Note : Les descriptions sont présentées dans la langue officielle dans laquelle elles ont été soumises.
CA 02314683 2000-06-12
WO 99/30742 PCT/US98125720
SUMMARY OF THE INVENTION
The instant invention relates to the use of lentiviral
vectors per se f or a therapeutic benef it . The vector need
not contain a transgene with antiviral activity.
BRIEF D88CRIPTION OF THE DRAWINf38
Figure 1~ depicts four graphs of Gag p24 antigen
expression in human SupTl lymphocytes transduced with
lentiviral vector at different multiplicity of infection
{M.O.I.; rectangles, triangles, ellipses) or in control
non-transduced cells (lozenges) after infection with
different amounts of HIV.
Figure 2 depicts Gag p24 antigen expression and cell
survival after HIV infection of human primary CD4+
lymphocytes transduced with either a lentiviral vector
Z5 (triangles) or a murine leukemia virus based vector
(squares) or non-transduced cells {diamonds).
DETAILED DESCRIPTION OF THE INVENTION
The instant invention provides use of a lentiviral
vector. The vector can be one which carries a foreign
gene with an anti-viral activity, however, that is not a
prerequisite in the practice of the instant invention.
Thus, a vector per se can be used.
The lentiviral genome and the proviral DNA have the
three genes found in retroviruses: gag, pol and env,
which are flanked by two long terminal repeat (LTR)
sequences. The gag gene encodes the internal structural
(matrix, capsid and nucleocapsid) proteins; the pol gene
encodes the RNA-directed DNA polymerase (reverse
transcriptase), a protease and an integrase; and the env
gene encodes viral envelope glycoproteins. The 5' and 3'
2
CA 02314683 2000-06-12
WO 99/30742 PCTIUS98/25720
LTR's serve to promote transcription and polyadenylation
of the virion RNA's. The LTR contains all other cis-acting
sequences necessary for viral replication. Lentiviruses
have additional genes including vif, vpr, tat, rev, vpu,
nef and vpx (in HIV-1, HIV-2 and/or SIV).
Adjacent to the 5' LTR are sequences necessary for
reverse transcription of the genome (the tRNA primer
binding site) and for ef f icient encapsidation of viral RNA
into particles (the Psi site). If the sequences necessary
for encapsidation (or packaging of retroviral RNA into
infectious virions) are missing from the viral genome, the
cis defect prevents encapsidation of genomic RNA.
However, the resulting mutant remains capable of directing
the synthesis of all virion proteins.
The vectors of interest are those which have an intact
5' and 3' lentivirus LTR. A vector of interest contains
a packaging signal sequence comprising the leader sequence
downstream of the LTR and until the beginning of the. gag
gene. The vector may also contain an additional portion
of the gag gene to enhance packaging. The vector of
interest also includes a part of the env gene containing
the Rev Response Element (RRE), and it may or may not
include a splice acceptor site downstream of the RRE. The
vectors of interest may contain one or more transgenes, or
foreign nucleic acid, and preferably a transgene with
anti-viral activity. However, a vector of interest need
not contain a heterologous gene.
The heterologous or foreign nucleic acid sequence, the
transgene, is linked operably to a regulatory nucleic acid
sequence. As used herein, the term "heterolagous" nucleic
acid sequence refers to a sequence that originates from a
foreign species, or, if from the same species, it may be
substantially modified from the original form.
Alternatively, an unchanged nucleic acid sequence that is
3
CA 02314683 2000-06-12
WO 99/30742 PCT/US98/25720
not expressed normally in a cell is a heterologous nucleic
acid sequence.
The term "operably linked" refers to functional
linkage between a regulatory sequence and a heterologous
nucleic acid sequence resulting in expression of the
latter. Preferably, the heterologous sequence is linked
to a promoter, resulting in a chimeric gene. The
heterologous nucleic acid sequence is preferably under
control of either the viral LTR promoter-enhancer signals
or of an internal promoter, and retained signals within
the retroviral LTR can still bring about efficient
expression of the transgene.
The foreign gene can be any transcribable nucleic acid
of interest. Generally the foreign gene encodes a
polypeptide. Preferably the palypeptide has some
therapeutic benefit. The polypeptide may supplement
deficient or nonexistent expression of an endogenous
protein in a host cell. The polypeptide can confer new
properties on the host cell, such as a chimeric signalling
receptor, see U.S. Pat. No. 5,359,046. The artisan can
determine the appropriateness of a foreign gene practicing
techniques taught herein and known in the art. For
example, the artisan would know whether a foreign gene is
of a suitable size for encapsidation and whether the
foreign gene product is expressed properly.
