Note : Les descriptions sont présentées dans la langue officielle dans laquelle elles ont été soumises.
CA 02307357 2000-OS-26
-1-
B&P File No. 6580-204/JRR
Title: WbpP and Method For Assay of WbpP
FIELD OF THE INVENTION
This invention is in the field of bacterial infections and is more
particularly concerned with infection by Pseudomonas aeruginosa and is
specifically concerned with enzymes involved with the synthesis of O
antigens, namely WbpP and methods for the use and assay for WbpP.
BACKGROUND OF THE INVENTION
Pseudomonas aeruginosa is an opportunistic gram-negative
bacterium that can cause life-threatening infections in patients with cystic
fibrosis or burn wounds (Hancock et al. (1983)). It produces a wide
variety of virulence factors such as proteases, toxins, alginate and
lipopolysaccharides (LPS) (Hancock et al. (1983)). Two forms of LPS have
been identified: the antigenically conserved A-band LPS, and the variable
O-antigen or B-band. B-band LPS is particularly important in the initial
steps of the infection, and particularly for evasion of host defenses and
colonization (Cryz et al. (1984); Pier et al. (1982)). It contributes to
causing
initial tissue damage and inflammatory responses in the lungs of patients
with cystic fibrosis (Cryz et al. (1984)). P. aeruginosa mutants deficient in
B-band LPS biosynthesis are more sensitive to serum killing (Hancock et
al. (1983); Schiller et al. (1983); Goldberg et al. (1996)) and are more
susceptible to phagocytosis (Engles et al. (1985)) than wild-type bacteria.
They are found almost avirulent in mouse models (Cryz et al. (1984)). B-
band LPS is the basis for classification of P. aeruginosa in 20 different
serotypes. Among these, serotypes 06 and 011 are the most clinically
relevant in epidemiological studies (Pitt (1989)). To date, the prognosis
for a cystic fibrosis patient infected with either serotype of P. aeruginosa
is
rather poor due to intrinsic multidrug resistance of P. aeruginosa. Such
resistance is due partly to a highly impermeable outer membrane and
partly to the presence of multidrug efflux pumps (Poole et al. (1993);
Poole et al. (1996); Srikumar et al. (1999)). Hence, B-band LPS
biosynthesis has become an important target for drug discovery.
The genetics of B-band LPS biosynthesis are well documented in
serotypes 05, 06 and 011 (Burrows et al. (1996); Belanger et al. (1999);
CA 02307357 2000-OS-26
-2-
Dean et al. (1999)) and were thoroughly reviewed recently (Rocchetta et
al. (1999)). For each of these serotypes, the entire cluster of genes
responsible for B-band LPS synthesis has been sequenced and putative
pathways for the synthesis of the corresponding O-antigens have been
proposed based on homology studies. In serotype 011, the functional
role of these genes awaits further studies. However, in serotypes 05 and
06, extensive functional characterisation has been performed by
knockout construction and complementation analysis, using not only
genes from P. aeruginosa but also homologues found in other organisms.
Despite these efforts, ambiguities persist that can only be alleviated by
direct biochemical characterisation of the proteins involved. Such a
characterisation will also allow screening for inhibitors that might be
useful for therapeutic purposes, especially if performed for enzymes
found in the clinically relevant serotype 06.
SUMMARY OF THE INVENTION
The present inventors have cloned the nucleic acid sequence of
WbpP in an expression vector that allows the production for the first time
of large amounts of the WbpP protein .
Accordingly, in one embodiment, the present invention provides
an isolated nucleic acid molecule comprising:
(a) a nucleic acid sequence as shown in Figure 9
(SEQ.ID.N0.:1), wherein T can also be U;
(b) nucleic acid sequences complementary to (a);
(c) nucleic acid sequences which are homologous to (a) or (b);
(d) a fragment of (a) to (c) that is at least 15 bases, preferably 20
to 30 bases, and which will hybridize to (a) to (d) under stringent
hybridization conditions; or
(e) a nucleic acid molecule differing from any of the nucleic
acids of (a) to (c) in codon sequences due to the degeneracy of the genetic
code.
According to another embodiment the present invention provides
an isolated nucleic acid molecule having the sequence shown in Figure 9
(SEQ.ID.N0.:1) (or variants or fragments thereof. The present invention
also provides a protein encoded by the nucleic acid sequence of Figure 9
(SEQ.ID.N0.:1) and shown in Figurel0 (SEQ.ID.N0.:2). The protein
CA 02307357 2000-OS-26
-3-
possesses a N-terminal extension as a histidine tag that allows fast and
efficient purification of the enzyme.
Having isolated and purified a WbpP enzyme has allowed the
inventors to characterize its function. The O-antigen of B-band LPS of
serotype 06 consists of a tetrasaccharide repeat of ~-a-D-3 O-acetyl, 6
amino-GaINAcA-(1~4)-a-D-6-amino-GaINFmA-(1-~3)-a-D-QuiNAc-
(1-~2)-a-z-Rha-(1(15-17). GaINAcA is thought to be synthesized in vivo
via epimerisation and dehydrogenation of UDP-GIcNAc, the main
precursor of surface-associated carbohydrate synthesis (Belanger et al.
(1999); Kochetkov et al. (1973); Virlogeux et al. (1995)). The product of
the epimerisation reaction, UDP-GaINAc, is an important intermediate for
the synthesis of polysaccharide structures that contain GaINAcA or a
derivative, not only in P. aeruginosa but also in other organisms. The gene
wbpP is part of the B-band LPS cluster in P. aeruginosa 06 (Belanger et al.
(1999)). The amino acid sequence of WbpP (Figure 10 (SEQ ID NO.: 2))
shows 23 % identity with the C4 UDP-Glc epimerase GaIE from
Escherichia coli. It also shows 66 % identity with WcdB, an enzyme thought
to be involved in the formation of GaINAcA residues present in the Vi
polysaccharide of Salmonella typhi (Virlogeux et al. (1995)). Disruption of
the wbpP gene in a knockout mutant results in loss of B-band LPS
production in P. aeruginosa and, this deficiency is fully alleviated after
complementation by the wcdB homologue (Belanger et al. (1999)).
Though no biochemical evidence is available for either WbpP or WcdB,
sequence comparisons with other proteins and carbohydrate composition
analysis suggest that they are C4 epimerases that transform UDP-GIcNAc
into UDP-GaINAc in vivo.
A functional assignment relying mainly on homology studies is
particularly problematic in the case of putative epimerases. Epimerases
belong to the short-chain d_ehydrogenase/reductase (SDR) enzyme
family. This family includes enzymes responsible for a wide variety of
functions (Jornvall et al. (1995); jornvall (Adv. Exp. Med. Biol. 463, 359-364
(1999)); Jornvall et al. (FEBS Lett. 445, 261-264 (1999)). Most of these
enzymes possess common features which include the presence of the G-
x-x-G-x-x-G signature for nucleotide binding proteins and the presence of
alternating a and (3 structures which delineate a typical nucleotide binding
CA 02307357 2000-OS-26
-4-
Rossman fold at their N-terminus (Rossmann, et al. (1975); Bauer et al.
(1992)). Moreover, they share a conserved catalytic triad S-(x)24--Y-(x)33-
K probably involved in initiation of the catalytic process. All these
features are present in WbpP and they match perfectly with those found
in the C4 UDP-Gal epimerase GaIE found in E. coli (Figure 1) but also
those of other enzymes with different functions such as RFFG, a dTDP-
glucose 4,6-dehydratase present in E. coli (Marolda et al. (1995)). Here is
described the work conducted by the inventors to perform the
biochemical analysis necessary to prove without ambiguity the function
of WbpP, namely, that of a C4 UDP-GIcNAc epimerase. This describes
the first epimerase for the N-acetylated form of the substrate.
The present invention also includes expression vectors containing
the nucleic acid molecules of the present invention. The expression
vectors will contain the necessary regulatory regions to provide for
expression of the histidine tagged protein.
The present invention further provides host cells which have been
transformed with the expression vectors of the present invention.
Accordingly, the present invention provides a method for
expressing a protein having WbpP activity comprising inserting a nucleic
acid molecule encoding the protein into an appropriate expression
vector; transforming a host cell with the expression vector; and
providing conditions which allow for expression of the protein.
Preferably the protein is expressed in soluble and active form.
In another embodiment the present invention provides a method
of assaying for WbpP activity in a sample comprising adding a sufficient
amount of UDP GaINAc to the sample, under appropriate conditions for
reaction, and assaying for UDP GIcNAc, wherein the appearance of UDP
GIcNAc reflects the presence of WbpP activity. Preferably the amount of
UDP GIcNAc which appears is determined, and preferably the amount of
UDP GIcNAc which is determined is correlated to the amount of the
substance providing the WbpP activity in order to determine the amount
of the substance providing the WbpP activity which is in the sample.
Preferably the amount of UDP-GIcNAc formed is determined by
spectrophotometric assay using p-dimethylaminobenzaldehyde (DMAB).
According to another embodiment, the present invention provides
CA 02307357 2000-OS-26
-5-
a method of assaying for WbpP activity in a sample comprising adding a
sufficient amount of UDP GIcNAc to the sample, under appropriate
conditions for reaction, and assaying for changes in the presence of UDP
GIcNAc, wherein a disappearance, or reduction in UDP GIcNAc reflects
the presence of WbpP activity. Preferably changes in the amount of UDP
GIcNAc are determined and preferably the amount of UDP-GIcNAc
which is determined is correlated to the amount of the substance
providing the WbpP activity in order to determine the amount of the
substance providing the WbpP activity which is in the sample. Preferably
the amount of UDP-GIcNAc is determined by spectrophotometric assay
using p-dimethylaminobenzaldehyde (DMAB).
In another aspect, the present invention provides an assay for
detecting inhibitors of a substance with WbpP activity. Accordingly, the
present invention further provides a method for screening for an
inhibitor of a substance with WbpP activity comprising (a) incubating a
test sample containing (i) a substance with WbpP activity, (ii) a substance
suspected of being an inhibitor of the substance; and (iii) UDP-GIcNAc or
UDP-GaINAc; (b) stopping the reaction; (c) comparing the amount of
UDP-GIcNAc, or UDP-GaINAc in the test sample with the amount in a
control sample (that does not contain the substance suspected of being an
inhibitor) wherein a decrease in the amount of GIcNAc, or UDP-GaINAc
in the control sample as compared to the test sample indicates that the
substance is an inhibitor of the substance with WbpP activity.
The present invention further provides a method for diagnosing
or detecting an infection, preferably those associated with Pseudomonas
aeruginosa, comprising detecting the presence of a nucleic acid or protein
of the present invention in a biological sample.
The present invention also provides a method for inhibiting
infection of an animal, preferably those infections associated with
Pseudomonas aeruginosa, comprising inhibiting the transcription or
translation (i.e., expression) of a nucleic acid molecule of the present
invention. The expression of the nucleic acid molecule may be inhibited
using antisense oligonucleotides that are complimentary to the nucleic
acid molecules of the invention.
CA 02307357 2000-08-24
-6-
The present invention further provides a method for inhibiting
infection in an animal comprising inhibiting the activity of the proteins of
the present invention. The proteins of the present invention may be
inhibited by using an antibody that is specific for the protein.
According, to another aspect, the present invention provides a
method for converting UDP-GIcNAc to UDP-GaINAc. UDP-N-
acetylgalactosamine (UDPGaINAc) may be used as a substrate in an
assay. UDP-GaINAc is very expensive. Consequently, the inventors
have developed a method of producing UDPGaINAc from UDP-N-
acetylglucosamine (UDPGIcNAc) which is less costly: Namely the present
invention provides a method of producing UDPGaINAc comprising
incubating an epimerase in the presence of UDPGIcNAc under
appropriate conditions for the production of UDPGaINAc. Preferably,
the epimerase is WbpP from serotype 06 (WbpP06). Preferably the
amount of UDP-GaINAc formed is determined by spectrophotometric
assay using p-dimethylaminobenzaldehyde (DMAB).
The present invention also provides a method of inhibiting the
epimerization of UDP-GaINAc. Preferably inhibition may be achieved
through inhibition of expression of the nucleic acid molecule using
antisense oligonucleotides that are complimentary to the nucleic acid
molecules of the invention.
Other features and advantages of the present invention will
become apparent from the following detailed description. It should be
understood, however, that the detailed description and the specific
examples while indicating preferred embodiments of the invention are
given by way of illustration only, since various changes and modifications
within the spirit and scope of the invention will become apparent to those
skilled in the art from this detailed description.
BRIEF DESCRIPTION OF THE FIGURES
Figure 1 illustrates a comparison of the primary and secondary
structural features of 3 members of the short-chain
dehydrogenase/reductase family including WbpP (SEQ.ID.NOS.5 and 6).
Figure 2 shows an SDS-PAGE analysis of WbpP through steps of
its purification.
Figure 3A is a graph showing the results of a DMAB assay using
CA 02307357 2000-OS-26
-7-
UDP-GIcNAc and UDP-GaINAc separately as standards (no enzyme
reaction performed)
Figure 3B is a graph showing the results of a DMAB assay using
mixtures of UDP-GIcNAc and UDP-GaINAc and comparing with the
theoretical curve obtained by calculations using standard curves (note,
there was no enzyme reaction).
Figure 3C is a graph showing the results of epimerisation of UDP-
GIcNAc and UDP-GaINAc in mixtures by WbpP as a function of amount
of enzyme added, using the DMAB assay.
Figure 4 is a graph showing a capillary electrophoresis analysis of
the epimerisation of UDP-GIcNAc and UDP-GaINAc by WbpP at
equilibrium.
Figure 5 is a graph showing the relationship of time course of
epimerisation of UDP-GIcNAc and UDP-GaINAc by WbpP as measured
by capillary electrophoresis.
Figure 6A is a graph illustrating the relationship between pH and
epimerisation of UDP-GIcNAc by WbpP using the DMAB assay.
Figure 6B is a graph illustrating the relationship between
temperature and epimerisation of UDP-GIcNAc by WbpP using the
DMAB assay.
Figure 7 is a graph illustrating the time-course for the
epimerisation of UDP-Glc and UDP-Gal by WbpP using the glucose
oxidase-coupled assay.
