Note : Les descriptions sont présentées dans la langue officielle dans laquelle elles ont été soumises.
CA 02323936 2000-11-20
TITLE OF THE INVENTION
ESTROGEN RECEPTOR
FIELD OF THE INVENTION
This invention relates to a novel estrogen receptor and to
the polynucleotide sequences encoding this receptor. This invention
also relates to methods for identifying l.igands which bind to this
receptor, to the ligands so identified, and to pharmaceutical
compositions comprising such ligands. This invention also relates to
pharmaceutical compositions useful for treating or preventing
estrogen receptor mediated diseases or conditions.
BACKGROUND OF THE INVENTION
This Application is a Divisional of Canadian Patent
Application, Serial No. 2,302,629, filed September 4, 1998.
Nuclear receptors are a large class of proteins that are.
responsible for the regulation of complex cellular events including
cell differentiation,homeostasis, the growth and functioning of
various organs and tissues, and transcription. It is believed that
nuclear receptors function by transducing extracellular chemical
signals from hormones into a transcriptiona:L response.
Estrogen receptors are a subclass of the larger nuclear
receptor class. The estrogen receptors are proteins that are
responsive to estrogen and estrogen-like molecules. Estrogen
receptors are believed to play an important role in the mammalian
endocrine system, the reproductive organs, breast tissue, bone
tissue, and the vascular system, and are believed to be involbed in
the development and progression of various diseases states such as
abnormal bone resorption, cardiovascular disease, cancer, and central
nervous system disorders. It is believed that various disease states
and conditions can be treated or prevented by the development of
appropriate ligands, i.e. drugs, for modifying the activity of
estrogen receptors. Consequently there is a neeed to identify
1 -
CA 02323936 2000-11-20
WO 99112961 PCTIIJS98/18577
estrogen receptors and their mode of action and to also identify ligands
for modifying the action of these receptors.
At least two distinct types of estrogen receptors have been
reported. An estrogen receptor having 595 amino acids is disclosed in
S Green, S. et al., Nature, 320, pp. 134-139 (1986) and Greene, G.L. et al.,
Science, 231, pp.1I50-1154 (1986),
These references also disclose the
corresponding DNA sequences for the receptor.
The other reported type of estrogen receptor has been disclosed by
two research groups and has been designated "(3" (beta). One research
group discloses a 485 amino acid (3 receptor that is obtained from rat,
human, and mouse sources, as well as the corresponding DNA
sequences. See PCT application No. W0 97/09348, to Kuiper, G.G. J. M.
et al., published March 13, 1997,
The second research group discloses a similar
estrogen receptor containing 483 amino acids. The corresponding DNA
sequence is also disclosed. See Mosselman. S. et al., ER/3: identification
and characterization of a nouel human estrogen receptor, FEBS Letters,
392, pp. 49-53 (1996),
In the present invention, a novel estrogen receptor having 548
amino acid units, and thai is distinct from the disclosed 595 amino acid,
485 amino acid, and 483 amino acid estrogen receptors, has been
identified and isolated from human tissue. It is believed that this novel
2S estrogen receptor plays a key role in mammalian physiology. This novel
estrogen receptor is an important research tool for identifying and
designing ligands for use in pharmaceutical compositions for treating
and/or preventing a wide range of estrogen receptor mediated diseases
or conditions.
It is therefore an object of the present invention to provide a novel
isolated estrogen receptor.
It is another object of the present invention to provide the amino
acid sequence of a novel estrogen receptor.
It is another object of the present invention to provide the
3S polynucleotide sequence encoding a novel estrogen receptor.
-2-
CA 02323936 2000-11-20,
WO 99/t2961 PCTNS98/18577
It is another object of the present invention to provide methods for
isolating a novel estrogen receptor.
It is another object of the present invention to provide ligands
capable of binding to a novel estrogen receptor.
5 It is another object of the present invention to provide
pharmaceutical compositions comprising ligands capable of binding to a
novel estrogen receptor.
