present invention
may be included
in formulations of the particular cytokine, lymphokine, other hematopoietic
factor,
thrombolytic or anti-thrombotic factor, or anti-inflammatory agent to minimize
side effects
of the cytokine, lymphokine, other hematopoietic factor, thrombolytic or anti-
thrombotic
factor, or anti-inflammatory agent.
3 0 A protein of the present invention may be active in multimers (e.g.,
heterodimers
or homodimers) or complexes with itself or other proteins. As a result,
pharmaceutical
compositions of the invention may comprise a protein of the invention in such
multimeric
or complexed form.
CA 02291477 1999-11-18
WO 98/53065 PCT/US98110188
The pharmaceutical composition of the invention may be in the form of a
complex
of the proteins) of present invention along with protein or peptide antigens.
The protein
and/or peptide antigen will deliver a stimulatory signal to both B and T
lymphocytes. B
lymphocytes will respond to antigen through their surface immunoglobulin
receptor. T
lymphocytes will respond to antigen through the T cell receptor (TCR)
following
presentation of the antigen by MHC proteins. MHC and structurally related
proteins
including those encoded by class I and class II MHC genes on host cells will
serve to
present the peptide antigens) to T lymphocytes. The antigen components could
also be
supplied as purified MHC-peptide complexes alone or with co-stimulatory
molecules that
can directly signal T cells. Alternatively antibodies able to bind surface
immunolgobulin
and other molecules on B cells as well as antibodies able to bind the TCR and
other
molecules on T cells can be combined with the pharmaceutical composition of
the
invention.
The pharmaceutical composition of the invention may be in the form of a
liposome
in which protein of the present invention is combined, in addition to other
pharmaceutically acceptable earners, with amphipathic agents such as lipids
which exist
in aggregated form as micelles, insoluble monolayers, liquid crystals, or
lamellar layers
in aqueous solution. Suitable lipids for liposomal formulation include,
without limitation,
monoglycerides, diglycerides, sulfatides, lysolecithin, phospholipids,
saponin, bile acids,
2 0 and the like. Preparation of such liposomal formulations is within the
level of skill in the
art, as disclosed, for example, in U.S. Patent No. 4,235,871; U.S. Patent No.
4,501,728; U.S.
Patent No. 4,837,028; and U.S. Patent No. 4,737,323, all of which are
incorporated herein
by reference.
As used herein, the term "therapeutically effective amount" means the total
2 5 amount of each active component of the pharmaceutical composition or
method that is
sufficient to show a meaningful patient benefit, i.e., treatment, healing,
prevention or
amelioration of the relevant medical condition, or an increase in rate of
treatment, healing,
prevention or amelioration of such conditions. When applied to an individual
active
ingredient, administered alone, the term refers to that ingredient alone. When
applied to
3 0 a combination, the term refers to combined amounts of the active
ingredients that result
in the therapeutic effect, whether administered in combination, serially or
simultaneously.
In practicing the method of treatment or use of the present invention, a
therapeutically effective amount of protein of the present invention is
administered to a
mammal having a condition to be treated. Protein of the present invention may
be
36
CA 02291477 1999-11-18
WO 98/53065 PCT/US98110188
administered in accordance with the method of the invention either alone or in
combination with other therapies such as treatments employing cytokines,
lymphokines
or other hematopoietic factors. When co-administered with one or more
cytokines,
lymphokines or other hematopoietic factors, protein of the present invention
may be
administered either simultaneously with the cytokine(s), lymphokine{s), other
hematopoietic factor(s), thrombolytic or anti-thrombotic factors, or
sequentially. If
administered sequentially, the attending physician will decide on the
appropriate
sequence of administering protein of the present invention in combination with
cytokine(s), lymphokine(s), other hematopoietic factor(s), thrombolytic or
anti-thrombotic
factors.
Administration of protein of the present invention used in the pharmaceutical
composition or to practice the method of the present invention can be carried
out in a
variety of conventional ways, such as oral ingestion, inhalation, topical
application or
cutaneous, subcutaneous, intraperitoneal, parenteral or intravenous injection.
Intravenous administration to the patient is preferred.
When a therapeutically effective amount of protein of the present invention is
administered orally, protein of the present invention will be in the farm of a
tablet,
capsule, powder, solution or elixir. When administered in tablet form, the
pharmaceutical
composition of the invention may additionally contain a solid carrier such as
a gelatin or
2 0 an adjuvant. The tablet, capsule, and powder contain from about 5 to 95%
protein of the
present invention, and preferably from about 25 to 90% protein of the present
invention.