Figure 8 is a graph showing a capillary electrophoresis analysis of
the epimerisation of UDP-Glc and UDP-Gal by WbpP at equilibrium.
Figure 9 is the DNA sequence of WbpP06 carrying a N-terminal
hexahistidine tag (in bold).
Figure 10 is the amino acid sequence of WbpP06 carrying a N-
terminal hexahistidine tag (in bold).
Figure 11 is the overexpression of WbpP as a soluble protein and
purification by nickel chelation.
Figure 12 shows the measurement of activity for WbpP as
followed by the disappearance of different substrates (UDP-GaINAc and
UDP-GIcNAc), after incubation with cell extracts containing
overexpressed protein or with purified protein.
CA 02307357 2000-OS-26
-8-
DETAILED DESCRIPTION OF THE INVENTION
As mentioned above, the present inventors have isolated and
purified the nucleic acid sequence of WbpP, and deduced the amino acid
sequence of the enzyme. Further, the authors have cloned the nucleic
acid sequence of WbpP in an expression vector and have expressed the
protein in an active form and determined its functional activity all of
which will now be described in further detail. It is understood by those
skilled in the art that the term "expression of the protein" includes
expression and overexpression.
As used herein "WbpP activity" means an epimerase activity of a
substance including conversion of UDP-GaINAc to UDP-GIcNAc and vice
versa.
As used herein "appropriate conditions" means those conditions, as
understood by those skilled in the art, including temperature, time,
volumes and quantities of reactants, pressure which allow for reactants to
undergo a reaction to give reaction products.
As used herein "sufficient amount" means an amount of a
substance or reactant to result in an observable reaction product.
The term "animal" as used herein includes all members of the
animal kingdom including mammals, preferably humans.
As used herein, the following symbols have the following
meaning: LPS, lipopolysaccharide; UDP, uridyl diphospho nucleoside;
Glc, glucose; Gal, galactose; GIcNAc, N-acetyl glucosamine; GaINAc, N-
acetyl galactosamine; DMAB, p-dimethylaminobenzaldehyde; SDR, short-
chain dehydrogenase/reductase; CE, capillary electrophoresis; PAGE,
polyacrylamide gel electrophoresis. IPTG, isopropyl-1-thin-[3-D-
galactopyranoside; IMAC: immobilized metal affinity chromatography.
I. NUCLEIC ACID MOLECULES OF THE INVENTION
As just stated the present invention relates to isolated nucleic acid
molecules of WbpP. and the cloning of the nucleic acid sequence of WbpP
in an expression vector and expression the protein in an active form. The
term "isolated" refers to a nucleic acid substantially free of cellular
material or culture medium when produced by recombinant DNA
techniques, or chemical precursors, or other chemicals when chemically
synthesized. The term "nucleic acid" is intended to include DNA and RNA
CA 02307357 2000-OS-26
-9-
and can be either double stranded or single stranded.
In an embodiment of the invention, an isolated nucleic acid
molecule is provided having a sequence as shown in Figure 9
(SEQ.ID.N0.:1), or a fragment or variant thereof.
Preferably, the isolated nucleic acid molecule comprises (a)-a
nucleic acid sequence as shown in Figure 9 (SEQ.ID.NO.:1), wherein T can
also be U; (b) nucleic acid sequences complementary to (a); (c) nucleic acid
sequences which are homologous to (a) or (b); (d) a fragment of (a) to (c)
that is at least 15 bases, preferably 20 to 30 bases, and which will
hybridize to (a) to (d) under stringent hybridization conditions; or (e) a
nucleic acid molecule differing from any of the nucleic acids of (a) to (c) in
codon sequences due to the degeneracy of the genetic code.
It will be appreciated that the invention includes nucleic acid
molecules encoding truncations of the proteins of the invention, and
analogs and homologs of the proteins of the invention and truncations
thereof, as described below. It will further be appreciated that variant
forms of the nucleic acid molecules of the invention which arise by
alternative splicing of an mRNA corresponding to a cDNA of the
invention are encompassed by the invention.
Further, it will be appreciated that the invention includes nucleic
acid molecules comprising nucleic acid sequences having substantial
sequence homology with the nucleic acid sequence as shown in
SEQ.ID.N0.:1 and fragments thereof. The term "sequences having
substantial sequence homology" means those nucleic acid sequences
which have slight or inconsequential sequence variations from these
sequences, i.e. the sequences function in substantially the same manner to
produce functionally equivalent proteins. The variations may be
attributable to local mutations or structural modifications.
Generally, nucleic acid sequences having substantial homology
include nucleic acid sequences having at least 70%, preferably 80-90%
identity with the nucleic acid sequence as shown in FIGURE 9 (SEQ ID.
NO.: 1).
Another aspect of the invention provides a nucleic acid molecule,
and fragments thereof having at least 15 bases, which hybridizes to the
nucleic acid molecules of the invention under hybridization conditions,
CA 02307357 2000-OS-26
-10-
preferably stringent hybridization conditions. Appropriate stringency
conditions which promote DNA hybridization are known to those skilled
in the art, or may be found in Current Protocols in Molecular Biology,
John Wiley & Sons, N.Y. (1989), 6.3.1-6.3.6. For example, the following
may be employed: 6.0 x sodium chloride/sodium citrate (SSC) at about
45°C, followed by a wash of 2.0 x SSC at 50°C. The stringency
may be
selected based on the conditions used in the wash step. For example, the
salt concentration in the wash step can be selected from a high stringency
of about 2.0 x SSC at 50°C. In addition, the temperature in the wash
step
can be at high stringency conditions, at about 65°C.
Isolated and purified nucleic acid molecules having sequences
which differ from the nucleic acid sequence shown in FIGURE 9 (SEQ ID.
NO.: 1) due to degeneracy in the genetic code are also within the scope of
the invention.
Nucleic acid molecules of the invention can be isolated by
preparing a labelled nucleic acid probe based on all or part of the nucleic
acid sequence as shown in FIGURE 9 (SEQ ID. NO.: 1), and using this
labelled nucleic acid probe to screen an appropriate DNA library (e.g. a
cDNA or genomic DNA library). For example, a human and mouse
libraries can be used to isolate a DNA encoding a novel protein of the
invention by screening the library with the labelled probe using standard
techniques. Nucleic acids isolated by screening of a cDNA or genomic
DNA library can be sequenced by standard techniques.
Nucleic acid molecules of the invention can also be isolated by
selectively amplifying a nucleic acid using the polymerase chain reaction
(PCR) method and cDNA or genomic DNA. It is possible to design
synthetic oligonucleotide primers from the nucleic acid molecules as
shown in FIGURE 9 (SEQ ID. NO.: 1) for use in PCR. A nucleic acid can be
amplified from cDNA or genomic DNA using these oligonucleotide
primers and standard PCR amplification techniques. The nucleic acid so
amplified can be cloned into an appropriate vector and characterized by
DNA sequence analysis. It will be appreciated that cDNA may be
prepared from mRNA, by isolating total cellular mRNA by a variety of
techniques, for example, by using the guanidinium-thiocyanate extraction
procedure of Chirgwin et al., Biochemistry, 18, 5294-5299 (1979). cDNA is
CA 02307357 2000-OS-26
-11-
then synthesized from the mRNA using reverse transcriptase (for
example, Moloney MLV reverse transcriptase available from Gibco/BRL,
Bethesda, MD, or AMV reverse transcriptase available from Seikagaku
America, Inc., St. Petersburg, FL).
An isolated nucleic acid molecule of the invention which is RNA
can be isolated by cloning a cDNA encoding a novel protein of the
invention into an appropriate vector which allows for transcription of the
cDNA to produce an RNA molecule which encodes a protein of the
invention.
A nucleic acid molecule of the invention may also be chemically
synthesized using standard techniques. Various methods of chemically
synthesizing polydeoxynucleotides are known, including solid-phase
synthesis which, like peptide synthesis, has been fully automated in
commercially available DNA synthesizers (See e.g., Itakura et al. U.S.
Patent No. 4,598,049; Caruthers et al. U.S. Patent No. 4,458,066; and
Itakura U.S. Patent Nos. 4,401,796 and 4,373,071).
The initiation codon and untranslated sequences of the nucleic acid
molecules of the invention may be determined using currently available
computer software designed for the purpose, such as PC/Gene
(IntelliGenetics Inc., Calif.). Regulatory elements can be identified using
conventional techniques. The function of the elements can be confirmed
by using these elements to express a reporter gene which is operatively
linked to the elements. These constructs may be introduced into cultured
cells using standard procedures. In addition to identifying regulatory
elements in DNA, such constructs may also be used to identify proteins
interacting with the elements, using techniques known in the art.
The sequence of a nucleic acid molecule of the invention may be
inverted relative to its normal presentation for transcription to produce
an antisense nucleic acid molecule. Preferably, an antisense sequence is
constructed by inverting a region preceding the initiation codon or an
unconserved region. In particular, the nucleic acid sequences contained in
the nucleic acid molecules of the invention or a fragment thereof,
preferably a nucleic acid sequence shown in the Sequence Listing as
SEQ.ID.N0.1 may be inverted relative to its normal presentation for
transcription to produce antisense nucleic acid molecules.
CA 02307357 2000-OS-26
-12-
The antisense nucleic acid molecules of the invention or a fragment
thereof, may be chemically synthesized using naturally occurring
nucleotides or variously modified nucleotides designed to increase the
biological stability of the molecules or to increase the physical stability of
the duplex formed with mRNA or the native gene e.g., phosphorothioate
derivatives and acridine substituted nucleotides. The antisense sequences
may be produced biologically using an expression vector introduced into
cells in the form of a recombinant plasmid, phagemid or attenuated virus
in which antisense sequences are produced under the control of a high
efficiency regulatory region, the activity of which may be determined by
the cell type into which the vector is introduced.
The invention also provides nucleic acids encoding fusion proteins
comprising a novel protein of the invention and a selected protein, or a
selectable marker protein (see below).
II. NOVEL PROTEINS OF THE INVENTION
The invention further broadly contemplates an isolated protein
encoded by the nucleic acid molecules of the invention. Within the
context of the present invention, a protein of the invention may include
various structural forms of the primary protein which retain biological
activity.
In an embodiment the protein has the amino acid sequence shown
in Figure 10 (SEQ.ID.N0.:2).
In addition to full length amino acid sequences the proteins of the
present invention also include truncations of the protein, and analogs,
and homologs of the protein and truncations thereof as described herein.
Truncated proteins may comprise peptides of at least fifteen amino acid
residues.
The truncated proteins may have an amino group (NH2), a
hydrophobic group (for example, carbobenzoxyl, dansyl, or T-
butyloxycarbonyl), an acetyl group, a 9-fluorenylmethoxy-carbonyl
(PMOC) group, or a macromolecule including but not limited to lipid-
fatty acid conjugates, polyethylene glycol, or carbohydrates at the amino
terminal end. The truncated proteins may have a carboxyl group, an
amido group, a T-butyloxycarbonyl group, or a macromolecule including
but not limited to lipid-fatty acid conjugates, polyethylene glycol, or
CA 02307357 2000-OS-26
-13-
carbohydrates at the carboxy terminal end.
Analogs of the protein having the amino acid sequence shown in
SEQ.ID.N0.:2 and/or truncations thereof as described herein, may
include, but are not limited to an amino acid sequence containing one or
more amino acid substitutions, insertions, and/or deletions. Amino acid
substitutions may be of a conserved or non-conserved nature.
Conserved amino acid substitutions involve replacing one or more amino
acids of the proteins of the invention with amino acids of similar charge,
size, and/or hydrophobicity characterisitics. When only conserved
substitutions are made the resulting analog should be functionally
equivalent. Non-conserved substitutions involve replacing one or more
amino acids of the amino acid sequence with one or more amino acids
which possess dissimilar charge, size, and/or hydrophobicity
characteristics.
One or more amino acid insertions may be introduced into the
amino acid sequence shown in SEQ.ID.N0.:2. Amino acid insertions may
consist of single amino acid residues or sequential amino acids ranging
from 2 to 15 amino acids in length. For example, amino acid insertions
may be used to destroy target sequences so that the protein is no longer
active. This procedure may be used in vivo to inhibit the activity of a
protein of the invention. Alternatively, mutatins could be introduced that
will increase the yield of production of UDP-GaINAc from UDP-GIcNAc
(and vice versa) in vitro .
Deletions may consist of the removal of one or more amino acids,
or discrete portions from the amino acid sequence shown in
SEQ.ID.N0.:2. The deleted amino acids may or may not be contiguous.
The lower limit length of the resulting analog with a deletion mutation is
about 10 amino acids, preferably 100 amino acids.
Analogs of a protein of the invention may be prepared by
introducing mutations in the nucleotide sequence encoding the protein.
Mutations in nucleotide sequences constructed for expression of analogs
of a protein of the invention must preserve the reading frame of the
coding sequences. Furthermore, the mutations will preferably not create
complementary regions that could hybridize to produce secondary
mRNA structures, such as loops or hairpins, which could adversely affect
CA 02307357 2000-OS-26
-14-
translation of the receptor mRNA.
Mutations may be introduced at particular loci by synthesizing
oligonucleotides containing a mutant sequence, flanked by restriction
sites enabling ligation to fragments of the native sequence. Following
ligation, the resulting reconstructed sequence encodes an analog having
the desired amino acid insertion, substitution, or deletion.
Alternatively, oligonucleotide-directed site specific mutagenesis
procedures may be employed to provide an altered gene having
particular codons altered according to the substitution, deletion, or
insertion required. Deletion or truncation of a protein of the invention
may also be constructed by utilizing convenient restriction endonuclease
sites adjacent to the desired deletion. Subsequent to restriction,
overhangs may be filled in, and the DNA religated. Exemplary methods
of making the alterations set forth above are disclosed by Sambrook et al
(Molecular Cloning: A Laboratory Manual, 2nd Ed., Cold Spring Harbor
Laboratory Press, 1989).
The proteins of the invention also include homologs of the amino
acid sequence shown in SEQ.ID.N0.:2 and/or truncations thereof as
described herein. Such homologs are proteins whose amino acid
sequences are comprised of amino acid sequences that hybridize under
stringent hybridization conditions (see discussion of stringent
hybridization conditions herein) with a probe used to obtain a protein of
the invention.