It is another object of the present invention to provide methods for
treating and/or preventing estrogen receptor mediated diseases or
10 conditions.
These and other objects will become readily apparent from the
detailed description which follows.
SUMMARY OF THE INVENTION
15 The present invention relates to an isolated estrogen receptor .
comprising the amino acid sequence of Figure 1 (which also corresponds
to SEQ ID NO: 1 ).
In further embodiments, the present invention relates to an
isolated estrogen receptor having an amino acid sequence that is
20 substantially similar to the amino acid sequence of Figure 1, wherein
the estrogen receptor comprises at least 531 amino acids.
In further embodiments, the present invention relates to an
isolated estrogen receptor comprising at least-531 amino acids and
having substantially the same ligand binding properties or substantially
25 the same DNA binding properties as the estrogen receptor of Figure 1.
In further embodiments, the present invention relates to an
isolated estrogen receptor that is derived from mammalian cells,
preferably human cells.
In further embodiments, the present invention relates to an
30 isolated polynucleotide encoding the estrogen receptor having the amino
acid sequence of Figure 1.
In further embodiments, the present invention relates to an
isolated polynucleotide which is a DNA, a cDNA, or an RNA.
In further embodiments, the present invention relates to an
35 isolated polynucleotide which hydridizes to and is complementary to the
-3-
CA 02323936 2000-11-20 '
a-
WO 99112961 PCTlUS98I18577
polynucleotide encoding the estrogen receptor having the amino acid
sequence of Figure 1.
In further embodiments, the present im~ention relates to an
isolated polynucleotide comprising a polynucleotide encoding a mature
polypeptide encoded by the estrogen receptor polynucleotide contained in
an ATCC Deposit selected from the group consisting of ATCC Deposit
No. 209238, ATCC Deposit No. 209239, and ATCC Deposit No. 209240.
In further embodiments, the present invention relates to an
isolated polynucleotide comprising the nucleotide sequence of Figure 2
(which also corresponds to SEQ ID NO: 2).
In further embodiments, the present invention relates to an
isolated polynucleotide which hybridizes to and is complementary to the
polynucleotide of Figure 2, wherein said polynucleotide comprises at
least 1593 nucleotides.
In further embodiments, the present invention relates to a vector
containing the DNA.
In further embodiments, the present invention relates to a host
cell transformed or transfected with the vector of the present invention.
In further embodiments, the present invention relates to a method
for producing an estrogen receptor of the present invention.
In Further embodiments, the present invention relates to a method
for determining whether a ligand can bind to the estrogen receptor of the
present invention.
In further embodiments, the present invention relates to a ligand
detected by the methods of the present invention.
In further embodiments, the present invention relates to a
pharmaceutical composition comprising a ligand of the present
invention.
In further embodiments, the present invention relates to a method
for treating or preventing an estrogen receptor mediated disease or
condition by administering an effective amount of a pharmaceutical
composition of the present invention.
The deposits referred to herein will be maintained under the
Budapest Treaty on the International Recognition of the Deposit of
Microorganisms for the purposes of Patent Procedure. These deposits
-4-
CA 02323936 2000-11-20
WO 99112961 PCT/US98/18577
are provided merely as a convenience,
The sequence of the
polynucleotides contained in the deposited materials, as well as the
amino acid sequence of the polypeptides encoded thereby,
- are controlling in
the event of any conflict with the description of the sequences herein. A
license may be required to make, use or sell the deposited materials, and
no such license is hereby granted.
All percentages and ratios used herein, unless otherwise
indicated, are by weight. The invention hereof can comprise, consist of,
or consist essentially of the essential as well as optional ingredients,
components, and methods described herein.
BRIEF DESCRIPTION OF THE FIGURES
FIG. 1 shows the amino acid sequence of the estrogen receptor,
i.e. the polypeptide, of the present invention.
FIG. 2 shows the nucleotide sequence, i.e. the cDNA
polynucleotide, encoding the estrogen receptor of the present invention.
