Note : Les descriptions sont présentées dans la langue officielle dans laquelle elles ont été soumises.
CA 02318434 2000-06-22
wo ~r~zi~ Pcrms9arrms
THROMBOGENIC POLYPEPIIDE CHIMERAS AND CONJUGATES HAVING ACTIVITY DEPENDENT
UPON ASSO-
CIATION WITH TUMOR VASCULAR ENDOTHELIUM
FIELD OF THE INVENTION
The present invention relates to a novel strategy for the treatrnent of
carcinomas
and other solid tumors. In particular, the present invention relates to
methods which
modulate the function of endothelial cells associated with the tumor
vasculature, and
compounds useful therefor.
BACKGROUND OF THE IIWENTION
Even a cursory eacamination of cancer treatments demonstrates the need for
better, more efficacious treatment reagents and protocols. Although
significant
advances in therapy have been achieved during the past 25 years, few drugs
have been
discovered that have a truly major impact on the course of the disease.
Conventional
chemotherapy produces severe side effects that range from loss of hair to
debilitating
neurotoxicity. Furthermore, there has been little inroad into the discovery of
new
stzstegies to develop drugs that are mechanistically different and which may
present
better opportunities to intervene in the disease. Because cancers differ
greatly in their
causes and origins, drugs are not effective across a wide variety of cancers.
No single
drug has been shown to be capable of treating a wide spectrum of cancers.
Because of
2 o the complexity of the causes and origins of cancer, it has been difficult.
to devise a single
drug that will act on different cancers in diffemnt organ and tissue
locations, particularly
with solid tumors.
Solid tumors make up more than 90% of all human cancers. Yet, the delivery of
2 s drugs, antibodies and immunoconjugates to specific tumors has proven to be
inefficient
because pharmacological barriers exist that prevent the drugs from reaching
the tumor in
sufficient concentrations that they inhibit or destroy the tumor. To get
enough drug into
the tumor, high concentrations must be used and these produce unacceptable
toxicity to
CA 02318434 2000-06-22
wo ~r~im pcrius9sm~s
2
- the normal cells - side effects.
Then~pies that target tumor cells using tumor antigens are also often not
effective because tumors are heterogeneous, as evidenced by the lack of
specific so
called "tumor antigens" on all of the cells that constitute a tumor mass.
Tumor variants
may be produced continuously that may lack the target to which the drug is
directed.
Moreover, tumor cells can become resistant to many conventional drugs, even to
the
extent of developing pumps, such as glycoprotein gp170, to remove drugs from
the cell.
This and other types of heterogeneity are well-known and are of great concern
to
0 oncologists.
Solid tumors require a continuous supply of nutrients supplied by the
continual
formation of new blood vessels that are derived from older blood vessels. When
the
tumor mass (from metastasis, for example) reaches about 1 to 2 mm in diameter,
new
blood vessels must be established to support growth. This process is called
tumor
angiogenesis and represents a potential site for intervention and control of
tumor
proliferation and growth. The growth of new vessels is likely related to the
response of
endothelial cells to the presence of various growth factors, proteases,
metalloproteinases,
chemokines, cytokines, adhesion substructures, etc. that are produced by the
nearby
2 o tumor cells. Because of the influence of the tumor cells, the endothelial
cells within the
vessels that feed the tumor mass differ from other normal endothelial cell
surfaces in
normal tissues and organs. These differences can be detected by the cell
surface
characteristics found within the blood vessels of the tumor compared to those
found in
normal tissues and organs. In addition, tumors are known to be procoagulant -
patients
2 5 with cancer typically show evidence of hypercoagulability and may even
develop
thromboembolic disease.
An approach to the therapy of solid tumors is to employ high affinity
immunoconjugates that target the endothelium to coagulate the vasculature of
solid
3o tumors. See e.g., Huang et al. Science (1997) 275(5299):547-550. However,
there are a
number of disadvantages associated with such therapies. High amity targeting
CA 02318434 2000-06-22
WO 99/32143 PCT/US98J~'1498
3
- elements, such as antibodies, include the need for nearly absolute
specificity (i.e., the
target antigen may not be present on any normal tissue or toxicity will
result).
Unfortunately, however, few antigens truly are tumor-specific. Moreover, few
antigens
are found only on one type of tissue (i.e., the endothelial surface of blood
vessels).
Thus, this approach has limited applicability. For example, immunoconjugate
coagulants described previously will unlikely be found adequately selective,
effective
and safe for use in humans.
It is clear that novel approaches are required to improve the ability of
i o oncologists to successfiilly and safely eradicate or markedly regress
tumors in humans.
BRIEF DESCRIPTION OF THE INVENTION
In accordance with the pn~ent invention, a novel strategy has been devised
that
~ 5 clearly sets out and creates a new method of treating cancer patients.
Invention methods
and reagents represent an abrupt departure from conventional approaches of
therapeutically attacking tumors, which kill individual tumors on a cell-by-
cell basis.
Thus, in accordance with the present invention, a method of attacking solid
tumors has
been developed which employs compounds which modulate the functions of tumor-
2 o associated vascular endothelial cells. This strategy accomplishes global
killing of the
tumor by eliminating its nutritional supply. By restricting the flow of
nutrients that
feeds the individual cells comprising the tumor, the growth of the entire
tumor mass can
not be sustained, thus resulting in regression and even eradication of the
tumor by
necrosis.
BRIEF DESCRIPTION OF THE FIGURES
Figure I depicts the process of chemically conjugating a context-enhancing
substructure and a cysteine-containing spacer substructure-TF.
CA 02318434 2000-06-22
WO 99/32143 PCT/US98I~~498
9
Figure 2 depicts the process of employing a thioether production substrocture
to
produce a context-dependent functional entity.
Figure 3a presents a graph illustrating the effect on plasma half life by
antibody
s against Tissue Factor (TF).
Figure 3b presents a graph comparing Tissue Factor half life with Selective
Tumor Vasculature Thrombogen (STVT) half life.
~ o Figure 4 presents a graph illustrating the effect of differing
concentrations of
NV 124 (protein expressed from the E. coli expression plasmid NuV 124, see
Example
7) on tumor growth.
Figure 5 depicts a graph illustrating the improved pharmacological effect of
i s multiple infusions of NV 124 on tumor growth.
Figure 6 graphs the effects of NV 129 (protein expressed from the E. coli
expression plasmid NuV 129, see Example 11 ) infusions on C 1300 tumor growth.
2 o Figures 7 and 8 provide graphs illustrating the effects of NV 144 (protein
expressed from the E. coli expression plasmid NuV 144, see Example 12) on C
1300
tumor growth in comparison with the effects of saline on tumor growth.
DETAILED DESCRIPTION OF THE INVENTION
2s
The present invention provides novel single molecules having thrombogenic
properties and context-enhancing properties. These molecules are context-
dependent
functional entities (also referred herein as "Selective Tumor Vasculature
Thrombogen"
or "STVT") comprising substructures with thrombogenic potential and
3 o context-enhancing substructures having the ability to recognize (e.g.,
possessing
functional complementarity) desired biologically susceptible site{s). Context-
dependent
CA 02318434 2000-06-22
WO 99/32143 PCT/US98r17498
:functional entities are characterized as imparting thrombogenic activity when
positioned
(e.g., fi~nctionally complemented) in the fiinction-forming-context at the
biologically
susceptible site(s), while having substantially no thrombogenic activity
absent a
fimction-forming-context at the biologically susceptible site(s). In yet
another aspect of
s the present embodiment, the context-dependent fiulctional entity transiently
imparts
activity upon formation of a transient fiuiction-forming-context at the
biologically
susceptible site(s).
As used herein, "substructure with thrombogenic potential" refers to one or
more
i o thrombosis promoting peptidyl, oligopeptidyl, protein or small organic
molecule (e.g.,
medicinal compounds), that has the ability to selectively impart thrombogenic
activity
when positioned (fimctionally complemented) in a fimction-forming-context at a
biologically susceptible site(s). The phrase "thrombogenic potential" refers
to the ability
of such substructures to selectively im~rt thrombogenic activity when
localized and
~ 5 oriented in a complementary function-forming-context at a biologically
susceptible
sites) so as to result in thrombogenic activity. In a preferred aspect of the
present
embodiment, substn~chues with thmmbogenic potential include one or more
domains or
modules of coagulation factors. Exemplary coagulation factors include
fibrinogen,
prothrombin, tissue factor ('TF), factor V, factor VII through factor XIII (in
addition to
2 o their activated states), von Willebrand factor, tissue plasminogen
activator (tPA),
streptokinase, staphylokinase, urokinase, eminase, factor C, Mac-1, EPR-1,
venom-derived coagulation enzymes (e.g., Russell's viper venom), cellular
enzymes
(e.g., grarlzymes), and the like. Preferred coagulation factors include those
involved in
the coagulation promoting pathways including TF, factor V, factor VII, factor
VIII,
2 5 factor IX, factor X, factor XI, activated states of such factors,
combinations of co-factors
(i.e., TF:factor VI1/VIIa, factors VIIIa:IXa, factors Va:Xa), and the like.
As used herein, the phrase "thrombogenic activity" refers to the selective
initiation, promotion, activation and/or propagation of occlusive thrombosis
(either
3 o partial or complete, transient or prolonged) at biologically susceptible
site(s). A
preferred thrombogenic activity includes the function of a coagulation factor
to activate
CA 02318434 2000-06-22
WO 99l3Zi43 PGTNS9827498
6
or provide co-factor function for other coagulation factors in a systematic
and limited
proteolytic sequence (i.e., limited proteolytic cleavage to activate
coagulation factors) at
a biologically susceptible site(s). Examples of thrombogenic activity include
conversion
of factor VII to factor VIIa, factor IX to factor IXa, factor X to factor Xa,
prothrombin to
s thrombin, and the like.
As used herein, the phrase "occlusive thrombosis" refers to the specific and
selective formation of a mass of blood elements (i.e., thrombus) that
partially or
completely, transiently or for a prolonged period obstructs blood flow at
biologically
i o susceptible site(s). Occlusive thrombosis, as contemplated by the present
invention,
would result in therapeutic activation of coagulation on biologically
susceptible sites}
(i.e., selected endothelial cells), by formation of an occlusive thrombus to
markedly
reduce or even cease blood flow both upstream and downstream of the blockage
as far
as the points where the thrombosed vascular channel anastomoses with another,
~5 unaffected vessel (Danekamp et al. (1984) Prog Appl Microcir 4:28-38).
Thus,
selective and specific occlusive thrombosis results in hypoxic cell death and
ischemic
necrosis of cells nourished by the affected blood vessels.
A preferred substructure with thrombogenic potential is modified or wild-type
2 o tissue factor (TF), preferably of human derivation. As used herein,
"modified or
wild-type tissue factor (Tl~" is a soluble TF, that in combination with factor
VII, can
selectively activate or initiate occlusive thrombosis only when positioned in
the proper
function-forming context at biologically susceptible site(s), i.e., by
conversion of factor
X to Xa and factor IX to IXa Preferably, the modified or wild-type TF retains
the
2 5 capacity to induce factor VII/VIIa-dependent coagulation. As used herein,
"modified
TF" refers to truncated or native TF wherein one or more amino acids have been
substituted, modified, added and/or deleted and in which carbohydrate moieties
are
present, absent or modified.
s o Exemplary TFs include soluble forms of TF which consist essentially of the
extracellular domain of wild-type TF (as described in Edgington et al., Patent
No.
CA 02318434 2000-06-22
WO 99/32143 PCT/US98/Z7498
7
- 5,110,730 (1992)), and do not contain portions of the transmembrane anchor
region (i.e.,
TF 220-242, or amino acid residues 252 through 274 of SEQ ID NO:1 ) which
anchors
native TF to the cell membrane. Preferably, the TF comprises substantially the
amino-terminal amino acids up to approximately residue 252 of SEQ ID NO:1.
More
s preferably, the modified TF has substantially the same amino acid sequence
as TF 3-211
(as set forth in residue nos. 35-243 of SEQ ID NO:1). In the presently most
prefen~ed
embodiment of the present invention, the modified TF is modified or further
modified to
increase thrombogenic activity when placed or oriented in the function-forming-
context
at a biologically susceptible site(s). Such modifications include substituting
the amino
to acid residue at one or more positions, e.g., TF 167 or position 199 of SEQ
ID NO:1, as
well as residues within 15 Angstrom of TF 167 or residue 199 of SEQ ID NO:1,
with a
basic amino acid such as lysine, arginine, histidine, and the like.
As used herein, the term "purified" means that the molecule is substantially
fi~ee
i5 of contaminants normally associated with a native or natlual environment.
TF protein,
or functional fi~nents thereof, useful in the practice of the present
invention, can be
obtained by a number of methods, e.g., precipitation, gel filtration, ion-
exchange,
reversed-phase, DNA affinity chromatography, and the like. Other well-known
methods are described in Deutscher et al., Guide to Protein Purification:
Methods in
2 o Enzymology Vol. 182, (Academic Press, 1990), which is incorporated herein
by
reference.
TF, and biologically active fiagments thereof, useful in the practice of the
present invention can also be produced by chemical synthesis. Synthetic
polypeptides
2s can be produced, for example, using Applied Biosystems, Inc. Model 430A or
431A
automatic polypeptide synthesizer and chemist<y provided by the manufacturer.
TF,
and biologically active fi~agments thereof, can also be isolated directly from
cells which
have been transformed with the expression vectors described below in more
detail.
Alternatively, a purified TF, or functional fi~agment thereof, usefi~l in the
practice
of the present invention, can also be obtained by well-known recombinant
methods as
CA 02318434 2000-06-22
WO 99/32143 PGTNS98/Z'1498
8
- described, for example, in Ausubel et al., Current Protocols in Molecular
Biology
(Greene Publishing Associates, Inc. and John Wiley & Sons, Inc. (1993)), also
incorporated herein by reference. An example of r~;ombinant means to prepare
modified or wild-type TF is to express nucleic acid encoding TF, or functional
fragment
thereof, in a suitable host cell, such as a bacterial, yeast (e.g.,
Saccharomyces or Pichia),
insect (e.g., Baculovirus or Drosophila) or mammalian cell, using methods well
known
in the art, and recovering the expressed protein, again using methods well
known in the
art. Thus, one embodiment of the present invention includes nucleic acid
consisting
essentially of the nucleic acid sequence as set forth in SEQ ID NO:1 from
about position
130 at the 5' terminus to about position 918 at its 3' terminus. Preferably,
the last about
one hundred fifty bases are not employed. Thus, nucleic acid encoding the
soluble form
of TF is contemplated, in a prefen-ed aspect, i.e., a nucleic acid segment
consisting
essentially of the nucleotide sequence from about position 178 to about 804 as
set forth
in SEQ ID NO:1.
As defined herein, the phrase "context-enha~ing substrucriu~e" refers to one
or
more peptidyl, oligopeptidyl, protein, or small organic molecule (e.g.,
medicinal
compounds) that enhances thrombogenic activity, and further enhances
selectivity by
positioning the context-dependent functional entity in a desired context at
the
2 o biologically susceptible site(s). As used herein, the phrase "having the
ability to
recognize desired biologically susceptible site(s)" refers to the ability or
capacity of the
context-enhancing substructure to exhibit elements of specificity and
selectivity for the
biologically susceptible site(s). Preferably, the context enhancing
substructure will have
a low affinity for the desired biologically susceptible sites) so as to
transiently activate
2 5 the thrombogenic potential of the context-dependent functional entity. The
context-enhancing substructure does not contain any substantial portion of any
transmembrane region, antibody, or the like, which will anchor or permanently
and/or
irreversibly associate the context-dependent functional entity to the
biologically
susceptible site(s).
CA 02318434 2000-06-22
WO 99/32143 PGT/US98n7498
9
- The function of the context-enhancing substructure is to provide transient
orientation and transient localization of the thrombogenic substructiue to
preferred
biological susceptible sites. Exemplary context-enhancing substructures
include cell
surface recognition domains (i.e., from annexin), charged phospholipid-
associating
elements, protease inhibitors, peptidyl sequences that facilitate orientation
and/or small
molecules that recognize molecules or molecular assemblies enriched in tumor
vasculature endothelium (e.g., all, part or modified growth factor, ligand,
hormone, or
lectin which have transient functional association properties so as to only
transiently
activate the thmmbogenic potential of the context-dependent functional
entity), and the
i o like. Specific examples of context-enhancing substructures include uPAR
binding
antagonists (e.g., peptide%lone 20 (1994) Goodson et al. PNAS 91:7129-7133),
anti-angiogenic proteins ((e.g., endostatin from collagen XVIII 20kD C-
teZminus,
(1997) O'Reilly et al. Cell 88(2):277-285; nucleotide sequences 1502 to 2053
from
genbank I3IJMCOL18AX ACCESSION L22548), peptides derived from TSP-1 (e.g.,
5 MaIIII from (1993) J Cell Biol 22:497-51 I; peptide 246, (1992) PNAS 89:3040-
3044;
Laminin binding peptides (e.g., Peptide G, Guo et al. (1992) J Biol Chem
267:17743-17747; Proliferin (PLF, (1988) J Biol Chem 263(7):3521-3527,
Proliferin-related-peptide (PRP, (1988) Mol Endocrinol 2(6):579-586 ,
membrane-binding peptide from factor VIII, (1995) Biochemistry 34(9):3022-
3031,
2 o single or multiple kringle domains (e.g., kringle 1 from plasrninogen (
1991 )
Biochemistry 30(7): 1948-1957; angiostatin, 1994 Cell 79(2):315-328,
respectively, or
fragments thereof (e.g., Pm Arg Lys Leu Tyr Asp), phosphatidyl-serine binding
proteins
(eg. annexin V J.Biol. Chem. 1995 270:21594-21599), and the like. Other
context-enhancing substructures can be readily identified employing such well
known
2 s methods such as phage display searches of peptide and constrained peptide
combinatorial libraries (See, e.g., Ruoslahti et al., U.S. Patent No.
5,622,699 (1997) and
Ruoslahti et al., U.S. Patent No. 5,206,347 (1990), Scott and Smith (1990)
Science
249:386-390, Markland et al (1991) Gene 109:13-19), and the like.
s o As defined herein, the phrase "biologically susceptible site(s)" refers to
one or
more molecules found at the cell surface, unique to, induced or up-regulated
in, vascular
CA 02318434 2000-06-22
WO 99/32143 PCT/US98l17498
- endothelial cells in human tumors. Progressive tumor growth necessitates the
development of new blood vessels (angiogenesis) to meet the nutritional needs
of the
expanding tumor mass. Numerous anatomical, morphological and behavioral
differences between tumor-associated blood vessels and normal ones have been
s documented (See, e.g., Dvorak et al. (1991) Cancer Cells 3:77-85, Jain
(1988) Cancer
Res 48:2641-2658, and Denekamp (1990) Cancer Metast Rev 9:267-282).
Preferably,
the invention context-dependent functional entity recognizes these differences
as sites in
which to selectively initiate, promote, activate and/or propagate occlusive
thrombosis.
1 o Examples of biologically susceptible sites include vascular structures,
specific
cells or tissue types associated with cancer and/or angiogenesis, wounds
caused by
tratuna, and other vascular pathologies, such as sites of infection by fungal,
bacterial or
viral agents. Additionally, examples of biologically susceptible sites include
such
structures, tissues and/or cells which are recognized by the context-enhancing
1 s substructure. In the case of cancer, the biologically susceptible sites)
recognized by the
context-dependent functional entity should preferably be molecules) on the
cell surface
of the tumor-associated endothelial cells and one that is not secreted into
body fluids.
Preferred biologically susceptible sites) for which the context-enhancing
substructure
has a functional preference include tumor-associated vascular endothelial
cells. Those
of skill in the art can readily determine other biologically susceptible
sites) which are
contemplated for formation of a function-forming-context by the context-
dependent
functional entity employed.
As used herein, the phrase "function-forming-context" refers to the necessary
2 5 orientation and position of the context-dependent functional entity to
impart
thrombogenic activity at the biologically susceptible site(s). The function-
forming
context will depend on numerous factors including the orientation and position
of the
context-enhancing substructure relative to the substructure with thrombogenic
potential.
Thus, the context-enhancing substructure can be positioned at the carboxy
terminus of
s o the substruchue with thrombogenic potential, the amino terminus of the
substructure
with thrombogenic potential, or between the amino terminus and the carboxy
terminus
CA 02318434 2000-06-22
wo ~r~im Pcriusssn~4ss
m
- of the substructure with thmmbogenic potential (i.e., inserted within a
hydrophilic
surface loop of the substructure with thrombogenic potential). In a preferred
embodiment of the present invention, the context-dependent functional entity
comprises
two or more context-enhancing substructures to enhance proper or desired
alignment of
the substructure with thrombogenic potential at the biologically susceptible
site(s).
Thus, the context-enhancing substructures) is(are) located at the carboxy
terminus of
the substructure with thrombogenic potential, the amino terminus of the
subsr<uctwe
with thrombogenic potential, between the amino terminus and the carboxy
terminus of
the substructure with thrombogenic potential, inserted in a hydrophilic
surface loop of
1 o the substructure with thrombogenic potential, or any combinations thereof.
In yet another embodiment of the present invention, context-dependent
functional entities fiuther comprise activity-modulating substructure(s). As
used herein,
the term "activity-modulating substructure" refers to one or more molecules
which
i 5 enhance the function-forming context by properly orienting and/or
positioning the
context-enhancing substructure relative to the substructure with thrombogenic
potential
(e.g., configuration of the active sites of each substructure, the relative
distance between
the substructures, and the like). Examples of activity modulating
substructures include
spacer substmch>ms, protease sites, and the like.
As used herein, the term "spacer substructure" refers to one or more spacer
molecules that serve to link substruct<mes with thrombogenic potential with
context-enhancing substructures. The nature of the linkage between the spacer
substructure and either the subst<uctule(s) with thrombogenic potential or the
2 s context-enhancing subst<ucture(s) depends on the functionality employed in
the
substructures with thrombogenic potential and the context-enhancing
substivctures.
Preferably, substructures with thrombogenic potential are linked to context-
enhancing
substz~uctures in a manner that retains the ability of the context-dependent
functional
entity to activate the substructure with thrombogenic potential. Typically,
spacer
3 o substructures are non-immunogenic and flexible and fall in the range of
about 0 to about
60 residues long, preferably about 10 amino acid residues.
CA 02318434 2000-06-22
WO 99/32143 PCT/U898IZ~498
12
- In a prefenred embodiment of the present invention, the spacer substnu~hue
increases degradation of the context-dependent functional entity by releasing
the
substructure with thrombogenic potential from the context-enhancing
substructure.
Preferably, such spacer substructures include those spacer molecules which are
subject
to scission when the context-dependent functional entity is extracellularly
positioned in
the function-forming-comext with cell surfaces at the biologically susceptible
site,
subjecting the spacer to degradation upon exposure to a specific enzyme.
Examples of
bonds within spacer molecules include esters, peptides, amides,
phosphodiesters, and
even glycosidic bonds, which are hydrolysed by exposure to an esterase,
protease or
1 o peptidase, amidase, phosphodiesterase and glycosidase, respectively.
Preferred
context-dependent functional entities will have cysteine residues native to
the spacer
molecule replaced by glycine, alanine or serine. Preferred context-dependent
functional
entities can be engineered so that they are hydrolysed only by exposure to an
enzyme
known to have a precise cellular location, including enzymes associated with
the
vascular endothelial surface. Cleavage of the spacer substructure provides a
safety
factor by limiting the lifetime of the intact context-dependent functional
entity at the
biologically susceptible sites) andlor irreversibly inactivating the context-
dependent
functional entity, thus preventing dissemination of native thrombogens or
access of
additional entities to biologically susceptible site(s).