A homologous protein includes a protein with an amino acid
sequence having at least 70%, preferably 80-90% identity with the amino
acid sequence as shown in SEQ.ID.N0.:2.
The invention also contemplates isoforms of the protein of the
invention. An isoform contains the same number and kinds of amino
acids as a protein of the invention, but the isoform has a different
molecular structure. The isoforms contemplated by the present invention
are those having the same properties as a protein of the invention as
described herein.
The present invention also includes a protein of the invention
conjugated with a selected protein, or a selectable marker protein (see
below) to produce fusion proteins. Additionally, immunogenic portions
CA 02307357 2000-OS-26
-15-
of a protein of the invention are within the scope of the invention.
The proteins of the invention (including truncations, analogs, etc.)
may be prepared using recombinant DNA methods. Accordingly, the
nucleic acid molecules of the present invention having a sequence which
encodes a protein of the invention may be incorporated in a known
manner into an appropriate expression vector which ensures good
expression of the protein. Possible expression vectors include but are not
limited to cosmids, plasmids, or modified viruses (e.g. replication
defective retroviruses, adenoviruses and adeno-associated viruses), so
long as the vector is compatible with the host cell used. The expression
vectors are "suitable for transformation of a host cell", means that the
expression vectors contain a nucleic acid molecule of the invention and
regulatory sequences selected on the basis of the host cells to be used for
expression, which is operatively linked to the nucleic acid molecule.
Operatively linked is intended to mean that the nucleic acid is linked to
regulatory sequences in a manner which allows expression of the nucleic
acid.
The invention therefore contemplates a recombinant expression
vector of the invention containing a nucleic acid molecule of the
invention, or a fragment thereof, and the necessary regulatory sequences
for the transcription and translation of the inserted protein-sequence.
Suitable regulatory sequences may be derived from a variety of sources,
including bacterial, fungal, or viral genes (For example, see the regulatory
sequences described in Goeddel, Gene Expression Technology: Methods
in Enzymology 185, Academic Press, San Diego, CA (1990). Selection of
appropriate regulatory sequences is dependent on the host cell chosen,
and may be readily accomplished by one of ordinary skill in the art.
Examples of such regulatory sequences include: a transcriptional
promoter and enhancer or RNA polymerase binding sequence, a
ribosomal binding sequence, including a translation initiation signal.
Additionally, depending on the host cell chosen and the vector employed,
other sequences, such as an origin of replication, additional DNA
restriction sites, enhancers, and sequences conferring inducibility of
transcription may be incorporated into the expression vector. It will also
be appreciated that the necessary regulatory sequences may be supplied
CA 02307357 2000-OS-26
-16-
by the native protein and/or its flanking regions.
The invention further provides a recombinant expression vector
comprising a DNA nucleic acid molecule of the invention cloned into the
expression vector. That is, the DNA molecule is operatively linked to a
regulatory sequence in a manner which allows for expression, by
transcription of the DNA molecule, of an RNA molecule and subsequent
translation into a protein corresponding to WbpP.
The recombinant expression vectors of the invention may also
contain a selectable marker gene which facilitates the selection of host
cells transformed or transfected with a recombinant molecule of the
invention. Examples of selectable marker genes are genes encoding a
protein such as 6418, ampicilin, and hygromycin which confer resistance
to certain drugs, (3-galactosidase, chloramphenicol acetyltransferase, or
firefly luciferase. Transcription of the selectable marker gene is
monitored by changes in the concentration of the selectable marker
protein such as f~-galactosidase, chloramphenicol acetyltransferase, or
firefly luciferase. If the selectable marker gene encodes a protein
conferring antibiotic resistance such as neomycin resistance transformant
cells can be selected with 6418. Cells that have incorporated the
selectable marker gene will survive, while the other cells die. This makes
it possible to visualize and assay for expression of recombinant
expression vectors of the invention and in particular to determine the
effect of a mutation on expression and phenotype. It will be appreciated
that selectable markers can be introduced on a separate vector from the
nucleic acid of interest.
The recombinant expression vectors may also contain genes which
encode a fusion moiety which provides increased expression of the
recombinant protein; increased solubility of the recombinant protein; and
aid in the purification of a target recombinant protein by acting as a
ligand in affinity purification. For example, a proteolytic cleavage site
may be added to the target recombinant protein to allow separation of
the recombinant protein from the fusion moiety subsequent to
purification of the fusion protein.
Recombinant expression vectors can be introduced into host cells
to produce a transformant host cell. The term "transformant host cell" is
CA 02307357 2000-OS-26
-17-
intended to include prokaryotic and eukaryotic cells which have been
transformed or transfected with a recombinant expression vector of the
invention. The terms "transformed with", "transfected with",
"transformation" and "transfection" are intended to encompass
introduction of nucleic acid (e.g. a vector) into a cell by one of many
possible techniques known in the art. Prokaryotic cells can be
transformed with nucleic acid by, for example, electroporation or
calcium-chloride mediated transformation. Nucleic acid can be
introduced into mammalian cells via conventional techniques such as
calcium phosphate or calcium chloride co-precipitation, DEAE-dextran-
mediated transfection, lipofectin, electroporation or microinjection.
Suitable methods for transforming and transfecting host cells can be
found in Sambrook et al. (Molecular Cloning: A Laboratory Manual, 2nd
Edition, Cold Spring Harbor Laboratory press (1989)), and other
laboratory textbooks.
Suitable host cells include a wide variety of prokaryotic and
eukaryotic host cells. For example, the proteins of the invention may be
expressed in bacterial cells such as E. coli, insect cells (using
baculovirus),
yeast cells or mammalian cells. Other suitable host cells can be found in
Goeddel, Gene Expression Technology: Methods in Enzymology 185,
Academic Press, San Diego, CA (1991).
A host cell may also be chosen which modulates the expression of
an inserted nucleic acid sequence, or modifies (e.g. glycosylation or
phosphorylation) and processes (e.g. cleaves) the protein in a desired
fashion. Host systems or cell lines may be selected which have specific
and characteristic mechanisms for post-translational processing and
modification of proteins. For example, eukaryotic host cells including
CHO, VERO, BHK, HeLA, COS, MDCK, 293, 3T3, and WI38 may be used.
For long-term high-yield stable expression of the protein, cell lines and
host systems which stably express the gene product may be engineered.
Host cells and in particular cell lines produced using the methods
described herein may be particularly useful in screening and evaluating
compounds that modulate the activity of a protein of the invention.
The proteins of the invention may also be expressed in non-human
transgenic animals including but not limited to mice, rats, rabbits, guinea
CA 02307357 2000-OS-26
-18-
pigs, micro-pigs, goats, sheep, pigs, non-human primates (e.g. baboons,
monkeys, and chimpanzees) (see Hammer et al. (Nature 315:680-683,
1985), Palmiter et al. (Science 222:809-814,1983), Brinster et al. (Proc.
Natl.
Acad. Sci USA 82:4438-4442,1985), Palmiter and Brinster (Cell. 41:343-345,
1985) and U.S. Patent No. 4,736,866). Procedures known in the art may
be used to introduce a nucleic acid molecule of the invention into animals
to produce the founder lines of transgenic animals. Such procedures
include pronuclear microinjection, retrovirus mediated gene transfer into
germ lines, gene targeting in embryonic stem cells, electroporation of
embryos, and sperm-mediated gene transfer.
The present invention contemplates a transgenic animal that
carries a nucleic acid of the invention in all their cells, and animals which
carry the transgene in some but not all their cells. The transgene may be
integrated as a single transgene or in concatamers. The transgene may
be selectively introduced into and activated in specific cell types (See for
example, Lasko et al, 1992 Proc. Natl. Acad. Sci. USA 89:6236). The
transgene may be integrated into the chromosomal site of the
endogenous gene by gene targeting. The transgene may be selectively
introduced into a particular cell type inactivating the endogenous gene in
that cell type (See Gu et al., Science 265:103-106).
The expression of a recombinant protein of the invention in a
transgenic animal may be assayed using standard techniques. Initial
screening may be conducted by Southern Blot analysis, or PCR methods
to analyze whether the transgene has been integrated. The level of
mRNA expression in the tissues of transgenic animals may also be
assessed using techniques including Northern blot analysis of tissue
samples, in situ hybridization, and RT-PCR. Tissue may also be evaluated
immunocytochemically using antibodies against a protein of the
invention.
The proteins of the invention may also be prepared by chemical
synthesis using techniques well known in the chemistry of proteins such
as solid phase synthesis (Merrifield,1964, J. Am. Chem. Assoc. 85:2149-
2154) or synthesis in homogenous solution (Houbenweyl, 1987, Methods
of Organic Chemistry, ed. E. Wansch, Vol. 15 I and II, Thieme, Stuttgart).
N-terminal or C-terminal fusion proteins comprising a protein of
CA 02307357 2000-OS-26
-19-
the invention conjugated with other molecules, such as proteins may be
prepared by fusing, through recombinant techniques, the N-terminal or
C-terminal of the protein, and the sequence of a selected protein or
marker protein with a desired biological function. The resultant fusion
proteins contain a protein of the invention fused to the selected protein or
marker protein as described herein. Examples of proteins which may be
used to prepare fusion proteins include immunoglobulins, glutathione-S-
transferase (GST), hemagglutinin (HA), and truncated myc.
III. APPLICATIONS
Methods of Modulating Epimerase Function
The present invention further relates to methods of modulating
the epimerase function of WbpP. In Pseudomonas aeruginosa this
epimerase activity converts UDP-GIcNAc to UDP-GaINAc. Because WbpP
is able to epimerize UDP-GIcNAc to UDP-GaINAc this function can be
used to commercially convert UDP-GIcNAc to UDP GaINAc. In another
embodiment the invention provides a method for assaying for WbpP
activity comprising adding a sufficient amount of UDP-GIcNAc to a
sample, allowing sufficient time under appropriate conditions for reaction
and assaying for the disappearance of UDP-GIcNAc. In yet another
embodiment the invention provides a method for assaying for WbpP
activity comprising adding a sufficient amount of UDP-GIcNAc to a
sample, allowing sufficient time under appropriate conditions for reaction
and assaying for the amount of disappearance of UDP-GIcNAc and
correlating the amount of UDP-GaINAc formed with the amount of
WbpP.
The present invention also provides an assay for detecting
inhibitors of a substance with WbpP activity. The method for screening
for an inhibitor of a substance with WbpP activity comprises (a)
incubating a test sample containing (i) a substance with WbpP activity, (ii)
a substance suspected of being an inhibitor of the substance; and (iii)
UDP-GIcNAc or UDP-GaINAc; (b) stopping the reaction; (c) comparing
the amount of UDP-GIcNAc, or UDP-GaINAc in the test sample with the
amount in a control sample (that does not contain the substance
suspected of being an inhibitor) wherein a decrease in the amount of
GIcNAc, or UDP-GaINAc in the control sample as compared to the test
CA 02307357 2000-OS-26
-20-
sample indicates that the substance is an inhibitor of the substance with
WbpP activity.
Therapeutic Applications
Antisense and antibodies
The present invention further provides a method of treating a
bacterial infection by inhibiting the expression of a nucleic acid molecule
of the present invention or by inhibiting the activity of a protein of the
invention. In one embodiment, the nucleic acids of the invention encode
a WbpP protein which is associated with B band LPS synthesis.
Accordingly, the present invention also provides a method for controlling
bacterial infections by inhibiting the expression of a nucleic acid or protein
of the invention. The expression of the nucleic acid molecule may be
inhibited using antisense oligonucleotides as described below.
Antisense Oligonucleotides
The sequence of a nucleic acid molecule of the invention may be
inverted relative to its normal presentation for transcription to produce
an antisense nucleic acid molecule. Preferably, an antisense sequence is
constructed by inverting a region preceding the initiation codon or an
unconserved region. In particular, the nucleic acid sequence contained in
the nucleic acid molecule of the invention or a fragment thereof,
preferably a nucleic acid sequence shown in the Sequence Listing as
SEQ.ID.N0.:1 may be inverted relative to its normal presentation for
transcription to produce antisense nucleic acid molecules.
The antisense nucleic acid molecules of the invention or a fragment
thereof, may be chemically synthesized using naturally occurring
nucleotides or variously modified nucleotides designed to increase the
biological stability of the molecules or to increase the physical stability of
the duplex formed with mRNA or the native gene e.g. phosphorothioate
derivatives and acridine substituted nucleotides. The antisense sequences
may be produced biologically using an expression vector introduced into
cells in the form of a recombinant plasmid, phagemid or attenuated virus
in which antisense sequences are produced under the control of a high
efficiency regulatory region, the activity of which may be determined by
the cell type into which the vector is introduced.
The invention further provides a recombinant expression vector
CA 02307357 2000-OS-26
-21-
comprising a DNA nucleic acid molecule of the invention cloned into the
expression vector in an antisense orientation. That is, the DNA molecule
is operatively linked to a regulatory sequence in a manner which allows
for expression, by transcription of the DNA molecule, of an RNA
molecule which is antisense to a nucleotide sequence comprising the
nucleotide as shown in SEQ.ID.N0.:1. Regulatory sequences operatively
linked to the antisense nucleic acid can be chosen which direct the
continuous expression of the antisense RNA molecule.
The activity of the proteins of the present invention may be
inhibited by using an antibodies that are specific for the proteins of the
invention as described in detail above. Conventional methods can be
used to prepare the antibodies. For example, by using a peptide or a
protein of the invention, polyclonal antisera or monoclonal antibodies can
be made using standard methods. A mammal, (e.g., a mouse, hamster,
or rabbit) can be immunized with an immunogenic form of the peptide
which elicits an antibody response in the mammal. Techniques for
conferring immunogenicity on a peptide include conjugation to carriers
or other techniques well known in the art. For example, the peptide can
be administered in the presence of adjuvant. The progress of
immunization can be monitored by detection of antibody titers in plasma
or serum. Standard ELISA or other immunoassay procedures can be
used with the immunogen as antigen to assess the levels of antibodies.
Following immunization, antisera can be obtained and, if desired,
polyclonal antibodies isolated from the sera.