It may be desirable to modulate the expression of a
gene regulating molecule in a cell by the introduction of
a molecule by the method of the invention. The term
"modulate" envisions the suppression of expression of a
gene when it is over-expressed or augmentation of
expression when it is under-expressed. Where a cell
proliferative disorder is associated with the expression
of a gene, nucleic acid sequences that interfere with the
expression of a gene at the translational level can be
4
CA 02314683 2000-06-12
WO 99130742 PCT/US98/25720
used. The approach can utilize, for example, antisense
nucleic acid, ribozymes or triplex agents to block
transcription or translation of a specific mRNA, either by
masking that mRNA with an antisense nucleic acid or
triplex agent, or by cleaving same with a ribozyme. The
target of those molecules is the lentiviral RNA.
Moreover, the RNA may be a sequence of the virus not
present in the vector or that has been mutated in the
vector.
Antisense nucleic acids are DNA or RNA molecules which
are complementary to at least a portion of a specific mRNA
molecule (Weintraub, Sci. Am. (1990) 262:40). In the
cell, the antisense nucleic acids hybridize to the
corresponding mRNA forming a double-stranded molecule.
The antisense nucleic acids interfere with the translation
of the mRNA since the cell will not translate a mRNA that
is double-stranded. Antisense oligomers of about 15
nucleotides or more are preferred since such are
synthesized easily and are less likely to cause problems
than larger molecules when introduced into the target
cell. The use of antisense methods to inhibit the in
vitro translation of~ genes is well known in the art
(Marcus-Sakura, Anal. Biochem. (2988) 172:289).
The antisense nucleic acid can be used to block
expression of a viral protein or a dominantly active gene
product, such as amyloid precursor protein that
accumulates in Alzheimer's disease. Such methods are also
useful for the treatment of Huntington's disease,
hereditary Parkinsonism and other diseases. Antisense
nucleic acids are also useful for the inhibition of
expression of proteins associated with toxicity.
Use of an oligonucleotide to stall transcription can
be by the mechanism known as the triplex strategy since
the oligomer winds around double-helical DNA, forming a
5
CA 02314683 2000-06-12
WO 99130742 PCT/US98/25720
three-strand helix. Therefore, the triplex compounds can
be designed to recognize a unique site on a chosen gene
(Maher et al., Antisense Res and Dev. (1991} 1(3):227;
Helene, Anticancer Drug Dis. (1991) 6(6):569).
Ribozymes are RNA molecules possessing the ability to
specifically cleave other single-stranded RNA in a manner
analogous to DNA restriction endonucleases. Through the
modification of nucleotide sequences which encode those
RNA~s, it is possible to engineer molecules that recognize
and cleave specific nucleotide sequences in an RNA
molecule (Cech, J. Amer. Med Assn. (1988) 260:3030). A
major advantage of that approach is only mRNA~s with
particular sequences are inactivated.
It may be desirable to transfer a nucleic acid
encoding a biological response modifier. Included in that
category are immunopotentiating agents including nucleic
acids encoding a number of the cytokines classified as
"interleukins", for example, interleukins 1 through 12.
Also included in that category, although not necessarily
working according to the same mechanism, are interferons,
and in particular gamma interferon (y-IFN), tumor necrosis
factor (TNF) and granulocyte-macrophage colony stimulating
factor (GM-CSF). It may be desirable to deliver such
nucleic acids to bone marrow cells or macrophages to treat
inborn enzymatic deficiencies or immune defects. Nucleic
acids encoding growth factors, toxic peptides, ligands,
receptors or other physiologically important proteins also
can be introduced into cells. The transgene also can be
an inducible toxic molecule.
The method of the invention may also be useful for
neuronal, glial, fibroblast or mesenchymal cell
transplantation, or "grafting", which involves
transplantation of cells infected with the recombinant
lentivirus of the invention ex vivo, or infection in vivo
6
CA 02314683 2000-06-12
WO 99/30742 PCTIUS98I25720
into the central nervous system or into the ventricular
cavities or subdurally onto the surface of a host brain.
Such methods for grafting will be known to those skilled
in the art and are described in Neural Grafting in the
Mammalian CNS, Bjorklund & Stenevi, eds. (1985).