In a preferred embodiment of the present invention, the spacer substructure
comprises homo- or hetero-bifunctional crosslinking agents or chitin
oligomers.
Exemplary spacer substtuctu~~es include combinations of Gly and Ser modules,
such as
((Gly)4Ser)", ((Ser)4G1Y~" and the like. Additional spacer substructm~es
contemplated
2 5 are the hinge region of the heavy chain of immunoglobulin (Ig) proteins,
preferably the
H chain IgD sequences. Ig hinge regions have flexibility that allows the
different
domains in immunoglobulins to assume different geometries and orientations.
Immunoglobulin hinge regions (see, e.g., Kabat et al. Seguences of Proteins of
Immunological Interest, 5 Ed., U.S. Dept. of Human Health Services) may be
used as
3 o spacers in thrombogens. Examples of hinge regions that may be back
converted to their
respective DNA sequences obtained from conventional databases and repositories
of
CA 02318434 2000-06-22
WO 99I3Z143 PCTN598/Z9498
13
- protein and nucleic acid sequences include Human IgD'd, Human IgG 3'Cl,
Human Iggl
aeCl, Human IgG eeCl, Human IGG2 a;Cl, Human Igg4 aeCl, and the like (See
ICabat et
al.; page 670). The cysteine residues of such hinge regions may be substituted
by
glycine, alanine, or serine in any combination to eliminate di~culties
presented by the
presence of particular cysteine thiol groups that may disrupt spacer structure
or inhibit
proper formation of tertiary structure of the subst<uctiwe with thrombogenic
potential.
Alternatively, the present invention provides for the creation of protease
sensitive sites to cleave and/or reduce activity (or inactivate) of the
context-dependent
functional entity after the context-dependent functional entity has performed
its desired
activity. Context-dependent functional entities comprising protease sensitive
sites can
be synthesized or manufactured employing methods well known to those of skill
in the
art (e.g., recombinant or chemical manufacture of integrating protease
sensitive sites).
15 In yet another embodiment of the present invention, context-dependent
functional entities further comprise production substlvcture(s). As used
herein, the term
"production substructure" refers to one or more substructural aspects which
facilitate the
production and/or assembly of the context-dependent functional entity.
Examples of
production substructtues include restriction sites, vectors, cys residues, His-
tags, and the
2 0 like.
Restriction enzyme sites can be optionally introduced to the contextdependent
functional entity, as well as the individual subst<uctures that comprise the
context-dependent functional entity (i.e., substtuchne(s) with thrombogenic
potential,
25 context enhancing substiuctiwe(s), activity-modulating substructures)
and/or cloning
cassette) by additions, deletions, substitutions or modifications made at
nucleic acid
sequences encoding the amino-ternlinal, the carboxyl terminal and/or sequences
in
between to produce the function-foaming context. Unique restriction sites may
be
placed for the convenience of constricting a context-dependent functional
entity(ies)
3o with different orientations and configurations, i.e., different
combinations of the
individual substructures. Unique restriction sites at the junctions of each of
these
CA 02318434 2000-06-22
WO 99/32143 PGT/US98n7498
19
- individual substructures can be used to clone various subtypes of the
individual
substructures (for example, spacer substructures of different lengths and
compositions).
Examples of such modifications include placement of a specific amino acid
residue at
position 212 of TF or position 245 as set forth in SEQ ID NO:1, preferably a
threonine,
to yield a restriction site favorable to splicing with a spacer substructure
and/or a
context-enhancing substructure. The sequences that are presented are the
subtypes of
the functional substruchu~es without restriction sites. Examples of
restriction sites that
are prefen~ed include Xmas (CCCGGG), BamHI (GGATCC), KpnI (GGTACC),
HindIII (AAGCTT), Aval (CCCGGG), EcoRI (GAATTC), AvrII (CCTAGG), or PmII
l o (CACGTG), and the like. Specific prefenred examples of context-dependent
functional
entity(ies) constructs are provided (e.g., SEQ ID NOs: 6, 12,15, 24 and 31).
Alternatively, the individual substructures can be conjugated chemically via
production substructures to produce the context-dependent functional entity
with the
preferred fimction-forming-context. Preferred chemical conjugations of the
individual
substructures use cysteine as a production substructure to link the
substructures. The
cysteine thiol group provides a convenient site at which chemical links may be
established, links that may be reducible (disulfide bonds) or stable
(thioether). Context
enhancing substructiue(s) and/or activity-modulating substructures) that
contain a
2 o cysteine residue production substructure can be coupled to substxucture(s)
with
thrombogenic potential through the cysteine. A peptide that may act as a
context
enhancing substruc>ure(s) and/or activity-modulating subshvcture(s) may be
modified
to contain a cysteine production substructure at its amino terminus, its
carboxy terminus,
or at a site between the amino and carboxy terminus. Examples of each
modification in
2 s a disulfide bond constrained peptide ( 1 ) are illustrated schematically
in Figure 1. The
preferred modification does not reduce the ability of the context enhancing
substructures) and/or activity modulating subs>ructure(s) to facilitate the
thrombogenic
activity of the final construct.
3 o An activity-modulating substructure containing a cysteine production
substructure at or near the amino terminus, or at any site within an activity-
modulating
CA 02318434 2000-06-22
WO 99/32143 PCT/US98JZ7498
substructiue, can be constructed synthetically and fused to the substructw~e
with
thrombogenic potential. For example, an activity-modulating substructure of
the
following sequence may be const<ucted between a KpnI and XmaI site:
5 GSCGGGGSGGGGSGGGGSP (SEQ ID N0:2)
The cysteine in this example is place at residue number 3 when numbering from
the
amino terminus. It is possible, however, to place the cysteine at residue
number 1 or 2 if
desired. However, a thrombin-sensitive sequence such as PRG must be retained
in order
i o to efficiently cleave the resulting protein with thrombin. Other peptides
inserted
between the hexahistidine sequence and the beginning of the substructure with
thrombogenic potential may be used in the construct, which would necessitate
the use of
a different erlzyme(s), known to those of skill in the art, to cleave and
release the
substructure with thrombogenic potential during its purification. The cysteine
thiol of
i 5 the substructure with thrombogenic substructure and the cysteine thiol of
cysteine-containing activity-modulating substructure may also be linked by
thioether
bonds using bismaleimido groups such as that of BMH, bismaleimidohexane.
Other methods of cross linking proteins using N-hydroxysuccinimide
(NHS)-ester haloacetyl cross linkers, photoreactive cross linkers, and the
like that may
be useful in establishing the desired bonds between facilitators and the
substNCture with
thrombogenic potential are known to those of skill in the art (see Figure 2).
Such
chemistry is described in the Pierce Chemical Co. catalogue and in Chemistry
of Protein
Conjugation and Cross-linking by S.S. Wong, CRC Press, 1991, which are
incorporated
2 5 herein by reference.
Context-dependent functional entity, as well as the individual substructures
that
comprise the context-dependent functional entity (i.e., substructure(s) with
thrombogenic potential, context enhancing substructure(s), activity modulating
s o substructures) and/or production substructure) useful in the practice of
the present
invention, can be obtained by a number of methods, e.g., solid-phase,
precipitation, gel
CA 02318434 2000-06-22
WO 99/32143 PCTNS98/Z9498
16
filtration, ion-exchange, reversed-phase, DNA at~nity chromatography, and the
like.
Other well-known methods are described in Deutscher et al., Guide to Protein
Purification: Methods in Enzyarology Vol. 182, (Academic Press, 1990), which
is
incorporated herein by reference. Alternatively, context-dependent functional
s entity(ies), as well as the individual substructures thereof, can also be
obtained by
well-known recombinant methods as described, for example, in Ausubel et al.,
Current
Protocols in Molecular Biology (Greene Publishing Associates, Inc. and John
Wiley &
Sons, Inc. 1993), also incorporated herein by reference. An example of
recombinant
means to prepare context-dependent functional entity, or the individual
substnrcnrres, is
1 o to express nucleic acid encoding such entity and/or substructures)
thereof, in a suitable
host cell, such as a bacterial, yeast {e.g., Pichia), insect (e.g.,
Baculovirus) or
mammalian cell, using methods well known in the art, and recovering the
expressed
protein, again using methods well known in the art.
15 Context-dependent functional entity, as well as the individual
substructures
thereof, useful in the practice of the present invention can also be produced
by chemical
synthesis (see, e.g., Meyers, Molecular Biology and Biotechnology: A
Comprehensive
Desk Reference, VCH Publishers (1995)). Synthetic polypeptides can be
produced, for
example, using Applied Biosystems, Inc. Model 430A or 431A automatic
polypeptide
z o synthesizer and chemistry provided by the manufacturer. In addition,
synthetic
polypeptides can be produced by solid phase peptide synthesis employing a
range of
solid supports. Examples of solid supports available include those based on
polyamides,
polyethelene glycol (PEG) resins, and the like. Context-dependent fimctional
entity, as
well as the individual substruct<wes thereof can also be isolated directly
finm cells
2 s which have been transformed with the expression vectors described below in
more
detail.
Alternatively, noncovalent links can be established to link the individual
substructures together to form an assembly-dependent functional entity. For
example,
3 0 leucine zippers are preferably used to hold together, by noncovalent
interaction, the
substnrctuze with thmmbogenic potential with the context-enhancing
substructure to
CA 02318434 2000-06-22
WO 99/32143 PCT/US98127498
17
fore an entity with thrombogenic potential.
In a preferred embodiment of the present invention, the context-dependent
functional entity, as well as the individual substructures thereof, is
modified to reduce
immunogenicity and/or modify biological half life. Such modifications include
employing polyethelene glycol (PEG), and the like.
In yet another embodiment of the present invention, the context-dependent
functional entity further comprises a cloning cassette. As used herein, the
phrase
"cloning cassette" refers to one or more additional substructural elements
which
facilitate orientation of the context-dependent fimctional entity on the
biologically
susceptible sites) or to add synergistic fimctions. Preferably, cloning
cassettes)
contemplated for inclusion into the context-dependent functional entity will
be inserted
into a permissive hydrophilic loop of the context-dependent finictional entity
which
does not adversely affect thrombogenic activity. The specific region replaced
or
inserted within will depend on the size and function of the cloning cassette
desired, the
sequence which imparts thrombogenic potential employed, and the like. Examples
of
amino acid residues which can be replaced include amino acid residues finm
about 112
to about 123, preferably from about 115-123, of human TF as set forth in SEQ
ID NO:1.
2o Direct loop replacements can be made from about 1-30 amino acids,
preferably 12-20
amino acids, so long as the entity retains thrombogenic activity. As used
herein, the
phrase "synergistic fiuiction" refers to functions which enhance the
thrombogenic
function of the substructure with thrombogenic potential or enhance the
function of the
context-enhancing subst<vcriue to orient the context-dependent functional
entity in a
2 5 function-fon~.ming-context at the biologically susceptible site(s). Those
of skill in the art
can readily determine exemplary cloning cassettes which can be employed in the
invention entity, including cloning cassettes identified from combinatorial
libraries.
In another prefen~ed embodiment of the present invention, there are provided
3o compositions comprising context-dependent functional entities in
combination with
coagulation factor VIIa. Binding of factor VIIa to TF enhances the enzymatic
activation
CA 02318434 2000-06-22
WO 99/32143 PCTNS98IZ7498
18
of substrate factors IX and X as much as 5,000 fold (Rao et a1 (1988) PNAS
85:6687).
Factor VII can be prepared as described by Fair (1983) Blood 62:784-791.
Recombinant Factor VIIa can be purchased from Novo Biolabs (Danbury, Conn.).
s In yet another aspect of the present invention, nucleic acid constructs
encoding
the invention context-dependent functional entity are provided. In accordance
with the
methods of the present invention, an effective amount of the context-dependent
functional entity can be administered in vivo as a therapeutic agent to
selectively result
in partial or complete occlusive thrombosis of the vasculature of solid tumors
in a
to subject in need thereof. The context-dependent functional entity can be
administered to
the subject by any means which readily permits the context-dependent
functional entity
to function at biologically susceptible sites) including intraperitoneal,
subcutaneous,
intravascular, intramuscular, intranasal or intravenous injection or
infiision, implant
modes of administration, and the like. In another embodiment of the present
invention,
1 s the context-dependent functional entity is supplied indirectly by
administering a nucleic
acid segment encoding same to the subject.
As used herein, the phrase "the vasculature of solid tumors" refers to
endothelial
lined vascular channels of the tumor and existing vasculature adopted by
invading tumor
2 o cells. Examples of tumors, also referred to herein as vascular tumors
(tumors of the
vasculature as well as vascular malformations), which are contemplated to be h
include solid tumors such as breast, prostrate, lung, liver, colon, rectal,
melanoma,
kidney, stomach, pancreas, ovarian, bladder, cervical, oral, uteri, brain, and
the like.
2 5 In another embodiment of the present invention, there are provided methods
for
obliterating vasculature malformations by administering to a subject an
effective amount
of the context-dependent functional entity, alone or in conjunction with aids
such as
coagulation factors, drugs, local hypertherniia, and the like. As used herein,
the phrase
"obliterating vasculature malformations" refers to the partial or complete
occlusive
s o thrombosis of malformations derived from or influenced by blood vessels
and/or
structures. Examples of vasculature malformations include hemangiomas,
preferably
CA 02318434 2000-06-22
WO 99/32143 PCTNS981s7498
19
w inoperable hemangiomas, aneurisms, granulomas, and the like.
Those skilled in the art will appreciate that when the compositions of the
present
invention are administered as therapeutic agents, it may be necessary to
combine the
content-dependent functional entities with a suitable pharmaceutical carrier.
The choice
of pharmaceutical carrier and the preparation of the context-dependent
functional entity
as a therapeutic agent will depend on the intended use and mode of
administration.
Suitable formulations and methods of administration of therapeutic agents can
be readily
be determined by those of skill in the art, including rendering the content-
dependent
1 o functional entity amenable to oral delivery, intravenous delivery,
intramuscular delivery,
topical delivery, nasal delivery, and the like.
Depending on the mode of delivery employed, the context-dependent functional
entity can be delivered in a variety of pharmaceutically acceptable forms. For
example,
1 s the context-dependent functional entity can be delivered in the form of a
solid, solution,
emulsion, dispersion, micelle, liposome, and the like.
Pharmaceutical compositions of the present invention can be used in the form
of
a solid, a solution, an emulsion, a dispersion, a micelle, a liposome, and the
like,
2 o wherein the resulting composition contains one or more of the compounds of
the present
invention, as an active ingredient, in admixture with an organic or inorganic
carrier or
excipient suitable for enteral or parenteral applications. The active
ingredient may be
compounded, for example, with the usual non-toxic, pharmaceutically acceptable
carriers for tablets, pellets, capsules, suppositories, solutions, emulsions,
suspensions,
2 5 and any other form suitable for use. The carriers which can be used
include glucose,
lactose, mannose, gum acacia, gelatin, mannitol, starch paste, magnesium
trisilicate,
talc, com starch, keratin, colloidal silica, potato starch, urea, medium chain
length
triglycerides, dextrans, and other carriers suitable for use in manufacturing
preparations,
in solid, semisolid, or liquid form. In addition auxiliary, stabilizing,
thickening and
s o coloring agents and perfumes may be used. Examples of a stabilizing dry
agent includes
triulose, preferably at concentrations of 0.1% or greater (See, e.g., U.S.
Patent No.
CA 02318434 2000-06-22
WO 99/32143 PCT/US98/27498
- 5,314,695). The active compound (i.e., context-dependent functional entity)
is included
in the pharmaceutical composition in an amount sufficient to produce the
desired effect
upon the processes or condition of diseases.
The pharmaceutical compositions may be in the form of a sterile injectable
suspension. This suspension may be formulated according to known methods using
suitable dispersing or wetting agents and suspending agents. The sterile
injectable
preparation may also be a sterile injectable solution or suspension in a non-
toxic
parenterally-acceptable diluent or solvent, for example, as a solution in 1,3-
butanediol.
i o Sterile, f xed oils are conventionally employed as a solvent or suspending
medium. For
this purpose any bland fixed oil may be employed including synthetic mono- or
diglycerides, fatty acids (including oleic acid), naturally occurring
vegetable oils like
sesame oil, coconut oil, peanut oil, cottonseed oil, etc., or synthetic fatty
vehicles like
ethyl oleate, or the like. Buffers, preservatives, antioxidants, and the like
can be
incorporated as required.
One particularly preferred method for delivering the context-dependent
functional entity is intravascularly to the selected vascular site via a small
diameter
medical catheter. When delivered by catheter, the injection rate will depend
on a
2 o number of variables, including the concentration of the active ingredient,
the specific
substructures employed, the rate of precipitation (formation of the thrombus),
total
volume of the vasculature to be thrombosed, location of the biologically
susceptible
site(s), toxicity, side effects, and the like. When introduced into the
vascular site, the
context-dependent functional entity diffuses rapidly into the blood and
initiates
2 s occlusive thrombosis specifically at the biologically susceptible site(s).
The dosage regimen necessary depends on a variety of factors, including type
of
disorder, age, weight, sex and medical condition of the patient, as well as
the severity of
the pathology, the route of administration, and the type of then~peutic agent
used. A
3 o skilled physician or veterinarian can readily determine and prescribe the
effective
amount of the context-dependent functional entity or pharmaceutical required
to treat
CA 02318434 2000-06-22
WO 99/32143 PCTNS98/I7498
21
- the patient. Conventionally, those of skill in the art would employ
relatively low doses
initially and subsequently increase the dose until a maximum response is
obtained.
Typical daily doses, in general, lie within the range of from about 1 pg up to
about 100 mg per kg body weight, and, preferably within the range of from 50
pg to 10
mg per kg body weight and can be administered up to four times daily. The
daily N
dose lies within the range of from about 1 ~,g to about 100 mg per kg body
weight, and,
preferably, within the range of from 10 ~g to 10 mg per kg body weight.
to
In yet another embodiment of the present invention, there are provided
assembly-dependent functional complexes comprising substructures with
thrombogenic
potential and one or more association-enhancing substructures having the
ability to
transiently associate the complexes to increase local concentration at desired
biologically susceptible site(s), wherein the complexes impart thrombogenic
activity
when positioned in the function-forming-context at the biologically
susceptible site(s),
and wherein such complexes have substantially no thrombogenic activity absent
a
fimction-forming-context at the biologically susceptible site(s). In a
preferred
embodiment of the present invention the complex transiently becomes functional
upon
2 o association of a functional context with the biologically susceptible
site(s).
Exemplary substructures with thrombogenic potential comprise a thrombogen,
preferably modified or wild-type TF. Exemplary association-enhancing
substructures
assemble the complex in a function-forming context.
The invention will now be described in greater detail by reference to the
following non-limiting examples.
CA 02318434 2000-06-22
WO 99/32143 PCTNS98IZ9498
22
- Example 1
PCR of TF cDNA
PCR is performed to amplify a DNA fiag<nent of 639 use pairs from a
Marathon-Ready cDNA of human placenta origin (Clontech:(97/98 cat.#7411-1). A
100 ~L reaction contains: 2 ~L cDNA mixture, 100 pmoles each of oligos BM21
and
BM33 (SEQ ID N0:3 and SEQ ID N0:4 (Oligos Etc.)), buffer, BSA, MgS04 according
to manufacturer, 1 pL IOmM dNTPs and 2 units of Vent DNA polymerase (New
England Biolabs 96/97 cat.#254S) which is added during the first cycle after
the
1 o temperature reaches 94°C.
The thermocycling is accomplished with 35 cycles of denaturation for 1 min at
94°C, primer annealing for 1 min at 60°C, and primer extension
for 1 min at 75°C. The
PCR product is about 640 base pairs in length. This DNA fiagment is purified
by
electrophoretic separation on a 1.0% agarose gel buffered with Tris-Borate-
EDTA
according to Maniatis, excision of the appropriate band, and extraction of the
DNA
using the QIAEX II gel extraction kit (QIAGEN cat#20051 ) according to
manufacturer's instructions for DNA Extraction from Agarose Gels (QIAEX II
Handbook 08/96). The 640 base pair DNA fiaginent concentration is estimated by
2 o agarose gel electrophoresis according to Maniatis.
The 640 base pair fragment is used as template for a second PCR amplification,
this time with the oligonucleotides BM51 (SEQ ID NO:S, Oligos Etc.) and BM33.
A
100 ~,L PCR reaction contains: 10 ng 640 base pair DNA fiagment, 100 pmoles
each of
2 5 oligos BM51 and BM33, buffer, BSA, MgS04 according to manufacturer, 100
N,M
dN'fPs and 2 units of Vent DNA polymerase (which is added during the first
cycle after
the temperature reaches 94°C). The thermocycling is accomplished with
25 cycles of
denah>xation for 1 min at 94°C, primer annealing for 1 min at
60°C, and primer
extension for 1 min at 75°C. The PCR product is about 670 base pairs in
length. This
3 o DNA fragment is purified by passage over an Elutip-D column according to
the
manufacturer's instructions {Schleicher & Schuell cat# 27370). Briefly, the
DNA is
CA 02318434 2000-06-22
WO 99/32143 PGT/US98/Z949$
23
diluted to 1 mL volume with Low-Salt buffer (0.2M NaCI, 20mM Tris-HC1, 1 mM
EDTA pH7.4) and passed over the elutip-D column. The column is subsequently
washed with 3 mL of Low-Salt buffer and eluted with 0.4 mL High-Salt buffer
(1M
NaCI, 20mM Tris-HCI, I mM EDTA pH7.4). The DNA is desalted and concentrated
by ethanol precipitation according to Maniatis. The result is a 640 by cDNA
fragment
encoding human TF residues 3 to 211 (i.e., amino acid residues 35-243 of SEQ
ID
NO:1.
Example 2
1 o Disulfide Conjugation
Different substtuchues may be joined by employing the thiol group of a
cysteine
production substructure. In this example, the conjugation is by the cysteine
thiol groups
of substructures) with thmmbogenic potential, context enhancing substructures)
and/or
15 activity-modulating substructiue(s), thereby forming a disulfide bond that
links the
cysteine-containing spacer - TF moiety to the context enhancing
substtucture(s). In
absence of a cysteine, a thiol group may be artificially introduced into an
amino group
of context enhancing substtvcture(s), for example, using 2-iminothiolane
(Treat's
Reagent). To achieve the highest degree of specificity of labeling, peptides
with a single
2o free amino group are preferred. The cysteine thiol of the context enhancing
subslructure(s) (or the cysteine thiol of the cysteine-containing activity-
modulating
substructure) is formed into a mixed disulfide bond through the use of a 10-
to I00-fold
molar excess of 5,5'-bis(2-nitrobenzoic acid), DTNB. The amount of reaction is
monitored by ultraviolet absorption of DTNB and measiued using 14,150 for the
molar
25 absorption coefficient at 412 nm. After 1 hour incubation at room
temperature in 0.1 M
sodium phosphate, pH 7.5, 0.1 M NaCI, 1 mM EDTA, excess DTNB is removed by gel
filtration.
