Note : Les descriptions sont présentées dans la langue officielle dans laquelle elles ont été soumises.
CA 02304169 2000-03-22
WO 99/19348 PCT/US98/21391
LANJZNINS AND USES THEREOF
BACKGROUND OF THE INVENTION
The invention relates to the laminin 12, laminin subunit y3, and laminin
subunit (31,
and methods of making and using these molecules.
SUMMARY OF THE INVENTION
The present invention is based, in part, on the discovery of a novel member of
the
laminin family, laminin 12. Accordingly, the present invention features a
purified or isolated
preparation or a recombinant preparation of laminin 12 which includes an a2
subunit, a ail
subunit and a y3 subunit.
In a preferred embodiment, the a2 subunit has at least 60% to about 70%, more
preferably at least about 80%, even more preferably at least about 90% to
about 95%, and
most preferably at least about 99% sequence identity with human a2 subunit,
e.g., the human
a2 subunit of SEQ ID N0:7. The a2 subunit can be identical to a human a2
sequence, e.g.,
that of SEQ ID N0:7. In another embodiment, the a2 subunit is encoded by a
nucleic acid
molecule which hybridizes under stringent conditions to a nucleic acid
molecule of the
nucleic acid sequence shown in SEQ ID N0:8. In addition, the a2 subunit can
have
substantially the same electrophoretic mobility as human a2 subunit, e.g., it
appears as a 205
kDa electrophoretic band on reducing gels. Yet another preferred embodiment of
the
invention features an a2 subunit which is reactive with an a2-specific
antibody, e.g., an
antibody which binds to the epitope recognized by mAb SH2. a2 specific
antibodies can be
made by methods known in the art.
Another preferred embodiment of the invention features a (31 subunit having at
least
60% to about 70%, more preferably at least about 80%, even more preferably at
least about
90% to about 95%, and most preferably at least about 99% sequence identity
with human (31
subunit, e.g., the human ail subunit of SEQ 1D N0:9. Preferably, the X31
subunit has the
identical amino acid sequence of human ~i 1 subunit, e.g., that of SEQ ID
N0:9. In another
embodiment, the ail subunit is encoded by a nucleic acid molecule which
hybridizes under
stringent conditions to a nucleic acid molecule of the nucleic acid sequence
shown in SEQ ID
NO:10. In addition, the (31 subunit can have substantially the same
electrophoretic mobility
as human (31 subunit, e.g., it appears as a 185 kDa electrophoretic band on
reducing gels. Yet
another preferred embodiment of the invention features an [31 subunit which is
reactive with
an (31-specific antibody, e.g., an antibody which binds to the epitope
recognized by mAb 545.
ail-specific antibodies can be made by methods known in the art.
In yet another preferred embodiment, the Y3 subunit of laminin 12 has at least
60% to
about 70%, more preferably at least about 80%, even more preferably at least
about 90% to
about 95%, and most preferably at least about 99% sequence identity with human
y3 subunit,
CA 02304169 2000-03-22
WO 99/19348 PCT/US98/21391
2
e.g., the y3 subunit of SEQ ID N0:3. The y3 subunit can be identical to a
naturally occuring
human y3 subunit, e.g., that of SEQ ID N0:3. In another embodiment, the y3
subunit is
encoded by a nucleic acid molecule which hybridizes under stringent conditions
to a nucleic
acid molecule of the nucleic acid sequence shown in SEQ ID N0:4. In addition,
the y3
subunit can have substantially the same electrophoretic mobility as human y3
subunit, e.g., it
appears as a 170 kDa electrophoretic band on reducing gels. Yet another
preferred
embodiment of the invention features an y3 subunit which is reactive with an
y3-specific
antibody. y3-specific antibodies can be made by methods known in the art and
taught herein.
In a preferred embodiment, the laminin 12 is a trimer which can be found in,
or can be
isolated from human placental chorionic villi. In another embodiment, the
laminin 12 is
expressed by a recombinant cell, e.g., a bacterial cell, a cultured cell
(e.g., a cultured
eukaryotic cell) or a cell of a non-human transgenic animal. Cultured cells
can include CHO
cells or SF8 cells. Expression of laminin 12 in a transgenic animal can be
general or can be
under the control of a tissue specific promoter. Preferably, one or more
sequences which
encode subunits of the laminin 12 trimer are expressed in a preferred cell-
type by a tissue
specific promoter, e.g., a milk specific promoter.
The present invention is also based, in part, on the discovery of a novel
laminin
subunit, y3. Accordingly, the invention features a recombinant or
substantially pure or
isolated preparation of a y3 polypeptide.
In a preferred embodiment, the y3 polypeptide has the following biological
acitivities:
1) it promotes adhesion between tissue elements; 2) provides a site for
insertion of nerves into
the basement membrane. Im other preferred embodiments: the y3 polypeptide
includes an
amino acid sequence with at least 60%, 80%, 90%, 95%, 98%, or 99% sequence
identity to
an amino acid sequence from SEQ ID N0:3; the y3 polypeptide includes an amino
acid
sequence essentially the same as the amino acid sequence in SEQ ID N0:3; the
y3
polypeptide is at least 5, 10, 20, 50, 100, or 150 amino acids in length; the
y3 polypeptide
includes at least 5, preferably at least 10, more preferably at least 20, most
preferably at least
50, 100, or 150 contiguous amino acids from SEQ ID N0:3; the y3 polypeptide is
either, an
agonist or an antagonist, of a biological activity of a naturally occurring y3
subunit; the y3
polypeptide is a vertebrate, e.g., a mammalian, e.g. a primate, e.g., a human,
y3 polypeptide.
In a preferred embodiment, the invention includes a y3 polypeptide encoded by
a
DNA insert of a plasmid deposited with ATCC as Accession No: 209357. In
another
embodiment, the y3 polypeptide is a polypeptide encoded by nucleotide
sequences of the
overlapping DNA inserts of more than one, preferably all seven of the plasmids
deposited
with ATCC as Accession No:209357.
In preferred embodiments: the y3 polypeptide is encoded by the nucleic acid in
SEQ
ID N0:4, or by a nucleic acid having at least about 85%, more preferably at
least about 90%
to about 95%, and most preferably at least about 99% sequence identity with
the nucleic acid
from SEQ ID NO: 4.
CA 02304169 2000-03-22
WO 99/19348 PCT/US98/21391
3
In preferred embodiments, the y3 polypeptide includes a nidogen-binding
domain.
Generally, the nidogen-binding domain is at least 5 residues in length and
preferably, has
about 70, 80, 90, or 95% sequence identity with the nidogen-binding domain of
the protein
shown in SEQ ID NO: 3 (amino acid residues 750-755). In another embodiment,
the y3
polypeptide includes at least 5, preferably 6 to 7, and most preferably 8 of
the cysteins found
Z O in native y3 protein. In yet another embodiment of the invention features
a y3 polypeptide
that does not include or has an inactivated nidogen-binding domain which
serves as an
antagonist to y3 biological activities. Furthermore, a y3 polypeptide which
has antagonist
activity can have inactivated or excluded regions which comprise at least one
cystein found in
native y3 protein.
In a preferred embodiment, the y3 polypeptide differs in amino acid sequence
at up to
1, 2, 3, 5, or 10 residues, from a sequence in SEQ ID NO: 3. In other
preferred embodiments,
the y3 polypeptide differs in amino acid sequence at up to 1, 2, 3, 5, or 10 %
of the residues
from a sequence in SEQ ID NO: 3. Preferably, the differences are such that:
the y3
polypeptide exhibits a y3 biological activity, e.g., the y3 polypeptide
retains a biological
activity of a naturally occurring y3 subunit.
In preferred embodiments the y3 polypeptide includes a y3 subunit sequence
described
herein as well as other N-terminal andlor C-terminal amino acid sequence.
In preferred embodiments, the y3 polypeptide includes all or a fragment of an
amino
acid sequence from SEQ ID NO: 3, fused, in reading frame, to additional amino
acid residues,
preferably to residues encoded by genomic DNA 5' to the genomic DNA which
encodes a
sequence from SEQ ID NO: 3.
In yet other preferred embodiments, the y3 polypeptide is a recombinant fusion
protein having a first y3 portion and a second polypeptide portion, e.g., a
second polypeptide
portion having an amino acid sequence unrelated to y3. The second polypeptide
portion can
be, e.g., any of glutathione-S-transferase, a DNA binding domain, or a
polymerase activating
domain. In preferred embodiment the fusion protein can be used in a two-hybrid
assay.
In a preferred embodiment the y3 polypeptide includes amino acid residues 750-
755
of SEQ ID N0:3. In another embodiment, the y3 polypeptide encodes domains IV-
VI of the
y3 subunit.
In preferred embodiments the y3 polypeptide has antagonistic activity, and is
capable
of inhibiting adhesion between connective tissues.
In a preferred embodiment, the y3 polypeptide is a fragment of a naturally
occurring y
3 which inhibits connective tissue adhesion.
Polypeptides of the invention include those which arise as a result of the
existence of
multiple genes, alternative transcription events, alternative RNA splicing
events, and
alternative translational and postranslational events. The y3 polypeptide can
be expressed in
systems, e.g., cultured cells, which result in substantially the same
postranslational
modifications present when expressed y3 is expressed in a native cell, or in
systems which
CA 02304169 2000-03-22
WO 99/19348 PCT/US98/21391
4
result in the omission of postranslational modifications present when
expressed in a native
cell. ~ _
The invention includes an immunogen which includes a y3 polypeptide in an
immunogenic preparation, the immunogen being capable of eliciting an immune
response
specific for the y3 polypeptide, e.g., a humoral response, an antibody
response, or a cellular
response. In preferred embodiments, the immunogen comprising an antigenic
determinant,
e.g., a unique determinant, from a protein represented by SEQ ID NO: 3.
The present invention also includes an antibody preparation specifically
reactive with
an epitope-of the y3 immunogen or generally of a y3 polypeptide, preferably an
epitope which
consists all or in part of residues from the the amino acid sequence of SEQ ID
N0:3, or an
epitope, which when bound to an antibody, results in the modulation of a
biological activity.
In preferred embodiments the y3-like polypeptide, as expressed in the cells in
which it
is normally expressed or in other eukaryotic cells, has a molecular weight of
170 kDa as
determined by SDS-PAGE.
In another embodiment, the y3 polypeptide comprises amino acid residues 100-
1761
of SEQ ID NO: 3.
In a preferred embodiment, the y3 polypeptide has one or more of the following
characteristics:
(i) it has the ability to promote adhesion between connective tissues;
(ii) it has a molecular weight, amino acid composition or other physical
characteristic of y3 subunit of SEQ ID N0:3;
(iii) it has an overall sequence similarity of at least 50%, preferably at
least
60%, more preferably at least 70, 80, 90, or 95%, with a y3 polypeptide of SEQ
ID N0:3;
(iv) it can be isolated from human placenta chorionic villi;
(v) it has a nidogen-binding domain which is preferably about 70%, 80%,
90% or 95% with amino acid residues 750-755 of SEQ ID N0:3;
(vi) it can colocalize with protein ubiquitin carboxy terminal hydroxylase I;
(vii) it has at least 5, preferably 6 or 7, and most preferably 8 of the
cysteins
found amino acid sequence of native y3.
Also included in the invention is a composition which includes a y3
polypeptide (or a
nucleic acid which encodes it) and one or more additional components, e.g., a
carrier, diluent,
or solvent. The additional component can be one which renders the composition
useful for in
vitro and in vivo pharmaceutical or veterinary use.
In another aspect, the invention provides an isolated or substantially pure
nucleic acid
having or comprising a nucleotide sequence which encodes a y3 polypeptide,
e.g., a y3
polypeptide described herein.
A preferred embodiment of the invention features a nucleic acid molecule
having a
nucleotide sequence at least about 85% sequence identity to a nucleotide
sequence of SEQ iD
N0:4. In other preferred embodiments, the y3 polypeptide is encoded by a
nucleic acid
CA 02304169 2000-03-22
WO 99/19348 PCT/US98/21391
S
S molecule having a nucleotide sequence with at least about 90% to about 9S%,
and more
preferably about 98% to about 99% sequence identity to the nucleotide sequence
from SEQ
ID N0:4. In another preferred embodiment, the y3 polypeptide is encoded by the
nulceic acid
molecule of SEQ ID N0:4.
In prefered embodiments, the isolated nucleic acid molecule includes the
nucleotide
sequence of at least one and preferably all of the DNA inserts of the plasmids
deposited with
ATCC as Accession No: 209357.
In preferred embodiments, the subject y3 nucleic acid will include a
transcriptional
regulatory sequence, e.g. at least one of a transcriptional promoter or
transcriptional enhancer
sequence, operably linked to the y3 gene sequence (also referred to as LAMG3),
e.g., to
1 S render the y3 gene sequence suitable for use as an expression vector.
In yet a further preferred embodiment, the nucleic acid which encodes a y3
polypeptide of the invention, hybridizes under stringent conditions to a
nucleic acid probe
corresponding to at least 12 consecutive nucleotides of SEQ ID N0:4. More
preferably, the
nucleic acid probe corresponds to at least 20 consecutive nucleotides from SEQ
ID NO: 4.
The invention also provides a probe or primer which includes or comprises a
substantially purified oligonucleotide. The oligonucleotide includes a region
of nucleotide
sequence which hybridizes under stringent conditions to at least 10
consecutive nucleotides of
sense or antisense sequence from SEQ ID NO: 4, or naturally occurring mutants
thereof. In
preferred embodiments, the probe or primer further includes a label group
attached thereto.
2S The label group can be, e.g., a radioisotope, a fluorescent compound, an
enzyme, and/or an
enzyme co-factor. Preferably the oligonucleotide is at least 10 and less than
20, 30, S0, 100,
or 150 nucleotides in length.
The invention involves nucleic acids, e.g., RNA or DNA, encoding a y3
polypeptide
of the invention. This includes double stranded nucleic acids as well as
coding and antisense
single strands.
In another aspect, the invention features a cell or purified preparation of
cells which
include a y3 subunit transgene, or which otherwise misexpress a y3 gene. The
cell
preparation can consist of human or non human cells, e.g., rodent cells, e.g.,
mouse or rat
cells, rabbit cells, or pig cells. In preferred embodiments, the cell or cells
include a y3
3S transgene, e.g., a heterologous form of a r3 gene, e.g., a gene derived
from humans (in the
case of a non-human cell). The y3 transgene can be misexpressed, e.g.,
overexpressed or
underexpressed. In other preferred embodiments, the cell or cells include a
gene which
misexpress an endogenous y3 gene, e.g., a gene the expression of which is
disrupted, e.g., a
knockout. Such cells can serve as a model for studying disorders which are
related to
mutated or mis-expressed y3 alleles or for use in drug screening.
In another aspect, the invention features a transgenic y3 animal, e.g., a
rodent, e.g., a
mouse or a rat, a rabbit, a pig, a goat, or a cow. In preferred embodiments,
the transgenic
animal includes (and preferably express) a heterologous form of a y3 gene,
e.g., a gene
CA 02304169 2000-03-22
WO 99/19348 PCT/US98121391
6
derived from humans. In a further embodiment, the y3 transgene includes a
tissue specific
promoter, e.g., a milk-specific promoter. In other preferred embodiments, the
animal has an
endogenous y3 gene which is misexpressed, e.g., a knockout. Such a transgenic
animal can
serve as a model for studying disorders which are related to mutated or mis-
expressed y3
alleles or for use in drug screening.
The invention is also based, in part, on the discovery of a novel laminin
subunit, (34.
Accordingly, the invention features a recombinant or substantially pure
preparation of a (34
polypeptide.
In preferred embodiment, the X34 polypeptide has the following biological
activities: 1 )
it promotes adhesion between tissue elements; 2) it aids in wound healing. In
other preferred
embodiments: the (34 polypeptide includes an amino acid sequence with at least
65%, 80%,
90%, 95%, 98%, or 99% sequence identity to an amino acid sequence from SEQ ID
NO:1;
the (34 polypeptide includes an amino acid sequence essentially the same as an
amino acid
sequence in SEQ ID NO: 1; the (34 polypeptide is at least 5, 10, 20, 50, 100,
or 150 amino
acids in length; the (34 polypeptide includes at least 5, preferably at least
10, more preferably
at least 20, most preferably at least 50, 100, or 150 contiguous amino acids
from SEQ ID
NO:1; the (34 polypeptide is either, an agonist or an antagonist, of a
biological activity of a
naturally occurnng ~i4 subunit; the ~i4 polypeptide is a vertebrate, e.g., a
mammalian, e.g. a
primate, e.g., a human, ~i4 polypeptide.
In preferred embodiments: the ~i4 polypeptide is encoded by the nucleic acid
in SEQ
ID N0:2, or by a nucleic acid having at least about 65% to about 70%, more
preferably at
least 80%, even more preferably at least about 90% to about 95%, and most
preferably about
99% sequence identity with the nucleic acid from SEQ ID NO: 2.
In preferred embodiments, the (34 polypeptide includes domains VI and V found
in
native [34 subunits. Amino acid residues from about 221-262 and 263-535 of SEQ
m NO: 1
are exemplary of domains VI and V, respectively, of (34. Generally, domain VI
is at least 33
residues in length and has preferably at least about 60%, more preferably
about 70% to about
80%, and most preferably about 90% to about 95% sequence identity with the
amino acid
residues 221-262 of the (34 protein shown in SEQ ID NO: 1. Domain V is at
least 272
residues in length and has preferably at least about 60%, more preferably
about 70% to about
80%, and most preferably about 90% to about 95% sequence identity with the
amino acid
residues 263-535 of the (34 protein shown in SEQ ID NO: 1. In another
embodiment, the (34
polypeptide has at least 5, preferably 6 or 7, and most preferably 8 cysteins
as found in native
(34. In yet another embodiment, a (34 polypeptide which has antagonist
activity has
inactivated or excluded regions which comprise at least one of the cysteins
found in native [34
protein.
In a preferred embodiment, the ~i4 polypeptide differs in amino acid sequence
at up to
1, 2, 3, 5, or 10 residues, from a sequence in SEQ ID NO: 1. In other
preferred embodiments,
the (34 polypeptide differs in amino acid sequence at up to 1, 2, 3, 5, or 10
% of the residues
CA 02304169 2000-03-22
WO 99/19348 PCT/US98/21391
7
from a sequence in SEQ ID NO: 1. Preferably, the differences are such that:
the (34
polypeptide exhibits a (34 biological activity, e.g., the (34 polypeptide
retains a biological
activity of a naturally occurring ~i4 subunit.
In preferred embodiments the (34 polypeptide includes a X34 sequence described
herein
as well as other N-terminal and/or C-terminal amino acid sequence.
In preferred embodiments, the (34 polypeptide includes all or a fragment of an
amino
acid sequence from SEQ ID NO:1, fused, in reading frame, to additional amino
acid residues,
preferably to residues encoded by genomic DNA 5' to the genomic DNA which
encodes a
sequence from SEQ ID NO:1.
In yet other preferred embodiments, the X34 polypeptide is a recombinant
fusion
protein having a first (34 portion and a second polypeptide portion, e.g., a
second polypeptide
portion having an amino acid sequence unrelated to (34. The second polypeptide
portion can
be, e.g., any of glutathione-S-transferase, a DNA binding domain, or a
polymerase activating
domain. In preferred embodiment the fusion protein can be used in a two-hybrid
assay.
In preferred embodiments the ~i4 polypeptide has antagonistic activity, and is
capable
of inhibiting the adhesion of connective tissues.
Preferably, the [34 polypeptide is a fragment of a naturally occurnng (34
which inhibits
connective tissue adhesion.
Polypeptides of the invention include those which arise as a result of the
existence of
multiple genes, alternative transcription events, alternative RNA splicing
events, and
alternative translational and postranslational events. In one aspect of the
invention, the ~i4
polypeptide is a splice variant of the [34 subunit. In another preferred
embodiment, the (34
splice variant is encoded by a nucleic acid molecule identical to the
nucleotide sequence of
SEQ ID N0:6. The polypeptide can be expressed in systems, e.g., cultured
cells, which result
in substantially the same postranslational modifications present when
expressed (34 is
expressed in a native cell, or in systems which result in the omission of
postranslational
modifications present when expressed in a native cell.
The invention includes an immunogen which includes a ~i4 polypeptide in an
immunogenic preparation, the immunogen being capable of eliciting an immune
response
specific for the (34 polypeptide, e.g., a humoral response, an antibody
response, or a cellular
response. In preferred embodiments, the immunogen comprising an antigenic
determinant,
e.g., a unique determinant, from a protein represented by SEQ ID NO: 1.
The present invention also includes an antibody preparation specifically
reactive with
an epitope of the (34 immunogen or generally of a (34 polypeptide, preferably
an epitope
which consists all or in part of residues from the amino acid sequence of SEQ
ID NO:1, or an
epitope, which when bound to an antibody, results in the modulation of a
biological activity.
In preferred embodiments the (34-like polypeptide, as expressed in the cells
in which it
is normally expressed or in other eukaryotic cells, has an estimated molecular
weight of 200
kDa as determined by SDS-PAGE.
CA 02304169 2000-03-22
WO 99/19348 PCT/US98/21391
8
In a preferred embodiment, the (34 polypeptide has one or more of the
following
characteristics:
(i) it has the ability to promote adhesion between connective tissues;
(ii) it has a molecular weight, amino acid composition or other physical
characteristic of [34 subunit of SEQ m NO:1;
(iii) it has an overall sequence similarity of at least 50%, preferably at
least
65%, more preferably at least 70, 80, 90, or 95%, with a [34 polypeptide of
SEQ >D NO:1;
(iv) it can be isolated from human placenta chorionic villi;
(v) it can associate with a3 or y2 subunits;
(vi) it has coiled coils in domains I and II.
(vii) it has at least 5, preferably 6 or 7, and most preferably 8 of the
cysteins
found in native (34 sequence.
Also included in the invention is a composition which includes a (34
polypeptide (or a
nucleic acid which encodes it) and one or more additional components, e.g., a
carrier, diluent,
or solvent. The additional component can be one which renders the composition
for in vitro
and in vivo pharmaceutical or veterinary use. Such uses can include aiding in
wound healing
or promotion of the adhesion of dermal and epidermal cells.
In another aspect, the invention provides an isolated or substantially pure
nucleic acid
having or comprising a nucleotide sequence which encodes a ~i4 polypeptide,
e.g., a (34
polypeptide described herein.
A preferred embodiment of the invention features a nucleic acid molecule
having a
nucleotide sequence at least about 65% sequence identity to a nucleotide
sequence of SEQ ID
N0:2. In other preferred embodiments, the ~i4 polypeptide is encoded by a
nucleic acid
molecule having a nucleotide sequence with at least 70%, preferably 80%, more
preferably
about 90% to about 95%, and even more preferably about 99% sequence identity
to the
nucleotide sequence from SEQ m N0:2. In another preferred embodiment, the (i4
polypeptide is encoded by the nulceic acid molecule of SEQ ID N0:2.
In preferred embodiments, the subject ~i4 nucleic acid will include a
transcriptional
regulatory sequence, e.g. at least one of a transcriptional promoter or
transcriptional enhancer
sequence, operably linked to the [34 gene sequence (also referred to as
LAMB4), e.g., to
render the ~i4 gene sequence suitable for use as an expression vector.