To produce monoclonal antibodies, antibody producing cells
(lymphocytes) can be harvested from an immunized animal and fused
with myeloma cells by standard somatic cell fusion procedures thus
immortalizing these cells and yielding hybridoma cells. Such techniques
are well known in the art, (e.g., the hybridoma technique originally
developed by Kohler and Milstein (Nature 256, 495-497 (1975)) as well as
other techniques such as the human B-cell hybridoma technique (Kozbor
et al., Immunol. Today 4, 72 (1983)), the EBV-hybridoma technique to
produce human monoclonal antibodies (Cole et al., Monoclonal
Antibodies in Cancer Therapy (1985) Allen R. Bliss, Inc., pages 77-96), and
screening of combinatorial antibody libraries (Huse et al., Science 246,
CA 02307357 2000-OS-26
-22-
1275 (1989)). Hybridoma cells can be screened immunochemically for
production of antibodies specifically reactive with the peptide and the
monoclonal antibodies can be isolated. Therefore, the invention also
contemplates hybridoma cells secreting monoclonal antibodies with
specificity for a protein of the invention.
The term "antibody" as used herein is intended to include
fragments thereof which also specifically react with a protein, of the
invention, or peptide thereof. Antibodies can be fragmented using
conventional techniques and the fragments screened for utility in the
same manner as described above. For example, F(ab')2 fragments can be
generated by treating antibody with pepsin. The resulting F(ab')2
fragment can be treated to reduce disulfide bridges to produce Fab'
fragments.
Chimeric antibody derivatives, i.e., antibody molecules that
combine a non-human animal variable region and a human constant
region are also contemplated within the scope of the invention. Chimeric
antibody molecules can include, for example, the antigen binding domain
from an antibody of a mouse, rat, or other species, with human constant
regions. Conventional methods may be used to make chimeric
antibodies containing the immunoglobulin variable region which
recognizes a protein of the invention (See, for example, Morrison et al.,
Proc. Natl Acad. Sci. U.S.A. 81,6851 (1985); Takeda et al., Nature 314, 452
(1985), Cabilly et al., U.S. Patent No. 4,816,567; Boss et al., U.S. Patent
No.
4,816,397; Tanaguchi et al., European Patent Publication EP171496;
European Patent Publication 0173494, United Kingdom patent GB
2177096B).
Monoclonal or chimeric antibodies specifically reactive with a
protein of the invention as described herein can be further humanized by
producing human constant region chimeras, in which parts of the
variable regions, particularly the conserved framework regions of the
antigen-binding domain, are of human origin and only the hypervariable
regions are of non-human origin. Such immunoglobulin molecules may
be made by techniques known in the art, (e.g., Teng et al., Proc. Natl.
Acad. Sci. U.S.A., 80, 7308-7312 (1983); Kozbor et al., Immunology Today,
4, 7279 (1983); Olsson et al., Meth. Enzymol., 92, 3-16 (1982)), and PCT
CA 02307357 2000-OS-26
-23-
Publication W092/06193 or EP 0239400). Humanized antibodies can also
be commercially produced (Scotgen Limited, 2 Holly Road, Twickenham,
Middlesex, Great Britain).
Specific antibodies, or antibody fragments, reactive against a
protein of the invention may also be generated by screening expression
libraries encoding immunoglobulin genes, or portions thereof, expressed
in bacteria with peptides produced from the nucleic acid molecules of the
present invention. For example, complete Fab fragments, VH regions
and FV regions can be expressed in bacteria using phage expression
libraries (See for example Ward et al., Nature 341, 544-546: (1989); Huse et
al., Science 246, 1275-1281 (1989); and McCafferty et al. Nature 348, 552-
554 (1990)).
Antibodies may also be prepared using DNA immunization. For
example, an expression vector containing a nucleic acid of the invention
(as described above) may be injected into a suitable animal such as
mouse. The protein of the invention will therefore be expressed in vivo
and antibodies will be induced. The antibodies can be isolated and
prepared as described above for protein immunization.
The antibodies may be labelled with a detectable marker including
various enzymes, fluorescent materials, luminescent materials and
radioactive materials. Examples of suitable enzymes include horseradish
peroxidase, biotin, alkaline phosphatase, i3-galactosidase, or
acetylcholinesterase; examples of suitable fluorescent materials include
umbelliferone, fluorescein, fluorescein isothiocyanate, rhodamine,
dichlorotriazinylamine fluorescein, dansyl chloride or phycoerythrin; an
example of a luminescent material includes luminol; and examples of
suitable radioactive material include S-35, Cu-64, Ga-67, Zr-89, Ru-97, Tc-
99m, Rh-105, Pd-109, In-111, I-123, I-125, I131, Re-186, Au-198, Au-199, Pb-
203, At-211, Pb-212 and Bi-212. The antibodies may also be labelled or
conjugated to one partner of a ligand binding pair. Representative
examples include avidin-biotin and riboflavin-riboflavin binding protein.
Methods for conjugating or labelling the antibodies discussed above with
the representative labels set forth above may be readily accomplished
using conventional techniques.
Compositions
CA 02307357 2000-OS-26
-24-
The antisense oligonucleotides and antibodies may be formulated
into pharmaceutical compositions for adminstration to subjects in a
biologically compatible form suitable for administration in vivo. By
"biologically compatible form suitable for administration in vivo" is meant
a form of the substance to be administered in which any toxic effects are
outweighed by the therapeutic effects. The substances may be
administered to living organisms including humans, and animals.
Administration of a therapeutically active amount of the pharmaceutical
compositions of the present invention is defined as an amount effective,
at dosages and for periods of time necessary to achieve the desired result.
For example, a therapeutically active amount of a substance may vary
according to factors such as the disease state, age, sex, and weight of the
individual, and the ability of antibody to elicit a desired response in the
individual. Dosage regima may be adjusted to provide the optimum
therapeutic response. For example, several divided doses may be
administered daily or the dose may be proportionally reduced as
indicated by the exigencies of the therapeutic situation.
The active substance may be administered in a convenient manner
such as by injection (subcutaneous, intravenous, etc.), oral administration,
inhalation, transdermal application, or rectal administration. Depending
on the route of administration, the active substance rnay be coated in a
material to protect the compound from the action of enzymes, acids and
other natural conditions which may inactivate the compound.
The compositions described herein can be prepared by per se
known methods for the preparation of pharmaceutically acceptable
compositions which can be administered to subjects, such that an effective
quantity of the active substance is combined in a mixture with a
pharmaceutically acceptable vehicle. Suitable vehicles are described, for
example, in Remington's Pharmaceutical Sciences (Remington's
Pharmaceutical Sciences, Mack Publishing Company, Easton, Pa., USA
1985). On this basis, the compositions include, albeit not exclusively,
solutions of the substances in association with one or more
pharmaceutically acceptable vehicles or diluents, and contained in
buffered solutions with a suitable pH and iso-osmotic with the
physiological fluids.
CA 02307357 2000-OS-26
-25-
Recombinant molecules comprising an antisense sequence or
oligonucleotide fragment thereof, may be directly introduced into cells or
tissues in vivo using delivery vehicles such as retroviral vectors,
adenoviral vectors and DNA virus vectors. They may also be introduced
into cells in vivo using physical techniques such as microinjection and
electroporation or chemical methods such as coprecipitation and
incorporation of DNA into liposomes. Recombinant molecules may also
be delivered in the form of an aerosol or by lavage.
Vaccines
The present invention also relates to a method of preventing or
treating a bacterial infection by Pseudomonas aeruginosa by administering a
vaccine that will induce an immune response against the protein of the
invention.
The vaccine can be a nucleic acid vaccine or a protein based vaccine
containing a nucleic acid or protein of the invention, respectively. A
nucleic acid vaccine will contain the nucleic acid sequence in a vector
suitable for expression of the protein in the host.
The vaccine may comprise an immunologically acceptable carrier
such as aqueous diluents, suspending aids, buffers, excipients, and one or
more adjuvants known in the art. The vaccine may also contain
preservatives such as sodium azide, thimersol, beta propiolactone, and
binary ethyleneimine.
The vaccines of the invention can be intended for administration to
animals, including mammals, avian species, and fish; preferably humans
and various other mammals, including bovines, equines, and swine.
The vaccines of the invention may be administered in a convenient
manner, such as intravenously, intramuscularly, subcutaneously,
intraperitoneally, intranasally or orally.The dosage will depend on the
desired effect and on the chosen route of administration, and other
factors known to persons skilled in the art.
Kits
The reagents suitable for carrying out the methods of the
invention may be packaged into convenient kits providing the necessary
materials, packaged into suitable containers. Such kits may include all the
reagents required to detect a nucleic acid molecule or protein of the
CA 02307357 2000-08-24
-26-
invention in a sample by means of the methods described herein, and
optionally suitable supports useful in performing the methods of the
invention.
The following non-limiting examples are illustrative of the present
invention:
EXAMPLES
MATERIALS AND METHODS FOR EXAMPLES
Materials - Unless stated otherwise all chemical reagents used were
from Sigma (St Louis, MO). Restriction enzymes and T4 DNA ligase were
from Gibco/BRL (Gaitherburg, MD). Pwo DNA polymerase was from
Boehringer-Mannheim (Laval, Quebec). The dNTPs were from Perkin
Elmer (Markham, ON). The pentaHis anti-histidine tag antibody was
from Qiagen (Santa Clarita, CA). Agar was from Difco (Detroit, MI). All
kits or enzymes were used following the manufacturer's instructions.
Cloning and overexpression of WbpP in the pET system - WbpP was
cloned in the Ncol and EcoRl sites of a pET23 derivative (26) with a N-
terminal histidine tag. The sequence of the primers used to amplify wbpP
by PCR from genomic DNA (strain IATS 06) were
S~CAATGCCATGGGAATGATGAGTCGTTATGAAG3~ (SEQ.ID.N0.3)
and S~TTAACGAATTCTCATTTCAAAAACATGATG3~ (SEQ.ID.N0.4) for
the top and bottom primers, respectively. The PCR reaction consisted 100
ng of genomic DNA, 0.5 ~M each primer, 0.2 mM each dNTP, 4 mM
MgCl2 and 1x buffer in a total of 50 ~1. A 5 min denaturation at
94°C was
done before addition of DNA polymerase (1.5 units of Pwo). This was
followed by 15 cycles of 1 min at 94°C, 45 sec at 55°C and 90
sec at 72°C.
A final 7 min elongation was performed at 72°C. The constructs
obtained
were checked by restriction analysis and sequencing.
The construct was subsequently transformed into the expression
strain BL21(DE3)pLysS (Novagen, Madison, WI) with ampicillin (100
~g/ml) and chloramphenicol (35 ~,g/ml) selection. For protein
expression, 2 ml of an overnight culture were inoculated into 100 ml of LB
in the presence of ampicillin and chloramphenicol. The culture was grown
at 30°C. When the OD6oonm reached 0.6, IPTG (Promega, Madison, WI)
was added to a final concentration of 0.15 mM and expression was
allowed to proceed for 5 to 6 h at 30°C. Cells were harvested by
CA 02307357 2000-OS-26
-27-
centrifugation at 5,000 g for 15 min at 4°C and the pellet was stored
at
-20°C until needed. Expression was monitored by SDS-PAGE analysis,
with Coomassie blue staining or Western immunoblot using the penta-
His anti-histidine tag antibody as instructed by the manufacturer.
Purification of WbpP by chromatography - Cells sedimented from 100
ml induced culture were resuspended in 10 ml of buffer A (5 mM
imidazole, 20 mM Tris pH 8, 0.1 M NaCI). T'he cells were briefly sonicated
(macrotip, sonicator XL2020 Heat systems Incorporated, power set to 4, 2
min total, 5 sec on, 5 sec off) on ice. Cell debris were removed by
centrifugation at 13 000 x g for 15 min at 4°C and the supernatant was
applied to a 3 ml fast flow chelating sepharose column (Amersham-
Pharmacia, Quebec) previously loaded with nickel sulfate (30 ml of 0.1 M)
and equilibrated with 5 column volumes (CV) of buffer A. Loading of the
sample as well as all washing and elution steps were done by gravity.
After loading of the sample, the column was washed with 10 CV of buffer
A and 5 CV of buffer B (20 mM imidazole, 20 mM Tris pH 8, 0.1M NaCI).
Elution was carried out with 3 CV of buffer C (1 M imidazole, 20 mM Tris
pH 8, 0.5 M NaCI 0.1 M). Fractions were collected every 1 CV. Most of
the protein was eluted in fraction number 2 as seen by SDS-PAGE
analysis. This fraction was subjected to further purification by anion
exchange chromatography after dilution 1 /30 in 50 mM Tris pH 8. Half
of it was loaded onto a 1 ml column of Q Sepharose fast flow (Pharmacia).
The column was washed with 30 CV of Tris buffer and the protein was
eluted with 3 CV of 50 mM Tris pH 8, 0.5 M NaCI. Fractions were
collected every 1 CV and most of the protein was recovered in fraction 2.
This fraction was desalted by overnight dialysis (cut off 3500 Da) in 50
mM Tris pH 8 at 4°C. The dialysed samples were concentrated by
overlay with PEG 8000 (Sigma) for 2 to 3 h at 4°C. Protein quantitation
was done using the BCA reagent (Pierce, Rockford, IL). The purified
enzyme was either used fresh or stored at -20°C in 25 % glycerol or 20
adonitol in 50 mM Tris, pH 8 without any significant loss of activity.
Determination of the oligomerisation status by gel filtration analysis - A
45 x 1.6 cm column containing 90 ml of 6100 Sephadex (Sigma,
fractionation range 4-150 kDa) was used to determine the oligomerisation
status of WbpP. The column was equilibrated in 50 mM Tris pH 8
CA 02307357 2000-OS-26
-28-
containing 100 mM NaCI and run at 1.4 ml/min. Molecular weight
standards (Sigma, 12-150 kDa) were applied onto the column one by one
(50 - 200 ~g each in 200 ~,1). WbpP was applied onto the column either as
a concentrated or a diluted solution (200 ~.g or 50 ~.g / 200 ~,1 deposited).
Protein elution was monitored at 280 nm.