The mixed disulfide context enhancing substructure is mixed with the
3 o cysteine-containing activity-modulating substzucture - TF moiety or the
cysteine-containing context enhancing substructures) (at different molar
ratios to
improve yield) and left at 4 °C to react at neutral to slightly basic
pH for a period of time
CA 02318434 2000-06-22
WO 99/31143 PCT/US98J2~498
24
in order to form the desired product (i.e., context-enhancing substructure-SS-
spacer
substructure - TF). The product is purified by a combination of gel filtration
and ion
exchange chromatography. The purity of the compound is judged by SDS-PAGE,
HPLC using reverse phase chromatography, or by electrospray mass spectometry.
Mixed disulfides suitable for reaction with the thiol group of cysteine-
containing
spacers are artificially introduced into the context enhancing substructures)
by
modification of its amino groups) with SPDP, N-succinimidyl-3-(2-pyridylthio}-
propionate, or by any of the other commonly used reagents used for this
purpose,
i o including without limitation SMPT, 4-succinimidly-oxycarbonyl-a,-(2-
pyridyltdithio)
toluene; Sulfo-LC-SMPT, sulfosuccinimdyl-6[4-succinimidly-oxycarbonyl-av-
methyl-
a(2-pyridyltdithio~toluamide] hexanoate; LC-SPDP, succinimidyl 6- [3- (2-
pyridyldi-
thio-~roprionamide) hexanoate; sulfo-LC-SPDP, sulfosuccinimdyl-6- [3(2-
pyridyldi-
thio)-propionamido] hexanoate; PDPH , 3-(2-pyridyldithio~propionyl hydrazide,
and
~ 5 the like. These and other reagents are available from Pierce Chemical Co.
The mixed
disulfide formed with any of these reagents is isolated by gel filtration
chromatography
and reacted with the cysteine-containing spacer at different molar
concentrations under
the conditions described above and analyzed for purity.
2 o A water-soluble, monitorable peptide and protein crosslinking agent,
N-maleimido-6-aminocaproyl ester of 1-hydroxy-2-nitm-4-benzenesulfonic acid,
(mal-sac-H1VSA), is reacted with an amino group of a peptide. In order to
achieve the
best specificity of labeling, the prefen:ed peptide does not contain lysine at
any position
other than the amino terminus (Aldwin and Nitecki (198 Anal Biochem 164:494-
501).
2 5 Reaction with amino groups releases the dianion phenolate, HNSA, that can
be
quantitated using a spectrophotometer. The peptide is linear or its
conformation may be
restrained (la) by the presence of 1 or more disulfide bonds. The
N-maleimido-6-aminocaproyl amide derivative is reacted with the thiol of the
cysteine-containing activity-modulating substructure - TF to form a thioether
bond that
s o conjugates the context enhancing substructures) to TF through a spacer of
variable
length. Other heterobifunctional cross linkers may be used to introduce a
maleimido
CA 02318434 2000-06-22
WO 99/32143 PGTNS98I2'1498
- group into the facilitator, these include without limitation such reagents
as SMCC,
succinimidly 4-(N-maleimido-methyl) cyclohexane-1-carboxylate; sulfo-SMCC,
sulfo-succinimidyl 4-(N-maleimidomethyl) cyclohexane-1-carboxylate; MBS,
m-maleimidobenzoyl-N-hydroxysuccinimide ester; sulfo-MBS, m-maleimidobenzoyl-
s N-hydroxysulfosuccinimide ester; SMPB, succinimidyl 4-(p-maieimido-phenyl)
-butyrate; sulfo-SMPB, succinimidyl-4- (p-maleimidophenyl)- butyrate; GMBS,
N-(-maleimidobutyryloxy) succinimide ester, sulfo-GMBS, N-(-
maleimidobutyryloxy)
sulfosuccinimide ester, and the like.
i o Example 3
Cloning of TF 3-211 for E.coli expression:NuV 120
670 by TF cDNA fi~nent firm PCR is prepared (described above in Example
1, in PCR of TF cDNA). The purified 670 terse pair DNA fi~nent is digested
with 5
1 s units restriction endonucleases BamHI and Hi~III (New England Biolabs
cat#1365 and
#1045 respectively) per ~g DNA in 1X BamHI buffer (New England Biolabs) for 4
h at
37°C. Subsequently, the 659 base pair fiagtnent is purified from an
agarose gel
eleclmphoresis band using the QIAEX II kit as previously described for the 640
base
pair fiagment. The -r659 by band is cloned into the BamHI and HindZB sites of
the
2 o vector pTrcHisC (Invitrogen) by standard methods. Briefly, the pTrcHisC
DNA is
digested with BamHI and HindTII and then the ~5 kb band is purified on an
agarose gel.
Ligation is perform~i with about 10 ng/~L of the purified vector fiugcnent
mixed with a
three fold molar excess of the purified 654 by fiagment and T4 DNA ligase
reaction
conditions according to the manufacturer (New England Biolabs). The resulting
clone
2 5 (NuV 120: SEQ ID N0:6) places the TF coding sequence in a translational
reading
fi~ame with the translabonal start of the vector. The clone NuV 120 is a
plasmid for
expression of a recombinant protein containing a (His)6 tag, a thrombin
cleavage site,
and TF residues 3 to 211 plus threonine at residue 212.
CA 02318434 2000-06-22
WO 99/32143 PCTNS9&27498
26
NuV 120 residues (SEQ
ID
N0:6)
start colon 413-415
(His)6 tag production substructure 425-442
BamHI production substructure 513-S 18
thrombin cleavageproduction substructure 521-532
site
AvaI/XmaI production substructure 533-538
TF 3-211 substructure with thrombogenic539-1165
potential
PmII production substructure 1165-1170
stop colon 1169-1171
HindIII production substtvcdue 1172-1177
Example 4
s Cloning of a synthetic spacer sequence in TF: NuV 121
Mix oligonucleotides NuV005 through NuV009 (SEQ ID NOs:7-11,
respectively (Oligos Etc.)) at 10 pmol/ph in 20 mM Tris-HCI, 10 mM MgCl2, 50
mM
NaCI, pH 7.5. Heat mixri~re to 80°C for 2 min then cool to 25°C
over a period of 30
i o min to allow annealing of oligonucleotides. Clone the resulting synthetic
spacer into the
Bam HI and Aval sites of NuV 120. The vector DNA is prepared by digesting
Clone
NuV 120 with BamHI and AvaI and isolation of the ~Skb fragment from an agarose
gel
and purification by QIAEX II (QIAGEN). The 10 pL Ggation reaction contains 100
ng
of NuV 120-BamHI/AvaI fragment, 0.5 ~L of the annealed oligonucleotide
mixtime, and
~ s T4 DNA ligase with buffer according to the manufacturer's recommendations
(New
England Biolabs). This results in NuV 121 (SEQ ID N0:12), a plasmid for
expression
of a recombinant protein containing a (His)6 tag, a thrombin cleavage site, a
17 amino
acid spacer, and TF residues 3 to 211.
CA 02318434 2000-06-22
WO 99/32143 PCT/US98/Z9498
27
NuV 121 residues (SEQ
ID
N0:12)
start colon 413-415
(His)6 tag production subsixucrure 425-442
BamHI production substivcture 513-518
thrombin cleavageproduction substructure 521-532
site
spacer activity-modulating substivchu~e533-574
Aval/XmaI production substructure 575-580
TF 3-211 substructure with thmmbogenic581-1207
potential
1'm1I production subst<uch>re 1207-1212
stop colon 1211-1213
HindIII production substructwe 1214-1219
Example 5
Mutation of TF residue Thr167 to Lys: NuV 122
Oligonucleotide mutagenesis is performed on Clone NuV 121 according to the
method of Deng and Nickeloff (1992) Analytical Biochem. 200:81-88] (also
according
to the Transformer Site-Directed Mutagenesis Kit, Clontech #K1600-1). The
selection
to primer (Stul, SEQ ID N0:13, (from Oligos Etc.)) changes the unique Scat
site in
NuV 121 to a Stul site; thus allowing selection against the parental pla~nid
by restriction
with ScaI. The mutagenic primer (TF+K, SEQ ID N0:14 (Oligos Etc.)) changes a
Thr
colon (ACA) to a Lys colon (AAA). Screening for the mutation is performed by
DNA
sequencing. The modified clone is NuV 122 (SEQ ID NO:15), a plasmid for
expression
~ 5 of a recombinant protein containing a (His)6 tag, a thrombin cleavage
site, a 17 amino
acid spacer, and TF residues 3 to 211, with residue 167 changed to Lys.
CA 02318434 2000-06-22
WO 99/32143 p~/p4gg
28
NuV 122 residues (SEQ
ID
NO:15)
start colon 413-415
(His)6 tag production substructure 425-442
BamHI production substructure 513-518
thrombin cleavageproduction subst<vct<ue 521-532
site
spacer activity-modulating subsauchn~e533-574
Aval/XmaI production subst<~ucture 575-580
TF 3-211 substructure with thrombogenic581-1207
potential
Thr167 to Lys modification 1073-1075
colon
Lys mutation modification 1074
PmII production substructure 1207-1212
stop colon 1211-1213
HindIII production substzuchire 1214-1219
selection mutation 1245-1246
Example 6
Cloning of a synthetic peptide clone20 with a spacer attached to TFK: NuV 124
Oligonucleotides NuV20-1 through NuV20-8 (SEQ ID Nos:lS-23) are mixed at
pmol/~L in 20 mM Tris-HCI, 10 mM MgCl2, 50 mM NaCI, pH 7.5. The mixt<n~e is
heated to 80°C for 2 min, then cool to 25°C over a period of 30
min to allow annealing
of oligonucleotides. The resulting synthetic spacer is cloned into the BamHI
and AvaI
t o sites of NuV 122. The vector DNA is prepared by digesting Clone NuV 122
with BamHI
and AvaI and isolation of the ~Skb fragment from an agamse gel and
purification by
QIAEX II (QIAGEN). The 10 microL ligation reaction contains 100 ng of
NuV 122-BamHI/Aval fragment, 0.5 ~,L of the annealed oligonucleotide mixture,
and
T4 DNA ligase with buffer according to the manufacturer's recommendations (New
England Biolabs). The resulting construct, NuV 124 (SEQ ID N0:24), is a
plasmid for
CA 02318434 2000-06-22
WO 99/32143 p~/pggg/Z~~gg
29
expression of a recombinant protein containing a His-tag, a thrombin cleavage
site, a
peptide sequence refen~ed to as clone20, a spacer segment, and TF3-211 with
K167.
10
NuV 124 - ~idues {SEQ ID
N0:24)
start colon 413-415
(His)6 tag production substruchu~e 425-442
thrombin cleavageproduction substructure 521-532
site
BamHI production substructure 530-535
Clone 20 context-enhancing substructure536-586
KpnI production substructure 587-592
spacer (C14S)g actlvlty-modul8tlng subshucture593-637
Aval/XmaI production substructtu~e 638-643
TF 3-211 substructure with thrombogenic644-1270
Thr167 to Lys modification 1136-1138
colon
Lys mutation modification 1137
PmII production subs 1270-1275
stop colon 1274-1276
HindIII production substructure 1277-1282
selection mutation 2108-2109
ScaI
to StuI
Example 7
Characterization of NV 124
Purification of NV124.
The protein, NV 124, is expressed from the E. coli expression plasmid
NuV 124. This protein is insoluble when expressed in E. coli and was recovered
from
inclusion bodies by solubilizing the proteins with guanidine hydrochloride
(GuHCI).
CA 02318434 2000-06-22
WO 99/32143 PCTNS98~'1498
NV 124 was partially purified by IMAC (im~,nobilized metal anion
chromatography)
on a Ni-NTA column (Qiagen) in guanidine HCI. After extensive washing, low pH
(4.0) was used to release the NV 124 from the column. Folding of the protein
was
performed by dilution of the denatured protein into 20 mM TrisCl containing
reduced
s and oxidized glutathione. The final concentration of the protein after
dilution in
folding buffer was 50 ~g/ml. Thrombin was added under precisely controlled
conditions to remove the (His)6 tag-thrombin cleavage peptide from the NV 124.
Thrombin was added at 5 microgram per mg of precursor protein. After 4 hours
digestion at 37°C essentially all of the (His)6 tag-thrombin cleavage
peptide was
1 o removed from the NV 124. In some studies, the (His)6 tag was not removed,
yet this
protein (referred to here as His-NV 124) displayed similar biological activity
to the
mature protein. The final step of purification was MonoQ-HR ion-exchange
chromatography using FPLC and a Pharnacia 10/10 column. A gradient elution was
used to elute the protein between 20 mM TrisCl, pH 8.5, and 20 mM TrisCl, pH
8.5,
1 s containing 1 M NaCI. The estimated purity at this stage is typically
greater than 90%.
Yields of 20 mg NV 124 per liter of E. coli culture are typical.
Protein characterization.
2 o NV 124 and His-NV 124 were physically characterized by SDS-PAGE and
mass spectrometry (MALDI). The mass of His-NV 124 determined by MALDI was
31.6 kDa and was similar to the theoretical mass of 31.7 kDa determined from
the
sequence.
2s TF function of NV124.
NV 124 was subjected to rigorous in vitro characterization of the function of
its
TF moiety. This included analysis of NV 124 dependent enhancement of factor
Vila
amidolytic activity, measurements of the affln'lty of NV 124 for factor VIIa,
and
3 o measurements of NV 124 dependent enhancement of factor VIIa's proteolytic
activity
and plasma clotting activity. Table 1 summarizes some of the results obtained
from
CA 02318434 2000-06-22
WO 99/32143 PGTNS98/27498
31
the analyses of NV 124, in comparison with other STVTs characterized.
Amidolytic
activity of factor VIIa complexed with NV 124 compared favorably with the
complex
of factor VIIa with TF1-218. This indicates that the N-terminal addition of
about 20
peptide residues by way of a spacer does not interfere with subtle protein-
protein
interactions at the protease domain of factor VIIa that are responsible for
allosteric
enhancement of factor VIIa amidolytic function. The affinity of NV 124 for
factor
VIIa as measured by surface plasmon resonance or titration of factor VIIa
amidolytic
activity was also similar to that of TF1-218. Thus, the NV124 modification
does not
interfere with extensive interactions between TF and factor VIIa.
to
It is also important that modifications to TF not disrupt proteolytic function
of
the TF-factor VIIa complex. This was addressed in an assay which measures the
ability of the TF-factor VIIa complex to activate factor X in the fluid phase
or on
phospholipid vesicles. Indeed, TF directly participates in protein-protein
interactions
with macromolecular substrates factors X and IX. Assay of NV 124 dependent
enhancement of factor VIIa hydrolysis of substrate factor X either in the
presence or
absence of phosphoiipid vesicles gave similar results to that obtained with
TF1-218.
Additionally, NV 124 initiated plasma clotting rimes were similar to clotting
times
obtained with TF1-218. The results indicate that the NV124 modification does
not
2 o interfere with the proteolytic cofactor function of TF. Moreover, analyses
of other
STVTs which were tested indicate that modifications at the N-terminus, the C-
terminus and the permissive loop generally do not interfere with the cofactor
functions of TF (Table 1 ).
CA 02318434 2000-06-22
WO 99/32143 PCT/US98/Z~498
32
Table l: Characterization of STYTs produced according to the invention.
Yield Kd Kd Relative
of
Class Protein Amidolyticfor for VIIaProteolytic
~2) VIIa
s of STVT Link (mg/liter)activity (nlV1)~4)(n11~~5)activity~6)
~~) ~)
TF1-218 50 1.000 4.73 3.26 1.000
NuV 123 N 47.2 0.998 5.63 4.95 0.995
NuV 125 N 0.28 ------- ------ --~_-- _
i o NuV N 21.8 0.902 5.63 3.65 1.456
124
NuV 129 N 6.66 0.736 4.42 4.06 0.955
NuV 135 N 23.3 ------ -------4.23 --------
NuV 139 N 7.7 ------ - - -~__ __~__
NuV 141 N 31.3 1.010 11.55 7.87 0.481
1 s NuV N 50.6 1.005 15.32 7.42 0.755
142
NuV 144 N 13.3 0.979 4.32 3.22 0.862
NuV 128 N 6.90 0.860 3.72 10.8 -----
NuV 131 C 3.66 1.031 9.70 ------- 2.082
NuV 137 C 3.89 0.941 6.03 --------0.858
2 o NuV I 62.9 1.032 6.18 --------0.977
143
TF-cys N 11.5 ------- ___~- _ __ ~_
1. Linkage is the position of the facilitator relative to TF. N is amino
terminus, C is
carboxy terminus, and I is inserted into the permissive loop. Each STVT
represents a
25 different subclass of facilitator directed towards a different biological
site. 2. Yield
of refolding expressed as mg per liter of E. coli culture. 3. Normalized
amidolytic
activity of STVT:factor VIIa complex. 4. Apparent dissociation constant for
factor
VIIa determined from amidolytic activity plots at 5 nM factor VIIa
concentration and
varying the STVT concentration. 5. Dissociation constant determined by surface
s o plasmon resonance in a BIAcore 2000. 6. Normalized factor Xa generation
activity
of STVT:factor VIIa complexes.
As is illustrated in Table 1, each STVT has amidolytic (measured by in vitro
activity on a synthetic substrate) and factor VIIa binding activity (measured
by
35 BIAcore) that is very close to that of the truncated TF. Therefore,
incorporating the
facilitators into the structure of TF has not damaged the inherent activity of
TF.
NuV 143 has a facilitator incorporated into the permissive loop, and is a
particularly
interesting example of invention constructs.
CA 02318434 2000-06-22
WO 99/32143 PCT/US98~Z7498
33
Tozicity of NV124.
Soluble, truncated TF is a remarkably safe molecule to administer
intravenously to mice. A dose of 1.5 mg per mouse (~75 mg/kg) has no visible
effect
on the mice. When a dose of 2.5 mg per mouse 0125 mg/kg) is administered,
about
half of the mice die. When native TF is inserted in a phospholipid vesicle and
administered, death of all the mice results at a dose of about 10 ng/mouse
0500
ng/kg). Fully constituted native tissue factor is more than 250,000 times more
toxic
than the soluble, truncated TF used in construction of NV 124.
to
When lethal doses of soluble, truncated TF or full length, reconstituted TF
are
given intravenously to mice, the mice are observed to rapidly become very
quiet and
hunched over within 30-90 seconds, their respiration rate increases, and death
occurs
within 1-10 minutes. It was found that most of the radiolabelled soluble,
truncated TF
is found in the lung a few minutes after IV administration. Doses of typical
STVTs
that kill 25-50% of 4 mice are generally around 125 to 200 micrograms per
mouse
(--6.25 to 10 mglkg). Therefore, NV 124 is about 12.5 to 20 times more toxic
to mice
than soluble, truncated TF and about at least 12,500 to 20,000 times less
toxic than
fully constituted TF.
Half lives of STVTs.
The half life of a STVT is short, on the order of several minutes as can be
seen
in the accompanying figures. Figure 3b illustrates the difference between the
very
short half life of radioiodinated truncated, soluble TF and the slightly
longer half lives
of two different STVTs injected intravenously into mice. As illustrated in
Figure 3a,
incubating an antibody (1OH10) that recognizes, but does not neutralize, TF
before
injecting the complex into the mouse produces a much longer half life. When
the
mice were sacrificed soon after the last time point and their organs collected
and
3o counted, most of the radiolabelled proteins were found in the lung.
Although injected,
soluble TF accumulated in the lung, little thrombosis in the lung was
observed. The
CA 02318434 2000-06-22
wo ~r~m43 pc~rius9srrr49s
34
- lack of phosphatidylserine expression in lung vesicles (see Ran et al. ( I
998) Cancer
Res. 58(20):4646-53.) may account for the lack of thrombogenic activity in
this tissue.
Histology
The effects of various subclasses of STVT molecules on the tumor vascular
system were histologically evaluated. It was desired to be able to quickly
determine
the effect on the vascular system by removing the tumor within 24 hours (1, 4,
or 24
hours) and examining histological slides (H & E or Carstair's staining) to see
the
1 o effects of the thrombogen on the vascular system. Because the tumor
vessels in
controls also show significant and variable tendency to thrornbose, results
that
differentiated control and STVT-treated tumors at early stages could not
confidently
be obtained. Therefore, tumor measurements over a period of 7 to 10 days were
relied
on.
Lack of inhibition of tumor growth by bolus doses of NV124.
Mice (strain A/~ were given C1300 neuroblastoma tumor cells
subcutaneously on their flank, the tumors were allowed to grow to substantial
size (up
2 o to 10 mm diameter) before treatrnent was started. After a bolus dose of
selected
NV 124 (in the range of 25 to 125 wg per mouse), the tumors became blue/black
over a
period of 1-5 minutes. In spite of the lack of inhibition of tumor growth, it
is believed
that change in coloration is physiologically significant and related to the NV
124,
because neither saline controls nor truncated TF alone (which lacks a
facilitator)
produced this effect. Furthermore, not all STVTs (having different
facilitators)
produced this effect. Except for an occasional animal, bolus doses were
generally not
able to adequately infarct and inhibit the growth of tumors.
CA 02318434 2000-06-22
WO 99/32143 PCT/US98lZ'1498
Inhibition of C1300 growth by a single infusion of NV124
Because of these results and the short half life of the STVTs compared to the
antibody based system that was previously demonstrated to work, it was decided
to
5 use intravenous infusion to prolong the time that NV 124 would have to act
on the
tumor vascular system. In two independent experiments, tumors were grown for
about 10 days before treatment was started. The volume of the tumors was
calculated
from {a2 * b)l2 where a is the smallest dimension of the tumor and b is the
dimention
of right angles to a. For comparison, a 5 x 5 mm and a 15 x 15 mm tumor yields
a
1 o volume of 62.5 and 1688 mm3, respectively. The growth of the tumors was
significantly slowed when the NV 124 was infused; the results of one
experiment are
shown in Figure 4. The tumors at the start of this experiment were about 7 x 7
mm.
A single dose 25 ~,g (closed diamond) or 125 ~g (closed square) of NV 124 was
given
by infusion through the tail vein over 1 hour. NV 124 contained a facilitator,
clone 20
i5 described by Goodson et al (Pros. Natl. Acad. Sci. USA (1994) 91:7129-
7133), which
is reputed to interact with human uPAR and much less efficiently with marine
uPAR.
Multiple infusion of NV124.
2 o As shown in Fig. 5, multiple infusions improved the pharmacological effect
of
NV 124 on tumor growth. C 1300 tumors were grown in A/J mice to about 5 x 5 mm
in about 10 days. The mice had been given two infusions of NV 124 that were
spaced
by 4 days. NV 124 was infused through the tail vein over 1 hour at a rate of
0.2 ml per
hour. One group received a single infusion of 125 pg (closed squares) and the
other
2 s group received decreasing doses of 125, 75, and 50 ~g per infusion for a
total of 3
infusions given on Days 0, 4, and 8. In this evaluation, the controls that
were infused
with saline grew from about 7 x 7 mm to about 15-17 mm in size in 8 days. The
group that received 3 infusions responded better than the group that received
only 1
infusion. In some animals, a hard black cap was formed over the tumors. In
these
3 o particular animals, the tumors were about 1 x 1 cm in size. The cap
formation, which
strongly resembled a scab, was usually produced when the tumors were
developing
CA 02318434 2000-06-22
WO 99132143 PGTNS98/Z7498
36
- redness just under the skin.
Histological evidence of NV124-induced effects on C1300 tumors.
Two regions of tumor loss were observed, which may correspond to scarring
caused by the first administration and most recent apoptosis caused by the
second
administration. At least 95% of the cells. in the tumor were dead as judged
from
histological examination.
i o Direct observation of treated vessels.
