Note : Les descriptions sont présentées dans la langue officielle dans laquelle elles ont été soumises.
CA 02326757 2000-10-25
WO 99/55368 PCT/US99/09034
REGULATION OF B~OFILM FORMATION
tatement as to Federall~S_ on nsored Research
S This research has been sponsored in part by NIH grant number
GM582I3 and NSF grant number 9207323. The government has certain rights
to the invention.
Field of the Invention
The field of the invention is bacterial genetics.
Background of the Invention
Populations of surface-attached microorganisms, comprised either of
single or multiple species, are commonly referred to as biofilms. In most
natural, clinical, and industrial settings, bacteria are found predominantly
in
biofilms, not as planktonic cells such as those typically studied in the
laboratory. Biofilm bacteria display a different gene expression pattern,
different cellular physiology, and higher resistance to antibiotics, relative
to
their planktonic counterparts.
Numerous reports have documented the ability of diverse bacterial
species to form biofilms on a variety of abiotic surfaces of great importance
in
medicine and industry. For example, Pseudomonas aeruginosa, an organism
that causes nosocomial infections, forms biofilms on surfaces as diverse as
cystic fibrosis lung tissue, contact lenses, and catheter lines. In general,
biofilms can become hundreds of microns in depth, thereby clogging tubular
structures such as catheters and industrial pipes.
CA 02326757 2000-10-25
WO 99/55368 PCTNS99109034
-2-
Biofilm development initiates when bacteria make the transition
from a planktonic existence to a lifestyle in which the microorganisms are
firmly attached to biotic or abiotic surfaces. This transition is thought to
be
regulated in part by the nutritional status of the environment. After their
initial
attachment to the substratum, the cells are believed to undergo a program of
physiological changes that result in a highly structured, sessile microbial
community. After growth and development of the biofilm, the developmental
cycle is completed when planktonic cells are shed from the biofilm into the
medium, perhaps in response to a lack of sufficient nutrients {Costerton,
J.W.,
et a1.,1995, In Annu. Rev. Microbiol. Ornston, L.l~., et al. (eds.). Palo
Alto,
CA: Annual Reviews, Inc., pp. 711-745; Wimpenny, J.W.T. and Colasanti,
8.,1997, FEMSMicrobiol. Ecology 22: 1-16).
Previous studies exploring biofilm formation have generally focused
on identification of the organisms that comprise biofilms, their physical and
chemical properties, and biofilm architecture (Costerton, J.W., et a1.,1995,
supra). In contrast, little is known about the cellular factors and molecular
mechanisms required for the transition from a planktonic to a sessile mode of
life and the subsequent development of a biofilm.
Understanding the molecular factors that contribute to biofilm
initiation and maintenance would allow us to better control biofilm formation,
and would thereby have a significant impact upon medicine, industry, and the
environment.
Summary of the Inven~ 'on
Using Pseudomonas fluorescens, Escherichia coli, and Pseudomonas
aeruginosa as model organisms, we have investigated the molecular
mechanisms required for biofilm formation. We have identified nutritional
CA 02326757 2000-10-25
WO 99/55368 PCT/US99109034
-3-
conditions that modulate biofilm formation in wild-type bacteria and in
mutants
defective in biofilm formation, and have identified a class of genes involved
in
biofiim formation, designated surface attachment defective (sad). The sad
genes, sad gene products, and sad transcriptional control regions may all be
used for the control of biofilm formation in commercially important fields
such
as manufacturing, agriculture, and healthcare. Furthermore, these reagents may
be used in methods for the detection of industrially and pharmaceutically
useful
compounds for the modulation of biofilm formation.
In a first aspect, the invention features a purified nucleic acid. The
purified nucleic acid includes a region that hybridizes under high stringency
conditions to a probe containing at least 75 consecutive nucleotides that are
complementary to a portion of an n-sad gene, wherein the region contains at
least 75 consecutive nucleotides. In preferred embodiments of this aspect of
the invention the n-sad gene is a P. fluorescens sad gene including a sequence
chosen from SEQ ID NOs: 1-24, or the nucleic acid is contained within an
expression vector.