In yet a further preferred embodiment, the nucleic acid which encodes a (34
polypeptide of the invention, hybridizes under stringent conditions to a
nucleic acid probe
corresponding to at least 12 consecutive nucleotides from SEQ ID N0:2, more
preferably to
at least 20 consecutive nucleotides from SEQ ID N0:2.
In a preferred embodiment, the nucleic acid differs by at least one nucleotide
from a
nucleotide sequence of SEQ m N0:2, nucleotides 4686-5870.
The invention also provides a probe or primer which includes or comprises a
substantially purified oligonucleotide. The oligonucleotide includes a region
of nucleotide
CA 02304169 2000-03-22
WO 99/19348 PCT/US98121391
9
sequence which hybridizes under stringent conditions to at least 10
consecutive nucleotides of
sense or antisense sequence from SEQ ID NO: 2, or naturally occurring mutants
thereof. In
preferred embodiments, the probe or primer further includes a label group
attached thereto.
The label group can be, e.g., a radioisotope, a fluorescent compound, an
enzyme, and/or an
enzyme co-factor. Preferably the oligonucleotide is at least 10 and less than
20, 30, 50, 100,
or 150 nucleotides in length.
The invention involves nucleic acids, e.g., RNA or DNA, encoding a (34
polypeptide
of the invention. This includes double stranded nucleic acids as well as
coding and antisense
single strands.
In another aspect, the invention features a cell or purified preparation of
cells which
include a p4 transgene, or which otherwise misexpress a ~4 gene. The cell
preparation can
consist of human or non human cells, e.g., rodent cells, e.g., mouse or rat
cells, rabbit cells, or
pig cells. In preferred embodiments, the cell or cells include a (34
transgene, e.g., a
heterologous form of a (34 gene, e.g., a gene derived from humans (in the case
of a non-
human cell). The X34 transgene can be rnisexpressed, e.g., overexpressed or
underexpressed.
In other preferred embodiments, the cell or cells include a gene which
misexpress an
endogenous (34 gene, e.g., a gene the expression of which is disrupted, e.g.,
a knockout. Such
cells can serve as a model for studying disorders which are related to mutated
or mis-
expressed ~i4 alleles or for use in drug screening.
In another aspect, the invention features a transgenic [34 animal, e.g., a
rodent, e.g., a
mouse or a rat, a rabbit, a pig, a goat, or a cow. In preferred embodiments,
the transgenic
animal includes (and preferably express) a heterologous form of a (34 gene,
e.g., a gene
derived from humans. In a fiutller embodiment, the (34 transgene includes a
tissue specific
promoter, e.g., a milk-specific promoter. In other preferred embodiments, the
animal has an
endogenous (34 gene which is misexpressed, e.g., a knockout. Such a transgenic
animal can
serve as a model for studying disorders which are related to mutated or mis-
expressed (34
alleles or for use in drug screening.
In another aspect, the invention features, a method of promoting adhesion of a
first
tissue element to a second tissue element. The method includes contacting one
or both of the
first tissue element and the second tissue element with an amount of a laminin
molecule
described herein, e.g., Iaminin 12, or'y3 (or a Iaminin trimer which inlcudes
y3), sufficient to
promote adhesion. The method can be performed in vivo, or in vitro. In in vivo
methods the
laminin is administered to the subject. The administration can be directed to
the site where
adhesion is desired, e.g., by topical appication or by injection, or
administered in a systemic
fashion.
A tissue element can be a cell or a multi-cellular on acellular structure.
Examples of
tissue elements include, skin cells, e.g., epidermal or dermal cells, neuronal
cells, e.g., nerve
cells, retinal cells, central or pereipheral nervous system components,
basement membrane or
components of the basement membrane, or any cell or structure which in normal,
non-
CA 02304169 2000-03-22
WO 99/19348 PCT/US98/21391
5 traumatized, or non-diseased tissue is adjascent or adhered to a specific
tissue element recited
herein.
In preferred embodiments the molecule is exogenous (e.g., administered to a
subject)
or is recombinant.
In preferred embodiments the method is an vivo method. In vivo methods can be
10 autologous, allogeneic, or xenogeneic. In autologous methods, adhesion
between two tissue
elements from the subject is promoted. In allogeneic methods, adhesion between
a recipient
tissue element and a donor tissue element from an allogeneic donor is
promoted. In
xenogeneic methods, adhesion between a recipient tissue element and a donor
tissue element
from a xenogeneic donor is promoted. Thus, one element can be a donor tissue
element
which is implanted into a recipient subject.
In preferred embodiments the first tissue is healthy tissue, e.g., skin
tissue, and the
second tissue is wounded, e.g., burned, diseased, traumatized, cut, and the
tissue, or is a
wound bed. For example, the first tissue is skin tissue, from the subject or
from a donor, and
the second tissue is wounded, e.g., burned or abraided tissue.
In preferred embodiments the first tissue and second tissue element are
normally
adhered but have become detached from one another due to trauma, burn or other
physical
injury, disease, or age.
In preferred embodiments: the first tissue element is a dermal cell and the
second
tissue element is an epidermal cell; the first tissue element is a nerve cell
or nerve and the
second tissue element is a cell or structure which in normal, non-traumatized,
or non-diseased
tissue is adjascent or adhered to the nerve cell or nerve; the first tissue
element is a retinal
cell or retina tissue and the second tissue element is a cell or structure
which in normal, non-
traumatized, or nvn-diseased tissue is adjascent or adhered to the a retinal
cell or retina tissue,
the first tissue is a nerve and the second tissue is basement membrane.
The administration of laminin can be repeated.
In another aspect, the invention features a method of promoting wound healing
in a
subject. The method includes administering an amount of a laminin molecule
described
herein, e.g., laminin 12, y3 (or a laminin trimer which inlcudes y3),
sufficient to promote
healing to the wound. The administration can be directed to the site where
healing is desired,
e.g., by topical appication or by injection, or administered in a systemic
fashion.
The wound can be in any tissue, but preferably ina tissue in which the laminin
normally occurs. Examples skin, central or peripheral nervous tissue, tissues
ofthe eye, e.g.,
the retinal, the basement membrane, or any tissue which in normal, non-
traumatized, or non-
diseased tissue is adjascent or adhered thereto.
In preferred embodiments the molecule is exogenous (e.g., administered to a
subject)
or is recombinant.
In preferred embodiments the wound tissue is burned, diseased, traumatized,
cut, the
subject of immune attack, e.g, autoimmune attack, or abraided.
CA 02304169 2000-03-22
WO 99/19348 PCTNS98121391
11
The administration of laminin can be repeated.
In another aspect, the invention features a method of promoting nerve growth
or
regeneration in a subject. The method includes administering an amount of a
laminin
molecule described herein, e.g., laminin 12, or y3 (or a laminin trimer which
inlcudes y3),
sufficient to promote nerve growth or regeneration. The administration can be
directed to the
site where nerve growth or regeneration is desired, e.g., by topical
appication or by injection,
or administered in a systemic fashion.
In preferred embodiments the molecule is exogenous (e.g., administered to a
subject)
or is recombinant.
In preferred embodiments the nerve growth or regeneration is promoted at a
wound
site.
The administration of laminin can be repeated.
In another aspect, the invention provides, a method of determining if a
subject is at risk for a
disorder related to a lesion in or the misexpression of a gene which encodes a
laminin described
herein, e.g., y3 or laminin 12.
Such disorders include, e.g., a disorder associated with the misexpression of
a laminin, e.g.,
laminin 12, or misexpression of the y3 subunit; a disorder of the central or
peripheral nervous system;
a disorder associated with a genetic lesion at chromosome 9, region q31-34;
Fukuyama-type
muscular dystrophy; muscle-eye-brain disease; Walker-Warburg Syndrome
(hydrocephalus, ageria,
and retinal displasia); a retinal disorder, e.g, retinitis pigmentosa-deafness
syndrome {which may be a
subtype of Walker-Warburg Syndrome); a disorder associated with abnormal
levels, e.g.,
abnormally low levels, of adhesion between tissues; a disorder associated with
the basement
membrane; a skin disorder, e.g., an epidermal or dermal, disorder; a disorder
associated with the
testis, spleen, placenta, thymus, ovary, small intestine, lung, or liver.
The method includes one or more of the following:
detecting, in a tissue of the subject, the presence or absence of a mutation
which
affects the expression of the y3 gene, or other gene which encodes a subunit
of laminin 12,
e.g., detecting the presence or absence of a mutation in a region which
controls the expression
of the gene, e.g., a mutation in the S' control region;
detecting, in a tissue of the subject, the presence or absence of a mutation
which alters
the structure of the y3 gene, or other gene which encodes a subunit of laminin
12;
detecting, in a tissue of the subject, the misexpression of they3 gene, or
other gene
which encodes a subunit of laminin 12 at the mRNA level, e.g., detecting a non-
wild type
level of a y3, or an other laminin 12 subunit mRNA ;
detecting, in a tissue of the subject, the misexpression of the y3 gene, or
other gene
which encodes a subunit of laminin 12, at the protein level, e.g., detecting a
non-wild type
level of a y3, or an other laminin 12 subunit polypeptide.
In preferred embodiments the method includes: ascertaining the existence of at
least
one of: a deletion of one or more nucleotides from the y3 gene, or other gene
which encodes a
CA 02304169 2000-03-22
WO 99/19348 PCT/US98/Z1391
12
subunit of laminin 12; an insertion of one or more nucleotides into the gene,
a point mutation,
e.g., a substitution of one or more nucleotides of the gene, a gross
chromosomal -
rearrangement of the gene, e.g., a translocation, inversion, or deletion.
For example, detecting the genetic lesion can include: (i) providing a
probe/primer
including an oligonucleotide containing a region of nucleotide sequence which
hybridizes to a
sense or antisense sequence from SEQ ID N4:4, or naturally occurring mutants
thereof or 5'
or 3' flanking sequences naturally associated with the LAMG3 gene; (ii)
exposing the
probe/primer to nucleic acid of the tissue; and detecting, by hybridization,
e.g., in situ
hybridization, of the probe/primer to the nucleic acid, the presence or
absence of the genetic
lesion.
I S In preferred embodiments detecting the misexpression includes ascertaining
the
existence of at least one of an alteration in the level of a messenger RNA
transcript of the y3
gene, or other gene which encodes a subunit of laminin I2; the presence of a
non-wild type
splicing pattern of a messenger RNA transcript of the y3 gene, or other gene
which encodes a
subunit of laminin 12; or a non-wild type level of Y3, or other subunit of
laminin 12.
Methods of the invention can be used prenatally or to determine if a subject's
offspring will be at risk for a disorder.
In preferred embodiments the method includes determining the structure of a y3
gene,
or other gene which encodes a subunit of laminin 12, an abnormal structure
being indicative
of risk for the disorder.
In preferred embodiments the method includes contacting a sample form the
subject
with an antibody to the laminin protein or a nucleic acid which hybridizes
specifically with
the y3 gene, or other gene which encodes a subunit of laminin 12.
In another aspect, the invention features, a method of promoting adhesion of a
first
tissue element to a second tissue element. The method includes contacting one
or both of the
first tissue element and the second tissue element with an amount of a laminin
molecule
described herein, e.g., (34, sufficient to promote adhesion. The method can be
performed in
vivo, or in vitro. In in vivo methods the laminin is administered to the
subject. The
administration can be directed to the site where adhesion is desired, e.g., by
topical
application or by injection, or administered in a systemic fashion.
A tissue element can be a cell or a multi-cellular on acellular structure.
Examples of
tissue elements include, skin cells, e.g., epidermal or dermal cells, neuronal
cells, e.g., nerve
cells, retinal cells, central or pereipheral nervous system components,
basement membrane or
components of the basement membrane, or any cell or structure which in normal,
non-
traumatized, or non-diseased tissue is adjascent or adhered to a specific
tissue element recited
herein.
In preferred embodiments the molecule is exogenous (e.g., administered to a
subject)
or is recombinant.
CA 02304169 2000-03-22
WO 99/19348 PCT/US98/21391
13
In preferred embodiments the method is an vivo method. In vivo methods can be
autologous, allogeneic, or xenogeneic. In autologous methods, adhesion between
two tissue
elements from the subject is promoted. In allogeneic methods, adhesion between
a recipient
tissue element and a donor tissue element from an allogeneic donor is
promoted. In
xenogeneic methods, adhesion between a recipient tissue element and a donor
tissue element
from a xenogeneic donor is promoted. Thus, one element can be a donor tissue
element
which is implanted into a recipient subject.
In preferred embodiments the first tissue is healthy tissue, e.g., skin
tissue, and the
second tissue is wounded, e.g., burned, diseased, traumatized, cut, and the
tissue, or is a
wound bed. For example, the first tissue is skin tissue, from the subject or
from a donor, and
the second tissue is wounded, e.g., burned or abraided tissue.
In preferred embodiments: the first tissue element is a dermal cell and the
second
tissue element is an epidermal cell; the first tissue element is a nerve cell
or nerve and the
second tissue element is a cell or structure which in normal, non-traumatized,
or non-diseased
tissue is adjascent or adhered to the nerve cell or nerve; the first tissue is
a nerve and the
second tissue is basement membrane.
The administration of laminin can be repeated.
In another aspect, the invention features a method of promoting wound healing
in a
subject. The method includes administering an amount of a laminin molecule
described
herein, e.g., ~i4, sufficient to promote healing to the wound. The
administration can be
directed to the site where healing is desired, e.g., by topical appication or
by injection, or
administered in a systemic fashion.
The wound can be in any tissue, but preferably in a tissue in which the
laminin
normally occurs in fetal or adult life. Examples examples include skin the
basement
membrane.
In preferred embodiments the molecule is exogenous (e.g., administered to a
subject)
or is recombinant.
In preferred embodiments the wound tissue is burned, diseased, traumatized,
cut, the
subject of immune attack, e.g, autoimmune attack, or abraded.
The administration of laminin can be repeated.
In another aspect, the invention features a method of promoting tissue growth,
development, or regeneration in a subject. The method includes administering
an amount of a
laminin molecule described herein, e.g., (34, sufficient to promote tissue
growth,
development, or regeneration in a subject. The administration can be directed
to the site
where nerve growth or regeneration is desired, e.g., by topical appication or
by injection, or
administered in a systemic fashion.
In preferred embodiments the molecule is exogenous (e.g., administered to a
subject)
or is recombinant.
CA 02304169 2000-03-22
WO 99/19348 PCT/US98/21391
14
In preferred embodiments the nerve growth or regeneration is promoted at a
wound
site.
The administration of laminin can be repeated.
In another aspect, the invention provides, a method of determining if a
subject is at risk for a
disorder related to a lesion in or the misexpression of a laminin molecule
described herein, e.g., (34.
Such disorders include, e.g., a disorder associated with the misexpression of
a laminin, e.g., ~i
4; a disorder associated with a genetic lesion at chromosome region 7q22-
q31.2; a developmetnal
disorder; a disorder associated with abnormal levels, e.g., abnormally low
levels, of adhesion
between tissues; a disorder associated with the basement membrane; a skin
disorder, e.g., an
epidermal or dermal, disorder.
The method includes one or more of the following:
detecting, in a tissue of the subject, the presence or absence of a mutation
which
affects the expression of the ~i4 gene, e.g, detecting the presence or absence
of a mutation in a
region which controls the expression of the gene, e.g., a mutation in the 5'
control region;
detecting, in a tissue of the subject, the presence or absence of a mutation
which alters
the structure of the ~i4 gene;
detecting, in a tissue of the subject, the misexpression of the (34 gene,
e.g., detecting a
non-wild type level of a (34 mRNA ;
detecting, in a tissue of the subject, the misexpression of the (34, at the
protein level,
e.g., detecting a non-wild type level of a (34 polypeptide.
In preferred embodiments the method includes: ascertaining the existence of at
least
one of a deletion of one or more nucleotides from the (34; an insertion of one
or more
nucleotides into the gene, a point mutation, e.g., a substitution of one or
more nucleotides of
the (34 gene, a gross chromosomal rearrangement of the (34 gene, e.g., a
translocation,
inversion, or deletion.
For example, detecting the genetic lesion can include: (i) providing a
probe/primer
including an oligonucleotide containing a region of nucleotide sequence which
hybridizes to a
sense or antisense sequence from SEQ ID N0:2, or naturally occurring mutants
thereof or 5'
or 3' flanking sequences naturally associated with the LAMB4 gene; (ii)
exposing the
probelprimer to nucleic acid of the tissue; and detecting, by hybridization,
e.g., in situ
hybridization, of the probe/primer to the nucleic acid, the presence or
absence of the genetic
lesion.
In preferred embodiments: detecting the misexpression includes ascertaining
the
existence of at least one of an alteration in the level of a messenger RNA
transcript of the (3
4; the presence of a non-wild type splicing pattern of a messenger RNA
transcript of the (34;
or a non-wild type level of (34.
Methods of the invention can be used prenatally or to determine if a subject's
offspring will be at risk for a disorder.
CA 02304169 2000-03-22
WO 99/19348 PCT/US98/21391
5 In preferred embodiments the method includes determining the structure of
the a ~i4,
an abnormal structure being indicative of risk for the disorder.
In preferred embodiments the method includes contacting a sample form the
subject
with an antibody to the (34 protein or a nucleic acid which hybridizes
specifically with the ~i4.
In another aspect, the invention features, a method of evaluating a compound
for the
10 ability to interact with, e.g., bind, a subject laminin polypeptide, e.g.,
laminin 12, y3, a
laminin trimer which inlcudes ~3, ~i4, or a laminin trimer which includes (34.
The method
includes: contacting the compound with the subject laminin polypeptide; and
evaluating
ability of the compound to interact with, e.g., to bind or form a complex with
the subject
laminin polypeptide. This method can be performed in vitro, e.g., in a cell
free system, or in
15 vivo, e.g., in a two-hybrid interaction trap assay. This method can be used
to identify
naturally occurring molecules which interact with subject laminin polypeptide.
It can also be
used to find natural or synthetic inhibitors of subject laminin polypeptide.
In another aspect, the invention features, a method of evaluating a compound,
e.g., a
polypeptide, e.g., a naturally occurring ligand of or a naturally occuring
substrate to which
binds a subject laminin polypeptide, e.g., of laminin 12, y3, a laminin trimer
which inlcudes y
3, (34, or a laminin trimer which includes (34, for the ability to bind a
subject laminin
polypeptide. The method includes: contacting the compound with the subject
laminin
polypeptide; and evaluating the ability of the compound to interact with,
e.g., to bind or form
a complex with the subject laminin polypeptide, e.g., the ability of the
compound to inhibit a
subject laminin polypeptide/ligand interaction. This method can be performed
in vitro, e.g.,
in a cell free system, or in vivo, e.g., in a two-hybrid interaction trap
assay. This method can
be used to identify compounds, e.g., fragments or analogs of a subject laminin
polypeptide,
which are agonists or antagonists of a subject laminin polypeptide.
In another aspect, the invention features, a method of evaluating a first
compound,
e.g., a subject laminin polypeptide, e.g., laminin 12, y3, a laminin trimer
which inlcudes Y3, (3
4, or a laminin trimer which includes (34, for the ability to bind a second
compound, e.g., a
second polypeptide, e.g., a naturally occurring ligand of or substrate to
which binds a subject
laminin polypeptide. The method includes: contacting the first compound with
the second
compound; and evaluating the ability of the first compound to form a complex
with the
second compound. This method can be performed in vitro, e.g., in a cell free
system, or in
vivo, e.g., in a two-hybrid interaction trap assay. This method can be used to
identify
compounds, e.g., fragments or analogs of a subject laminin polypeptide, which
are agonists or
antagonists of a subject laminin polypeptide.
In yet another aspect, the invention features a method for evaluating a
compound, e.g.,
for the ability to modulate an interaction, e.g., the ability to inhibit an
interaction of a subject
laminin polypeptide, e.g., of laminin 12, y3, a laminin trimer which inlcudes
y3, (34, or a
laminin trimer which includes [34, with a second polypeptide, e.g., a
polypeptide, e.g., a
natural ligand of the of or a substrate wo which binds a subject laminin
polypeptide, or a
CA 02304169 2000-03-22
WO 99/19348 PCT/US98/Z1391
16
fragment thereof. The method includes the steps of (i) combining the second
polypeptide (or
preferably a purified preparation thereof), a subject laminin polypeptide, (or
preferably a
purified preparation thereof), and a compound, e.g., under conditions wherein
in the absence
of the compound, the second polypeptide, and the subject laminin polypeptide,
are able to
interact, e.g., to bind or form a complex; and (ii) detecting the interaction,
e.g., detecting the
formation (or dissolution) of a complex which includes the second polypeptide,
and the
subject laminin polypeptide. A change, e.g., a decrease or increase, in the
formation of the
complex in the presence of a compound (relative to what is seen in the absence
of the
compound)-is indicative of a modulation, e.g., an inhibition or promotion, of
the interaction
between the second polypeptide, and the subject laminin polypeptide. In
preferred
embodiments: the second polypeptide, and the subject laminin polypeptide, are
combined in
a cell-free system and contacted with the compound; the cell-free system is
selected from a
group consisting of a cell lysate and a reconstituted protein mixture; the
subject laminin
polypeptide, and the second polypeptide are simultaneously expressed in a
cell, and the cell is
contacted with the compound, e.g. in an interaction trap assay (e.g., a two-
hybrid assay).
In yet another aspect, the invention features a two-phase method (e.g., a
method
having an in vitro, e.g., in a cell free system, and an in vivo phase) for
evaluating a
compound, e.g., for the ability to modulate, e.g., to inhibit or promote, an
interaction of a
subject laminin polypeptide subject laminin polypeptide, e.g., of laminin 12,
y3, a laminin
trimer which inlcudes y3, (34, or a laminin trimer which includes [34, with a
second
compound, e.g., a second polypeptide, e.g., a naturally occurring ligand of or
a substrate to
which binds a subject laminin polypeptide, or a fragment thereof. The method
includes steps
(i) and (ii) of the method described immediately above performed in vitro, and
further
includes: (iii) determining if the compound modulates the interaction in
vitro, e.g., in a cell
free system, and if so; (iv) administering the compound to a cell or animal;
and (v)
evaluating the in vivo effect of the compound on an interaction, e.g.,
inhibition, of a subject
laminin polypeptide, with a second polypeptide.
In another aspect, the invention features, a method of evaluating a compound
for the
ability to bind a nucleic acid encoding a subject laminin polypeptide, e.g., a
laminin 12, y3, a
laminin trimer which inlcudes y3, (34, or a laminin trimer which includes (34
polypeptide
regulatory sequence. The method includes: contacting the compound with the
nucleic acid;
and evaluating ability of the compound to form a complex with the nucleic
acid.
In another aspect, the invention features a method of making a y3 or [34
polypeptide,
e.g., a peptide having a non-wild type activity, e.g., an antagonist, agonist,
or super agonist of
a naturally occurring y3 or ~i4 polypeptide, e.g., a naturally occurring Y3 or
X34 polypeptide.
The method includes: altering the sequence of a y3 or ~i4 polypeptide, e.g.,
altering the
sequence , e.g., by substitution or deletion of one or more residues of a non-
conserved region,
a domain or residue disclosed herein, and testing the altered polypeptide for
the desired
activity.
CA 02304169 2000-03-22
WO 99/19348 PCT/US98/Z1391
17
In another aspect, the invention features a method of making a fragment or
analog of a
y3 or (34 polypeptide having a biological activity of a naturally occurring y3
or [34
polypeptide. The method includes: altering the sequence, e.g., by substitution
or deletion of
one or more residues, of a y3 or (34 polypeptide, e.g., altering the sequence
of a non-
conserved region, or a domain or residue described herein, and testing the
altered polypeptide
for the desired activity.