This sequence includes the translation termination codon "TGA".
DESCRIPTION OF THE INVENTION
In accordance with one aspect of the present invention, there is
provided a polypeptide, namely an estrogen receptor, which has the
deduced amino acid sequence of FIG. 1 or which has the amino acid
sequence encoded by the cDNA of the clone deposited as ATCC Deposit
No. 209238 on September 8, 1997, by the genomic DNA of the clone
deposited as ATCC Deposit No. 209239 on September 8,1997, or by the
genomic DNA of the clone deposited as ATCC Deposit No. 209240 on
September 8, 1997. The present invention also relates to fragments,
analogs and derivatives of such an estrogen receptor.
The terms "fragments", "derivatives", and "analogs " when
referring to the estrogen receptor of FIG. 1 or that encoded by the
deposited DNA, means a polypeptide which retains essentially the same
biological function or activity as such estrogen receptor. Thus, an
-5-
i
CA 02323936 2000-11-20
WO 99112961 PCTNS98/18577
analog includes a proprotein which can be activated by cleavage of the
proprotein portion to produce an active mature estrogen receptor.
The estrogen receptor of the present invention can be a
recombinant polypeptide, a natural polypeptide, or a synthetic
polypeptide of the sequence of FIG. 1, or of that encoded by the deposited
DNA. Also contemplated within the scope of the present invention are
splice variants of the receptor of FIG. 1, or that encoded by the deposited
DNA.
The fragments, derivatives, or analogs of the estrogen receptor of
FIG. 1 or that encoded by the deposited DNA can be (i) one in which one
or more of the amino acid residues are substituted with a conserved or
non-conserved amino acid residue (preferably a conserved amino acid
residue) and such substituted amino acid residue can be one that is or is
not encoded by the genetic code, or (ii) one in which one or more of the
amino acid residues includes a substituent group, or (iii) one in which
the mature estrogen receptor is fused with another compound, such as a
compound to increase the half life of the estrogen receptor (for example,
polyethylene glycol), or (iv) one in which the additional amino acids are
fused to the mature estrogen receptor, such as a leader or secretory
sequence or a sequence which is employed for purification of the mature
estxogen receptor or a proprotein sequence. Such fragments, derivatives
and analogs are deemed to be within the scope of those sitilled in the art
from the teachings herein.
The present invention also encompasses estrogen receptors which
have substantially the same amino acid sequence as the estrogen
receptor of Figure i. In further embodiments of the present invention,
the isolated estrogen receptor comprises at least 531 amino acid units
and is at least about 75% identical with the sequence shown in Figure 1.
In even further embodiments of the present invention, the isolated
estrogen receptor comprises at least 531 amino acid units and is at least
about 94°6 identical with the sequence shown in Figure 1. In even
further embodiments of the present invention, the isolated estrogen
receptor comprises at least 531 amino acid units and is at least about
95°.6 identical with the sequence shown in Figure 1. In even further
embodiments of the present invention, the isolated estrogen receptor
-6-
- CA 02323936 2000-11-20
WO 99111961 PCTNS98118577
comprises at least 531 amino acid units and is at least about 99%
identical with the sequence shown in Figure 1.
The present invention also encompasses estrogen receptors
comprising at least 531 amino acids and having substantially the same
ligand binding proper~es or substantially the same DNA binding
properties as that of the estrogen receptor of Figure 1. In other words,
the respective ligand binding or DNA binding domains of the receptors
have at least about 750, homology, preferably about 90°6 homology, more
preferably about 95°.6 homology, and most preferably about 99°rb
homology
to each of the respective ligand binding and DNA binding domains in the
receptor of Figure 1.
In accordance with another aspect of the present invention, there
is provided an isolated nucleic acid, i.e. the polynucleotide, which
encodes for the mature estrogen receptor having the deduced amino acid
I S sequence of FIG. 1, or for the mature estrogen receptor encoded by the
DNA of the deposited clones.