For diseases due to deficiency of a protein product,
gene transfer could introduce a normal gene into the
affected tissues for replacement therapy, as well as to
create animal models for the disease using antisense
mutations. For example, it may be desirable to insert a
Factor VIII or IX encoding nucleic acid into a lentivirus
for infection of a muscle, spleen or liver cell.
The promoter sequence may be homologous' or
heterologous to the desired gene sequence. A wide range
of promoters may be utilized, including a viral or a
mammalian promoter, and an inducible promoter. Cell or
tissue specific promoters can be utilized to target
expression of gene sequences in specific cell populations.
Suitable mammalian and viral promoters for the instant
invention are available in the art.
Optionally during the cloning stage, the nucleic acid
construct referred to as the transfer vector, having the
packaging signal and the heterologous cloning site, also
contains a selectable marker gene. Marker genes are
utilized to assay for the presence of the vector, and
thus, to confirm infection and integration. The presence
of a marker gene ensures the selection and growth of only
those host cells which express the inserts. Typical
selection genes encode proteins that confer resistance to
antibiotics and other toxic substances, e.g., histidinol,
puromycin, hygromycin, neomycin, methotrexate etc. and
cell surface markers.
The recombinant virus of the invention is capable of
7
CA 02314683 2000-06-12
WO 99/30742 PCT/US98/25720
transferring a nucleic acid sequence into a mammalian
cell. The term, "nucleic acid sequence", refers to any
nucleic acid molecule, preferably DNA, as discussed in
detail herein. The nucleic acid molecule may be derived
from a variety of sources, including DNA, cDNA, synthetic
DNA, RNA or combinations thereof. Such nucleic acid
sequences may comprise genomic DNA which may or may not
include naturally occurring introns. Moreover, such
genomic DNA may be obtained in association with promoter
regions, poly A sequences or other associated sequences.
Genomic DNA may be extracted and purified from suitable
cells by means well known in the art. Alternatively,
messenger RNA (mRNA) can be isolated from cells and used
to produce cDNA by reverse transcription or other means.
Preferably, the recombinant lentivirus produced by the
method of the invention is a derivative of human
immunodeficiency virus (HIV).
The vectors of interests are produced using known
methods. The vectors of interest can be introduced into
cells either as the nucleic acid or encapsidated as a
virus particle. An artisan is familiar with methods for
encapsidating a lentiviral vector of interest. The
vectors are introduced into target cells using methods
known by those of skill in the art.
Thus, the vectors can be introduced into human cell
lines by calcium phosphate transfection, lipofection or
electroporation, generally together with a dominant
selectable marker, such as neo, DHFR, Gln synthetase or
ADA, followed by selection in the presence of the
appropriate drug and isolation of clones. The selectable
marker gene can be the transgene.
A likely means far transforming host cells with a
vector of interest is by infecting cells with virus
8
CA 02314683 2000-06-12
WO 99/30742 PCTIUS98/25720
particles carrying a vector of interest. Thus, the vector
of interest would be encapsidated using known packaging
systems, such as that taught in U. S. Pat. No. 5, 686, 279
and in Naldini et al. Science (1996) 272:263-267.
Briefly, using either a stable packaging cell line or by
transient transfection, the vector of interest is
introduced into a cell which packages the vector of
interest into viral particles. The virus particles are
obtained from the culture medium, treated as known in the
art to provide a virus preparation.
The target cell then is exposed to the virus
preparation. That can be via in vivo administration
means, wherein the virus preparation is administered to a
host, for example, in a parenteral form. Alternatively,
cells from the host can be retrieved and maintained in
culture where those cells are exposed to the virus
preparation. Once transformed, stably or not, the cells
then can be returned to the host.
While the therapeutic benefit of the instant invention
can be obtained by the vector per se, it is preferred that
the vector carry a transgene. Preferably that transgene
is one which itself has a therapeutic effect. Thus, the
vectors of interest should have a place in current therapy
of diseases associated with lentivirus.
Although the techniques used to construct vectors and
the like are provided in standard resource materials which
describe specific conditions and procedures, for
convenience, the following paragraphs may serve as a
guideline.
Construction of the vectors of the invention employs
standard ligation and restriction techniques which are
well understood in the art (see Maniatis et al., in
Molecular Cloning: A Laboratory Manual, Cold Spring
9
CA 02314683 2000-06-12
WO 99130742 PCTIUS98/25720
Harbor Laboratory, N.Y., 1982). Isolated plasmids, DNA
sequences or synthesized oligonucleotides are cleaved,
tailored and religated in the form desired.