When administered in liquid form, a liquid carrier such as water, petroleum,
oils of animal
or plant origin such as peanut oil, mineral oil, soybean oil, or sesame oil,
or synthetic oils
may be added. The liquid form of the pharmaceutical composition may further
contain
2 5 physiological saline solution, dextrose or other saccharide solution, or
glycols such as
ethylene glycol, propylene glycol or polyethylene glycol. When administered in
liquid
form, the pharmaceutical composition contains from about 0.5 to 90% by weight
of protein
of the present invention, and preferably from about 1 to 50% protein of the
present
invention.
3 0 When a therapeutically effective amount of protein of the present
invention is
administered by intravenous, cutaneous or subcutaneous injection, protein of
the present
invention will be in the form of a pyrogen-free, parenterally acceptable
aqueous solution.
The preparation of such parenterally acceptable protein solutions, having due
regard to
pH, isotonicity, stability, and the like, is within the skill in the art. A
preferred
37
CA 02291477 1999-11-18
WO 98/53065 PCTIUS98/10188
pharmaceutical composition for intravenous, cutaneous, or subcutaneous
injection should
contain, in addition to protein of the present invention, an isotonic vehicle
such as Sodium
Chloride Injection, Ringer's Injection, Dextrose Injection, Dextrose and
Sodium Chloride
Injection, Lactated Ringer's Injection, or other vehicle as known in the art.
The
pharmaceutical composition of the present invention may also contain
stabilizers,
preservatives, buffers, antioxidants, or other additives known to those of
skill in the art.
The amount of protein of the present invention in the pharmaceutical
composition
of the present invention will depend upon the nature and severity of the
condition being
treated, and on the nature of prior treatments which the patient has
undergone.
Ultimately, the attending physician will decide the amount of protein of the
present
invention with which to treat each individual patient. Initially, the
attending physician
will administer low doses of protein of the present invention and observe the
patient's
response. Larger doses of protein of the present invention may be administered
until the
optimal therapeutic effect is obtained for the patient, and at that point the
dosage is not
increased further. It is contemplated that the various pharmaceutical
compositions used
to practice the method of the present invention should contain about 0.01 ug
to about 100
mg (preferably about O.lng to about 10 mg, more preferably about 0.1 ~g to
about 1 mg)
of protein of the present invention per kg body weight.
The duration of intravenous therapy using the pharmaceutical composition of
the
2 0 present invention will vary, depending on the severity of the disease
being treated and
the condition and potential idiosyncratic response of each individual patient.
It is
contemplated that the duration of each application of the protein of the
present invention
will be in the range of 12 to 24 hours of continuous intravenous
administration.
Ultimately the attending physician will decide on the appropriate duration of
intravenous
2 5 therapy using the pharmaceutical composition of the present invention.
Protein of the invention may also be used to immunize animals to obtain
polyclonal and monoclonal antibodies which specifically react with the
protein. Such
antibodies may be obtained using either the entire protein or fragments
thereof as an
immunogen. The peptide immunogens additionally may contain a cysteine residue
at the
3 0 carboxyl terminus, and are conjugated to a hapten such as keyhole limpet
hemocyanin
(KLH). Methods for synthesizing such peptides are known in the art, for
example, as in
R.P. Merrifield, J. Amer.Chem.Soc. 85, 2149-2154 (19b3); J.L. Krstenansky, et
aL, FEBS Lett.
211, 10 (1987}. Monoclonal antibodies binding to the protein of the invention
may be
useful diagnostic agents for the immunodetection of the protein. Neutralizing
monoclonal
38
CA 02291477 1999-11-18
WO 98/53065 PCT/US98110188
antibodies binding to the protein may also be useful therapeutics for both
conditions
associated with the protein and also in the treatment of some forms of cancer
where
abnormal expression of the protein is involved. In the case of cancerous cells
or leukemic
cells, neutralizing monoclonal antibodies against the protein may be useful in
detecting
and preventing the metastatic spread of the cancerous cells, which may be
mediated by
the protein.
For compositions of the present invention which are useful for bone,
cartilage,
tendon or ligament regeneration, the therapeutic method includes administering
the
composition topically, systematically, or locally as an implant or device.