Implanted tumor and angiogenic vessels were observed through a window
established in a skin flap. This technique has been used most with hamsters in
which
the window is placed in the cheek pouch. The skin over the back of the animal
(mice
or rats) and a metal frame was placed so a fold of skin is held rigidly. A
circular piece
of skin was removed from one side of the skin fold; this exposed the underside
of the
skin on the other side of the fold. A cover glass inserted and immobilized in
the
frame provides a sealed window. Vessels were easily seen by microscopic
observation thmugh the window.
Before the introduction of NV 124, blood was observed flowing through
arterioles and venules, individual red blood cells could be seen moving in
capillaries,
and white blood cells could be seen rolling along the vessel walls. The images
were
continuously captured on video recording tape. NV 124 produced a very rapid
2 s response; it caused rapid occlusion of arterioles, which prevented blood
flow in the
tumor vessels. In some instances, thromboses were visible in the vasculature.
CA 02318434 2000-06-22
WO 99/32143 PCT/US98l19498
37
- Example 8
PCR of human plasminogen cDNA fi~nents
PCR is performed to amplify a DNA fi~agment of 965 base pairs from the
s Clontech cDNA mixture (Marathon-Ready cDNA of Human placenta origin fiom
Clontech (97/98cat.#7411-1)) which encodes kringle domains 1 and 2. A 100 pL
reaction should contain: 2 ~L cDNA mixture, 100 pmoles each of oligos Plg+63
and
Plg-1005 (SEQ ID N0:25 and SEQ ID N0:26, respectively), buffer, BSA, MgS04
according to manufacturer; 1 ~L IOmM dNTPs and 2 units of Vent DNA polymerise
i o which is added during the first cycle after the temperature reaches
94°C. The
thermocycling is accomplished with 35 cycles of denaturation for 1 min at
94°C, primer
annealing for 1 min at 55°C, and primer extension for 1 min at
75°C. The PCR product
is about 965 base pairs in length. This DNA fiagtnent is purified by
electrophoretic
separation on a 1.0% agarose gel buffered with Tris-Borate-EDTA according to
15 Maniatis, excision of the appropriate band, and extraction of the DNA using
the QIAEX
II gel extraction kit (QIAGEN cat#20051 ) according to manufacturer's
instructions for
DNA Extraction from Agarose Gels (QIAEX II Handbook 08/96). The 965 base pair
DNA fi~agment concentration is estimated by agarose gel electrophoresis
according to
Maniatis.
The 965 base pair fragment is used as template for a second PCR amplification,
this time with the oligonucleotides Plg+289 and Plg-523 (SEQ ID N0:27 and SEQ
ID
N0:28, respectively) to amplify only the kringle 1 domain and to add
restriction sites
appropriate for cloning. A 100 ~L PCR reaction contains: 10 ng 965 base pairs
DNA
2 5 fisgment; 100 pmoles each of oligos Plg+289 and Plg-523, buffer, BSA,
MgS04
according to manufacturer, 100 pM dNTPs and 2 units of Vent DNA polymerise
(which is added during the first cycle after the temperature reaches
94°C). The
thermocycling is accomplished with 25 cycles of denaturation for 1 min. at
94°C,
primer annealing for 1 min at 55°C, and primer extension for 1 min at
75°C. The PCR
3 o product is about 267 by in length.
CA 02318434 2000-06-22
WO 99/31143 PGT/US98JZ7498
38
This 267 by DNA fi~Cnent is purified by passage over an elutip-D column
according to the manufac~'s instructions. Briefly, the DNA is diluted to 1 mL
volume with Low-Salt buffer (0.2M NaCI, 20mM Tris-HCI, 1 mM EDTA pH7.4) and
passed over the Elutip-D column. The column is subsequently washed with 3 mL
of
Low-Salt buffer and eluted with 0.4 mL High-Salt buffer ( 1 M NaCI, 20mM Tris-
HCI, 1
mM EDTA pH7.4). The DNA is desalted and concentrated by ethanol precipitation
according to Maniatis. PCR is performed to amplify a DNA fiagment of 1677 by
from
the Clontech cDNA mixture which encodes kringle domains 3, 4 and 5. A 100 p,I,
reaction should contain: 2 pL cDNA mixture, 100 pmoles each of oligos Plg+737
and
1 o Plg-2393 (SEQ ID N0:29 and SEQ ID N0:30, respectively), buffer, BSA, MgS04
according to the manufacturer; 1 pL IOmM dNTPs and 2 units of Vent DNA
polymerise which is added during the first cycle after the temperature reaches
94°C.
The thermocycling is accomplished with 35 cycles of denaturation for 1 min at
94°C,
primer annealing for 1 min at 55°C, and primer extension for 1 min at
75°C.
The PCR product is about 1677 by in length. This DNA fragment is purified by
electrophoretic separation on a 1.0% agarose gel buffered with Tris-Bon~te-
EDTA
according to Maniatis, excision of the appropriate band, and extraction of the
DNA
using the QIAEX II gel extraction kit {QIAGEN cat#20051) according to
manufrcd~rers
2 o instivctions for DNA Extraction from Agarose Gels (QIAEX II Handbook
08/96). The
1677 by DNA fi~agment concentration is estimated by agarose gel
electrophoresis
according to Maniatis. The result is a 965 by cDNA fi~agment encoding
plasminogen
kringle domains 1 and 2, a 1677bp cDNA fragment encoding plasminogen kringle
domains 3 through 5, and a 267bp cDNA fiagment encoding plasminogen kringle
domain 1.
Example 9
Cloning of plasminogen kringle 1 into TFK: NuV 125
3 o The plasminogen kringle 1 fi~agment is cloned into the BamHI and KpnI
sites of
NuV 124, replacing the clone 20 sequence with the plasminogen sequence. The
267 by
CA 02318434 2000-06-22
WO 99/32143 p~~sgg,~~4gg
39
Plasminogen cDNA fragment from PCR of human plasminogen cDNA fragments is
digested with BamHI and KpnI, separated on an agarose gel, purified with QIAEX
II
resin, and ligated with NuV 124 that was prepared as follows: digestion with
BamHi and
KpnI, separation on an agarose gel, and purification of the -V6kb band with
QIAEX II
resin. The resulting clone is designated NuV 125 (SEQ ID N0:31 ), a plasmid
for
expression of a recombinant protein containing a His-tag, a thrombin cleavage
site, a
plasminogen kringle 1, a spacer segment, and TF3-211 with K167.
NuV 125 residues (SEQ
ID
N0:31)
start colon 413-415
(His)6 tag production substructure 425-442
thrombin cleavageproduction substructure 521-532
site
BamHI production subshuch~re 530-535
plasminogen kringlecontext-enhancing substructure542-778
1
KpnI production substructure 779-784
Spacer (G4S); activity-modulating substructure785-829
AvaI/XmaI production substructure 830-835
TF 3-211 substructure with thrombogenic836-1462
potential
Thr157 to Lys modification 1328-1330
colon
Lys mutation modification 1329
stop colon 1466-1468
PmII production substructure 1462-1467
HindIII production substructure 1459-1474
selection mutation 2300-2301
Scat
to StuI
CA 02318434 2000-06-22
WO 99/32143 PCT/US98IZ9498
- Example 10
Expression, refolding, and purification of TFK fusion proteins
Expression in E. coli, refolding, thrombin cleavage, and purification of TFx
and
fusions with TFK are performed essentially as described by Stone et al. (1995)
Biochem.
J. 310:605-614. TFK and variants of TFK are purified by the same basic
protocol with
modifications appropriate to the particular characteristics of the TFK fusion
protein such
as differences in elution from ion exchange chromatography and migration upon
SDS-PAGE. TFK fusions are produced in yeast (see Stone et al. (1995) Biochem.
J.
io 310:605-614) or mammalian cells (see Ruf et al. (1991) J. Biol. Chem.
266:2158-2166
and Ruf et al.(1992) J. Crystal Growth 122, 253-264. These systems have the
advantage that no refolding step is necessaZy. Expression in yeast may require
additional mutations in TFK which alters recognition sites for the cell
glycosylation
machinery (Stone et al. (1995) Biochem. J. 310:605-614). A biophysical
analysis is
i 5 performed either by SDS PAGE or mass spectrometry (both of which are
described by
Stone et al. (1995) Biochem. J. 310:605-614). In vitm activity is determined
either by
titration of factor VIIa monitored by changes in rates of chromogenic
substrate
hydrolysis or by changes in rates of factor Xa activity generation (as
described by Stone
et al. (1995) Biochem. J. 310:605-614).
Example 11
Cloning of NuV 129
A human plasminogen fisgment encoding the fifth lcringle domain was
2 5 amplified by PCR finm a human EST clone (Genome Systems, genbank accession
H61584) using Vent DNA polymerise (New England Biolabs) and the following
oligonucleotides:
KS+: 5' CACACAGGATCCGAAGAAGACTGTATG 3'
(SEQ ID N0:32)
so KS': 5' CACACAGGTACCTGAAGGGGCCGCACA 3'
(SEQ ID N0:33)
CA 02318434 2000-06-22
WO 99/32143 PCT/US98/29498
41
- This amplified a 285 by fragment, which was digested with BamHI and KpnI and
cloned into the corresponding sites of the plasmid NuV 127. Plasmid NuV 127 is
a
vector derived from pTrcHisC (Invitrogen) for cloning of amino terminally
linked TF-
fusion proteins. The resulting plasmid NuV 129 encodes a protein, NV 129, with
a
His-tag near the N-terminus, a thrombin cleavage site, plasminogen kringle 5
domain,
a 15 residue flexible spacer, and human TF residues 3 to 211 at the C
terminus.
NuV I29 residues (SEQ
ID
N0:34)
start colon 413-415
(Hiss tag production substructure 425-442
thrombin cleavageproduction substructure 521-532
site
BamHI production substructure 530-535
plasminogen kringlecontext-enhancing substructure536-796
5
KpnI production substructure 797-802
spacer activity-modulating substructure803-847
TF 3-211 substnuture with thrombogenic854-1480
potential
stop colon 1484-1486
1 o Purification and characterization.
Purification of NV 129 was performed as described for purification of NV 124
(see example 6.) Yields were in the range of 6 mg / L of E. coli culture. Mass
spectrometry was performed by MALDI as previously described and resulted in a
is determination of 39,305 Da in close agreement with the predicted mass of
39,303.
TF function of NV129.
Characterization of NV 129 TF activity was performed as previously described
2 o for NV 124. As shown in Table 1 although amidolytic activity of NV
129:factor VIIa
CA 02318434 2000-06-22
WO 99132143 PGTNS98lZ?498
42
- was slightly lower than that of TF1-218, affinity for factor VIIa was
similar to that of
TF1-218. NV129:factor VIIa proteolytic activity for factor X activation was
also
similar to that of TF1-218:factor VIIa, as assayed both in the presence and
absence of
phospholipids. The results demonstrate that the TF entity of NV 129 is
properly folded
and functional.
C1300 neuroblastoma cells (500,000) were injected subcutaneously into the
flank of A/J mice. After about 7-10 days, the tumors were grown to about 5-7
mm in
diameter and were ready for treatment. A restraining device was used in which
the
1 o mice were immobilized by a vest placed around their trunk and the vest was
connected to the interior of a plexiglass tube. The tail of the mice was
exposed from
one end of the plexiglass tube. The tail was taped to a plexiglass plate and a
30-gauge
needle inserted into the tail vein was connected to a Harvard precision pump.
The
infusion was carried out for 60 minutes without anesthesia. Two hundred
microliters
i s was infused. Saline was infused into tumor bearing mice as a control.
Tumors were
measured with calipers and the volume of the tumor was determined by the
formula,
(a~*b)l2, where a is the smallest dimension of the tumor and b is the
dimension at
right angles to a.
2 o A/J mice bearing C 1300 tumors of an initial size of about 6 X 6 mm were
infused with 125 micrograms of NV 129 for 60 minutes. This treatment produced
a
statistically significant erect on the growth of C 1300 neuroblastoma tumors,
as
shown in Fig. 6. Saline treated control tumors grew to a volume of near 4 mls
in 10
days.
Example 12
Cloning of NV 144
Oligonucleotides encoding a peptide facillitator were synthesized:
KLYD-1: S' GATCCCCGCGTAAACTGTACGACGGTAC 3' (SEQ ID N0:35)
KLYD-2: S' CGTCGTACAGTTTACGCGGG 3'
(SEQ ID N0:36)
CA 02318434 2000-06-22
WO 99/32143 PGT/US98/Z~498
93
These oligonucleotides were annealed and cloned into the BamHI and KpnI sites
of
NuV 127. The resulting plasmid, NuV 144, encodes a protein, NV 144, with a His-
tag
near the N-terminus, a thrombin cleavage site, a six residue peptide , a 15
residue
s flexible spacer, and human TF residues 3 to 211 at the C terminus.
NuV 144 residues (SEQ
ID
N0:37)
start colon 413-41 S
(Hiss tag production substructure 425-442
thrombin cleavageproduction substructure 521-532
site
BamHI production subshucture 530-535
peptide facilitatorcontext-enhancing substruchu~536-553
KpnI production substruchue 554-559
SpaCeI (O4S)3 activity-modulating substruchue560-604
TF 3-211 substruchu~ with thrombogenic6I 1-1240
potential
stop colon 1241-1243
C1300 neuroblastoma cells (500,000) were injected subcutaneously into the
flank of A/J mice. After about 7-10 days, the tumors had grown to about 5-7 mm
in
~ o diameter and were ready for treatment. A restraining device was used in
which the
mice were immobilized by a vest placed around their trunk and the vest was
connected to the interior of a plexiglass tube. The tail of the mice was
exposed from
one end of the plexiglass tube. The tail was taped to a plexiglass plate and a
30-gauge
needle inserted into the tail vein was connected to a Harvard precision pump.
The
i 5 infusion was carried out for 60 minutes without anesthesia. Two hundred
microliters
was infused. Saline was infi~sed into tumor bearing mice as a control. Tumors
were
measured with calipers and the volume of the tumor was determined by the
formula,
(a2*b)l2, where a is the smallest dimension of the tumor and b is the
dimension at
right angles to a.
CA 02318434 2000-06-22
WO 99/32143 PCTNS98/27498
44
Figure 7 shows the effect of multiple infusions of NV144 on C1300 tumor
growth. A/J mice bearing C 1300 tumors were infused over a period of 1 hour
with
125 micrograms NV 144 (also refen~ed to as KSp-TF) on Day 0 and 50 micrograms
s NV 144 on Day 3. Saline controls grew rapidly with the tumors growing nearly
to 3
ml in volume within 8 days. A group of 5 muscle-based tumors (triangles)
exhibited
reduced tumor growth rate whereas a skin based tumor (diamonds) had remarkably
slowed growth rate with a secondary tumor appearing by Day 4. The higher dose
of
NV 144 produced better efficacy than the lower dose.
In another experiment shown in Figure 8, A/J mice bearing C 1300 tumors of
an initial size of 7 X 7 mm were infi~sed over a 1 hour period on day 0 with
125 microgram NV 144 and again on Day 2 with 50 microgram NV 144. Both animals
exhibited dramatic decreased tumor growth compared with saline controls
1 s (n=5). By day 7 the primary skin tumors were accompanied with large (> 5X5
mm) muscle tumors. The primary tumors developed superficial black necrotic
caps by day 1. This is clear evidence for the pharmacological efficacy of
NV 144.
2 o Example 13
Toxicity tests in animals
Dose ranging study to identify the acute effects of test protein (TP) is
performed
in test animals by intravenous infusion of the drug. The maximum anticipated
dosage of
2 s a therapeutic candidate molecules) in vivo is determined in adult rats,
rabbits, dogs,
nonhuman primates, etc. by an intravenous infiision schedule that mimics the
anticipated potential therapeutic protocol in order to observe the acute
effects of the
drug.
s o A typical experimental design would include the following. Groups of 3
male
rats are used for each dose concentration and for each control. The
unanesthetized rats
are gently immobilized in an approved manner with tail vein immobilized and
prepared
CA 02318434 2000-06-22
WO 99/32143 pG.j.~~~4~
- for sterile insertion of the intravenous catheter. The inserted catheter is
flushed with
sterile physiologic saline (SPS) or lactated Ringer's solution (LRS) at a rite
of 20
L/min/100gBW. The infusion line intercepts the SPS or LRS line and under pump
control permits infusion into the catheter of the test material. The control
infusion of
5 SPS or LRS proceeds for 10 min. The test material shall be labeled by
confidential test
number and have been adjusted to five concentrations. The test samples contain
differing concentrations in 3- to 10-fold concentration increments. The test
material
infusion pump syringe connects to the same infusion catheter by a T connector
(or
needle insertion) taking care that no bubbles are created that could be
infused. This
i o permits washing of the line past the point of test material entry. The
test material, under
confidential identification number and letter designation, is infused at 5 to
200
L/min/100gBW. The duration of infusion is 0.5 to 120 min.
The rats are observed for changes in behavior, convulsions, increase of
i 5 respiratory rate, or death and each shall be scored. At the end of the
designated test
material infusion period, the infusion is switched to SPS or LRS for 1 to 60
min. The
catheter is then removed and the behavior, respiratory rate, and hemostasis at
the tail
vein site observed and monitored at 0.5, 1 and 2 hrs after termination of test
infusion. A
sample of blood is taken at each interval for enumeration of cell types and
counts. Each
2 o rat is eilthanized twenty-four hours later. The abdomen is opened and the
inferior vena
cava incised to take a blood sample and exsanguinate the rat followed
immediately by
perfusion through the heart of cold SPS or LRS containing 50 U/ml of USP
heparin.
The organs (heart, lungs, liver, kidneys, spleen, pancreas, stomach, large
bowel and
small bowel, adrenal, and brain are removed, cut to ~ 3 mm thick blocks and
fixed in
25 10~~o neutral formalin. After processing and embedding in para~n blocks,
cutting at 5
microns, sections are stained with Hematoxylin and Basin, as well as by
Carstair's
method for histological examination.
CA 02318434 2000-06-22
WO 99/32143 PCT/US98lZ'1498
46
. Example 14
Inhibition of human tumors grown in human skin
implants in immunodeficient mice
The ability of the test compounds to eradicate or reduce the size of tumors in
test
animals is tested as follows in a model using human skin, such as foreskin or
breast
reduction mammoplasty, or other transplants in severe combined immunodeficient
(SC1D) mice, cats or other types of immunodeficient animals. The human
foreskins are
trimmed to an oval of approximately 8 mm x 13 mm and stored at 4°C in
DMEM or
1 o RPMI tissue culture medium containing 10% FCS until surgery (next day).
100:1 of
diluted Ketamine HCl (diluted 1:10 in sterile water) is injected
intraperitoneally into
mouse abdomen. A light plane of anesthesia is induced with metophane and the
back of
the mouse is prepared by shaving and swabbing with alcohol. After making an
incision
in the skin, a sample of foreskin is placed within the wound and secured by
sutures. The
~ 5 wound is wrapped and dressed. Observations of the growth of the foreskin
implant are
made each day for 10 days. After 10 days, the bandages are removed. After 4
weeks,
the implant is ready to be inoculated with an injection of tumor cells. Three
million
tumor cells are injected intradermally into the transplanted human skin. After
approximately 2 weeks the tumors are large enough to initiate treatment of the
animal
2 0 With test materials.
Example 15
Inhibition of tumors grown immunodeficient,
SCID, nude or wildtype rodents
The ability of the test materials to eradicate or reduce the size of tumors in
test
animals is tested as follows in a model using xenografts of human tumor cells
implanted
into SCID or nude mice or of rodent tumor cells implanted into compatible
strains of
wildtype rodents. Examples of mouse tumors and their host strains of rodents
(i.e., mice
so or rat) include colon adenocarcinoma CT-26 cells into Balb/c mice, C1300
neuroblastoma cells into AlJ mice, Hepatoma 129 cells into C3H mice, Lewis
lung cells
into B57BL/6 mice, and other combinations of cells and mice listed in the
Division of
CA 02318434 2000-06-22
WO 99/32143 PGT/tTS98/Z7498
47
Cancer Treatment, Diagnosis and Centers (DCTDC) Tumor Repository Catalogue of
Transplantable Animal and Hunan Tumors that is maintained by The National
Cancer
Institute, Rederick Cancer Research and Development Center, PO Box B,
Frederick,
MD 21702. Fifty thousand to three million tumor cells are injected
subcutaneously into
recipient animals and the tumors allowed to grow for 3 to 30 days. Test
materials are
injected intravenously after the tenors have reached the desired size. Test
materials
over various concentrations and doses and . over different schedules may be
administered. Typical doses range between 0.1 ~,g to 20 mg of test material
per kg.
Typical schedules range between a course of 3 to 4 doses per day to 1 dose per
week for
i o a course of treatment ranging between 1 to 6 treatment cycles. The tumors
are measured
with calipers and the note of growth of the tumors are followed before and
ailer
treatment to distinguish effects of the test materials on growth. The tumor
sites are
removed from the mice for histological examination.
1 s Example 16
Pharn~acologic Effect in Primates
Normal, healthy nonhunan primates are implanted in the superficial subdermal
tissue of the volar surface of one forearm with pellets, which are
approximately 100
2 o microns in diameter and containing one or more angiogenic factors, such as
vascular
endothelial growth factor (vascular permeability factor), basic fibroblast
growth factor,
etc., in three sets to produce a variation in the maturity of the vessels that
are induced to
grow around the pellet As a control, a similar set of pellets containing human
albumin
are placed in the same distribution in the other forearm. Pellets are
permitted to
2 s establish local angiogenic networks for periods of 2 to 14 days. The
animals then
receive test materials given by intravenous injection. At intervals of 0.5
hours to 3 days
following infusion of test materials, a 3 mm diameter punch biopsy is taken to
include a
pellet and surrounding tissue. The biopsied materials are examined
histologically for
any effect of the test material on the structwe of the vessels and compared
with the
s o control biopsy.
CA 02318434 2000-06-22
WO 99I321d3 PCTNS98/Z'1498
48
While the invention has been described in detail with reference to certain
preferred embodiments thereof, it will be understood that modifications and
variations
are within the spirit and scope of that which is described and claimed.
CA 02318434 2000-06-22
WO 99/32143 PCTNS98rZ9498
1
SEQUENCE LISTING
<110> Houston, L.L.
Dickinson, Craig D.