Site-specific DNA cleavage is performed by treating
with the suitable restriction enzyme (or enzymes) under
conditions which are understood in the art, and the
particulars of which are specified by the manufacturer of
the commercially available restriction enzymes, see, e.g.
New England Biolabs, Product Catalog. In general, about
1 ~Cg of plasmid or DNA sequences is cleaved by one unit of
enzyme in about 20 ~1 of buffer solution. Typically, an
excess of restriction enzyme is used to ensure complete
digestion of the DNA substrate. Incubation times of about
one hour to two hours at about 37°C are workable, although
variations can be tolerated. After each incubation,
protein is removed by extraction with phenol/chloroform,
which may be followed by ether extraction, and the nucleic
acid recovered from aqueous fractions by precipitation
with ethanol. If desired, size separation of the cleaved
fragments may be performed by polyacrylamide gel or
agarose gel electrophoresis using standard techniques. A
general description of size separations is found in
Methods of Enzymology 65:499-560 (1980).
Restriction cleaved fragments may be blunt ended by
treating with the large fragment of E. coli DNA
polymerase I (Klenow) in the presence of the four
deoxynucleotide triphosphates (dNTP's) using incubation
times of about 15 to 25 minutes at 20°C in 50 mM Tris
(pH 7.6) 50 mM NaCl, 6 mM MgCl2, 6 mM DTT and 5-10 ~M
dNTP's. The Klenow fragment f ills in at 5' sticky ends
but chews back protruding 3' single strands, even though
the four dNTP's are present. If desired, selective repair
can be performed by supplying only one of the dNTP's, or
with selected dNTP's, within the limitations dictated by
the nature of the sticky ends. After treatment with
CA 02314683 2000-06-12
WO 99130742 PCT/US98I25720
Klenow, the mixture is extracted with phenol/chloroform
and ethanol precipitated. Treatment under appropriate
conditions with S1 nuclease or Bal-31 results in
hydrolysis of any single-stranded portion.
Legations can be performed in 15-50 ~1 volumes under
the following standard conditions and temperatures: 20 mM
Tris-C1 pH 7.5, 10 mM MgCl2, 10 mM DTT, 33 mg/ml BSA,
mM-50 mM NaCl and either 40 ~M ATP, 0.01-0.02 (Weiss)
units T4 DNA ligase at 0°C (for "sticky end" legation) or
10 1 mM ATP, 0.3-0.6 (Weiss) units T4 DNA ligase at 14°C
(for "blunt end" legation). Intermolecular "sticky end"
legations are usually performed at 33-100 ~g/ml total DNA
concentrations (5-100 mM total end concentration).
Intermolecular blunt end legations (usually employing a
10-30 fold molar excess of linkers) are performed at 1 ~M
total ends concentration.
Lentiviral vectors (Naldini et al., supra and Proc.
Natl. Acad. Sci. (1996) 93:11382-11388) have been used to
infect human cells growth-arrested in vitro and to
transduce neurons after direct injection into the brain of
adult rats. The vector was efficient at transferring
marker genes in vivo.into the neurons and long term
expression in the absence of detectable pathology was
achieved. Animals analyzed ten months after a single
injection of the vector, the longest time tested so far,
showed no decrease in the average level of transgene
expression and no sign of tissue pathology or immune
reaction. (Blomer et al., J. Virol. (1997) 71:6641-6649).
An improved version of the lentiviral vector in which the
HIV virulence genes env, vif, vpr, vpu and nef were
deleted without compromising the ability of the vector to
transduce non-dividing cells have been developed. The
multiply attenuated version represents a substantial
improvement in the biosafety of the vector (Zufferey
et al. Nat. Biotech. (1997) 15:871-875).
11
CA 02314683 2000-06-12
WO 99/30742 PG"T/US98125720
Viral supernatants are harvested using standard
techniques such as filtration of supernatants 48 hours
post transfection. The viral titer is determined by
infection of, for example, 106 NIH 3T3 cells or 105 HeLa
cells with an appropriate amount of viral supernatant, in
the presence of 8 ~Cg/ml polybrene (Sigma Chemical Co., St.
Louis, MO). Forty-eight hours later, the transduction
efficiency is assayed.