When
administered, the therapeutic composition for use in this invention is, of
course, in a
pyrogen-free, physiologically acceptable form. Further, the composition may
desirably
be encapsulated or injected in a viscous form for delivery to the site of
bone, cartilage or
tissue damage. Topical administration may be suitable for wound healing and
tissue
repair. Therapeutically useful agents other than a protein of the invention
which may also
1 S optionally be included in the composition as described above, may
alternatively or
additionally, be administered simultaneously or sequentially with the
composition in the
methods of the invention. Preferably for bone and/or cartilage formation, the
composition would include a matrix capable of delivering the protein-
containing
composition to the site of bone and/or cartilage damage, providing a structure
for the
2 0 developing bone and cartilage and optimally capable of being resorbed into
the body.
Such matrices may be formed of materials presently in use for other implanted
medical
applications.
The choice of matrix material is based on biocompatibility, biodegradability,
mechanical properties, cosmetic appearance and interface properties. The
particular
2 5 application of the compositions will define the appropriate formulation.
Potential
matrices for the compositions may be biodegradable and chemically defined
calcium
sulfate, tricalciumphosphate, hydroxyapatite, polylactic acid, polyglycolic
acid and
polyanhydrides. Other potential materials are biodegradable and biologically
well-
defined, such as bone or dermal collagen. Further matrices are comprised of
pure proteins
3 0 or extraceilular matrix components. Other potential matrices are
nonbiodegradable and
chemically defined, such as sintered hydroxapatite, bioglass, aluminates, or
other
ceramics. Matrices may be comprised of combinations of any of the above
mentioned
types of material, such as polylactic acid and hydroxyapatite or collagen and
tricalciumphosphate. The bioceramics may be altered in composition, such as in
calcium-
39
CA 02291477 1999-11-18
WO 98/53065 PCT/US98/10188
aluminate-phosphate and processing to alter pore size, particle size, particle
shape, and
biodegradability.
Presently preferred is a 50:50 (mole weight) copolymer of lactic acid and
glycolic
acid in the form of porous particles having diameters ranging from 150 to 800
microns.
In some applications, it will be useful to utilize a sequestering agent, such
as
carboxymethyl cellulose or autologous blood clot, to prevent the protein
compositions
from disassociating from the matrix.
A preferred family of sequestering agents is cellulosic materials such as
alkylcelluloses (including hydroxyalkylcelluloses), including methylcellulose,
ethylcellulose, hydroxyethylcellulose, hydroxypropylcellulose, hydroxypropyl-
methylcellulose, and carboxymethylcellulose, the most preferred being cationic
salts of
carboxymethylcellulose (CMC). Other preferred sequestering agents include
hyaluronic
acid, sodium alginate, polyethylene glycol), polyoxyethylene oxide,
carboxyvinyl
polymer and polyvinyl alcohol). The amount of sequestering agent useful herein
is 0.5-20
wt%, preferably 1-10 wt% based on total formulation weight, which represents
the
amount necessary to prevent desorbtion of the protein from the polymer matrix
and to
provide appropriate handling of the composition, yet not so match that the
progenitor cells
are prevented from infiltrating the matrix, thereby providing the protein the
opportunity
to assist the osteogenic activity of the progenitor cells.
2 0 In further compositions, proteins of the invention may be combined with
other
agents beneficial to the treatment of the bone and/or cartilage defect, wound,
or tissue in
question. These agents include various growth factors such as epidermal growth
factor
(EGF), platelet derived growth factor (PDGF), transforming growth factors {TGF-
a and
TGF-(3), and insulin-like growth factor (IGF).
2 5 The therapeutic compositions are also presently valuable for veterinary
applications. Particularly domestic animals and thoroughbred horses, in
addition to
humans, are desired patients for such treatment with proteins of the present
invention.
The dosage regimen of a protein-containing pharmaceutical composition to be
used in tissue regeneration will be determined by the attending physician
considering
3 0 various factors which modify the action of the proteins, e.g., amount of
tissue weight
desired to be formed, the site of damage, the condition of the damaged tissue,
the size of
a wound, type of damaged tissue (e.g., bone), the patient's age, sex, and
diet, the severity
of any infection, time of administration and other clinical factors. The
dosage may vary
with the type of matrix used in the reconstitution and with inclusion of other
proteins in
CA 02291477 1999-11-18
WO 98/53065 PCTIUS98110188
the pharmaceutical composition. For example, the addition of other known
growth
factors, such as IGF I (insulin like growth factor I}, to the final
composition, may also effect
the dosage. Progress can be monitored by periodic assessment of tissue/bone
growth
and/or repair, for example, X-rays, histomorphometric determinations and
tetracycline
labeling.