A polynucleotide encoding an estrogen receptor of the present
invention can be obtained by performing polymerase chain reactions
(PCR) on human testis cDNA and subcloning into a vector in JM109 E.
cola. Alternatively, the polynucleotide can be obtained by screening a
human genomic DNA library derived from human testis.
The polynucleotide of the present invention can be in the form of
RNA or in the form of DNA, which DNA includes eDNA, genomic DNA,
and synthetic DNA. The DNA can be double-stranded or single-
stranded, and if single stranded can be the coding strand or non-coding
(anti-sense) strand. The coding sequence which encodes the mature
estrogen receptor can be identical to the coding sequence shown in FIG.
2 or that of the deposited clones or can be a different coding sequence,
which coding sequence, as a result of redundancy or degeneracy of the
genetic code, encodes the same, mature estrogen receptors as the DNA
of FIG. 2 or the deposited DNA.
The polynucleotide which encodes for the mature estrogen
receptor of FIG. 1 or for the mature polypeptide encoded by the deposited
DNA can include: only the coding sequence for the mature polypeptide;
the coding sequence for the mature polypeptide and additional coding
_7_
CA 02323936 2000-11-20
WO 99112961 PCT/US98/18577
sequence such as a leader or secretory sequence or a proprotein
sequence; or the coding sequence for the mature polypeptide (and
optionally additional coding sequence) and non-coding sequepce, such as
introns or non-coding sequence ~' and/or 3' of the coding sequence for
the mature polypeptide.
Thus, the term "polynucleotide encoding a polypeptide"
encompasses a polynucleotide which includes coding sequence for the
polypeptide as well as a polynucleotide which includes additional coding
and/or non-coding sequence.
The present invention further relates to variants of the
hereinabove described polynucleotides which encode for fragments,
analogs and derivatives of the polypeptide having the deduced amino
acid sequence of FIG. 1 or the polypeptide encoded by the DNA of the
deposited clones. The variant of the polynucleotide can be a naturally
occurring allelic variant of the polynucleotide. The present invention
also relates to polynucleotide probes constructed from the polynucleotide
sequence of FIG. 2 or a segment of the sequence of FIG. 2 amplified by
the PCR method, which can be utilized to screen a cDNA library to
deduce the estrogen receptor of the present invention.
Thus, the present invention includes polynucleotides encoding the
same mature estrogen receptor as shown in FIG. 1 or the same mature
polypeptide encoded by the DNA of the deposited clones, as well as
variants of such polynucleotides which variants encode for fragments,
derivatives or analogs of the polypeptide of FIG. 2 or the polypeptide
encoded by the DNA of the deposited clones. Such nucleotide variants
include deletion variants, substitution variants and addition or insertion
variants.
As hereinabove indicated, the polynucleotide can have a coding
sequence which is a naturally occurring allelic variant of the coding
sequence shown in FIG. 2 or of the coding sequence of the deposited
clones. As known in the art, an allelic variant is an alternate form of a
polynucleotide sequence which can have a substitution, deletion or
addition of one or more nucleotides, which does not substantially alter
the function of the encoded polypeptide.
_g_
CA 02323936 2000-11-20
WO 99112961 PCT/US98118577
The present invention further relates to polynucleotides which
hybridize to the polynucleotides encoding the estrogen receptor having
the amino acid sequence of FIG. 1. The present invention relates to an
isolated polynucleotide which hybridizes to and is at least about 75°k
complementary to the polynucleotide encoding the estrogen receptor
having the amino acid sequence of FIG. 1. The present invention relates
to an isolated polynucleotide which hybridizes to and is at least about
90°~n complementary to the poiynucleotide encoding the estrogen
receptor
having the amino acid sequence of FIG. 1. The present invention relates
to an isolated polynucleotide which hybridizes to and is at least about
95°.~o complementary to the polynucleotide encoding the estrogen
receptor
having the amino acid sequence of FIG. 1. The present invention relates
to an isolated polynucleotide which hybridizes to and is at least about
99% complementary to the polynucleotide encoding the estrogen receptor
I S having the amino acid sequence of FIG. 1.