While not wanting to be bound to any posited
hypothesis, it is believed the mechanism of the resistance
was mapped to a past-integration step and shown to be
dependent on an intact HIV LTR in the vector. On HIV
infection of transduced cells, transcription from the
vector LTR was enhanced greatly, resulting in increased
expression of the transgene. Conceivably the vector RNA
competes effectively with the viral RNA's both for binding
the transactivators and for packaging by the budding viral
particles, resulting in inhibition of viral replication
and mobilization and spreading of the vector. Viral
particles collected from the infected transduced cells
were less infectious than virus collected from infected
non-transduced cells, and transferred efficiently the
transgene into naive cells.
Thus, expression of both the vector and the virus in
the same cell is detrimental to viral replication, and
result in mobilization and spreading of the transgene into
selected target cells of HIV. That effect and the strong
enhancement of transgene expression induced by HIV are
significant advantages of an HIV-derived vector of
anti-HIV gene therapy applications.
Thus, the instant vector will find use alone, either
containing a transgene or not, and preferably the
transgene has an antiviral activity; or in combination
with another vector carrying a transgene with antiviral
12
CA 02314683 2000-06-12
WO 99/30742 PCT/US98/25720
activity, wherein the instant vector does or does not
contain a transgene.
The viral particles can be further purified from the
viral supernatants as known in the art.
The viral particles or vector nucleic acid can be
administered to a host with a disorder associated with or
caused by a lentivirus using known techniques.
Actual delivery of the vectors or particles is
accomplished by using any physical method that will
transport same into a host and into the target cell. As
used herein, "vector", means both a bare recombinant
lentiviral vector and recombinant lentiviral particle.
Simply dissolving a vector in Hanks' balanced saline
solution or phosphate buffered saline is sufficient to
provide a solution useful for injection. There are no
known restrictions on the carriers or other components
that can be coadministered with the vector (although
compositions that degrade the virion or polynucleotides
thereof should be avoided in the normal manner with
vectors).
Pharmaceutical compositions can be prepared as
injectable formulations to be delivered intramuscularly,
including implantable pumps (known by those of skill in
the art and described, for example, in U.S. Pat. No.
5,474,552). Numerous formulations for injection are known
and can be used in the practice of the instant invention.
The vectors can be used with any pharmaceutically
acceptable carrier for ease of administration and
handling.
~ Such aqueous solutions can be buffered, if desired,
and the liquid diluent first rendered isotonic with saline
or glucose. Solutions of the vector as a free acid (DNA
13
CA 02314683 2000-06-12
WO 99/30742 PC'T/US98/25720
contains acidic phosphate groups) or a pharmacologically
acceptable salt can be prepared in water suitably mixed
with a surfactant such as hydroxypropylcellulose. A
dispersion of viral particles also can be prepared in
glycerol, liquid polyethylene glycols and mixtures thereof
and in oils. Under ordinary conditions of storage and
use, the preparations contain a preservative to prevent
the growth of microorganisms. The sterile aqueous media
employed are obtainable by standard techniques well-known
to those skilled in the art.
The pharmaceutical forms suitable for injectable use
include sterile aqueous solutions or dispersions and
sterile powders far the extemporaneous preparation of
sterile injectable solutions or dispersions. In all cases
the form must be sterile and must be fluid to the extent
that administration by a syringe is possible. The
formulation must be stable under the conditions of
manufacture and storage and must be preserved against the
contaminating action of microorganisms such as bacteria
and fungi. The carrier can be a solvent or dispersion
medium containing, for example, water, ethanol, polyol
(for example, glycerol, propylene glycol, liquid
polyethylene glycol and the like), suitable mixtures
thereof and vegetable oils. The proper fluidity can be
maintained, for example, by the use of a coating such as
lecithin, by the maintenance of the required particle size
in the case of a dispersion and by the use of surfactants.
The prevention of the action of microorganisms can be
brought about by various antibacterial and antifungal
agents, for example, parabens, chlorobutanol, phenol,
sorbic acid, thimerosal and the like. In many cases it
will be preferable to include isotonic agents, for
example, sugars or sodium chloride. Prolonged absorption
of the injectable compositions can be brought about by use
of agents delaying absorption, for example, aluminum
monostearate and gelatin.