Polynucleotides of the present invention can also be used for gene therapy.
Such
polynucleotides can be introduced either in vivo or ex vivo into cells for
expression in a
mammalian subject. Polynucleotides of the invention may also be administered
by other
known methods for introduction of nucleic acid into a cell or organism
(including, without
limitation, in the form of viral vectors or naked DNA).
Cells may also be cultured ex vivo in the presence of proteins of the present
invention in order to proliferate or to produce a desired effect on or
activity in such cells.
Treated cells can then be introduced in vivo for therapeutic purposes.
Patent and literature references cited herein are incorporated by reference as
if
fully set forth.
41
CA 02291477 1999-11-18
WO 98/53065 PCT/US98/10188
SEQUENCE LISTING
(1) GENERAL
INFORMATION:
(i) APPLICANT: Jacobs, Kenneth
McCoy, John M.
LaVallie, Edward R.
Racie, Lisa A.
Merberg, David
Treacy, Maurice
Spaulding, Vikki
Agostino, Michael J.
Howes, Steven H.
Fechtel, Kim
(ii) TITLE OF INVENTION: SECRETED PROTEINS AND POLYNUCLEOTIDES
ENCODING THEM
2 (iii) NUMBER OF SEQUENCES: 3
O
(iv} CORRESPONDENCE ADDRESS:
(A) ADDRESSEE: Genetics Institute, Inc.
(B) STREET: 87 CambridgePark Drive
2 (C) CITY: Cambridge
5
(D) STATE: MA
(E) COUNTRY: U.S.A.
(F) ZIP: 02140
3 ( v ) COMPLJTER READABLE FORM
O
(A) MEDIUM TYPE: Floppy disk
{B) COMPUTER: IBM PC compatible
(C) OPERATING SYSTEM: PC-DOS/MS-DOS
(D) SOFTWARE: PatentIn Release #1.0, Version #1.30
35
(vi) CURRENT APPLICATION DATA:
(A) APPLICATION NUMBER:
(B) FILING DATE:
(C) CLASSIFICATION:
40
(viii) ATTORNEY/AGENT INFORMATION:
(A) NAME: Sprunger, Suzanne A.
(B) REGISTRATION NUMBER: 41,323
45 (ix) TELECOMMUNICATION INFORMATION:
(A) TELEPHONE: {617) 498-8284
(B) TELEFAX: {617) 876-5851
S O (2) INFORMATION FOR SEQ ID N0:1:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 2975 base pairs
(B) TYPE: nucleic acid
55 (C) STRANDEDNESS: double
(D) TOPOLOGY: linear
{ii) MOLECULE TYPE: cDNA
(xi) SEQUENCE DESCRIPTION: SEQ ID N0:1:
42
CA 02291477 1999-11-18
WO 98153065 PCT/US98l10188
GAGCGACGCGGAGAAGAGCTCCGGGTGCCGCGGCACTGCAGCGCTGAGATTCCTTTACAA60
AGAAACTCAGAGGACCGGGAAGAAAGAATTTCACCTTTGCGACGTGCTAGAAAATAAGGT120
CGTCTGGGAAAAGGACTGGAGACACAAGCGCATCCAACCCCGGTAGCAAACTGATGACTT180
TTCCGTGCTGATTTCTTTCAACCTCGGTATTTTCCCTTGGATATTAACTTGCATATCTGA240
AGAAATGGCATTCCGGACAATTTGCGTGTTGGTTGGAGTATTTATTTGTTCTATCTGTGT300
