Note : Les descriptions sont présentées dans la langue officielle dans laquelle elles ont été soumises.
CA 02318935 2000-07-21
WO 99/37770 PC'TNS99101361
PHAGOCYTOSIS GENES AND USES THEREOF
SLATED A_P~PLICATIONS
This application is a continuation-in-part of and claims priority to U.K.
Patent Application No. 9820816.8 filed September 24, 1998 and U.K. Patent
Application No. 9812660.0 filed June 11, 1998; and is a continuation-in-part
of
and claims priority to U.S. Application No. 09/096,347, filed June 11, 1998
and
U.S. Application No. 09/096,631, filed June 11, 1998; and claims the benefit
of
U.S. Provisional Application No. 60/072,324, filed January 23, 1998. The
teachings of all of the referenced applications are incorporated herein by
reference
in their entirety.
~rOVERNMENT SUIePORT
The invention was supported, in whole or in part, by Grant GM52540 from
the National Institutes of Health. The Government has certain rights in the
invention.
BACKGROUND TO THE INVENTION
Phagocytosis or engulfment, is a specialized form of endocytosis through
which eukaryotes take up very large particles, or even whole cells. It is a
fundamental biological process conserved from single-cell organisms, such as
amoebae to mammals (Metchnikoff, E. 1891 ), Lectures on the comparative
pathology of inflammation; delivered at the Pasteur Institute, 1891, 1968
Edition
(New York: Dover Publication)). Initially used for the dual purpose of feeding
and defence, phagocytosis evolved, following the emergence of mesoderm, into a
mechanism used to protect the host against invading organisms and to clear up
foreign particles and cell debris (Metchnikoff, 1891 ). Recently, the
significance of
phagocytosis has been extended due to its role in eliminating cells undergoing
programmed cell death (apoptosis). Since apoptosis has been implicated in a
number of human diseases elucidation of the regulation of this phagocytosis is
CA 02318935 2000-07-21
WO 99/37770 PCT/US99/01361
-2-
highly desirable since it may lead to a new route of therapeutic intervention
in
these diseases. Accordingly, a need exists to isolate a gene and protein that
regulate phagocytosis. A further need exists for therapeutic treatment for
diseases
related to phagocytosis of apoptotic cells.
SUMMARY OF THE INVENTION
Genetic studies in C. elegans have identified over a dozen genes that
function in programmed cell death. The present inventors have used the
positional
method to clone and have functionally characterized the C. elegans gene CED-6.
It is shown that the CED-6 protein contains a phosphotyresine binding domain
and
several potential SH3 binding sites. It is further demonstrated that CED-6
acts
within engulfing cells, and functions to promote the removal of both early and
persistent cell corpses. Overexpression of CED-b can partially suppress the
engulfment defect of both CED-1 and CED-7, suggesting that CED-6 functions
downstream of these two genes. CED-6 acts as an adaptor molecule in a signal
transduction pathway that mediates the engulfment of apoptotic cells in C.
elegans.
The present inventors have also identified isolated and characterized human
CED-
6 homologue including a splice variant thereof, which it is shown is involved
in a
similar process in mammalian cells.
The invention provides, in isolated form, a protein which is the CED-6
protein of C. elegans or a protein which has equivalent function thereto and
human
homologues of the protein, hereinafter referred to as h 1 CED-6, h2CED-6, and
h3CED-6.
The invention further provides a functional fragment of CED-6, h 1 CED-6,
h2CED-6 and h3CED-6, for example, a fragment corresponding to the
phosphotyrosine binding domain and/or the proline/serine rich region.
The invention further provides an isolated nucleic acid encoding CED-6
and human homologues of CED-6, as well as nucleic acid encoding functional
fragments of CED-6, hlCED-6, h2-CED-6 and h3-CED-6 as described above.
CA 02318935 2000-07-21
WO 99/37770 PCT/US99/01361
-3
The invention further provides nucleic acid which is antisense to any of the
nucleic acids described above or which is capable of hybridizing to any of the
nucleic acids described above under conditions of low, medium or high
stringency
or portions or fragments thereof.
The invention further provides expression vectors comprising nucleic acid
encoding CED-6, hlCED-6, h2CED-6, h3CED-6 or encoding functional fragments
of said proteins as above.
The invention further provides mammalian cell-lines transfected with one
or more nucleic acids encoding CED-6, h 1 CED-6, h2CED-6, and/or h3CED-6.
The invention further provides assay methods using the proteins, nucleic
acids and transfected cells described above to identify compounds which
enhance
or inhibit the signal transduction pathway in which CED-6, hICED-6, h2CED-6,
and/or h3CED-6 participate.
The invention further provides assay methods using the transfected cells
described above to identify compounds which enhance or inhibit the expression
of
the CED-6, hlCED-6, h2CED-6 or h3CED-6 genes.
The invention further provides antibodies which react with an epitope of
CED-6, hlCED-6, h2CED-6, and/or h3CED-6.
The invention further provides a method of treating diseases the etiology of
which may be attributed to failure of engulfment of apoptotic or other
diseased
cells such as inflammation autoimmune disease or cancer by administering to a
patient one or more of the aforesaid proteins or nucleic acids or compounds
which
are enhancers of CED-6, h 1 CED-6, h2CED-6 or h3CED-6.
The invention further provides a method of treating diseases which would
benefit from a reduction in the engulfment of apoptotic cells, such as,
neurodegenerative diseases, stroke, or sickle-cell anaemia, by administering
one or
more of the aforesaid proteins, nucleic acids or compounds which are
inhibitors of
CED-6, hICED-6, h2CED-6, or h3CED-6.
The invention further provides a method of diagnosis of a human or animal
disease using a nucleic acid encoding CED-6, h 1 CED-6, h2CED-6 or h3CED-6 or
CA 02318935 2000-07-21
WO 99/37770 PC'f/US99/01361
-4
the complement thereof or an antibody to CED-6, hlCED-6, h2CED-6 or h3CED-
6 to detect a genetic defect.
The invention further provides a method of identifying proteins which
interact with CED-6, hICED-6, h2CED-6 or h3CED-6 in the signal transduction
pathway in which those proteins participate.
The invention farther provides a fusion protein in which CED-6, h 1 CED-6,
h2CED-6 or h3CED06 or a functional fragment thereof such as the
phosphotyrosine binding domain or serine proline rich region, is fused to
another
protein such as an epitope tag or product of a reporter gene .
The invention further provides a method of determining whether a
compound is an enhancer or inhibitor of the signal transduction pathway in
which
CED-6 participates by observing the effect of the compound on C. elegans worms
having altered CED-6 expression.
BRIEF DE~,CRIPTION OF THE D~tAWINGS
Figure lA - lE are schematic representation of the CED-6 Locus. Figure
lA Genetic map of CED-6. CED-6 and some genes close to and also used to map
CED-6 are shown. Figure 1B Cosmid rescue. Transgenic animals carrying
cosmids or subcloned DNA fragments (see C, D) were examined for cell corpses
on three fold embryos. Those who gave embryos with partial or no cell corpses
were counted as rescuing transgenic lines. Four out of tested thirteen cosmids
are
shown. Rescuing fragments are bold. Number represents # rescuing lines/ #
lines
tested. Figure 1 C Subcloning of F56D2 cosmid and rescue. Restriction map of
the CED-6 region is shown on the top. In the middle, several restriction
fragments
were tested for their ability to rescue the engulfment defect caused by
CED-6(n1813). Figure 1D Subcloning of 10 kb Xho I fragment and rescue.
Restriction map of Xho I fragment is shown on the top. In the middle mutations
made on the Xho I fragment and their rescuing ability are shown. An X
indicates a
frameshift mutation (see Experimental Procedures for details). Figure lE
Transcripts on Xho I fragments. Intron/exon structure of the transcripts on
Xho I
CA 02318935 2000-07-21
13-04-2000 U S 009901361
-S-
PCTlUS9~/013G1
fragment r~gion_ Boxes: cxons; V symbol: introns. AAA: poly(A) tail. RT-PC.R
products of 5' end of FSfiD2.7 contain both SLI and S 1.2.
Figures 2A and B shows that F56D2.7 Encodes CEh-G. Figure 2A shaws
the full-length cDNA (SEQ LD NO: I) aad amino acid (SEQ ID NO: ~) of C.
ele~crns CCD-G. Double underline shows the nucleic acid (SEQ 1 D NO: 3) and
amino acid sequence (SI;Q 1D 1~0: 4) ofphusphotyrosinc binding (P't'B) domain;
Single underline indicates the nucleic acid (S8Q TD NO: S) and the amino acid
(SEQ iD NO: 6) sequence of the prolindseune rich region. Dashed underline
indicates charac~I region. Star identifies the prolincs in the PxxP signature
l0 scducncc, empty triangles the charged residues within the dashed rcFion.
Shaded
box indicates polyadcnylation signal. Both SL1 and Sf,2 could be added to
transplicing acccpior site. 'fhe single base pair deletion identified in
CEO-6(nI8I3j is shown. Figure 2B Southern blot which revealed a ItFLP on a.l
kb fmgmcnt fin~m CED-6 (n2095). XJrol probe ideraifics art allele-specifc RFLP
in CEn-6(n2U95) that affect a 4.1 kb Hind III fragment containing, FSf D2.7.
On
the right bottom the genomic fragments digested by Hind Tll on the X~ro I
tragtnent
region is shown. On the right top Xho I fragment anal three genes covered on
this
region. Thr~~ Xind l1I fragments, 4,lkb, 0.4 kb and 9.9 kb that should be
lighted
up on the Southern blot are indicated. On the left genomic I~NA isolated
2U independently from wild-type N2, CFD-G(n 1813) and CEn-G(n~095) were probed
with'ZP-labeled~Yho 1 fragment. n2095 allele showed the missing of the 4.1 kb
fragment and the extra 2.1 kb fragment, 0.4 kb fragments were not affected in
both alleles (data on a separate gel, not shown here),
rigure 3A-C show that CLD-G Contains a Phosphatytrsine Binding
Domain. Figure 3A shows that aligntnent of CED-6 PTI~ (SfiQ 1D NO: 4) with
other fTB domain. The PTB domain alignment was based on the NMR structure
of Shc protein_ Black boxes indicate identical amino acids showed by >SU% of
sequences. Grey boxes indicatE similar amino acid showed by X50°~~ o f
sequc;nees. For this purpose, the following sets of amino acids are considered
similar: (3, A, C, S, T; E. D, Q, N; R, K, H; V, M, L, I; F, Y, W .a indicate
the a
AMENDED SHEET
CA 02318935 2000-07-21
WO 99/37770 PCT/US99/01361
-6
helices suggested by the NMR structure of Shc, and (3 the (3 sheats. Invariant
residues (found in all sequences shown) are highlighted by star, "*". Figure
3B
shows the comparison of CED-6 to other PTB domain containing proteins. Proline
rich regions and charged regions next to PTB domains and other regions. PTB
domains were compared in the percentage of identity. Figure 3C shows the
evolution tree of the PTB domains. The alignment from (A) was displayed using
Seqlab package in GCG program, and the evolution tree was grown graphically.
Figure 4 shows results of the Genetic Mosaic Analysis for CED-6 {table at
bottom) and Cell lineage of C. elegans (top). The descendence of both germline
and somatic sheath cells are illustrated. Body wall muscles cells which were
used
to determine the loss of the duplication were also illustrated. The solid
square
indicates the duplication loss in germ cells, and the solid square indicates
the
duplication loss in the somatic sheath cells. The black arrow indicates the
somatic
sheath cell with the enlarged nucleoli in the distal arm of the anterior
gonad. The
white arrow indicates the cell corpses accumulated in the proximal arm of
anterior
gonad.
Figure SA-D provide results that showed that heat-shock overexpression of
CED-6 cDNA rescued the engulfment defect in both soma and germline. Figure
SA shows the cell death during the embryonic development. Shaded box is a
histogragh indicating the number of dying cells every 50 minutes during the
embryonic development. The arrows indicates the timing of heat shock and the
timing to observe the engulfment phenotype. Figure SB shows the overexpression
of CED-6 cDNA promotes the engulfment at both the early and the late stage of
cell death. Transgenic animals carrying the transgene, CED-6 cDNA driven by
heat shock promoter were treated with heat before the cell death occurred at
the
indicated time. Cell Corpses in the head of young L 1 larvae were examined.
The
animals without the heat treatment were also examined. Other control
experiments
included N2, CED-6(n1813) with or without heat treatment, and CED-6(n1813)
carrying lacZ transgene treated with heat. The solid circles indicate the
experiments with the heat shock after the formation of cell corpses, and the
empty
CA 02318935 2000-07-21
WO 99/39770 PC'f/US99/01361
-7_
circles with the heat shock before the cell death took place and the
experiments
without heat shock. Figure SC shows the overexpression of CED-6 cDNA rescue
the engulfment defect in germline. The arrow indicates the timing for a heat
shock
when transgenic animals were at the development stage of the 24 hours after
the
L4 molt. Cell corpses were examined at the several time points between the
time
of heat shock and the 60 hours after the heat shock. Figure SD shows the
overexpression of CED-6 cDNA promotes the engulfment many hours after the
formation of the cell corpses in germline. Adult transgenic animals were
treated
with heat as indicated. Cell corpses were examined in one gonad arm 12 hours
after the heat shock. Control experiments including N2, and CED-6(n1813) are
indicated in (C).
Figure 6 presents results that show overexpression of CED-6 partially
suppresses the engulfment defect of both CED-1 and CED-7 during embryonic
development CED-6 was overexpressed at the genetic background of three alleles
of both CED-l and CED-7. The timing for the heat shock and the timing for the
examination of cell corpses are illustrated in figure SA. Animals with each
genetic
background were treated with heat before the cell death occurred or without
the
heat treatment. Cell corpses were examined in head of young L1 larvae. LacZ
was also expressed in the each genetic background. Each mutant was also
treated
with heat shock to examine the effect of heat on the expression of cell
corpses.
Figure 7 is a model of the epistatic pathway for the engulfment genes
overexpression of CED-6 did not have an obvious effect on the cell corpses
expression on CED-2, 5 and 10 but on CED-l and CED-7. We propose that
CED-6 might act downstream of both CED-l and CED-7. And CED-2, 5 and 10
either act in the different pathway or act downstream of CED-6.
Figure 8 is a flow chart illustrating a Xho I fragment from F56 cosmid
rescues the CED-6 engulfment defect.
Figure 9A-B are schematics that illustrate that the COSD2.7 construct is
CED-6. Figure 9A shows the restriction Map of Xho I fragment and rescue.
Figure 9B shows the transcripts.
CA 02318935 2000-07-21
WO 99/37770 PCT/US99/01361
_g_
Figure 10 is a bar graph illustrating that the over-expression of CED-6
rescues the engulfment defect of the CED-6 mutant.
Figure 11 contains graphs illustrating that the over-expression of CED-6
rescues the engulfment defect of CED-6 mutant during embryonic development.
Figure 12 is a bar graph illustrating that CED-6 may also promote the
engulfment of persisting corpses.
Figure 13 shows that CED-6 promotes the engulfment of persistent cell
corpses and probably acts within engulfing cells.
Figure 14 is a schematic that shows that CED-6 may be an adaptor protein
acting in signal transduction pathway.
Figure 15 shows graphs which indicate that over-expression of CED-6
rescues the engulfment defect in the adult gonad, and CED-6 might act in
somatic
sheath cells.
Figure 16 illustrates that over-expression of CED-6 partially suppresses the
engulfment defect of CED-1 mutants.
Figure 17 shows that the over-expression of CED-6 cDNA suppresses the
engulfment defect of CED-7 mutants.
Figure 18 shows consensus DNA sequence (SEQ ID NO: 7) of h 1 CED-6
(2416bp) with start and stop codon in bold and alternatively spliced sequence
underlined.
Figure 19 shows DNA sequence (SEQ ID NO: 13) of h2CED-6 (alternative
splice) with start and stop codons in bold.
Figure 20 shows the amino acid sequence (SEQ ID NO: 8) of h 1 CED-6
with alternatively spliced region underlined.
Figure 21 shows the amino acid sequence (SEQ ID NO: 14) of h2CED-6
(alternative splice).
Figure 22 shows h 1 CED-6 cDNA (SEQ ID NO: 7) and h 1 CED-6 (SEQ ID
NO: 8) amino acid sequence with PTB domain nucleic (SEQ ID NO: 9) and amino
acid (SEQ ID NO: 10) sequences, charged region, and proline/serine rich
nucleic
acid (SEQ ID NO: 11 ) and amino acid (SEQ ID NO: 12) sequences indicated.
CA 02318935 2000-07-21
WO 99/37770 PCTNS99/01361
-9-
Figure 23 shows an alignment of CED-6 and hlCED-6.
Figure 24 shows an alignment of regions of 47.5% and 31.6% identity,
respectively.