The present invention relates to an isolated polynucleotide
comprising at least 1593 nucleotides. The present invention relates to an
isolated polynucleotide comprising at least 1593 nucleotides which
hybridizes to and is at least about 75°6 complementary to the
polynucleotide of FIG. 2. The present invention relates to an isolated
polynucleotide comprising at least 1593 nucleotides which hybridizes to
and is at least about 90°r6 complementary to the polynucleotide of FIG.
2.
The present invention relates to an isolated polynucleotide comprising at
Least 1593 nucleotides which hybridizes to and is at least about
95°.b
2S complementary to the polynucleotide of FIG. 2. The present invention
relates to an isolated polynucleotide which hybridizes to and is at least
about 9996 complementary to the poiynucleotide of FIG. 2.
The polynucleotides which hybridize to the hereinabove described
polynucleotides encode estrogen receptors which retain substantially the
same biological function or activity as the mature estrogen receptors
encoded by the cDNA of FIG 2 or the deposited DNA. Hybridization is
described in U.S. Patent No. 5,501,969, to Hastings et al., issued
March 26, 1996.
-9-
CA 02323936 2000-11-20
WO 99112961 PCTNS98/18577
The polypeptides and polynucleotides of the present invention are
preferably provided in an isolated form, and preferably are purified to
homogeneity.
The term "isolated' means that the material is removed from its
S original environment (e.g., the natural environment if it is naturally-
occuring). For example, a naturally-occuring polynucleotide or
polypeptide present in a living animal is not isolated, but the same
polynucleotide or DNA or polypeptide, separated from some or all of the
coexisting materials in the natural system, is isolated. Such
polynucleotide could be part of a vector and/or such polynucleotide or
polypeptide could be part of a composition, and still be isolated in that
such vector or composition is not part of its natural environment.
The present invention also relates to vectors which include
polynucleotides of the present invention, host cells which are genetically
engineered with vectors of the invention and the production of estrogen
receptors of the invention by recombinant techniques.
Host cells are genetically engineered (transduced or transformed
or transfected) with the vectors of this invention which can be, for
example, a cloning vector or an expression vector. The vector can be, for
example in the form of a plasmid, a viral particle, a phage, etc. The
engineered host cells can be cultured in conventional nutrient media
modified for activating promoters, selecting transformants or
amplifying the estrogen receptor genes. The culture conditions, such as
temperature, pH and the like, are those previously used with the host
cell selected for expression, and will be apparent to the ordinarily skilled
artisan.
The polynucleotide of the present invention can be employed for
producing a polypeptide by recombinant techniques. Thus, for example,
the polynucleotide sequence can be included in any one of a variety of
expression vehicles, in particular vectors or plasmids for expressing an
estrogen receptor. Such vectors include chromosomal,
nonchromosomal and synthetic DNA sequences, e.g., derivatives of
SV40: bacterial plasmids; phage DNA; yeast plasmids; vectors derived
from combinations of plasmids and phage DNA, viral DNA such as
vaccinia, adenovirus, fowl, pox virus, and pseudorabies. However, any
-10-
CA 02323936 2000-11-20
WO 99/12961 PCTNS98118577
other plasmid or vector can be used as long as it is replicable and viable
in the host.
As hereinabove indicated the appropriate DNA sequence can be
inserted into the vector by a variety of procedures. In general, the DNA
sequence is inserted into appropriate restriction endonuclease sites by
procedures known in the art. Such procedures and others are deemed to
be within the scope of those skilled in the art.
The present invention also includes recombinant constructs
comprising one or more of the sequences as broadly defined herein. The
constructs comprise a vector, such as a plasmid or viral vector, into
which a sequence of the invention has been inserted, in a forward or
reverse orientation. Large numbers of suitable vectors and promoters
are known to those of skill in the art, and are commercially available.