In another aspect, the invention features, a human cell, e.g., a hematopoietic
stem cell,
transformed with nucleic acid which encodes a subject laminin polypeptide,
e.g., a laminin
12, y3, a laminin trimer which inlcudes y3, (34, or a laminin trimer which
includes ~i4.
In another aspect, the invention includes: a y3, ~i4 nucleic acid, e.g., a y3,
/34 nucleic
acid inserted into a vector; a cell transformed with a y3, ~i4 nucleic acid; a
y3, (34 made by
culturing a cell transformed with a y3, (34 nucleic acid; and a method of
making a y3, [34
polypeptide including culturing a a cell transformed with a y3, (34 nucleic
acid.
The inventors have shown that y3 forms laminin 12'in association with a2 and
ail.
However, we are unsure of the chain associations of y3 within other tissues.
It is very likely
that y3 can also associate with y3, a3, a4, and a5; with (32, ~i3, [34 and
(35. Therefore, our
results predict 25 new laminins: laminins 12-37. y3 and [i4 polypetides of the
invention can
be expressed with, assembled with, or administered with other laminin subunits
in any of the
methods described herein. E.g., y3 can be assembled with an a and a (3 subunit
to form a
laminin trimer. [34 can be assembled with an a and a (3 subunit to form a
laminin trimer.
In any treatment or therapeutic application which administers y3, a (32
subunit can
also be administered.
A "heterologous promoter", as used herein is a promoter which is not naturally
associated with a gene or a purified nucleic acid.
A "purified"or "substantially pure" or isolated "preparation" of a
polypeptide, as used
herein, means a polypeptide that has been separated from other proteins,
lipids, and nucleic
acids with which it naturally occurs. Preferably, the polypeptide is also
separated from
substances, e.g., antibodies or gel matrix, e.g., polyacrylamide, which are
used to purify it.
Preferably, the polypeptide constitutes at least 10, 20, 50 70, 80 or 95% dry
weight of the
purified preparation. Preferably, the preparation contains: sufficient
polypeptide to allow
protein sequencing; at least 1, 10, or 100 ~,g of the polypeptide; at least 1,
10, or 100 mg of
the polypeptide.
A "purified preparation of cells", as used herein, refers to, in the case of
plant or
animal cells, an in vitro preparation of cells and not an entire intact plant
or animal. In the
case of cultured cells or microbial cells, it consists of a preparation of at
least 10% and more
preferably 50% of the subject cells.
A "treatment", as used herein, includes any therapeutic treatment, e.g., the
administration of a therapeutic agent or substance, e.g., a drug.
CA 02304169 2000-03-22
WO 99/19348 PCT/US98/21391
18
An "isolated" or " pure nucleic acid", e.g., a substantially pure DNA, is a
nucleic acid
which is one or both of not immediately contiguous with either one or both of
the sequences,
e.g., coding sequences, with which it is immediately contiguous (i.e., one at
the 5' end and
one at the 3' end) in the naturally-occurring genome of the organism from
which the nucleic
acid is derived; or which is substantially free of a nucleic acid sequence
with which it occurs
in the organism from which the nucleic acid is derived. The term includes, for
example, a
recombinant DNA which is incorporated into a vector, e.g., into an
autonomously replicating
plasmid or virus, or into the genomic DNA of a prokaryote or eukaryote, or
which exists as a
separate molecule (e.g., a cDNA or a genomic DNA fragment produced by PCR or
restriction
endonuclease treatment) independent of other DNA sequences. Substantially pure
DNA can
also includes a recombinant DNA which is part of a hybrid gene encoding
sequence.
"Sequence identity or homology", as used herein, refers to the sequence
similarity
between two polypeptide molecules or between two nucleic acid molecules. When
a position
in both of the two compared sequences is occupied by the same base or amino
acid monomer
subunit, e.g., if a position in each of two DNA molecules is occupied by
adenine, then the
molecules are homologous or sequence identical at that position. The percent
of homology or
sequence identity between two sequences is a function of the number of
matching or
homologous identical positions shared by the two sequences divided by the
number of
positions compared x 100. For example, if 6 of 10, of the positions in two
sequences are the
same then the two sequences are 60% homologous or have 60% sequence identity.
By way
of example, the DNA sequences ATTGCC and TATGGC share 50% homology or sequence
identity. Generally, a comparison is made when two sequences are aligned to
give maximum
homology.
The tenors "peptides", "proteins", and "polypeptides" are used interchangeably
herein.
As used herein, the term "transgene" means a nucleic acid sequence {encoding,
e.g.,
one or more subject laminin polypeptides), which is partly or entirely
heterologous, i.e.,
foreign, to the transgenic animal or cell into which it is introduced, or, is
homologous to an
endogenous gene of the transgenic animal or cell into which it is introduced,
but which is
designed to be inserted, or is inserted, into the animal's genome in such a
way as to alter the
genome of the cell into which it is inserted (e.g., it is inserted at a
location which differs from
that of the natural gene or its insertion results in a knockout). A transgene
can include one or
more transcriptional regulatory sequences and any other nucleic acid, such as
introns, that
may be necessary for optimal expression of the selected nucleic acid, all
operably linked to
the selected nucleic acid, and may include an enhancer sequence.
As used herein, the term "transgenic cell" refers to a cell containing a
transgene.
As used herein, a "transgenic animal" is any animal in which one or more, and
preferably essentially all, of the cells of the animal includes a transgene.
The transgene can
be introduced into the cell, directly or indirectly by introduction into a
precursor of the cell,
by way of deliberate genetic manipulation, such as by microinjection or by
infection with a
CA 02304169 2000-03-22
WO 99/19348 PCT/US98/21391
19
recombinant virus. This molecule may be integrated within a chromosome, or it
may be
extrachromosomally replicating DNA. ~ -
As used herein, the term "tissue-specific promoter" means a DNA sequence that
serves as a promoter, i.e., regulates expression of a selected DNA sequence
operably
linked to the promoter, and which effects expression of the selected DNA
sequence in
specific cells of a tissue, such as mammary tissue. The term also covers so-
called "leaky"
promoters, which regulate expression of a selected DNA primarily in one
tissue, but cause
expression in other tissues as well.
"Unrelated to a y3 or (34 amino acid or nucleic acid sequence" means having
less than
30% sequence identity, less than 20% sequence identity, or, preferably, less
than 10%
homology with a naturally occuring y3 or (34 sequence disclosed herein.
A polypeptide has y3 biological activity if it has one or more of the
properties of y3
disclosed herein. A polypeptide has biological activity if it is an
antagonist, agonist, or super-
agonist of a polypeptide having one of the properties of y3 disclosed herein.
A polypeptide has (34 biological activity if it has one or more of the
properties of [34
disclosed herein. A polypeptide has biological activity if it is an
antagonist, agonist, or super-
agonist of a polypeptide having one of the properties of ~i4 disclosed herein.
"Misexpression", as used herein, refers to a non-wild type pattern of gene
expression,
at the RNA or protein level. It includes: expression at non-wild type levels,
i.e., over or under
expression; a pattern of expression that differs from wild type in terms of
the time or stage at
which the gene is expressed, e.g., increased or decreased expression (as
compared with wild
type) at a predetermined developmental period or stage; a pattern of
expression that differs
from wild type in terms of decreased expression (as compared with wild type)
in a
predetermined cell type or tissue type; a pattern of expression that differs
from wild type in
terms of the splicing size, amino acid sequence, post-transitional
modification, or biological
activity of the expressed polypeptide; a pattern of expression that differs
from wild type in
terms of the effect of an environmental stimulus or extracellular stimulus on
expression of the
gene, e.g., a pattern of increased or decreased expression (as compared with
wild type) in the
presence of an increase or decrease in the strength of the stimulus.
Subject, as used herein, can refer to a mammal, e.g., a human, or to an
experimental or
animal or disease model. The subject can also be a non-human animal, e.g., a
horse, cow,
goat, or other domestic animal.
As described herein, one aspect of the invention features a substantially pure
(or
recombinant) nucleic acid which includes a nucleotide sequence encoding a Y3
or ~i4
polypeptide and/or equivalents of such nucleic acids. The term nucleic acid as
used herein
can include fragments and equivalents. The term equivalent refers to
nucleotide sequences
encoding functionally equivalent polypeptides. Equivalent nucleotide sequences
will include
sequences that differ by one or more nucleotide substitutions, additions or
deletions, such as
CA 02304169 2000-03-22
WO 99/19348 PCT/US98/21391
5 allelic variants, and include sequences that differ from the nucleotide
sequences disclosed
herein by degeneracy of the genetic code.
The practice of the present invention will employ, unless otherwise indicated,
conventional techniques of cell biology, cell culture, molecular biology,
transgenic biology,
microbiology, recombinant DNA, and immunology, which are within the skill of
the art.
10 Such techniques are described in the literature. See, for example,
Molecular Cloning A
Laboratory Manual, 2nd Ed., ed. by Sambrook, Fritsch and Maniatis (Cold Spring
Harbor
Laboratory Press: 1989); DNA Cloning, Volumes I and II (D. N. Glover ed.,
1985);
Oligonucleotide Synthesis (M. J. Gait ed., 1984); Mullis et al. U.S. Patent
No: 4,683,195;
Nucleic Acid Hybridization (B. D. Hames & S. J. Higgins eds. 1984);
Transcription And
15 Translation (B. D. Hames & S. J. Higgins eds. 1984); Culture Of Animal
Cells (R. I.
Freshney, Alan R. Liss, Inc., 1987); Immobilized Cells And Enzymes (IRL Press,
1986); B.
Perbal, A Practical Guide To Molecular Cloning (1984); the treatise, Methods
In Enzymology
{Academic Press, Inc., N.Y.); Gene Transfer Vectors For Mammalian Cells (J. H.
Miller and
M. P. Calos eds., 1987, Cold Spring Harbor Laboratory); Methods In Enzymolo~r,
Vols. 154
20 and 155 (Wu et al. eds.), Immunochemical Methods In Cell And Molecular
Biology (Mayer
and Walker, eds., Academic Press, London, 1987); Handbook Of Experimental
Immunology,
Volumes I-IV (D. M. Weir and C. C. Blackwell, eds., 1986); Manipulating the
Mouse
Embryo, (Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., 1986).
Other features and advantages of the invention will be apparent from the
following
detailed description, and from the claims.
DETAILED DESCRIPTION
The drawings are briefly described.
Figure 1 depicts the cDNA sequence for human a2 subunit.
Figure 2 depicts the predicted amino acid sequence for human a2 subunit.
Figure 3 depicts the cDNA sequence for human ø4 subunit.
Figure 4 depicts the predicted amino acid sequence for human ø4 subunit.
Figure 5 depicts an alignment of the amino acid sequence of human ø4 of SEQ ID
NO: 1 and ø4 splice varient of SEQ ID N0:5 and laminin ø1, ø2, and ø3
subunits.
Figure 6 provides a comparision of the similarities of laminin ø4 domains with
the
domains of other known laminin ø subunits.
CA 02304169 2000-03-22
WO 99/19348 PC'T/US98/21391
21
Lanvnin 12 was isolated from human placental chorionic villi. Briefly, human
chorionic placental villi were frozen in liquid nitrogen, ground in a Waring
blender and
washed in 1 M NaCI. The final tissue pellet (200g, wet weight) was suspended
in 1 L of
extraction buffer (50 mM Tris-HCl 50 mM, pH=7.8; NaCI O.SM, EDTA IOmM, 625
mg/1 of
N-ethylmaleimide, 150 mg/1 of phenyhnethylsulphonyl fluoride. The suspension
was
incubated at 4°C with stirring for 48 h. Unless otherwise noted, all
subsequent steps were
performed at 4oC. The soluble fraction was collected following centrifugation
(30000 x g, 60
min) and precipitated by 300g11 of Ammonium Sulfate. The precipitated proteins
were
collected by centrifugation (30000 x g, 60 min) and redissolved into
chromatography buffer
(2M Urea, 25 mM NaCI, 5 mM EDTA, and 50 mM Tris-HCI, pH=7.8). The sample was
then
dialyzed against the same buffer. Following dialysis, 0.5 volumes of buffer
equilibrated
DEAE-cellulose (DE-52, Whatman) was added and the mixture shaken overnight.
Material
not bound to DEAF-cellulose was collected by filtration on a Buchner fimnel
(Whatman filter
4) and precipitated by addition of 300g/1 of ammonium sulfate. The proteins
were collected
by centrifugation (30000 x g, 60 min), redissolved in the Concanavalin-A
buffer (0.5 M
NaCI, 5 mM CaCl2, 5 mM MgCl2, and Tris-HCl 50 mM, pH=7.8) and dialyzed against
the
same buffer overnight. The fraction was applied to a 2.5 x 5 cm Concanavalin-A
sepharose
column (Pharmacia), and unbound material was removed by extensive washing.
Bound
proteins were first eluted with 10 mM a-D- Mannopyrannoside (Sigma, St. Louis,
MO) and
secondly with 1 M a-D-Glucopyrannoside (Sigma, St. Louis, MO). A third elution
with 1M
a-D-Manno-pyrannoside (Sigma, St. Louis, MO) allowed the recovery of the
proteins of
interest. Each fraction was independently concentrated to 10 ml on a AmiconT""
concentrator
(30 kDa membrane) and applied to a 2.5 x 100 cm Sephacryl S-500 column in a
0.5 M NaCI,
50 mM Tris-HCI, pH=7.8 buffer. The fractions of interest were pooled, dialyzed
against
Mono-Q buffer (0.1 M NaCI, 25 mM Tris-HCI, pH=7.8) and applied to the 1 x 5 cm
Mono-Q
column (Pharmacia). Elution was achieved with a 60 ml 0.1-0.5 M NaCI gradient.
The final fraction of interest resulting from the above protocol contains
multiple
laminins. The laminin 12 was resolved from this mixture by SDS-PAGE (3-5%
polyacrylamide) under non-reducing conditions. Six band were resolved. Only
the bands at
approximately 560 kDa and at the top of the gel were shown to be reactive with
polyclonal
anti-laminin antiserum (Sigma, St. Louis, MO).
Laminin 12 was excised, equilibrated and reduced in 10°b 2-me SDS-PAGE
sample
buffer, and resolved by 5 % SDS-PAGE. Three bands were resolved, which were
approximately 205 kDa, 185 kDa, and 170 kDa. The band at 185 kDa reacted with
monoclonal antibody 545, specific to the laminin ~i 1 subunit. Each of the
three bands were
CA 02304169 2000-03-22
WO 99/19348 PCT/US98/21391
22
digested with trypsin and the peptides were resolved by HPLC. The selected
resolves were
subject to peptide sequencing.
Protein sequencing was done according to Aebersold et al. (1987). The complex
laminin 5-laminin 7 was run on a polyacrylamide gel in the presence of 2-
mercaptoethanol
and blotted onto a nitrocellulose membrane (Biorad). The 190 kDa band of ~i2
and the
165 kDa a3 band were separately excised and digested by protease trypsin. The
digested
product was separated by HPLC and one fragment was sequenced on an Applied
Biosystems sequenator (Applied Biosystems, Foster City, CA). The 205 kDa chain
contained a sequence identical to human laminin a2, and was thus identified as
human
laminin a2 subunit. The 185 kDa produced two peptides identical to human (31,
and was
thus identified as human laminin ~i 1 subunit. The band at 170 kDa contained
three
sequences not contained in any known laminin chain. A N-terminal sequence of
the 170
kDa chain was also determined. In addition, the N-terminal sequence was not
identical to
any known laminin sequence.
The cDNA sequences of human yl and r2 were used to probe the National Center
for Biomedical Information (NCBI) dBestTM data base by BLAST search and a
clone was
isolated that was homologous, but not identical to yl and y2. This clone was
extended by
PCR at the 5' end using Marathon cDNA from human placenta from Clonetech (Palo
Alto,
CA). The resulting sequence was determined to be 100% identical to all three
of the 170
kDa band peptide sequences.
Comparison of the nucleotide sequence of the isolated y3 subunit to yl,
demonstrated about 80 % sequence identity.
The human cDNA encoding y3, which is approximately 4710 nucleotides in length,
encodes a protein having an estimated molecular weight of approximately 146
kDa (including
post-translational modifications) and which is approximately 1570 amino acid
residues in
length. The human y3 protein contains a nidogen-binding domain, which can be
found, for
example, from about amino acids 750-755 of SEQ ID N0:3. The y3 amino acid
sequence and
the nucleotide sequence encoding human laminin y3 is shown in SEQ ID N0:3 and
SEQ ID
N0:4, respectively.
By Northern analysis the size of the y3 mRNA is approximately 5 kb, which is
consistent with other laminin y subunits. The y3 mRNA transcript is expressed
in human
tissues including spleen, testis, brain, placenta, lung, and possibly liver.
Chromosomal
mapping using the y3 cDNA sequence indicates that the human y3 gene is located
on
CA 02304169 2000-03-22
WO 99/19348 PCT/US98lZ1391
23
chromosome 9q31-34. The location of y3 on chromosome 9 was confirmed by FISH
analysis
using a 1.3 kb y3 cDNA probe within the predicted domains I and II, which
are~the regions of
the least sequence identity among y subunits. Four human genes associated with
Walker-
Walburg syndrome, Fukuyama muscular dystrophy, retinitis pigmentosa-deafness
syndrome
and Eye, Muscle, Brain disease have also been mapped to chromosome 9q31-34.
Production of a y3 specific antibody and tissue lo~~alization of ~
The 170 kDa (y3) chain was excised from the reducing SDS-PAGE gel described
above and inj ected into a rabbit for antibody production. The resulting serum
(rabbit 16) was
evaluated by Western analysis and shown to react with the 170 kDa y3 chain,
and showed
minor crossreactivity with other laminin chains.
Using immunofluorescence, this antiserum shows localization of y3 to the
following
tissue areas: 1) sites of insertions of nerves into the dermal-epidermal
junction basement
membrane of human skin; 2) the inner nuclear layers, outer nuclear layers, and
outer limiting
membranes of human, mouse and rat neural retina; 3) the Purkinje cells, and
molecular
layers, and (perhaps) the glial cells of the mouse and rat cerebellum; 4) the
neuromuscular
junctions of skeletal muscle; and, S) the taste buds of the cow tongue.
The y3 was also shown to colocalize with protein ubiquitin carboxy terminal
hydrolase I using antibody pGp 9.5. The y3 subunit also appears to colocalize
with the a2
subunit in the same tissue sections.
Isolation and Sequencing of cDNA encodLng Q4
The initial 350 by fragment of human laminin (34 cDNA was amplified by
touchdown RT-PCR from cultured human keratinocyte total RNA using nested
primers
made from the published chicken laminin (3 x 503 by cDNA sequence (as
described in Ybot-
Gonzalez et al. (1995)). Subsequent cDNA clones were isolated by nested PCR
directly from
a human placenta cDNA library packaged in lambda-gtl 1 (Clontech, Palo Alto,
CA) or by
nested PCR directly from human placenta Marathon-Ready cDNA (Clontech, Palo
Alto, CA).
The 5' end of the cDNA was cloned using the 5'-RACE technique from human
placenta total
RNA. The Expanded Long Template PCR System (Boehringer Mannheim Biochemicals,
Indianapolis, Il~ was used for all PCR reactions. The PCR products were
ligated into the
pCR2.1 vector (Invitrogen, San Diego, CA) and recombinant plasmids purified
for
sequencing using the QIAprepT"" kit (Qiagen). The DNA sequence was determined
using
either the Sequenase version 2.0 DNA Sequencing Kit (Amersham) and 35S-dATP or
the
Thermo Sequenase Radiolabeled Terminator Cycle Sequencing kit (Amersham) and
33p_
ddNTPs. At least two independent cDNA subclones were sequenced to rule out Taq
polymerase-generated nucleotide substitutions. In some cases, PCR product
bands were
sequenced directly by cycle sequencing after excision from a TAE-EtBr agarose
gel and
purification using QIAquick Gel Extraction kit (Qiagen).
CA 02304169 2000-03-22
WO 99/19348 PCT/US98l21391
24
The human cDNA encoding a long form (34, which is approximately 5.87 kb,
encodes
a protein having an estimated molecular weight of approximately 200 kDa and
which is
approximately 1761 amino acid residues in length. The human (34 protein
retains the highest
amino acid sequence identity with domains VI and V, which can be found, for
example, from
about amino acids 221-262 and about 263-535 of SEQ ID NO:1. In addition, a
short form,
splice variant of (34, which is approximately 3.84 kb and an estimated
molecular weight of
120 kDa, was also isolated. The splice variant has 132 nucleotide sequence
identical to the
long form of [34, with the sequence diverging at nucleotide 3375 and spliced
into a unique 3'
I 5 untranslated region. The short form cDNA encodes a truncated (34 subunit
which contains
only the short arm of the (34 subunit and is missing the domains necessary for
heterodimerization. The (34 amino acid sequence and the nucleotide sequence
encoding
human laminin (34 is shown in SEQ ID NO:1 and SEQ ID N0:2, respectively.
Northern analysis was performed using total RNA prepared from JAR cell,
cultured
human keratinocytes and human placenta using either Trizol (Gibco BRL,
Bethesda, MD) or
RNeasyT"" (Qiagen) which was denatured, separated on a formaldehyde agarose
gel and
blotted onto nitrocellulose according to standard protocols (Sambrook, et al.,
1989). In
addition, A human multiple tissue northern blot (Clontech, Palo Alto, CA) and
Human
Northern Terntory normal tissue blots and custom fetal skin northern blot
(Invitrogen, San
Diego, CA) were used. Hybridization and washing were performed using
NorthernMAXT""
buffer system (Ambion) by manufacturer's recommended protocols. 32P-dCTP-
labelled
probes were generated from gel-purified restriction fragments using
RediprimeT"' random
primer labeling kit (Amersham). 32P-UTP-labelled antisense RNA probes were
generated
using the RNA transcription kit (Stratagene, La Jolla, CA) from cDNAs
subcloned into
Bluescript II KS+ (Stratagene, La Jolla, CA).
Northern blotting showed that human laminin ~i4 is expressed in JAR cells,
derived
from undeveloped chronic villi and in placenta. By RT-PCR, it is also
expressed in cultured
keratinocytes. Using a northern blot of human fetal skin developmental
progression, (34
subunit (long form) demonstrates strong expression at week twelve of fetal
development and
persists until birth, but expression is barely detectable in adult skin. The
~i4 splice variant,
however, is expressed in various tissues including adult heart, brain, lung,
liver, skeletal
muscle, kidney, spleen, stomach, esophagus, intestine, colon, uterus, bladder,
adipose tissue
and pancreas. Chromosomal mapping with a (34 cDNA probe indicates that the
human (34
subunit is located at locus 7q22-q31.2. The gene encoding (31 is located near,
but not on, this
position of chromosome 7. Statistical analysis of the mapping data using
markers for ~i 1 and
(34 suggest that the gene encoding ~i 1 is linked to both ends of the gene
encoding ~i4. In
addition, neonatal cutis laxa with manifold phenotype has been mapped near,
but not in the
same position, as the gene encoding (34.
CA 02304169 2000-03-22
WO 99/19348 PCTNS98/21391
In situ hybridization to wounded human skin grafted into nude mice suggests
that
laminin ~3 x is expressed in the dermis underneath the migrating epidermal
tongues during
wound closure.