Figure 25A Human Multiple Tissue Northern Blot (MTN), Figure 25B
shows a Human Multiple Tissue Northern (MTN) Blot II, and Figure 25C shows a
Human Cancer Cell Line Multiple Tissue Northern (MTNT"') Blot. The expression
pattern of hlCED-6 in normal human tissues and cancer cell lines by Northern
blotting is shown.
Figure 26 is a map of plasmid pGA3015 in which a CED-6 fragment is
cloned as a C-terminal fusion to GFP.
Figure 27 is a map of plasmid pGA3064 with CED-6 cloned as a C-
terminal fusion of GFP.
Figure 28A-28F is a DNA alignment (Genework) of sequenced hbc3123
EST clone, the PCR fragment I isolated from a cDNA library, and three EST
sequences identified using the PCR fragment. hbc3123 EST clone was sequenced
and analyzed. The three EST clones were identified through searching the
Genbank using the isolated PCR fragment.
Figure 29 shows the amino acid sequence (SEQ ID NO: 16) of the human
h3 CED-6, as compared to hlCED-6 (SEQ ID NO: 8).
Figures 30A-B show the nucleic acid sequence (SEQ ID NO: 15) that
encodes human h3 CED-6, as compared to h 1 CED-6 (SEQ ID NO: 7).
Figures 31A-B show that overexpression of h3CED-6 rescue an engulfment
defect. Figures 31A shows overexpression of hCED-6 rescued the engulfment
defect of CED-6(n1813) embryos. Embryos laid by transgenic mothers were heat-
shocked before the wave of embryonic cell death, and scored for the numbers of
persistent cell corpses in head of L1 larvae. Each dot represents one animal.
Figure 31B shows overexpression of hCED-G rescued the germ cell engulfment
defect of CED-6(n1813) animals. Transgenic animals were heat-shocked 36 hours
after L4/adult molt, and germ cell corpses were scored 12 hours after heat
shock.
The number of animals scored is indicated on the top of each bar.
CA 02318935 2000-07-21
WO 99/37770 PCT/US99/0136i
-10-
Figure 32A-J shows the nucleic acid sequence comparison among ESTs,
CED-6, hCED-6, and a consensus construction of 2416 by consensus sequence
was done by using sequence information obtained from EST RACE & colony
hybridization. Seq was compiled by using aa1599394 as template and primers as
indicated in multiple alignment. Rcc stands for the reverse complement. Both
CED-6 and hCED-6 are indicated above the multiple alignment pGA101 was
picked up by colony hybridization.
DETAILED DESCRIPTION OF THE INVENTION
cDNAs encoding the alternative splice h2CED-6 and the additional
sequence required to constitute h3CED-6 from h2CED-6 have been deposited at
the Belgian Coordinated Collections of Microorganisms (BCCM) at Laboratorium
voor Moleculaire Biologie - plasmidencollective (LMBP), Universiteit Gent,
K.L.
Ledeganckstraat 35, B 9000, Gent, Belgium in accordance with the Budapest
Treaty on 8th June 1998 and have been accorded the Accession Nos LMBP 3868
and LMBP 3869, respectively.
Primers which will assist in obtaining the relevant inserts from these
deposits are shown in Example 14.
CA 02318935 2000-07-21
13-04-2000 U S 009901361
PCT/US9~I01361
-I 1-
AMINO ACID AND NUCLEOTInF Sh:QUF~iCES
SEQ. ID NO. Nucleic acid sequence of C. r~le~ans C.'ED-6.
1 (e.g., Tigurc 2A)
SEQ. lU NO. Amino Acid sequence of G'. elegans CETS-6
Z (e.g., rigum 2A)
Nucleotide sequence c,-ncoJing PT13 domain
of C. clescena CED-G (~.~.,
SFQ. ID X10.
3
Figure 2A)
Amino acid sequence of I''FH domain of C.
elcsans CLD-G (e.g.,
SEQ. ID NO.
4
C'igure 2A)
NuclcotiJc soqunnce encoding prolinelscrine
rich region of C.
SEQ. I D NCIi.
5
elegnns Cl'sIl-6 (e.g.. >:iguru 2A)
Amino acid soquence of prolinc;lsvxinc; rich
region of C. elegatr~
SEQ..I U
YO. G
CJrI)-6 (c.g., Tigure 2A)
SIH;Q. ID NU. Nucleotide sequence that encodes hl(;~l)-6
~ (e.g., I<igure 22,1'igvre 18)
S1:Q. IU NO. Amino acid scquct~ce of hlCl;I?-6 {c.b., Figure
8 2Q and rigure 22)
SI~:Q. Tt1 Nn. lVuclcotiVe sequence encoding, P'FB domain
9 of hlCl:D-G (o.i;.,l:ibure 22)
Amino acid suqw'rtcc encoding P1'B domain
of hlCLO-G (e.g.,1'igurc
1 SFQ. ID NO.
S 10
zz.)
Nucleic acid sequence tl~al encodes the hrolinelserinc
rich rcbion of
SEQ.1D NO. 11
hICE~-6 (c.g., Figure 22)
Amino acid sequence of the prolinc/s~~rinc
rich region of hlCJrl)-G (c.g.,
SEQ.11) NO.1 .
Z
Figure 22)
SF,Q. ID NO. Nucleotide sequence that encoacs h2CTD-6 (e.g.,
13 l~'igurr 19)
sQ. In No. ~4
Amino acid sequc,ncc of b2CTsD-6 (e.g., hibrurc
21)
Sk;Q. II) NO.15Nuclootidc sequence encoding h3CED-6 (c.g.
rigure 30A ~3)
SFQ. ID hi0. Aauino acid sequence of h3CED-6 (e.g. Pigure
16 29)
AMENDED SHEET
CA 02318935 2000-07-21
WO 99/37770 PC'f/US99/01361
-12-
C. ELEGANS CED-6
Programmed cell death has traditionally been divided into two distinct,
sequential processes: cell killing, and the removal of dead cells. However,
these
two events are very closely linked. In vivo, cells that present an apoptotic
morphology are usually already engulfed by other cells (Wyllie A. H. et al.,
1980
Int. Rev. Cytol ~$, 251-306; Lockshin R.A. ( 1981 ) Cell Death in Biology and
Pathology, R.A. Lockshin and LD. Browen, eds. (London: Clapman and Hall),
pp79-122; Duvall and Wyllie (1986). Immunol Today 7 pp 115-119; Robertson
and Thompson (1982) J. Embryol. Exp. Morph. ~ pp 89-100; Hedgecock et al
(1983) Science ~, 1277-1279; Ellis et al ( 1991) Genetics 1~2 pp 79-94;).
Engulfment is also a swift and efficient process in the nematode
Caenorhabditis
elegans : dying cells are engulfed and completely removed by their neighboring
cells within an hour (Sulston and Horvitz, ( 1977); Dev. Biol ,5~ pp 110-156;
Robertson and Thomson, 1982). The engulfment is not necessarily by
professional
phagocytes. Rapid engulfment of apoptotic cells is important, as it prevents
dying
cells from releasing potentially harmful contents during their lysis, which
could
damage surrounding tissue and result in an inflammatory response (Duvall et
al.,
(1985) Immunology,S~ pp 351-358; Savill et al., (1989) J. Clin. Invest. $,~ pp
865-875; Grigg et al., (1991) Lancet X58 pp 720-722; Savill et al., (1993)
Immunol. Today 1_4, pp 131-136).
The nematode C. elegans has been used extensively for the study of
programmed cell death {reviewed by Hengartner, ( 1997) Cell Death in C.
elegans
II, Plain View, Cold Spring Harbour Laboratory Press, pp 383-415). Genetic
studies have identified over a dozen genes that function in the regulation and
execution of apoptosis in C. elegans. Six genes - CED-1, CED-2, CED-5, CED-6,
CED-7, and CED-10 - function in the engulfment of all dying cells (Hedgecock
et
al., 1983; Ellis et al., 1991; Horvitz et al., ( 1994) Cold Spring Harbour
Symp.
Quant Biol ( 1994) ~: pp 377-385). In animals mutant for any one of these
genes,
many apoptotic cells fail to be engulfed and persist for many hours as highly
refractile disks that can be readily identified under differential
interference contrast
CA 02318935 2000-07-21
WO 99/37770 PCT/US99/01361
-13
(DIC) optics (Hedgecock et al., 1983; Ellis et al., 1991 ). None of the six
engulfinent genes is absolutely essential for engulfment, as many dying cells
are
still properly removed in these mutants. Genetic analysis of various double
mutants has suggested that these six genes might form two partially redundant
S groups, one being comprised of CED-1, CED-6, and CED-7; the other of CED-2,
CED-5, and CED-10 (Ellis et aL, 1991 ). The number of persistent cell corpses
is
increased dramatically in double mutants crossing groups, but not in those
within
the same group. Understanding how these genes are involved in regulating
engulfment requires the elucidation of their molecular nature.
In other species, several candidate apoptotic receptors have been identified
over the past few years; these include the ATP-binding cassette transporter
ABC 1
(Luciani and Chimini, ( 1996), EMBO J. ~S pp 226-235) adhesion molecules such
as the vitronectin receptor (Savill et al (1990), Nature ~ pp 170-173) and
CD36
(Asch et al. ( 1987) J. Clin. Invest. 7~ pp 1054-1061; Savill et al ( 1992) J.
Clin.
1 S Invest. ZQ pp 1513-1522; Ren et al ( 1995) J. Exp. Med.1$1857-1862),
Drosophila
croquemort (Franc et al., (1996), Immunity 4_, pp 431-443 class A scavenger
receptors (Platt et al., (1996), Proc. Natl. Acad. Sci. USA Q,~ pp 12456-
12460)
lectins (Duvall et al., (1985), and a predicted receptor that can recognize
phosphatidylserine on the outer leaflet of apoptotic cells (Fadok et al., (
1992) J.
Immunol. ,~$ pp 2207-2216; Fadok et al ( 1992) J. Immunol ~Q pp 4029-4035).
Currently little is known about the molecules used by engulfing cells to
transduce
signals from surface receptors to the cytoskeleton, or how these molecules
regulate
the local cytoplasmic rearrangements and dynamic extensions that are required
for
phagocytosis (Savill et al., 1993). A genetic analysis of engulfment in C.
elegans
could identify genes involved in these processes. Indeed Wu and Horvitz (
1998)
(Nature ,9~ pp 501-504) showed that C. elegans CED-S is homologous to human
DOCK180, and might regulate cytoskeleton rearrangement during engulfment.
The process of apoptosis has been implicated in the etiology, or associated
with the pathology, of a wide range of diseases, including cancer, autoimmune
diseases, various neurodegenerative diseases such as Amyotrophic Lateral
CA 02318935 2000-07-21
WO 99/37770 PC'C/US99l01361
-14
Sclerosis, Huntington's Disease, and Alzheimer's Disease, stroke, myocardial
heart infarct, and AIDS (Thompson, (1995) Science ~, pp 1456-1462). Thus, a
better understanding of the molecular events that underlie apoptosis might
lead to
novel therapeutic interventions. While much of the current attention is
centered on
the genes and proteins that control the killing step of the death process, it
is very
likely that the removal of apoptotic cells will prove to also be crucial for
the proper
overall functioning of the apoptotic program, and will offer another entry
point for
therapeutic intervention (as described herein).
The process of recognition and engulfment of dying cells is extremely swift
and efficient. In animals, it is essentially impossible to find a cell with
apoptotic
features that is not already within another cell. Such rapid recognition and
phagocytosis of apoptotic cells is a crucial aspect of programmed cell death
in
vivo: unengulfed apoptotic bodies can undergo secondary necrosis, leading to
inflammation. Failure to remove apoptotic bodies also exposes the body to
novel
epitopes (from e.g., caspase-generated protein fragments), possibly
encouraging
the development of autoimmune disease. Persistent apoptotic bodies can often
be
observed following chemotherapeutic intervention (which leads to extensive
apoptosis) and are particularly abundant in solid tumors, in which clearance
of cell
corpses might be delayed.
In addition to their ability to recognize and engulf apoptotic cells,
professional phagocytes carry specific surface receptors, such as the Fc
(Ravetch,
(1994) Cell Z$ 553-560; Greenberg et al., (1993) J. Exp. Med. 177 pp 529-534)
and C3 (Bianco et al., (1975) J. Exp. Med. l~ pp 1278-1290; Greenberg, (1995)
Trends in Cell Biol. ~ pp 93-99) receptors, which recognize antigen-opsonized
particles and trigger their phagocytosis. Inhibitor studies have shown that Fc
receptor-mediated phagocytosis requires tyrosine phosphorylation (Greenberg et
al., 1993; Greenberg, 1995). The work of the present inventors suggests that
the
engulfment of apoptotic cells could be also mediated by a tyrosine kinase
signal
transduction pathway. While these two pathways clearly use distinct receptors
at
the cell surface, they must eventually converge on the same downstream
CA 02318935 2000-07-21
WO 99/37770 PCTNS99/01361
-15
engulfinent machinery, and could thus share at least some common signal
transduction molecules.
The invention relates to an isolated protein which is an adaptor molecule in
a signal transduction pathway which regulates phagocytosis of apoptotic cells.
In a particular embodiment, the invention pertains to an isolated protein
from the nematode worm C. elegans which is an adaptor molecule acting in a
signal transduction pathway which promotes phagocytosis of apoptatic cells,
which protein comprises the amino acid sequence shown in Figure 2A (SEQ ID
No: 2) or an amino acid sequence which differs from Figure 2A only in
conservative amino acid changes. As aforesaid the amino acid sequence shown in
Figure 2A is that of the C. elegans CED-6 protein with its encoding DNA also
shown.
In another of the aspects the invention comprises a nucleic acid comprising
a sequence of nucleotides which encodes the amino acid sequence of Figure 2A,
(SEQ ID No: 2) for example, a sequence of nucleotides from about nucleotide
position 22 to about nucleotide position 1500 of Figure 2A or the entire
sequence
of nucleotides shown in Figure 2A.
In a further embodiment of the invention there is provided an isolated
protein which is a fragment or portion of a protein having the amino acid
sequence
of Figure 2A or of a protein having an amino acid sequence which differs from
that shown in Figure 2A only in conservative amino acid changes. For example,
the portion may comprise an amino acid sequence corresponding to the
phosphotyrosine binding domain (SEQ ID No: 4) (about amino acid 46 to about
amino acid 193 in Figure 2A) or an amino acid sequence corresponding to the
proline/serine rich region (SEQ ID No: 6) (about amino acid 242 to about amino
acid 339 in Figure 2A).
Nucleic acids (SEQ ID Nos: 3 and 5 respectively) encoding the PTB
domain or the proline/serine rich region of the C. elegans CED-6 protein are
encompassed by the claimed invention.
CA 02318935 2000-07-21
WO 99/3???0 PCT/US99/01361
-16-
In yet a further aspect of the invention there is provided an isolated nucleic
acid capable of hybridizing to the sequence of nucleotides of SEQ ID Nos: 1,
3, 5,
7, 9, 11, 13, 15 under conditions of low, medium or high stringency. It is to
be
understood that low stringency means approximately: 0.2 to 2xSSC; 0.1% SDS;
S 25° to 50°C.
In a further embodiment of the invention there is provided a fusion protein
which comprises as part of the fusion a protein having an amino sequence of
SEQ
ID No: 2, 4, 6, 8, 10, 12, 14, or 16 or an amino acid sequence which differs
from
the amino acid sequence shown in SEQ ID Nos: 2, 4, 6, 8, 10, 12, 14, or 16
only in
conservative amino acid changes. The protein may be fused to, for example, an
epitope tag or the expression product of a reporter gene.
In yet a further aspect the invention provides expression vectors comprising
any of the nucleic acid sequences of SEQ ID Nos: 1, 3, 5, 7, 9, 11, 13, 15.
Preferably, the vectors incorporate a reporter gene such as green fluorescent
protein which is positioned relative to the nucleic acid of the invention such
that
expression of the nucleic acid results in expression of the reporter gene.
Preferably, a fusion of CED-6 and the reporter gene is expressed.
it is to be understood that the term "nucleic acid" as used herein may
include genomic DNA, RNA and cDNA.
Positional cloning methods were used to clone the G elegans CED-6 gene
and determine the nucleotide sequence. In addition they have functionally
characterized the protein. By searching publicly available protein sequence
databases, it has been determined that the CED-6 protein has in the N-terminal
half
a putative phosphotyrosine binding domain and in the C-terminal half a
proline/serine rich region which is a potential SH3 binding domain.
Genetic mosaic analysis, as well as rescue and over-expression
experiments, have shown that CED-6 acts autonomously within engulfing cells
and promotes engulfment of apoptotic cells. Further database searching has
confirmed the functional regions to be surprisingly evolutionally conserved.