Extraction of NAD(H) from purified WbpP - A freshly purified and
extensively dialysed sample of WbpP at 1.75 mg / ml in 50 mM Tris pH 8
was used for the extraction and quantification of bound NAD(H). WbpP
(175 ~.g) was incubated in the presence of 10 ~,g of proteinase K for 45
min at 37°C. Total digestion of WbpP was checked by SDS-PAGE analysis
and Coomassie staining. After complete digestion, WbpP was submitted
to chemical reduction by successive additions of 1 ~1 of 10 mg/ml of
sodium borohydride (Fisher, Nepean, ON) every 30 min for 2 h 30 min.
The proteolysis step was included prior to reduction to ensure
quantitative reduction and recovery of NAD(H). The absorption
spectrum was recorded before and after chemical reduction between 230
and 450 nm using a DU520 spectrophotometer (Beckman Fullerton, CA)
equipped with a 50 ~.1 microcell. Serial dilutions of NAD+ (Sigma) ranging
from 5 to 40 ~M were prepared in 50 mM Tris pH 8 and were incubated
at 37°C for the same amount of time as WbpP with or without chemical
reduction. The precise concentration in NAD+ was calculated using ~26o~,m
= 17400 M-1 x cm-1 and the efficiency of reduction was calculated using
~~a,."r, = 6270 M-1 x cm-1.
Determination of the enzymatic conversion of UDP-GIcNAc and UDP-
GaINAc using p-dimethylaminobenzaldehyde (DMAB) - Reactions were
performed with a total reaction volume of 35 ~1 at 37°C in 20 mM Tris
pH
8 unless stated otherwise. The specific amount of enzyme used, substrate
concentrations, and incubation time are indicated in the legend of each
figure. The reactions were stopped by acid hydrolysis of the UDP moiety
of the substrate. For this purpose, the samples were acidified to pH 2 by
addition of 7 ~l of HCl 0.1 N, boiled for 6 min, and neutralised by addition
of 7 ~1 of NaOH 0.1 N. For the spectrophotometric quantification of
GaINAc and GIcNAc, the reagent DMAB was prepared at 10 % in glacial
acetic acid / HCl 9 / 1 v /v, and further diluted 1 / 10 in glacial acetic
acid
CA 02307357 2000-OS-26
-29-
before use (Reissig et al. (1955)). For the assay itself, 100 ~.l of 0.2 M
sodium tetraborate pH 9.1 were added to 50 ~.1 of quenched and
neutralised enzymatic reactions and boiled immediately for 3 min. 40 ~1
of this mixture were transferred to a microtitration plate and 200 ~,l of
DMAB reagent were added. After incubation for 30 min at 37°C, the
OD595 nm was recorded using a microplate reader. For practical reasons,
the DMAB assay was carried out using a wavelength setting of 595 nm in
the spectrophotometer. However, the signal of the assay could be
increased by ca. 15% if the wavelength is adjusted to 580 nm. T'he assay
was done in duplicate for each reaction tested. Standard curves were
prepared using UDP-GIcNAc and UDP-GaINAc that were subjected to
acid hydrolysis in the same conditions as described above.
Determination of the kinetic parameters for UDP-GIcNAc and UDP-
GaINAc by capillary electrophoresis - Reactions were performed at
37°C in
20 mM Tris pH 8 with a total reaction volume of 44 ~,1. The amount of
purified enzyme added was 234 ng and 117 ng for reaction with UDP-
GIcNAc and UDP-GaINAc, respectively. After incubation at 37 oC for the
required amount of time, the reactions were quenched by boiling the
sample for 6 min. Time course studies were performed with final sugar-
nucleotide concentrations of 0.075 and 1.75 mM. Samples were quenched
after 0, 2, 4, 6, 8, 10 and 15 min. For Km and Vmax determinations, the
final sugar nucleotide concentrations ranged from 0.075 to 1.75 mM and
the reactions were quenched after 3 min of incubation. Capillary
electrophoresis (CE) analysis was performed using a PACE 5000 system
(Beckman, Fullerton, CA) with UV detection. The running buffer was 25
mM sodium tetraborate pH 9.4. The capillary was bare silica 75 ~m x 57
cm, with a detector at 50 cm. The capillary was conditioned before each
run by washing with 0.2 M NaOH for 2 min, water for 2 min, and
running buffer for 2 min. Samples were introduced by pressure injection
for 4 s and the separation was performed at 22 kV. Peak integration was
done using the Beckman PACE Station software. The calculation of
kinetic parameters was done using the PRISM program.
Study of the Requirement for NAD+ or divalent canons for enzymatic
activity - To access the requirements for NAD+ or divalent cations for the
enzymatic activity of WbpP, reactions were carried out with or without
CA 02307357 2000-OS-26
-30-
NAD+ (1mM final concentration), and with or without divalent cations (4
mM final concentration of MnCl2, MgCl2, or CaCl2) and monitored by
capillary electrophoresis as described above.
Spectrophotometric study of the epimerisation of UDP-Glc and UDP-Gal
by WbpP - The enzymatic reactions were performed in 20 mM Tris pH 8,
with 39 ~g of freshly purified enzyme and 0.8 mM sugar-nucleotide in a
total reaction volume of 44 ~1. Time course studies were performed over
2 hours at 37°C. After incubation for the required amount of time, the
reactions were quenched by acid hydrolysis of the UDP moiety as
described above. Standard curves were prepared using UDP-Glc or UDP-
Gal that were also subjected to acid hydrolysis. The quantitation of
remaining glucose present in the reaction mixture was measured
spectrophotometrically using a coupled assay adapted from Moreno et al.
(Moreno et al. (1981)). A reaction mix containing 22 units/ml of glucose
oxidase, 7 units/ml of horse radish peroxidase and 0.3 mg/ml of O-
dianisidine was prepared in 50 mM sodium acetate buffer, pH 5.5. Four
hundred ~.l of this reaction mix were added to the neutralised samples
described above and the reaction was allowed to proceed for 30 min at
37°C. The reaction was then quenched by addition of 600 ~,1 of 6 N HCl
and the optical density at 540 nm was read.
Determination of the kinetic parameters for UDP-Glc and UDP-Gal by
capillary electrophoresis - The enzymatic reactions were performed in 20
mM Tris pH 8, with 16.4 ~,g of freshly purified enzyme in a total reaction
volume of 44.8 ~,1. The total sugar nucleotide concentrations in the
enzymatic reactions ranged from 0.048 to 2.009 mM. The reactions were
quenched after 15 min of incubation at 37°C. The samples were analysed
by CE in the same conditions as described above and the Km and Vmax
values were determined using the PRISM software.
EXAMPLE 1
Protein expression and purification - WbpP is a 37.7 kDa protein with
a slightly acidic isoelectric point (pI = 5.99). It was expressed in the pET
system as a N-terminally histidine-tagged protein. Provided that
expression was carried out at low temperature (30°C) and with a low
concentration of inducer IPTG (0.15 mM), most of the protein was
expressed in a soluble form (Figure 2). It was expressed at a very high
CA 02307357 2000-OS-26
-31-
level since it represented 30-35% of total cellular proteins. It was readily
purified to 90-95 % by nickel chelation and most of the contaminants
were further eliminated by anion exchange chromatography to produce
95-98 % pure protein. Therefore, the protein was purified only 3-fold to
reach homogeneity. The yield obtained was 5-7 mg/100 ml of culture
(Table 1). The presence of the histidine tag was confirmed by Western
immunoblot using an anti-histidine tag antibody (data not shown).
Results from gel filtration analysis suggest that WbpP exists as a
dimer in its native form (data not shown). No apparent monomer or
higher order oligorners were detected even in the presence of 100 mM
salt or at low enzyme concentration.
EXAMPLE 2
Characteristics of the spectrophotometric assay used for the quantitation
of GIcNAc and GaINAc - The spectrophotometric assay used to quantitate
GIcNAc and GaINAc in enzymatic reactions relies on the use of DMAB
which is specific for N-acetyl hexosamines. Different colorimetric yields
are obtained with different N-acetyl hexosamines (REISSIG ET AL.
(1955)). For the two substrates relevant to this study, a much higher
reaction yield (6 times) is obtained with GIcNAc than with GaINAc
(Figure 3A). The assay is very sensitive and allows discrimination
between both substrates at low substrate concentration (0.15 mM).
Moreover, the yields of reaction are additive. Hence, the composition of
a mixture of GIcNAc and GaINAc obtained after enzymatic conversion
can be calculated from standard curves established with each substrate
separately (Figure 3B).
EXAMPLE 3
Functional characterisation of WbpP using the DMAB assay - The
results obtained for WbpP using the DMAB assay are consistent with a
UDP-GIcNAc C4 epimerase activity. When the enzymatic reaction was
performed with UDP-GIcNAc, the total yield of the reaction with DMAB
decreased (Figure 3C). This is consistent with the formation of GalNAc
that reacts poorly with DMAB. Alternatively, when the enzymatic
reaction was performed with UDP-GaINAc, the yield of the reaction with
DMAB increased. This is consistent with the formation GIcNAc that reacts
strongly with DMAB. The activity was dependent on the quantity of
CA 02307357 2000-OS-26
-32-
enzyme added (Figure 3C). Maximum substrate conversions obtained
were approximately 30% for UDP-GIcNAc and 70 % of UDP-GaINAc.
Less enzyme was required to obtain maximum substrate conversion for
UDP-GaINAc than for UDP-GIcNAc. The specific activity of purified
WbpP was 5.6 and 2.3 Units / mg with regards to UDP-GaINAc and UDP-
GIcNAc, respectively (Table 1). This represents only a 2 fold increase of
the specific activity after the two-step purification procedure. This
apparent low level of purification in terms of specific activity is due to the
fact that the protein was expressed at very high levels since it represented
30-35 % of total cellular proteins.
EXAMPLE 4
Characterization of the C4 UDP-GIcNAc epimerase activity by capillary
electrophoresis analysis - Capillary electrophoresis was used to confirm the
identity of the reaction products after enzymatic conversion of UDP-
GIcNAc or UDP-GaINAc by WbpP by comparison with standard
compounds. Under analytical conditions, UDP-GIcNAc and UDP-GaINAc
are well resolved, with peaks at 11.6 and 12.3 minutes, respectively.
Figure 4 shows that UDP-GIcNAc and UDP-GaINAc are inter-converted
into one another by WbpP, thus confirming its C4 epimerase activity on
these substrates. At equilibrium, the yields of enzymatic conversion are
the same as calculated from the DMAB assay data.
EXAMPLE 5
Determination of the kinetic parameters for UDP-GIcNAc and UDP-
GaINAc by capillary electrophoresis - Time course experiments performed
with different enzyme dilutions indicate that the rate of conversion of
UDP-GIcNAc is much slower than that of UDP-GaINAc at equal enzyme
dilution (Figure 5). Initial rates conditions were selected by choosing the
enzyme dilutions that allow transformation of less than 10 % of the
substrate in 3 min, for substrates concentrations ranging from 0.02 to 1.75
mM. The Km and Vmax parameters of WbpP for each substrate were
determined under these initial rates conditions (Table 2). The Km values
derived from Eadie-Hofstee plots are 224 and 197 ~M for UDP-GIcNAc
and UDP-GaINAc, respectively. The enzyme shows an equal affinity for
these substrates.
EXAMPLE 6
CA 02307357 2000-OS-26
-33-
Determination of the physico-chemical parameters: optimal pH,
temperature and storage conditions - WbpP has a broad pH range of activity,
with significant activity observed for pH > 6.5 and an optimum between
pH 7 and 8 (data not shown). The enzyme is also active over a wide range
of temperatures (data not shown) with an optimum between 37 and
42°C. The enzyme can be kept active without any significant loss of
activity when stored at -20°C in 25% glycerol or 20% adonitol in Tris
20
mM, pH 8 (data not shown).
EXAMPLE 7
Substrate specificity - A glucose-specific spectrophotometric assay
relying on the use of glucose oxidase (Moreno et al. (1981)) was used to
study the substrate specificity for WbpP. Using this assay, it was shown
that WbpP can use UDP-Glc as a substrate (Figure 6) but the identity of
the reaction product is unknown. Also, UDP-Glc was produced when the
reaction was performed with UDP-Gal as a substrate. These results are
consistent with a C4 epimerase activity on the non-acetylated substrates
UDP-Glc and UDP-Gal. From these results, the product of UDP-Glc
modification by WbpP is expected to be UDP-Gal but its identity needs to
be confirmed by analytical methods. Also, the rate of conversion was
significantly higher for UDP-Gal than UDP-Glc at equal enzyme dilution
(Figure 6). At equilibrium, approximately 40% of UDP-Gal were
transformed to UDP-Glc whereas only 15% of UDP-Glc were modified by
the enzyme. Capillary electrophoresis analysis confirmed without
ambiguity that WbpP also has C4 epimerase activity on UDP-Glc and
UDP-Gal (Figure 7) and confirmed that the maximum conversion were 40
and 17% for UDP-Gal and UDP-Glc, respectively.
EXAMPLE 8
Determination of the kinetic parameters for UDP-Glc and UDP-Gal by
capillary electrophoresis - The kinetic parameters determined under initial
rates conditions are summarised in Table 2. The Km values are 237 and
251 ~,M for UDP-Glc and UDP-Gal, respectively. T'he Vmax values are 54
and 82 pmol/min.
Analysis of NAD+ or divalent cations requirements by capillary
electrophoresis - The addition of NAD+, Mg2+, Ca2+ or Mn2+ to the reaction
mixture was not necessary for the C4 epimerase activity of WbpP, would
CA 02307357 2000-OS-26
-34-
it be on the acetylated or non-acetylated forms of the substrates as
determined by capillary electrophoresis (data not shown).
Extraction of NAD+/NADH from purified WbpP - Tightly bound
NAD+/NADH could be extracted from highly purified and extensively
dialysed WbpP after complete digestion with proteinase K. The released
nucleotide was reduced to NADH by sodium borohydride treatment. A
yield of 0.7 to 0.8 mol of NAD(H) / mol of WbpP was calculated from the
absorbance at 340 nm (data not shown). This indicates that WbpP binds to
the nucleotide tightly during its synthesis.