A GenBankTM search using the human nucleotide sequence encoding [34 as shown
in
SEQ ID N0:3 revealed an EST, which corresponds to nucleotides 4686-5870 of the
human
10 nucleotide sequence encoding (34 depicted in SEQ ID N0:3. Alignment of cDNA
encoding
~i4 with the genes encoding human laminin X31 and laminin (32 shows 61 % and
59% sequence
identity, respectively, as shown in Figure 5.
Production of a (~4 specific antibodjr and ti ue local'~a ion of j~
15 Antibodies were raised in rabbits against a 26 kDa bacterial fusion protein
which
corresponds to the 175 amino acid residues of domain VI (e.g., from about
amino acid
residues 221-262) of SEQ ID NO:1. Briefly the fusion protein was made by PCR
amplification of nucleotides 302-785 of the cDNA encoding ~i4 using adapter
primers and
cloned in-frame into the NdeI and SacII sites of pET-15b (Novagen). The fusion
protein
20 construct was confirmed by restriction mapping and DNA sequencing.
Expression of the
fusion protein was induced and separated from E. coli proteins using reducing
SDS-PAGE.
Bands corresponding to the fusion protein were excised from the gel,
equilibrated and
homogenized using Freud's adjuvant. The same fusion protein was also western
blotted on
nitrocellulose, dissolved in DMSO and used to immunize mice for monoclonal
antibody
25 production.
The polyclonal antisera raised in mice against the fusion protein reacted well
with (34,
as well as, (31 and (32 polypeptides.
The (34 subunit contains six domains, and a interruption and a signal peptide.
The
signal peptide and domain VI can be found, for example, at about amino acid
residues 1-262
of SEQ ID NO:1. Domain V can be found, for example, at about amino acid
residues 263-
535 of SEQ ID NO:1. Domains IV and III can be found, for example, at about
amino acid
residues 536-767 and 768-1178 of SEQ ID NO:1, respectively. Domain I can be
found, for
example, at about amino acid residues 1409-1761 of SEQ ID NO:I.
The (34 suburut (long form) is most similar in size and domain structure to
laminin (31
with an amino acid sequence identity of 42.5%. (34 retains the highest levels
of amino acid
identity with the other laminin ~3 subunits in domains VI and V, and the
lowest levels in
domains I and II, as shown in Figure 6. Using the MulticoilT"" program, it was
determined
that only domains I and II of (34 have a high probability of forming coiled
coil structures.
Domains I and II of ~i4 look most similar to human (33. Both [34 and (i3 are
epithelial and the
coiled coil structures in domains I and II dictate the a and y subunits with
which the ~i
CA 02304169 2000-03-22
WO 99/19348 PGT/US98/21391
26
subunits are associated. Thus, it is likely that /34 associates with a3 and
y2, as does the
laminin (33 subunit.
The cDNA encoding the splice variant of ~i4 contains only the short arm of the
(34
subunit, and is missing the EGF repeat of domain III, as shown in Figure 5.
Thus, the (34
polypeptide encoded by the [34 c DNA splice variant is missing the coiled coil
structures in
domains I and II, rendering the short subunit unable to associate into a
laminin heterotrimer.
PCR amplification of human genomic DNA suggest that the exon which encodes the
alternative short form 3' untranslated region is located downstream from the
carboxyl-most
common exon, exon 23, and is splices out of the (34 subunit, long form, by
exon skipping.
Analogs o~r3 and ~
Analogs can differ from naturally occurring y3 or [34 in amino acid sequence
or in
ways that do not involve sequence, or both. Non-sequence modifications include
in vivo or
in vitro chemical derivatization of y3 or ~i4. Non-sequence modifications
include changes in
acetylation, methylation, phosphorylation, carboxylation, or glycosylation.
Preferred analogs include y3 or (34 (or biologically active fiagments thereof)
whose
sequences differ from the wild-type sequence by one or more conservative amino
acid
substitutions or by one or more non-conservative amino acid substitutions,
deletions, or
insertions which do not abolish the Y3 or (34 biological activity.
Conservative substitutions
typically include the substitution of one amino acid for another with similar
characteristics,
e.g., substitutions within the following groups: valine, glycine; glycine,
alanine; valine,
isoleucine, leucine; aspartic acid, glutamic acid; asparagine, glutamine;
serine, threonine;
lysine, arginine; and phenylalanine, tyrosine. Other conservative
substitutions can be taken
from the table below.
CA 02304169 2000-03-22
WO 99/19348 PCT/US98/Z1391
27
TABLE 1
CONSERVATIVE AMINO ACID REPLACEMENTS
For Amino Acid Code Replace with any of
Alanine A D-Ala, Gly, beta-Ala, L-Cys, D-Cys
Arginine R D-Arg, Lys, D-Lys, homo-Arg, D-homo-Arg,
Met, Ile, D-
Met, D-Ile, Orn, D-Orn
Asparagine N D-Asn, Asp, D-Asp, Glu, D-Glu, Gln,
D-Gln
Aspartic Acid D D-Asp, D-Asn, Asn, Glu, D-Glu, Gln,
D-Gln
Cysteine C D-Cys, S-Me-Cys, Met, D-Met, Thr, D-Thr
Glutamine Q D-Gln, Asn, D-Asn, Glu, D-Glu, Asp,
D-Asp
Glutamic Acid E D-GIu, D-Asp, Asp, Asn, D-Asn, Gln,
D-Gln
Glycine G Ala, D-Ala, Pro, D-Pro, (3-Ala, Acp
~i Isoleucine I D-Ile, VaI, D-Val, Leu, D-Leu, Met,
D-Met
I Leucine L D-Leu, Val, D-Val, Leu, D-Leu, Met,
D-Met
Lysine K D-Lys, Arg, D-Arg, homo-Arg, D-
homo-Arg, Met, D-Met, Ile, D-Ile, Orn,
D-Orn
Methionine M D-Met, S-Me-Cys, Ile, D-Ile, Leu, D-Leu,
Val, D-Val
Phenylalanine F D-Phe, Tyr, D-Thr, L-Dopa, His, D-His,
Trp, D-Trp,
Trans-3,4, or 5-phenylproline, cis-3,4,
or 5-phenylproline
Proline P D-Pro, L-I-thioazolidine-4-carboxylic
acid, D-or L-1-
oxazolidine-4-carboxylic acid
Serine S D-Ser, Thr, D-Thr, allo-Thr, Met, D-Met,
Met(O), D-
Met(O), L-Cys, D-Cys
Threonine . T D-Thr, Ser, D-Ser, allo-Thr, Met, D-Met,
Met(O), D-
Met(O), Val, D-Val
Tyrosine Y D-Tyr, Phe, D-Phe, L-Dopa, His, D-His
Valine V D-Val, Leu, D-Leu, Ile, D-Ile, Met,
D-Met
Other analogs within the invention are those with modifications which increase
peptide stability; such analogs may contain, for example, one or more non-
peptide bonds
(which replace the peptide bonds) in the peptide sequence. Also included are:
analogs that
include residues other than naturally occurring L-amino acids, e.g., D-amino
acids or non-
naturally occurring or synthetic amino acids, e.g., [i or y amino acids; and
cyclic analogs.
Geny Theranv
CA 02304169 2000-03-22
WO 99/19348 PCTNS98/Z1391
zs
The gene constructs of the invention can also be used as a part of a gene
therapy
protocol to deliver nucleic acids encoding either an agonistic or antagonistic
form of a Y3 ar (3
4 polypeptide. The invention features expression vectors for in vivo
transfection and
expression of a y3 or ~i4 polypeptide in particular cell types so as to
reconstitute the function
of, or alternatively, antagonize the function of y3 or (i4 polypeptide in a
cell in which that
polypeptide is misexpressed. Expression constructs of y3 or (34 polypeptides,
may be
administered in any biologically effective carrier, e.g. any formulation or
composition
capable of effectively delivering the Y3 or ~i4 gene to cells in vivo.
Approaches include
insertion of the subject gene in viral vectors including recombinant
retroviruses, adenovirus,
adeno-associated virus, and herpes simplex virus-l, or recombinant bacterial
or eukaryotic
plasmids. Viral vectors transfect cells directly; plasmid DNA can be delivered
with the help
of, for example, cationic liposomes (lipofectin) or derivatized (e.g. antibody
conjugated),
polylysine conjugates, gramacidin S, artificial viral envelopes or other such
intracellular
carriers, as well as direct injection of the gene construct or CaP04
precipitation carried out in
vivo.
A preferred approach for in vivo introduction of nucleic acid into a cell is
by use of a
viral vector containing nucleic acid, e.g. a cDNA, encoding a y3 or (34
polypeptide. Infection
of cells with a viral vector has the advantage that a large proportion of the
targeted cells can
receive the nucleic acid. Additionally, molecules encoded within the viral
vector, e.g., by a
cDNA contained in the viral vector, are expressed efficiently in cells which
have taken up
viral vector nucleic acid.
Retrovirus vectors and adeno-associated virus vectors can be used as a
recombinant
gene delivery system for the transfer of exogenous genes in vivo, particularly
into humans.
These vectors provide efficient delivery of genes into cells, and the
transferred nucleic acids
are stably integrated into the chromosomal DNA of the host. The development of
specialized
cell lines (termed "packaging cells") which produce only replication-defective
retroviruses
has increased the utility of retroviruses for gene therapy, and defective
retroviruses are
characterized for use in gene transfer for gene therapy purposes (for a review
see Miller, A.D.
( 1990) Blood 76:271 ). A replication defective retrovirus can be packaged
into virions which
can be used to infect a target cell through the use of a helper virus by
standard techniques.
Protocols for producing recombinant retroviruses and for infecting cells in
vitro or in vivo
with such viruses can be found in Cu_r_rent Protocols in Molecul r ioloev,
Ausubel, F.M. et
aI. (eds.) Greene Publishing Associates, (1989), Sections 9.10-9.14 and other
standard
laboratory manuals. Examples of suitable retroviruses include pLJ, pZIP, pWE
and pEM
which are known to those skilled in the art. Examples of suitable packaging
virus lines for
preparing both ecotropic and amphotropic retroviral systems include yrCrip,
y~Cre, yr2 and yr
Am. Retroviruses have been used to introduce a variety of genes into many
different cell
types, including epithelial cells, in vitro and/or in vivo (see for example
Eglitis, et al. (1985)
Science 230:1395-1398; Danos and Mulligan (1988) Proc. Natl. Acad Sci. USA
85:6460-
CA 02304169 2000-03-22
WO 99/19348 PCT/US98/21391
29
6464; Wilson et al. (1988) Proc. Natl. Acad. Sci. USA 85:3014-3018; Armentano
et al. (1990)
Proc. Natl. Acad. Sci. USA 87:6141-6145; Huber et al. ( 1991 ) Proc. Natl.
Acad Sci. USA
88:8039-8043; Ferry et al. (1991) Proc. Natl. Acad. Sci. USA 88:8377-8381;
Chowdhury et
al. (1991) Science 254:1802-1805; van Beusechem et al. (1992) Proc. Natl.
Acad. Sci. USA
89:7640-7644; Kay et al. (1992) Human Gene Therapy 3:641-647; Dai et al.
(1992) Proc.
Natl. Acad Sci. USA 89:10892-10895; Hwu et al. (1993) J. Immunol. 150:4104-
4115; U.S.
Patent No. 4,868,116; U.S. Patent No. 4,980,286; PCT Application WO 89/07136;
PCT
Application WO 89/02468; PCT Application WO 89/05345; and PCT Application WO
92/07573).
Another viral gene delivery system useful in the present invention utilizes
adenovirus-
derived vectors. The genome of an adenovirus can be manipulated such that it
encodes and
expresses a gene product of interest but is inactivated in terms of its
ability to replicate in a
normal lytic viral life cycle. See, for example, Berkner et al. (1988)
BioTechnigues 6:616;
Rosenfeld et al. (1991) Science 252:431-434; and Rosenfeld et al. (1992) Cell
68:143-155.
Suitable adenoviral vectors derived from the adenovirus strain Ad type 5 d1324
or other
strains of adenovirus (e.g., Ad2, Ad3, Ad7 etc.) are known to those skilled in
the art.
Recombinant adenoviruses can be advantageous in certain circumstances in that
they are not
capable of infecting nondividing cells and can be used to infect a wide
variety of cell types,
including epithelial cells (Rosenfeld et al. (1992) cited supra). Furthermore,
the virus particle
is relatively stable and amenable to purification and concentration, and as
above, can be
modified so as to affect the spectrum of infectivity. Additionally, introduced
adenoviral
DNA (and foreign DNA contained therein) is not integrated into the genome of a
host cell but
remains episomal, thereby avoiding potential problems that can occur as a
result of insertional
mutagenesis in situations where introduced DNA becomes integrated into the
host genome
(e.g., retroviral DNA). Moreover, the carrying capacity of the adenoviral
genome for foreign
DNA is large (up to 8 kilobases) relative to other gene delivery vectors
(Berkner et al. cited
supra; Haj-Ahmand and Graham (1986) J. Virol. 57:267).
Yet another viral vector system useful for delivery of the subject gene is the
adeno-
associated virus (AAV). Adeno-associated virus is a naturally occurring
defective virus that
requires another virus, such as an adenovirus or a herpes virus, as a helper
virus for efficient
replication and a productive life cycle. (For a review see Muzyczka et al.
Curr. Topics in
Micro. and Immunol. (1992) 158:97-129). It is also one of the few viruses that
may integrate
its DNA into non-dividing cells, and exhibits a high frequency of stable
integration (see for
example Flotte et al. (1992) Am. J. Respir. Cell. Mol. Biol. 7:349-356;
Samulski et al. (1989)
J. Virol. 63:3822-3828; and McLaughlin et al. (1989) J. Virol. 62:1963-1973).
Vectors
containing as little as 300 base pairs of AAV can be packaged and can
integrate. Space for
exogenous DNA is limited to about 4.5 kb. An AAV vector such as that described
in
Tratschin et al. (1985) Mol. Cell. Biol. 5:3251-3260 can be used to introduce
DNA into cells.
A variety of nucleic acids have been introduced into different cell types
using AAV vectors
CA 02304169 2000-03-22
WO 99/19348 PCTNS98/21391
5 (see for example Hermonat et al. ( 1984) Proc. Natl. Acad Sci. USA 81:6466-
6470; Tratschin
et al. (1985) Mol. Cell. Biol. 4:2072-2081; Wondisford et al. (1988) Mol.
Endocrinol. 2~32-
39; Tratschin et al. (1984) J. Yirol. 51:611-619; and Flotte et al. (1993) J.
Biol. Chem.
268:3781-3790).
In addition to viral transfer methods, such as those illustrated above, non-
viral
10 methods can also be employed to cause expression of a y3 or (34 polypeptide
in the tissue of
an animal. Most nonviral methods of gene transfer rely on normal mechanisms
used by
mammalian cells for the uptake and intracellular transport of macromolecules.
In preferred
embodiments, non-viral gene delivery systems of the present invention rely on
endocytic
pathways for the uptake of the subject y3 or ~i4 gene by the targeted cell.
Exemplary gene
15 delivery systems of this type include liposomal derived systems, poly-
lysine conjugates, and
artificial viral envelopes.
In a representative embodiment, a gene encoding a y3 or (34 polypeptide can be
entrapped in liposomes bearing positive charges on their surface (e.g.,
lipofectins) and
(optionally) which are tagged with antibodies against cell surface antigens of
the target tissue
20 (Mizuno et al. (1992) No Shinkei Geka 20:547-551; PCT publication
W091/06309;
Japanese patent application 1047381; and European patent publication EP-A-
43075).
In clinical settings, the gene delivery systems for the therapeutic y3 or ~i4
gene can be
introduced into a patient by any of a number of methods, each of which is
familiar in the art.
For instance, a pharmaceutical preparation of the gene delivery system can be
introduced
25 systemically, e.g. by intravenous injection, and specific transduction of
the protein in the
target cells occurs predominantly from specificity of transfection provided by
the gene
delivery vehicle, cell-type or tissue-type expression due to the
transcriptional regulatory
sequences controlling expression of the receptor gene, or a combination
thereof. In other
embodiments, initial delivery of the recombinant gene is more limited with
introduction into
30 the animal being quite localized. For example, the gene delivery vehicle
can be introduced by
catheter (see U.S. Patent 5,328,470) or by Stereotactic injection (e.g. Chen
et al. (1994) PNAS
91: 3054-3057).
The pharmaceutical preparation of the gene therapy construct can consist
essentially
of the gene delivery system in an acceptable diluent, or can comprise a slow
release matrix in
which the gene delivery vehicle is imbedded. Alternatively, where the complete
gene
delivery system can be produced in tact from recombinant cells, e.g.
retroviral vectors, the
pharmaceutical preparation can comprise one or more cells which produce the
gene delivery
system.
Transgenic nimal_s
The invention includes transgenic animals which include cells (of that animal)
which contain a y3 or (34 transgene and which preferably (though optionally)
express (or
misexpress) an endogenous or exogenous y3 or ~i4 gene in one or more cells in
the animal.
CA 02304169 2000-03-22
WO 99/19348 PCT/US98/21391
31
The y3 or (34 transgene can encode the wild-type form of the protein, or can
encode homologs
thereof, including both agonists and antagonists, as well as antisense
constructs: In preferred
embodiments, the expression of the transgene is restricted to specific subsets
of cells, or
tissues utilizing, for example, cis-acting sequences that control expression
in the desired
pattern. Tissue-specific regulatory sequences and conditional regulatory
sequences can be
used to control expression of the transgene in certain spatial patterns, e.g.,
to restrict
production to the milk or other secreted product of the animal.
Fragments of a protein can be produced in several ways, e.g., recombinantly,
by
proteolytic digestion, or by chemical synthesis. Internal or terminal
fragments of a
polypeptide can be generated by removing one or more nucleotides from one end
(for a
terminal fragment) or both ends (for an internal fragment) of a nucleic acid
which encodes the
polypeptide. Expression of the mutagenized DNA produces polypeptide fragments.
Digestion with "end-nibbling" endonucleases can thus generate DNA's which
encode an array
of fragments. DNA's which encode fragments of a protein can also be generated
by random
shearing, restriction digestion or a combination of the above-discussed
methods.
Fragments can also be chemically synthesized using techniques known in the art
such
as conventional Merrifield solid phase f Moc or t-Boc chemistry. For example,
peptides of
the present invention may be arbitrarily divided into fragments of desired
length with no
overlap of the fragments, or divided into overlapping fragments of a desired
length.
Amino acid sequence variants of a protein can be prepared by random
mutagenesis of
DNA which encodes a protein or a particular domain or region of a protein.
Useful methods
include PCR mutagenesis and saturation mutagenesis. A library of random amino
acid
sequence variants can also be generated by the synthesis of a set of
degenerate
oligonucleotide sequences. (Methods for screening proteins in a library of
variants are
elsewhere herein.)
PCR Mutagenesis
In PCR mutagenesis, reduced Taq polymerise fidelity is used to introduce
random
mutations into a cloned fragment of DNA (Leung et al., 1989, Technique 1:11-
15). This is a
very powerful and relatively rapid method of introducing random mutations. The
DNA
region to be mutagenized is amplified using the polymerise chain reaction
(PCR) under
conditions that reduce the fidelity of DNA synthesis by Taq DNA polymerise,
e.g., by using
a dGTP/dATP ratio of five and adding Mn2+ to the PCR reaction. The pool of
amplified
CA 02304169 2000-03-22
WO 99/19348 PCT/US981Z1391
32
DNA fragments are inserted into appropriate cloning vectors to provide random
mutant
libraries.
Saturation Mutagenesis
Saturation mutagenesis allows for the rapid introduction of a large number of
single
base substitutions into cloned DNA fragments (Mayers et al., 1985, Science
229:242). This
technique includes generation of mutations, e.g., by chemical treatment or
irradiation of
single-stranded DNA in vitro, and synthesis of a complimentary DNA strand. The
mutation
frequency can be modulated by modulating the severity of the treatment, and
essentially all
possible base substitutions can be obtained. Because this procedure does not
involve a
genetic selection for mutant fragments both neutral substitutions, as well as
those that alter
function, are obtained. The distribution of point mutations is not biased
toward conserved
sequence elements.
Degenerate Oligonucleotides
A library of homologs can also be generated from a set of degenerate
oligonucleotide
sequences. Chemical synthesis of a degenerate sequences can be carried out in
an automatic
DNA synthesizer, and the synthetic genes then ligated into an appropriate
expression vector.
The synthesis of degenerate oligonucleotides is known in the art (see for
example, Narang,
SA (1983) Tetrahedron 39:3; Itakura et al. (1981) Recombinant DNA, Proc 3rd
Cleveland
Sympos. Macromolecules, ed. AG Walton, Amsterdam: Elsevier pp273-289; Itakura
et al.
(1984) Annu. Rev. Biochem. 53:323; Itakura et al. (1984) Science 198:1056; Ike
et al. (1983)
Nucleic Acid Res. 11:477. Such techniques have been employed in the directed
evolution of
other proteins (see, for example, Scott et al. (1990) Science 249:386-390;
Roberts et al.
(1992) PNAS 89:2429-2433; Devlin et al. (1990) Science 249: 404-406; Cwirla et
al. (1990)
PNAS 87: 6378-6382; as well as U.S. Patents Nos. 5,223,409, 5,198,346, and
5,096,815).
Non-random or directed, mutagenesis techniques can be used to provide specific
sequences or mutations in specific regions. These techniques can be used to
create variants
which include, e.g., deletions, insertions, or substitutions, of residues of
the known amino
acid sequence of a protein. The sites for mutation can be modified
individually or in series,
e.g., by (1) substituting first with conserved amino acids and then with more
radical choices
depending upon results achieved, (2) deleting the target residue, or (3)
inserting residues of
the same or a different class adjacent to the located site, or combinations of
options 1-3.
Alanine Scanning Mutagenesis
CA 02304169 2000-03-22
WO 99/19348 PCT/US98/21391
33
S Alanine scanning mutagenesis is a useful method for identification of
certain residues
or regions of the desired protein that are preferred locations or domains for
mutagenesis,-
Cunningham and Wells (Science 244:1081-1085, 1989}. In alanine scanning, a
residue or
group of target residues are identified (e.g., charged residues such as Arg,
Asp, His, Lys, and
Glu) and replaced by a neutral or negatively charged amino acid (most
preferably alanine or
polyalanine). Replacement of an amino acid can affect the interaction of the
amino acids
with the surrounding aqueous environment in or outside the cell. Those domains
demonstrating functional sensitivity to the substitutions are then refined by
introducing
further or other variants at or for the sites of substitution. Thus, while the
site for introducing
an amino acid sequence variation is predetermined, the nature of the mutation
per se need not
be predetermined. For example, to optimize the performance of a mutation at a
given site,
alanine scanning or random mutagenesis may be conducted at the target codon or
region and
the expressed desired protein subunit variants are screened for the optimal
combination of
desired activity.
Oligonucleotide-Mediated Mutagenesis
Oligonucleotide-mediated mutagenesis is a useful method for preparing
substitution,
deletion, and insertion variants of DNA, see, e.g., Adehnan et al., (DNA
2:183, 1983).