Thus,
CA 02318935 2000-07-21
WO 99/37770 PCT/US99/01361
-17-
the inventors have now cloned two human homologues of the C. elegans CED-6
gene and shown them to have equivalent function.
Molecular Cloning of C. elegans CED-6
Previous genetic mapping experiments by Ellis and Colleagues (Ellis et al,
( 1991 ) {Genetics 129 pp 79-94) have placed CED-6 gene close to the daf 4
locus
on chromosome three (Figure lA). The region around daf 4 has been mostly
sequenced by the C. elegans genome sequence consortium (Wilson et al, (1994)
Nature 368 pp 32-38). To determine the exact physical location of CED-6; the
present inventors collected thirteen overlapping cosmids in this region which
together are roughly 0.3 Mbp. Using the germline transformation method (Mello
and Fire, (1995), methods in cell biology (San Diego Academic Press) pp 452-
482)these cosmids were tested for their ability to rescue the engulfment
defect of
CED-6(n1813), by scoring three-fold embryos laid by transgenic animals for the
presence of persistent cell corpses. Three fold embryos were chosen for the
initial
study because cell corpses are numerous and easily seen at this stage of
development. Two overlapping cosmids F56D2 and F43F12 were found to be
able to rescue the engulfment defect of CED-6(n1813). The further rescuing
experiments using the DNA fragments from F56D2 were identified to contain the
rescuing activity.
The gene prediction program GENEFINDERTM suggested that this region
contains two genes, which the C. elegans genome sequence consortium submitted
to Genbank under the names F56D2.7 and COSD2.6. Using a combination of RT-
PCR and screening of cDNA libraries (see below) the existence and predicted
intron/exon pattern of F56D2.7 was confirmed. However, the inventors found
that
COSD2.6, rather than corresponding to a single gene, actually corresponds to
two
genes and the short distance (»>bp) between the end of the upstream transcript
and the start of the downstream transcript suggested that COSD2.6A/B might be
a
two-gene operon (Zorio et al (1994) Nature 372 pp 270-272.). It was found that
COSD2.6B is trans-spliced to the "downstream" splice leader SL2, whereas the
CA 02318935 2000-07-21
WO 99/37770 PCT/US99/01361
-18-
upstream transcript COSD2.6A is trans-spliced to the more common SL1 splice
leader (Figure lE).
The CED-6 Locus
To determine which one of the three genes present on the Xho I fragment
corresponds to CED-6, a number of constructs were generated containing
internal
deletions or point mutations. The deletion of most of the COSD2.6A/B operon
had
no deleterious effect on CED-6 rescue, whereas the introduction of a
frameshift
mutation within exon 3 of F56D2.7 abolished the fragment's rescuing activity
(Figure lE). To exclude the possibility that F56D2.7 might be a multicopy
suppressor of CED-6, and to confirm suspicions that F56D2.7 might correspond
to
the CED-6 locus, the two known CED-6 alleles, n1813 and n2095 were analysed
for any nucleotide changes within this region. Southern blot analysis revealed
an
allele-specific restriction fragment length polymorphism affecting F56D2.7 in
CED-6(n2095) mutants (Figure 2A). Based on the hybridization patterns observed
in n2095, a single nucleotide deletion in exon 4 of F56D2.7 in CED-6(n1813)
was
also identified. This mutation should result in a reading frame shift and a
truncated protein (Figure 2B). Taken together, the genomic rescue and mutation
data strongly suggested that F56D2.7 corresponded to CED-6.
Identification of CED-6 Transcripts
To confirm the predicted intron/exon structure for CED-b, the present
inventor screened a mixed-stage cDNA library and identified 10 clones
corresponding the CED-6 gene. Several of these contained splice leader SL2
sequences at the S' end, suggesting that CED-6 might also be a downstream gene
in an operon. RT-PCR was performed on mixed-stage RNA using both SL 1 and
SL2 trans-splicing leaders as primers for the PCR step. Interestingly,
sequence
analysis of the PCR-amplified fragments revealed that both SL1 and SL2 trans-
splicing leaders can be found at the 5' end of CED-6 transcripts (Figure 2B).
The
upstream gene in the CED-6 operon is the predicted gene F56D2.1. The presence
CA 02318935 2000-07-21
WO 99/37770 PCTNS99/01361
-19-
of SL1-traps-spiced mRNA suggests that CED-6 might also be transcribed from a
second downstream promoter, independently of the upstream gene. The existence
of a downstream promoter could explain why the Xho I fragment could rescue
CED-6 mutants even though it does not contain the whole CED-6 operon.
CED-6 Protein Contains a Phosphotyrosine Binding (PTB) Domain and a
Proline/Serine Rich Region
The full-length CED-6 cDNA is predicted to code for a 492 amino acid
protein (Figure 2B). A search of public sequence database with the predicted
CED-6 sequence indicated that the N-terminal half of CED-6 contains a putative
phospho-tyrosine binding (PTB) domain. PTB domains can promote binding to
phosphorylated tyrosine residues located within an appropriate primary
sequence
context. The PTB domain is similar in function, but distinct in structure from
the
SH2 domain. The present inventors have aligned the CED-6 PTB domain with the
PTB domains found in a number of other proteins (Figure 3A). Secondary
structure prediction programs suggest that most of these structural elements
also
exist in the CED-6 PTB domain.
In addition to its similarity to known proteins, the CED-6 PTB domain also
showed significant sequence similarity to the predicted translation products
of a
number of expressed sequence tags (ESTs; Figure 3A, B). In fact, the degree of
similarity between CED-6 and a number of these ESTs was much higher than
between CED-6 and any previously characterized protein (Figure 3A, 3B).
Furthermore, in several cases, the sequence similarity between CED-6 and ESTs
extended beyond the PTB domain (Figure 3B). CED-6 also contains a
proline/serine rich region at its C-terminal half, with 42% serine over a 24
amino
acids stretch and clusters of proline-rich regions (Figure 2B, Figure 3B).
These
proline-rich regions were characterized by several sequence signatures of PxxP
(Figure 2A), which has been shown to promote interaction with SH3 domains
(Rep et al, ( 1993); Yu et al ( 1994) Cell 76 pp 933-945,; Grabs et al ( 1997)
J. Biol,
Chem. 272 pp 13419-13425). Between the PTB and proline-rich regions is a short
CA 02318935 2000-07-21
WO 99/37770 ~ PCT/US99/01361
-20-
stretch rich in charged residues(4I % charged amino acids over 46 amino
acids).
This highly charged region is also found in several other PTB domain
containing
proteins, including mouse p96, Shc, and G elegans M110.S (Figure 3B).
Conservation of CED-6 Amongst Species
S It was found that these EST clones also shared the homology region
beyond the PTB domain with the CED-6 protein. A C. Briggsae EST clone has
72% identity to CED-6 over 132 amino acids at the N-terminus, and 64% identity
to CED-6 over 103 amino acids at the C-terminus (Figure 3B). Three overlapping
human EST clones were also obtained and constructed into one sequence. The
human EST fusion sequence showed -S4% identity to PTB domain of CED-6, and
also contains a highly charged region right after the PTB domain. The
evolution
tree based on the alignment of PTB domains showed that CED-6 formed a
subgroup with EST clones from human, Drosophila, and C. Briggsae, suggesting
that these proteins might be functionally conserved. Mouse p96, Drosophila
1S Disabled, and C. elegans M110.S formed another subgroup (Figure 3C). The
tree
also indicated that the Shc subgroup is more similar than the p96 subgroup to
CED-6 subgroup.
CED-6 Acts Cell-autonomously Within Engulfing Cells
A genetic mosaic analysis was performed to determine if CED-6 acts
within engulfing cells or dying cells. For convenience, a pair of cells on
adult
gonad, germ cells and somatic sheath cells (Figure 4A) were used. During
oogenesis large number of oocytes undergo programmed cell death, and normally
these dying cells are engulfed by somatic sheath cells {Hengartner,1997). In
this
analysis a mosaic pattern of genetic background for CED-6 and wild type
between
2S germ cells and somatic sheath cells was generated. Ncl-I mutant was used
for the
identification of the mosaic pattern in the single-cell resolution since in
the Ncl-1
mutant somatic cells of animals exhibit abnormal enlarged nucleoli, which can
be
easily identified under Normaski optics (Herman, 1984; Genetics 108 pp 16S-
189;
CA 02318935 2000-07-21
WO 99/37770 PCTlUS99/01361
-21
Hedgecock and Herman, 1995 Genetics 141 pp 989-1006). A strain was
constructed dpy-17(e164) CED-6 (n1813) mec-14(u55) ncl-1 (e1865)
unc-36(e251)III; sDp3. This worm strain showed a wild type phenotype since the
sDp3(111;,~ duplication covers all these mutations (Rosenbluth et al, (1985)
Genetics 109 pp 493-511 ). To identify the animals with CED-6 mutant germ
cells
and wild-type somatic sheath cells, animals must be found with the duplication
loss from any of P2, P3 and P4 lineages but not from EMS, MS or any lineages
below the MS which would lead to the loss of the duplication in somatic sheath
cells (Figure 4). These animals can be obtained by looking through many
animals
of the constructed strain for the animals laying only Dpy Unc progenies. The
animals with the loss of the duplication in P 1 lineage also lay only the Dpy
Unc
progenies, however these animals are not mosaic animals for the present
purpose
since the loss of the duplication in P 1 lineage results in the CED-6 mutant
background in both germ cells and somatic sheath cells. From 1,000 dpy-
17(e164)
1S CED-6(n1813) mec-14(u55) ncl-1(e1865) unc-36(e251)III; sDp3 animals, six
animals were identified laying only Dpy Unc progenies. Observation of these
six
animals under Normaski optics indicated that one animal had the duplication
lost
in P4, one in P3, three in P2, and one in P 1. All five animals displayed no
cell
corpses in gonad except the one with the duplication lost in P1, suggesting
that
CED-6 is not required in germline for engulfment. Since the chance for loss of
the
duplication in all cell divisions is approximately the same (Hedgecock and
Herman, 1995), the rate of the sDp3 loss is 0.15% per cell division. Animals
were
then looked for with the CED-6 mutant somatic sheath cells and wild-type germ
cells. From S00 animals four animals were identified with enlarged nucleoli in
the
somatic sheath cells in one arm of the gonad (Figure SB), and all four animals
did
not have the duplication lost in the lineage generating germ cells (Figure 4).
Three
animals appeared to have the duplication lost in sheath cells in the anterior
arm but
not in the posterior arm. And the accumulated cell corpses were only observed
within the anterior gonad arm, but not the posterior gonad arm of these
animals
(Figure 4, Table). One animal had the duplication lost in the sheath cells
CA 02318935 2000-07-21
WO 99/37770 PCTNS99/01361
-22-
surrounding the posterior gonad arm, but not in that surrounding the anterior
arm.
This animal had cell corpses accumulated within the posterior arm but not the
anterior arm (Figure 4). These results suggest that CED-6 is required for
somatic
sheath cells, or engulfing cells to eliminate the dying cells in adult gonad.
CED-6 Promotes the Engulfinent of Embryonic and Germ Cell Corpses
To unambiguously demonstrate that F56D2.7 cDNA indeed corresponds to
CED-6, the inventors tested whether the full-length F56D2.7 cDNA can rescue
the
engulfment defect of CED-6 mutants, and transgenic animals were generated
carrying the F56D2.7 cDNA under the control of the G elegans heat shock
promoters hsp-16.2 and hsp-16.48 (see Examples) Used together, these two
promoters drive expression in almost all somatic cells, including both cells
that
normally undergo programmed cell death and cells that normally engulf the
dying
cells. To test for rescue, embryos laid by transgenic mothers were exposed to
a
brief heat shock pulse just prior to the appearance of the first developmental
cell
deaths, and scored the number of persistent corpses visible in the heat-
shocked
animals after hatching (Figure 4). As expected, over-expression of F56D2.7
cDNA significantly and specifically reduced the number of persistent cell
corpses
visible in CED-6 mutants, confirming that F56D2.7 is the relevant gene
affected
by the mutations that we detected in CED-6(n 1813) and CED-6(n2095) mutants.
Rescue of F56D2.7 cDNA in germline was also tested (Figure SC). Adult
hermaphrodites were exposed to a brief heat shock pulse just prior to the
appearance of the germline cell death, and scored the number of persistent
cell
corpses 12 hours and beyond after the heat shock. No cell corpses were found
in
gonads of the majority of animals, suggesting that CED-6 cDNA can also rescue
the engulfment defect of CED-6 in germline.
Recognition and engulfment of apoptotic cells is a very early event in C.
elegans programmed cell death (Robertson and Thomson, ( 1982)J. Embryol. Ex.
Morph 67 pp 89-100). In CED-6 mutants, the extension of cytoplasm is blocked,
resulting in the persistence of cell corpses (Elks et al, 1991 ). These cell
corpses,
CA 02318935 2000-07-21
WO 99/37770 PCT/US99/01361
-23-
however disappeared from the animal eventually . To determine whether CED-6
acts only in a narrow time-window at the early stage of cell death or whether
the
signal transduction pathway can be used to engulf cell corpses formed many
hours
after cell death takes place, the inventors tested whether F56D2.7 cDNA
promotes
the engulfinent of persistent cell corpses. CED-6 was over-expressed three
hours
before the embryos hatch, when most of cells dying by programmed cell death
during the embryonic development have been dead approximately for five hours
(Figure SA), and examined cell corpses three hours after the heat-shock on the
head of L1 larvae. The number of cell corpses was found to be suppressed
significantly (Figure SB). The control experiments with either no heat
treatment,
or over-expression of lacZ showed no obvious effect on the corpse expression,
suggesting that over-expression of CED-6 can promote the engulfment of cell
corpses in soma (Figure SB). The inventors also tested if over-expression of
CED-6 could promote the engulfment of cell corpses formed hours after the cell
death in the germline (Figure SD). Adult transgenic animals carrying CED-6
cDNA driven by the heat shock promoters were heat structured at several time
points after the accumulation of cell corpses in gonad and the number of cell
corpses 12 hours after the heat shock were examined. It was found that cell
corpses
could be removed sufficiently at all time points, suggesting that over-
expression of
CED-6 can promote the engulfment of cell corpses accumulated in germline for
hours, even days (Figure SD). The present inventors have concluded that the
signal transduction pathway in which CED-6 is involved can carry on the task
of
removing cell corpses, and there is no specific time-window for CED-6 to act
during the process of programmed cell death.
Mosaic CED-6 Protein Expression Supports, That CED-6 Acts Within Engulfing
Cells
The invention includes methods to detect quickly if CED-6 acts within
engulfing cells. This method is based on dying cells' failing to express
proteins so
as to generate a mosaic pattern of protein expression. However, this idea can
be
CA 02318935 2000-07-21
WO 99/37770 PCT/US99/01361
-24-
only applied to the soma, but might not to the germline, since in germline all
germ
cells share one syncytial cytoplasm (Hirsh et al, ( 1976) Developmental
Biology 49
pp 200-210), so those germ cells carrying the transgenes could contribute the
expressed proteins into the cytoplasm, subsequently all newly formed oocytes.
S However the mosaic pattern of the protein expression can be generated in the
germline because the transgenes have been found not to be expressed well in
germ
cells. The expression pattern of heat shock promoters in gonad were examined.
Adult animals carrying the lacZ transgenes driven by heat shock promoter were
applied heat shock 24 hours after L4 molts. The lacZ expression by beta-gal
staining in both germ cells and sheath cells was subsquently examined. It was
found that somatic sheath cells were stained blue and the stain could last 60
hours
after the heat shock, but not the germline at any time point after the heat
shock, the
similar result was also observed in previous studies (Stringham et al, (1992)
Molecular Biology of the cell 3 221-233). The expression of CED-6 in germline
upon heat shock was also examined for three-fold embryos laid by heat-treated
transgenic animals for the rescuing activity of the engulfment defect. It was
found
that the majority of embryos had the CED-6 mutant phenotype, suggesting that
CED-6 is not expressed well in germline. That CED-6 transgene in gonad is not
expressed very well provided a useful tool to test if CED-6 acts within the
somatic
sheath cells. As described in Figures 4 and 5, cell corpses were not observed
in
majority of animals in gonad at the different time point after the heat
treatment,
and the phenomenon lasted until 60 hours or beyond after the heat treatment
(SC).
In contrast to this result, without the heat treatment these transgenic
animals had
cell corpses accumulated in gonad, similar to that of the CED-6(n1813) mutant.
Over-expression of lacZ didn't affect the expression of cell corpses of CED-6
mutant, either (SC). These results support the conclusion from the mosaic
analysis
that CED-6 might act within engulfing cells, the somatic sheath cells. This
method
provides a simple way to detect if a gene acts within engulfing cells or dying
cells.