In a further embodiment, the present invention relates to host
cells containing the above-described construct. The host cell can be a
higher eukaryotic cell, such as a mammalian cell, or a lower eukaryotic
cell, such as a yeast cell, or the host cell can be a prokaryotic cell, such
as a bacterial cell. Introduction of the construct into the host cell can be
effected by calcium phosphate transfection, DEAE-Deatran mediated
transfection, or electroporation lDavis, L., Dibner, M., Battey, L, Basic
Methods in Molecular Biology, 1986) .
The constructs in host cells can be used in a conventional manner
to produce the gene product encoded by the recombinant sequence.
Alternatively, the estrogen receptors of the present invention can be
synthetically produced by conventional peptide synthesizers.
ll~Iature estrogen receptors can be expressed in mammalian cells,
yeast, bacteria, or other cells under the control of appropriate promoters.
Cell-free translation systems can also be employed to produce such
estrogen receptors using R.NAs derived from the DNA constructs of the
present invention. Appropriate cloning and expression vectors for use
with prokaryotic and eukaryotic hosts are described by Sambrook et al.,
Molecular Cloning: A Laboratory Manual, Second Edition (Cold Spring
Harbor, NY, 1989).
-11-
CA 02323936 2000-11-20.
WO 99112961 PCT/US98lt 85??
The estrogen receptors of the present invention can be naturally
purified products expressed from a high expressing cell line, or a
product of chemical synthetic procedures, or produced by recombinant
techniques from a prokaryotic or eukaryotic host (for example, by
5 bacterial, yeast, higher plant, insect and mammalian cells in culture).
Alternatively, a baculovirus~nsect cell expression system can also be
employed.
The estrogen receptors, their fragments or other derivatives or
analogs thereof, or cells expressing them can be used as an immunogen
IO to produce antibodies thereto. These antibodies can be, for example,
polyclonal or monoclonal antibodies. The present invention also
includes chimeric, single chain and humanized antibodies, as well as
Fab fragments, or the product of a Fab expression library. Various
procedures known in the art can be used for the production of such
I S antibodies and fragments.
The present invention is also directed to ligands, i.e. drugs, of the
estrogen receptors herein. The term "ligand" as used herein means any
molecule which binds to the estrogen receptor of the present invention.
These ligands can have either agonist, partial agonist, antagonist,
20 partial antagonist, inverse agonist, or mixtures of these properties.
Thus, for example, a ligand that binds to an estrogen receptor of the
present invention might modify, inhibit, or eliminate its function. In
this way, the ligand can be used to treat or prevent a disease in which
the estrogen receptor is involved. The ligands contemplated herein are
25 those that have selectivity to specifically activate or inhibit genes that
are
normally regulated by the estrogen receptors of the present invention.
The present invention also relates to methods for determining
whether a ligand not Down to be capable of binding to a human
estrogen receptor can bind to a human estrogen receptor. These
30 methods comprise contacting a mammalian cell comprising an isolated
DNA molecule encoding a human estrogen receptor with the ligand
under conditions permitting binding of ligands known to bind to an
estrogen receptor, detecting the presence of any of the ligand bound to a
human estrogen receptor, and thereby determining whether the ligand
35 binds to a human estrogen receptor. In these methods, the mammalian
I~
CA 02323936 2000-11-20
WO 99112961 PCTJUS98/18577
cell is actually expressing the isolated DNA molecules. The general
methodology for conducting such a method is well known to those of
ordinary skill in the art. See EP 787,797, to Weinshank et al., published
July 6, 1997..
Alternatively, RNA that ultimately encodes for the estrogen receptor
could be injected into, for example Xenopus oocytes, and expressed, and
used in analogous assay experiments.
The present invention also relates to pharmaceutical compositions
comprising the ligands of the present invention. Such compositions
comprise a pharmaceutically effective amount of the ligand. The term
"pharmaceutically effective amount", as used herein, means that
amount of the ligand that will elicit the desired therapeutic effect or
response when administered in accordance with the desired treatment
regimen. The ligand is typically administered in admixture with
IS suitable pharmaceutical diluents, excipients, or carriers, collectively
referred to herein as "carrier materials", suitably selected with respect
to the mode of administration, i.e. oral, LV., nasal, parenteral, ocular,
etc. A wide variety of product and dosage forms well known to one of
ordinary skill in the art ca.n be used to administer these ligands.