Briefly, the desired DNA is altered by hybridizing an oligonucleotide encoding
a mutation to
a DNA template, where the template is the single-stranded form of a plasmid or
bacteriophage containing the unaltered or native DNA sequence of the desired
protein. After
hybridization, a DNA polymerase is used to synthesize an entire second
complementary
strand of the template that will thus incorporate the oligonucleotide primer,
and will code for
the selected alteration in the desired protein DNA. Generally,
oligonucleotides of at least 25
nucleotides in length are used. An optimal oligonucleotide will have 12 to 15
nucleotides
that are completely complementary to the template on either side of the
nucleotides) coding
for the mutation. This ensures that the oligonucleotide will hybridize
properly to the single-
stranded DNA template molecule. The oligonucleotides are readily synthesized
using
techniques known in the art such as that described by Crea et al. (Proc. Natl.
Acad. Sci. USA,
75: 5765[1978]).
Cassette Mutagenesis
Another method for preparing variants, cassette mutagenesis, is based on the
technique described by Wells et al. (Gene, 34:315[1985]). The starting
material is a plasmid
(or other vector) which includes the protein subunit DNA to be mutated. The
codon(s) in the
protein subunit DNA to be mutated are identified. There must be a unique
restriction
endonuclease site on each side of the identified mutation site(s). If no such
restriction sites
exist, they may be generated using the above-described oligonucleotide-
mediated
mutagenesis method to introduce them at appropriate locations in the desired
protein subunit
CA 02304169 2000-03-22
WO 99/19348 PCT/US98/21391
34
DNA. After the restriction sites have been introduced into the plasmid, the
plasmid is cut at
these sites to linearize it. A double-stranded oligonucleotide encoding the
sequence of the
DNA between the restriction sites but containing the desired mutations) is
synthesized using
standard procedures. The two strands are synthesized separately and then
hybridized together
using standard techniques. This double-stranded oligonucleotide is referred to
as the cassette.
This cassette is designed to have 3' and 5' ends that are comparable with the
ends of the
linearized plasmid, such that it can be directly ligated to the plasmid. This
plasmid now
contains the mutated desired protein subunit DNA sequence.
Combinatorial Mutagenesis
Combinatorial mutagenesis can also be used to generate mutants. E.g., the
amino acid
sequences for a group of homologs or other related proteins are aligned,
preferably to
promote the highest homology possible. All of the amino acids which appear at
a given
position of the aligned sequences can be selected to create a degenerate set
of combinatorial
sequences. The variegated library of variants is generated by combinatorial
mutagenesis at
the nucleic acid level, and is encoded by a variegated gene library. For
example, a mixture of
synthetic oligonucleotides can be enzymatically ligated into gene sequences
such that the
degenerate set of potential sequences are expressible as individual peptides,
or alternatively,
as a set of larger fusion proteins containing the set of degenerate sequences.
Primalv High-Through-Put Me hod for greening Libraries of Peg it de Fra n . or
Various techniques are known in the art for screening generated mutant gene
products.
Techniques for screening large gene libraries often include cloning the gene
library into
replicable expression vectors, transforming appropriate cells with the
resulting library of
vectors, and expressing the genes under conditions in which detection of a
desired activity,
e.g., in this case, binding to other laminin subunits, assembly into a
trimeric laminin
molecules, binding to natural ligands or substrates, facilitates relatively
easy isolation of the
vector encoding the gene whose product was detected. Each of the techniques
described
below is amenable to high through-put analysis for screening large numbers of
sequences
created, e.g., by random mutagenesis techniques.
Two Hybrid Systems
Two hybrid assays such as the system described above (as with the other
screening
methods described herein), can be used to identify fragments or analogs. These
may include
agonists, superagonists, and antagonists. (The subject protein and a protein
it interacts with
are used as the bait protein and fish proteins.) .
Display Libraries
CA 02304169 2000-03-22
WO 99/19348 PCTNS98/Z1391
5 In one approach to screening assays, the candidate peptides are displayed on
the
surface of a cell or viral particle, and the ability of particular cells or
viral particles to bind an
appropriate receptor protein via the displayed product is detected in a
"panning assay". For
example, the gene library can be cloned into the gene for a surface membrane
protein of a
bacterial cell, and the resulting fusion protein detected by panning (Ladner
et al., WO
10 88/06630; Fuchs et al. (1991) BiolTechnology 9:1370-1371; and Goward et al.
(1992) TIBS
18:136-140). In a similar fashion, a detectably labeled ligand can be used to
score for
potentially functional peptide homologs. Fluorescently labeled ligands, e.g.,
receptors, can be
used to detect homolog which retain ligand-binding activity. The use of
fluorescently labeled
ligands, allows cells to be visually inspected and separated under a
fluorescence microscope,
15 or, where the morphology of the cell permits, to be separated by a
fluorescence-activated cell
sorter.
A gene library can be expressed as a fusion protein on the surface of a viral
particle.
For instance, in the filamentous phage system, foreign peptide sequences can
be expressed on
the surface of infectious phage, thereby conferring two significant benefits.
First, since these
20 phage can be applied to affinity matrices at concentrations well over 1013
phage per milliliter,
a large number of phage can be screened at one time. Second, since each
infectious phage
displays a gene product on its surface, if a particular phage is recovered
from an affinity
matrix in low yield, the phage can be amplified by another round of infection.
The group of
almost identical E. coli filamentous phages M13, fd., and fl are most often
used in phage
25 display libraries. Either of the phage gIII or gVIII coat proteins can be
used to generate
fusion proteins without disrupting the ultimate packaging of the viral
particle. Foreign
epitopes can be expressed at the NH2-terminal end of pIII and phage bearing
such epitopes
recovered from a large excess of phage lacking this epitope (Ladner et al. PCT
publication
WO 90/02909; Garrard et al., PCT publication WO 92/09690; Marks et al. (1992)
J. Biol.
30 Chem. 267:16007-16010; Griffiths et al. (1993} EMBO J 12:725-734; Clackson
et al. (1991)
Nature 352:624-628; and Barbas et al. (1992) PNAS 89:4457-4461).
A common approach uses the maltose receptor of E. coli (the outer membrane
protein,
Lama) as a peptide fusion partner (Charbit et al. (1986) EMBO 5, 3029-3037).
Oligonucleotides have been inserted into plasmids encoding the Lama gene to
produce
35 peptides fused into one of the extracellular loops of the protein. These
peptides are available
for binding to ligands, e.g., to antibodies, and can elicit an immune response
when the cells
are administered to animals. Other cell surface proteins, e.g., OmpA (Schorr
et al. (1991)
Vaccines 91, pp. 387-392), PhoE (Agterberg, et al. {1990) Gene 88, 37-45}, and
PAL (Fuchs
et al. (1991) BiolTech 9, 1369-1372), as well as large bacterial surface
structures have served
as vehicles for peptide display. Peptides can be fused to pilin, a protein
which polymerizes to
form the pilus-a conduit for interbacterial exchange of genetic information
(Thiry et al.
(1989) Appl. Environ. Microbiol. 55, 984-993). Because of its role in
interacting with other
cells, the pilus provides a useful support for the presentation of peptides to
the extracellular
CA 02304169 2000-03-22
WO 99/19348 PCT/US98/21391
36
environment. Another large surface structure used for peptide display is the
bacterial motive
organ, the flagellum. Fusion of peptides to the subunit protein flagellin
offers a dense array
of may peptides copies on the host cells (Kuwajima et al. (1988) BiolTech. 6,
1080-1083).
Surface proteins of other bacterial species have also served as peptide fusion
partners.
Examples include the Staphylococcus protein A and the outer membrane protease
IgA of
Neisseria (Hansson et al. (1992) J. Bacteriol. 174, 4239-4245 and Klauser et
al. (1990)
EMBO J. 9, 1991-1999}.
In the filamentous phage systems and the Lama system described above, the
physical
link between the peptide and its encoding DNA occurs by the containment of the
DNA within
a particle (cell or phage) that carries the peptide on its surface. Capturing
the peptide captures
the particle and the DNA within. An alternative scheme uses the DNA-binding
protein LacI
to form a link between peptide and DNA (Cull et al. (1992) PNAS USA 89:1865-
1869). This
system uses a plasmid containing the LacI gene with an oligonucleotide cloning
site at its 3'-
end. Under the controlled induction by arabinose, a LacI-peptide fusion
protein is produced.
This fusion retains the natural ability of LacI to bind to a short DNA
sequence known as
LacO operator (LacO). By installing two copies of LacO on the expression
plasmid, the
LacI-peptide fusion binds tightly to the plasmid that encoded it. Because the
plasmids in
each cell contain only a single oligonucleotide sequence and each cell
expresses only a single
peptide sequence, the peptides become specifically and stably associated with
the DNA
sequence that directed its synthesis. The cells of the library are gently
lysed and the peptide-
DNA complexes are exposed to a matrix of immobilized receptor to recover the
complexes
containing active peptides. The associated plasmid DNA is then reintroduced
into cells for
amplification and DNA sequencing to determine the identity of the peptide
ligands. As a
demonstration of the practical utility of the method, a large random library
of dodecapeptides
was made and selected on a monoclonal antibody raised against the opioid
peptide dynorphin
B. A cohort of peptides was recovered, all related by a consensus sequence
corresponding to
a six-residue portion of dynorphin B. (Cull et al. (1992) Proc. Natl. Aced.
Sci. U.S.A. 89-
1869)
This scheme, sometimes referred to as peptides-on-plasmids, differs in two
important
ways from the phage display methods. First, the peptides are attached to the C-
terminus of
the fusion protein, resulting in the display of the library members as
peptides having free
carboxy termini. Both of the filamentous phage coat proteins, pIII and pVIII,
are anchored to
the phage through their C-termini, and the guest peptides are placed into the
outward-
extending N-terminal domains. In some designs, the phage-displayed peptides
are presented
right at the amino terminus of the fusion protein. (Cwirla, et al. (1990)
Proc. Natl. Aced. Sci.
U.S A. 87, 6378-6382) A second difference is the set of biological biases
affecting the
population of peptides actually present in the libraries. The LacI fusion
molecules are
confined to the cytoplasm of the host cells. The phage coat fusions are
exposed briefly to the
cytoplasm during translation but are rapidly secreted through the inner
membrane into the
CA 02304169 2000-03-22
WO 99/19348 PGT/US98/21391
37
periplasmic compartment, remaining anchored in the membrane by their C-
terminal
hydrophobic domains, with the N-termini, containing the peptides, protruding
into the
periplasm while awaiting assembly into phage particles. The peptides in the
LacI and phage
libraries may differ significantly as a result of their exposure to different
proteoLytic activities.
The phage coat proteins require transport across the inner membrane and signal
peptidase
processing as a prelude to incorporation into phage. Certain peptides exert a
deleterious
effect on these processes and are underrepresented in the libraries (Gallop et
al. (1994) J.
Med. Chem. 37(9):1233-1251). These particular biases are not a factor in the
LacI display
system.
The number of small peptides available in recombinant random libraries is
enormous.
Libraries of 10~-109 independent clones are routinely prepared. Libraries as
large as 1011
recombinants have been created, but this size approaches the practical limit
for clone
libraries. This limitation in Library size occurs at the step of transforming
the DNA
containing randomized segments into the host bacterial cells. To circumvent
this limitation,
an in vitro system based on the display of nascent peptides in polysome
complexes has
recently been developed. This display library method has the potential of
producing libraries
3-6 orders of magnitude larger than the currently available phage/phagemid or
plasmid
Libraries. Furthermore, the construction of the libraries, expression of the
peptides, and
screening, is done in an entirely cell-free format.
In one application of this method (Gallop et a1. (1994) J. Med Chem.
37(9):1233-
1251 ), a molecular DNA library encoding 1012 decapeptides was constructed and
the library
expressed in an E. coli S30 in vitro coupled transcription/translation system.
Conditions were
chosen to stall the ribosomes on the mRNA, causing the accumulation of a
substantial
proportion of the RNA in polysomes and yielding complexes containing nascent
peptides still
linked to their encoding RNA. The polysomes are sufficiently robust to be
affinity purified
on immobilized receptors in much the same way as the more conventional
recombinant
peptide display Libraries are screened. RNA from the bound complexes is
recovered,
converted to cDNA, and amplified by PCR to produce a template for the next
round of
synthesis and screening. The polysome display method can be coupled to the
phage display
system. Following several rounds of screening, cDNA from the enriched pool of
polysomes
was cloned into a phagemid vector. This vector serves as both a peptide
expression vector,
displaying peptides fused to the coat proteins, and as a DNA sequencing vector
for peptide
identification. By expressing the polysome-derived peptides on phage, one can
either
continue the affinity selection procedure in this format or assay the peptides
on individual
clones for binding activity in a phage ELISA, or for binding specificity in a
completion phage
ELISA (Barnet, et al. (1992) Anal. Biochem 204,357-364). To identify the
sequences of the
active peptides one sequences the DNA produced by the phagemid host.
CA 02304169 2000-03-22
WO 99/19348 PCT/US98/21391
38
The high through-put assays described above can be followed by secondary
screens in
order to identify further biological activities which will, e.g., allow one
skilled in the art-to
differentiate agonists from antagonists. The type of a secondary screen used
will depend on
the desired activity that needs to be tested. For example, an assay can be
developed in which
the ability to inhibit an interaction between a protein of interest and its
respective ligand can
be used to identify antagonists from a group of peptide fragments isolated
though one of the
primary screens described above.
Therefore, methods for generating fragments and analogs and testing them for
activity
are known in the art. Once the core sequence of interest is identified, it is
routine to perform
for one skilled in the art to obtain analogs and fragments.
P~ntide Mimetics
The invention also provides for reduction of the protein binding domains of
the
subject y3 or (34 polypeptides to generate mimetics, e.g. peptide or non-
peptide agents. See,
for example, "Peptide inhibitors of human papillomavirus protein binding to
retinoblastoma
gene protein" European patent applications EP-412,762A and EP-B31,080A.
Non-hydrolyzable peptide analogs of critical residues can be generated using
benzodiazepine (e.g., see Freidinger et al. in Peptides: Chemistry and
Biology, G.R. Marshall
ed., ESCOM Publisher: Leiden, Netherlands, 1988), azepine (e.g., see Huffinan
et al. in
Peptides: Chemistry and Biology, G.R. Marshall ed., ESCOM Publisher: Leiden,
Netherlands, 1988), substituted gama lactam rings (Garvey et al. in Peptides:
Chemistry and
Biology, G.R. Marshall ed., ESCOM Publisher: Leiden, Netherlands, 1988), keto-
methylene
pseudopeptides (Ewenson et al. (1986) JMed Chem 29:295; and Ewenson et al. in
Peptides:
Structure and Function (Proceedings of the 9th American Peptide Symposium)
Pierce
Chemical Co. Rockland, IL, 1985), (3-turn dipeptide cores (Nagai et al. (1985)
Tetrahedron
Lett 26:647; and Sato et al. ( 1986) J Chem Soc Perkin Trans 1:1231 ), and (3-
aminoalcohols
(Gordon et al. (1985) Biochem Biophys Res Commun126:419; and Dann et al.
(1986)
Biochem Biophys Res Commun 134:71).
~~ntibodies
The invention also includes antibodies specifically reactive with a subject y3
or (34
polypeptides. Anti-protein/anti-peptide antisera or monoclonal antibodies can
be made by
standard protocols (See, for example, Antibodies: A Laboratory Manual ed. by
Harlow and
Lane (Cold Spring Harbor Press: 1988)).
Antibodies which specifically bind y3 or (34 epitopes can also be used in
immunohistochemical staining of tissue samples in order to evaluate the
abundance and
pattern of expression of y3 or [34. Anti y3 or (34 antibodies can be used
diagnostically in
CA 02304169 2000-03-22
WO 99/19348 PCT/US98/21391
39
S immuno-precipitation and immuno-blotting to detect and evaluate y3 or ~i4
levels in tissue or
bodily fluid as part of a clinical testing procedure.
Another application of antibodies of the present invention is in the
immunological
screening of cDNA libraries constructed in expression vectors such as ~,gtl l,
~.gtl8-23,
7v.ZAP, and ~,ORF8. Messenger libraries of this type, having coding sequences
inserted in the
correct reading frame and orientation, can produce fusion proteins. For
instance, ~,gtl l will
produce fusion proteins whose amino termini consist of 13-galactosidase amino
acid sequences
and whose carboxy tenmini consist of a foreign polypeptide. Antigenic epitopes
of a subject
polypeptide can then be detected with antibodies, as, for example, reacting
nitrocellulose
filters lifted from infected plates with antibodies of the invention. Phage,
scored by this
assay, can then be isolated from the infected plate. Thus, the presence of
homologs can be
detected and cloned from other animals, and alternate isoforms (including
splicing variants)
can be detected and cloned from human sources.
Other Embodiments
Included in the invention are: allelic variations; natural mutants; induced
mutants;
proteins encoded by DNA that hybridizes under high or low stringency
conditions to a
nucleic acid which encodes a polypeptide of SEQ ID NO:1 or SEQ ID N0:3 (for
definitions
of high and low stringency see Current Protocols in Molecular Biology, John
Wiley & Sons,
New York, 1989, 6.3.1 - 6.3.6, hereby incorporated by reference); and,
polypeptides
specifically bound by antisera to Y3 or ~i4.
Nucleic acids and polypeptides of the invention includes those that differ
from the
sequences discolosed herein by virtue of sequencing errors in the disclosed
sequences.
The invention also includes fragments, preferably biologically active
fragments, or
analogs of y3 or ~i4. A biologically active fragment or analog is one having
any in vivo or in
vitro activity which is characteristic of they3 or (34 shown in SEQ ID N0:3
and SEQ ID
NO:1, respectively, or of other naturally occurring y3 or (34, e.g., one or
more of the
biological activities described above. Especially preferred are fragments
which exist in vivo,
e.g., fragments which arise from post transcriptional processing or which
arise from
translation of alternatively spliced RNA's. Fragments include those expressed
in native or
endogenous cells, e.g., as a result of post-translational processing, e.g., as
the result of the
removal of an amino-terminal signal sequence, as well as those made in
expression systems,
e.g., in CHO cells. Particularly preferred fragments are fragments, e.g.,
active fragments,
which are generated by proteolytic cleavage or alternative splicing events.
CA 02304169 2000-03-22
WO 99/19348 PCT/US98/21391
40
Other embodiments are within the following claims.
What is claimed is:
CA 02304169 2000-03-22
WO 99/19348 PCT/US98lZ1391
1
S SEQUENCE LISTING
(1) GENERAL INFORMATION:
ld (i) APPLICANT: Burgeson, Robert,
et al.