CA 02318935 2000-07-21
WO 99/37770 PCT/US99/01361
-25-
Site of active of CED-6 in relation to CED-l and CED-7
To understand if CED-6 genetically interacts with any other engulfment
genes, CED-6 was over-espressed at the genetic background of CED-l, 7, 2, 5,
and 10. The extra-chromosomal arrays carrying CED-6 cDNA driven by heat
shock promoters were transferred from CED-6(n1813) background to wild-type
N2 background, and subsequently to CED-1. 7, 2. 5, and 10 mutant background.
CED-6 was then over-exposed by following the method used for the rescue of
CED-6 engulfment defect by the over-expression of CED-6 cDNA as described in
Figure 5A. It was found that over-expression of CED-6 could partially suppress
the engulfment defect for CED-7(n1997). To understand if the suppression is
allele-specific, two additional alleles, CED-7(n1996) and CED-7(n1892), were
tested and similar results were achieved, suggesting that the suppression is
not
allele-specific (Figure 6). For the same purpose three alleles of CED-l,
n1506,
n1995, and n1735, were also tested it was found that over-expression of CED-6
could partially suppress the engulfment defect of three alleles of CED-1
(Figure 6).
Several control experiments were performed to confirm that these rescue were
specific for CED-6. Transgenic animals with CED-6 transgene without heat
treatment were tested; over-expression of lacZ at CED-1 or CED-7 engulfment
mutant background was also tested. Results showed that the similar numbers of
cell corpses were achieved as that of the CED-I or CED-7 mutants. Heat
treatment reduced the expression of cell corpses for CED-7(n1997). Over-
expression of CED-6 reduced the expression of cell corpses even more. These
data suggest that the partial suppression of the engulfment defect of both CED-
I
and CED-7 are specific for CED-6. It was also observed that over-expression of
CED-6 did not have obvious effect on the number of cell corpses for CED-2, 5
and
10. These results suggested that CED-6 might act downstream of both CED-l and
CED-7, and CED-2, 5 and 10 act either downstream of CED-l, 6, and 7 or in a
different pathway (Figure 6).
CA 02318935 2000-07-21
WO 99/37770 PC'f/US99/01361
-26-
The Regulation of the CED-6 Expression
SL2 was detected at the 5' end of the CED-6 cDNA, suggesting that CED-6
is a downstream gene of an operon (Huang and Hirsh, ( 1989); Proc. Natl, Acad.
ScLUSA 86 pp 8640-8644; Spieth et al (1993) Cell 73 pp 521-532; Zorio et al
(1994) Nature 372 pp 270-272; Blumenthal et al (1995) TIG II pp 132-136). The
inventors have shown previously that a 10 kb Xho I fragment can rescue the
engulfment defect of the CED-6 mutant. The fragment, however contains only
CED-6, the downstream gene of an operon, but not the upstream one. The
expression of CED-6 might rely on the 1 kb upstream region of CED-6 gene, a
intergenic region of the operon. The Intergenic region of a operon sometimes
could be used as a promoter for the expression of the downstream gene
(Blementhal and Steward, (1997 C.elegans II) (Cold Spring Harbor; Cold Spring
Harbor Laboratory Press pp 117-145)
CED-6 is an Adaptor Molecule Acting in the Signal Transduction Pathway of the
1 S Engulfment
Protein phosphorylation is a well-defined "switch" mechanism for cells to
deliver signals from one protein to another, and it is essential to transduce
extracellular signals inside cells. PTB domain is another domain besides the
SH2
domain to be able to interact with a phosphorylated tyrosine residue
(Kavanaugh
and Williams, (1994) Science 266; Blaikie et al, (1994) J.Biol.Chem 269 32031-
32034). Several proteins containing PTB domains have been found to act as
adaptor molecules in the signal transduction pathway. These include Shc, Sck,
Numb, FE65, disabled, DOC-2, P96 and IRS-1 (Bork and Margolis, (1995) Cell
80 pp 693-694); Geer and Pawson, (1995) TIBS 20 pp 277-280). The proline rich
region from many proteins have been shown to form multiproline helix and
interact with a SH3 domain (Ren et al, 1993; Gout et al, (1993) Cell 75 pp 25-
36;
Yu et al, i 994). Both biological analysis and analysis of the crystal
structure of
the SH3 binding domain suggested that the sequence signature, PxxP, was
essential for its interaction with the SH3 domain {Ren et al, 1993; Yu et al,
1994;
CA 02318935 2000-07-21
WO 99/37770 PCTNS99/01361
-27
Grabs et al, 1997). CED-6 contained stretches of proline rich regions
containing
the PxxP signature, suggesting its potential to interact with the SH3 domain.
CED-6 is an adaptor molecule that directly or indirectly transduces the signal
from
receptors to effectors or cytoskeleton molecules to initiate the engulfment
process.
The Interaction Partners of CED-6
The PTB domain has been shown to interact specifically with a NPXY(p)
motif (Kavanaugh and Williams, 1994; Zhou et al, (1995) Nature 378 pp 584-592;
Geer and Pawson, 1995). Many receptors such as EGF receptor, TrkA, insulin
receptor, IGF-1 receptor contain this motif at the carboxyl terminal (Geer and
Pawson, 1995). Signals from these receptors have been shown to be transduced
through the interaction of a phosphotyrosine residue of this motif with PTB
domains of adaptor molecules, such as Shc and insulin receptor substrate 1.
The
inventors found that in the intracellular region of CED-7 there was a NPXY(p)
motif. CED-7 has been suggested to act in the same genetic pathway with CED-6
(Ellis et al, 1991). The inventors have shown that CED-7 might act upstream of
CED-6 (Figure 7). CED-7 encodes a ABC transporter, and its mammalian
homologue, ABC 1 was found to be required for the macrophage to engulf dying
cells (Luciani and Chimini, 1996), suggesting that CED-7 might act within
engulfing cells. It is possible for CED-6 to physically interact with CED-7
through a PTB domain with NPXY(p) motif of CED-7 to regulate the signal
transduction of engulfment process.
CED-6 also contains a proline/serine rich region with several sequence
signature PxxP, which might mediate its interaction with the SH3 domain. The
SH3 domain has been suggested to mediate protein-protein interactions between
signaling molecules downstream of membrane-bound receptors (Koch et al, (1991)
Science 252 pp 252-673; Pawson and Schlessinger, ( 1993) Current Biology 3 pp
434-442. A SH3 domain containing protein is likely to interact with CED-6 and
to
regulate the signal transduction pathway of engulfment. Several proteins might
directly or indirectly interact with CED-6 protein. CED-1 might act upstream
of
CA 02318935 2000-07-21
WO 99/37770 PCT/US99/01361
-28-
CED-6(Figure 6 & 7A). The relationship between CED-l and CED-6 will depend
on,the cloning of the gene. A protein with a phosphorylated tyrosine residue
should exist to interact with the PTB domain of CED-6. This phosphorylated
protein is either a tyrosine kinase or a substrate of a tyrosine kinase, and a
tyrosine
phosphatase should also be involved in the signal transduction pathway of
engulfment to down-regulate the activity of the phosphorylated proteins. Some
studies on phagocytosis in mammalian system have shown that a tyrosine kinase
signal transduction pathway might play an essential role in the opsonin-
mediated
phagocytosis process (Roshenshine and Finlay, ( 1993) BioEssays 15 pp 17-24;
Greenberg, (1995) Trends in Cell Biology 5 pp 93-99. The present results
suggest
that it might be the same case for the PCD triggered engulfrnent. These two
types
of phagocytosis might share some similarity at the end.
CED-6 Acts Within Engulfing Cells
A genetic mosaic analysis has been performed to determine that CED-6
acts within engulfing cells. This conclusion was drawn based on the
observation
of a pair of cells, germ cells and somatic sheath cells. We have shown
previously
that over-expression of CED-6 can promote the engulfment of cell corpses.
Since
cells that have been dead for many hours are very unlikely to maintain their
ability
for protein expression (Estus, 1994; Freeman, 1994), the rescue of cell
corpses is
most likely to be due to the expression of CED-6 within the engulfing cells.
This
result suggests that CED-6 also acts within the engulfing cells in the soma.
Previously it has been shown by the inventors that over-expression of CED-6
could rescue the engulfment defect of CED-6 in both soma and germline (Figure
5), suggesting that CED-6 acts in a similar mechanism in both places.
CED-b Can Promote the Engulfment of Cell Corpses
Over-expression of CED-6 promotes the engulfment of dying cells at a
very early stage of the cell death, and cell corpses formed hours after the
cell
death. Cell corpses have been shown to have a typical morphology of apoptotic
CA 02318935 2000-07-21
WO 99/37770 PCT/US99/01361
-29-
cells, for instance, membrane blebing. The antigens presented on the membrane
surface of cell corpses for their recognition by engulfing cells might be
somewhat
different from that on the membrane surface of the early dying cells.
Irrespective
of ligands on dying cells and receptors on the engulfing cells are the same or
not in
both situations, CED-6 is required for the engulfment. A few cell corpses in
the
gonad were not removed upon heat shock for some animals later after the heat
shock. These corpses tend to be located in between oocytes and closed to the
spermatheca. The failure of the engulfment of these cell corpses might be due
to
their lack of contact with the sheath cells. It is concluded that cell
corpses, just
like dying cells at the early stage of the PCD, can trigger phagocytosis. In
mec-4
mutant animals six touch sensory neurons die of necrotic death due to a
channel
defect leading to an impaired osmotic pressure in these cells (Driscoll and
Chalfie,
( 1991 ) Nature 349 pp 588-593). Chung and Driscoll showed that the removal of
the swelling dead cells was delayed significantly at the CED-6 background,
implying that CED-6 is also involved in the removal of necrotic dying cells.
Thus,
there might be similar signals presented on the surface of dead cells to allow
them
to be recognized by engulfing cells regardless the manner of the death; and
the
signal transduction pathway in which CED-6 is involved can be used to respond
to
these signals to cause engulfment. The fact that engulfment is triggered so
early
and is completed so swiftly is a clever design of nature, it is important
especially
for tissues with massive cell death.
Conservation of the Engulfment Program
In an alignment, an EST clone from G Briggsae is highly conserved with
CED-6 in both the N- and C-terminal region, suggesting that this EST clone
might
represent a real CED-6 homologue (Figure 3B). EST clones for Drosophila and
human are also highly conserved to CED-6 but mainly in the region of PTB
domain (Figure 3A & 3B). This result suggested the possibility for these PTB
domain proteins to be functional homologues of CED-6 in those specimens. As a
CA 02318935 2000-07-21
WO 99/37770 PCT/US99/01361
-30-
result two human homologues of C.elegans CED-6 gene have been cloned and
characterized.
Expression Vectors and Transfected Mammalian Cells Expressing CED-6
Fragments of C.elegans CED-6 DNA was inserted into commercially
available vectors, including vectors having the reporter gene, green
fluorescent
protein (GFP), are set out in table 1 below;
TABLE 1
GFP-CED-6 expression in MCF7
Cloning of CED-6 fragments in pEGFP
from
...
(bp)
- to
....
(b-)
1.
Vector 2-1591 22-1492598-1581598-149422-745 744-1581744-1494
TA-PCR pGAI pGA2 pGA3 pGA4 pGAS pGA6 pGA7
pAS2 pGA1011 pGA1013
pGAD414
pEGFP-C1()pGA3011 pGA3013 pGA3015
pEGFP-C3(') pGA3036
pEGFP-N3() pGA3045
pEGFP-N3() pGA3062 pGA30(~4 pGA3067
*are commercially available from Clontech
Visualization GFP fluorescence in MCF7 cells
Human breast cancer cells, MCF7 (ATCC: HTB-22), were seeded in Lab
Tek chambered coverglass (Nalge Nunc International) and transfected using
lipofect~~MINE (GibcoBRL). After 18 hours, the chambered coverglasses where
placed on a inverted microscope, and GFP fluorescence could be visualized.
Expression of GFP-CED-6
CA 02318935 2000-07-21
WO 99/37770 PCT/US99/01361
-31-
Subcellular localization of worm CED-6 was assayed using GFP fusion
proteins. By using different fragments the inventors showed that CED-6 has a
clear
cytoplasmic localization. This localization was abolished when only the PTB of
CED-6 was used indicating that the C-terminal part might be implicated in
proper
targeting. Since the actual expression level varies from cell to cell one can
observe
an apoptotic phenotype in highly expressing cells and an elevated level of
phagocytosis in strong expressing cells. In addition, localization to the
lamelli was
observed in some cells which perform engulfment.
The transfected MCF7 cells as above are useful for conducting assays to
identify compounds which inhibit and enhance CED-6 or CED-6 as will be
discussed hereafter.
Human Homologues of C. Elegans CED-6
In accordance with the invention there is provided an isolated protein which
is an adaptor molecule in a signal transduction pathway which regulates
phagocytosis of apoptotic cells.
In accordance with another embodiment of the invention there is provided an
isolated protein which is a human homologue of C.elegans CED-6 which comprises
an amino acid sequence as shown in Figure 20 or Figure 22 (SEQ ID No: 8) or an
amino acid sequence which differs from that shown in Figure 20 only in
conservative amino acid changes (hICED-6).
Also provided is a nucleic acid (DNA RNA, cDNA or genomic DNA; SEQ
ID NO: 7, 13, 15) encoding hICED-6, h2CED-6 or h3CED-6 (SEQ ID Nos: 8, 14,
16) or a functional equivalent thereof. For example the invention encompasses
a
nucleic acid comprising the sequence of nucleotides from about nucleotide
position
430 to about nucleotide position 1344 shown in Figure 18, Figure 19, or Figure
22
or the entire sequence of nucleotides shown in these figures. The invention
includes
the open reading frame of the nucleic acid sequence that encodes c. elegans
CED-6,
CED-6, h2CED-6 or h3CED-6.
The invention also provides a protein which is a fragment of the protein with
the amino acid sequence shown in Figure 20, Figure 22 or Figure 29 (SEQ ID No:
8,
CA 02318935 2000-07-21
WO 99/37770 PCT/US99/01361
-32
14, 16). The fragment may comprise a sequence of amino acids corresponding to
the phosphotyrosine binding domain of SEQ ID NOs: 8, 14, 16. For example, the
PTB domain of SEQ ID Nos: 8 or 16 is from amino acids Nos. 15-157. The
invention also pertains to the nucleic acid and amino acid sequences of the
proline/serine rich domains of hICED-6 and/or h3CED-6 (e.g., amino acid Nos.:
201-276 in Figures 20, 22, or 29). Similarly, the highly charged region of SEQ
ID
NOs.: 8 or 16 is encompassed by the invention (e.g., amino acid Nos. 161-195
of
Figures 20, 22 and 29). The invention includes the nucleic acid sequences that
encode these fragments.
There is also identified herein a splice variant of h3CED-6 (referred to
herein
as h2CED-6) which variant comprises an amino acid sequence as shown in Figure
21 (SEQ ID No: 14) or an amino acid sequence which differs from that shown in
Figure 21 only in conservative amino acid changes. Also provided is a nucleic
acid
(DNA, RNA, cDNA or genomic DNA) encoding h2CED-6 (SEQ ID No: 13) or a
functional equivalent thereof, for example a nucleic acid comprising from
about
nucleotide position 430 to about nucleotide position 1206 in Figure 19 or the
entire
nucleotide sequence shown in Figure 19. (SEQ ID No: 13)
The human CED-6 amino acid sequence (SEQ ID NO: 16) is also shown in
Figure 26. Amino acid sequence SEQ ID NO: 16 (human CED-6) and SEQ ID NO:
8 (hICED-6) differ at amino acid No. 150. The nucleic acid sequence (SEQ ID
NO:
15) that encodes human CED-6 is shown in Figure 30A-B. The claimed invention
includes SEQ ID NOs: 15 and/or 16, the open reading frame of SEQ ID NO.: 1 S,
and the nuclic acid and amino acid sequence that encoded the functional
fragments,
(e.g., serine/ protein rich region, the PTB domain or the highly charged
domain), as
described herein.
The invention also provides a fusion protein in which one part of the fusion
is a protein having an amino acid sequence as shown in any of SEQ ID Nos: 8,
14 or
16 or a sequence differing from acid sequences only in conservative amino acid
changes. The protein may be fused with, for example, an epitope tag or
expression
product of a reporter gene.
CA 02318935 2000-07-21
WO 99/37770 PCT/US99/01361
-33-
The present invention is intended to encompass CED-6 proteins (e.g., C.
elegans CED-6, hl CED-6, h2 CED-6 and/or h3 CED-6) and polypeptides having
amino acid sequences analogous to the amino acid sequences of CED-6. Such
polypeptides are defined herein as CED-6 analogs (e.g., homologues),
orthologs, or
mutants or derivatives. Analogous amino acid sequences are defined herein to
mean
amino acid sequences with sufficient identity of CED-6 (e.g., C. elegans CED-
6,
hlCED-6, h2CED-6 or h3CED-6) amino acid sequence to possess the biological
activity of CED-6. For example, an analog polypeptide can be produced with
"silent" changes in the amino acid sequence wherein one, or more, amino acid
residues differ from the amino acid residues of the CED-6, yet still possesses
the
biological activity of CED-6. Examples of such differences include additions,
deletions or substitutions of residues of the amino acid sequence of CED-6.