DISCUSSION OF EXAMPLES
UDP-GIcNAc is an essential precursor of surface carbohydrate
biosynthesis (SHIBAEV (1986)), both in bacteria where it is the precursor
of peptidoglycan, capsule or lipopolysaccharide biosynthesis, and in
humans, where it is the main precursor involved in cell surface sialylation
(KEPPLER ET AL. (1999)). Though the requirements of UDP-GIcNAc
modifying enzymes such as C2- and C4- epimerases or C6 dehydratases
(Keppler et al. (1999); Kiser et al. (1999); Plumbridge et al. (1999);
Belanger
et al. (1999); Dean et al. (1999)) has been inferred from in vivo experiments
and structural analysis of various surface carbohydrates, very little
information is available at the biochemical level on the enzymes
responsible for such activities.
WbpP is a small protein essential for the biosynthesis of B-band
LPS in Pseudomonas aeruginosa serotype 06 (12). Previously, the exact
function of this enzyme was unknown. Sequence analysis indicated that it
most likely belongs to the short chain dehydrogenase/reductase (SDR)
family. The variety of enzymatic functions represented in the SDR family
doesn't allow for a specific functional assignment for WbpP. Most
enzymes belonging to this family share the same initial steps of catalysis
resulting in the formation of a 4-hexosulose intermediate that can
subsequently lead to the formation of a variety of new carbohydrates
such as epimers, deoxysugars or branched carbohydrates. Hence
belonging to this family is not a sufficient criteria for specific functional
assignment. Comparisons of the LPS composition of organisms that
exhibit WbpP or a homologue suggested that WbpP might be a C4
epimerase specific for UDP-GIcNAc. The validity of such an assignment is
CA 02307357 2000-OS-26
-35-
supported by successful complementation of a wbpP null mutant of P.
aeruginosa by a Salmonella typhi homologue, wcdB. This homologue of
wbpP has been shown to be involved in the biosynthesis of a
homopolymer of a-1,4 2-deoxy-2-N-acetylgalactosamine uronic acid (19).
However, another homologue, WbpK, showing 51 % homology to
WbpP is localized in the gene cluster for B-band LPS biosynthesis in P.
aeruginosa serotype 05 (PA01) where its function is at present unknown.
The 05 LPS contains FucNAc, which was previously proposed to arise
from epimerisation of UDP-GIcNAc to UDP-GaINAc followed by
dehydration and reduction to UDP-FucNAc. Hence, a UDP-GIcNAc C4
epimerase activity was also expected to exist in serotype 05. WbpKoS
was the best candidate for such an epimerase as judged by its high level
of homology to WpbPp6. Complementation analysis using a WbpKpS
knock-out showed that WbpPo6 is not able to rescue LPS biosynthesis in
PA01 (this study, data not shown). This suggests that WbpPo6 and
WbpKo5 have a different function and/or substrate specificity despite
their high level of sequence conservation. Hence, in addition to providing
the first description of a UDP-GIcNAc C4 epimerase at the biochemical
level, the characterisation of WbpP will also be useful to clarify
ambiguous biosynthetic pathways for LPS biosynthesis in organisms that
possess homologues of WbpP.
As mentioned above, the existence of UDP-N-acetylglucosamine 4-
epimerase activity has been suggested from the analysis of the surface
carbohydrates of a variety of organisms or even mammalian tissues.
However, the experimental demonstration of the existence of the activity
has only been reported on two occasions. The first one was the
description of both UDP-GIcNAc and UDP-Glc C4 epimerase activity
associated with a protein fraction isolated from porcine submaxillary
gland (filler et al. (1983)). In this study, the purified enzyme performs
with equal or higher efficiency on the non-acetylated substrates than on
the acetylated ones. Hence, it is doubtful that the activity arises from a
genuine UDP-GIcNAc C4 epimerase but rather is a side-reaction of a
standard GaIE homologue. The sequence of the enzyme was not
provided to resolve the question. In the second case, a UDP-N-
CA 02307357 2000-OS-26
-36-
acetylglucosamine 4-epimerase activity was linked with the gneA locus in
Bacillus subtilis (Estrela et al. (1991)). Assays were performed using whole
cell extracts and the enzyme was not purified. Considering that the
substrate and product involved in this reaction are shared by a variety of
sugar-nucleotide modifying enzymes, results obtained using whole cell
extracts are not unequivocal. The biochemical characterisation described
in here and performed in vitro using overexpressed and purified enzyme
is the first unambiguous demonstration of the existence of a specific UDP-
GIcNAc C4 epimerase and provides the first kinetic analysis of such an
enzyme.
Though numerous spectrophotometric assays are available to
study the UDP-Glc C4 epimerase activity, none is available for the UDP-
GIcNAc C4 epimerase activity. Most assays rely on the coupling of the
epimerisation reaction to a secondary enzymatic reaction that is usually
very specific for the substrate or product in its non-acetylated form
(Moreno et al. (1981); Wilson et al. (1969)). A spectrophotometric assay
using p-dimethylaminobenzaldehyde (DMAB) was designed to measure
C4 epimerase activity on the N-acetylated substrates, UDP-GIcNAc and
UDP-GaINAc. The results obtained with the DMAB assay as described in
this study are consistent with a C4 epimerase activity involving UDP-
GIcNAc and UDP-GaINAc. But other activities resulting in the production
of different N-acetylhexosamines derivatives with different reactivities
towards DMAB cannot be excluded. Hence, capillary electrophoresis was
used to provide the proof for the identity of the reaction products. The
results from CE analysis clearly confirmed that WbpP is a UDP-GIcNAc
C4 epimerase.
Kinetic analysis was carried out under initial rates conditions using
the standard Michaelis-Menten model. One of the assumptions of this
model is that no product can be used as a substrate. The initial rates
conditions used in the present examples ensured that no more than 10
of the substrate was used up by the enzyme, hence maintaining product
re-conversion to a minimum. Kinetic analysis revealed that WbpP has
the same affinity for UDP-GaINAc and UDP-GIcNAc but the reaction
proceeds at a faster rate for the former than the latter. Moreover, the
kcat shows that for an equal amount of enzyme present in the reaction,
CA 02307357 2000-OS-26
-37-
the conversion of UDP-GaINAc to UDP-GIcNAc is more efficient than the
reverse reaction. This is also apparent at equilibrium where 70% of UDP-
GaINAc are converted to UDP-GIcNAc whereas only 30% of UDP-GIcNAc
are converted to UDP-GaINAc. Hence, in vitro, the equilibrium is shifted
towards the production of UDP-GIcNAc. Such a shift of the equilibrium
towards the production of the glucose isomer has been previously
reported for GaIE from E. coli (Wilson et al. (1969)). However, this is
opposite to what is expected in vivo and in the pathway proposed for O-
antigen biosynthesis in serotype 06. The use of the product by the next
enzyme involved in the B-band LPS biosynthetic pathway pulls the
equilibrium towards the production of UDP-GaINAc in vivo. While not
wishing to be bound to a particular theory, this could be part of a
regulatory mechanism. When the biosynthesis of LPS is down-regulated
as a function of varying environmental conditions (Creuzenet et al.
(1999)), the UDP-GIcNAc stock is not depleted by the activity of WbpP
and stays available for synthesis of other biologically important polymers
such as peptidoglycan. On the other hand, the low level of UDP-GIcNAc
conversion ensures that some precursors of LPS O-antigen are still
present in the cell. This allows for extremely fast LPS production recovery
as soon as normal environmental conditions are restored (Creuzenet et
al. (1999)). Finally, the kcat/Km ratio, which is an indication of binding of
the substrate to its site, suggests that the differences obtained for both
substrates are due to a less efficient binding of UDP-GIcNAc in the
substrate binding pocket than of UDP-GaINAc.
The specificity of WbpP for the N-acetylated forms of the
substrates was investigated. This aspect of the examples was initiated
with regards to the current proposed mechanism of action for C4
epimerase GaIE. The epimerase binds tightly to its substrate via the UDP
moiety while the sugar moiety is more loosely bound and rotates along
the bond between P[3 of UDP and O of the pyranosyl ring (Frey (1996))
while catalysis proceeds. As a result, GaIE has been shown to be able to
accommodate slightly different substrates, with different substitutions at
positions C2 and C6 (Frey (1996); Flentke et al. (1990); Thoden et al.
(1997)). It can also bind very different compounds as long as the UDP
structure is preserved (Thoden et al. (1996)). In the case of WbpP, the
CA 02307357 2000-OS-26
-38-
enzyme can still perform the epimerisation of both UDP-Gal and UDP-Glc
with Km values of the same order as those for the acetylated substrates.
However the kcat and Vmax values clearly indicate that the catalysis is
1000 fold less efficient with these substrates than with the acetylated ones.
Moreover, the k~at~Km ratio indicates that the binding is quite poor,
especially for UDP-Glc. This is reflected by the fact that the epimerisation
of the non-acetylated substrates requires the presence of significantly
higher amounts of enzyme than the epimerisation of the acetylated
substrates.
As observed for the acetylated substrates, the equilibrium is also
shifted towards the production of UDP-Glc, but the maximum
percentages of substrate conversion are much lower than in the previous
case. Only 40% of UDP-Gal are converted to UDP-Glc at equilibrium, and
around 12% of UDP-Glc are converted to UDP-Gal. Though WbpP can
epimerise the non-acetylated substrates in vitro, the poor efficiency of
catalysis and high amounts of enzyme necessary to carry such reactions
indicate that these reactions are unlikely to happen in vivo and that the
acetylated forms of the substrates are the preferred ones in vivo.
Determination of the 3-dimensional structure and site-directed
mutagenesis studies of WbpP will help decipher the molecular basis for
substrate specificity in this enzyme. In P. aeruginosa, a genuine UDP-Glc
C4 epimerase activity is required for the synthesis of the galactose
residue found in the LPS core. Since the data show in the examples that
UDP-Glc is not the preferred substrate for WbpP, this activity might be
carried by a yet uncharacterised homologue of WbpP. This is consistent
with the fact that inactivation of WbpP by gentamycin cassette insertion
and allelic replacement does not result in the production of a truncated
core in serotype 06 (Belanger et al. (1999)). This is also consistent with the
observation that Southern blotting experiments using the wbpP gene as a
probe reveal the existence of homologues in all 20 serotypes of P.
aeruginosa which share common core structural motifs.
Overall, the Km determined for WbpP and its different substrates
are within the range of values reported in the literature for GalE
epimerases from different sources (Moreno et al. (1981); Piller et al.
(1983); Wilson et al. (1969); Swanson et al. (1993); Quimby et al. (1997)).
CA 02307357 2000-OS-26
-39-
For both series of substrates, the enzyme is active without
requiring addition of exogenous NAD+ or divalent cations such as Mg2+,
Mn2+ or Ca2+. However, the mechanism of C4 epimerisation implies the
participation of a NAD+ molecule as an essential coenzyme (Fret' (1996)).
This molecule is predicted to be bound in the Rossman fold delineated by
the alternating a helix and (3 sheet structures and the G-x-x-G-x-x-G motif
at the N-terminus of the protein. The binding site has been mapped by
NMR (43) and crystallography studies (Bauer et al. (1992); Thoden et al.
(1996); Thoden et al. (1996)) in GaIE from E. coli. In GaIE, the NAD+
molecule is a redox cofactor responsible for reversibly and non-
stereospecifically dehydrogenating carbon 4 in the pyranosyl rings of
UDP-Glc and UDP-Gal. This NAD+ molecule does not dissociate from the
enzyme either in the course of catalysis or between catalytic cycles.
However, an NAD+-independent epimerase that carries its function via
carbon-carbon bond cleavage rather than by a simple deprotonation-
reprotonation mechanism was recently described (Johnson et al. (1998)).
In the case of WbpP, NAD(H) could be extracted from purified and
extensively dialysed enzyme after complete proteolysis and chemical
reduction. This indicates that NAD(H) is present and tightly bound to the
enzyme as it is expressed in E. coli. This molecule of NAD(H) might be
recycled internally without being released into the external medium as
has been proposed for GaIE. Structure determination of WbpP will
confirm the presence of a bound NAD+ molecule in WbpP and allow the
mapping of its binding site.
Most SDR enzymes exist as dimers or tetramers in their native
state (Jornvall et al. (1995)). Our gel filtration data suggest that WbpP also
forms a dimer. However, contrary to what has been previously described
for a UDP-GIcNAc C2 epimerase (Morgan et al. (1997)), no allosteric
behaviour was observed for WbpP.
While the present invention has been described with reference to
what are presently considered to be preferred examples, it is to be
understood that the invention is not limited to the disclosed examples. To
the contrary, the invention is intended to cover various modifications and
equivalents included within the spirit and scope of the appended claims.
All publications, patents and patent applications are herein
CA 02307357 2000-OS-26
-40-
incorporated by reference in their entirety to the same extent as if each
individual publication, patent or patent application was specifically and
individually indicated to be incorporated by reference in its entirety.
CA 02307357 2000-OS-26
-41-
Table 1
Purification table for WbpP established using the DMAB assay and
either UDP-GIcNAc or UDP-GaINAc as a substrate)
FractionVol. Cone Prot-Yield Substrate Total SpecificFold-
(ml) (g/1)ein (%) units3activ- Purif.
(mg) sty (x)
(U /
mg)
Total 10 5.2 52 100 UDP-GIcNAc 111 0.2
cell
extracts
UDP-GalNAc 133 2.6 1
Soluble 10 3.3 33 64 UDP-GIcNAc 35 1.1 1
fractions
UDP-GaINAc 113 3.4 1.3
IMAC 3.5 2.8 9.7 19 UDP-GIcNAc 19 2.0 1.8
UDP-GaINAc 45 4.6 1.8
Anion 5 1.2 5.8 11 UDP-GIcNAc 13 2.3 2.1
exchange
UDP-GaINAc 33 5.6 2.2
1 Total cell extracts produce a high background of UDP-GIcNAc-
modifying activity (9.5 units), mostly associated with the membrane
fraction. In addition, the preferred direction of the reaction with WbpP is
towards UDP-GIcNAc production (see kinetic data). Hence, very little
difference is observed on total cell extracts expressing WbpP (20.5 units)
or not (9.5 units) when reactions are performed with UDP-GIcNAc as a
substrate. Therefore, the controls for analysis of total cell extracts or
soluble fraction containing WbpP were total cell extract or soluble fraction
of the same E. coli strain used for expression of WbpP but harbouring the
empty pET23 vector only. Also, for UDP-GIcNAc, the reference used for
the purification is the specific activity obtained with the soluble extract
only, when unspecific UDP-GIcNAc modification was not observed.