In another preferred embodiment of the first aspect of the invention,
the nucleic acid encodes a polypeptide that has a biological activity
necessary
for biofilm formation under at least one condition known to allow biofilm
formation by a bacterium that expresses said polypeptide.
In a second aspect, the invention features a probe comprising at least
18 nucleotides that are complementary to an n-sad gene from P. _fluorescens
including a sequence chosen from SEQ ID NOs: 1-24. In preferred
embodiments of this aspect of the invention, the probe includes at least 25,
40,
60, 80, 120, 150, 175, or 200 nucleotides that are complementary to the n-sad
gene.
CA 02326757 2000-10-25
WO 99155368 PCT/US99/09034
-4-
In a third aspect, the intention features a substantially pure n-sad
polypeptide. In a preferred embodiment of the second aspect of the invention,
the polypeptide has a biological activity necessary for biofilm formation
under
at least one condition known to allow biofilrn formation by a bacterium that
expresses the polypeptide.
In a fourth aspect, the invention features a substantially pure
antibody that specifically binds an n-sad polypeptide.
In preferred embodiments of the third and fourth aspects of the
invention, the polypeptide includes a polypeptide encoded by a P. fluorescens
n-sad gene that includes a sequence chosen from SEQ ID NOs: 1-24.
In a fifth aspect, the invention features a method of screening for a
compound that modulates biofilm formation including a) contacting a sample
containing a sad gene, sadlreporter gene fusion, or sad polypeptide with a
test
compound, and b) measuring the level of sad biological activity in the sample.
An increase in sad biological activity in the sample, relative to sad
biological
activity in a sample not contacted with the test compound, indicates a
compound that increases biofilm formation. A decrease in sad biological
activity in the sample, relative to sad biological activity in a sample not
contacted with the test compound, indicates a compound that decreases biofilm
formation. In preferred embodiments, the sample comprises bacterial cell
extract; the sad gene, the sad/reporter gene, or the sad polypeptide is within
a
bacterial cell; the sad gene, the sad/reporter gene, or the sad polypeptide
are
from P. fluorescens, and the sad gene and the sad/reporter gene include a
sequence chosen from SEQ ID NOs: 1-24, or the sad polypeptide is encoded by
a gene comprising a sequence chosen from SEQ ID NOs: 1-24.
CA 02326757 2000-10-25
WO 99155368 PCT/US99109034
-5-
In a sixth aspect, the invention features a method of screening for a
compound that modulates biofilm formation including a) contacting a sample
with a test compound, wherein the sample contains a clpP gene, a clpP/reporter
gene, or a CIpP polypeptide, and b) measuring the level of CIpP activity in
the
sample. An increase in ClpP activity in the sample, relative to CIpP activity
in
a sample not contacted with the test compound, indicates a compound that
increases biofilm formation. A decrease in CIpP activity in the sample,
relative
to CIpP activity in a sample not contacted with the test compound, indicates a
compound that decreases biofilm formation. In preferred embodiments, the
sample comprises bacterial cell extract; the clpP gene, the clpP/reporter
gene,
or the CIpP polypeptide is within a bacterial cell; the clpP gene, the
clpP/reporter gene, or the CIpP polypeptide is from P. fluorescens; the CIpP
activity is measured by measuring biofilm formation; or the clpP gene,
clpP/reporter gene, or CIpP polypeptide is a non-E. coli clpP gene, a non-E.
coli clpP/reporter gene, or a non-E. coli ClpP polypeptide.
In another preferred embodiment of the sixth aspect of the invention,
the clpP gene, clpP/reporter gene, or CIpP polypeptide is within a bacterial
cell
and the bacterial cell is cultured under standard biofilm assay conditions
after
the contacting.