The present invention also relates to methods for treating and/or
preventing estrogen receptor mediated diseases or conditions. By
"estrogen receptor mediated diseases or conditions" is meant a
physiological or pathological state in which an estrogen receptor is
involved. Nonlimiting examples of estrogen receptor mediated diseases
or conditions include those of the endocrine system, the reproductive
organs, breast tissue, bone tissue, and the vascular system, especially
those diseases that become more prevelant in aging males and females.
More specifically, such diseases and conditions include those selected
from the group consisting of abnormal bone resorption, cardiovascular
disease, cancer, metabolic disorders, and central nervous system
disorders. Even more specifically, such diseases and conditions include
those selected from the group consisting of osteoporosis, breast cancer,
uterine cancer, ovarian cancer, prostate cancer, diabetes, and
Alzheimer's disease.
- 13-
CA 02323936 2000-11-20
WO 99112961 PCT/US981t 8577
EXAMPhES
The following examples further describe and demonstrate
embodiments within the scope of the present invention. The examples
are given solely for the purpose of illustration and are not to be construed
as limitations of the present invention as many variations thereof are
possible without departing from the spirit and scope of the invention.
EXAMPLE 1
Cloning and Sequencing of cDNA Clones of a Human Estrogen Receptor
Gene
The 5' rapid amplification of cDNA ends (R.ACE) product was
identified by performing two rounds of polymerase chain reactions
(PCR) on human testis Marathon-Ready cDNA (Clontech*product #?414-
IS 1) using Venti'Polymerase (New England Biolabs product #254S). The
first round of PCR was performed using the oligonucleotide,
GGAGAAAGGTGCCCAGGTGTTGGCC (SEQ ID NO: 3), in the 5'
coding region of human estrogen receptor beta (GenBanlf'sequence
number X99101) and the Clontech*AP1 primer, according to the
manufacturer s instructions. The second round of PCR was performed
using either of two different nested primers having the sequences
GTGGTCTGCCGACCAGGCCCACC (SEQ ID NO: 4) or
GGTGTTGGCCACAACACATTTGG (SEQ ID NO: 5), corresponding to
the 5' end of a human estrogen receptor beta clone (GenBank sequence
2~ number X99101), and the Clontech*AP2 primer, according to the
manufacturer's. instructions. The PCR product was subcloned into the
PCRAmpScript vector (Stratagene product # 211188) in JM109 E. coli.
This clone was sequenced on both strands by cycle sequencing
(Pharmacia product #2?-1694-01), according to the manufacturer s
instructions using primers corresponding to the vector sequence having
the following sequence GTAATACGACTCACTATAGGGC (SEQ ID NO:
6) as well as a primer in the 5' end of the human estrogen receptor beta
receptor gene having the following sequence
GTTAGTGACATTGCTGGGAATGC (SEQ ID NO: ?). Further
sequencing was performed with four additional primers having the
* trade-mark
_14_
CA 02323936 2000-11-20
WO 99ItZ961 PCT/US98118577
following sequences: GATCAGAGGCTTCAGCGAAACAG (SEQ ID
NO: 8), GAACGCGTGGATTAGTGACTAGCC (SEQ ID NO: 9),
GGAGGAAGGAGAATTAAGGCTAG (SEQ ID NO: 10), and
GAGATAACAGCTGAG.AAAACACC (SEQ LD NO: 11). These four
primers were derived firona the initial sequence analysis. Sequence
alignments and analysis of the nucleotide and protein sequences were
carried out using MacVector and AssemblyLigri programs (Oxford
Molecular Group) as well as the GCG Sequence Analysis Software
Package (Madison, WI: pileup).