2 Conc. refers to the total protein concentration of the fraction tested for
activity.
3 One unit is defined as the amount of enzyme that allows conversion of
1 ~mol of substrate in 1 min under our experimental conditions. The
reactions were performed using 8.8 ~,1 of enzyme fraction or cell extract
and 0.75 mM of substrate in a total volume of 44 ~.1. The activity was
determined using the DMAB assay.
CA 02307357 2000-OS-26
-42-
Table 2
Kinetic parameters for WbpP and its four substrates as determined by
capillary electrophoresis.
Substrate Km Vmax Enzyme kcat kcat/Km
(pM) (pmol (pmol) (min-1) (mM-1 x min-1)
/ min)
UDP-GalNAce197 840 t 3.1 271 t 7 1375 143
15 25
UDP-GIcNAca224 741 22 6.2 120 3 536 57
17
UDP-Galb 251 82 3 436 0.188 0.749 0.06
16 0.007
UDP-Glcb 237 54 6 436 0.124 0.523 0.18
53 0.014
a Three independent experiments were performed where the range of
substrate concentrations was shifted towards lower concentrations and
the enzyme used at higher dilutions to refine the value of the parameters
obtained. The results presented in this table are the results of the last
experiment.
b Two independent experiments were performed and analysed using the
spectrophotometric assay to get an estimation of the Km and V
parameters. A third experiment was performed with a wider substrate
concentration range including 5 points below the estimated Km to refine
the values of the parameters. Very similar kinetic parameters were
obtained in the three experiments, but the error was considerably lower
using CE data. Therefore, the results presented in this table are the
results of the last experiment which were obtained by CE analysis.
CA 02307357 2000-OS-26
-43-
FULL CITATIONS FOR REFERENCES REFERRED TO IN THE
SPECIFICATION
Bauer, A. J., Rayment, L, Frey, P. A., and Holden, H. M. (1992) Proteins 12,
372-381.
Belanger, M., Burrows, L.L., and Lam, J.S. (1999) Microbiology 145, 3505-
3521.
Burrows, L. L., Charter, D. F., and Lam, J. S. (1996) Mol. Microbiol. 22, 481-
495.
Creuzenet, C., Smith, M., and Lam, J.S. (1999) Pseudomonas'99:
biotechnology and pathogenesis. Abstract # 93. Maui, Hawai.
Cryz, S. J., Jr., Pitt, T. L., Furer, E., and Germanier, R. (1984) Infect.
Immun.
44, 508-513.
Dean, C. R., Franklund, C. V., Retief, J. D., Coyne, M. J., Jr., Hatano, K.,
Evans, D. J., Pier, G. B., and Goldberg, J. B. (1999) J. Bacteriol. 181, 4275
4284.
Engles, W., Endert, J., Kamps, M.A.F., and VanBoven C.P.A. (1985) Infect.
Immun. 49,182-189.
Estrela, A. L, Pooley, H. M., de Lencastre, H., and Karamata, D. (1991) J.
Gen. Microbiol. 137, 943-950.
Flentke, G. R., and Frey, P. A. (1990) Biochemistry 29, 2430-2436.
Frey, P. A. (1996) Faseb J. 10, 461-470.
Goldberg, J. B., and Pier, G. B. (1996) Trends Microbiol. 4, 490-494.
Hancock, R. E., Mutharia, L. M., Chan, L., Darveau, R. P., Speert, D. P.,
and Pier, G. B. (1983) Infect. Immun. 42,170-177.
Johnson, A. E., and Tanner, M. E. (1998) Biochemistry 37, 5746-5754.
Jornvall, H., Persson, B., Krook, M., Atrian, S., Gonzalez-Duarte, R.,
Jeffery, J., and Ghosh, D. (1995) Biochemistry 34, 6003-6013.
Jornvall, H. (1999) Adv. Exp. Med. Biol. 463, 359-364.
Jornvall, H., Hoog, J. O., and Persson, B. (1999) FEBS Lett. 445, 261-264.
Keppler, O. T., Hinderlich, S., Langner, J., Schwartz-Albiez, R., Reutter,
W., and Pawlita, M. (1999) Science 284,1372-1376.
Kiser, K. B., Bhasin, N., Deng, L., and Lee, J. C. (1999) J. Bacteriol. 181,
4818-4824.
Knirel, Y. A., Vinogradov, E. V., Shashkov, A. S., Dmitriev, B. A.,
CA 02307357 2000-OS-26
-44-
Kochetkov, N. K., Stanislavsky, E. S., and Mashilova, G. M. (1985) Eur. J.
Biochem. 150, 541-550.
Knirel, Y. A. (1990) Crit. Rev. Microbiol. 17, 273-304.
Knirel, Y. A., and Kochetkov, N. K. (1994) Biokhimiia 59,1784-1851.
Kochetkov, N.K., and Shibaev, V.N. (1973) Adv. Carbohydr. Chem. Biochem.
28, 307-399.
Konopka, J. M., Halkides, C. J., Vanhooke, J. L., Gorenstein, D. G., and
Frey, P. A. (1989) Biochemistry 28, 2645-2654.
Marolda, C. L., and Valvano, M. A. (1995) J. Bacteriol. 177, 5539-5546.
Moreno, F., Rodicio, R., and Herrero, P. (1981) Cell. Mol. Biol. 27, 589-592.
Morgan, P.M., Sla R.F., and Tanner, M.E. (1997) j. Am. Chem. Soc. 119,
10269-10277.
Newton, D. T., and Mangroo, D. (1999) Biochem. J. 339, 63-69.
Pier, G.B., and Thomas D.M. (1982) J. Infect. Dis. 148, 217-223.
Piller, F., Hanlon, M. H., and Hill, R. L. (1983) J. Biol. Chem. 258, 10774-
10778.
Pitt, T. L. (1989) Antibiot. Chemother. 42,1-7.
Plumbridge, J., and Vimr, E. (1999) j. Bacteriol. 181, 47-54.
Poole, K., Krebes, K., McNally, C., and Neshat, S. (1993) J. Bacteriol. 175,
7363-7372.
Poole, K., Gotoh, N., Tsujimoto, H., Zhao, Q., Wada, A., Yamasaki, T.,
Neshat, S., Yamagishi, J., Li, X. Z., and Nishino, T. (1996) Mol. Microbiol.
21,
713-724.
Quimby, B. B., Alano, A., Almashanu, S., DeSandro, A. M., Cowan, T. M.,
and Fridovich-Keil, J. L. (1997) Am. J. Hum. Genet. 61, 590-598.
Reissig, J.L., Strominger J.L., and Leloir, L.F. (1955) j. Biol. Chem. 217,
959-
966.
Rocchetta, H.L., Burrows, L.L., and Lam, J.S. (1999) Microbiol. Mol. Biol.
Rev. 63, 523-553.
Rossmann, M. G., and Argos, P. (1975) J. Biol. Chem. 250, 7525-7532.
Schiller, N. L., and Hatch, R. A. (1983) Diagn. Microbiol. Infect. Dis. 1,145-
157.
Shibaev, V. N. (1986) Adv. Carbohydr. Chem. Biochem. 44, 277-339.
CA 02307357 2000-OS-26
-45-
Srikumar, R., Tsang, E., and Poole, K. (1999) J. Antimicrob. Chemother. 44,
537-540.
Swanson, B. A., and Frey, P. A. (1993) Biochemistry 32,13231-13236.
Thoden, J. B., Frey, P. A., and Holden, H. M. (1996) Biochemistry 35, 5137-
5144.
Thoden, J. B., Frey, P. A., and Holden, H. M. (1996) Biochemistry 35, 2557-
2566.
Thoden, J. B., Frey, P. A., and Holden, H. M. (1996) Protein Sci. 5, 2149-
2161.
Thoden, J. B., Hegeman, A. D., Wesenberg, G., Chapeau, M. C., Frey, P.
A., and Holden, H. M. (1997) Biochemistry 36, 6294-6304.
Virlogeux, L, Waxin, H., Ecobichon, C., and Popoff, M. Y. (1995)
Microbiology 141, 3039-3047.
Wilson, D. B., and Hogness, D. S. (1969) J. Biol. Chem. 244, 2132-2136.
CA 02307357 2000-OS-26
-46-
DETAILED LEGENDS FOR VARIOUS FIGURES
Figure 1: Comparison of the primary and secondary structural features
of 3 members of the short-chain dehydrogenase/reductase family: WbpP
from P. aeruginosa serotype 06, the C4 UDP-Glc epimerase GaIE from E.
coli and the dTDP-glucose 4,6-dehydratase RFFG from E. coli. +, identical
amino acids; *, homologous amino acids; green letters, (3=sheets; pink
letters, a-helices. The conserved catalytic triad is highlighted in blue. The
G-X-X-G-X-X-G signature for NAD(P)+ binding proteins is highlighted in
bold. Secondary structure predictions were made using the Expasy
molecular biology sofware (expasy.hcuge.ch).
Figure 2: SDS-PAGE analysis of WbpP along its purification. 30 ~.l
aliquotes were withdrawn at each step of the purification described in the
experimental section and loaded on a 10 % SDS-PAGE gel. The detection
was performed with Coomassie Blue staining. WbpP eluted from the
anion exchange (AE) column was loaded in two lanes in different
amounts to show purity and size. MW: molecular weight markers.
Figure 3: Study of the epimerisation of UDP-GIcNAc and UDP-GaINAc
by WbpP using the DMAB assay. Panel A, standard curves obtained with
each compound separately. Open circles, UDP-GIcNAc; Open squares,
UDP-GaINAc. Panel B, comparison of the experimental data (closed
triangles) obtained for mixtures of UDP-GaINAc and UDP-GIcNAc of
different proportions (constant total sugar-nucleotide concentration of
0.75 mM) and the theoretical data (open triangles) calculated from the
standard curves from panel 3A. 3C: Activity of WbpP as a function of the
amount of enzyme added. The reactions were performed with 0.75 mM
substrate in a total volume of 35 ~.1 for 8 min at 37°C. Closed
circles, UDP-
GIcNAc; Closed squares, UDP-GaINAc.
Figure 4: Capillary electrophoresis analysis of the epimerisation of UDP-
GIcNAc and UDP-GaINAc by WbpP at equilibrium. The reactions were
performed in a total volume of 35 ~1 with 1.5 mM substrate and 17 ~.g of
enzyme. They were incubated at 37°C for 2 h. 1, UDP-GaINAc alone; 2,
CA 02307357 2000-OS-26
-47-
UDP-GIcNAc alone; 3, UDP-GaINAc + WbpP; 4, UDP-GIcNAc + WbpP.
Figure 5: Time course of epimerisation of UDP-GIcNAc and UDP-GaINAc
by WbpP as measured by capillary electrophoresis. Reactions were
performed at 37°C in 20 mM Tris pH 8 with a total reaction volume of 44
~1. The amount of purified enzyme added was 234 ng and 117 ng for
reaction with UDP-GIcNAc and UDP-GaINAc, respectively. Closed circles,
UDP-GIcNAc 0.075 mM; Closed squares, UDP-GaINAc 0.075 mM; Open
circles, UDP-GIcNAc 1.75 mM; Open squares, UDP-GaINAc 1.75 mM.
Figure 6: Determination of the optimum pH and temperature for the
epimerisation of UDP-GIcNAc by WbpP using the DMAB assay: For the
pH study (panel A), the reactions were performed with 5 mM UDP-
GIcNAc and 39 ng of enzyme in a total volume of 44 ~,1 and incubated for
10 min at 37°C. The pH between 5 and 7 were obtained with 50 mM
sodium acetate buffer (open circles), whereas pH 7 to 10 were obtained
with 50 mM Tris-HCl (closed circles). For the temperature study (panel B),
the reactions were performed in 50 mM Tris-HCl pH 8 with 5 mM UDP-
GIcNAc and 0.78 ng of enzyme in a total volume of 44 ~.l and 30 min
incubation. For both panels, two enzymatic reactions were set up in each
experimental condition and two determinations of residual UDP-GIcNAc
were made per reaction. Each point represents the average of the four
determinations.
Figure 7: Time-course for the epimerisation of UDP-Glc and UDP-Gal by
WbpP using the glucose oxidase - coupled assay. Two measurements
were made per time point on the same enzymatic reaction. The reactions
were made with 33 ~,g of enzyme and 0.45 mM substrate in a total
volume of 44 ~.1. Squares, UDP-Gal; Circles, UDP-Glc. The same
differences between both substrates were observed when reactions were
done with different enzyme quantities (data not shown).
Figure 8: Capillary electrophoresis analysis of the epimerisation of UDP-
Glc and UDP-Gal by WbpP at equilibrium. The reactions were performed
in a total volume of 35 ~.1 with 1.5 mM substrate and 17 ~g of enzyme.
CA 02307357 2000-OS-26
-48-
They were incubated at 37°C for 2 h. 1, UDP-Gal alone; 2, UDP-Glc
alone;
3, UDP-Gal + WbpP; 4, UDP-Glc + WbpP.
Figure 9. DNA sequence of WbpP06 carrying a N-terminal hexahistidine
tag (in bold). The start codon for WbpP06 is indicated in italics.
Accession number for WbpP06: AF035937. Total number of bases: 1059.
Figure 10 Amino acid sequence of WbpP06 carrying a N-terminal
hexahistidine tag (in bold). The start methionine of WbpP06 is indicated
in italics. Accession number for WbpP06: AF035937. Total number of
amino acids: 352.
Figure 11. SDS-PAGE analysis of WbpP overexpressed in the pET
system, in BL21DE3pLysS, under low inducer concentration (0.15 mM)
and at low temperature (30°C). The soluble fraction was purified by
nickel chelation after lysis by sonication.
Figure 12. Measurement of activity of WbpP as followed by the
disappearance of different substrates (UDP-GaINAc and UDP-GIcNAc),
after incubation with cell extracts containing overexpressed protein or
with purified protein (see Figure 14). Measurements were done in
duplicates for three different quantities of proteins and normalized for
the background (bcg) obtained with control cell extracts or purification
buffers only. The results are compatible with an interconversion of UDP-
GaINAc for UDP-GIcNAc by WbpP in vitro.