In a seventh aspect, the invention features a method for preventing a
bacterial cell from participating in formation of a biofilm. The method may
include any one of the following: inhibiting the synthesis or function of a
sad
polypeptide; inhibiting protein synthesis in the bacterial cell; contacting
bacterial cell with a protease, where the contacting is sufficient to prevent
the
bacterial cell from participating in formation of a biofilm; limiting the
concentration of Fe2+/Fe3+ in the environment of the bacterial cell, where the
Fe2+/Fe3+ concentration of the environment is limited to 0.3 ~.M or less;
CA 02326757 2000-10-25
WO 99/55368 PCT/US99/09034
-G-
providing a high osmolarity environment to the bacterial cell, where the
osmolarity of the environment is equivalent to or greater than the osmolarity
of
a solution containing 0.2 M NaCI or 15% sucrose; and adding mannose to the
environment of the bacterial cell, such that the mannose concentration in the
environment after the addition of the mannose is at least 15 mM; and adding a-
methyl-D-mannoside to the environment of the bacterial cell, such that the a-
methyl-D-mannoside concentration in the environment after the addition of the
a-methyl-D-mannoside is at least 15 mM.
In preferred embodiments the sad polypeptide is encoded by a P.
fluorescens sad gene; the mannose concentration or the a-methyl-D-mannoside
concentration is at least 1 S mM, 25 mM, 50 mM, or most preferably 100 mM;
or the surface is an abiotic surface.
In further embodiments of aspects 5, 6, and 7, the bacterial cell is
selected from the group including: Pseudomonas.fluorescens, Pseudomonas
aeruginosa, Escherichia coli, Vibrio paramaemolyticus, Salmonella
typhimurium, Streptococcus mutans, Enterococcus species, Serratia
marcescens, Staphylococcus aureus, Staphylococcus epidermidis, and other
coagulase-negative Staphyloccus species, such as S. hominis, S. haemolyticus,
S. warneri, S. cohnii, S. saprophyticus, S. capitis, and S. lugdunensis.
In an eighth aspect, the invention features a method for inhibiting
participation of a bacterium in formation of a biofilm on a surface. The
method
includes inhibiting the synthesis or function of a flagellum on the bacterium.
In
preferred embodiments the surface is abiotic; or the synthesis or function of
the
flagellum is inhibited by inhibiting the synthesis or function of FIiC
(Genbank
Accession No. L07387 (gb-L07387); SEQ ID NC): 34); FlhD (gb-AE000283,
U00096; SEQ ID NO: 35); MotA (gb-JO1 G52; SEQ ID NO: 36}; MotB (gb-
M12914; SEQ ID NO: 37); FIiP (gb-L22182, L21994; SEQ ID NO: 38); FlaE
CA 02326757 2000-10-25
WO 99/55368 PCT/US99/09034
(gb-D90834, AB 001340; SEQ ID NO: 39); or FIgK (gb-AE000209, U00096;
SEQ ID NO: 40); or homologues thereof. In another preferred embodiment of
the eighth aspect of the invention, the inhibiting is under conditions that
otherwise result in biofilm formation.
In a ninth aspect, the invention features a method for inhibiting
participation of a bacterium in formation of a biofilm on an abiotic surface.
The method includes inhibiting the synthesis or function of a pilus on the
bacterium. In preferred embodiments the function of the pilus is inhibited by
contacting the pilus with mannose or a-methyl-D-mannoside; the synthesis or
function of the pilus is inhibited by inhibiting the synthesis or function of
PilB
(Genbank Accession No. M32066 (gb-M32066); SEQ ID NO: 41 ); PiIC (gb-
M32066; SEQ ID NO: 42); PiID (gb-M32066; SI?Q ID NO: 43); PiIV (gb-
L76605; SEQ ID NO: 44); PiIW gb-L76605(; SEQ ID NO: 45); PiIX (gb-
L76605; SEQ ID NO: 46); PilYl (gb-L76605; SEQ ID NO: 47); PilY2 (gb-
L76605; SEQ ID NO: 48); or PiIE (gb-L76605; SEQ ID NO: 49); or
homologues thereof. In preferred embodiments, the bacterium is chosen from
the group including: Pseudomonas fluorescens, P. aeruginosa, Escherichia
coli, Yibrio paramaemolyticus, Salmonella typhimurium, Streptococcus
mutans, Enterococcus species, Serratia marcescens, Staphylococcus aureus,
Staphylococcus epidermidis, and other coagulase-negative Staphyloccus
species, such as S. hominis, S haemolyticus, S. warneri, S. cohnii, S.
saprophyticus, S. capitis, and S. lugdunensis.