GAAAGGATCTTCCCAGCCCCAAGCAAGAGTTTATTTAACATTTGATGAACTTCGAGAAAC360
CAAGACCTCTGAATACTTCAGCCTTTCCCACCATCCTTTAGACTACAGGATTTTATTAAT420
1 GGATGAAGATCAGGACCGGATATATGTGGGAAGCAAAGATCACATTCTTTCCCTGAATAT480
5
TAACAATATAAGTCAAGAAGCTTTGAGTGTTTTCTGGCCAGCATCTACAATCAAAGTTGA540
AGAATGCAAAATGGCTGGCAAAGATCCCACACACGGCTGTGGGAACTTTGTCCGTGTAAT600
TCAGACTTTCAATCGCACACATTTGTATGTCTGTGGGAGTGGCGCTTTCAGTCCTGTCTG660
TACTTACTTGAACAGAGGGAGGAGATCAGAGGACCAAGTTTTCATGATTGACTCCAAGTG720
2 TGAATCTGGAAAAGGACGCTGCTCTTTCAACCCCAACGTGAACACGGTGTCTGTTATGAT780
5
CAATGAGGAGCTTTTCTCTGGAATGTATATAGATTTCATGGGGACAGATGCTGCTATTTT840
TCGAAGTTTAACC_zIAGAGGAATGCGGTCAGAACTGATCAACATAATTCCAAATGGCTAAG900
TGAACCTATGTTTGTAGATGCACATGTCATCCCAGATGGTACTGATCCAAATGATGCTAA960
GGTGTACTTCTTCTTCAAAGAAAAACTGACTGACAATAACAGGAGCACGAAACAGATTCA1020
3 TTCCATGATTGCTCGAATATGTCCTAATGACACTGGTGGACTGCGTAGCCTTGTCAACAA1080
5
GTGGACCACTTTCTTAAAGGCGAGGCTGGTGTGCTCGGTAACAGATGAAGACGGCCCAGA1140
AACACACTTTGATGAATTAGAGGATGTGTTTCTGCTGGAAACTGATAACCCGAGGACAAC1200
ACTAGTGTATGGCATTTTTACAACATCAAGCTCAGTTTTCAAAGGATCAGCCGTGTGTGT1260
GTATCATTTATCTGATATACAGACTGTGTTTAATGGGCCTTTTGCCCACAAAGAAGGGCC1320
4 CAATCATCAGCTGATTTCCTATCAGGGCAGAATTCCATATCCTCGCCCTGGAACTTGTCC1380
5
AGGAGGAGCATTTACACCCAATATGCGAACCACCAAGGAGTTCCCAGATGATGTTGTCAC1440
TTTTATTCGGAACCATCCTCTCATGTACAATTCCATCTACCCAATCCACAAAAGGCCTTT1500
GATTGTTCGTATTGGCACTGACTACAAGTACACAAAGATAGCTGTGGATCGAGTGAACGC1560
TGCTGATGGGAGATACCATGTCCTGTTTCTCGGAACAGATCGGGGTACTGTGCAAAAAGT1620
5 GGTTGTTCTTCCTACTAACAACTCTGTCAGTGGCGAGCTCATTCTGGAGGAGCTGGAAGT1680
5
CTTTAAGAATCATGCTCCTATAACAACAATGAAAATTTCATCTAAAAAGCAACAGTTGTA1740
TGTGAGTTCCAATGAAGGGGTTTCCCAGGTATCTCTGCACCGCTGCCACATCTATGGTAC1800
AGCCTGTGCTGACTGCTGCCTGGCGCGGGACCCTTATTGCGCCTGGGATGGCCATTCCTG1860
TTCCAGATTCTACCCAACTGGGAAACGGAGGAGCCGAAGACAAGATGTGAGACATGGAAA1920
43
CA 02291477 1999-11-18
WO 98/53065 PCTIUS98110188
CCCACTGACTCAATGCAGAG GATTTAATCTAAAAGCATACAGAAATGCAGCTGAAATTGT1980
GCAGTATGGAGTAAAAAATA ACACCACTTTTCTGGAGTGTGCCCCCAAGTCTCCGCAGGC2040
ATCTATCAAGTGGCTGTTAC AGAAAGACAAAGACAGGAGGAAAGAGGTTAAGCTGAATGA2100
ACGAATAATAGCCACTTCAC AGGGACTCCTGATCCGCTCTGTTCAGGGTTCTGACCAAGG2160
ACTTTATCACTGCATTGCTA CAGAAAATAGTTTCAAGCAGACCATAGCCAAGATCAACTT2220
CAAAGTTTTAGATTCAGAAA TGGTGGCTGTTGTGACGGACAAATGGTCCCCGTGGACCTG2280
GGCCAGCTCTGTGAGGGCTT TACCCTTCCACCCGAAGGACATCATGGGGGCATTCAGCCA2340
CTCAGAAATGCAGATGATTA ACCAATACTGCAAAGACACTCGGCAGCAACATCAGCAGGG2400
AGATGAATCACAGAAA.ATGA GAGGGGACTATGGCAAGTTAAAGGCCCTCATCAATAGTCG2460