Also
encompassed by the present invention are analogous polypeptides that exhibit
greater, or lesser, biological activity of the CED-6 proteins of the present
invention.
1 S The claimed CED-6 protein and nucleic acid sequences include homologues,
as defined herein. The homologous proteins and nucleic acid sequences can be
determined using methods known to those of skill in the art. Initial homology
searches can be performed at NCBI against the GenBank (release 87.0), EMBL
{release 39.0), dbEST SwissProt (release 30.0) databases using the BLAST
network
20 service and other EST databases. Altshul, SF, et al, Basic Local Aliment
Search
~, J. Mol. Biol. 215: 403 (1990), the teachings of which are incorporated
herein
by reference. Computer analysis of nucleotide sequences can be performed using
the MOTIFS and the FindPatterns subroutines of the Genetics Computing Group .
(GCG, version 8.0) software. Protein and/or nucleotide comparisons can also be
25 performed according to Higgins and Sharp (Higgins, D.G. and P.M. Shaip,
"Description of the method used in CLUSTAL," Gene, 73: 237-244 (1988)).
Homologous proteins and/or nucleic acid sequences to the CED-6 protein and/or
nucleic acid sequences that encode the CED-6 protein are defined as those
molecules
with greater than 70% sequences identity and/or similarity (e.g., 75%, 80%,
85%,
30 90%, or 95% homology).
CA 02318935 2000-07-21
WO 99/37770 PCT/US99/01361
-34-
The "biological activity" of CED-b proteins is defined herein to mean the
ability to regulate or affect the phagocytosis of apoptotic cells.
The claimed CED-6 proteins also encompasses biologically active
polypeptide fragments of the CED-6 proteins, described herein. Such fragments
can
include only a part of the full-length amino acid sequence of an CED-6 yet
possess
the ability to modulate or regulate phagocytosis of apoptotic cells. For
example,
polypeptide fragments comprising deletion mutants of the CED-6 proteins can be
designed and expressed by well-known laboratory methods. Such polypeptide
fragments can be evaluated for biological activity, as described herein.
Antibodies can be raised to the CED-6 proteins and analogs, using
techniques known to those of skill in the art. These antibodies polyclonal,
monoclonal, chimeric, or fragments thereof, can be used to immunoaffinity
purify or
identify CED-6 proteins contained in a mixture of proteins, using techniques
well
known to those of skill in the art. These antibodies, or antibody fragments,
can also
15 be used to detect the presence of CED-6 proteins and homologs in other
tissues
using standard immunochemistry methods.
In particular, biologically active derivatives or analogs of the above
described proteins, including fragments and functional domains from c. elegans
CED-6, hICED-6, h2CED-6, or h3CED-6, referred to herein as peptide mimetics,
20 can be designed and produced by techniques known to those of skill in the
art. (see
e.g., U.S. Patent Nos. 4,612,132; 5,643,873 and 5,654,276, the teachings of
which
are incorporated herein by reference}. These mimetics can be based, for
example, on
a specific CED-6, hICED-6 or h2CED-6 or h3CED-6 amino acid sequence and
maintain the relative position in space of the corresponding amino acid
sequence.
25 These peptide mimetics possess biological activity similar to the
biological activity
of the corresponding peptide compound, but possess a "biological advantage"
over
the corresponding CED-6 amino acid sequence with respect to one, or more, of
the
following properties: solubility, stability and susceptibility to hydrolysis
and
proteolysis.
30 Methods for preparing peptide mimetics include modifying the N-terminal
amino group, the C terminal carboxyl group, and/or changing one or more of the
CA 02318935 2000-07-21
WO 99/37770 PC'f/US99/01361
-35-
amino linkages in the peptide to a non-amino linkage. Two or more such
modifications can be coupled in one peptide mimetic molecule. Modifications of
peptides to produce peptide mimetics are described in U.S. Patent Nos.
5,643,873
and 5,654,276, the teachings of which are incorporated herein by reference.
Other
forms of the hl, h2, or h3 CED-6 proteins, encompassed by the claimed
invention,
include those which are "functionally equivalent." This term, as used herein,
refers
to any nucleic acid sequence and its encoded amino acid which mimics the
biological activity of the hl, h2, or h3 CED-6 proteins and/or functional
domains
thereof. Biologically active is used to describe a protein capable of
regulating the
phagocytosis of apoptotic cells.
A polypeptide can be in the form of a conjugate or a fusion protein, both of
which can be made by known methods. Fusion proteins can be manufactured
according to known methods of recombinant DNA technology. For example, fusion
proteins can be expressed from a nucleic acid molecule comprising sequences
which
1 S code for a biologically active portion of the protein and its fusion
partner, for
example a portion of an immunoglobulin molecule. For example, some
embodiments can be produced by the intersection of a nucleic acid encoding
immunoglobulin sequences into a suitable expression vector, phage vector, or
other
commercially available vectors. The resulting construct can be introduced into
a
suitable host cell for expression. Upon expression, the fission proteins can
be
isolated or purified from a cell by means of affinity matrix.
Expression vectors incorporating any of the above mentioned nucleic acids
including those designated SEQ ID Nos: 1, 3, S, 7, 9, 11, 13 or 15, optionally
with a
reporter gene as aforesaid, are also provided by the invention.
The present invention also encompasses isolated nucleic acid sequences
encoding the CED-6 (e.g., C. elegans CED-6, hICED-6, h2CED-6 or h3CED-6)
proteins described herein, and fragments of nucleic acid sequences encoding
biologically active CED-6 proteins. Fragments of the nucleic acid sequences,
described herein, are useful as probes. Specifically provided for in the
present
invention are DNAlRNA sequences encoding CED-6 proteins, the fully
complementary strands of these sequences, and allelic variations thereof. Also
CA 02318935 2000-07-21
WO 99/37770 PCT/US99/013b1
-36-
encompassed by the present invention are nucleic acid sequences, genomic DNA,
cDNA, RNA or a combination thereof, which are substantially complementary to
the DNA sequences encoding CED-6, and which specifically hybridize with the
CED-6 DNA sequences under conditions of stringency known to those of skill in
the
art, those conditions being sufficient to identify DNA sequences with
substantial
nucleic acid identity. As defined herein, substantially complementary means
that the
sequence need not reflect the exact sequence of the CED-6 (e.g., C. elegans
CED-6,
hlCED-6, h2CED-6 or h3CED-6) DNA, but must be sufficiently similar in identity
of sequence to hybridize with CED-6 DNA under stringent conditions. Conditions
of stringency are described in e.g., Ausebel, F.M., et al., Current Protocols
in
Molecular Biology, (Current Protocols, 1994). For example, non-complementary
bases can be interspersed in the sequence, or the sequences can be longer or
shorter
than CED-6 DNA, provided that the sequence has a sufficient number of bases
complementary to CED-6 to hybridize therewith. Exemplary hybridization
conditions are described herein.
Cloning of human CED-6
Following the cloning of the C.elegans CED-6 gene and the full sequencing
of the open reading fi-ame, extensive searches against public domain human
databases were performed. These revealed statistically significant homologies
to a
number of ESTs at the carboxy terminal region of the protein and one EST
showed
homology to the carboxy ternlinal of the PTB domain and at the beginning of
the
charged region. These ESTs were used for construction of primers for 5'RACE
using a Marathon- ready cDNA colorectal adenocarcinoma library from Clontech.
Subsequent additional sequence analysis and rounds of database searching
revealed
additional ESTs which enabled construction of a consensus sequence of
approximately 2400 by for h3CED-6 (Figure 6). Further sequence analysis has
revealed a splice variant of the sequence shown in Figure 18 (h2CED-6), the
portion
which is alternatively spliced being underlined. The DNA of h2CED-6 is shown
in
Figure 19 and the amino acid sequence in Figure 21. The amino acid sequence of
CA 02318935 2000-07-21
WO 99/37770 PCT/US99/01361
-37-
h2CED-6 is consistent with it being a dominant negative version of h 1 or h3
CED-6
which antagonizes active of hl or h3CED-6.
Assays for the identification of inhibitors and enhancers of CED-6
hlCED-6, h2CED-6, or h3CED-6
The cloning and functional characterization of C.elegans CED-6 and its two
human homologues have permitted assay methods to be developed which allow
identification of compounds which might inhibit or enhance CED-6, hICED-6,
h2CED-6, or h3CED-6 activity or inhibit or enhance the transcription of these
proteins. These may involve detection of the level of phagocytosis of
apoptotic
particles, measurement of level of actin-cytoskeieton rearrangement or
detection of
the level of transcription of the CED-6 proteins via a reporter gene such as
GFP.
An assay for the identification of inhibitors and/or enhancers of phagocytosis
may consist of a cell line stably or transiently transfected with CED-6, hlCED-
6,
h2CED-6, or h3CED-6 or any other member of the CED-6 signal transduction
pathway: Cell lines may also be microinjected with purified protein or vectors
expressing antisense RNA. The expression product may be a fusion protein with
GFP. Non transfected cells can be used in the assay also. The cell line may be
a
fibroblast cell line such as COSI, BHK 21, L929, CV1, Swiss 3T3, HT144, IMR32
or another fibroblast cell line. The cell line may also be an epithelial cell
line such as
HEPG2, MDCK, MCF7, 293, Hela, A549, SW48, 6361, or any other epithelial cell
line. The cell line may a primary line, such as human dernal FIBS, dermal
keratinocytes, leucocytes, monocytes, macrophages, or any other primary cell
line.
Cells may be double transfected with other genes (like lectin, CD14, SRA, CD36
ABCl, CEDS, DOCK180) being from vertebrate (human fish, mouse) or
invertebrate origin (C.elegans).
Phagocytosis assays consist of the addition of and uptake of particles and/or
apoptotic cells, by these cell lines. The particle may be opsonized heat or
chemically
killed bacteria and yeast in a variety of sizes, shapes and natural
antigenicities. The
CA 02318935 2000-07-21
WO 99/37770 PCTNS99/01361
-38-
particle or cell may be an opsonized, fluorescently labeled, heat or
chemically killed
bacteria and yeast in a variety of sizes , shapes and natural antigenicities.
The cell
may be a apoptotic neutrophils, apoptotic lymphocytes, apoptotic erythrocytes
or
any other apototic cell. These apoptotic cells may be opsonized and/or labeled
with
dyes or fluorescent dyes. The killed bacteria or yeast cells and the apoptotic
cells are
referred to as herein apoptotic particles.
Assay 1
Cells, transfected with CED-6 or any other gene described herein, for
example, nucleic acids of SEQ ID Nos: 1, 3, 7, 9, 11, 13, or 15, can be grown
in
monolayer or in suspension. The apoptotic particles are added to the
transfected cell.
Phagocytosis can be followed by the uptake rate of the apoptotic particles.
This can
be measured by microscopy, by fluorescence microscopy, by quantitative
spectrofluorometry and by flow cytometry. Cells and or particles may
additionally
be labeled with dyes, fluorescent dyes, antibodies and dyes of fluorescent
dyes
1 S linked to antibodies prior to detection and measurement. Decrease or
increase of the
uptake of the apoptotic particles is a measurement for the influence of the
transfected gene or genes in the phagocytosis.
Assay 2
Compounds can be added to assay 1 to test their influence on the genes that
are involved in the phagocytosis pathway. Transiently or stably transfected
cells are
grown in suspension or in monolayer. A series of compounds is added to the
cells
prior to the addition of the apoptotic particles. The influence of the
compounds can
be measured by comparing the uptake rate of the apoptotic particles with and
without the addition of the compound. Measurements are described in Assay 1
2S Assay 3
Cells are able to phagocytose apoptotic particles by engulfment of particles.
This involves the reorganization of the actin cytoskeleton. Mammalian cells,
may be
transiently or stably transfected with CED-6 or any gene involved in the CED-6
CA 02318935 2000-07-21
WO 99/37770 PCT/US99/01361
-39-
phagocytosis signal transduction pathway, for example, with a nucleic acid
have the
sequence of nucleotides shown in any one of SEQ ID Nos: 1, 3, 5, 7, 9, 11, 13
or 15.
Cells can be any cell as described in Assay I . The genes may be expressed as
a GPF
fusion product. Cells may be double transfected (see Assay 1). The
reorganization of
the actin cytoskeleton can be visualized with fluorescent dyes linked to
phalloidine,
which interacts with F-actin. Reorganization of the cytoskeleton is an
measurement
for the engulfinent induction by the transfected gene or genes. Transfected
cells may
be treated with particles or apoptotic cells as described in Assay 1.
Reorganization
of the cytoskeleton is visualized by microscopy or fluorescence microscopy.
Assay 4
Compounds can be added to Assay 3 to test their influence on the genes that
are involved in the cytoskeleton reorganization related to the phagocytosis
pathway
and engulfinent. These compounds may enhance or inhibit the engulfment or
cytoskeleton reorganization induced by the introduced genes. Transiently or
stably
i 5 transfected cells are grown in suspension or in monolayer. A series of
compounds is
added to the cells. The influence of the compounds can be measured by
comparing
the reorganization of actin cytoskeleton with and without the addition of the
compound. Measurements as are described in Assay 1, Assay 2 and Assay 3.
Apoptotic particles may be added in this test to induce phagocytosis, as
described in
Assay 2.
Assay 5
Non-transfected or transfected cell-lines such as those described above may
be microinjected with purified CED-6 protein, for example, a protein having
the
amino acid sequence as shown in SEQ ID Nos: 2, 4; 6, 8, 10, 12, 14, or 16 or
any
protein from the CED-6 pathway or a fusion protein comprising any of said
proteins.
Microinjection can be done on the primary cell lines or the fibroblast cell
lines or the
other epithelial cells lines. The cell lines can be transfected with another
gene prior
to microinjections. Assays 1 through Assay 4 can be performed on these
microinjected cells.
CA 02318935 2000-07-21
WO 99/37770 PCT/US99/01361
-40-
Assay 6
Transfected or non-transfected cell-lines as described above may be
microinjected with a vector expressing CED-6 antisense RNA including antisense
RNA in respect of any of the aforementioned proteins or any antisense RNA for
genes involved in the CED-6 pathway. Microinjection can be done on the primary
cell lines or the fibroblast cell lines or the epithelial cell lines. The cell
lines can be
transfected with another gene prior to microinjection. Assays 1 through Assay
5 can
be performed on these microinjected cells.
Assay 7
Cell lines, as described in Assay 6 may be micro-injected with a vector
expressing CED-6 antisense RNA or any antisense RNA for genes involved in the
CED-6 pathway. Microinjection can be done on the macrophages. Inhibitory
effects
of the antisense RNA by inhibition of the CED-6 gene or genes involved in the
CED-6 pathway can be followed and detected as described in Assay 1 through
Assay 6. Compounds can be isolated which rescue the negative phenotype.
Phagocytosis assays to screen for CED-6 inhibitor/enhancers in C.elegans
The C.elegans CED-6 gene promotes the engulfinent of dying embryonic
and germ cells and persistent cell corpses. C.elegans may be used for
detection and
isolation of compounds that have an enhancing or inhibitory influence on
phagocytosis and engulfinent. In particular mutant worms lacking CED-6
activity or
with otherwise altered CED-6 activity may be used or alternatively a
transgenic
worm transfected or transferred with CED-6, h 1 CED-6, h2CED-6, or h3CED-6
DNA may be used.
Assay 8
A series of compounds may be applied on CED-6 mutant worms or on
worms harboring mutations in the CED-6 pathway. Restoration of engulfment
induced by the compounds can be visualized using Nomarski microscopy by
CA 02318935 2000-07-21
WO 99/37770 PCT/US99/01361
-41-
counting cell corpses remaining in the head region of LI larvae and in the
gonads of
the worms.
Assay 9
A series of compounds may be applied on humanized CED-6 mutant worms.
S Humanized worms are wonms expressing the human CED-6 gene and are mutated
for the C.elegans gene. Human CED-6 rescues the mutant phenotype. Compounds
inhibiting or enhancing the CED-6 phenotype can be selected by visualization
of the
engulfment phenotype using Nomarski microscopy and looking for cell corpses as
aforesaid.