In a tenth aspect, the invention features a method of screening for a
compound that inhibits bacterial pathogenicity. The method includes a}
exposing a bacterial culture to a test compound, such that at least one
bacterial
cell in the bacterial culture is contacted by the test compound, and b)
testing
the bacterial culture for biofilm formation on an abiotic surface. A decrease
in
CA 02326757 2000-10-25
WO 99155368 PCTNS99/09034
_g_
biofilm formation, relative to biofilm formation by a bacterial culture that
has
not been exposed to the test compound, indicates a compound that inhibits
biofilm formation, and an increase in biofilm formation, relative to biofilm
formation by a bacterial culture that has not -been exposed to the test
compound,
indicates a compound that stimulates biofilm formation. In preferred
embodiments the bacterial culture is a liquid bacterial culture; at least 5%,
10%,
25%, 50%, 75%, or most preferably 100% of the bacterial cells contacted by
the bacterial growth medium are contacted by the test compound; and the
bacterial cell is chosen from the group including: .P. aeruginosa, Escherichia
toll, Vibrio paramaemolyticus, Salmonella typhin:urium, Streptococcus
mutans, Enterococcus species, Serratia marcescens, Staphylococcus aureus,
Staphylococcus epidermidis, and other coagulase-negative Staphyloccus
species, such as S. hominis, S. haemolyticus, S. warneri, S. cohnii, S.
saprophyticus, S. capitis, and S. lugdunensis.
1 S In an eleventh aspect, the invention features a method of stimulating
formation of a biofiim by a population of bacteria. The method includes at
least one of adding iron to the growth environment of the bacteria, such that
the final concentration of iron in the growth environment is at least 3 pM;
adding glutamate to the growth environment of the bacteria, such that the
final
concentration of glutamate in the growth environment is at least 0.4%; adding
citrate to the growth environment of the bacteria, such that the final
concentration of citrate in the growth environment is at least 0.4%; and
stimulating expression of a sad gene or activity of a sad polypeptide. In a
preferred embodiment, the bacterium is Pseudomonas fluorescens.
By "biofilm" is meant a sessile population of microorganisms,
comprised of a single species or multiple species, that are enclosed by an
extracellular matrix and adhere to each other and to a biotic or abiotic
surface.
CA 02326757 2000-10-25
WO 99/55368 PCT/US99/09034
-9-
By "standard biofilm assay" is meant experimental conditions that
provide the equivalent to growth, on an abiotic surface, of approximately 106
colony forming units (CFU)/ml for 10 hours or I0g CFU/ml for approximately
30 minutes, at 30-37° C, preferably at 25° C; 30° C, or
37° C, in minimal M63
medium supplemented with 0.2% glucose and 0.5% casamino acids (CAA) or
(particularly for E. coli) in rich medium such as I,uria broth or Luria-
Bertani
broth.
By "environment" is meant the habitat or living conditions of a
population of bacteria.
By "sad gene" or " surface attachment defective gene" is meant a
DNA molecule that hybridizes at high stringency to one of the sad gene
identifier sequences shown in Fig. 9, and encodes a polypeptide involved in
biofilm formation on an abiotic surface under at least some environmental
conditions. Examples of sad genes include the P., fluorescens genes sad-10,
sad-ll, sad-13, sad-14, sad-16, sad-18, sad-19, sad-20, sad-21, sad-22, sad-
51,
sad-52, sad-53, sad-57, sad-58, sad-62, sad-79, sad 80, sad-81, sad-83, sad-
87,
sad-89, sad-98, sad-100, sad-101, and sad-102.
By "sad polypeptide" is meant the protein product encoded by a sad
gene.
By "n-sad gene" or "n-sad polypeptide" is meant a novel sad gene or
gene product, including the P. fluorescens genes sad-10, sad-Il, sad-16, sad-
18, sad-19, sad-20, sad-21, sad-22, sad-51, sad-52, sad-53, sad-57, sad-58,
sad-62, sad-79, sad-80, sad-81, sad-83, sad-87, sad-89, sad-98, sad-100, sad-
101, and sad-102, and products of these genes.