<120>
<130> NuVas1100-wo
<160> 37
<170> FastSEQ for Windows Version 3.0
<210> 1
<211> 2104
<212> DNA
<213> Homo sapiens
<220>
<221> CDS
<222> (76)...(960)
<400> 1
gggtgccttc agcccaacct ccccagcccc acgggcgcca cggaacccgc tcgatctcgc 60
cgccaactgg tagac atg gag acc cct gcc tgg ccc cgg gtc ccg cgc ccc 111
Met Glu Thr Pro Ala Trp Pro Arg Val Pro Arg Pro
1 5 10
gag acc gcc gtc get cgg acg ctc ctg ctc ggc tgg gtc ttc gcc cag 159
Glu Thr Ala Val Ala Arg Thr Leu Leu Leu Gly Trp Val Phe Ala Gln
15 20 25
gtg gcc ggc get tca ggc act aca aat act gtg gca gca tat aat tta 207
Val Ala Gly Ala Ser Gly Thr Thr Asn Thr Val Ala Ala Tyr Asn Leu
30 35 40
act tgg aaa tca act aat ttc aag aca att ttg gag tgg gaa ccc aaa 255
Thr Trp Lys Ser Thr Asn Phe Lya Thr Ile Leu Glu Trp Glu Pro Lys
45 50 55 60
ccc gtc aat caa gtc tac act gtt caa ata agc act aag tca gga gat 303
Pro Val Asn Gln Val Tyr Thr Val Gln Ile Ser Thr Lys Ser Gly Asp
65 70 75
tgg aaa agc aaa tgc ttt tac aca aca gac aca gag tgt gac ctc acc 351
Trp Lys Ser Lys Cys Phe Tyr Thr Thr Asp Thr Glu Cys Asp Leu Thr
80 85 90
gac gag att gtg aag gat gtg aag cag acg tac ttg gca cgg gtc ttc 399
Asp Glu Ile Val Lys Asp Val Lys Gln Thr Tyr Leu Ala Arg Val Phe
95 100 105
tcc tac ccg gca ggg aat gtg gag agc acc ggt tct get ggg gag cct 447
CA 02318434 2000-06-22
WO 99/32143 PCTNS98r17498
2
Ser Tyr Pro Ala Gly Asn Val Glu Ser Thr Gly Ser Ala Gly Glu Pro
110 115 120
ctg tat gag aac tcc cca gag ttc aca cct tac ctg gag aca aac ctc 495
Leu Tyr Glu Asn Ser Pro Glu Phe Thr Pro Tyr Leu Glu Thr Asn Leu
125 130 135 140
gga cag cca aca att cag agt ttt gaa cag gtg gga aca aaa gtg aat 543
Gly Gln Pro Thr Ile Gln Ser Phe Glu Gln Val Gly Thr Lys Val Asn
145 150 155
gtg acc gta gaa gat gaa cgg act tta gtc aga agg aac aac act ttc 591
Val Thr Val Glu Asp Glu Arg Thr Leu Val Arg Arg Asn Asn Thr Phe
160 165 170
cta agc ctc cgg gat gtt ttt ggc aag gac tta att tat aca ctt tat 639
Leu Ser Leu Arg Asp Val Phe Gly Lys Asp Leu Ile Tyr Thr Leu Tyr
175 180 185
tat tgg aaa tct tca agt tca gga aag aaa aca gcc aaa aca aac act 687
Tyr Trp Lys Ser Ser Ser Ser Gly Lys Lys Thr Ala Lys Thr Asn Thr
190 195 200
aat gag ttt ttg att gat gtg gat aaa gga gaa aac tac tgt ttc agt 735
Asn Glu Phe Leu Ile Asp Val Asp Lys Gly Glu Asn Tyr Cys Phe Ser
205 210 215 220
gtt caa gca gtg att ccc tcc cga aca gtt aac cgg aag agt aca gac 783
Val Gln Ala Val Ile Pro Ser Arg Thr Val Asn Arg Lys Ser Thr Asp
225 230 235
agc ccg gta gag tgt atg ggc cag gag aaa ggg gaa ttc aga gaa ata 831
Ser Pro Val Glu Cys Met Gly Gln Glu Lys Gly Giu Phe Arg Glu Ile
240 245 250
ttc tac atc att gga get gtg gca ttt gtg gtc atc atc ctt gtc atc 879
Phe Tyr Ile Ile Gly Ala Val Ala Phe Val Val Ile Ile Leu Val Ile
255 260 265
atc ctg get ata tct cta cac aag tgt aga aag gca gga gtg ggg cag 927
Ile Leu Ala Ile Ser Leu His Lys Cys Arg Lys Ala Gly Val Gly Gln
270 275 280
agc tgg aag gag aac tcc cca ctg aat gtt tca taaaggaagc actgttggag 980
Ser Trp Lys Glu Asn Ser Pro Leu Asn Val Ser
285 290 295
ctactgcaaatgctatattgcactgtgaccgagaacttttaagaggatagaatacatgga1040
aacgcaaatgagtatttcggagcatgaagaccctggagttcaaaaaactcttgatatgac1100
ctgttattaccattagcattctggttttgacatcagcattagtcactttgaaatgtaacg1160
aatggtactacaaccaattccaagttttaatttttaacaccatggcaccttttgcacata1220
acatgctttagattatatattccgcactcaaggagtaaccaggtcgtccaagcaaaaaca1280
aatgggaaaatgtcttaaaaaatcctgggtggacttttgaaaagcttttttttttttttt1340
ttttttgagacggagtcttgctctgttgcccaggctggagtgcagtagcatgatctcggc1400
tcactgcaccctccgtctctcgggttcaagcaattgtctgcctcagcctcccgagtagct1460
CA 02318434 2000-06-22
wo 99r~zm3 pcrius9sizr49s
3
gggattacaggtgcgcactaccacaccaagctaatttttgtattttttagtagagatggg1520
gtttcaccatcttggccaggctggtcttgaattcctgacctcaggtgatccacccacctt1580
ggcctcccaaagtgctagtattatgggcgtgaaccaccatgcccagccgaaaagcttttg1640
aggggctgacttcaatccatgtaggaaagtaaaatggaaggaaattgggtgcatttctag1700
gacttttctaacatatgtctataatatagtgtttaggttctttttttttttcaggaatac1760
atttggaaattcaaaacaattggcaaactttgtattaatgtgttaagtgcaggagacatt1820
ggtattctgggcaccttcctaatatgctttacaatctgcactttaactgacttaagtggc1880
attaaacatttgagagctaactatatttttataagactactatacaaactacagagttta1940
tgatttaaggtacttaaagcttctatggttgacattgtatatataattttttaasaaggt2000
tttctatatggggattttctatttacgtaggtaatattgttctatttgtatatattgaga2060
taatttatttaatatactttaaataaaggtggactgggattgtt 2104
<210> 2
<211> 19
<212> PRT
<213> Homo sapiens
<400> 2
Gly Ser Cys Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly
1 5 10 15
Gly Ser Pro
<210> 3
<211> 21
<212> DNA
<213> Homo Sapiens
<400> 3
actacaaata ctgtggcagc a 21
<210> 4
<211> 33
<212> DNA
<213> Homo sapiens
<400> 4
tttaagcttt cacgtgccca tacactctac cgg 33
<210> 5
<211> 51
<212> DNA
<213> Homo sapiens
<400> 5
aaatggatcc tggtgcctag gggccccggg actacaaata ctgtggcagc a 51
<210> 6
<211> 5027
<212> DNA
<213> Homo sapiens
<220>
<221> CDS
<222> (413)...(1168)
CA 02318434 2000-06-22
WO 99/32143 PCTNS98/Z7498
4
<400>
6
gtttgacagcttatcatcgactgcacggtgcaccaatgcttctggcgtcaggcagccatc
ggaagctgtggtatggctgtgcaggtcgtaaatcactgcataattcgtgtcgctcaaggc 120
gcactcccgttctggataatgttttttgcgccgacatcataacggttctggcaaatattc 180
tgaaatgagctgttgacaattaatcatccggctcgtataatgtgtggaattgtgagcgga 240
taacaatttcacacaggaaacagcgccgctgagaaaaagcgaagcggcactgctctttaa 300
caatttatcagacaatctgtgtgggcactcgaccggaattatcgattaactttattatta 360
aaaattaaagaggtatatattaatgtatcgattsaataaggaggaataaacc atg ggg 418
Met Gly
1
ggt tct cat cat cat cat cat cat ggt atg get agc atg act ggt gga 466
Gly Ser His His His His His His Gly Met Ala Ser Met Thr Gly Gly
10 15
cag caa atg ggt cgg gat ctg tac gac gat gac gat aag cat cga tgg 514
Gln Gln Met Gly Arg Asp Leu Tyr Asp Asp Asp Asp Lys His Arg Trp
20 25 30
atc Ctg gtg cct agg ggc cec ggg act aca aat act gtg gca gca tat 562
Ile Leu Val Pro Arg Gly Pro Gly Thr Thr Asn Thr Val Ala Ala Tyr
35 40 45 50
aat tta act tgg aaa tca act aat ttc aag aca att ttg gag tgg gaa 610
Asn Leu Thr Trp Lys Ser Thr Asn Phe Lya Thr Ile Leu Glu Trp Glu
55 60 65
ccc aaa ccc gtc aat caa gtc tac act gtt caa ata agc act aag tca 658
Pro Lys Pro Val Asn Gln Val Tyr Thr Val Gln Ile Ser Thr Lys Ser
70 75 80
gga gat tgg aaa agc aaa tgc ttt tac aca aca gac aca gag tgt gac 706
Gly Asp Trp Lya Ser Lye Cys Phe Tyr Thr Thr Asp Thr Glu Cys Asp
85 90 95
ctc acc gac gag att gtg aag gat gtg aag cag acg tac ttg gca cgg 754
Leu Thr Asp Glu Ile Val Lys Asp Val Lys Gln Thr Tyr Leu Ala Arg
100 105 110
gtc ttc tcc tac ccg gca ggg aat gtg gag agc acc ggt tct get ggg 802
Val Phe Ser Tyr Pro Ala Gly Asn Val Glu Ser Thr Gly Ser Ala aly
115 120 125 130
gag cct ctg tat gag aac tcc cca gag ttc aca cct tac ctg gag aca 850
Glu Pro Leu Tyr Glu Asn Ser Pro Glu Phe Thr Pro Tyr Leu Glu Thr
135 140 145
aac ctc gga cag cca aca att cag agt ttt gaa cag gtg gga aca aaa 898
Asn Leu Gly Gln Pro Thr Ile Gln Ser Phe Glu Gln Val Gly Thr Lys
150 155 160
gtg aat gtg acc gta gaa gat gaa cgg act tta gtc aga agg aac aac 946
Val Asn Val Thr Val Glu Asp Glu Arg Thr Leu Val Arg Arg Asn Asn
165 170 175
CA 02318434 2000-06-22
WO 99/32143 PCT/US98/Z7498
act ttc cta agc ctc cgg gat gtt ttt ggc aag gac tta att tat aca 994
Thr Phe Leu Ser Leu Arg Asp Val Phe Gly Lys Asp Leu Ile Tyr Thr
180 185 190
ctt tat tat tgg aaa tct tca agt tca gga aag aaa aca gcc aaa aca 1042
Leu Tyr Tyr Trp Lys Ser Ser Ser Ser Gly Lys Lys Thr Ala Lys Thr
195 200 205 210
aac act aat gag ttt ttg att gat gtg gat aaa gga gaa aac tac tgt 1090
Asn Thr Asn Glu Phe Leu Ile Asp Val Asp Lys Gly Glu Asn Tyr Cys
215 220 225
ttc agt gtt caa gca gtg att ccc tcc cga aca gtt aac cgg aag agt 1138
Phe Ser Val Gln Ala Val Ile Pro Ser Arg Thr Val Asn Arg Lys Ser
230 235 240
aca gac agc ccg gta gag tgt atg ggc acg tgaaagcttg gctgttttgg 1188
Thr Asp Ser Pro Val Glu Cys Met Gly Thr
245 250
cggatgagagaagattttcagcctgatacagattaaatcagaacgcagaagcggtctgat1248
aaaacagaatttgcctggcggcagtagcgcggtggtcccacctgaccccatgccgaactc1308
agaagtgaaacgccgtagcgccgatggtagtgtggggtctccccatgcgagagtagggaa1368
ctgccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatct1428
gttgtttgtcggtgaacgctctcctgagtaggacaaatccgccgggagcggatttgaacg1488
ttgcgaagcaacggcccggagggtggcgggcaggacgcccgccataaactgccaggcatc1548
aaattaagcagaaggccatcctgacggatggcctttttgcgtttctacaaactctttttg1608
tttatttttctaaatacattcaaatatgtatecgctcatgagacaataaccctgataaat1668
gcttcaataatattgaaaaaggaagagtatgagtattcaacatttccgtgtcgcccttat1728
tcccttttttgcggcattttgccttcctgtttttgctcacccagaaacgctggtgaaagt1788
aaaagatgctgaagatcagttgggtgcacgagtgggttacatcgaactggatctcaacag1848
cggtaagatccttgagagttttcgccccgaagaacgttttccaatgatgagcacttttaa1908
agttctgctatgtggcgcggtattatcccgtgttgacgccgggcaagagcaactcggtcg1968
ccgcatacactattctcagaatgacttggttgagtactcaccagtcacagaaaagcatct2028
tacggatggcatgacagtaagagaattatgcagtgctgccataaccatgagtgataacac2088
tgcggccaacttacttctgacaacgatcggaggaccgaaggagctaaccgcttttttgca2148
caacatgggggatcatgtaactcgccttgatcgttgggaaccggagctgaatgaagccat2208
accaaacgacgagcgtgacaccacgatgcctgtagcaatggcaacaacgttgcgcaaact2268
attaactggcgaactacttactctagcttcccggcaacaattaatagactggatggaggc2328
ggataaagttgcaggaccacttctgcgctcggcccttccggctggctggtttattgctga2388
taaatctggagccggtgagcgtgggtctcgcggtatcattgcagcactggggccagatgg2448
taagccctcccgtatcgtagttatctacacgacggggagtcaggcaactatggatgaacg2508
aaatagacagatcgctgagataggtgcctcactgattaagcattggtaactgtcagacca2568
agtttactcatatatactttagattgatttaaaacttcatttttaatttaaaaggatcta2628
ggtgaagatcctttttgataatctcatgaccaaaatccettaacgtgagttttcgttcca2688
ctgagcgtcagaccccgtagaaaagatcaaaggatcttcttgagatcctttttttctgcg2748
cgtaatctgctgcttgcaaacaaaaaaaccaccgctaccagcggtggtttgtttgccgga2808
tcaagagctaccaactctttttccgaaggtaactggcttcagcagagcgcagataccaaa2868
tactgtccttctagtgtagccgtagttaggccaccacttcaagaactctgtagcaccgcc2928
tacatacctcgctctgctaatcctgttaccagtggctgctgccagtggcgataagtcgtg2988
tcttaccgggttggactcaagacgatagttaccggataaggcgcagcggtcgggctgaac3048
ggggggttcgtgcacacagcccagcttggagcgaacgacctacaccgaactgagatacct3108
acagcgtgagctatgagaaagcgccacgcttcccgaagggagaaaggcggacaggtatcc3168
ggtaagcggcagggtcggaacaggagagcgcacgagggagcttccagggggaaacgcctg3228
gtatctttatagtcctgtcgggtttcgccacctctgacttgagcgtcgatttttgtgatg3288
CA 02318434 2000-06-22
WO 99/32143 PCTNS98IZ7498
6
ctcgtcaggggggcggagcctatggaaaaacgccagcaacgcggcctttttacggttcct3348
ggccttttgctggccttttgctcacatgttctttcctgcgttatcccctgattctgtgga3408
taaccgtattaccgcctttgagtgagctgataccgctcgccgcagccgaacgaccgagcg3468
cagcgagtcagtgagcgaggaagcggaagagcgcctgatgcggtattttctccttacgca3528
tctgtgcggtatttcacaccgcatatggtgcactctcagtacaatctgctctgatgccgc3588
atagttaagccagtatacactccgctatcgctacgtgactgggtcatggctgcgccccga3648
cacccgccaacacccgctgacgcgccctgacgggcttgtctgctcccggcatccgcttac3708
agacaagctgtgaccgtctccgggagctgcatgtgtcagaggttttcaccgtcatcaccg3768
aaacgcgcgaggcagcagatcaattcgcgcgcgaaggcgaagcggcatgcatttacgttg3828
acaccatcgaatggtgcaaaacctttcgcggtatggcatgatagcgcccggaagagagtc3888
aattcagggtggtgaatgtgaaaccagtaacgttatacgatgtcgcagagtatgccggtg3948
tctcttatcagaccgtttcccgcgtggtgaaccaggccagccacgtttctgcgaaaacgc4008
gggaaaaagtggaagcggcgatggcggagctgaattacattcccaaccgcgtggcacaac4068
aactggcgggcaaacagtcgttgctgattggcgttgccacctccagtctggccctgcacg4128
cgccgtcgcaaattgtcgcggcgattaaatctcgcgccgatcaactgggtgccagcgtgg4188
tggtgtcgatggtagaacgaagcggcgtcgaagcctgtaaagcggcggtgcacaatcttc4248
tcgcgcaacgcgtcagtgggctgatcattaactatccgctggatgaccaggatgccattg4308
ctgtggaagctgcctgcactaatgttccggcgttatttcttgatgtctctgaccagacac4368
ccatcaacagtattattttctcccatgaagacggtacgcgactgggcgtggagcatctgg4428
tcgcattgggtcaccagcaaatcgcgctgttagcgggcccattaagttctgtctcggcgc4488
gtctgcgtctggctggctggcataaatatctcactcgcaatcaaattcagccgatagcgg4548
aacgggaaggcgactggagtgccatgtccggttttcaacaaaccatgcaaatgctgaatg4608
agggcatcgttcccactgcgatgctggttgccaacgatcagatggcgctgggcgcaatgc4668
gcgccattaccgagtccgggctgcgcgttggtgcggatatctcggtagtgggatacgacg4728
ataccgaagacagctcatgttatatcccgccgtcaaccaccatcaaacaggattttcgcc4788
tgctggggcaaaccagcgtggaccgcttgctgcaactctctcagggccaggcggtgaagg4848
gcaatcagctgttgcccgtctcactggtgaaaagaaaaaccaccctggcgcccaatacgc4908
aaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttccc4968
gactggaaagcgggcagtgagcgcaacgcaattaatgtgagttagcgcgaattgatctg 5027
<210> 7
<211> 32
<212> DNA
<213> Homo sapiens
<400> 7
gatcctggtc cctaggggag gaggcggttc ag 32
<210> 8
<211> 30
<212> DNA
<213>~Homo sapiens
<400> 8
gtggtggagg taccggaggt ggaggttctc 30
<210> 9
<211> 13
<212> DNA
<213> Homo sapiens
<400> 9
ccctagggac cag 13
<210> 10
CA 02318434 2000-06-22
WO 99/32143 PCT/US98/Z7498
7
<211> 13
<212> DNA
<213> Homo sapiens
<400> 10
ccctagggac cag 13
<210> li
<211> 21
<212> DNA
<213> Homo sapiens
<400> 11
ccgggagtac ctccacctcc g 21
<210> 12
<211> 5069
<212> DNA
<213> Homo sapiens
<220>
<221> CDS
<222> (413)...(1210)
<400>
12
gtttgacagcttatcatcgactgcacggtgcaccaatgcttctggcgtcaggcagccatc 60
ggaagctgtggtatggctgtgcaggtcgtaaatcactgcataattcgtgtcgctcaaggc 120
gcactcccgttctggataatgttttttgcgccgacatcataacggttctggcaaatattc 180
tgaaatgagctgttgacaattaatcatccggctcgtataatgtgtggaattgtgagcgga 240
taacaatttcacacaggaaacagcgccgctgagaaaaagcgaagcggcactgctctttaa 300
caatttatcagacaatctgtgtgggcactcgaccggaattatcgattaactttattatta 360
aaaattaaagaggtatatattaatgtatcgattaaataaggaggaataaacc atg ggg 418
Met Gly
1
ggt tct cat cat cat cat cat cat ggt atg get agc atg act ggt gga 466
Gly Ser His His His Hie His His Gly Met Ala Ser Met Thr Gly Gly
10 15
cag caa atg ggt cgg gat ctg tac gac gat gac gat aag cat cga tgg 514
Gln Gln Met Gly Arg Asp Leu Tyr Asp Asp Asp Asp Lys His Arg Trp
20 25 30
atc ctg gtc cct agg gga gga ggc ggt tca ggt ggt gga ggt acc gga 562
Ile Leu Val Pro Arg Gly Gly Gly Gly Ser Gly Gly Gly Gly Thr Gly
35 40 45 50
ggt gga ggt tct ccc ggg act aca aat act gtg gca gca tat aat tta 610
Gly Gly Gly Ser Pro Gly Thr Thr Asn Thr Val Ala Ala Tyr Asn Leu
55 60 65
act tgg aaa tca act aat ttc aag aca att ttg gag tgg gaa ccc aaa 658
Thr Trp Lys Ser Thr Asn Phe Lys Thr Ile Leu Glu Trp Glu Pro Lys
70 75 80
CA 02318434 2000-06-22
WO 99!32143 PGTNS981S9498
8
ccc gtc aat caa gtc tac act gtt caa ata agc act aag tca gga gat 706
Pro Val Asn Gln Val Tyr Thr Val Gln Ile Ser Thr Lys Ser Gly Asp
85 90 95
tgg aaa agc aaa tgc ttt tac aca aca gac aca gag tgt gac ctc acc 754
Trp Lys Ser Lys Cys Phe Tyr Thr Thr Asp Thr Glu Cys Asp Leu Thr
100 105 110
gac gag att gtg aag gat gtg aag cag acg tac ttg gca cgg gtc ttc 802
Asp Glu Ile Val Lys Asp Val Lys Gln Thr Tyr Leu Ala Arg Val Phe
115 120 125 130
tcc tac ccg gca ggg aat gtg gag agc acc ggt tct get ggg gag cct 850
Ser Tyr Pro Ala Gly Asn Val Glu Ser Thr Gly Ser Ala Gly Glu Pro
135 140 145
ctg tat gag aac tcc cca gag ttc aca cct tac ctg gag aca aac ctc 898
Leu Tyr Glu Asn Ser Pro Glu Phe Thr Pro Tyr Leu Glu Thr Asn Leu
150 155 160
gga cag cca aca att cag agt ttt gaa cag gtg gga aca aaa gtg aat 946
Gly Gln Pro Thr Ile Gln Ser Phe Glu Gln Val Gly Thr Lys Val Asn
165 170 175
gtg acc gta gaa gat gaa cgg act tta gtc aga agg aac aac act ttc 994
Val Thr Val Glu Asp Glu Arg Thr Leu Val Arg Arg Asn Asn Thr Phe
180 185 190
cta agc ctc cgg gat gtt ttt ggc aag gac tta att tat aca ctt tat 1042
Leu Ser Leu Arg Asp Val Phe Gly Lys Asp Leu Ile Tyr Thr Leu Tyr
195 200 205 210
tat tgg aaa tct tca agt tca gga aag aaa aca gcc aaa aca aac act 1090
Tyr Trp Lys Ser Ser Ser Ser Gly Lys Lys Thr Ala Lys Thr Asn Thr
215 220 225
aat gag ttt ttg att gat gtg gat aaa gga gaa aac tac tgt ttc agt 1138
Asn Glu Phe Leu Ile Asp Val Asp Lys Gly Glu Asn Tyr Cys Phe Ser
230 235 240