Medical applications
The process of apoptosis has been implicated in the etiology - or associated
with the pathology - of a wide range of diseases, including cancer, autoimmune
diseases, various neurodegenerative diseases such as Amyotrophic Lateral
Sclerosis,
Huntington's Disease, and Alzheimer's Disease, stroke, myocardial heart
infarct,
1 S and AIDS (Thompson, 199S). Thus a better understanding of the molecular
events
that underlie apoptosis might lead to novel therapeutic interventions. While
much of
the current attention is centered on the genes and proteins that control the
killing
step of the death process, it is very likely that the removal of apoptotic
cells will
prove to also be crucial for the proper overall functioning of the apoptotic
program,
and will offer another entry point for therapeutic intervention.
The process of recognition and engulfment of dying cells is extremely swift
and efficient. In animals, it is essentially impossible to find a cell with
apoptoic
features that is not already within another cell. Such rapid recognition and
phagocytosis of apoptotic cells is an crucial aspect of probed cell death in
vivo:
2S unengulfed apoptotic bodies can undergo secondary necrosis, leading to
inflammation. Failure to remove apoptotic bodies also exposes the body to
novel
epitopes (from e.g., caspase-generated protein fragments); possibly
encouraging the
development of autoimmune disease. Persistent apoptotic bodies can often be
CA 02318935 2000-07-21
WO 99/37770 PCT/US99/01361
-42-
observed following chemotherapeutic intervention (which leads to extensive
apoptosis) and are particularly abundant in solid tumors, in which clearance
of cell
corpses might be delayed.
It is likely that failure to properly dispose of apoptoic cells leads to human
disease. Genes involved in phagocytosis could therefore correspond to
currently
uncloned human inherited disease genes. Restoring proper phagocytosis would be
a
valid therapy for certain types of inflammation and autoimmune diseases.
Conversely, In some cases, cells that should be maintained are inappropriately
recognized by the engulfment machinery and cleared from the body. Preventing
the
engulfinent of such cells could be of great therapeutic value. Examples of
such
diseases might include neurodegenerative diseases and stroke, as well as
sickle cell
aenemla.
In addition activation of engulfment could be used for the same cases for
which it is proposed to use activation of apoptosis, e.g., cancer. Indeed,
specific
activation within the cancer cells of the pro-engulfing signal would lead to
the cells'
removal - (and death) - without needing to activate the rest of the apoptotic
machinery. This could be particularly useful for highly resistant tumors in
which
crucial elements of the central apoptotic machinery have already been
inactivated.
Thus, in accordance with another of its aspects the invention provides a
method of treating, for example inflammation, autoimmune disease and cancer by
administering to a patient an effective amount of a substance which enhances
phagocytosis of apoptoic cells, in particular a substance which enhances the
activity
of hl-CED6, h3-CED-6 or the signal transduction pathway in which it
participates.
Such substances includes hl-CED 6 or h3-CED-6 itself, a nucleic acid encoding
hl-
CEDE or h3-CED-6, an anti-sense nucleic acid to hl, h2 or h3 CED-6 or
compounds
identified in any of the aforementioned assays as enhancers of CED-6, hl-CED-
6,
h2-CED-6, or h3-CED-6 or of transcription thereof.
In addition the invention also enables a method of treatment of, for example,
neurodegenerative diseases, stroke and sickle-cell anaemia by administering to
a
patient an effective amount of a substance which inhibits phagocytosis of
apoptotic
cells, in particular a substance which inhibits the activity of hl-CED6 or h3-
CEDE
CA 02318935 2000-07-21
WO 99137770 PCT/US99/01361
-43-
or the signal transduction pathway in which it participates. Such substances
include
h2 CED-b, a nucleic acid encoding h2CED-6, an anti-sense nucleic acid to hICED-
6
or h3CED-6 or compounds identified in any of the aforementioned assays as
inhibitors of CED-6 or hICED-6 or h3CED-6 or of transcription thereof.
Pharmaceutical compositions comprising any of the above-mentioned
therapeutic substances and a pharmaceutically acceptable carrier are also
envisaged
by the invention.
To accomplish the various therapeutic treatments as described herein, a
nucleic acid which encodes hl, h2 or h3 CED-6 or a functional portion or
domain
thereof must be introduced into a mammalian cell (e.g., mammalian somatic
cell,
mammalian germ line cell (sperm and egg cells)). This can be accomplished by
inserting the isolated nucleic acid that encodes either the full length
protein, or the
domains described herein, or a functional equivalent thereof, into a nucleic
acid
vector, e.g., a DNA vector such as a plasmid, virus or other suitable replicon
(e.g., a
viral vector), which can be present in a single copy or multiple copies. The
nucleic
acid may be transfected or transformed into cells using suitable methods known
in
the art such as electroporation, microinjection, infection, and lipoinfection
and direct
uptake. Such methods are described in more detail, for example, in Sambrook et
al.,
"Molecular Cloning: A Laboratory Manual," 2nd ED. ( 1989), Ausubel, F.M., et
al.,
Current Protocols in Molecular Biology, (Current Protocol, 1994) and Sambrook
et
al., "Molecular Cloning: A Laboratory Manual," 2nd ED. (1989).
hl, h2 or h3 CED-6 can be delivered to a cell by the use of viral vectors
comprising one or more nucleic acid sequences encoding those proteins.
Generally,
the nucleic acid sequence has been incorporated into the genome of the viral
vector.
In vitro, the viral vector containing hl, h2 or h3 CED-6 protein described
herein or
nucleic acid sequences encoding the protein can be contacted with a cell and
infectivity can occur. The cell can then be used experimentally to study
phagocytosis of apoptotic cells or for assays as aforesaid or be implanted
into a
patient for therapeutic use. The cell can be migratory, such as hematopoietic
cells,
or non-migratory such as a solid tumor or fibroblast. The cell can be present
in a
CA 02318935 2000-07-21
WO 99/37770 PC'f/US99/01361
biological sample obtained from the patient (e.g., blood, bone marrow) and
used in
the treatment of disease, or can be obtained from cell culture.
After contact with the viral vector comprising the hl, h2 or h3 CED-6
protein or a nucleic acid sequence encoding them, the sample can be returned
or
readministered to a cell culture or patient according to methods known to
those
practiced in the art. In the case of delivery to a patient or experimental
animal
model (e.g., rat, mouse, monkey, chimpanzee), such a treatment procedure is
sometimes referred to as ex vivo treatment or therapy. Frequently, the cell is
targeted from the patient or animal and returned to the patient or animal once
contacted with the viral vector comprising the activated mutant of the present
invention. Ex vivo gene therapy has been described, for example, in Kasid, et
al.,
Proc. Natl. Acad. Sci. USA 87:473 ( 1990); Rosenberg, et al., New EngL .I. Med
323:570 (1990); Williams, et al., Nature 310476 ( 1984); Dick, et al., Cell
42:71
(1985); KeIler, et al., Nature 318:149 (1985) and Anderson, et al., U.S.
Patent No.
5,399,346 (1994).
Where a cell is contacted In vitro, the cell incorporating the viral vector
comprising a nucleic acid sequence of hl CED-6, h2 CED-6 or h3CED-6 can be
implanted into a patient or experimental animal model for delivery or used in
In
vitro experimentation to study cellular events mediated by hl, h2 or h3 CED-6.
Various viral vectors can be used to introduce the nucleic acid into
mammalian cell. Viral vectors include retrovirus, adenovirus, parvovirus
(e.g.,
adeno-associated viruses), coronavirus, negative strand RNA viruses such as
orthomyxovirus (e.g., influenza virus), rhabdovirus (e.g., rabies and
vesicular
stomatitis virus), paramyxovirus (e.g. measles and Sendai), positive strand
RNA
viruses such as picornavirus and alphavirus, and double stranded DNA viruses
including adenovirus, herpesvirus (e.g., Herpes Simplex virus types 1 and 2,
Epstein-Barr virus, cytomegalovirus), and poxvirus (e.g., vaccinia, fowlpox
and
canarypox). Other viruses include Norwalk virus, togavirus, flavivirus,
reoviruses,
papovavirus, hepadnavirus, and hepatitis virus, for example. Examples of
retroviruses include: avian leukosis-sarcoma, mammalian C-type, B-type
viruses, D-
type viruses, HTLV-BLV group, lentivirus, spumavirus (Coffin, J.M.,
Retroviridae:
CA 02318935 2000-07-21
WO 99/37770 PCT/US99/01361
-45-
The viruses and their replication, In Fundamental virology, Third Edition,
B.N.
Fields, et al., Eds., Lippincott-Raven Publishers, Philadelphia, 1996). Other
examples include marine leukemia viruses, marine sarcoma viruses, mouse
mammary tumor virus, bovine leukemia virus, feline leukemia virus, feline
sarcoma
virus, avian leukemia virus, human T-cell leukemia virus, baboon endogenous
virus,
Gibbon ape leukemia virus, Mason Pfizer monkey virus, simian immunodeficiency
virus, simian sarcoma virus, Rous sarcoma virus, lentiviruses and
baculoviruses.
A preferred method to introduce nucleic acid that encodes hl, h2 or h3 CED-
6 into cells is through the use of engineered viral vectors. These vectors
provide a
means to introduce nucleic acids into cycling and quiescent cells, and have
been
modified to reduce cytotoxicity and to improve genetic stability. The
preparation
and use of engineered Herpes simplex virus type 1 (D.M. Krisky, et al., Gene
Therapy 4(10):1120-1125. (1997)), adenoviral (A. Amalfitanl, et al., Journal
of
Virology 72(2):926-933. (1998)), attenuated lentiviral (R. Zufferey, et al.,
Nature
Biotechnology 15(9)871-875 (1997)) and adenoviral/retroviral chimeric (M.
Feng, et
al., Nature Biotechnology 15(9):866-870 (1997)) vectors are known to the
skilled
artisan.
Hence, the claimed invention encompasses various therapeutic uses as
aforesaid for the hl, h2 or h3 CED-6 protein or nucleic acid.
The protein may be administered using methods known in the art. For
example, the mode of administration is preferably at the location of the
target cells.
As such, the administration can be nasally (as in administering a vector
expressing
ADA) or by injection (as in administering a vector expressing a suicide gene
tumor).
Other modes of administration (parenteral, mucosal, systemic, implant,
intraperitoneal, etc.) are generally known in the art. The agents can,
preferably, be
administered in a pharmaceutically acceptable carrier, such as saline, sterile
water,
Ringer's solution, and isotonic sodium chloride solution.
The invention also provides diagnostic reagents which may be used in the
diagnosis of a disease associated with a defect in phagocytosis of apoptotic
cells.
For example, an antibody to an epitope of any of the proteins with an amino
acid
sequence as shown in SEQ ID Nos: 2, 4, 6, 8, 10, 12, 14 or 16 could be used as
a
CA 02318935 2000-07-21
WO 99137770 PCT/US99/01361
-46-
diagnostic reagent to determine whether a patient has a defect in hICED-6,
h2CED-
6 or h3CED-6 or in the expression thereof. In addition defects at the genetic
level
can be detected by using as a probe a nucleic acid having a sequence as shown
in
SEQ ID Nos: 1, 3, S, 7, 9, 1 l, 13, or 15 or portions thereof.
Identification of the other proteins active in the CED-6 signal transduction
pathway
CED-6, hlCED-6, h2CED-6 or h3CED-6 can be used to identify other
members of the signal transduction pathway promoting phagocytosis of apoptotic
cells. There are number of possible methods by which this can be done but a
preferred method is the so-called "two hybrid" system developed in yeast by
Chien
et al (1994, Proc. Natl. Acad Sci. USA 88 pp 9578-9582) which allows
identification of proteins which bind to a particular protein of interest.
This technique is based on functional in vivo reconstruction of a
transcription
factor which activates a reporter gene. More particularly the technique
comprises
providing an appropriate host cell, preferably yeast, with a DNA construct
comprising a reporter gene under the control of a promoter regulated by a
transcription factor having a DNA binding domain and an activating domain,
expressing in the host cell a first hybrid DNA sequence encoding a first
fusion of a
fragment or all of a nucleic acid sequence according to the invention and
either said
DNA binding domain or the activating domain of the transcription factor,
expressing
in the host cell at least one second hybrid DNA sequence encoding putative
binding
proteins to be investigated together with the DNA binding domain or activating
domain of the transcription factor which is not incorporated in the first
fusion;
detecting any binding of the protein being investigated with a protein
according to
the invention by detecting for the production of any reporter gene product in
the host
cell; optionally isolating second hybrid DNA sequence encoding the binding
protein.
EXAMPLES
The N2 Bristol strain was used as the reference wild-type strain for this
study. All strains were maintained as described by Brenner (Brenner, 1974),
except
CA 02318935 2000-07-21
WO 99/37770 PCfNS99/01361
-47-
that worms were raised on NGM-lite agar medium. Strains were maintained and
raised at 20°C, unless otherwise noted. The following mutations were
used In this
study: LG I: ced 1 (el 735), ced I (n 1995) and ced 1 (n 1506) (Ellis et a1,
1991 ); LG
III: dpy-17(e164), ced 6(n1813, n2095), mec-14(u55), ncl 1 (e1865) ced
7(n1997),
ced 7(n1892), ced 7(n1996) (Ellis et al, 1991 ), unc-36(e251) (Brenner, 1974)
and
sDp3(Ill,,~ (Rosenbluth et al, 1985); on LG IY: ced-2(e1752) (Hedgecock et al,
1983), ced S(n1812) and ced 10(n1993) (Ellis et al, 1991). All mutations are
described in Hodgkin ( 1997).
EXAMPLE 1
Analysis and Quantifying of Engulfment
Animals were anesthetized with 30mM NaN3 and mounted on agar pads to
observation using Normarski optics microscope (Sulston & Horvitz, 1977; Avery
and Horvitz, 1987). To quantify engulfinent of cell corpses generated during
embryonic development, the number of persistent cell corpses that were visible
in
1 S the head region of young L1 larvae that still had only four cells in gonad
(i.e., had
hatched in the previous four hours) were scored. To quantify the germ line
engulfment defect, cell corpses visible within both the distal arm (where the
germ
cell deaths occur) and the proximal arm (where persistent germ cell corpses
can
sometimes be observed as they are swept along by the developing oocytes) were
counted.
EXAMPLE 2
Germline Transformation and Genomic Rescue of ced 6
Transgenic animals were generated using the germline microinjection
procedure developed by Mello et al. Cosmids W03AS, F20F10, F48E8, R02F2,
2S W02G12, T06H6, C48E6, C44D7, FS6D2, F43F12, COSD2, T06C9, COSH8 were
injected, either singly or in groups (final concentration 20ng/ul for each
cosmid),
into ced-6(n1813) animals. Plasmid pRF4 was used (final concentration SO-80
ng/ul) as the dominant co-injection marker (Mello et al., 1991); pRF4 cues the
mutated collagen gene rol-6(su1006gf) and confers a dominant roller (Rol)
CA 02318935 2000-07-21
WO 99/37770 PCT/US99/01361
-48-
phenotype. Transgenic lines carrying stably transmitting extrachromosomal
arrays
were kept for further analysis. To assay for rescue, three-fold embryos laid
by
transgenic animals were examined for cell corpses under Normaski optics.
Transgenic lines that generated embryos with fewer or no corpses were
considered
to be rescued. To further define the position of ced-6 within F56D2, a number
of
deletion constructs were created and other fragments subcloned into
pBluescript
SK(+) II. 50-90 ng/ul of these clones were co-injected with 80-100 ng/ul pRF4
injection marker into ced 6(n1813) worms, and their rescuing ability tested as
described above.
EXAMPLE 3
Isolation of ced 6 cDNAs
To isolate full-length ced-6 cDNAs, a mixed-stage C.elegans lambda Zap
cDNA library was screened (gift of R. Barstead, Oklahoma Medical Research
Foundation, Oklahoma City, OK) using established protocols (Sambrook et al.,
1989). 'ZP-labeled probe was made using the rescuing 10 kb Xho I genomic
fragment as template. Positive phage were transformed into plasmid clones
using
the in vivo excision protocol. The clones representing F56D2.7 gene from
isolated
plasmid clones were identified on a Southern blot. For this purpose a 32P-
labeled
probe was generated from RT-PCR product, which represents three exons of
predicted F56D2.7. Primers used for RT-PCR: GAATGTTCTCATTTATTG (SEQ
ID NO.: 29) and GGATTCAAACGATCCGATG. (SEQ ID NO: 17)
From about 300,000 plaques 10 plasmid clones corresponding F56D2.7
cDNAs were isolated. These clones were sequenced for both ends of the insert
using the flanking T3 and T7 primers. Two clones with partial SL2 sequence at
the
5' end and intact poly(A) tail were identified as full-length F56D2.7 cDNAs.
Analysis of these sequence results and the pattern of restriction digestion by
Sau3A
I also suggested that these clones represent for one transcript.