14
CA 02314683 2000-06-12
WO 99/30742 PCTIUS98/25720
Sterile injectable solutions are prepared by
incorporating the vector in the required amount in the
appropriate solvent with various of the other ingredients
enumerated above, as required, followed by filtered
sterilization. Generally, dispersions are prepared by
incorporating the sterilized active ingredient into a
sterile vehicle which contains the basic dispersion medium
and the required other ingredients from those enumerated
above. In the case of sterile powders for the preparation
of sterile injectable solutions, the preferred methods of
preparation are vacuum drying and freeze drying which
yield a powder of the active ingredient plus any
additional desired ingredient from the previously
sterile-filtered solution thereof.
The therapeutic compounds of this invention may be
administered to a host alone or in combination with
pharmaceutically acceptable carriers. As noted above, the
relative proportions of active ingredient and carrier are
determined by the solubility and chemical nature of the
compound, chosen route of administration and standard
pharmaceutical practice.
The dosage of the instant therapeutic agents which
will be most suitable for prophylaxis or treatment will
vary with the form of administration, the particular
recombinant vector chosen and the physiological
characteristics of the particular patient under treatment.
Generally, small dosages will be used initially and, if
necessary, will be increased by small increments until the
optimum effect under the circumstances is reached.
Exemplary dosages are within the range of 108 up to
approximately 5 x 10'5 particles in a total volume of
3-10 ml.
The invention now having been described in detail,
provided hereinbelow are non-limiting examples
CA 02314683 2000-06-12
WO 99/30742 PCT/US98/25720
demonstrating various embodiments of the instant
invention.
Example 1
CONSTRUCTION OF THE LENTIVIRAL VECTORS
The lentiviral transfer vector plasmids were derived
from the plasmid pHR'-CMV-LacZ described previously in
Naldini et al., Science (1996) 272:263-267. Plasmid
pHR'-CMV-Neo was derived by substituting the BamHI-XhoI
fragment of pHR'-CMV-LacZ containing the E.coli LacZ gene
with a BamHI-XhoI fragment containing the neomycin
phosphotransferase gene of E.coli (Beck et al., Gene
(1982) 19:327-336).
pHR2 is a lentiviral transfer vector in which 124 base
pairs (bp) of nef sequences upstream of the 3' LTR in pHR
have been replaced with a polylinker both to reduce HIV-1
sequences and to facilitate transgene cloning. pHR2 was
derived from pHR'-CMV-LacZ by replacing the 4.6 kilobase
(kb) ClaI-StuI fragment with an 828 by ClaI-Stul fragment
generated by PCR using pHR'-CMV-LacZ as the template and
with the oligonucleotide primer, 5'-
CCATCGATCACGAGACTAGTCCTACGTATCCCCGGGGACGGGATCCGCGGAATTCC
GTTTAAGAC-3' (SEQ ID NO: ) and the primer 5'-
TTATAATGTCAAGGCCTCTC-3' (SEQ ID NO: ) in a three part
ligation with a 4.4 kb StuI-Ncol fragment and a 4.5 kb
NcoI-ClaI fragment from pHR'-CMV-LacZ.
Plasmid pHR2-PGK-GFP was derived by cloning the
XhoI-BamHI fragment of pRT43.3PGKF3 (WO 97/07225)
containing the human PGK promoter (GenBank Accession
number #M11958 nucleotides 2-516) and the BamHI-NotI
fragment of plasmid of pEGFPI (Clontech) containing a
codon usage-optimized and improved version of the Green
Fluorescent Protein (GFP) of A. victoria and a NotI-SacII
linker, into the Xhol and SacII sites of pHR2.
16
CA 02314683 2000-06-12
WO 99/30742 PCT/US98/25720
EB~mple 2
INHIBITION OF HIV-1 REPLICATION OF LYMPHOCYTES TRANSDUCED
BY THE LENTIVIRAL VECTOR
Human SupTi T-lymphoblastoid cells were obtained by
ATCC. Human CD4+ primary blood lymphocytes (PBL) were
separated from huffy coats from donations, stimulated with
2.5 ~g/ml phytohemagglutinin or Dynal beads coated with
OKT3 and CD28 antibodies for 2 days, then washed and
cultured with 100 U/ml of interleukin 2 (Chiron) in AIM-V
medium (Gibco). The SupTi cells or PBL were transduced
either with lentivector or a murine leukemia virus (MLV)
vector carrying the same transgene overnight in the
presence of 2 ug/ml polybrene, then washed and selected
for transgene expression after 48 hrs.
All vectors were produced by transient transaction of
293T cells and pseudotyped with the VSV.G envelope as
described previously (Naldini et al., Proc. Natl. Acad.