gtt caa gca gtg att ccc tcc cga aca gtt aac cgg aag agt aca gac 1186
Val Gln Ala Val Ile Pro Ser Arg Thr Val Asn Arg Lys Ser Thr Asp
245 250 255
agc ccg gta gag tgt atg ggc acg tgaaagcttg gctgttttgg cggatgagag 1240
Ser Pro Val Glu Cys Met Gly Thr
260 265
aagattttcagcctgatacagattaaatcagaacgcagaagcggtctgataaaacagaat1300
ttgcctggcggcagtagcgcggtggtcccacctgaccccatgccgaactcagaagtgaaa1360
cgccgtagcgccgatggtagtgtggggtctccccatgcgagagtagggaactgccaggca1420
tcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtc1480
ggtgaacgctctcctgagtaggacaaatccgccgggagcggatttgaacgttgcgaagca1540
acggcccggagggtggcgggcaggacgcccgccataaactgccaggcatcaaattaagca1600
gaaggccatcctgacggatggcctttttgcgtttctacaaactctttttgtttatttttc1660
CA 02318434 2000-06-22
WO 99/32143 PCT/US98lZ'1498
9
taaatacattcaaatatgtatccgctcatgagacaataaccctgataaatgcttcaataa1720
tattgaaaaaggaagagtatgagtattcaacatttccgtgtcgcccttattccctttttt1780
gcggcattttgccttcctgtttttgctcacccagaaacgctggtgaaagtaaaagatgct1840
gaagatcagttgggtgcacgagtgggttacatcgaactggatctcaacagcggtaagatc1900
cttgagagttttcgccccgaagaacgttttccaatgatgagcacttttaaagttctgcta1960
tgtggcgcggtattatcccgtgttgacgccgggcaagagcaactcggtcgccgcatacac2020
tattctcagaatgacttggttgagtactcaccagtcacagaaaagcatcttacggatggc2080
atgacagtaagagaattatgcagtgctgccataaccatgagtgataacactgcggccaac2140
ttaettctgacaacgatcggaggaccgaaggagctaaccgcttttttgcacaacatgggg2200
gatcatgtaactcgccttgatcgttgggaaccggagctgaatgaagccataccaaacgac2260
gagcgtgacaccacgatgcctgtagcaatggcaacaacgttgcgcaaactattaactggc2320
gaactacttactctagcttcccggcaacaattaatagactggatggaggcggataaagtt2380
gcaggaccacttctgcgctcggcccttccggctggctggtttattgctgataaatctgga2440
gccggtgagcgtgggtctcgcggtatcattgcagcactggggccagatggtaagccctcc2500
cgtatcgtagttatctacacgacggggagtcaggcaactatggatgaacgaaatagacag2560
atcgctgagataggtgcctcactgattaagcattggtaactgtcagaccaagtttactca2620
tatatactttagattgatttaaaacttcatttttaatttaaaaggatctaggtgaagatc2680
ctttttgataatctcatgaccaaaatcccttaacgtgagttttcgttccactgagcgtca2740
gaccccgtagaaaagatcaaaggatcttcttgagatcctttttttctgcgcgtaatctgc2800
tgcttgcaaacaaaaaaaccaccgctaccagcggtggtttgtttgccggatcaagagcta2860
ccaactctttttccgaaggtaactggcttcagcagagcgcagataccaaatactgtcctt2920
ctagtgtagccgtagttaggccaccacttcaagaactctgtagcaccgcctacatacctc2980
gctctgctaatcctgttaccagtggctgctgccagtggcgataagtcgtgtcttaccggg3040
ttggactcaagacgatagttaccggataaggcgcagcggtcgggctgaacggggggttcg3100
tgcacacagcccagcttggagcgaacgacctacaccgaactgagatacctacagcgtgag3160
ctatgagaaagcgccacgcttcccgaagggagaaaggcggacaggtatccggta~gcggc3220
agggtcggaacaggagagcgcacgagggagcttccagggggaaacgcctggtatctttat3280
agtcctgtcgggtttcgccacctctgacttgagcgtcgatttttgtgatgctcgtcaggg3340
gggcggagcctatggaaaaacgccagcaacgcggcctttttacggttcctggccttttgc3400
tggccttttgctcacatgttctttcctgcgttatcccctgattctgtggataaccgtatt3460
accgcctttgagtgagctgataccgctcgccgcagccgaacgaccgagcgcagcgagtca3520
gtgagcgaggaagcggaagagcgcctgatgcggtattttctccttacgcatctgtgcggt3580
atttcacaccgcatatggtgcactctcagtacaatctgctctgatgccgcatagttaagc3640
cagtatacactccgctatcgctacgtgactgggtcatggctgcgccccgacacccgccaa3700
cacccgctgacgcgccctgacgggcttgtctgctcccggcatccgcttacagacaagctg3760
tgaccgtctccgggagctgcatgtgtcagaggttttcaccgtcatcaccgaaacgcgcga3820
ggcagcagatcaattcgcgcgcgaaggcgaagcggcatgcatttacgttgacaccatcga3880
atggtgcaaaacetttcgcggtatggcatgatagcgcccggaagagagtcaattcagggt3940
ggtgaatgtgaaaccagtaacgttatacgatgtcgcagagtatgccggtgtctcttatca4000
gaccgtttcccgcgtggtgaaccaggccagccacgtttctgcgaaaacgcgggaaaaagt4060
ggaagcggcgatggcggagctgaattacattcccaaccgcgtggcacaacaactggcggg4120
caaacagtcgttgctgattggcgttgccacctccagtctggccctgcacgcgccgtcgca4180
aattgtcgcggcgattaaatctcgcgccgatcaactgggtgccagcgtggtggtgtcgat4240
ggtagaacgaagcggcgtcgaagcctgtaaagcggcggtgcacaatcttctcgcgcaacg4300
cgtcagtgggctgatcattaactatccgctggatgaccaggatgccattgctgtggaagc4360
tgcctgcactaatgttccggcgttatttcttgatgtctctgaccagacacccatcaacag4420
tattattttctcccatgaagacggtacgcgactgggcgtggagcatctggtcgcattggg4480
tcaccagcaaatcgcgctgttagcgggcccattaagttctgtctcggcgcgtctgcgtct4540
ggctggctggcataaatatctcactcgcaatcaaattcagccgatagcggaacgggaagg4600
cgactggagtgccatgtccggttttcaacaaaccatgcaaatgctgaatgagggcatcgt4660
tcccactgcgatgctggttgccaacgatcagatggcgctgggcgcaatgcgcgccattac4720
cgagtccgggctgcgcgttggtgcggatatctcggtagtgggatacgacgataccgaaga4780
cagctcatgttatatcccgccgtcaaccaccatcaaacaggattttcgcctgctggggca4840
aaccagcgtggaccgcttgctgcaactctctcagggccaggcggtgaagggcaatcagct4900
gttgcccgtctcactggtgaaaagaaaaaccaccctggcgcccaatacgcaaaccgcctc4960
CA 02318434 2000-06-22
WO 99/32143 PCT/US98~Z7498
tccccgcgcg ttggccgatt cattaatgca gctggcacga caggtttccc gactggaaag 5020
cgggcagtga gcgcaacgca attaatgtga gttagcgcga attgatctg 5069
<210> 13
<211> 28
<212> DNA
<213> Homo Sapiens
<400> 13
tcaggaaaga aaaaagccaa aacaaaca 28
<210> 14
<211> 26
<212> DNA
<213> Homo sapiens
<400> 14
gacttggttg aggcctcacc agtcac 26
<210> 15
<211> 5069
<212> DNA
<213> Homo sapiens
<220>
<221> CDS
<222> (413) ... (1210)
<400> 15
gtttgacagcttatcatcgactgcacggtgcaccaatgcttctggcgtcaggcagccatc60
ggaagctgtggtatggctgtgcaggtcgtaaatcactgcataattcgtgtcgctcaaggc120
gcactcccgttctggataatgttttttgcgccgacatcataacggttctggcaaatattc180
tgaaatgagctgttgacaattaatcatecggctcgtataatgtgtggaattgtgagcgga240
taacaatttcacacaggaaacagcgccgctgagaaaaagcgaagcggcactgctctttaa300
caatttatcagacaatctgtgtgggcactcgaccggaattatcgattaactttattatta360
aaaattaaagaggtatatattaatgtatcgattaaataaggaggaataaacc atg 418
ggg
Met Gly
1
ggt tct cat cat cat cat cat cat ggt atg get agc atg act ggt gga 466
Gly Ser His His His His His His Gly Met Ala Ser Met Thr Gly Gly
5 10 15
cag caa atg ggt cgg gat ctg tac gac gat gac gat aag cat cga tgg 514
Gln Gln Met Gly Arg Asp Leu Tyr Asp Asp Asp Asp Lys His Arg Trp
25 30
atc ctg gtc cct agg gga gga ggc ggt tca ggt ggt gga ggt acc gga 562
Ile Leu Val Pro Arg Gly Gly Gly Gly Ser Gly Gly Gly Gly Thr Gly
35 40 45 50
ggt gga ggt tct ccc ggg act aca aat act gtg gca gca tat aat tta 610
Gly Gly Gly Ser Pro Gly Thr Thr Asn Thr Val Ala Ala Tyr Asn Leu
55 60 65
CA 02318434 2000-06-22
WO 99/31143 PCTNS98/Z7498
11
act tgg aaa tca act aat ttc aag aca att ttg gag tgg gaa ccc aaa 658
Thr Trp Lys Ser Thr Asn Phe Lys Thr Ile Leu Glu Trp Glu Pro Lys
70 75 80
ccc gtc aat caa gtc tac act gtt caa ata agc act aag tca gga gat 706
Pro Val Asn Gln Val Tyr Thr Val Gln Ile Ser Thr Lys Ser Gly Asp
85 90 95
tgg aaa agc aaa tgc ttt tac aca aca gac aca gag tgt gac ctc acc 754
Trp Lys Ser Lys Cys Phe Tyr Thr Thr Asp Thr Glu Cys Asp Leu Thr
100 105 110
gac gag att gtg aag gat gtg aag cag acg tac ttg gca cgg gtc ttc 802
Asp Glu Ile Val Lys Asp Val Lys Gln Thr Tyr Leu Ala Arg Val Phe
115 120 125 130
tcc tac ccg gca ggg aat gtg gag agc acc ggt tct get ggg gag cct 850
Ser Tyr Pro Ala Gly Asn Val Glu Ser Thr Gly Ser Ala Gly Glu Pro
135 140 145
ctg tat gag aac tcc cca gag ttc aca cct tac ctg gag aca aac ctc 898
Leu Tyr Glu Asn Ser Pro Glu Phe Thr Pro Tyr Leu Glu Thr Asn Leu
150 155 160
gga cag cca aca att cag agt ttt gaa cag gtg gga aca aaa gtg aat 946
Gly Gln Pro Thr Ile Gln Ser Phe Glu Gln Val Gly Thr Lys Val Asn
165 170 175
gtg acc gta gaa gat gaa cgg act tta gtc aga agg aac aac act ttc 994
Val Thr Val Glu Asp Glu Arg Thr Leu Val Arg Arg Asn Asn Thr Phe
180 185 190
cta agc ctc cgg gat gtt ttt ggc aag gac tta att tat aca ctt tat 1042
Leu Ser Leu Arg Asp Val Phe Gly Lys Asp Leu Ile Tyr Thr Leu Tyr
195 200 205 210
tat tgg aaa tct tca agt tca gga aaa aaa aaa gcc aaa aca aac act 1090
Tyr Trp Lys Ser Ser Ser Ser Gly Lys Lys Lys Ala Lys Thr Asn Thr
215 220 225
aat gag ttt ttg att gat gtg gat aaa gga gaa aac tac tgt ttc agt 1138
Asn Glu Phe Leu Ile Asp Val Asp Lys Gly Glu Asn Tyr Cys Phe Ser
230 235 240
gtt caa gca gtg att ccc tcc cga aca gtt aac cgg aag agt aca gac 1186
Val Gln Ala Val Ile Pro Ser Arg Thr Val Asn Arg Lys Ser Thr Asp
245 250 255
agc ccg gta gag tgt atg ggc acg tgaaagcttg gctgttttgg cggatgagag 1240
Ser Pro Val Glu Cys Met Gly Thr
260 265
aagattttca gcctgataca gattaaatca gaacgcagaa gcggtctgat aaaacagaat 1300
ttgcctggcg gcagtagcgc ggtggtccca cctgacccca tgccgaactc agaagtgaaa 1360
cgccgtagcg ccgatggtag tgtggggtct ccccatgcga gagtagggaa ctgccaggca 1420
CA 02318434 2000-06-22
WO 99!32143 PCT/US98r17498
12
tcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtc1480
ggtgaacgctctcctgagtaggacaaatccgccgggagcggatttgaacgttgcgaagca1540
acggcccggagggtggcgggcaggacgcccgccataaactgccaggcatcaaattaagca1600
gaaggccatcctgacggatggcctttttgcgtttctacaaactctttttgtttatttttc1660
taaatacattcaaatatgtatccgctcatgagacaataaccctgataaatgcttcaataa1720
tattgaaaaaggaagagtatgagtattcaacatttccgtgtcgcccttattccctttttt1780
gcggcattttgccttcctgtttttgctcacccagaaacgctggtgaaagtaaaagatgct1840
gaagatcagttgggtgcacgagtgggttacatcgaactggatctcaacagcggtaagatc1900
cttgagagttttcgccccgaagaacgttttccaatgatgagcacttttaaagttctgcta1960
tgtggcgcggtattatcccgtgttgacgccgggcaagagcaactcggtcgccgcatacac2020
tattctcagaatgacttggttgaggcctcaccagtcacagaaaagcatcttacggatggc2080
atgacagtaagagaattatgcagtgctgccataaccatgagtgataacactgcggccaac2140
ttacttctgacaacgatcggaggaccgaaggagctaaccgcttttttgcacaacatgggg2200
gatcatgtaactcgccttgatcgttgggaaccggagctgaatgaagccataccaaacgac2260
gagcgtgacaccacgatgcctgtagcaatggcaacaacgttgcgcaaactattaactggc2320
gaactacttactctagcttcccggcaacaattaatagactggatggaggcggataaagtt2380
gcaggaccacttctgcgctcggcccttccggctggctggtttattgctgataaatctgga2440
gccggtgagcgtgggtctcgcggtatcattgcagcactggggccagatggtaagccctcc2500
cgtatcgtagttatctacacgacggggagtcaggcaactatggatgaacgaaatagacag2560
atcgctgagataggtgcctcactgattaagcattggtaactgtcagaccaagtttactca2620
tatatactttagattgatttaaaacttcatttttaatttaaaaggatctaggtgaagatc2680
ctttttgataatctcatgaccaaaatcccttaacgtgagttttcgttccactgagcgtca2740
gaccccgtagaaaagatcaaaggatcttcttgagatcctttttttctgcgcgtaatctgc2800
tgcttgcaaacaaaaaaaccaccgctaccagcggtggtttgtttgccggatcaagagcta2860
ccaactctttttccgaaggtaactggcttcagcagagcgcagataccaaatactgtcctt2920
ctagtgtagccgtagttaggccaccacttcaagaactctgtagcaccgcctacatacctc2980
gctctgctaatcctgttaccagtggctgctgccagtggcgataagtcgtgtcttaccggg3040
ttggactcaagacgatagttaccggataaggcgcagcggtcgggctgaacggggggttcg3100
tgcacacagcccagcttggagcgaacgacctacaccgaactgagatacctacagcgtgag3160
ctatgagaaagcgccacgcttcccgaagggagaaaggcggacaggtatccggtaagcggc3220
agggtcggaacaggagagcgcacgagggagcttccagggggaaacgcctggtatctttat3280
agtcctgtcgggtttcgccacctctgacttgagcgtcgatttttgtgatgctcgtcaggg3340
gggcggagcctatggaaaaacgccagcaacgcggcctttttacggttcctggccttttgc3400
tggccttttgctcacatgttctttectgcgttatcccctgattctgtggataaccgtatt3460
accgcctttgagtgagctgataccgctcgccgcagccgaacgaccgagcgcagcgagtca3520
gtgagcgaggaagcggaagagcgcctgatgcggtattttctccttacgcatctgtgcggt3580
atttcacaccgcatatggtgcactctcagtacaatctgctctgatgccgcatagttaagc3640
cagtatacactccgctatcgctacgtgactgggtcatggctgcgccccgacacccgccaa3700
cacccgctgacgcgccctgacgggcttgtctgctcccggcatccgcttacagacaagctg3760
tgaccgtctccgggagctgcatgtgtcagaggttttcaccgtcatcaccgaaacgcgcga3820
ggcagcagatcaattcgcgcgcgaaggcgaagcggcatgcatttacgttgacaccatcga3880
atggtgcaaaacctttcgcggtatggcatgatagcgcccggaagagagtcaattcagggt3940
ggtgaatgtgasaccagtaacgttatacgatgtcgcagagtatgccggtgtctcttatca4000
gaccgtttcccgcgtggtgaaccaggccagccacgtttctgcgaaaacgcgggaaaaagt4060
ggaagcggcgatggcggagctgaattacattcccaaccgcgtggcacaacaactggcggg4120
caaacagtcgttgctgattggcgttgccacctccagtctggccctgcacgcgccgtcgca4180
aattgtcgcggcgattaaatctcgcgccgatcaactgggtgccagcgtggtggtgtcgat4240
ggtagaacgaagcggcgtcgaagcctgtaaagcggcggtgcacaatcttctcgcgcaacg4300
cgtcagtgggctgatcattaactatccgctggatgaccaggatgccattgctgtggaagc4360
tgcctgcactaatgttccggcgttatttcttgatgtctctgaccagacacccatcaacag4420
tattattttctcccatgaagacggtacgcgactgggcgtggagcatctggtcgcattggg4480
tcaccagcaaatcgcgctgttagcgggcccattaagttctgtctcggcgcgtctgcgtct4540
ggctggctggcataaatatctcactcgcaatcaaattcagccgatagcggaacgggaagg4600
cgactggagtgccatgtccggttttcaacaaaccatgcaaatgctgaatgagggcatcgt4660
tcccactgcgatgctggttgccaacgatcagatggcgctgggcgcaatgcgcgccattac4720
CA 02318434 2000-06-22
WO 99/32143 PGT/US98/Z7498
13
cgagtccggg ctgcgcgttggtgcggatatctcggtagtgggatacgacgataccgaaga4780
cagctcatgt tatatcccgccgtcaaccaccatcaaacaggattttcgcctgctggggca4840
aaccagcgtg gaccgcttgctgcaactctctcagggccaggcggtgaagggcaatcagct4900
gttgcccgtc tcactggtgaaaagaaaaaccaccctggcgcccaatacgcaaaccgcctc4960
tccccgcgcg ttggccgattcattaatgcagctggcacgacaggtttcccgactggaaag5020
cgggcagtga gcgcaacgcaattaatgtgagttagcgcgaattgatctg 5069
<210> 16
<211> 37
<212> DNA
<213> Homo sapiens
<400> 16
gatcttggtc cctaggggat ccgcagaacc aatgcct 37
<210> 17
<211> 36
<212> DNA
<213> Homo sapiens
<400> 17
cactcgctaa acttcagtca atacctctgg tatact 36
<210> 18
<211> 36
<212> DNA
<213> Homo Sapiens
<400> 18
ggtaccggag gaggcggttc aggtggtgga ggttca 36
<210> 19
<211> 16
<212> DNA
<213> Homo sapiens
<400> 19
ggaggtggag gttctc 16
<210> 20
<211> 23
<212> DNA
<213> Homo sapiens
<400> 20
tctgcggatc ccctagggac caa
23
<210> 21
<211> 36
<212> DNA
<213> Homo sapiens
<400> 21
aggtattgac tgaagtttag cgagtgaggc attggt 36
CA 02318434 2000-06-22
WO 99/32143 PCT/US98/Z7498
14
<210> 22
<211> 36
<212> DNA
<213> Homo sapiens
<400> 22
ccacctgaac cgcctcctcc ggtaccagta taccag 3s
<210> 23
<211> 30
<212> DNA
<213> Homo sapiens
<400> 23
ccgggagaac ctccacctcc tgaacctcca 30
<210> 24
<211> 5132
<212> DNA
<213> Homo sapiens
<220>
<221> CDS
<222> (413)...(1273)
<400> 24
gtttgacagc ttatcatcga ctgcacggtg caccaatgct tctggcgtca ggcagccatc 60
ggaagctgtg gtatggctgt gcaggtcgta aatcactgca taattcgtgt cgctcaaggc 120
gcactcccgt tctggataat gttttttgcg ccgacatcat aacggttctg gcaaatattc 180
tgaaatgagc tgttgacaat taatcatccg gctcgtataa tgtgtggaat tgtgagcgga 240
taacaatttc acacaggaaa cagcgccgct gagaaaaagc gaagcggcac tgctctttaa 300
caatttatca gacaatctgt gtgggcactc gaccggaatt atcgattaac tttattatta 360
aaaattaaag aggtatatat taatgtatcg attaaataag gaggaataaa cc atg ggg 418
Met Gly
1
ggt tct cat cat cat cat cat cat ggt atg get agc atg act ggt gga 466
Gly Ser His His His His His His Gly Met Ala Ser Met Thr Gly Gly
10 15
cag caa atg ggt cgg gat ctg tac gac gat gac gat aag cat cga tgg 514
Gln Gln Met Gly Arg Asp Leu Tyr Asp Asp Asp Asp Lys His Arg Trp
20 25 30
atc ttg gtc cct agg gga tcc gca gaa cca atg cct cac tcg cta aac 562
Ile Leu Val Pro Arg Gly Ser Ala Glu Pro Met Pro His Ser Leu Asn
35 40 45 50
ttc agt caa tac ctc tgg tat act ggt acc gga gga ggc ggt tca ggt 610
Phe Ser Gln Tyr Leu Trp Tyr Thr Gly Thr Gly Gly Gly Gly Ser Gly
55 60 65
ggt gga ggt tca gga ggt gga ggt tct ccc ggg act aca aat act gtg 658
Gly Gly Gly Ser Gly Gly Gly Gly Ser Pro Gly Thr Thr Asn Thr Val
70 75 80
CA 02318434 2000-06-22
WO 99/31143 PCTNS98/Z9498
gca gca tat aat tta act tgg aaa tca act aat ttc aag aca att ttg 706
Ala Ala Tyr Asn Leu Thr Trp Lys Ser Thr Asn Phe Lys Thr Ile Leu
85 90 95
gag tgg gaa ccc aaa ccc gtc aat caa gtc tac act gtt caa ata agc 754
Glu Trp Glu Pro Lys Pro Val Asn Gln Val Tyr Thr Val Gln Ile Ser
100 105 110
act aag tca gga gat tgg aaa agc aaa tgc ttt tac aca aca gac aca 802
Thr Lys Ser Gly Asp Trp Lys Ser Lys Cys Phe Tyr Thr Thr Asp Thr
115 120 125 130
gag tgt gac ctc acc gac gag att gtg aag gat gtg aag cag acg tac 850
Glu Cys Asp Leu Thr Asp Glu Ile Val Lys Asp Val Lys Gln Thr Tyr
135 140 145
ttg gca cgg gtc ttc tcc tac ccg gca ggg aat gtg gag agc acc ggt 898
Leu Ala Arg Val Phe Ser Tyr Pro Ala Gly Asn Val Glu Ser Thr Gly
150 155 160
tct get ggg gag cct ctg tat gag aac tcc cca gag ttc aca cct tac 946
Ser Ala Gly Glu Pro Leu Tyr Glu Asn Ser Pro Glu Phe Thr Pro Tyr
165 170 175
ctg gag aca aac ctc gga cag cca aca att cag agt ttt gaa cag gtg 994
Leu Glu Thr Asn Leu Gly Gln Pro Thr Ile Gln Ser Phe Glu Gln Val