EXAMPLE 4
Reverse transcription-PCR
CA 02318935 2000-07-21
WO 99/37770 PCT/US99/01361
-49-
Reverse transcription (RT)-PCR experiments were performed to determine
the 5'end of transcripts detected or predicted within the rescuing Xho I
genomic
fragment. Reverse transcription was performed with following primers:
COSD2.6a:
GAATCTGTCCATCGCATTGC (SEQ ID NO.: 18),
GAATTTCTTTGGGTAGACA (SEQ ID NO.: 19); COSD2.6b:
GCTCTGAAGAACTGTGA (SEQ ID NO.: 20), GACGAGGTGAAGCGATTGTG
(SEQ ID NO.: 21); F56D2.7: GGGATCAAACGAATCATC (SEQ ID NO.: 22).
These primers were then used in combination with SL1
(GTTTAATTACCCAAGTTTGAG (SEQ ID NO.: 23)) or SL2
(GGTTTTAACCCAGTTACTCAAG (SEQ ID NO.: 24)) primers for subsequent
PCR amplification. Total C. elegans mixed stage RNA was isolated as described
previously. RT-PCR was performed using the Superscript Preamplication System
(Gibco BRL).
EXAMPLE 5
Identification of ced 6 Mutations
To determine whether either ced 6 allele resulted in a large physically
detectable polymorphism, we generated Southern blots of N2, ced-6(n1813), and
ced 6(n2095) genomic DNA digested with various restriction enzymes. A probe
generated from the rescuing Xho I genomic fragment detected noval allele-
specific
bands in ced 6(n2095) using four different restriction enzymes. Analysis of
the
novel restriction patterns in ced 6(n2095) indicates that this allele carries
a complex
rearrangement. in this region, that covers at least part of F56D2.7, but does
not affect
the neighboring COSD2.6b transcript.
To identify point mutations within F56D2.7, overlapping fragments of the
F56D2.7 locus from N2, ced-6(n1813), and ced 6(n2095) mutants were PCR
amplified and directly sequenced using the PCR Product Sequencing Kit
(Amersham). The overlapping PCR fragments covered the entire F56D2.7
transcription unit and about 1 kb of upstream genomic sequence. Sequences of
the
primers used for PCR amplification and sequencing are available upon request.
CA 02318935 2000-07-21
WO 99/37770 PCT/US99/01361
-50-
EXAMPLE 6
Heat Shock Experiments
To test whether ced 6 cDNA can rescue the engulfment defect, Kpn IlSal I
fragment of full-length F56D2.7 cDNA was inserted in Kpn USac I site of MCS II
of
both pPD49.78 and pPD49.83 vectors which carry hsp 16-2 and hsp 16-41
promoters,
creating the constructs pLQhsl and pLQhs2. The two constructs were co-
injected, at
SOng/uI each with 80ng/ul pRF4, to generated stably transmitting
extrachromosomal
arrays. For our control experiments, we used pPD50.21 and pPD50.15, two
derivatives of pPD49.78 and pPD49.83 in which the lacZ open reading frame has
been placed under heat shock promoters. Transgenic lines carrying these
constructs
were generated as described above.
To overexpress ced 6 before cell death occurs during embryonic
development, adult animals were put on a plate seeded with E.coli and allowed
to
lay eggs for one hour. Plates were subsequently parafilmed and subjected to
heat
shock by transfer to 33°C waterbath for 45 minutes. Following a 75-
minute recovery
at 20°C, adult animals were removed from the plates. 12-14 hours after
heatshock,
hatching L1 larvae were scored for corpses in the head region.
To overexpress ced 6 after the formation of cell corpses during embryonic
development, worm plates containing embryos at all developmental stages (but
not
larvae) were parafilmed and subjected to heat shock in a 33°C waterbath
for 45
minutes. Three hours after the heat shock, freshly hatched L 1 larvae were
scored for
corpses in the head region.
To determine the effect of ced 6 overexpression before cell death occurs on
the engulfinent of dying germ cells, L4 stage transgenic animals were
transferred to
new plates and stored at 20°C. Starting 24 hours after the L4 molt, the
worm plates
were parafilmed and heat shocked for 45 minutes at 33°C as described
above.
Animals were examined for germ cell corpses at 12 hours after heat shock, also
18,
24, 36, and 60 hours after heat shock.
To overexpress ced-6 after the formation of germ cell corpses, L4 stage
transgenic animals were collected and put into several plates, a few for each
plate.
24 hours after the L4 molt one plate of worms were heat shocked for 45 minutes
as
CA 02318935 2000-07-21
WO 99/37770 PC'f/US99/01361
-51-
described above. Similarly, 36, 42, 48 and 60 hours after the L4 molt, each
plate of
worms at one time point were treated with heat. Animals were examined for germ
cell corpses 12 hours after heat shock.
To overexpress ced-6 in the background of other engulfinent mutants, the
ced-6 or lacZ-expressing extrachromosomal arrays were transferred from
ced-6(n1813) to a wild-type background, and crossed subsequently to ced-I
(e1735)
ced I (n1506), ced-1 (n1995), ced 7(1892), ced-7(n1996), ced 7(n1997),
ced-2(n1752), ced-5(n1812) or ced 10(n1993) to generate the corresponding
transgenic mutant strains. Heat shock experiments were performed as described
above.
EXAMPLE 7
Genetic Mosaic Analysis
1000 dpy-17(e164) ced-6(n1813) mec-14(u55) ncl-1 (e186S) unc-36(e25) lll;
sDp3(IIl,~ were put in worm plates individually. The progenies of these
animals
were examined to identify animals who laid only DPY UNC progenies under the
dissecting microscope. The adult animals were examined under the Normaski
Optics
immediately after being identified. First the somatic sheath cells were
examined,
then the body wall muscle descended from D and C lineages. When all body wall
muscle cells displayed wild-type, the duplication is lost in P4 lineage. When
body
wall muscle cells from D lineage are wild-type, while those from C lineage
exhibit
ncl phenotype, the duplication must be lost from P3 lineage. When body wall
muscle cells from both D and C lineages show the ncl phenotype, the
duplication
must be lost from P2 lineage. The cell corpse in both arms of gonad were also
examined for the engulfinent phenotype. To find the animals with the
duplication
lost in the somatic sheath cells, but not in germ cells, dpy-17(e164) ced
6(n1813)
mec-14(u55) ncl-1 (e1865) unc-36(e25) III; sDp3(III,~ animals were examined
under
the Normaski Optics for the loss of the duplication in somatic sheath cells.
At the
same time cell corpses in gonad were also examined for the engulfinent
phenotype.
EXAMPLE 8
CA 02318935 2000-07-21
WO 99/37770 PCT/US99/01361
-52-
Identification of a human homologue of CED-6
Extensive searches (tblastn) with the ced-6 sequence (Figure 18 Consensus
DNA Sequence of hCED-6) against the public domain databases (EST, Genbank,
EMBL, Swissprot and PIR) revealed statistically significant homologies to some
ESTS at the carboxyterminal region of the protein (AA443368, AA431995,
R33389,R53881). One EST (T48513) showed homology to the Carboxyterminal of
the PTB domain and the beginning of the charged region. For 5' RACE analyses a
Marathon-ready cDNA colorectal adenocarcinoma, library was used from Clontech.
The position of the primers used for RACE and sequencencing is indicated in
figure
18. By subsequent cloning and sequence analysis additional sequence
information
was obtained. Using this additional sequence information and subsequent rounds
of
database searching (biastn) revealed additional EST, which enabled us to
construct a
consensus of approx 2400 hp. This sequence was further extended and verified
by
colony hybridization and sequencing additional RACE products.
1 S EXAMPLE 9
RNA Blots (see Figure 25 expression pattern of hCED-6 in normal human
tissues and cancer cell lines by Northern blotting A) Human Multiple Tissue
Northern (MTN) Blot B) Human Multiple Tissue Northern (MTN) Blot II C)
Human Cancer Cell Line Multiple Tissue Northern (MTNTM) Blot)
A Human multiple tissue Northern (MTN-1, Clontech) containing in each
lane 2 mg of poly A + RNA from eight different human tissues (heart, brain,
placenta, lung, liver skeletal muscle, kidney, and pancreas) and a MTN-II
human
multiple tissue Northern, containing in each lane 2 mg of poly A + ~A from
spleen, thymus, prostate, testis, ovary, small intestine, colon and peripheral
leukocyte, were hybridized according to the manufacturer's instructions and
washed
out in 0.1 x SSC, 0.2% SDS at 55 °C. Also from Clontech, a poly A + RNA
blot from
human cancer cell lines (melanoma 6361, lung carcinoma A549, colorectal
adenocarcinoma SW480, Burkitt's lymphoma Raji Leukemia Molt 4, lympohoblastic
leukemia K562, HeLa S3 and promyelocytic leukemia HL60) was tested.
CA 02318935 2000-07-21
WO 99/37770 PCT/US99/01361
-53-
EXAMPLE 10
Isolation of the full-length human ced-6 cDNA.
Several human EST clones including hbc3123 have been identified through
searching variety of database. The hbc3123 EST clone was completely sequenced.
One pair of primers, P (ACAATTGCCAGCTTCATAG; SEQ ID NO.: 30) and Q
(CTGTTTTCTTGTTTCAACATC; SEQ ID NO.: 31 ) have been designed on the
region of PTB domain and subsequently tested for their specificity using human
genomic DNA as a template. The result showed that the primers are specific.
One
set of ~.gtl0 cDNA libraries (purchased from Clontech) including Brain, Heart,
Kidney, Liver, Lung, Pancreas, Placenta, Skeletal Muscle tissues were tested
using
primers P and Q to detect whether ced-6 is expressed in any of these tissues.
The primer Q and a primer against ~.gtl0 vector were used to isolate several
PCR fragments using brain and pancreas cDNA libraries. These PCR fragments
were reamplified using the same primer set and sequenced. The sequence
analysis
suggested that these PCR fragments allows the extension of cDNA 130bp upstream
of the initiation codon of human ced-6 coding region. The longest PCR fragment
was then sent to human EST database to search for more EST clones which have
overlap with the isolated PCR fragments but not the hbc3123 EST clone. The
Genbank names of these three EST clones are 865982, 865983 and AA159394,
respectively. These 3 ESTs together with the PCR fragment and hbc3123
constitute
the full-length coding sequence of human CED-6 and about 450 by of S'UTR. The
human ced-6 cDNA sequenced is confirmed correctly by the sequencing data of
hbc3123 EST clone, the sequencing data of the isolated PCR fragments and the
sequence data of the many EST clones on the human cDNA region from human EST
project. These human ced-6 cDNA data have suggested and guided any experiments
shown in both Example 8 and Example 9. See Figure 32.
CA 02318935 2000-07-21
WO 99/37770 PCT/US99/01361
-54-
EXAMPLE 11
Human Tissue Distribution of Human CED-6
This is a further example of the human tissue distribution. Two primers
against the PTB domain were used to detect whether the cDNA libraries
contained
human ced-6. The two primers have been tested using human genomic DNA as a
template and they are specific since no background amplification was detected.
The
result of this tissue distribution study is as follows:
I. Information obtained from cDNA library
Tissue Presence of hum n ced-6 cDNA
Brain
Heart +~-
Kidney +-~
Liver +
Lung
Pancreas ++
Placenta ++
Skeletal muscle ++
CA 02318935 2000-07-21
WO 99/37770 PCT/US99/01361
-55-
II. Information obtained from human EST project
Tissue EST clones from
Brain 2
Testis 3
Pancreas
HCC cell line 1
Aorta 1
Placenta 13
Fetus 1
Pooled sample 2
EXAMPLE 12
The technique lulown as FISH was carned out, the human ced-6 gene was
localized to chomosomal position 2q32.3-q33.
EXAMPLE 13
Functional conservation between C. elegans and human ced-6 homologues;
overexpression of hCED Rescues the Engulfinent Defect of CED-6 Mutants in c.
elegans:
Given that signal transduction pathways are usually conserved through
evolution, it is thought that the human ced-6 homologue (hereafter referred to
as
hced 6 which encompasses hlCED-6 and/or h3CED-6) might also be involved in
promoting the phagocytic removal of apoptotic cells in mammals. To address
this
question, we tested the human and worm ced-6 genes for functional conservation
by
overexpressing hced 6 in C. elegans and determining whether it could
functionally
substitute for the endogenous ced 6 gene.
CA 02318935 2000-07-21
WO 99/37770 PCT/US99/01361
-56-
It is shown herein that overexpression of a C. elegans ced 6 cDNA under the
control of the heat shock promoters hspl b-2 and hspl b-4l efficiently rescues
the
engulfment defect in transgenic ced 6 mutant embryos. The same assay was used
to
test hced 6 for biological activity in C. elegans: constructs were created
carrying the
S hced 6 open reading flame under the control of hspl b-2 and hspl b-41, and
ced
6(n1813) mutant animals transgenic for both constructs were tested for rescue
of the
engulfment defect in late embryos and young larvae. It was found that heat-
shocked
embryos laid by transgenic mothers, but not non-heat shocked embryos,
contained
few cell corpses (Figure 31A). These observations suggest that hced 6 can
substitute, albeit weakly in the current assay, for C. elegans ced 6,
supporting the
concept that C. elegans and human ced-6 are functionally conserved. Further
assessment as shown in Example 13, showed successful rescue.
Partial rescue, or even absence of rescue in certain assays, has been observed
previously, even in cases where functional conservation has been established.
For
example, Wu and Horvitz (1998x) Nature 1998a ~ SO1-504, have found that
DOCKI80, the mammalian homologue of C. elegans CED-5, efficiently rescued the
distal tip cell migration defect of CED-5 mutants, but not the engulfinent
defect.
Experimental Procedures
The open reading frame of hced-b was PCR-amplified using oligonucleotides
flanking the start and stop codons, and subcloned into the heat shock vectors
pPD49.78 and pPD49.83, previously digested with Kpn I and Sac I (see before).
The
two constructs were then injected into ced-6(n1813) animals as described
previously
to establish stably transmitting transgenic lines.
To score for rescue of the engulfment defect in embryos and in the adult germ
line, transgenic animals were submitted to heat-shock and the number of cell
corpses
quantified as described previously herein.
CA 02318935 2000-07-21
WO 99/37770 PCT/US99/01361
-57-
Table 2
Overexpression of human ced 6 homologue reduces the number of persistent
cell corpses in ced 6(n1813) late embryos.
Genotype Persistent cell corpses
- heatshock + heatshock
Wild Type {N2) - -
ced 6(n1813) +++ ++
ced 6(n1813); hs::hced 6 +++ +
One of the isolated PCR fragments was fused to the hbc3123 EST clone.
pLQhced-6.1, the fusion cDNA, has 130 nucleotides upstream of the initiation
codon
ATG. Two primers, Hhs 1 (GGGGTACCGAATTCTGATGGCAAC; (SEQ ID
N0.:27)) and Hhs3 (CGAGCTCGATCAATAGTGAAGGTGAGG; (SEQ ID NO.:
28)) were used to amplify the open reading frame of human ced 6 cDNA. The PCR
fragment was digested subsequently with Kpn I and Sac I, and inserted into Kpn
I
and Sac I sites of both ppD49.78 and ppD49.83 heat shock vectors. The heat
shock
constructs, pLQhsl and pLQhs2, 50 ng/pl for each, whre then co-injected with a
marker pRF4 (80 ng/p.l) into the germline of adult ced-6(h1813)
hermaphrodites.
nced 6 was examined for its ability to rescue the engulfinent defect in embryo
progeny of ced-6(n1813) transgenic animals following an established procedure,
as
described herein.
The rescuing ability of hCED-6 for the engulfinent defect of ced 6(n1813) in
the adult gonas was also tested. Transgenic animals at L4/adult molt were
picked
and put on a fresh plate. 36 hours later these animals were treated with a 45
minute
heat shock at 33 °C. Twelve hours after the heat shock, cell corpses
were scored in
one gonad arm. Control experiments, such as transgenic animals withut heat
treatment, ced 6(n1813) animals at the same development stage with or without
heat
shock, were also used. These experiments show that overexpression of hced-6
rescued the engulfment defect of CED-6 mutants in C. elegans in a germ line.
These
CA 02318935 2000-07-21
WO 99/37770 PCT/US99/01361
-58-
experiments confirm that human ced-6's (e.g., h3CED-6) function induces the
phagocytosis of apoptotic cells. Figures 31 A and 31 B.
EXAMPLE 14
Sequences can be obtained in both deposits using T3 or T7 primers (either
one or both can be used, they are at different sites of the actual insert).
Both are
commercially available from Clontech (#1227 and #1228) and sequence is shown
below
T7 primer: 5'(TAATACGACTCACTATAGGGAGA)3' (SEQ ID NO.: 25)
T3 primer: 5'(ATTAACCCTCACTAAAGGGA)3' (SEQ ID NO.: 26)
REFERENCES:
Avery, L., and Horvitz, H. (1987). A cell that dies during wild-type C.
elegans
development can function as a neuron in a ced-3 mutant. Cell 51, 1071-1078.