(ii) TITLE OF INVENTION: DNA Sequences
(iii) NUMBER OF SEQUENCES: 6
1S
(iv) CORRESPONDENCE ADDRESS:
(A) ADDRESSEE: LAHIVE & COCKFIELD
(B) STREET: 28 State Street
(C) CITY: Boston
20 (D) STATE: Massachusetts
(E) COUNTRY: USA
(F) ZIP: 02109
(v) COMPUTER READABLE FORM:
ZS (A) MEDIUM TYPE: Floppy disk
(B) COMPUTER: IBM PC compatible
(C) OPERATING SYSTEM: PC-DOS/MS-DOS
(D) SOFTWARE: PatentIn Release #1.0, Version #1.25
3O (vi) CURRENT APPLICATION DATA:
(A) APPLICATION NUMBER: US 000000
(B) FILING DATE: 13-APR-1994
(C) CLASSIFICATION:
3S (vii) PRIOR
APPLICATION
DATA:
(A) APPLICATION NUMBER: US 08/111,111
(B) FILING DATE: 12-DEC-1909
(viii) ATTORNEY/AGENT
INFORMATION:
40 (A) NAME: Attorney, Name Init
(B} REGISTRATION NUMBER: 000000
(C) REFERENCE/DOCKET NUMBER:
oe
(ix) TELECOMMUNICATION
INFORMATION:
4S (A) TELEPHONE: (617)227-7400
(B) TELEFAX: (617)742-4214
S0
(2) INFORMATION FOR SEQ ID NO:1:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 1761 amino acids
(B) TYPE: amino acid
(D) TOPOLOGY: linear
SS
(ii) MOLECULE TYPE: peptide
(v) FRAGMENT TYPE: internal
(xi) SEQUENCE DESCRIPTION: SEQ ID N0:1:
CA 02304169 2000-03-22
WO 99/19348 PCT/US98/21391
2
$ Met Gln Phe Gln Leu Thr Leu Phe Leu His Leu Gly Trp Leu Ser Tyr
1 5 10 15
Ser Lys Ala Gln Asp Asp Cys Asn Arg Gly Ala Cys His Pro Thr Thr
20 25 30
Gly Asp Leu Leu Val Gly Arg Asn Thr Gln Leu Met Ala Ser Ser Thr
35 40 45
Cys Gly Leu Ser Arg Ala Gln Lys Tyr Cys Ile Leu Ser Tyr Leu Glu
1$ 50 55 60
Gly Glu Gln Lys Cys Ser Ile Cys Asp Ser Arg Phe Pro Tyr Aap Pro
65 70 75 BO
Tyr Asp Gln Pro Asn Ser His Thr Ile Glu Asn Val Thr Val Ser Phe
85 90 95
G1u Pro Asp Arg Glu Lys Lys Trp Trp Gln Ser Glu Asn Gly Leu Asp
100 105 110
2$
His Val Ser Ile Arg Leu Asp Leu Glu Ala Leu Phe Arg Phe Ser His
115 120 125
Leu Ile Leu Thr Phe Lys Thr Phe Arg Pro Ala Ala Met Leu Val Glu
130 135 140
Arg Ser Thr Asp Tyr Gly His Asn Trp Lys Val Phe Lys Tyr Phe Ala
145 150 155 160
3$ Lys Asp Cys Ala Thr Ser Phe Pro Asn Ile Thr Ser Gly Gln Ala Gln
165 170 175
Gly Val Gly Asp Ile Val Cys Asp Ser Lys Tyr Ser Asp Ile Glu Pro
180 185 190
Ser Thr Gly Gly Glu Val Val Leu Lys Val Leu Asp Pro Ser Phe Glu
195 200 205
Ile Glu Asn Pro Tyr Ser Pro Tyr Ile Gln Asp Leu Val Thr Leu Thr
4$ 210 215 220
Asn Leu Arg Ile Asn Phe Thr Lys Leu His Thr Leu Gly Asp Ala Leu
225 230 235 240
$0 Leu Gly Arg Arg Gln Asn Asp Ser Leu Asp Lys Tyr Tyr Tyr Ala Leu
245 250 255
Tyr Glu Met Ile Val Arg Gly Ser Cys Phe Cys Asn Gly His Ala Ser
260 265 270
$$
Glu Cys Arg Pro Met Gln Lys Met Arg Gly Asp Val Phe Ser Pro Pro
275 280 285
Gly Met Val His Gly Gln Cys Val Cys Gln His Asn Thr Asp Gly Pro
60 290 295 300
Asn Cys Glu Arg Cys Lys Asp Phe Phe Gln Asp Ala Pro Trp Arg Pro
305 310 315 320
CA 02304169 2000-03-22
WO 99/19348 PGT/US98/21391
3
Ala Ala Asp Leu Gln Asp Asn Ala Cys Arg Ser Cys Ser Cys Asn.Ser
325 330 335
His Ser Ser Arg Cys His Phe Aap Met Thr Thr Tyr Leu Ala Ser Gly
340 345 350
Gly Leu Ser Gly Gly Val Cys Glu Asp Cys Gln His Asn Thr Glu Gly
355 360 365
1$ Gln His Cys Asp Arg Cys Arg Pro Leu Phe Tyr Arg Asp Pro Leu Lys
370 375 380
Thr Ile Ser Asp Pro Tyr Ala Cys Ile Pro Cys Glu Cys Asp Pro Asp
385 390 395 400
Gly Thr Ile Ser Gly Gly Ile Cys Val Ser His Ser Asp Pro Ala Leu
405 410 415
Gly Ser Val Ala Gly Gln Cys Leu Cys Lys Glu Asn Val Glu Gly Ala
2$ 420 425 430
Lys Cys Aap Gln Cys Lys Pro Asn His Tyr Gly Leu Ser Ala Thr Asp
435 440 445
Pro Leu Gly Cys Gln Pro Cys Asp Cys Asn Pro Leu Gly Ser Leu Pro
450 455 460
Phe Leu Thr Cys Aep Val Asp Thr Gly Gln Cys Leu Cys Leu Ser Tyr
465 470 475 480
Val Thr Gly Ala His Cys Glu Glu Cys Thr Val Gly Tyr Trp Gly Leu
485 490 495
Gly Asn His Leu His Gly Cys Ser Pro Cys Asp Cys Asp Ile Gly Gly
500 505 510
Ala Tyr Ser Asn Val Cys Ser Pro Lys Asn Gly Gln Cys Glu Cys Arg
515 520 525
4$ Pro His Val Thr Gly Arg Ser Cys Ser Glu Pro Ala Pro Gly Tyr Phe
530 535 540
$d
Phe Ala Pro Leu Asn Phe Tyr Leu Tyr Glu Ala Glu Glu Ala Thr Thr
545 550 555 560
Leu Gln Gly Leu Ala Pro Leu Gly Ser Glu Thr Phe Gly Gln Ser Pro
565 570 575
Ala Val His Val Val Leu Gly Glu Pro Val Pro Gly Asn Pro Val Thr
$$ 580 585 590
Trp Thr Gly Pro Gly Phe Ala Arg Val Leu Pro Gly Ala Gly Leu Arg
595 600 605
60 Phe Ala Val Asn Asn Ile Pro Phe Pro Val Asp Phe Thr Ile Ala Ile
610 615 620
His Tyr Glu Thr Gln Ser Ala Ala Asp Trp Thr Val Gln Ile Val Val
CA 02304169 2000-03-22
WO 99/19348 PCT/US98/21391
4
$ 625 630 635 640
Asn ProProGlyGly SerGluHis CysIlePro LysThrLeu Gln.Ser
w
645 650 655
Lys ProGlnSerPhe AlaLeuPro AlaAlaThr ArgIleMet LeuLeu
660 665 670
Pro ThrProIleCys LeuGluPro AspValGln TyrSerIle AspVal
675 680 685
1$
Tyr PheSerGlnPro LeuGlnGly GluSerHis AlaHisSer HisVal
690 695 700
Leu ValAspSerLeu GlyLeuIle ProGlnIle AsnSerLeu GluAsn
705 710 715 720
Phe CysSerLysGln AspLeuAsp GluTyrGln LeuHisAsn CysVal
72S 730 735
2$ Glu IleAlaSerAla MetGlyPro GlnValLeu ProGlyAla CysGlu
740 74S 750
Arg LeuIleIleSer MetSerAla LysLeuHis AspGlyAla ValAla
755 760 765
Cys LysCysHisPro GlnGlySer ValGlySer SerCysSer ArgLeu
770 775 780
Gly GlyGlnCysGln CysLysPro LeuValVal GlyArgCys CysAsp
3$ 785 790 795 800
Arg CysSerThrGly SerTyrAsp LeuGlyHis HisGlyCys HisPro
805 810 815
Cys HisCysHisPro GlnGlySer LysAspThr Va1CysAsp GlnVal
820 825 830
Thr GlyGlnCysPro CysHisGly GluValSer GlyArgArg CysAsp
835 840 845
4$
Arg CysLeuAlaGly TyrPheGly PheProSer CysHisPro CysPro
850 855 860
Cys AsnArgPheAla GluLeuCys AspProGlu ThrGlySer CysPhe
$0 865 870 875 880
Asn CysGlyGlyPhe ThrThrGly ArgAenCys GluArgCys IleAsp
885 890 895
$$ Gly TyrTyrGlyAsn ProSerSer GlyGlnPro CysArgPro CysLeu
900 905 910
Cys ProAspAspPro SerSerAsn GlnTyrPhe AlaHisSer CysTyr
915 920 925
60
Gln AsnLeuTrpSer SerAspVal IleCysAsn CysLeuGln GlyTyr
930 935 940
CA 02304169 2000-03-22
WO 99/19348 PCT/US98/21391
$ Thr Gly Thr Gln Cys Gly Glu Cys Ser Thr Gly Phe Tyr Gly Asn Pro
945 950 955 960
Arg Ile Ser Gly Ala Pro Cys Gln Pro Cys Ala Cys Asn Asn Asn Ile
965 970 975
Asp Val Thr Asp Pro Glu Ser Cys Ser Arg Val Thr Gly Glu Cys Leu
980 985 990
Arg Cys Leu His Asn Thr Gln Gly Ala Asn Cys Gln Leu Cys Lys Pro
1$ 995 1000 1005
Gly His Tyr Gly Ser Ala Leu Asn Gln Thr Cys Arg Arg Cys Ser Cys
1010 1015 1020
His Ala Ser Gly Val Ser Pro Met Glu Cys Pro Pro Gly Gly Gly Ala
1025 1030 1035 1040
Cys Leu Cys Asp Pro Val Thr Gly Ala Cys Pro Cys Leu Pro Asn Val
1045 1050 1055
2$
Thr Gly Leu Ala Cys Asp Arg Cys Ala Asp Gly Tyr Trp Asn Leu Val
1060 1065 1070
Pro Gly Arg Gly Cys Gln Ser Cys Asp Cys Asp Pro Arg Thr Ser Gln
1075 1080 1085
Ser Ser His Cys Asp Gln Leu Thr Gly Gln Cys Pro Cys Lys Leu Gly
1090 1095 1100
3$ Tyr Gly Gly Lys Arg Cys Ser Glu Cys Gln Glu Asn Tyr Tyr Gly Asp
1105 1110 1115 1120
Pro Pro Gly Arg Cys Ile Pro Cys Asp Cys Asn Arg Ala Gly Thr Gln
1125 1130 1135
Lys Pro Ile Cys Asp Pro Asp Thr Gly Met Cys Arg Cys Arg Glu Gly
1140 1145 1150
Val Ser Gly Gln Arg Cys Asp Arg Cys Ala Arg Gly His Ser Gln Glu
4$ 1155 1160 1165
Phe Pro Thr Cys Leu Gln Cys His Leu Cys Phe Asp Gln Trp Asp His
1170 1175 1180
$0 Thr Ile Ser Ser Leu Ser Lys Ala Val Gln Gly Leu Met Arg Leu Ala
1185 1190 1195 1200
Ala Asn Met Glu Asp Lys Arg Glu Thr Leu Pro Val Cys Glu Ala Asp
1205 1210 1215
$$
Phe Lys Asp Leu Arg Gly Asn Val Ser Glu Ile Glu Arg Ile Leu Lys
1220 1225 1230
His Pro Val Phe Pro Ser Gly Lys Phe Leu Lys Val Lys Asp Tyr His
60 1235 1240 1245
Asp Ser Val Arg Arg Gln Ile Met Gln Leu Asn Glu Gln Leu Lys Ala
1250 1255 1260
CA 02304169 2000-03-22
WO 99/19348 PG"T/US98/21391
6
Val Tyr Glu Phe Gln Asp Leu Lys Asp Thr Ile Glu Arg Ala Lys Asn
1265 1270 1275 1280
Glu Ala Asp Leu Leu Leu Glu Asp Leu Gln Glu Glu Ile Asp Leu Gln
1285 1290 1295
Ser Ser Val Leu Asn Ala Ser Ile Ala Asp Ser Ser Glu Asn Ile Lys
1300 1305 1310
1S Lys Tyr Tyr His Ile Ser Ser Ser Ala Glu Lys Lys Ile Asn Glu Thr
1315 1320 1325
Ser Ser Thr Ile Asn Thr Ser Ala Asn Thr Arg Asn Asp Leu Leu Thr
1330 1335 1340
Ile Leu Asp Thr Leu Thr Ser Lys Gly Asn Leu Ser Leu Glu Arg Leu
1345 1350 1355 1360
Lys Gln Ile Lys Ile Pro Asp Ile Gln Ile Leu Asn Glu Lys Val Cys
2$ 1365 1370 1375
Gly Asp Pro Gly Asn Val Pro Cys Val Pro Leu Pro Cys Gly Gly Ala
1380 1385 1390
Leu Cys Thr Gly Arg Lys Gly His Arg Lys Cys Arg Gly Pro Gly Cys
1395 1400 1405
His Gly Ser Leu Thr Leu Ser Thr Asn Ala Leu Gln Lys Ala Gln Glu
1410 1415 1420
Ala Lys Ser Ile Ile Arg Asn Leu Asp Lys Gln Val Arg Gly Leu Lys
1425 1430 1435 1440
Asn Gln Ile Glu Ser Ile Ser Glu Gln Ala Glu Val Ser Lys Asn Asn
1445 1450 1455
Ala Leu Gln Leu Arg Glu Lys Leu Gly Asn Ile Arg Asn Gln Ser Asp
1460 1465 1470
Ser Glu Glu Glu Asn Ile Asn Leu Phe Ile Lys Lys Val Lys Asn Phe
1475 1480 1485
Leu Leu Glu Glu Asn Val Pro Pro Glu Asp Ile Glu Lys Val Ala Asn
1490 1495 1500
Gly Val Leu Asp Ile His Leu Pro Ile Pro Ser Gln Asn Leu Thr Asp
1505 1510 1515 1520
Glu Leu Val Lys Ile Gln Lys His Met Gln Leu Cys Glu Aap Tyr Arg
SS 1525 1530 1535
Thr Asp Glu Asn Arg Ser Asn Glu Glu Ala Asp Gly Ala Gln Lys Leu
1540 1545 1550
Leu Val Lys Ala Lys Ala Ala Glu Lys Ala Ala Asn Ile Leu Leu Asn
1555 1560 1565
Leu Aap Lys Thr Leu Asn Gln Leu Gln Gln Ala Gln Ile Thr Gln Gly
CA 02304169 2000-03-22
WO 99/19348 PCT/US98/21391
7
S 1570 1575 1580
Arg Ala AsnSerThr IleThr LeuThr AlaAsnIle ThrLysIle
Gln
1585 1590 1595 1600
Lys Lys AsnValLeu GlnAla AsnGln ThrArgGlu MetLysSer
Glu
1605 1610 1615
Glu Leu GluLeuAla LysGln SerGly LeuGluAsp GlyLeuSer
Arg
1620 1625 1630
1S
Leu Leu GlnThrLys LeuGln HisGln AspHisAla ValAanAla
Arg
1635 1640 1645
Lys Val GlnAlaGlu SerAla HisGln AlaGlySer LeuGluLys
Gln
1650 1655 1660
G1u Phe ValGluLeu LysLys TyrAla IleLeuGln ArgLysThr
Gln
1665 1670 1675 1680
ZS Ser Thr ThrGlyLeu ThrLye ThrLeu GlyLysVal LysGlnLeu
Glu
1685 1690 1695
Lys Asp AlaAlaGlu LysLeu GlyAsp ThrGluAla LysIleArg
Ala
1700 1705 1710
Arg Ile ThrAspLeu GluArg IleGln AspLeuAen LeuSerArg
Lys
1715 1720 1725
Gln Ala LysAlaAsp GlnLeu IleLeu GluAspGln ValValAla
Arg
3S 1730 1735 1740
Ile Lys AsnGluIle ValGlu GluLys LysTyrAla ArgCysTyr
Gln
1745 1750 1755 1760
Ser
(2) INFORMATION FOR SEQ ID N0:2:
4S (i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 5874 base pairs
(B} TYPE: nucleic acid
(C} STRANDEDNESS: single
(D) TOPOLOGY: linear
SO
(ii) MOLECULE TYPE: cDNA
SS (xi} SEQUENCE DESCRIPTION: SEQ ID N0:2:
ACATGCCCCG TTTGCTGCCT GAACCTCTCC ACAAAGACTC CCAGATCCTG AATTGAATTT 60
AATCATCTCC TGACAAAAGA ATGCAATTTC AACTGACCCT TTTTTTGCAC CTTGGGTGGC 120
TCAGTTACTC AAAAGCTCAA GATGACTGCA ACAGGGGTGC CTGTCATCCC ACCACTGGTG 180
ATCTCCTGGT GGGCAGGAAC ACGCAGCTTA TGGCTTCTTC TACCTGTGGG CTGAGCAGAG 240
CA 02304169 2000-03-22
WO 99/19348 PCT/US98/Z1391
S
CCCAGAAATACTGCATCCTCAGTTACCTGGAGGGGGAACAAAAATGCTCCATCTGTGACT300
CTAGATTTCCATATGATCCGTATGACCAACCCAACAGCCACACCATTGAGAATGTCACTG360
IO TAAGTTTTGAACCAGACAGAGAAAAGAAATGGTGGCAATCTGAAAATGGTCTTGATCATG420
TCAGCATCAGACTGGACTTAGAGGCATTATTTCGGTTCAGCCACCTTATCCTGACCTTTA480
AGACTTTTCGGCCTGCTGCAATGTTAGTTGAACGTTCCACAGACTATGGACACAACTGGA540
1S
AAGTGTTCAAATATTTTGCAAAAGACTGTGCCACTTCCTTTCCTAACATCACATCTGGCC600
AGGCCCAGGGAGTGGGAGACATTGTTTGTGACTCCAAATACTCGGATATTGAACCCTCAA660
2O CAGGTGGAGAGGTTGTTTTAAAAGTTTTGGATCCCAGTTTTGAAATTGAAAACCCTTATA720
GCCCCTACATCCAAGACCTTGTGACATTGACAAACCTGAGGATAAACTTTACCAAGCTCC780
ACACCCTTGGGGATGCTTTGCTTGGAAGGAGGCAAAATGATTCCCTTGATAAATACTACT840
2S
ATGCTCTGTACGAGATGATTGTTCGGGGAAGCTGCTTTTGCAATGGCCATGCTAGCGAAT900
GTCGCCCTATGCAGAAGATGCGGGGAGATGTTTTCAGCCCTCCTGGAATGGTTCACGGTC960
3O AGTGTGTGTGTCAGCACAATACAGATGGTCCGAACTGTGAGAGATGCAAGGACTTCTTCC1020
AGGATGCTCCTTGGAGGCCAGCTGCAGACCTCCAGGACAACGCTTGCAGATCGTGCAGCT1080
GTAATAGCCACTCCAGCCGCTGTCACTTTGACATGACTACGTACCTGGCAAGCGGTGGCC1140
3S
TCAGCGGGGGCGTGTGTGAAGACTGCCAGCACAACACTGAGGGGCAGCACTGCGACCGCT1200
GCAGACCCCTCTTCTACAGGGACCCGCTCAAGACCATCTCAGATCCCTACGCGTGCATTC1260
4O CTTGTGAATGTGACCCCGATGGGACCATATCTGGTGGCATTTGTGTGAGCCACTCTGATC1320
CTGCCTTAGGGTCTGTGGCCGGCCAGTGCCTTTGTAAAGAGAACGTGGAAGGAGCCAAAT1380
GCGACCAGTGCAAACCCAACCACTACGGACTAAGCGCCACCGACCCCCTGGGCTGCCAGC1440
4S
CCTGCGACTGTAACCCCCTTGGGAGTCTGCCATTCTTGACCTGTGATGTGGATACAGGCC1500
AATGCTTGTGCCTGTCATATGTCACCGGAGCACACTGCGAAGAATGCACTGTTGGATACT1560
SO GGGGCCTGGGAAATCATCTCCATGGGTGTTCTCCCTGTGACTGTGATATTGGAGGTGCTT1620
ATTCTAACGTGTGCTCACCCAAGAATGGGCAGTGTGAATGCCGCCCACATGTCACTGGCC1680
GTAGCTGCTCTGAACCAGCCCCTGGCTACTTCTTTGCTCCTTTGAATTTCTATCTCTACG1740
SS
AGGCAGAGGAAGCCACAACACTCCAAGGACTGGCGCCTTTGGGCTCGGAGACGTTTGGCC1800
AGAGTCCTGCTGTTCACGTTGTTTTAGGAGAGCCAGTTCCTGGGAACCCTGTTACATGGA1860
E)OCTGGACCTGGATTTGCCAGGGTTCTCCCTGGGGCTGGCTTGAGATTTGCTGTCAACAACA1920
TTCCCTTTCCTGTGGACTTCACCATTGCCATTCACTATGAAACCCAGTCTGCAGCTGACT1980
CA 02304169 2000-03-22
WO 99/19348 PCTNS98/Z1391
9
S GGACTGTCCAGATTGTGGTGAACCCCCCTGGAGGGAGTGAGCACTGCATACCCAAGACTC2040
TACAGTCAAAGCCTCAGTCTTTTGCCTTACCAGCGGCTACGAGAATCATGCTGCTTCCCA210
CACCCATCTGTTTAGAACCAGATGTACAATATTCCATAGATGTCTATTTTTCTCAGCCTT2160
TGCAAGGAGAGTCCCACGCTCATTCACATGTCCTGGTGGACTCTCTTGGCCTTATTCCCC2220
AAATCAATTCATTGGAGAATTTCTGCAGCAAGCAGGACTTAGATGAGTATCAGCTTCACA2280
IS ACTGTGTTGAAATTGCCTCAGCAATGGGACCTCAAGTGCTCCCGGGTGCCTGTGAAAGGC2340
TGATCATCAGCATGTCTGCCAAGCTGCATGATGGGGCTGTGGCCTGCAAGTGTCACCCCC2400
AGGGCTCAGTCGGATCCAGCTGCAGCCGACTTGGAGGCCAGTGCCAGTGTAAACCTCTTG2460
TGGTCGGGCGCTGCTGTGACAGGTGCTCAAGTGGAAGCTATGATTTGGGGCATCACGGCT2520
GTCACCCATGTCACTGCCATCCTCAAGGATCAAAGGACACTGTATGTGACCAAGTAACAG2580
2S GACAGTGCCCCTGCCATGGAGAGGTGTCTGGCCGCCGCTGTGATCGCTGCCTGGCAGGCT2640
ACTTTGGATTTCCCAGCTGCCACCCTTGCCCTTGTAATAGGTTTGCTGAACTTTGTGATC2700
CTGAGACAGGGTCATGCTTCAATTGTGGAGGCTTTACAACTGGCAGAAACTGTGAAAGGT2760
GTATTGATGGTTACTATGGAAATCCTTCTTCAGGACAGCCCTGTCGTCCTTGCCTGTGTC2820
CAGATGATCCCTCAAGCAATCAGTATTTTGCCCATTCCTGTTATCAGAATCTGTGGAGCT2880
3S CAGATGTAATCTGCAATTGTCTTCAAGGTTATACGGGTACTCAGTGTGGAGAATGCTCTA2940
CTGGTTTCTATGGAAATCCAAGAATTTCAGGAGCACCTTGCCAACCATGTGCCTGCAACA3000
ACAACATAGATGTAACCGATCCAGAGTCCTGCAGCCGGGTAACAGGGGAGTGCCTTCGAT3060
GTTTGCACAACACTCAGGGCGCAAACTGCCAGCTCTGCAAACCAGGTCACTATGGATCAG3120
CCCTCAATCAGACCTGCAGAAGATGCTCCTGCCATGCTTCCGGCGTGAGTCCCATGGAGT3180
4S GTCCCCCTGGTGGGGGAGCTTGCCTCTGTGACCCTGTCACTGGTGCATGTCCTTGTCTGC3240
CGAATGTCACAGGCCTGGCCTGTGACCGTTGTGCTGATGGATACTGGAATCTGGTCCCTG3300
GCAGAGGATGTCAGTCATGTGACTGTGACCCTAGGACCTCTCAAAGTAGCCACTGTGACC3360
S0
AGCTTACAGGCCAGTGTCCGTGTAAATTAGGTTACGGCGGGAAACGTTGCAGTGAGTGCC3420
AGGAAAATTATTATGGTGATCCACCTGGGCGATGCATTCCATGTGATTGTAACAGGGCAG3480
SS GTACCCAGAAGCCCATCTGTGATCCAGACACAGGCATGTGCCGCTGCCGGGAGGGTGTCA3540
GCGGCCAGAGATGTGATCGCTGTGCCCGGGGACACAGCCAGGAATTCCCTACTTGTCTTC3600
AATGTCACTTGTGCTTTGATCAATGGGACCACACCATTTCTTCCCTCTCCAAAGCGGTGC3660
60
AAGGGTTAATGAGACTGGCTGCTAACATGGAAGATAAAAGAGAGACCCTGCCTGTCTGTG3720
AGGCAGACTTCAAAGACCTCAGAGGGAACGTGTCTGAAATAGAAAGGATTTTGAAACATC3780
CA 02304169 2000-03-22
WO 99/19348 PCT/US98/21391
5
CTGTTTTCCC ATCTGGGAAA TTCTTAAAAGTCAAGGATTA TCATGACTCTGTTAGAAGAC3840
AAATCATGCA GCTAAATGAA CAACTGAAAGCAGTGTATGA ATTTCAAGATCTGAAAGATA3900
10 CAATAGAAAG AGCAAAGAAT GAAGCAGACCTCTTACTTGA AGACCTTCAGGAAGAAATTG3960
ATTTGCAATC CAGTGTCCTT AATGCAAGCATTGCGGACTC CTCAGAAAACATCAAGAAAT4020
ATTATCACAT ATCATCATCT GCTGAAAAGAAAATTAATGA AACTAGTTCCACCATTAATA4080
CCTCTGCAAA TACAAGGAAT GACTTACTTACCATCTTAGA TACACTAACCTCAAAAGGAA4140
ACTTGTCATT GGAAAGATTA AAGCAGATTAAGATACCAGA TATCCAAATATTGAATGAAA4200
2O AGGTGTGCGG AGATCCAGGA AATGTGCCATGTGTGCCCTT GCCCTGTGGCGGTGCTCTCT4260
GCACGGGCCG GAAGGGGCAC AGGAAGTGTAGGGGTCCCGG CTGTCACGGCTCCCTGACCC4320
TCTCAACGAA TGCCCTCCAA AAAGCCCAGGAAGCAAAATC CATTATTCGTAATTTGGACA4380
.