EXAMPLE 2
Cloning and Sequencing of Genomic DNA Clones of a Human Estrogen
Receptor Gene
To obtain a probe for use in the screening of a human genomic
DNA library, cDNA was first generated from human testis mRNA
(Clontech product #6535-1) using an oligo-dT primer and MMLV
Reverse Transcriptase (Stratagene product #200420) according to the
manufactures s instructions. The cDNA was amplified by PCR using
Boehringer Mannheims Expand*High Fidelity PCR System (product #1
732 641) and two primers having the following sequences:
GTGATGAATTACAGCATTCCCAGCAATGTCACTAACTTGGAAGG
(SEQ ID N0:12) and
ATGGCCCAAGCTTGGGTTCCAGTTCACCTCAGGGCCAGGCG (SEQ
ID NO: 13). The PCR product was cloned into the TGEM vector
(Promega product #A3600) in JM109 E. coli. The product was sequenced
on one strand with a Pharmacia cycle sequencing kit (product #27-1694-
01) according to the manufacturer's instructions using nine primers
having the following sequences: CTTGGAAGGTGGGCCTGGTCGGC
(SEQ ID NO: 14), GGAGAAAGGTGCCCAGGTGTTGGCC (SEQ ID NO:
15, wlrich is identical to SEQ ID NO: 3),
CCGTTGCGCCAGCCCTGTTACTGG (SEQ ID NO: 16),
CGCAAGAGCTGCCAGGCCTGCCG (SEQ ID NO: 17),
CCCCGAGCAGCTAGTGCTCACCC (SEQ ID NO: 18),
CTTGGAGAGCTGTTGGATGGAGG (SEQ ID NO: 19),
* trade-_mark
-15-
CA 02323936 2000-11-20
WO 99112961 PCTIUS98118577
CTCTGTGTCAAGGCCATGATCC (SEQ ID NO: 20),
CGTCAGGCATGCGAGTAACAAGGG (SEQ iD NO: 2I), and
GCAAGTCCTCCATCACGGGGTCCG (SEQ ID NO: 22), corresponding
to the published DNA sequence (Mosselman, S. et al., ER~B: identification
and characterization of a noc~el human estrogen receptor, FEBS Letters,
392, pp. 49-53 [1996]). Sequence alignments and analysis of the
nucleotide and protein sequences were carried out using MacVector and
AssemblyLign programs (Oxford Molecular Group) as well as the GCG
Sequence Analysis Software Package (Madison, WI: pileup).
The cDNA clone obtained was digested with the restriction
enzymes Ncol and KpnI to obtain an approximately 500 base pair
fragment corresponding to the 5' end of the human estrogen receptor
beta cDNA (GenBank sequence number X99101). This fragment was
labeled with P-32 and used to screen a human genomic DNA library
(Stratagene product #946206) as per the manufacturer's instructions.
One million bacteriophage plaques were screened and seventeen
potential hybridizing phages were chosen. These phages were
reamplified and screened using a slightly smaller probe (i.e an
approximately 300 base pair fragment generated by digesting the human
ERbeta clone with NcoI and PstI). Two positive phages were plaque
purified and used for the production of DNA. The phages were digested
with NotI and BamHI to generate smaller fragments encoding most of
the phage DNA and these were subcloned into pBluescript~(Stratagene;
GenBank #52324). There were two fragments from one phage of
approximately 8.5 and 6kb and two fragments from the other phage of
approximately 7.7 and 6.3 kb. The genomic subclones of 8.5 and 7.7 kb
were sequenced on both strands with a Pharmacia cycle sequencing Mt
(product #27-1694-O1) according to the manufacturer s instructions
using primers derived from the 5'RACE product sequencing (EXAMPLE
1). Sequence alignments and analysis of the nucleotide and protein
sequences were carried out using MacVector and AssemblyLign
programs (Oxford Molecular Group) as well as the GCG Sequence
Analysis Soiiware Package (Madison, WI: pileup).
* trade-mark
-16-