By "sad gene identifier sequence" is meant a nucleotide sequence
that constitutes a portion of a sad gene. A sad gene identifier sequence is at
least 40 nucleotides, preferably at least 75 nucleotides, more preferably at
least
CA 02326757 2000-10-25
WO 99/55368 PCTNS99/09034
-10-
125 nucleotides, and most preferably at least 175 nucleotides. Sad gene
identifier sequences include SEQ ID NOs: 1-24, shown in Fig. 9.
By "sad mutant" is meant a bacterium that has a mutation in a sad
gene and is defective for biofilm formation. A sad mutant may be defective for
biofilm formation on only a subset of surfaces, or on all surfaces. For
example,
the sad-10 mutant described below has a biofilm formation defect on
hydrophobic surfaces such as PVC, polycarbon, and polypropylene, but forms
biofilms indistinguishable from wild-type biofilms on a hydrophilic surface
such as borosilicate glass.
By "reporter gene" is meant any gene that encodes a product whose
expression is detectable and/or quantitatabie by immunological, chemical,
biochemical or biological assays. A reporter gene product may, for example,
have one of the following attributes, without restriction: fluorescence (e.g.,
green fluorescent protein), enzymatic activity (e.g., lacZ/~i-galactosidase,
luciferase, chloramphenicol acetyltransferase), toxicity (e.g., ricin A), or
an
ability to be specifically bound by a second molecule (e.g., biotin or a
detectably labelled antibody). It is understood that any engineered variants
of
reporter genes, which are readily available to one skilled in the art, are
also
included, without restriction, in the forgoing definition.
By "sadlreporter gene" or "clpP/reporter gene" is meant a DNA
construct comprising transcriptional control sequences from, respectively, a
sad
gene or a clpP gene, operably linked to a reporter gene such that reporter
gene
expression is regulated in a manner analogous to that of an endogenous sad or
clpP gene; therefore, modulation of expression of a sad/reporter or
clpP/reporter gene construct, e.g., by a compound or environmental stimulus
reflects modulation of expression of the endogenous sad or clpP gene. A
CA 02326757 2000-10-25
WO 99/55368 PCT/US99/09034
-11-
sad/reporter or clpP/reporter gene may exist within a cell as an episomal DNA
molecule, or may be integrated into the cellular genomic DNA.
By "sad/reporter mRNA," "sad/reporter polypeptide," "clpP/reporter
mRNA," and "clpP/reporter polypeptide," is meant, respectively, the mRNA or
polypeptide encoded by a sad/reporter gene or a clpP/reporter gene.
By "changes in sad biological activity" is meant changes in:
transcription of a sad gene or sad/reporter gene; post-transcriptional
degradation or translation of a sad mRNA or sad/reporter mRNA; post-
translational degradation, enzymatic function, or structural function of a sad
polypeptide or sad/reporter polypeptide. In all cases, a change in sad
biological
activity in a sample, for example, a sample exposed to an environmental
stimulus such as a change in nutrient status or the addition of a chemical, is
measured by an increase or decrease, in the activity being measured, of at
least
30%, more preferably at least 40%, still more preferably at least 55%, and
most
preferably by at least 70%, relative to a sample not exposed to the
environmental stimulus.
By "CIpP palypeptide" is meant any protease that bears at least 70%
sequence identity, more preferably at least 80%, and most preferably at least
89% sequence identity, over an amino acid stretch at least 50 amino acids in
length, to the P. fluorescens ClpP polypeptide. t)ne example of a CIpP
polypeptide is the E. coli CIpP.
By "clpP gene" is meant any gene that encodes a CIpP protease.
By "CIpP activity" is meant enzymatic activity of Clp protease, as
evidenced by cleavage of a Clp protease substrate, for example, a misfolded
protein, RpoS, l0 protein, and Mu vir repressor. CIpP activity may directly
measured by measuring Clp enzymatic activity. CIpP activity also may be
determined by measuring clpP mRNA levels or CIpP polypeptide levels, which
CA 02326757 2000-10-25
WO 99/55368 PCT/US99/09034
-12-
reflect relative changes in: transcription of a clpP gene, post-
transcriptional
degradation of a clpP mRNA, translation of a clpP mRNA, or post-translational
degradation of a CIpP polypeptide. In all cases, a change in ClpP activity in
a
sample, for example, a sample exposed to an environmental stimulus such as a
change in nutrient status or the addition of a chemical, is measured by an
increase or decrease of at least 30%, more preferably at least 40%, still more
preferably at least 55%, and most preferably by at least 70%, relative to a
sample not exposed to the environmental stimulus.