AACAGGTTCG TGGGTTGAAA AATCAGATCGAAAGTATAAG TGAACAGGCAGAAGTCTCCA4440
AAAACAATGC CTTACAGCTG AGGGAAAAACTGGGAAATAT AAGAAACCAAAGTGACTCTG4500
3O AAGAAGAAAA CATCAATCTT TTCATCAAAAAAGTGAAAAA CTTTTTGTTAGAGGAAAACG4560
TGCCTCCAGA AGACATCGAG AAGGTTGCGAATGGTGTGCT TGACATTCACCTACCAATTC4620
CATCCCAAAA TCTAACCGAT GAACTTGTCAAAATACAGAA ACATATGCAACTCTGTGAGG4680
ATTACAGGAC AGATGAAAAC AGGTCAAATGAAGAAGCAGA TGGAGCCCAAAAGCTTTTGG4740
TGAAGGCCAA AGCAGCTGAG AAAGCAGCAAATATTCTATT AAATCTTGACAAAACATTGA4800
4O ACCAGTTACA ACAAGCTCAA ATCACTCAAGGACGGGCAAA CTCTACCATTACACAGCTGA4860
CTGCCAATAT AACAAAAATA AAAAAGAATGTGCTGCAGGC TGAAAATCAAACCAGGGAAA4920
TGAAGAGTGA GCTGGAGTTA GCAAAGCAGCGATCAGGGCT GGAGGATGGACTTTCCCTGC4980
TGCAGACCAA GTTGCAAAGG CATCAAGACCACGCTGTCAA TGCGAAAGTTCAGGCTGAAT5040
CTGCCCAACA CCAGGCTGGG AGTCTTGAGAAGGAATTTGT TGAGCTGAAAAAACAATATG5100
SO CTATTCTCCA ACGTAAGACA AGCACTACAGGACTAACAAA GGAGACATTAGGAAAAGTTA5160
AACAGCTAAA AGATGCGGCA GAAAAATTGGCTGGAGATAC AGAGGCCAAGATAAGAAGAA5220
TAACAGATTT AGAAAGGAAA ATCCAAGATTTGAATCTAAG TAGACAAGCAAAAGCTGATC5280
$$
AACTGAGAAT ATTGGAAGAT CAAGTTGTTGCCATTAAAAA TGAAATTGTTGAACAAGAAA5340
AAAAATATGC TAGGTGCTAT AGCTAGGCAGAGTTAAAGAG CAAAAGCTTGTGCCTTTGTT5400
6O TCTGGTTTCT GATGTACAAG CCCCTGGGGCTCTGTTGAAC CTGTGAAATACTGACAATGT5460
CTTCTACCTT CCTTCCCCAC ACCCTGTCCTTATTAGACAC CTGCTCAGTGTGGCTGGAGG5520
CA 02304169 2000-03-22
WO 99/19348 PCT/US98/21391
11
S TTGAAATGCC ACCAGGAAAA TGCCACTTCA TAATTGAAAGGGGAAAGTAA TGAAATTGTC5580
TCTGGTTTCA GAAACTTTTC CTCTTACCTT CGTTTCTCTTTCCTAACTTA AAAATAACAG5640
TTTCCATATA ACAAGTAGAA ATTTAAGTAA GTACTCTACTAACTAATAAT CATTTCAGTC5700
AGATAAACCT AAACATTAAA TAAATATCTC CAATATTAGGATGGAATACA TATGTATGGC5760
ATGTACTAGA TTGTCCTATA TTTTATGTTT ATTTGGATTTGCTTTTATTT GTAAAATTAT5820
IS TCTTTTCTGA ATAAACTGCA TACAATTCAA AATGGAAAAAAAAAAAAAAA AAAA 5874
(2) INFORMATION FOR SEQ ID N0:3:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 1524 amino acids
(B) TYPE: amino acid
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: peptide
2S
(v) FRAGMENT TYPE: internal
3O (xi) SEQUENCE
DESCRIPTION:
SEQ
ID
N0:3:
Ala AlaGlyAla GlyAlaHis CysGlnArg.CysAspAla AlaAspPro
1 5 10 15
35 Gln ArgHisHis AsnAlaSer TyrLeuThr AspPheHis SerGlnAsp
20 25 30
Glu SerThrTrp TrpGlnSer ProSerMet AlaPheGly ValGlnTyr
35 40 45
40
Pro ThrSerVal AsnIleThr LeuXaaArg LeuGlyLys AlaTyrGlu
50 55 60
Ile ThrTyrVal ArgLeuLys PheHisThr SerArgPro GluSerPhe
4S 65 70 75 BO
Ala IleTyrLys ArgSerArg AlaAspGly ProTrpGlu ProTyrGln
85 90 95
S0 Phe TyrSerAla SerCysGln LysThrTyr GlyArgPro GluGlyGln
100 105 110
Tyr LeuArgPro GlyGluAsp GluArgVal AlaPheCys ThrSerGlu
115 120 125
SS
Phe SerAspIle SerProLeu SerGlyGly AsnValAla PheSerThr
130 135 140
Leu GluGlyArg ProSerAla TyrAsnPhe GluGluSer ProGlyLeu
60 145 150 155 160
Gln GluTrpVal ThrSerThr GluLeuLeu IleSerLeu AspArgLeu
165 170 175
CA 02304169 2000-03-22
WO 99/19348 PCT/US98/21391
12
Asn Thr Phe Gly Asp Asp Ile Phe Lys Asp Pro Lys Val Leu Gln Ser
180 185 190
Tyr Tyr Tyr Ala Val Ser Asp Phe Ser Val Gly Gly Arg Cys Lys Cys
195 200 205
Asn Gly His Ala Ser Glu Cys Gly Pro Asp Val Ala Gly Gln Leu Ala
210 215 220
1$ Cys Arg Cys Gln His Asn Thr Thr Gly Thr Asp Cys Glu Arg Cys Leu
225 230 235 240
Pro Phe Phe Gln Asp Arg Pro Trp Ala Arg Gly Thr Ala Glu Ala Ala
245 250 255
His Glu Cys Leu Pro Cys Asn Cys Ser Gly Arg Ser Glu Glu Cys Thr
260 265 270
Phe Asp Arg Glu Leu Phe Arg Ser Thr Gly His Gly Gly Arg Cys Hia
2$ 275 280 285
His Cys Arg Asp His Thr Ala Gly Pro His Cys Glu Arg Cys Gln Glu
290 295 300
Asn Phe Tyr His Trp Asp Pro Arg Met Pro Cys Gln Pro Cys Asp Cys
305 310 315 320
3$
Gln Ser Ala Gly Ser Leu His Leu Gln Cys Asp Asp Thr Gly Thr Cys
325 330 335
Ala Cys Lys Pro Thr Val Thr Gly Trp Lys Cys Asp Arg Cys Leu Pro
340 345 350
Gly Phe His Ser Leu Ser Glu Gly Gly Cys Arg Pro Cys Thr Cys Asn
355 360 365
Pro Ala Gly Ser Leu Asp Thr Cya Asp Pro Arg Ser Gly Arg Cys Pro
370 375 380
4$ Cys Lys Glu Asn Val Glu Gly Aen Leu Cys Asp Arg Cys Arg Pro Gly
385 390 395 400
Thr Phe Asn Leu Gln Pro His Asn Pro Ala Gly Cys Ser Ser Cys Phe
405 410 415
$0
Cys Tyr Gly His Ser Lys Val Cys Ala Ser Thr Ala Gln Phe Gln Val
420 425 430
His His Ile Leu Ser Asp Phe His Gln Gly Ala Glu Gly Trp Trp Ala
$$ 435 440 445
Arg Ser Val Gly Gly Ser Glu His Ser Pro Gln Trp Ser Pro Asn Gly
450 455 460
f)0 Val Leu Leu Ser Pro Glu Asp Glu Glu Glu Leu Thr Ala Pro Gly Lys
465 470 475 480
Phe Leu Gly Asp Gln Arg Phe Ser Tyr Gly Gln Pro Leu Ile Leu Thr
CA 02304169 2000-03-22
WO 99/19348 PCT/US98/21391
13
$ 485 490 495
Phe Arg Val Pro Pro Gly Asp Ser Pro Leu Pro Val Gln Leu Arg Leu
500 505 510
Glu Gly Thr Gly Leu Ala Leu Ser Leu Arg His Ser Ser Leu Ser Gly
515 520 525
Pro Gln Asp Ala Arg Ala Ser Gln Gly Gly Arg Ala Gln Val Pro Leu
530 535 540
1$
Gln Glu Thr Ser Glu Aap Val Ala Pro Pro Leu Pro Pro Phe His Phe
545 550 555 560
Gln Arg Leu Leu Ala Asn Leu Thr Ser Leu Arg Leu Arg Val Ser Pro
565 570 575
Gly Pro Ser Pro Ala Gly Pro Val Phe Leu Thr Glu Val Arg Leu Thr
580 585 590
2$ Ser Ala Arg Pro Gly Leu Ser Pro Pro Ala Ser Trp Val Glu Ile Cys
595 600 605
Ser Cys Pro Thr Gly Tyr Thr Gly Gln Phe Cys Glu Ser Cys Ala Pro
610 615 620
Gly Tyr Lys Arg Glu Met Pro Gln Gly Gly Pro Tyr Ala Ser Cys Val
625 630 635 640
Pro Cys Thr Cys Asn Gln His Gly Thr Cys Asp Pro Asn Thr Gly Ile
3$ 645 650 655
Cys Val Cys Ser His His Thr Glu Gly Pro Ser Cys Glu Arg Cys Leu
660 665 670
Pro Gly Phe Tyr Gly Asn Pro Phe Ala Gly Gln Ala Asp Asp Cys Gln
675 680 685
Pro Cys Pro Cys Pro Gly Gln Ser Ala Cys Thr Thr Ile Pro Glu Ser
690 695 700
4$
Gly Glu Val Val Cys Thr His Cys Pro Pro Gly Gln Arg Gly Arg Arg
705 710 715 720
Cys Glu Val Cys Asp Asp Gly Phe Phe Gly Asp Pro Leu Gly Leu Phe
$0 725 730 735
Gly His Pro Gln Pro Cys His Gln Cys Gln Cys Ser Gly Asn Val Asp
740 745 750
$$ Pro Asn Ala Val Gly Asn Cys Asp Pro Leu Ser Gly His Cys Leu Arg
755 760 765
Cys Leu His Asn Thr Thr Gly Asp His Cys Glu His Cys Gln Glu Gly
770 775 780
Phe Tyr Gly Ser Ala Leu Ala Pro Arg Pro Ala Asp Lys Cys Met Pro
785 790 795 800
CA 02304169 2000-03-22
WO 99/19348 ~ 4 PCT/US98/21391
$ Cys Ser Cys His Pro Gln Gly Ser Val Ser Glu Gln Met Pro Cys Asp
805 810 815
Pro Val Thr Gly Gln Cys Ser Cys Leu Pro His Val Thr Ala Arg Asp
820 825 830
Cys Ser Arg Cys Tyr Pro Gly Phe Phe Asp Leu Gln Pro Gly Arg Gly
835 840 845
Cys Arg Ser Cys Lys Cys His Pro Leu Gly Ser Gln Glu Asp Gln Cys
1$ 850 855 860
His Pro Lys Thr Gly Gln Cys Thr Cys Arg Pro Gly Val Thr Gly Gln
865 870 875 880
Ala Cys Asp Arg Cys Gln Leu Gly Phe Phe Gly Ser Ser Ile Lye Gly
885 890 895
2$
Cys Arg Ala Cys Arg Cys Ser Pro Leu Gly Ala Ala Ser Ala Gln Cys
900 905 910
His Tyr Asn Gly Thr Cys Val Cys Arg Pro Gly Phe Glu Gly Tyr Lys
915 920 925
Cys Aep Arg Cys His Tyr Asn Phe Phe Leu Thr Ala Asp Gly Thr His
930 935 940
Cys Gln Gln Cys Pro Ser Cys Tyr Ala Leu Val Lys Glu Glu Xaa Ala
945 950 955 960
3$ Lys Leu Lys Ala Arg Leu Thr Leu Thr Glu Gly Trp Leu Gln Gly Ser
965 970 975
Asp Cys Gly Ser Pro Trp Gly Pro Leu Asp Ile Leu Leu Gly Glu Ala
980 985 990
Pro Arg Xaa Asp Val Tyr Gln Gly His His Leu Leu Pro Gly Ala Arg
995 1000 1005
Glu Ala Phe Leu Glu Gln Met Met Gly Leu Glu Gly Ala Val Lys Ala
4$ solo loss 1020
Ala Arg Glu Gln Leu Gln Arg Leu Asn Lys Gly Ala Arg Cys Ala Gln
1025 1030 1035 1040
$0 Ala Gly Ser Gln Lys Thr Cys Thr Gln Leu Ala Asp Leu Glu Ala Val
1045 1050 1055
$$
Leu Glu Ser Ser Glu Glu Glu Ile Leu His Ala Ala Ala Ile Leu Ala
1060 1065 1070
Ser Leu Glu Ile Pro Gln Glu Gly Pro Ser Gln Pro Thr Lys Trp Ser
1075 1080 1085
His Leu Ala Ile Glu Ala Arg Ala Leu Ala Arg Ser His Arg Asp Thr
60 1090 1095 1100
Ala Thr Lys Ile Ala Ala Thr Ala Trp Arg Ala Leu Leu Ala Ser Asn
1105 1110 1115 1120
CA 02304169 2000-03-22
WO 99/19348 ~ 5 PCT/US98/Z1391
Thr Ser Tyr Ala Leu Leu Trp Asn Leu Leu Glu Gly Arg Val Ala L_eu
1125 1130 1135
Glu Thr Gln Arg Asp Leu Glu Asp Arg Tyr Gln Glu Val Gln Ala Ala
IQ 1140 1145 1150
Gln Lys Ala Leu Arg Thr Ala Val Ala Glu Val Leu Pro Glu Ala Xaa
1155 1160 1165
IS Lys Arg Val Gly His Arg Ala Ala Ser Trp Arg Arg Tyr Ser Pro Val
1170 1175 1180
Pro Gly Leu Ala Gly Phe Pro Gly Ser Ser Ala Ser Xaa Lys Ser Arg
1185 1190 1195 1200
Ala Glu Asp Leu Gly Leu Lys Ala Lys Ala Leu Glu Lys Thr Val Ala
1205 1210 1215
Ser Trp Gln His Met Ala Thr Glu Ala Ala Arg Thr Leu Gln Thr Ala
2$ 1220 1225 1230
Ala Gln Ala Thr Leu Arg Gln Thr Glu Pro Leu Thr Met Ala Arg Ser
1235 1240 1245
Arg Leu Thr Ala Thr Phe Ala Ser Gln Leu His Gln Gly Ala Arg Ala
1250 1255 1260
Ala Leu Thr Gln Ala Ser Ser Ser Val Gln Ala Ala Thr Val Thr Val
1265 1270 1275 1280
Met Gly Ala Arg Thr Leu Leu Ala Asp Leu Glu Gly Met Lys Leu Gln
1285 1290 1295
Phe Pro Arg Pro Lys Asp Gln Ala Ala Leu Gln Arg Lys Ala Asp Ser
1300 1305 1310
Val Ser Asp Arg Leu Leu Ala Asp Thr Arg Lys Lys Thr Lys Gln Ala
1315 1320 1325
4S Glu Arg Met Leu Gly Asn Ala Ala Pro Leu Ser Ser Ser Ala Lys Lys
1330 1335 1340
Lys Gly Arg Glu Ala Glu Val Leu Ala Lys Asp Ser Ala Lys Leu Ala
1345 1350 1355 1360
Lys Ala Leu Leu Arg Glu Arg Lys Gln Ala His Arg Arg Ala Ser Arg
1365 1370 1375
Leu Thr Ser Gln Xaa Leu Gln Ala Thr Leu Gln Gln Ala Ser Gln Gln
1380 1385 1390
Val Leu Ala Ser Glu Ala Arg Arg Gln Glu Leu Glu Glu Ala Glu Arg
1395 1400 1405
Val Gly Ala Gly Leu Ser Glu Met Glu Gln Gln Ile Arg Glu Ser Arg
1410 1415 1420
Ile Ser Leu Glu Lys Asp Ile Glu Thr Leu Ser Glu Leu Leu Ala Arg
CA 02304169 2000-03-22
WO 99/19348 16 PCT/US98/21391
S 1425 1430 1435 1440
Leu Gly SerLeuAsp Thr GlnAlaPro AlaGlnAlaLeuAsn Glu
His
1445 1450 1455
Thr Gln TrpAlaLeu Glu LeuArgLeu GlnLeuGlySerPro Gly
Arg
1460 1465 1470
Ser Leu GlnArgLys Leu LeuLeuGlu GlnGluSerGlnGln Gln
Ser
1475 1480 1485
1S
Glu Leu GlnIleGln Gly GluSerAsp LeuAlaGluIleArg Ala
Phe
1490 1495 1500
Asp Lys GlnAsnLeu Glu IleLeuHis SerLeuProGluAsn Cys
Ala
1505 1510 1515 1520
Ala Ser TrpGln
ZS (2) INFORMATION FOR SEQ ID N0:4:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 4890 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: cDNA
3S
(xi) SEQUENCE
DESCRIPTION:
SEQ ID
N0:4:
GCCGCGGGCGCGGGGGCTCATTGCCAGCGCTGCGACGCCGCCGACCCCCAGCGCCACCAC 60
AACGCCTCCTACCTCACCGACTTCCACAGCCAGGACGAGAGCACCTGGTGGCAGAGCCCG 120
TCCATGGCCTTCGGCGTGCAGTACCCCACCTCGGTCAACATCACCCTCCCGCCTAGGGAA 180
4S GGCTTATGAGATCACGTATGTGAGGCTGAAGTTCCACACCAGTCGCCCTGAGAGCTTTGC 240
CATCTACAAGCGCAGCCGCGCCGACGGCCCATGGGAGCCCTACCAGTTCTACAGCGCCTC 300
CTGCCAGAAGACCTACGGCCGGCCCGAGGGCCAGTACCTGCGCCCCGGCGAGGACGAGCG 360
S0
CGTGGCCTTCTGCACCTCTGAGTTCAGCGACATCTCCCCGCTGAGTGGCGGCAACGTGGC 420
CTTCTCCACCCTGGAGGGCCGGCCCAGCGCCTACAACTTCGAGGAGAGCCCTGGGCTGCA 480
SS GGAGTGGGTCACCAGCACCGAACTCCTCATCTCTCTAGACCGGCTCAACACGTTTGGGGA 540
CGACATCTTCAAGGACCCCAAGGTGCTCCAGTCCTACTATTATGCCGTGTCCGACTTCTC 600
TGTGGGCGGCAGGTGCAAGTGCAACGGGCATGCCAGCGAGTGCGGCCCCGACGTGGCAGG 660
60
CCAGTTGGCCTGCCGGTGCCAGCACAACACCACCGGCACAGACTGTGAGCGCTGCCTGCC 720
CTTCTTCCAGGACCGCCCGTGGGCCCGGGGCACCGCCGAGGCTGCCCACGAGTGTCTGCC 780
CA 02304169 2000-03-22
WO 99/19348 ~ ~ PCT/US98/21391
S
CTGCAACTGCAGTGGCCGCTCCGAGGAATGCACGTTTGATCGGGAGCTCTTCCGCAGCAC840
AGGCCACGGCGGGCGCTGTCACCACTGCCGTGACCACACAGCTGGGCCACACTGTGAGCG900
lO CTGTCAGGAGAATTTCTATCACTGGGACCCGCGGATGCCATGCCAGCCCTGTGACTGCCA960
GTCGGCAGGCTCCCTACACCTCCAGTGCGATGACACAGGCACCTGCGCCTGCAAGCCCAC1020
AGTGACTGGCTGGAAGTGTGACCGCTGTCTGCCCGGGTTCCACTCGCTCAGTGAGGGAGG1080
1S
CTGCAGACCCTGCACTTGCAATCCCGCTGGCAGCCTGGACACCTGTGACCCCCGCAGTGG1140
GCGCTGCCCCTGCAAAGAGAATGTGGAAGGCAACCTATGTGACAGATGTCGCCCGGGGAC1200
2O CTTTAACCTGCAGCCCCACAATCCAGCTGGCTGCAGCAGCTGTTTCTGCTATGGCCACTC1260
CAAGGTGTGCGCGTCCACTGCCCAGTTCCAGGTGCATCACATCCTCAGCGATTTCCACCA1320
GGGAGCCGAAGGCTGGTG~GCCAGAAGTGTGGGGGGCTCTGAGCACTCCCCACAATGGAG1380
2S
CCCAAATGGGGTCCTCCTGAGCCCAGAAGACGAGGAGGAGCTCACAGCACCAGGGAAGTT1440
CCTGGGAGACCAGCGGTTCAGCTATGGGCAGCCCCTCATACTGACCTTCCGGGTGCCCCC1500
3O CGGGGACTCCCCACTCCCTGTACAGCTGAGGCTGGAAGGGACAGGCTTGGCCCTGTCCCT1560
GAGGCACTCTAGCCTGTCTGGCCCCCAGGATGCCAGGGCATCCCAGGGAGGTAGAGCTCA1620
GGTTCCACTGCAGGAGACCTCCGAGGACGTGGCCCCTCCACTGCCCCCCTTCCACTTCCA1680
3S
GCGGCTCCTCGCCAACCTGACCAGCCTCCGCCTCCGCGTCAGTCCCGGCCCCAGCCCTGC1740
CGGTCCAGTGTTCCTGACTGAGGTCCGGCTCACATCCGCCCGGCCAGGGCTTTCCCCGCC1800
4O AGCCTCCTGGGTGGAGATTTGTTCATGTCCCACTGGCTACACGGGCCAGTTCTGTGAATC1860
CTGTGCTCCGGGATACAAGAGGGAGATGCCACAGGGGGGTCCCTATGCCAGCTGTGTCCC1920
CTGCACCTGTAACCAGCATGGCACCTGTGACCCCAACACAGGGATCTGTGTCTGCAGCCA1980
4S
CCATACCGAGGGCCCATCCTGTGAACGCTGTTTGCCAGGTTTCTATGGCAACCCTTTCGC2040
GGGCCAAGCCGACGACTGCCAGCCCTGTCCCTGCCCTGGCCAGTCGGCCTGTACGACCAT2100
SO CCCAGAGAGCGGGGAGGTGGTGTGTACCCACTGCCCCCCGGGCCAGAGAGGGCGGCGCTG2160
TGAGGTCTGTGATGATGGCTTTTTTGGGGACCCGCTGGGGCTCTTTGGGCACCCCCAGCC2220
CTGCCACCAGTGCCAGTGTAGCGGGAACGTGGACCCCAATGCCGTGGGCAACTGTGACCC2280
SS
CCTGTCTGGCCACTGCCTGCGCTGCCTGCACAACACCACGGGTGACCACTGTGAGCACTG2340
TCAGGAAGGCTTCTACGGGAGCGCCCTGGCCCCTCGACCCGCAGACAAATGCATGCCTTG2400
6O CAGCTGTCACCCACAGGGCTCGGTCAGTGAGCAGATGCCCTGCGACCCAGTGACAGGCCA2460
ATGCTCCTGCCTGCCTCATGTGACTGCACGGGACTGCAGCCGCTGCTACCCTGGCTTCTT2520
CA 02304169 2000-03-22
WO 99/19348 ~ 8 PCT/US9$/21391