CA 02307357 2000-08-24
- 49 -
SEQUENCE LISTING
(1) GENERAL INFORMATION:
(i) APPLICANT: University of Guelph
(ii) TITLE OF INVENTION: WbpP and Method For Assay of WbpP
(iii) NUMBER OF SEQUENCES: 6
(iv) CORRESPONDENCE ADDRESS:
(A) ADDRESSEE: Bereskin & Parr
(B) STREET: Suite 4000, 40 King Street West
(C) CITY: Toronto
(D) STATE: Ontario
(E) COUNTRY: Canada
(F) ZIP: M5H 3Y2
(v) COMPUTER READABLE FORM:
(A) MEDIUM TYPE: Floppy disk
(B) COMPUTER: IBM PC compatible
(C) OPERATING SYSTEM: PC-DOS/MS-DOS
(D) SOFTWARE: PatentIn Release #1.0, Version #1.30
(vi) CURRENT APPLICATION DATA:
(A) APPLICATION NUMBER: CA 2,307,357
(B) FILING DATE: 26-MAY-2000
(C) CLASSIFICATION:
(vii) PRIOR APPLICATION DATA:
(A) APPLICATION NUMBER: US 60/136,564
(B) FILING DATE: 28-MAY-1999
(vii) PRIOR APPLICATION DATA:
(A) APPLICATION NUMBER: CA 2,305,716
(B) FILING DATE: 09-MAY-2000
(viii) ATTORNEY/AGENT INFORMATION:
(A) NAME: Rudolph, John R.
(B) REGISTRATION NUMBER: 4213
(C) REFERENCE/DOCKET NUMBER: 6580-204
(ix) TELECOMMUNICATION INFORMATION:
(A) TELEPHONE: 416-364-7311
(B) TELEFAX: 416-361-1398
(2) INFORMATION FOR SEQ ID NO:1:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 1059 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: other nucleic acid
(xi) SEQUENCE DESCRIPTION: SEQ ID N0:1:
ATGCACCACC ACCACCACCA CGGTTCCATG GGCATGATGA GTCGTTATGA AGAGCTAAGA 60
AAGGAATTGC CGGCGCAGCC GAAAGTCTGG CTGATTACAG GTGTGGCGGG CTTTATTGGC 120
CA 02307357 2000-08-24
- 50 -
TCTAATCTTC TTGAGACTTTGCTAAAGCTTGATCAGAAGGTTGTCGGTCT GGATAATTTT180
GCTACTGGTC ATCAGCGGAACCTGGACGAAGTGCGGTCCTTGGTTAGCGA GAAGCAATGG240
TCAAATTTTA AATTTATTCAAGGTGATATTCGCAATCTGGATGATTGCAA TAACGCCTGT300
GCAGGTGTTG ATTACGTTTTACATCAAGCTGCCTTGGGTTCGGTACCGCG TTCTATTAAC360
GATCCGATCA CCTCCAATGCAACGAACATCGATGGTTTCTTGAATATGCT GATTGCAGCC420
AGAGATGCCA AGGTGCAGAGTTTCACTTATGCGGCAAGTAGCTCTACCTA TGGAGATCAT480
CCTGGTTTAC CGAAGGTGGAGGATACTATAGGTAAGCCTCTTTCCCCTTA TGCGGTTACC540
AAATATGTGA ATGAGCTTTATGCCGATGTGTTTTCACGCTGCTACGGCTT TTCGACCATT600
GGGCTTCGTT ATTTCAATGTGTTCGGTCGTCGACAGGATCCCAATGGTGC CTATGCGGCA660
GTCATACCAA AATGGACCTCTTCGATGATCCAGGGTGATGACGTCTATAT TAACGGTGAT720
GGCGAGACCA GTCGGGATTTTTGTTATATTGAAAACACCGTTCAGGCCAA TCTGCTTGCT780
GCAACCGCGG GGCTTGATGCTCGTAATCAAGTTTACAATATTGCTGTTGG CGGGCGGACG840
AGTTTGAATC AGTTGTTCTTTGCGCTTCGCGACGGCCTTGCCGAAAACGG TGTGTCCTAT900
CACCGGGAAC CTGTTTATCGTGATTTTAGGGAGGGGGATGTACGTCACTC TCTCGCTGAT960
ATCAGCAAGG CTGCCAAACTGCTGGGGTATGCGCCGAAATATGATGTGTC TGCAGGTGTG1020
GCGTTGGCCA TGCCTTGGTACATCATGTTTTTGAAATGA 1059
(2) INFORMATION
FOR SEQ ID N0:2:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 352 amino
acids
(B) TYPE: amino
acid
(C) STRANDEDNESS:
single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE:
peptide
(xi) SEQUENCE DESCRIPTION: SEQ ID N0:2:
Met His His His His His His Gly Ser Met Gly Met Met Ser Arg Tyr
1 5 10 15
Glu Glu Leu Arg Lys Glu Leu Pro Ala Gln Pro Lys Val Trp Leu Ile
20 25 30
Thr Gly Val Ala Gly Phe Ile Gly Ser Asn Leu Leu Glu Thr Leu Leu
35 40 45
Lys Leu Asp Gln Lys Val Val Gly Leu Asp Asn Phe Ala Thr Gly His
50 55 60
Gln Arg Asn Leu Asp Glu Val Arg Ser Leu Val Ser Glu Lys Gln Trp
65 70 75 80
Ser Asn Phe Lys Phe Ile Gln Gly Asp Ile Arg Asn Leu Asp Asp Cys
85 90 95
Asn Asn Ala Cys Ala Gly Val Asp Tyr Val Leu His Gln Ala Ala Leu
100 105 110
CA 02307357 2000-08-24
- 51 -
Gly Ser Val Pro Arg Ser Ile Asn Asp Pro Ile Thr Ser Asn Ala Thr
115 120 125
Asn Ile Asp Gly Phe Leu Asn Met Leu Ile Ala Ala Arg Asp Ala Lys
130 135 140
Val Gln Ser Phe Thr Tyr Ala Ala Ser Ser Ser Thr Tyr Gly Asp His
145 150 155 160
Pro Gly Leu Pro Lys Val Glu Asp Thr Ile Gly Lys Pro Leu Ser Pro
165 170 175
Tyr Ala Val Thr Lys Tyr Val Asn Glu Leu Tyr Ala Asp Val Phe Ser
180 185 190
Arg Cys Tyr Gly Phe Ser Thr Ile Gly Leu Arg Tyr Phe Asn Val Phe
195 200 205
Gly Arg Arg Gln Asp Pro Asn Gly Ala Tyr Ala Ala Val Ile Pro Lys
210 215 220
Trp Thr Ser Ser Met Ile Gln Gly Asp Asp Val Tyr Ile Asn Gly Asp
225 230 235 240
Gly Glu Thr Ser Arg Asp Phe Cys Tyr Ile Glu Asn Thr Val Gln Ala
245 250 255
Asn Leu Leu Ala Ala Thr Ala Gly Leu Asp Ala Arg Asn Gln Val Tyr
260 265 270
Asn Ile Ala Val Gly Gly Arg Thr Ser Leu Asn Gln Leu Phe Phe Ala
275 280 285
Leu Arg Asp Gly Leu Ala Glu Asn Gly Val Ser Tyr His Arg Glu Pro
290 295 300
Val Tyr Arg Asp Phe Arg Glu Gly Asp Val Arg His Ser Leu Ala Asp
305 310 315 320
Ile Ser Lys Ala Ala Lys Leu Leu Gly Tyr Ala Pro Lys Tyr Asp Val
325 330 335
Ser Ala Gly Val Ala Leu Ala Met Pro Trp Tyr Ile Met Phe Leu Lys
340 345 350
(2) INFORMATION FOR SEQ ID N0:3:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 32 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: other nucleic acid
(xi) SEQUENCE DESCRIPTION: SEQ ID N0:3:
CAATGCCATG GGAATGATGA GTCGTTATGA AG 32
(2) INFORMATION FOR SEQ ID N0:4:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 30 base pairs
CA 02307357 2000-08-24
- 52 -
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: other nucleic acid
(xi) SEQUENCE DESCRIPTION: SEQ ID N0:4:
TTAACGAATT CTCATTTCAA AAACATGATG 30
(2) INFORMATION FOR SEQ ID N0:5:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 338 amino acids
(B) TYPE: amino acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: peptide
(xi) SEQUENCE DESCRIPTION: SEQ ID N0:5:
Met Arg Val Leu Val Thr Gly Gly Ser Gly Tyr Ile Gly Ser His Thr
1 5 10 15
Cys Val Gln Leu Leu Gln Asn Gly His Asp Val Ile Ile Leu Asp Asn
20 25 30
Leu Cys Asn Ser Lys Arg Ser Val Leu Pro Val Ile Glu Arg Leu Gly
35 40 45
Gly Lys His Pro Thr Phe Val Glu Gly Asp Ile Arg Asn Glu Ala Leu
50 55 60
Met Thr Glu Ile Leu His Asp His Ala Ile Asp Thr Val Ile His Phe
65 70 75 80
Ala Gly Leu Lys Ala Val Gly Glu Ser Val Gln Lys Pro Leu Glu Tyr
85 90 95
Tyr Asp Asn Asn Val Asn Gly Thr Leu Arg Leu Ile Ser Ala Met Arg
100 105 110
Ala Ala Asn Val Lys Asn Phe Ile Phe Ser Ser Ser Ala Thr Val Tyr
115 120 125
Gly Asp Gln Pro Lys Ile Pro Tyr Val Glu Ser Phe Pro Thr Gly Thr
130 135 140
Pro Gln Ser Pro Tyr Gly Lys Ser Lys Leu Met Val Glu Gln Ile Leu
145 150 155 160
Thr Asp Leu Gln Lys Ala Gln Pro Asp Trp Ser Ile Ala Leu Leu Arg
165 170 175
Tyr Phe Asn Pro Val Gly Ala His Pro Ser Gly Asp Met Gly Glu Asp
180 185 190
Pro Gln Gly Ile Pro Asn Asn Leu Met Pro Tyr Ile Ala Gln Val Ala
195 200 205
CA 02307357 2000-08-24
- 53 -
Val Gly Arg Arg Asp Ser Leu Ala Ile Phe Gly Asn Asp Tyr Pro Thr
210 215 220
Glu Asp Gly Thr Gly Val Arg Asp Tyr Ile His Val Met Asp Leu Ala
225 230 235 240
Asp Gly His Val Val Ala Met Glu Lys Leu Ala Asn Lys Pro Gly Val
245 250 255
His Ile Tyr Asn Leu Gly Ala Gly Val Gly Asn Ser Val Leu Asp Val
260 265 270
Val Asn Ala Phe Ser Lys Ala Cys Gly Lys Pro Val Asn Tyr His Phe
275 280 285
Ala Pro Arg Arg Glu Gly Asp Leu Pro Ala Tyr Trp Ala Asp Ala Ser
290 295 300
Lys Ala Asp Arg Glu Leu Asn Trp Arg Val Thr Arg Thr Leu Asp Glu
305 310 315 320
Met Ala Gln Asp Thr Trp His Trp Gln Ser Arg His Pro Gln Gly Tyr
325 330 335
Pro Asp
(2) INFORMATION FOR SEQ ID N0:6:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 355 amino acids
(B) TYPE: amino acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: peptide
(xi) SEQUENCE DESCRIPTION: SEQ ID N0:6:
Met Arg Lys Ile Leu Ile Thr Gly Gly Ala Gly Phe Ile Gly Ser Ala
1 5 10 15
Leu Val Arg Tyr Ile Ile Asn Glu Thr Ser Asp Ala Val Val Val Val
20 25 30
Asp Lys Leu Thr Tyr Ala Gly Asn Leu Met Ser Leu Ala Pro Val Ala
35 40 45
Gln Ser Glu Arg Phe Ala Phe Glu Lys Val Asp Ile Cys Asp Arg Ala
50 55 60
Glu Leu Ala Arg Val Phe Thr Glu His Gln Pro Asp Cys Val Met His
65 70 75 g0
Leu Ala Ala Glu Ser His Val Asp Arg Ser Ile Asp Gly Pro Ala Ala
85 90 95
Phe Ile Glu Thr Asn Ile Val Gly Thr Tyr Thr Leu Leu Glu Ala Ala
100 105 110
Arg Ala Tyr Trp Asn Ala Leu Thr Glu Asp Lys Lys Ser Ala Phe Arg
115 120 125
Phe His His Ile Ser Thr Asp Glu Val Tyr Gly Asp Leu His Ser Thr
CA 02307357 2000-08-24
- 54 -
130 135 140
Asp Asp Phe Phe Thr Glu Thr Thr Pro Tyr Ala Pro Ser Ser Pro Tyr
145 150 155 160
Ser Ala Ser Lys Ala Ser Ser Asp His Leu Val Arg Ala Trp Leu Arg
165 170 175
Thr Tyr Gly Leu Pro Thr Leu Ile Thr Asn Cys Ser Asn Asn Tyr Gly
180 185 190
Pro Tyr His Phe Pro Glu Lys Leu Ile Pro Leu Met Ile Leu Asn Ala
195 200 205
Leu Ala Gly Lys Ser Leu Pro Val Tyr Gly Asn Gly Gln Gln Ile Arg
210 215 220
Asp Trp Leu Tyr Val Glu Asp His Ala Arg Ala Leu Tyr Cys Val Ala
225 230 235 240
Thr Thr Gly Lys Val Gly Glu Thr Tyr Asn Ile Gly Gly His Asn Glu
245 250 255
Arg Lys Asn Leu Asp Val Val Glu Thr Ile Cys Glu Leu Leu Glu Glu
260 265 270
Leu Ala Pro Asn Lys Pro His Gly Val Ala His Tyr Arg Asp Leu Ile
275 280 285
Thr Phe Val Ala Asp Arg Pro Gly His Asp Leu Arg Tyr Ala Ile Asp
290 295 300
Ala Ser Lys Ile Ala Arg Glu Leu Gly Cys Val Pro Gln Glu Thr Phe
305 310 315 320
Glu Ser Gly Met Arg Lys Thr Val Gln Trp Tyr Leu Ala Asn Glu Ser
325 330 335
Trp Trp Lys Gln Val Gln Asp Gly Ser Tyr Gln Gly Glu Arg Leu Gly
340 345 350
Leu Lys Gly
355