GAAAAGTAGAAACAGGAGGA ATCAGTTGCCAGAGTCATAATATTTTCTTATGTGGGTCTT2520
ATGCTTCCATTAACAAATGC TCTGTCTTCAATGATCAAATTTTGAGCAAAGAAACTTGTG2580
CTTTACCAAGGGGAATTACT GAAAAAGGTGATTACTCCTGAAGTGAGTTTTACACGAACT2640
2 GAAATGAGCATGCATTTTCT TGTATGATAGTGACTAGCACTAGACATGTCATGGTCYTCA2700
5
TGGTGCATATAAATATATTT AACTTAACCCAGATTTTATTTATATCTTTATTCACCTTTT2760
CTTCAAAATCGATATGGTGG CTGCAAAACTAGAATTGTTGCATCCCTCAATTGAATGAGG2820
GCCATATCCCTGTGGTATTC CTTTCCTGCTTTGGGGCTTTAGAATTCTAATTGTCAGTGA2880
TTTTGTATATGAAAACAAGT TCCAAATCCACAGCTTTTACGTAGTAAAAGTCATAAATGC2940
3 ATATGACAGAATGGCTATCA AAAGAAAAAAAAAAA 2975
5
(2) INFORMATION
FOR SEQ
ID N0:2:
(i) SEQUENCE
CHARACTERISTICS:
4 (A) LENGTH: 751 acids
0 amino
(B) TYPE: amino
acid
(C) STRANDEDNESS:
(D) TOPOLOGY: linear
4 (ii) MOLECULE
5 TYPE:
protein
50 (xi) SEQUENCE DESCRIPTION: SEQ ID N0:2:
Met Ala Phe Arg Thr Ile Cys Val Leu Val Gly Val Phe Ile Cys Ser
1 5 10 15
5 5 Ile Cys Val Lys Gly Ser Ser Gln Pro Gln Ala Arg Val Tyr Leu Thr
20 25 30
Phe Asp Glu Leu Arg Glu Thr Lys Thr Ser Glu Tyr Phe Ser Leu Ser
40 45
His His Pro Leu Asp Tyr Arg Ile Leu Leu Met Asp Glu Asp Gln Asp
50 55 60
44
CA 02291477 1999-11-18
WO 98/53065 PCT/US98/10188
Arg Ile Tyr Val Gly Ser Lys Asp His Ile Leu Ser Leu Asn Ile Asn
65 70 75 80
Asn Ile Ser Gln Glu Ala Leu Ser Val Phe Trp Pro Ala Ser Thr Ile
85 90 95
Lys Val Glu Glu Cys Lys Met Ala Gly Lys Asp Pro Thr His Giy Cys
100 105 110
1 0 Gly Asn Phe Val Arg Val Ile Gln Thr Phe Asn Arg Thr His Leu Tyr
115 120 125
Val Cys Gly Ser Gly Ala Phe Ser Pro Val Cys Thr Tyr Leu Asn Arg
130 135 140
Gly Arg Arg Ser Glu Asp Gln Val Phe Met Ile Asp Ser Lys Cys Glu
145 150 155 160
Ser Gly Lys Gly Arg Cys Ser Phe Asn Pro Asn Val Asn Thr Val Ser
165 170 175
Val Met Ile Asn Glu Glu Leu Phe Ser Gly Met Tyr Ile Asp Phe Met
180 185 190
2 Gly Thr AspAlaAla IlePheArg SerLeu ThrLysArg AsnAlaVal
5
195 200 205
Arg Thr AspGlnHis AsnSerLys TrpLeu SerGluPro MetPheVal
210 215 220
Asp Ala HisValIle ProAspGly ThrAsp ProAsnAsp AlaLysVal
225 230 235 240
Tyr Phe PhePheLys GluLysLeu ThrAsp AsnAsnArg SerThrLys
245 250 255
Gln Ile HisSerMet IleAlaArg IleCys ProAsnAsp ThrGlyGly
260 265 270
4 Leu Arg SerLeuVal AsnLysTrp ThrThr PheLeuLys AlaArgLeu
0
275 280 285
Val Cys Ser Val Thr Asp Glu Asp Gly Pro Glu Thr His Phe Asp Glu
290 295 300
Leu Glu Asp Val Phe Leu Leu Glu Thr Asp Asn Pro Arg Thr Thr Leu
305 310 315 320
Val Tyr Gly Ile Phe Thr Thr Ser Ser Ser Val Phe Lys Gly Ser Ala
325 330 335