Sci. (1996) 93:11382-88). Cells transduced with vectors
carrying the neomycin resistance gene were selected in
medium containing 1 mg/ml 6418, then cultured in normal
medium for virus challenge. Cells transduced with vectors
carrying the green fluorescent protein (GFP) as transgene
were selected by cell sorting.
The cells were challenged with increasing amounts of
HIV virus. HIV-1 virions were produced either by 293T
cells transfected with the proviral infectious molecular
clone R8, or by SupTi cells chronically infected With R8
virus. R8 is a lymphocytotropic HIV-1 hybrid of the
HXB2-D and NL43 isolates that expresses all HIV reading
frames (Gallay et al., Cell (1995) 83:569-576). The virus
stock was titered on HeLa P4 cells and had an infectivity
of 1, 000 to 3, 000 infectious units/ng p24 . The cells were
washed twice after overnight incubation with the virus in
the presence of 2 ~Cg/ml polybrene, and further cultured
17
CA 02314683 2000-06-12
WO 99/30742 PCT/US98/25720
for up to 3 weeks. Every 3-4 days, the conditioned medium
was collected and HIV replication was determined by
accumulation of HIV-1 Gag p24 in the medium by a
commercially available ELISA kit (DuPont).
In the first experiment (see Figure 1) , SupTl cells
transduced by lentiviral vector carrying the neomycin
resistance gene, pHR'-CMV-Neo, were tested. HIV
accumulated in control non-transduced cultures. On the
other hand, in cells transduced by the lentiviral vector,
pHR2, HIV replication was detected only for the higher
amounts of HIV and p24 accumulation was decreased
dramatically and delayed. Similar results were obtained
with three different SupT1 populations selected after
transduction with the lentiviral vector at different
multiplicity of infection (M.O.I.). Moreover, no
cytopathic effect was observed in lentivector transduced
cells infected with up to 10 ng of HIV. In contrast, the
non-transduced cultures developed cytopathic effect with
all tested amounts of HIV.
The applicability of the inhibitory effect on HIV
growth to primary cells and its specificity for lentiviral
vectors were tested in another experiment (see Figure 2).
CD4+ PBL's were transduced with either lentivector
(pHR2-PGK-GFP) or the MLV retrovector carrying the same
GFP transgene driven by the human PGK promoter, and sorted
for transgene expression. The selected populations then
were challenged with HIV virus as described above. Both
the non-transduced cells (indicated in the figure by
diamonds) and sorted cells transduced by the MLV
retrovector (indicated by squares) yielded similar levels
of p24 antigen in the culture medium. However, the cells
transduced by the lentiviral (indicated by triangles)
yielded sharply reduced p24 even after inoculation with
high doses of HIV (100 ng p24 equivalent of virus).
Moreover, there were twice as many cells transduced by the
18
CA 02314683 2000-06-12
WO 99/30742 PCT/US98/25720
lentivector surviving 13 days after infection than those
transduced by the retrovector or non-transduced. In cells
transduced by the lentivector, transgene expression was
augmented significantly after infection with the HIV
virus.
All publications and patent applications cited in this
specification are herein incorporated by reference in
their entirety as if each individual publication or patent
application were specifically and individually indicated
to be incorporated by reference.
As will be apparent to those skilled in the art to
which the invention pertains, the present invention may be
embodied in forms other than those specifically disclosed
above, for example to transfect and transduce other
mammalian cell types, without departing from the spirit or
essential characteristics of the invention. The
particular embodiments of the invention described above,
are, therefore, to be considered as illustrative and not
restrictive. The scope of the present invention is as set
forth in the appended claims rather than being limited to
the examples contained in the foregoing description.
19
CA 02314683 2000-06-12
WO 99130742 PGTIUS98/25720
SEQUENCE LISTING
<110> Song, Jin-Ping
Naldini, Luigi
Cell Genesys
<120> THERAPEUTIC USE OF LENTIVIRAL VECTORS
<130> F126922
<140>
<141>
<150> 60/069,579
<151> 1997-12-12
<160> 2
<170> PatentIn Ver. 2.0
<210> 1
<211> 65
<212> DNA
<213> primer
<900> 1
ccatcgatca cgagactagt cctacgtatc cccggggacg ggatccgcgg aattccgttt 60
aagac 65
<210> 2
<211> 20
<212> DNA
<213> primer
<400> 2
ttataatgtc aaggcctctc 20
1