Blaikie, P., Immanuel, D., Wu, J., Li, N., Yajnik, V., and Margolis, b.
(1994). A
region in Shc distinct from the SH2 domain can bind tyrosine-phosphorylated
growth
factor receptor. The Journal of Biological Chemistry 269, 32031-32034.
Blumenthal, T. (1995). Traps-splicing and polycistronic transcription in
Caenorbabditir elegans. TIG 11, 132-136.
Blumenthal, T., and Steward, K. ( 1997). RNA processing and gene structure. In
C.
ELEGANS II, D. L. Riddle, T. Blumenthal, B. J. Meyer and J. R. Priess, eds.
(Cold
Spring Harbor: Cold Spring Harbor Laboratory Press), pp. 117-145.
Bork, P., and Margolis, B. (1995). A phosphotyrosine interaction domain. Cell
80,
693-694.
CA 02318935 2000-07-21
WO 99/37770 PCT/US99/01361
-59-
Brennar, S. (1974). The genetics of Caenorhabditis elegans. Genetics 77, 71-
94.
Driscoll, M., and Chalfie, M. (1991). The mec-4 gene is a member of a family
of
Caenorhabditis elegans genes that can mutate to induce neuronal degeneration.
Nature 349, 588-593.
S Driscoll, M. (1992). Molecular genetics of cell death in the nematode
Caenorhabditis
elegans. The Journal of Neurobiology 23, 1327-1351.
Duvall, E., Wyllie, A. H., and Moms, R. G. (1985). Macrophage recognition of
cells
undergoing programmed cell death (apoptosis). Immunology 56, 351-358.
Ellis, R. E., Jacobson, D. M., and Horvitz, H. R. (1991). Genes required for
the
engulfment of cell corpses during programmed cell death in Caenorhabditis
elegans.
Genetics 1?9, 79-94.
Fadok, V. A., Savill, J. S., Haslett, C., Bratton, D. L., Doherty, D. E.,
Campbell, P.
A., and Henson, P. M. (1992). Different populations of macrophages use either
the
vitronectin receptor or the phosphatidylserine receptor to recognize and
remove
apoptotic cells. The Journal of Immunology 149, 4029-4035.
Fadok, V. A., Voelker, D. R., Campbell, P. A., Cohen, J. J., Bratton, D. L.,
and
Henson, P. M. (1992). Exposure of phosphatidylserine on the Surface of
apoptotic
lymphocytes triggers specific recognition and removal by macrophages. The
Journal
of Immunology 148, 2207-2216.
Finan, P., Shimizu, Y., Gout, L, Hsuan, J., Truong, O., Butcher, C., Bennett,
P.,
Waterfield, M. D., and Kellie, S. (1994). An SH3 domain and proline-rich
sequence
CA 02318935 2000-07-21
WO 99/37770 PCT/US99/01361
-60-
mediate an interaction between two components of the phagocyte NADPH oxidase
complex. The Journal of Biochemical Chemistry 269, 13752-13755.
Franc, N. C., Dimarcq, J.-L., Lagueux, M., Hoffinann, J., and Ezekowitz, R. A.
B.
(1996). Croquemort, A novel Drosophila hemocyte/macrophage receptor that
recognizes apoptotic cells. Immunity 4, 431-443.
Frise, E., Knoblich, J., Younger-Shepherd, S., Jan, L., and Jan, Y. (I996).
The
Drosophila Numb protein inhibits signaling of the Notch receptor during cell-
cell
interaction in sensory organ lineage. Proc Natl Acad Sci U S A 93(15), 11925-
11932.
Geer, P. v. d., and Pawson, T. (1995). The PTB domain: a new protein module
implicated in signal transduction. TIBS 20, 277-280.
Gout, L, Dhand, R., Hiles, I. D., Truong, O., Totty, N. F., Hsuan, J., Booker,
G. W.,
Campbell, L. D., and Waterfield, M. D. (1993). The GTPase dynamin binds to and
is
activated by a subset of SH3 domains. Cell 75, 25-36.
Grabs, D., Slepnev, V. L, Songyang, Z., David, C., Lynch, M., Cantley, L. C.,
and
Camilli, P. D. (1997). The SH3 domain of amphiphysin binds the proline-rich
domain of dynamin at a single site that defines a new SH3 binding consensus
sequence. The Journal of Biological Chemistry 272, 13419-13425.
Greenberg, S., Chang, P., and Silverstein, S. (1993). Tyrosine phosphorylation
is
required for Fc receptor-mediated phagocytosis in mouse macrophages. J Med Med
177, 529-534.
CA 02318935 2000-07-21
WO 99/37770 PCf/US99/01361
-61-
Greenberg, S., Chang, P., and Silverstein, S. (1994). Tyrosine phosphorylation
of the
gamma subunit of Fc gamma receptors, p72syk, and paxillin during Fc
receptor-mediated phagocytosis in macrophages. J Biol Chem 269, 3897-3902.
Greenberg, S. (1995). Signal transduction of phagocytosis. Trends in Cell
Biology 5,
93-99.
Grigg, J., Savill, J., Sarraf, C., Haslett, C., and Silverman, M. (1991).
Neutrophil
apoptosis and clearance from neonatal lungs. Lancet 338, 720-722.
Hedgecock, E. M., Sulston, J. E., and Thomson, J. N. (1983). Mutations
affecting
programmed cell deaths in the nematode Caenorhabditis elegans. Science 220,
1277-1279.
Hedgecock, E. M., and Herman, R. K. (1995). The nuc-1 gene and genetic mosiac
of
Caenorhabditis elegans. Genetics 141, 989-1006.
Hengartner, M. O., and Horvitz, H. R. ( 1994): C. elegans cell survival gene
ced-9
encodes a functional homologue of the mammalian proto-oncogene bcl-2. Cell 76,
665-676.
Hengartner, M. O. (1997). Cell Death. In C. ELEGANS II, D. L. Riddle, T.
Blumenthal, B. J. Meyer and J. R. Priess, eds. (Plainview: Cold Spring Harbor
Laboratory Press), pp. 383-415.
Herman, R. K. (1984). Analysis of genetic mosiac of the nematode
Caenorhabditis
Elegans. Genetics 108, 165-180.
CA 02318935 2000-07-21
WO 99/37770 PCT/US99/01361
-62-
Hirsh, D., Oppenheim, D., and Klass, M. ( 1976). Development of the
reproductive
system of Caenorhabditis elegans. Developmental Biology 49, 200-219.
Horvitz, J. E. S. a. H. R. (1977). Post-embryonic cell lineages of the
nematode,
Caenorhabditis elegans. Developmental Biology 56, 110-156.
Huang, X.-Y., and Hirsh, D. ( 1989). A second traps-spliced RNA leader
sequence in
the nematode Caenorhabditis elegans. Proc. Natl. Acad. Sci. USA 86, 8640-8644.
Kavanaugh, W. M., and Williams, L. T. (1994). An alternative to SH2 domains
for
binding tyrosine-phosphorylated proteins. Science 266.
Kavanaugh, W. M., Turck, C. W., and Williams, L. T. (1995). PTB domain binding
to signaling proteins through a sequence motif containing phosphotyrosine.
Science
268, 1177-1179.
Kimble, J., and Hirsh, D. (1979). The postembryonic cell lineages of the
hermaphrodite and male gonads in Caenorhabditis elegans. Developmental Biology
70, 396-417.
Koch, C. A., Anderson, D., Moran, M. F., Ellis, C., and Pawson, T. (1991). SH2
and
SH3 Domains: elements that control interactions of cytoplasmic signaling
proteins.
Science 252, 252-673.
Kramer, J. M., French, R. P., Park, E., and Johnson, J. J. (1990). The
Caenorhabditis
elegans rol-6 gene, which interacts with the sgt-1 collagen gene to determine
organismal morphology, encodes a collagen. Molecular and cellular Biology 10,
2081-2089.
CA 02318935 2000-07-21
WO 99/37770 PC'f/US99/01361
-63-
Lockshin, R. A. (1981). Cell death in metamorphosis. In Cell death in biology
and
pathology, R. A. Lockshin and I. D. Browen, eds. (London: Chapman & Hall), pp.
79-122.
Luciani, M.-F., and Chimili, G. (1996). The ATP binding cassette transporter
ABC1,
is required for the engulfment of corpses generated by apoptotic cell death.
The
EMBO Journal 15, 226-235.
Mello, C., and Fire, A. (1995). DNA transformation. In Methods in Cell
Biology, H.
F. Epstein and D. C. Shakes, eds. (San Diego: Academic Press), pp. 452-482.
Morris, R. G., Duvall, E., Hangreaves, A. D., and Wyllie, A. H. (1984).
Hormone-induced cell death. 2. Surface changes in thymocytes undergoing
apoptosis. American Journal of Pathology 115, 426-436.
Morris, R. G., Hargreaves, A. D., DuvaIl, E., and Wyllie, A. H. ( 1984).
Hormone-Induced Cell Death. .
Pawson, T., and Schlessinger, J. (1993). SH2 and SH3 domains. Current Biology
3,
434-442.
Platt, N., Suzuki, H., Kurihara, Y., Kodama, T., and Cordon, S. (1996). Role
for the
class A macrophage scavenger receptor in the phagocytosis of apoptotic
thymocytes
in vitro. Proc. Natl. Acad. Sci. USA 93, 12456-12460.
Ravetch, J. V. (1994). Fc Receptor: Rubor Redux. Cell 78, 553-560.
CA 02318935 2000-07-21
WO 99/37770 PCT/US99/01361
-64-
Ren, Y., Silverstein, R. L., Allen, J., and Savill, J. ( 1995). CD36 Gene
Transfer
Confers Capacity for Phagocytosis of Cells Undergoing Apoptosis. J. Exp. Med.
18,
1857-1862.
Roberson, A., and Thomson, N. (1982). Morphology of programmed cell death in
the
ventral nerve cord of Caenorhabditis elegans Larvae. J. Embryol.Exp.Morph 67,
89-100.
Rosenbluth, R. E., Cuddeford, C., and Baillie, D. L. (1985). Mutagenesis in
Caenorhabditis elegans. II. A spectrum of mutational events induced with 1500
R of
r-radiation. Genetics 109, 493-511.
Rosenshine, L, and Finlay, B. B. (1993). Exploitation ofHost Signal
Transduction
Pathways and Cytoskeletal Functions by Invasive Bacteria. BioEssays 1 S, 17-
24.
Rotello, R. J., Fernandez, P.-A., and Yuan, J. ( 1994). Anti-apogens and
anti-engulfens: monoclonal antibodies reveal specific antigens on apoptotic
and
engulfment cells during chicken embryonic development. Development 120,
1421-1431.
Sambrook, J., Fritsch, E. F., and Maniatis, T. ( 1989). Molecular cloning: a
laboratory
manual (Cold Spring Harbor, NY: Cold Spring Harbor Press). .
Savill, J., Wyllie, A., Henson, J., Walport, M., Henson, P., and Haslett, C.
(1989).
Macrophage phagocytosis of aging neutrophils in inflamation. Programmed cell
death in the neutrophil leads to its recognition by macrophages. J Clin Invest
83,
865-875.
CA 02318935 2000-07-21
WO 99/37770 PCT/US99/01361
-65-
Savill, J., Dransfield, L, Hogg, N., and Haslett, C. ( 1990). Vitronectin
receptor-mediated phagocytosis of cells undergoing apoptosis. Nature 343, 170-
173.
Savill, J., Hogg, N., Ren, Y., and Haslett, C. ( 1992). Thrombospondin
cooperates
with CD36 and the vitronectin receptor in macrophage recognition of
neutrophils
undergoing apoptosis. J Clin Invest 90, 1513-1522.
Savill, J., Fadok, V., Henson, P., and Haslett, C. (1993). Phagocyte
recognition of
cells undergoing apoptosis. .
Songyang, Z., and Cantley, L. C. (1995). Recognition and specificity in
protein
tyrosine kinase-mediated signaling. TIBS 20, 470-475.
Songyang, Z., Margolis, B., Chaudhuri, M., Shoelson, S. E., and Cantley, L. C.
(1995). The phosphotyrosine interaction domain of SHC recognizes
tyrosine-phosphorylated NPXY motif. The Journal of Biological Chemistry 270,
14863-14866.
Spieth, J., Brooke, G., Kuersten, S., Lea, K., and Blumenthal, T. (1993).
Operons in
C. elegans: polycistronic mRNA precursors are processed by trans-splicing of
SL2 to
downstream coding region. Cell 73, 521-532.
Stinchcomb, D. T., Shaw, J. E., Carr, S. H., and Hirsh, D. (1985).
Extrachromosomal
DNA transformation of Caenorhabditis elegans. Molecular and Cellular biology
5,
3484-3496.
Stringham, E. G., Dixon, D. K., Jones, D., and Candido, E. P. M. ( 1992).
Temporal
and spatial expression patterns of the small heat shock (hsp 16) genes in
transgenic
Caenorhabditis elegans. Molecular Biology of the Cell 3, 221-233.
CA 02318935 2000-07-21
WO 99/37770 PCT/US99/01361
-66-
Sulston, J. (1976). Post-embryonic development in the ventral cord of
Caenorhabditis elegans. Philos Trans R Soc Lond B Biol Sci 275, 287-297.
Sulston, J. E., and Horvitz, H. R. ( 1977). Post-embryonic Cell Lineages of
the
Nematode, Caenorhabditis elegans. Developmental Biology 56, 110-156.
Sulston, J. E., Schierenberg, E., White, J. G., and Thomson, J. N. (1983). The
embryonic cell lineage of the nematode Caenorhabditis elegans. Developmental
Biology 100, 64-119.
Wilson, R., Ainscough, R., Anderson, K., Baynes, C., Berks, M., Bonfield, J.,
Burton, J., Connell, M., Copsey, T., Cooper, J., Coulson, A., Craxton, M.,
Dear, S.,
Du, Z., Durbin, R., Favello, A., Fraser, A., Fulton, L., Gardner, A., Green,
P.,
Hawkins, T., Hitler, L., Jier, M., Johnston, L., Jones, M., Kershaw, J.,
Kirsten, J.,
Laisster, N., Latrellie, P., Lightning, J., Lloyd, C., Mortimore, B.,
O'Callaghan, M.,
Parsons, J., Percy, C., Riffcen, L., Roopra, A., Saunders, D., Shownkeen, R.,
Sims,
M., Smaldon, N., Smith, A., Smith, M., Sonnhammer, E., Staden, R., Sulston,
J.,
Thierry-Mieg, J., Thomas, K., Vaudin; M., Vaughan, K., Waterston, R., Watson,
A.,
Welnstock, L., Wilkinson-Sproat, J., and Wohldman, P. (1994). 2.2 Mb of
contiguous nucleotide sequence from chromosome III of C. elegans. Nature 368,
32-38.
Wolf, G., Trub, T., Ottinger, E., Groninga, L., Lynch, A., White, M. F.,
Miyazaki,
M., Lee, J., and Shoelson, S. E. (1995). PTB domain of IRS-1 and Shc have
distinct
but overlapping binding specificities. The Journal of Biological Chemistry
270,
27407-27410.
Wyllie, A. H., Kerr, J. F. R., and Currie, A. R. (1980). Cell Death: The
significance
of apoptosis. International Review of Cytology 68, 251-306.
CA 02318935 2000-07-21
WO 99/37770 PCT/US99/01361
-67-
Xu, X.-X., Yang, W., Jackowski, S., and Rock, C. O. (1995). Cloning of a novel
phosphoprotein regulated by colony-stimulating factor 1 shares a domain with
the
Drosophila disabled gene product. The Journal of Biological Chemistry 270,
14184-14191.
Yenush, L., and White, M. F. ( 1997). The IRS-signalling system during insulin
and
cytokine action. BioEssay 19, 491-500.
Yu, H., Chen, J. K., Feng, S., Dalgarno. D. C., Brauer, A. W., and Schreiber,
S. L.
(1994). Structural basis for the binding of proline-rich peptides to SH3
domains. Cell.
76, 933-945.
Zhou, M.-M., Ravichandran, K. S., Olejniczak, E. T., Petros, A. M., Meadows,
R. P.,
Sattler, M:, Harlan, J. E., Wade, W. S., and Fesik, S. J. B. S. W. (1995).
Structure
and ligand recognition of the phosphotyrosine binding domain of Shc. Nature
378,
584-592.
Zorio, D. A. R., Cheng, N. N., Blumenthal, T., and Spieth, J. (1994). Operons
as a
common form of chromosomal organization in C. elegans. Nature 372, 270-272.
While this invention has been particularly shown and described with
references to preferred embodiments thereof, it will be understood by those
skilled in
the art that various changes in form and details may be made therein without
departing from the spirit and scope of the invention as defined by the
appended
claims.