180 185 190
gga aca aaa gtg aat gtg acc gta gaa gat gaa cgg act tta gtc aga 1042
Gly Thr Lys Val Asn Val Thr Val Glu Asp Glu Arg Thr Leu Val Arg
195 200 205 210
agg aac aac act ttc cta agc ctc cgg gat gtt ttt ggc aag gac tta 1090
Arg Asn Asn Thr Phe Leu Ser Leu Arg Asp Val Phe Gly Lys Asp Leu
215 220 225
att tat aca ctt tat tat tgg aaa tct tca agt tca gga aaa aaa aaa 1138
Ile Tyr Thr Leu Tyr Tyr Trp Lys Ser Ser Ser Ser Gly Lys Lys Lys
230 235 240
gcc aaa aca aac act aat gag ttt ttg att gat gtg gat aaa gga gaa 1186
Ala Lys Thr Asn Thr Asn Glu Phe Leu Ile Asp Val Asp Lys Gly Glu
245 250 255
aac tac tgt ttc agt gtt caa gca gtg att ccc tcc cga aca gtt aac 1234
Asn Tyr Cys Phe ser Val Gln Ala Val Ile Pro Ser Arg Thr Val Asn
260 265 270
cgg aag agt aca gac agc ccg gta gag tgt atg ggc acg tgaaagcttg 1283
Arg Lys Ser Thr Asp Ser Pro Val Glu Cys Met Gly Thr
275 280 285
gctgttttgg cggatgagag aagattttca gcctgataca gattaaatca gaacgcagaa 1343
gcggtctgat aaaacagaat ttgcctggcg gcagtagcgc ggtggtccca cctgacccca 1403
CA 02318434 2000-06-22
WO 99/32143 PCTJUS98n7498
16
tgccgaactcagaagtgaaacgccgtagcgccgatggtagtgtggggtctccccatgcga1463
gagtagggaactgccaggcatcaaataasacgaaaggctcagtcgaaagactgggccttt1523
cgttttatctgttgtttgtcggtgaacgctctcctgagtaggacaaatccgccgggagcg1583
gatttgaacgttgcgaagcaacggcccggagggtggcgggcaggacgcccgccataaact1643
gccaggcatcaaattaagcagaaggccatcctgacggatggcctttttgcgtttctacaa1703
actctttttgtttatttttctaaatacattcaaatatgtatccgctcatgagacaataac1763
cctgataaatgcttcaataatattgaaaaaggaagagtatgagtattcaacatttccgtg1823
tcgcccttattcccttttttgcggcattttgccttcctgtttttgctcacccagaaacgc1883
tggtgaaagtaaaagatgctgaagatcagttgggtgcacgagtgggttacategaactgg1943
atctcaacagcggtaagatccttgagagttttcgccccgaagaacgttttccaatgatga2003
gcacttttaaagttctgctatgtggcgcggtattatcccgtgttgacgccgggcaagagc2063
aactcggtcgccgcatacactattctcagaatgacttggttgaggcctcaccagtcacag2123
aaaagcatcttacggatggcatgacagtaagagaattatgcagtgctgccataaccatga2183
gtgataacactgcggccaacttacttctgacaacgatcggaggaccgaaggagctaaccg2243
cttttttgcacaacatgggggatcatgtaactcgccttgatcgttgggaaccggagctga2303
atgaagccataccaaacgacgagcgtgacaccacgatgcctgtagcaatggcaacaacgt2363
tgcgcaaactattaactggcgaactacttactctagcttcccggcaacaattaatagact2423
ggatggaggcggataaagttgcaggaccacttctgcgctcggcccttccggctggctggt2483
ttattgctgataaatctggagccggtgagcgtgggtctcgcggtatcattgcagcactgg2543
ggccagatggtaagccctcccgtatcgtagttatctacacgacggggagtcaggcaacta2603
tggatgaacgaaatagacagatcgctgagataggtgcctcactgattaagcattggtaac2663
tgtcagaccaagtttactcatatatactttagattgatttaaaacttcatttttaattta2723
aaaggatctaggtgaagatcctttttgataatctcatgaccaaaatcccttaacgtgagt2783
tttcgttccactgagcgtcagaccccgtagaaaagatcaaaggatcttcttgagatcctt2843
tttttctgcgcgtaatctgctgcttgcaaacaaaaaaaccaccgctaccagcggtggttt2903
gtttgccggatcaagagctaccaactctttttccgaaggtaactggcttcagcagagcgc2963
agataccaaatactgtccttctagtgtagccgtagttaggccaccacttcaagaactctg3023
tagcaccgcctacatacctcgctctgctaatcctgttaccagtggctgctgccagtggcg3083
ataagtcgtgtcttaccgggttggactcaagacgatagttaccggataaggcgcagcggt3143
cgggctgaacggggggttcgtgcacacagcccagcttggagcgaacgacctacaccgaac3203
tgagatacctacagcgtgagctatgagaaagcgccacgcttcccgaagggagaaaggcgg3263
acaggtatccggtaagcggcagggtcggaacaggagagcgcacgagggagcttccagggg3323
gaaacgcctggtatctttatagtcctgtcgggtttcgccacctctgacttgagcgtcgat3383
ttttgtgatgctcgtcaggggggcggagcctatggaaaaacgccagcaacgcggcctttt3443
tacggttcctggccttttgctggccttttgctcacatgttctttcctgcgttatcccctg3503
attctgtggataaccgtattaccgcctttgagtgagctgataccgctcgccgcagccgaa3563
cgaccgagcgcagcgagtcagtgagcgaggaagcggaagagcgcctgatgeggtattttc3623
tccttacgcatctgtgcggtatttcacaccgcatatggtgcactctcagtacaatctgct3683
ctgatgccgcatagttaagccagtatacactccgctatcgctacgtgactgggtcatggc,3743
tgcgccccgacacccgccaacacccgctgacgcgccctgacgggcttgtctgctcccggc3803
atccgcttacagacaagctgtgaccgtctccgggagctgcatgtgtcagaggttttcacc3863
gtcatcaccgaaacgcgcgaggcagcagatcaattegcgcgcgaaggcgaagcggcatgc3923
atttacgttgacaccatcgaatggtgcaaaacctttcgcggtatggcatgatagcgcccg3983
gaagagagtcaattcagggtggtgaatgtgaaaccagtaacgttatacgatgtcgcagag4043
tatgccggtgtctcttatcagaccgtttcccgcgtggtgaaccaggccagccacgtttct4103
gcgaaaacgcgggaaaaagtggaagcggcgatggcggagctgaattacattcccaaccgc4163
gtggcacaacaactggcgggcaaacagtcgttgctgattggcgttgccacctccagtctg4223
gccctgcacgcgccgtcgcaaattgtcgcggcgattaaatctcgcgccgatcaactgggt4283
gccagcgtggtggtgtcgatggtagaacgaagcggcgtcgaagcctgtaaagcggcggtg4343
cacaatcttctcgcgcaacgcgtcagtgggctgatcattaactatccgctggatgaccag4403
gatgccattgctgtggaagctgcctgcactaatgttccggcgttatttcttgatgtctct4463
gaccagacacccatcaacagtattattttctcccatgaagacggtacgcgactgggcgtg4523
gagcatctggtcgcattgggtcaccagcaaatcgcgctgttagcgggcccattaagttct4583
gtctcggcgcgtctgcgtctggctggctggcataaatatctcactcgcaatcaaattcag4643
ccgatagcggaacgggaaggcgactggagtgccatgtccggttttcaacaaaccatgcaa4703
CA 02318434 2000-06-22
WO 99!32143 PCT/US98I19498
17
atgctgaatg agggcatcgttcccactgcgatgctggttgccaacgatcagatggcgctg4763
ggcgcaatgc gcgccattaccgagtccgggctgcgegttggtgcggatatctcggtagtg4823
ggatacgacg ataccgaagacagctcatgttatatcccgccgtcaaccaccatcaaacag4883
gattttcgcc tgctggggcaaaccagcgtggaccgcttgctgcaactctctcagggccag4943
gcggtgaagg gcaatcagctgttgcccgtctcactggtgaaaagaaaaaccaccctggcg5003
cccaatacgc aaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacga5063
caggtttccc gactggaaagcgggcagtgagcgcaacgcaattaatgtgagttagcgcga5123
attgatctg 5132
<210> 25
<211> 21
<212> DNA
<213> Homo sapiens
<400> 25
tcaccaccga ccccaacaag c 21
<210> 26
<211> 21
<212> DNA
<213> Homo sapiens
<400> 26
cctcaatcca agtaacaaac c 21
<210> 27
<211> 21
<212> DNA
<213> Homo sapiens
<400> 27
cctctggatg actatgtgaa t 21
<210> 28
<211> 21
<212> DNA
<213> Homo sapiens
<400> 28
acttggctgt tggttgtatg g 21
<210> 29
<211> 40
<212> DNA
<213> Homo Sapiens
<400> 29
cctaggggat ccggaggttg caagactggg aatggaaaga 40
<210> 30
<211> 33
<212> DNA
<213> Homo sapiens
<400> 30
CA 02318434 2000-06-22
WO 99/32143 PCT/US98/Z7498
18
tcctccggta ccacactcaa gaatgtcgca gta 33
<210> 31
<211> 5324
<212> DNA
<213> Homo sapiens
<220>
<221> CDS
<222> (413)...(1465)
<400>
31
gtttgacagcttatcatcgactgcacggtgcaccaatgcttctggcgtcaggcagccatc 60
ggaagctgtggtatggctgtgcaggtcgtaaatcactgcataattcgtgtcgctcaaggc 120
gcactcccgttctggataatgttttttgcgccgacatcataacggttctggcaaatattc 180
tgaaatgagctgttgacaattaatcatccggctcgtataatgtgtggaattgtgagcgga 240
taacaatttcacacaggaaacagcgccgctgagaaaaagcgaagcggcactgctctttaa 300
caatttatcagacaatctgtgtgggcactcgaccggaattatcgattaactttattatta 360
aaaattaaagaggtatatattaatgtatcgattaaataaggaggaataaacc atg ggg 418
Met Gly
1
ggt tct cat cat cat cat cat cat ggt atg get agc atg act ggt gga 466
Gly Ser His His His His His His Gly Met Ala Ser Met Thr Gly Gly
10 15
cag caa atg ggt cgg gat ctg tac gac gat gac gat aag cat cga tgg 514
Gln Gln Met Gly Arg Asp Leu Tyr Asp Asp Asp Asp Lys His Arg Trp
20 25 30
atc ttg gtc cct agg gga tcc gga ggt tgc aag act ggg aat gga aag 562
Ile Leu Val Pro Arg Gly Ser Gly Gly Cys Lys Thr Gly Asn Gly Lys
35 40 45 50
aac tac aga ggg acg atg tcc aaa aca aaa aat ggc atc acc tgt caa 610
Asn Tyr Arg Gly Thr Met Ser Lys Thr Lys Asn Gly Ile Thr Cys Gln
55 60 65
aaa tgg agt tcc act tct ccc cac aga cct aga ttc tca cct get aca 658
Lys Trp Ser Ser Thr Ser Pro His Arg Pro Arg Phe Ser Pro Ala Thr
70 75 80
cac ccc tca gag gga ctg gag gag aac tac tgc agg aat cca gac aac 706
His Pro Ser Glu Gly Leu Glu Glu Asn Tyr Cys Arg Asn Pro Asp Asn
85 90 95
gat ccg cag ggg ccc tgg tgc tat act act gat cca gaa aag aga tat 754
Asp Pro Gln Gly Pro Trp Cys Tyr Thr Thr Asp Pro Glu Lys Arg Tyr
100 105 110
gac tac tgc gac att ctt gag tgt ggt acc gga gga ggc ggt tca ggt 802
Asp Tyr Cys Asp Ile Leu Glu Cys Gly Thr Gly Gly Gly Gly Ser Gly
115 120 125 130
ggt gga ggt tca gga ggt gga ggt tct ccc ggg act aca aat act gtg 850
CA 02318434 2000-06-22
WO 99/32143 PCT/US98/29498
19
Gly Gly Gly Ser Gly Gly Gly Gly Ser Pro Gly Thr Thr Asn Thr Val
135 140 145
gca gca tat aat tta act tgg aaa tca act aat ttc aag aca att ttg 898
Ala Ala Tyr Asn Leu Thr Trp Lys Ser Thr Asn Phe Lys Thr Ile Leu
150 155 160
gag tgg gaa ccc aaa ccc gtc aat caa gtc tac act gtt caa ata agc 946
Glu Trp Glu Pro Lys Pro Val Asn Gln Val Tyr Thr Val Gln Ile Ser
165 170 175
act aag tca gga gat tgg aaa agc aaa tgc ttt tac aca aca gac aca 994
Thr Lys Ser Gly Asp Trp Lys Ser Lys Cys Phe Tyr Thr Thr Asp Thr
180 185 190
gag tgt gac ctc acc gac gag att gtg aag gat gtg aag cag acg tac 1042
Glu Cys Asp Leu Thr Asp Glu Ile Val Lys Asp Val Lys Gln Thr Tyr
195 200 205 210
ttg gca cgg gtc ttc tcc tac ccg gca ggg aat gtg gag agc acc ggt 1090
Leu Ala Arg Val Phe Ser Tyr Pro Ala Gly Asn Val Glu Ser Thr Gly
215 220 225
tct get ggg gag cct ctg tat gag aac tcc cca gag ttc aca cct tac 1138
Ser Ala Gly Glu Pro Leu Tyr Glu Asn Ser Pro Glu Phe Thr Pro Tyr
230 235 240
ctg gag aca aac ctc gga cag cca aca att cag agt ttt gaa cag gtg 1186
Leu Glu Thr Asn Leu Gly Gln Pro Thr Ile Gln Ser Phe Glu Gln Val
245 250 255
gga aca aaa gtg aat gtg acc gta gaa gat gaa cgg act tta gtc aga 1234
Gly Thr Lys Val Asn Val Thr Val Glu Asp Glu Arg Thr Leu Val Arg
260 265 270
agg aac aac act ttc cta agc ctc cgg gat gtt ttt ggc aag gac tta 1282
Arg Asn Asn Thr Phe Leu Ser Leu Arg Asp Val Phe Gly Lys Asp Leu
275 280 285 290
att tat aca ctt tat tat tgg aaa tct tca agt tca gga aaa aaa aaa 1330
Ile Tyr Thr Leu Tyr Tyr Trp Lys Ser Ser Ser Ser Gly Lys Lys Lys
295 300 305
gcc aaa aca aac act aat gag ttt ttg att gat gtg gat aaa gga gaa 1378
Ala Lys Thr Asn Thr Asn Glu Phe Leu Ile Asp Val Asp Lys Gly Glu
310 315 320
aac tac tgt ttc agt gtt caa gca gtg att ccc tcc cga aca gtt aac 1426
Asn Tyr Cys Phe Ser Val Gln Ala Val Ile Pro Ser Arg Thr Val Asn
325 330 335
cgg aag agt aca gac agc ccg gta gag tgt atg ggc acg tgaaagcttg 1475
Arg Lys Ser Thr Asp Ser Pro Val Glu Cys Met Gly Thr
340 345 350
CA 02318434 2000-06-22
WO 99/32143 PCTNS98/29498
gctgttttggcggatgagagaagattttcagcctgatacagattaaatcagaacgcagaa1535
gcggtctgataaaacagaatttgcctggcggcagtagcgcggtggtcccacctgacccca1595
tgccgaactcagaagtgaaacgccgtagcgccgatggtagtgtggggtctccccatgcga1655
gagtagggaactgccaggcatcaaataaaacgaaaggctcagtcgaaagactgggccttt1715
cgttttatctgttgtttgtcggtgaacgctctcctgagtaggacaaatccgccgggagcg1775
gatttgaacgttgcgaagcaacggcccggagggtggcgggcaggacgcccgccataaact1835
gccaggcatcaaattaagcagaaggccatcetgacggatggcctttttgcgtttctacaa1895
actctttttgtttatttttctaaatacattcaaatatgtatccgctcatgagacaataac1955
cctgataaatgcttcaataatattgaaaaaggaagagtatgagtattcaacatttccgtg2015
tcgcccttattcccttttttgcggcattttgccttcctgtttttgctcacccagaaacgc2075
tggtgaaagtaaaagatgctgaagatcagttgggtgcacgagtgggttacatcgaactgg2135
atctcaacagcggtaagatccttgagagttttcgccccgaagaacgttttccaatgatga2195
gcacttttaaagttctgctatgtggcgcggtattatcccgtgttgacgccgggcaagagc2255
aactcggtcgccgcatacactattctcagaatgacttggttgaggcctcaccagtcacag2315
aaaagcatcttacggatggcatgacagtaagagaattatgcagtgctgccataaccatga2375
gtgataacactgcggccaacttacttctgacaacgatcggaggaccgaaggagctaaccg2435
cttttttgcacaacatgggggatcatgtaactcgccttgatcgttgggaaccggagctga2495
atgaagccataccaaacgacgagcgtgacaccacgatgcctgtagcaatggcaacaacgt2555
tgcgcaaactattaactggcgaactacttactctagcttcccggcaacaattaatagact2615
ggatggaggcggataaagttgcaggaccacttctgcgctcggcccttccggctggctggt2675
ttattgctgataaatctggagccggtgagcgtgggtctcgcggtatcattgcagcactgg2735
ggccagatggtaagccctcccgtatcgtagttatctacacgacggggagtcaggcaacta2795
tggatgaacgaaatagacagatcgctgagataggtgcctcactgattaagcattggtaac2855
tgtcagaccaagtttactcatatatactttagattgatttaaaacttcatttttaattta2915
aaaggatctaggtgaagatcctttttgataatctcatgaccaaaatcccttaacgtgagt2975
tttcgttccactgagcgtcagaccccgtagaaaagatcaaaggatcttcttgagatcctt3035
tttttctgcgcgtaatctgctgcttgcasacaaaaaaaccaccgctaccagcggtggttt3095
gtttgccggatcaagagctaccaactctttttccgaaggtaactggcttcagcagagcgc3155
agataccaaatactgtccttctagtgtagccgtagttaggccaccacttcaagaactctg3215
tagcaccgcctacatacctcgctctgctaatcctgttaccagtggctgctgccagtggcg3275
ataagtcgtgtcttaccgggttggactcaagacgatagttaccggataaggcgcagcggt3335
cgggctgaacggggggttcgtgcacacagcccagcttggagcgaacgacctacaccgaac3395
tgagatacctacagcgtgagctatgagaaagcgccacgcttcccgaagggagaaaggcgg3455
acaggtatccggtaagcggcagggtcggaacaggagagcgcacgagggagcttccagggg3515
gaaacgcctggtatctttatagtcctgtcgggtttcgccacctctgacttgagcgtcgat3575
ttttgtgatgctcgtcaggggggcggagcctatggaaaaacgccagcaacgcggcctttt3635
tacggttcctggccttttgctggccttttgctcacatgttctttcctgcgttatcccctg3695
attctgtggataaccgtattaccgcctttgagtgagctgataccgctcgccgcagccgaa3755
cgaccgagcgcagcgagtcagtgagcgaggaagcggaagagcgcctgatgcggtattttc3815
tccttacgcatctgtgcggtatttcacaccgcatatggtgcactctcagtacaatctgct3875
ctgatgccgcatagttaagccagtatacactccgctatcgctacgtgactgggtcatggc3935
tgcgccccgacacccgccaacacccgctgacgcgccctgacgggcttgtctgctcccggc3995
atccgcttacagacaagctgtgaccgtctccgggagctgcatgtgtcagaggttttcacc4055
gtcatcaccgaaacgcgcgaggcagcagatcaattcgcgcgcgaaggcgaagcggcatgc4115
atttacgttgacaccatcgaatggtgcaaaacctttcgcggtatggcatgatagcgcccg4175
gaagagagtcaattcagggtggtgaatgtgaaaccagtaacgttatacgatgtcgcagag4235
tatgccggtgtctcttatcagaccgtttcccgcgtggtgaaccaggccagccacgtttct4295
gcgaaaacgcgggaaaaagbggaagcggcgatggcggagctgaattacattcccaaccgc4355
gtggcacaacaactggcgggcaaacagtcgttgetgattggcgttgccacctccagtctg4415
gccctgcacgcgccgtcgcaaattgtcgcggcgattaaatctcgcgcagatcaactgggt4475
gccagcgtggtggtgtcgatggtagaacgaagcggcgtcgaagcctgtaaagcggcggtg4535
cacaatcttctcgcgcaacgcgtcagtgggctgatcattaactatccgctggatgaccag4595
gatgccattgctgtggaagctgcctgcactaatgttccggcgttatttcttgatgtctct4655
gaccagacacccatcaacagtattattttctcccatgaagacggtacgcgactgggcgtg4715
gagcatctggtcgcattgggtcaccagcaaatcgcgctgttagcgggcccattaagttct4775
CA 02318434 2000-06-22
WO 99132143 PCTNS98/Z9498
21
gtctcggcgcgtctgcgtctggctggctggcataaatatctcactcgcaatcaaattcag4835
ccgatagcggaacgggaaggcgactggagtgccatgtccggttttcaacaaaccatgcaa4895
atgctgaatgagggcatcgttcccactgcgatgctggttgccaacgatcagatggcgctg4955
ggcgcaatgcgcgccattaccgagtccgggctgcgcgttggtgcggatatctcggtagtg5015
ggatacgacgataccgaagacagctcatgttatatcccgccgtcaaccaccatcaaacag5075
gattttcgcctgctggggcaaaccagcgtggaccgcttgctgcaactctctcagggccag5135
gcggtgaagggcaatcagctgttgcccgtctcactggtgaaaagaaaaaccaccctggcg5195
cccaatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacga5255
caggtttcccgactggaaagcgggcagtgagcgcaacgcaattaatgtgagttagcgcga5315
attgatctg 5324
<210> 32
<211> 27
<212> DNA
<213> Homo sapiens
<400> 32
cacacaggat ccgaagaaga ctgtatg 27
<210> 33
<211> 27
<212> DNA
<213> Homo sapiens
<400> 33
cacacaggta cctgaagggg ccgcaca 27
<210> 34
<211> 5342
<212> DNA
<213> Homo sapiens
<220>
<221> CDS
<222> (413)...(1483)
<400>
34
gtttgacagcttatcatcgactgcacggtgcaccaatgcttctggcgtcaggcagccatc60
ggaagctgtggtatggctgtgcaggtcgtaaatcactgcataattcgtgtcgctcaaggc120
gcactcccgttctggataatgttttttgcgccgacatcataacggttctggcaaatattc180
tgaaatgagctgttgacaattaatcatccggctcgtataatgtgtggaattgtgagcgga240
taacaatttcacacaggaaacagcgccgctgagaaaaagcgaagcggcactgctctttaa300
caatttatcagacaatctgtgtgggcactcgaccggaattatcgattaactttattatta360
aaaattaaagaggtatatattaatgtatcgattaaataaggaggaataaacc atg 418
ggg
Met Gly
1
ggt tct cat cat cat cat cat cat ggt atg get agc atg act ggt gga 466
Gly Ser His His His His His His Gly Met Ala Ser Met Thr Gly Gly
10 15
cag caa atg ggt cgg gat ctg tac gac gat gac gat aag gat cga tgg 514
Gln Gln Met Gly Arg Asp Leu Tyr Asp Asp Asp Asp Lys Asp Arg Trp
20 25 30
CA 02318434 2000-06-22
WO 99/32143 PCTNS98/29498
22
atc ttg gtc cct agg gga tcc gaa gaa gac tgt atg ttt. ggg aat ggg 562
Ile Leu Val Pro Arg Gly Ser Glu Glu Asp Cys Met Phe Gly Asn Gly
35 40 45 50