S CGACCTCCAG CCTGGGAGGG GCTGCCGGAG CTGCAAGTGT CACCCACTGG GCTCCCAGGA 2580
GGACCAGTGCCATCCCAAGACTGGACAGTGCACCTGCCGCCCAGGTGTCACAGGCCAGGC2640
CTGTGACAGGTGCCAGCTGGGTTTCTTCGGCTCCTCAATCAAGGGCTGCCGGGCCTGCAG2700
GTGCTCCCCACTGGGCGCTGCCTCGGCCCAGTGCCACTATAACGGCACATGCGTGTGCAG2760
GCCTGGCTTCGAGGGCTACAAATGTGACCGCTGCCACTACAACTTCTTCCTCACGGCAGA2820
IS CGGCACACACTGCCAGCAATGTCCGTCCTGCTACGCCCTGGTGAAGGAGGAGCAGCCAAG2880
CTGAAGGCCAGACTGACTTTGACGGAGGGGTGGCTCCAAGGGTCCGACTGTGGCAGTCCC2940
TGGGGACCACTAGACATTCTGCTGGGAGAGGCCCCAAGGGGGACGTCTACCAGGGCCATC3000
ACCTGCTTCCAGGGGCTCGGGAAGCCTTCCTGGAGCAGATGATGGGCCTCGAGGGTGCTG3060
TCAAGGCCGCCCGGGAGCAGCTGCAGAGGCTGAACAAGGGTGCCCGCTGTGCCCAGGCCG3120
2S GATCCCAGAAGACCTGCACCCAGCTGGCAGACCTGGAGGCAGTGCTGGAGTCCTCGGAAG3180
AGGAGATTCTGCATGCAGCTGCCATTCTCGCGTCTCTGGAGATTCCTCAGGAAGGTCCCA3240
GTCAGCCGACCAAATGGAGCCACCTGGCCATAGAGGCCCGTGCCCTCGCCAGGAGCCACA3300
GAGACACCGCCACCAAGATCGCAGCCACTGCTTGGAGGGCCCTGCTCGCCTCCAACACCA3360
GCTACGCGCTTCTCTGGAATCTGCTGGAGGGAAGGGTGGCCCTAGAGACCCAGCGGGACC3420
3S TGGAGGACAGGTACCAGGAGGTCCAGGCGGCCCAGAAAGCACTGAGGACGGCTGTGGCAG3480
AGGTGCTGCCTGAAGCGGAAAGCGTGTTGGCCACCGTGCAGCAAGTTGGCGCAGATACAG3540
CCCCGTACCTGGCCTTGCTGGCTTCCCCGGGAGCTCTGCCTCAGAAGTCCCGGGCTGAAG3600
ACCTGGGCCTGAAGGCGAAGGCCCTGGAGAAGACAGTTGCATCATGGCAGCACATGGCCA3660
CTGAGGCTGCCCGAACCCTCCAGACTGCTGCCCAGGCGACGCTACGGCAAACAGAACCCC3720
4S TCACAATGGCGCGATCTCGGCTCACTGCAACCTTTGCCTCCCAGCTGCACCAGGGGGCCA3780
GAGCCGCCCTGACCCAGGCTTCCTCATCTGTCCAGGCTGCGACAGTGACTGTCATGGGAG3840
CCAGGACTCTGCTGGCTGATCTGGAAGGAATGAAGCTGCAGTTTCCCCGGCCCAAGGACC3900
S0
AGGCGGCATTGCAGAGGAAGGCAGACTCCGTCAGTGACAGACTCCTTGCAGACACGAGAA3960
AGAAGACCAAGCAGGCGGAGAGGATGCTGGGAAACGCGGCCCCTCTTTCCTCCAGTGCCA4020
SS AGAAGAAGGGCAGAGAAGCAGAGGTGTTGGCCAAGGACAGTGCCAAGCTTGCCAAGGCCT4080
TGCTGAGGGAGCGGAAACAGGCGCACCGCCGTGCCAGCAGGCTCACCAGCCAGACTGCAA4140
GCCACGCTCCAACAGGCGTCCCAGCAGGTGCTGGCGTCTGAAGCACGCAGACAGGAGCTG4200
60
GAGGAAGCTGAGCGGGTGGGTGCTGGGCTGAGCGAGATGGAGCAGCAGATCCGGGAATCG4260
CGTATCTCACTGGAGAAGGACATCGAGACCTTGTCAGAGCTGCTTGCCAGGCTGGGGTCG4320
CA 02304169 2000-03-22
WO 99/19348 ~ g PCT/US98/21391
CTGGACACCC ATCAAGCCGC AGCCCAGGCC CTGAACGAGA CTCAGTGGGC ACTAGAACGC 4380
CTGAGGCTGC AGCTGGGCTC CCCGGGGTCC TTGCAGAGGA AACTCAGTCT GCTGGAGCAG 4440
IO GAATCCCAGC AGCAGGAGCT GCAGATCCAGGGCTTCGAGAGTGACCTCGC CGAGATCCGC4500
GCCGACAAAC AGAACCTGGA GGCCATTCTGCACAGCCTGCCCGAGAACTG TGCCAGCTGG4560
CAGTGAGGGC TGCCCAGATC CCCGGCACACACTCCCCCACCTGCTGTTTA CATGACCCAG4620
1$
GGGGTGCACA CTACCCCACA GGTGTGCCCATACAGACATTCCCCGGAGCC GGCTGCTGTG4680
AACTCGACCC CGTGTGGATA GTCACACTCCCTGCCGATTCTGTCTGTGGC TTCTTCCCTG4740
2O CCAGCAGGAC TGAGTGTGCG TACCCAGTTCACCTGGACATGAGTGCACAC TCTCACCCCT4800
GCACATGCAT AAACGGGCAC ACCCCAGTGTCAATAACATACACACGTGAG GGTGCATGTC4860
TGTGTGTATG ACCCAAATAA p~~74AAAAAAA 4
8
9
0
2$
(2) INFORMATION FOR SEQ ID
N0:5:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 1105 amino acids
30 (B) TYPE: amino acid
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: peptide
3$ (v) FRAGMENT TYPE: internal
(xi) SEQUENCE N0:5:
DESCRIPTION:
SEQ
ID
40
Met GlnPheGln LeuThrLeu PheLeuHis LeuGlyTrp LeuSerTyr
1 5 10 15
Ser LysAlaGln AspAspCys AsnArgGly AlaCysHis ProThrThr
4$ 20 25 30
Gly AepLeuLeu.ValGlyArg AsnThrGln LeuMetAla SerSerThr
35 40 45
$0 Cys GlyLeuSer ArgAlaGln LysTyrCys IleLeuSer TyrLeuGiu
50 55 60
Gly GluGlnLys CysSerIle CysAspSer ArgPhePro TyrAspPro
65 70 75 BO
$$
Tyr AspGlnPro AsnSerHie ThrIleGlu AsnValThr ValSerPhe
85 90 95
Glu ProAspArg GluLysLys TrpTrpGln SerGluAsn GlyLeuAsp
60 100 105 110
His ValSerIle ArgLeuAsp LeuGluAla LeuPheArg PheSerHis
115 120 125
CA 02304169 2000-03-22
WO 99/19348 PCT/US98/Z1391
Leu IleLeuThr PheLysThr PheArgPro AlaAlaMet LeuValGlu
130 135 140 -
Arg SerThrAsp TyrGlyHis AsnTrpLys ValPheLys TyrPheAla
10 145 150 155 160
Lys AspCysAla ThrSerPhe ProAsnIle ThrSerGly GlnAlaGln
165 170 175
1$ Gly ValGlyAsp IleValCys AspSerLys TyrSerAep IleGluPro
180 185 190
Ser ThrGlyGly GluValVal LeuLysVal LeuAspPro SerPheGlu
195 200 205
20
Ile GluAsnPro TyrSerPro TyrIleGln AspLeuVal ThrLeuThr
210 215 220
Asn LeuArgIle AenPheThr LysLeuHis ThrLeuGly AspAlaLeu
2$ 225 230 235 240
Leu GlyArgArg GlnAsnAsp SerLeuAsp LysTyrTyr TyrAlaLeu
245 250 255
Tyr GluMetIle ValArgGly SerCysPhe CysAsnGly HisAlaSer
260 265 270
Glu CysArgPro MetGlnLys MetArgGly RspValPhe SerProPro
275 280 285
3$
Gly MetValHis GlyGlnCys ValCysGln HisAsnThr AspGlyPro
290 295 300
Asn CysGluArg CysLysAsp PhePheGln AspAlaPro TrpArgPro
305 310 315 320
Ala AlaAspLeu GlnAspAsn AlaCysArg SerCysSer CysAsnSer
325 330 335
4$ His SerSerArg CysHisPhe AspMetThr ThrTyrLeu AlaSerGly
340 345 350
Gly LeuSerGly GlyValCys GluAspCys GlnHisAsn ThrGluGly
355 360 365
$~
Gln HisCysAsp ArgCysArg ProLeuPhe TyrArgAsp ProLeuLys
370 375 380
Thr IleSerAsp ProTyrAla CysIlePro CysGluCys AspProAsp
$$ 385 390 395 400
Gly ThrIleSer GlyGlyIle CysValSer HisSerAsp ProAlaLeu
405 410 415
fib Gly SerValAla GlyGlnCys LeuCysLys GluAsnVal GluGlyAla
420 425 430
Lys CysAspGln CysLysPro AsnHisTyr GlyLeuSer AlaThrAsp
CA 02304169 2000-03-22
WO 99/19348 2 ~ PCT/US98121391
$ 435 440 445
Pro Leu Gly Cys Gln Pro Cys Aep Cys Asn Pro Leu Gly Ser Leu~Pro
450 455 460
Phe Leu Thr Cys Asp Val Asp Thr G1y Gln Cys Leu Cys Leu Xaa Tyr
465 470 475 480
Val Thr Gly Ala His Cys Glu Glu Cys Thr Val Gly Tyr Trp Gly Leu
485 490 495
IS
Gly Asn His Leu His Gly Cys Ser Pro Cys Asp Cys Asp Ile Gly Gly
500 505 510
Ala Tyr SerAsnVal CysSer ProLysAsn GlyGlnCysGlu CysArg
0 515 520 525
Pro His ValThrGly ArgSer CysSerGlu ProAlaProGly TyrPhe
530 535 540
2$ Phe Ala ProLeuAsn PheTyr LeuTyrGlu AlaGluGluAla ThrThr
545 550 555 560
Leu Gln GlyLeuAla ProLeu GlySerGlu ThrPheGlyGln SerPro
565 570 575
30
Ala Val HisValVal LeuGly GluProVal ProGlyAsnPro ValThr
580 585 590
Trp Thr GlyProGly PheAla ArgValLeu ProGlyAlaGly LeuArg
3$ 595 600 605
Phe Ala Val Asn Asn Ile Pro Phe Pro Val Asp Phe Thr Ile Ala Ile
610 615 620
40 His Tyr Glu Thr Gln Ser Ala Ala Asp Trp Thr Val Gln Ile Val Val
625 630 635 640
Asn Pro Pro Gly Gly Ser Glu His Cys Ile Pro Lys Thr Leu Gln Ser
645 650 655
Lys Pro Gln Ser Phe Ala Leu Pro Ala Ala Thr Arg Ile Met Leu Leu
660 665 670
Pro Thr Pro Ile Cys Leu Glu Pro Asp Val Gln Tyr Ser Ile Asp Val
$0 675 680 685
Tyr Phe Ser Gln Pro Leu Gln Gly Glu Ser His Ala His Ser His Val
690 695 ' 700
Leu Val Asp Ser Leu Gly Leu Ile Pro Gln Ile Asn Ser Leu Glu Asn
705 710 715 720
Phe Cys Ser Lys Gln Asp Leu Asp Glu Tyr Gln Leu His Asn Cys Val
725 730 735
Glu Ile Ala Ser Ala Met Gly Pro Gln Val Leu Pro Gly Ala Cys Glu
740 745 750
CA 02304169 2000-03-22
WO 99/19348 22 PCT/US98J~1391
Arg Leu Ile Ile Ser Met Ser Ala Lys Leu His Asp Gly Ala Val Ala
755 760 765
Cys Lys Cys His Pro Gln Gly Ser Val Gly Ser Ser Cys Ser Arg Leu
770 775 780
Gly Gly Gln Cys Gln Cys Lys Pro Leu Val Val Gly Arg Cys Cys Asp
785 790 795 800
Arg Cys Ser Thr Gly Ser Tyr Asp Leu Gly His Hie Gly Cys His Pro
IS 805 810 815
Cys His Cys His Pro Gln Gly Ser Lys Asp Thr Val Cys Asp Gln Val
820 825 830
Thr Gly Gln Cys Pro Cys His Gly Glu Val Ser Gly Arg Arg Cys Asp
835 840 845
Arg Cys Leu Ala Gly Tyr Phe Gly Phe Pro Ser Cys His Pro Cys Pro
850 855 860
Cys Xaa Arg Phe Xaa Ala Xaa Asp Xaa Leu Xaa Xaa Asp Pro Glu Thr
865 870 875 880
Gly Ser Cys Phe Asn Cys Gly Gly Phe Thr Thr Gly Arg Asn Cys Glu
885 890 895
Arg Cys Ile Asp Gly Tyr Tyr Gly Asn Pro Ser Ser Gly Gln Pro Cys
900 905 910
3$ Arg Pro Cys Leu Cys Pro Asp Asp Pro Ser Ser Asn Gln Tyr Phe Ala
915 920 925
His Ser Cys Tyr Gln Asn Leu Trp Ser Ser Asp Val Ile Cys Asn Cys
930 935 940
Leu Gln Gly Tyr Thr Gly Thr Gln Cys Gly Glu Cys Ser Thr Gly Phe
945 950 955 960
Tyr Gly Asn Pro Arg Ile Ser Gly Ala Pro Cys Gln Pro Cys Ala Cys
965 970 975
Asn Asn Asn Ile Asp Val Thr Asp Pro Glu Ser Cys Ser Arg Val Thr
980 985 990
SO Gly Glu Cys Leu Arg Cys Leu His Asn Thr Gln Gly Ala Asn Cys Gln
995 1000 1005
Leu Cys Lys Pro Gly His Tyr Gly Ser Ala Leu Asn Gln Thr Cys Arg
1010 1015 1020
Arg Cys Ser Cys His Ala Ser Gly Val Ser Pro Met Glu Cys Pro Pro
1025 1030 1035 1040
Gly Gly Gly Ala Cys Leu Cys Asp Pro Val Thr Gly Ala Cys Pro Cys
1045 1050 1055
Leu Pro Asn Val Thr Gly Leu Ala Cys Asp Arg Cys Ala Asp Gly Tyr
1060 1065 1070
CA 02304169 2000-03-22
WO 99/19348 PCT1US98/21391
23
S
Trp Asn Leu Val Pro Gly Arg Gly Cys Gln Ser Cys Asp Cys Asp Pro
1075 1080 1085
Arg Xaa Ser Gln Ser Ser His Cys Asp Gln Ala Arg Tyr Phe Lys Ala
1090 1095 1100
Tyr
1105
IS (2) INFORMATION FOR SEQ ID N0:6:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 3754 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: cDNA
2S
(xi) SEQUENCE
DESCRIPTION:
SEQ ID
N0:6:
ACATGCCCCGTTTGCT(3CCT GAACCTCTCC ACAAAGACTCCCAGATCCTG AATTGAATTT60
AATCATCTCCTGACAAAAGA ATGCAATTTC AACTGACCCTTTTTTTGCAC CTTGGGTGGC120
TCAGTTACTCAAAAGCTCAA GATGACTGCA ACAGGGGTGCCTGTCATCCC ACCACTGGTG180
3S ATCTCCTGGTGGGCAGGAAC ACGCAGCTTA TGGCTTCTTCTACCTGTGGG CTGAGCAGAG240
CCCAGAAATACTGCATCCTC AGTTACCTGG AGGGGGAACAAAAATGCTCC ATCTGTGACT300
CTAGATTTCCATATGATCCG TATGACCAAC CCAACAGCCACACCATTGAG AATGTCACTG360
TAAGTTTTGAACCAGACAGA GAAAAGAAAT GGTGGCAATCTGAAAATGGT CTTGATCATG420
TCAGCATCAGACTGGACTTA GAGGCATTAT TTCGGTTCAGCCACCTTATC CTGACCTTTA480
4S AGACTTTTCGGCCTGCTGCA ATGTTAGTTG AACGTTCCACAGACTATGGA CACAACTGGA540
AAGTGTTCAAATATTTTGCA AAAGACTGTG CCACTTCCTTTCCTAACATC ACATCTGGCC600
AGGCCCAGGGAGTGGGAGAC ATTGTTTGTG ACTCCAAATACTCGGATATT GAACCCTCAA660
S0
CAGGTGGAGAGGTTGTTTTA AAAGTTTTGG ATCCCAGTTTTGAAATTGAA AACCCTTATA720
GCCCCTACATCCAAGACCTT GTGACATTGA CAAACCTGAGGATAAACTTT ACCAAGCTCC780
SS ACACCCTTGGGGATGCTTTG CTTGGAAGGA GGCAAAATGATTCCCTTGAT AAATACTACT840
ATGCTCTGTACGAGATGATT GTTCGGGGAA GCTGCTTTTGCAATGGCCAT GCTAGCGAAT900
GTCGCCCTATGCAGAAGATG CGGGGAGATG TTTTCAGCCCTCCTGGAATG GTTCACGGTC960
AGTGTGTGTG TCAGCACAAT ACAGATGGTC CGAACTGTGA GAGATGCAAG GACTTCTTCC 1020
AGGATGCTCC TTGGAGGCCA GCTGCAGACC TCCAGGACAA CGCTTGCAGA TCGTGCAGCT 1080
CA 02304169 2000-03-22
WO 99119348 PCT/US98I21391
24
S
GTAATAGCCACTCCAGCCGCTGTCACTTTGACATGACTACGTACCTGGCA 1140
AGCGGTGGCC
TCAGCGGGGGCGTGTGTGAAGACTGCCAGCACAACACTGAGGGGCAGCACTGCGACCGCT1200
lO GCAGACCCCTCTTCTACAGGGACCCGCTCAAGACCATCTCAGATCCCTACGCGTGCATTC1260
CTTGTGAATGTGACCCCGATGGGACCATATCTGGTGGCATTTGTGTGAGCCACTCTGATC1320
CTGCCTTAGGGTCTGTGGCCGGCCAGTGCCTTTGTAAAGAGAACGTGGAAGGAGCCAAAT1380
1S
GCGACCAGTGCAAACCCAACCACTACGGACTAAGCGCCACCGACCCCCTGGGCTGCCAGC1440
CCTGCGACTGTAACCCCCTTGGGAGTCTGCCATTCTTGACCTGTGATGTGGATACAGGCC1500
2O AATGCTTGTGCCTGTATATGTCACCGGAGCACACTGCGAAGAATGCACTGTTGGATACTG1560
GGGCCTGGGAAATCATCTCCATGGGTGTTCTCCCTGTGACTGTGATATTGGAGGTGCTTA1620
TTCTAACGTGTGCTCACCCAAGAATGGGCAGTGTGAATGCCGCCCACATGTCACTGGCCG1680
2S
TAGCTGCTCTGAACCAGCCCCTGGCTACTTCTTTGCTCCTTTGAATTTCTATCTCTACGA1740
GGCAGAGGAAGCCACAACACTCCAAGGACTGGCGCCTTTGGGCTCGGAGACGTTTGGCCA1800
3O GAGTCCTGCTGTTCACGTTGTTTTAGGAGAGCCAGTTCCTGGGAACCCTGTTACATGGAC1860
TGGACCTGGATTTGCCAGGGTTCTCCCTGGGGCTGGCTTGAGATTTGCTGTCAACAACAT1920
TCCCTTTCCTGTGGACTTCACCATTGCCATTCACTATGAAACCCAGTCTGCAGCTGACTG1980
35
GACTGTCCAGATTGTGGTGAACCCCCCTGGAGGGAGTGAGCACTGCATACCCAAGACTCT2040
ACAGTCAAAGCCTCAGTCTTTTGCCTTACCAGCGGCTACGAGAATCATGCTGCTTCCCAC2100
4O ACCCATCTGTTTAGAACCAGATGTACAATATTCCATAGATGTCTATTTTTCTCAGCCTTT2160
GCAAGGAGAGTCCCACGCTCATTCACATGTCCTGGTGGACTCTCTTGGCCTTATTCCCCA2220
AATCAATTCATTGGAGAATTTCTGCAGCAAGCAGGACTTAGATGAGTATCAGCTTCACAA2280
4S
CTGTGTTGAAATTGCCTCAGCAATGGGACCTCAAGTGCTCCCGGGTGCCTGTGAAAGGCT2340
GATCATCAGCATGTCTGCCAAGCTGCATGATGGGGCTGTGGCCTGCAAGTGTCACCCCCA2400
SO GGGCTCAGTCGGATCCAGCTGCAGCCGACTTGGAGGCCAGTGCCAGTGTAAACCTCTTGT2460
GGTCGGGCGCTGCTGTGACAGGTGCTCAACTGGAAGCTATGATTTGGGGCATCACGGCTG2520
TCACCCATGTCACTGCCATCCTCAAGGATCAAAGGACACTGTATGTGACCAAGTAACAGG2580
SS
ACAGTGCCCCTGCCATGGAGAGGTGTCTGGCCGCCGCTGTGATCGCTGCCTGGCAGGCTA2640
CTTTGGATTTCCCAGCTGCCACCCTTGCCCTTGTAAAGGTTTCGCTAGACACTTTTGTGA2700
C)OTCCTGAGACAGGGTCATGCTTCAATTGTGGAGGCTTTACAACTGGCAGAAACTGTGAAAG2760
GTGTATTGATGGTTACTATGGAAATCCTTCTTCAGGACAGCCCTGTCGTCCTTGCCTGTG2820
CA 02304169 2000-03-22
WO 99/19348 PCT/US98/21391
25
S TCCAGATGAT CCCTCAAGCAATCAGTATTTTGCCCATTCCTGTTATCAGAATCTGTGGAG 2880
CTCAGATGTA ATCTGCAATTGTCTTCAAGGTTATACGGGTACTCAGTGTGGAGAATGCTC 2940
TACTGGTTTC TATGGAAATCCAAGAATTTCAGGAGCACCTTGCCAACCATGTGCCTGCAA 3000
CAACAACATA GATGTAACCGATCCAGAGTCCTGCAGCCGGGTAACAGGGGAGTGCCTTCG 3060
ATGTTTGCAC AACACTCAGGGCGCAAACTGCCAGCTCTGCAAACCAGGTCACTATGGATC 3120
IS AGCCCTCAAT CAGACCTGCAGAAGATGCTCCTGCCATGCTTCCGGCGTGAGTCCCATGGA 3180
GTGTCCCCCT GGTGGGGGAGCTTGCCTCTGTGACCCTGTCACTGGTGCATGTCCTTGTCT 3240
GCCGAATGTC ACAGGCCTGGCCTGTGACCGTTGTGCTGATGGATACTGGAATCTGGTCCC 3300
TGGCAGAGGA TGTCAGTCATGTGACTGTGACCCTAGCCTCTCAAAGTAGCCACTGTGACC 3360
AGGCAAGATA CTTTAAAGCTTACTAGTGCATCAAAGTGAGCATGATAGTGAGACATGGTT 3420
2S TCTAATGTGT AAAGAAAGTTTCTTTTATGTACTGTTGTTAATTAGTGCATTGAAACAGGA 3480
TGCCTTACAG GGATGGAGTCAGCCTCTATCAAGGAATGAAACCAAAAAAGAGAATGAGCA 3540
TCTCAAGTTC AGCTTCGCCTACTTCAGTTTCCCCTC'rGTGACTGAGGAAGTCAGAATTCA 3600
TACACAGTGA AACACAGACATCAGCCTCACCTTTCACTATTTCATACATGTAACCATAGG 3660
GAAGACCTAA GAAATAGTTAATCAGAAGAGATTATGAATCAGAATGAAAATAAACAGATA 3720
3S CCTTCAAAAC CTAAAAAAAAAAA,AAAAAAAAAAA 3754