Val Cys Val Tyr His Leu Ser Asp Ile Gln Thr Val Phe Asn Gly Pro
340 345 350
Phe Ala His Lys Glu Gly Pro Asn His Gln Leu Ile Ser Tyr Gln Gly
355 360 365
Arg Ile Pro Tyr Pro Arg Pro Gly Thr Cys Pro Gly Gly Ala Phe Thr
370 375 380
Pro Asn Met Arg Thr Thr Lys Glu Phe Pro Asp Asp Val Val Thr Phe
385 390 395 400
CA 02291477 1999-11-18
WO 98/53065 PCTIUS98/10188
Ile Arg Asn His Pro Leu Met Tyr Asn Ser Ile Tyr Pro Ile His Lys
405 410 415
Arg Pro Leu Ile Val Arg Ile Gly Thr Asp Tyr Lys Tyr Thr Lys Ile
420 425 430
Ala Val Asp Arg Val Asn Ala Ala Asp Gly Arg Tyr His Val Leu Phe
435 440 445
1 0 Leu Gly Thr Asp Arg Gly Thr Val Gln Lys Val Val Val Leu Pro Thr
450 455 460
Asn Asn Ser Val Ser Gly Glu Leu Ile Leu Glu Glu Leu Glu Val Phe
465 470 475 480
Lys Asn His Ala Pro Ile Thr Thr Met Lys Ile Ser Ser Lys Lys Gln
485 490 495
Gln Leu Tyr Val Ser Ser Asn Glu Gly Val Ser Gln Val Ser Leu His
2 0 500 505 510
Arg Cys His Ile Tyr Gly Thr Ala Cys Ala Asp Cys Cys Leu Ala Arg
515 520 525
2 5 Asp Pro Tyr Cys Ala Trp Asp Gly His Ser Cys Ser Arg Phe Tyr Pro
530 535 540
Thr Gly Lys Arg Arg Ser Arg Arg Gln Asp Val Arg His Gly Asn Pro
545 550 555 560
Leu Thr Gln Cys Arg Gly Phe Asn Leu Lys Ala Tyr Arg Asn A1a Ala
565 570 575
Glu Ile Val Gln Tyr Gly Val Lys Asn Asn Thr Thr Phe Leu Glu Cys
580 585 590
Ala Pro Lys Ser Pro Gln Ala Ser Ile Lys Trp Leu Leu Gln Lys Asp
595 600 605
4 0 Lys Asp Arg Arg Lys Glu Val Lys Leu Asn Glu Arg Ile Ile Ala Thr
610 615 620
Ser Gln Gly Leu Leu Ile Arg Ser Val Gln Gly Ser Asp Gln Gly Leu
625 630 635 640
Tyr His Cys Ile Ala Thr Glu Asn Ser Phe Lys Gln Thr Ile Ala Lys
645 650 655
Ile Asn Phe Lys Val Leu Asp Ser Glu Met Val Ala Val Va1 Thr Asp
660 665 670
Lys Trp Ser Pro Trp Thr Trp Ala Ser Ser Val Arg Ala Leu Pro Phe
675 680 685
5 5 His Pro Lys Asp Ile Met Gly Ala Phe Ser His Ser Glu Met Gln Met
690 695 700
Ile Asn Gln Tyr Cys Lys Asp Thr Arg Gln Gln His Gln Gln Gly Asp
705 710 715 720
Glu Ser Gln Lys Met Arg Gly Asp Tyr Gly Lys Leu Lys Ala Leu Ile
725 730 735
46
CA 02291477 1999-11-18
WO 98/53065 PCT/US98/10188
Asn Ser Arg Lys Ser Arg Asn Arg Arg Asn Gln Leu Pro Glu Ser
740 745 750
(2) INFORMATION FOR SEQ ID N0:3:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 29 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: other nucleic acid
(A) DESCRIPTION: /desc = "oligonucleotide"
(xi) SEQUENCE DESCRIPTION: SEQ ID N0:3:
2 O GNCCGGAATG CCATTTCTTC AGATATGCA 2g
47