aaa gga tac cga ggc aag agg gcg acc act gtt act ggg acg cca tgc 610
Lys Gly Tyr Arg Gly Lys Arg Ala Thr Thr Val Thr Gly Thr Pro Cys
55 60 65
cag gac tgg get gcc cag gag ccc cat aga cac agc att ttc act cca 658
Gln Asp Trp Ala Ala Gln Glu Pro His Arg His Ser Ile Phe Thr Pro
70 75 80
gag aca aat cca cgg gcg ggt ctg gaa aaa aat tac tgc cgt aac cct 706
Glu Thr Asn Pro Arg Ala Gly Leu Glu Lys Asn Tyr Cys Arg Asn Pro
85 90 95
gat ggt gat gta ggt ggt ccc tgg tgc tac acg aca aat cca aga aaa 754
Asp Gly Asp Val Gly Gly Pro Trp Cys Tyr Thr Thr Asn Pro Arg Lys
100 105 110
ctt tac gac tac tgt gat gtc cct cag tgt gcg gcc cct tca ggt acc 802
Leu Tyr Asp Tyr Cys Asp Val Pro Gln Cys Ala Ala Pro Ser Gly Thr
115 120 125 130
gga gga ggc ggt tca ggt ggt gga ggt tca gga ggt gga ggt tct cec 850
Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Pro
135 140 145
ggg act aca aat act gtg gca gca tat aat tta act tgg aaa tca act 898
Gly Thr Thr Asn Thr Val Ala Ala Tyr Asn Leu Thr Trp Lys Ser Thr
150 155 160
aat ttc sag aca att ttg gag tgg gaa ccc aaa ccc gtc aat caa gtc 946
Asn Phe Lys Thr Ile Leu Glu Trp Glu Pro Lys Pro Val Asn Gln Val
165 170 175
tac act gtt caa ata agc act aag tca gga gat tgg aaa agc aaa tgc 994
Tyr Thr Val Gln Ile Ser Thr Lys Ser Gly Asp Trp Lys Ser Lys Cys
180 185 190
ttt tac aca aca gac aca gag tgt gac ctc acc gac gag att gtg aag 1042
Phe Tyr Thr Thr Asp Thr Glu Cys Asp Leu Thr Asp Glu Ile Val Lys
195 200 205 210
gat gtg aag cag acg tac ttg gca cgg gtc ttc tcc tac ccg gca ggg 1090
Asp Val Lys Gln Thr Tyr Leu Ala Arg Val Phe Ser Tyr Pro Ala Gly
215 220 225
aat gtg gag agc acc ggt tct get ggg gag cct etg tat gag aac tcc 1138
Asn Val Glu Ser Thr Gly Ser Ala Gly Glu Pro Leu Tyr Glu Asn Ser
230 235 240
cca gag ttc aca cct tac ctg gag aca aac ctc gga cag cca aca att 1186
Pro Glu Phe Thr Pro Tyr Leu Glu Thr Asn Leu Gly Gln Pro Thr Ile
245 250 255
CA 02318434 2000-06-22
WO 99/32143 PGTNS98/I7498
23
cag agt ttt gaa cag gtg gga aca aaa gtg aat gtg acc gta gaa gat 1234
Gln Ser Phe Glu Gln Val Gly Thr Lys Val Asn Val Thr Val Glu Asp
260 265 270
gaa cgg act tta gtc aga agg aac aac act ttc cta agc ctc cgg gat 1282
Glu Arg Thr Leu Val Arg Arg Asn Asn Thr Phe Leu Ser Leu Arg Asp
275 280 285 290
gtt ttt ggc aag gac tta att tat aca ctt tat tat tgg aaa tct tca 1330
Val Phe Gly Lys Asp Leu Ile Tyr Thr Leu Tyr Tyr Trp Lys Ser Ser
295 300 305
agt tca gga aaa aaa aca gcc aaa aca aac act aat gag ttt ttg att 1378
Ser Ser Gly Lys Lys Thr Ala Lys Thr Asn Thr Asn Glu Phe Leu Ile
310 315 320
gat gtg gat aaa gga gaa aac tac tgt ttc agt gtt caa gca gtg att 1426
Asp Val Asp Lys Gly Glu Asn Tyr Cys Phe Ser Val Gln Ala Val Ile
325 330 335
ccc tcc cga aca gtt aac cgg aag agt aca gac agc ccg gta gag tgt 1474
Pro Ser Arg Thr Val Asn Arg Lys Ser Thr Asp Ser Pro Val Glu Cys
340 345 350
atg ggc acg tgaaagcttg gctgttttgg cggatgagag aagattttca 1523
Met Gly Thr
355
gcctgatacagattaaatcagaacgcagaagcggtctgataaaacagaatttgcctggcg1583
gcagtagcgcggtggtcccacctgaccccatgccgaactcagaagtgaaacgccgtagcg1643
ccgatggtagtgtggggtctccccatgcgagagtagggaactgccaggcatcaaataaaa1703
cgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgct1763
ctcctgagtaggacaaatccgccgggagcggatttgaacgttgcgaagcaacggcccgga1823
gggtggcgggcaggacgcccgccataaactgccaggcatcaaattaagcagaaggccatc1883
ctgacggatggcctttttgcgtttctacaaactctttttgtttatttttctaaatacatt1943
caaatatgtatccgctcatgagacaataaccctgataaatgcttcaataatattgaaaaa2003
ggaagagtatgagtattcaacatttccgtgtcgcccttattcccttttttgcggcatttt2063
gccttcctgtttttgctcacccagaaacgctggtgaaagtaaaagatgctgaagatcagt2123
tgggtgcacgagtgggttacatcgaactggatctcaacagcggtaagatccttgagagtt2183
ttcgccccgaagaacgttttccaatgatgagcacttttaaagttctgctatgtggcgcgg2243
tattatcccgtgttgacgccgggcaagagcaactcggtcgccgcatacactattctcaga2303
atgacttggttgaggcctcaccagtcacagaaaagcatcttacggatggcatgacagtaa2363
gagaattatgcagtgctgccataaccatgagtgataacactgcggccaacttacttctga2423
caacgatcggaggaccgaaggagctaaccgcttttttgcacaacatgggggatcatgtaa2483
ctcgccttgatcgttgggaaccggagctgaatgaagccataccaaacgacgagcgtgaca2543
ccacgatgcctgtagcaatggcaacaacgttgcgcaaactattaactggcgaactactta2603
ctctagcttcccggcaacaattaatagactggatggaggcggataaagttgcaggaccac2663
ttctgcgctcggcccttccggctggctggtttattgctgataaatctggagccggtgagc2723
gtgggtctcgcggtatcattgcagcactggggccagatggtaagccctcccgtatcgtag2783
ttatctacacgacggggagtcaggcaactatggatgaacgaaatagacagatcgctgaga2843
taggtgcctcactgattaagcattggtaactgtcagaccaagtttactcatatatacttt2903
agattgatttaaaacttcatttttaatttaaaaggatctaggtgaagatcctttttgata2963
atctcatgaccaaaatcccttaacgtgagttttcgttccactgagcgtcagaccccgtag3023
aaaagatcaaaggatcttcttgagatcctttttttctgcgcgtaatctgctgcttgcaaa3083
CA 02318434 2000-06-22
WO 99/32143 PCT/US9&Z'1498
24
caaaaaaacc accgctacca gcggtggttt gtttgccgga tcaagagcta ccaactcttt 3143
ttccgaaggt aactggcttc agcagagcgc agataccaaa tactgtcctt ctagtgtagc 3203
cgtagttagg ccaccacttc aagaactctg tagcaccgcc tacatacctc gctctgctaa 3263
tcctgttacc agtggctgct gccagtggcg ataagtcgtg tcttaccggg ttggactcaa 3323
gacgatagtt accggataag gcgcagcggt cgggctgaac ggggggttcg tgcacacagc 3383
ccagcttgga gcgaacgacc tacaccgaac tgagatacct acagcgtgag ctatgagaaa 3443
gcgccacgct tcccgaaggg agaaaggcgg acaggtatcc ggtaagcggc agggtcggaa 3503
caggagagcg cacgagggag cttccagggg gaaacgcctg gtatctttat agtcctgtcg 3563
ggtttcgcca cctctgactt gagcgtcgat ttttgtgatg ctcgtcaggg gggcggagcc 3623
tatggaaaaa cgccagcaac gcggcctttt tacggttcct ggccttttgc ~tggccttttg 3683
ctcacatgtt ctttcctgcg ttatcccctg attctgtgga taaccgtatt accgcctttg 3743
agtgagctga taccgctcgc cgcagccgaa cgaccgagcg cagcgagtca gtgagcgagg 3803
aagcggaaga gcgcctgatg cggtattttc tccttacgca tctgtgcggt atttcacacc 3863
gcatatggtg cactctcagt acaatctgct ctgatgccgc atagttaagc cagtatacac 3923
tccgctatcg ctacgtgact gggtcatggc tgcgccccga cacccgccaa cacccgctga 3983
cgcgccctga cgggcttgtc tgctcccggc atccgcttac agacaagctg tgaccgtctc 4043
cgggagctgc atgtgtcaga ggttttcacc gtcatcaccg aaacgcgcga ggcagcagat 4103
caattcgcgc gcgaaggcga agcggcatgc atttacgttg acaccatcga atggtgcaaa 4163
acctttcgcg gtatggcatg atagcgcccg gaagagagtc aattcagggt ggtgaatgtg 4223
aaaccagtaa cgttatacga tgtcgcagag tatgccggtg tctcttatca gaccgtttcc 4283
cgcgtggtga accaggccag ccacgtttct gcgaaaacgc gggaaaaagt ggaagcggcg 4343
atggcggagc tgaattacat tcccaaccgc gtggcacaac aactggcggg caaacagtcg 4403
ttgctgattg gcgttgccac ctccagtctg gccctgcacg cgccgtcgca aattgtcgcg 4463
gcgattaaat ctcgcgccga tcaactgggt gccagcgtgg tggtgtcgat ggtagaacga 4523
agcggcgtcg asgcctgtaa agcggcggtg cacaatcttc tcgcgcaacg cgtcagtggg 4583
ctgatcatta actatccgct ggatgaccag gatgccattg ctgtggaagc tgcctgcact 4643
aatgttccgg cgttatttct tgatgtctct gaccagacac ccatcaacag tattattttc 4703
tcccatgaag acggtacgcg actgggcgtg gagcatctgg tcgcattggg tcaccagcaa 4763
atcgcgctgt tagcgggccc attaagttct gtctcggcgc gtctgcgtct ggctggctgg 4823
cataaatatc tcactcgcaa tcaaattcag ccgatagcgg aacgggaagg cgactggagt 4883
gccatgtccg gttttcaaca aaccatgcaa atgctgaatg agggcatcgt tcccactgcg 4943
atgctggttg ccaacgatca gatggcgctg ggcgcaatgc gcgccattac cgagtccggg 5003
ctgcgcgttg gtgcggatat ctcggtagtg ggatacgacg ataccgaaga cagctcatgt 5063
tatatcccgc cgtcaaccac catcaaacag gattttcgcc tgctggggca aaccagcgtg 5123
gaccgcttgc tgcaactctc tcagggccag gcggtgaagg gcaatcagct gttgcccgtc 5183
tcactggtga aaagaaaaac caccctggcg cccaatacgc aaaccgcctc tccccgcgcg 5243
ttggccgatt cattaatgca gctggcacga caggtttccc gactggaaag cgggcagtga 5303
gcgcaacgca attaatgtga gttagcgcga attgatctg 5342
<210> 35
<211> 28
<212> DNA
<213> Homo sapiens
<400> 35
gatccccgcg taaactgtac gacggtac 28
<210> 36
<211> 20
<212> DNA
<213> Homo sapiens
<400> 36
cgtcgtacag tttacgcggg 20
CA 02318434 2000-06-22
WO 99/32143 PCTNS98/Z749$
<210> 37
<211> 5099
<212> DNA
<213> Homo sapiens
<220>
<221> CDS
<222> (413) . .. (1240)
<400>
37
gtttgacagcttatcatcgactgcacggtgcaccaatgcttctggcgtcaggcagccatc 60
ggaagctgtggtatggctgtgcaggtcgtaaatcactgcataattcgtgtcgctcaaggc 120
gcactcccgttctggataatgttttttgcgccgacatcataacggttctggcaaatattc 180
tgaaatgagctgttgacaattaatcatccggctcgtataatgtgtggaattgtgagcgga 240
taacaatttcacacaggaaacagcgccgctgagaaaaagcgaagcggcactgctctttaa 300
caatttatcagacaatctgtgtgggcactcgaccggaattatcgattaactttattatta 360
aaaattaaagaggtatatattaatgtatcgattaaataaggaggaataaacc atg ggg 418
Met Gly
1
ggt tct cat cat cat cat cat cat ggt atg get agc atg act ggt gga 466
Gly Ser His His His His His His Gly Met Ala Ser Met Thr Gly Gly
5 10 15
cag caa atg ggt cgg gat ctg tac gac gat gac gat aag gat cga tgg 514
Gln Gln Met Gly Arg Asp Leu Tyr Asp Asp Asp Asp Lys Asp Arg Trp
20 25 30
atc ttg gtc cct agg gga tcc ccg cgt aaa ctg tac gac ggt acc gga 562
Ile Leu Val Pro Arg Gly Ser Pro Arg Lys Leu Tyr Asp Gly Thr Gly
40 45 50
gga ggc ggt tca ggt ggt gga ggt tca gga ggt gga ggt tct ccc ggg 610
Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Pro Gly
55 60 65
act aca aat act gtg gca gca tat aat tta act tgg aaa tca act aat 658
Thr Thr Asn Thr Val Ala Ala Tyr Asn Leu Thr Trp Lys Ser Thr Asn
70 75 80
ttc aag aca att ttg gag tgg gaa ccc aaa ccc gtc aat caa gtc tac 706
Phe Lys Thr Ile Leu Glu Trp Glu Pro Lys Pro Val Asn Gln Val Tyr
85 . 90 95
act gtt caa ata agc act aag tca gga gat tgg aaa agc aaa tgc ttt 754
Thr Val Gln Ile Ser Thr Lye Ser Gly Asp Trp Lys Ser Lys Cys Phe
100 105 110
tac aca aca gac aca gag tgt gac ctc acc gac gag att gtg aag gat 802
Tyr Thr Thr Asp Thr Glu Cys Asp Leu Thr Asp Glu Ile Val Lys Asp
115 120 125 130
gtg aag cag acg tac ttg gca cgg gtc ttc tcc tac ccg gca ggg aat 850
Val Lys Gln Thr Tyr Leu Ala Arg Val Phe Ser Tyr Pro Ala Gly Aen
135 140 145
CA 02318434 2000-06-22
wo 99r~im rcTius9s~~49s
26
gtg gag agc acc ggt tct get ggg gag cet ctg tat gag aac tcc cca 898
Val Glu Ser Thr Gly Ser Ala Gly Glu Pro Leu Tyr Glu Asn Ser Pro
150 155 160
gag ttc aca cct tac ctg gag aca aac ctc gga cag cca aca att cag 946
Glu Phe Thr Pro Tyr Leu Glu Thr Asn Leu Gly Gln Pro Thr Ile Gln
165 170 175
agt ttt gaa cag gtg gga aca aaa gtg aat gtg acc gta gaa gat gaa 994
Ser Phe Glu Gln Val Gly Thr Lys Val Asn Val Thr Val Glu Asp Glu
180 185 190
cgg act tta gtc aga agg aac aac act ttc cta agc ctc cgg gat gtt 1042
Arg Thr Leu Val Arg Arg Asn Aan Thr Phe Leu Ser Leu Arg Asp Val
195 200 205 210
ttt ggc aag gac tta att tat aca ctt tat tat tgg aaa tct tca agt 1090
Phe Gly Lys Asp Leu Ile Tyr Thr Leu Tyr Tyr Trp Lys Ser Ser Ser
215 220 225
tca gga aaa aaa aca gcc aaa aca aac act sat gag ttt ttg att gat 1138
Ser Gly Lys Lys Thr Ala Lys Thr Asn Thr Asn Glu Phe Leu Ile Asp
230 235 240
gtg gat aaa gga gaa aac tac tgt ttc agt gtt caa gca gtg att ccc 1186
Val Asp Lys Gly Glu Asn Tyr Cys Phe Ser Val Gln Ala Val Ile Pro
245 250 255
tcc cga aca gtt aac cgg aag agt aca gac agc ccg gta gag tgt atg 1234
Ser Arg Thr Val Asn Arg Lys Ser Thr Asp Ser Pro Val Glu Cys Met
260 265 270
ggc acg tgaaagcttg gctgttttgg cggatgagag aagattttca gcctgataca 1290
Gly Thr
275
gattasatcagaacgcagaagcggtctgataaaacagaatttgcctggcggcagtagcgc1350
ggtggtcccacctgaccccatgccgaactcagaagtgaaacgccgtagcgccgatggtag1410
tgtggggtctccccatgcgagagtagggaactgccaggcatcaaataaaacgaaaggctc1470
agtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctcctgagta1530
ggacaaatccgccgggagcggatttgaacgttgcgaagcaacggcccggagggtggcggg1590
caggacgcccgccataaactgccaggcatcaaattaagcagaaggccatcctgacggatg1650
gcctttttgcgtttctacaaactctttttgtttatttttctaaatacattcaaatatgta1710
tccgctcatgagacaataaccctgataaatgcttcaataatattgaaaaaggaagagtat1770
gagtattcaacatttccgtgtcgcccttattcccttttttgcggcattttgccttcctgt1830
ttttgctcacccagaaacgctggtgaaagtaaaagatgctgaagatcagttgggtgcacg1890
agtgggttacatcgaactggatctcaacagcggtaagatccttgagagttttcgccccga1950
agaacgttttccaatgatgagcacttttaaagttctgctatgtggcgcggtattatcccg2010
tgttgacgccgggcaagagcaactcggtcgccgcatacactattctcagaatgacttggt2070
tgaggcctcaccagtcacagaaaagcatcttacggatggcatgacagtaagagaattatg2130
cagtgctgccataaccatgagtgataacactgcggccaacttacttctgacaacgatcgg2190
aggaccgaaggagctaaccgcttttttgcacaacatgggggatcatgtaactcgccttga2250
tcgttgggaaccggagctgaatgaagccataccaaacgacgagcgtgacaccacgatgcc2310
tgtagcaatggcaacaacgttgcgcaaactattaactggcgaactacttactctagcttc2370
CA 02318434 2000-06-22
WO 99/32143 PCT/US98/27498
27
ccggcaacaa ttaatagact ggatggaggc ggataaagtt gcaggaccac ttctgcgctc 2430
ggcccttccg gctggctggt ttattgctga taaatctgga gccggtgagc gtgggtctcg 2490
cggtatcatt gcagcactgg ggccagatgg taagccctcc cgtatcgtag ttatctacac 2550
gacggggagt caggcaacta tggatgaacg aaatagacag atcgctgaga taggtgcctc 2610
actgattaag cattggtaac tgtcagacca agtttactca tatatacttt agattgattt 2670
aaaacttcat ttttaattta aaaggatcta ggtgaagatc ctttttgata atctcatgac 2730
caaaatccct taacgtgagt tttcgttcca ctgagcgtca gaccccgtag aaaagatcaa 2790
aggatcttct tgagatcctt tttttctgcg cgtaatctgc tgcttgcaaa caaaaaaacc 2850
accgctacca gcggtggttt gtttgccgga tcaagagcta ccaactcttt ttccgaaggt 2910
aactggcttc agcagagcgc agataccaaa tactgtcctt ctagtgtagc cgtagttagg 2970
ccaccacttc aagaactctg tagcaccgcc tacatacctc gctctgctaa tcctgttacc 3030
agtggctgct gccagtggcg ataagtcgtg tcttaccggg ttggactcaa gacgatagtt 3090
accggataag gcgcagcggt cgggctgaac ggggggttcg tgcacacagc ccagcttgga 3150
gcgaacgacc tacaccgaac tgagatacct acagcgtgag ctatgagaaa gcgccacgct 3210
tcccgaaggg agaaaggcgg acaggtatcc ggtaagcggc agggtcggaa caggagagcg 3270
cacgagggag cttccagggg gaaacgcctg gtatctttat agtcctgtcg ggtttcgcca 3330
cctctgactt gagcgtcgat ttttgtgatg ctcgtcaggg gggcggagcc tatggaaaaa 3390
cgccagcaac gcggcctttt tacggttcct ggccttttgc tggccttttg ctcacatgtt 3450
ctttcctgcg ttatcccctg attctgtgga taaccgtatt acegcctttg agtgagctga 3510
taccgctcgc cgcagccgaa cgaccgagcg cagcgagtca gtgagcgagg aagcggaaga 3570
gcgcctgatg cggtattttc tccttacgca tctgtgcggt atttcacacc gcatatggtg 3630
cactctcagt acaatctgct ctgatgccgc atagttaagc cagtatacac tccgctatcg 3690
ctacgtgact gggtcatggc tgcgccccga cacccgccaa cacccgctga cgcgccctga 3750
cgggcttgtc tgctcccggc atccgcttac agacaagctg tgaccgtctc cgggagctgc 3810
atgtgtcaga ggttttcacc gtcatcaccg aaacgcgcga ggcagcagat caattcgcgc 3870
gcgaaggcga agcggcatgc atttacgttg acaccatcga atggtgcaaa acctttcgcg 3930
gtatggcatg atagcgcccg gaagagagtc aattcagggt ggtgaatgtg aaaccagtaa 3990
cgttatacga tgtcgcagag tatgccggtg tctcttatca gaccgtttcc cgcgtggtga 4050
accaggccag ccacgtttet gcgaaaacgc gggaaaaagt ggaagcggcg atggcggagc 4110
tgaattacat tcccaaccgc gtggcacaac aactggcggg caaacagtcg ttgctgattg 4170
gcgttgccac ctccagtctg gccctgcacg cgccgtcgca aattgtcgcg gcgattaaat 4230
ctcgcgccga tcaactgggt gccagcgtgg tggtgtcgat ggtagaacga agcggcgtcg 4290
aagcctgtaa agcggcggtg cacaatcttc tcgcgcaacg cgtcagtggg ctgatcatta 4350
actatccgct ggatgaccag gatgccattg ctgtggaagc tgcctgcact aatgttccgg 4410
cgttatttct tgatgtctct gaccagacac ccatcaacag tattattttc tcccatgaag 4470
acggtacgcg actgggcgtg gagcatctgg tcgcattggg tcaccagcaa atcgcgctgt 4530
tagcgggccc attaagttct gtctcggcgc gtctgcgtct ggctggctgg cataaatatc 4590
tcactcgcaa tcaaattcag ccgatagcgg aacgggaagg cgactggagt gccatgtccg 4650
gttttcaaca aaccatgcaa atgctgaatg agggcatcgt tcccactgcg atgctggttg 4710
ccaacgatca gatggcgctg ggcgcaatgc gcgccattac cgagtccggg ctgcgcgttg 4770
gtgcggatat ctcggtagtg ggatacgacg ataccgaaga cagctcatgt tatatcccgc 4830
cgtcaaccac catcaaacag gattttcgcc tgctggggca aaccagcgtg gaccgcttgc 4890
tgcaactctc tcagggccag gcggtgaagg gcaatcagct gttgcccgtc tcactggtga 4950
aaagaaaaac caccctggcg cccaatacgc aaaccgcctc tccccgcgcg ttggccgatt 5010
cattaatgca gctggcacga caggtttccc gactggaaag cgggcagtga gcgcaacgca 5070
attaatgtga gttagcgcga attgatctg 5099