By "non-E. coli CIpP" or "non-E. coli clpP" is meant a CIpP
polypeptide or nucleic acid that is not the CIpP polypeptide or nucleic acid
that
is naturally encoded by the endogenous E. coli genome.
By "homologue" is meant a gene (e.g., a gene encoding a
polypeptide component of pili or flagella, or a polypeptide that regulates
synthesis or function of pili or flagella) whose nucleic acid hybridizes at
low
stringency to the nucleic acid of a reference gene, and whose encoded
polypeptide displays a biological activity similar to that of the polypeptide
encoded by the reference gene. For example, the Vibrio paramaemolyticus
flaE, Salmonella typhimurium,flgK, and P. fluore,scens sad-14 genes are
homologues of one another. The effect of a homologue on synthesis of pili or
flagella may be assessed by measuring rnRNA or polypeptide levels of pilus or
flagellum components. Function of pili or flagella may be measured by
motility assays, such as those known in the art and described herein.
By "biological activity" is meant an activity associated with biofilm
formation, as provided herein below.
By "high stringency conditions" is meant conditions that allow
hybridization comparable with the hybridization that occurs during an
overnight incubation using a DNA probe of at least 500 nucleotides in length,
CA 02326757 2000-10-25
WO 99155368 PCT/US99109034
-13-
in a solution containing 0.5 M NaHP04, pH 7.2, 7% SDS, 1 mM EDTA, 1
BSA {fraction V), and 100 ug/ml denatured, sheared salmon sperm DNA, at a
temperature of 65° C, or a solution containing 48% formamide, 4.8X SSC
( 150
mM NaCI, I 5 mM trisodium citrate), 0.2 M Tris-Cl, pH 7.6, 1 X Denhardt's
solution, 10% dextran sulfate, 0.1 % SDS, and 100 ~,g/ml denatured, sheared
salmon sperm DNA, at a temperature of 42° C (these are typical
conditions for
high stringency Northern or Southern, or colony hybridizations). High
stringency hybridization may be used for techniques such as high stringency
PCR, DNA sequencing, single strand conformational polymorphism analysis,
and in situ hybridization. The immediately aforementioned techniques are
usually performed with relatively short probes (e.g., usually 16 nucleotides
or
longer for PCR or sequencing, and 40 nucleotides or longer for in situ
hybridization). The high stringency conditions used in these techniques are
well known to those skilled in the art of molecular biology, and may be found,
for example; in F. Ausubel et al., Current Protocols in Molecular Biology,
John
Wiley & Sons, New York, NY, 1997, hereby incorporated by reference.
By "low stringency" is meant conditions that allow hybridization
comparable with the hybridization that occurs during an overnight incubation
at
37°C using a DNA probe of at least 500 nucleotides in length, in a
solution
containing 20% formamide, SX SSC, SO rnM sodium phosphate (pH 7.6), SX
Denhardt's solution, 10% dextran sulfate, and 20 ~.g/ml denatured, sheared
salmon sperm DNA (these are typical conditions for low stringency Northern,
Southern, or colony hybridizations). Low stringency hybridization may be
used for techniques such as low stringency PCR, which is usually performed
with relatively short probes (e.g., usually 16 nucleotides). Factors.that
alter
hybridization stringency (e.g., the relative likelihood of forming a duplex
CA 02326757 2000-10-25
WO 99/55368 PCT/US99109034
-14-
between a single stranded probe and a target nucleic acid) are well known in
the art, and are described in Ausubel, supra, at pages 2.10.8-2.10.16.
By "probe" or "primer" is meant a single-stranded DNA or RNA
molecule of defined sequence that can base-pair to a second DNA or RNA
molecule that contains a complementary sequence (the "target"). The stability
of the resulting hybrid depends upon the extent of the base-pairing that
occurs.
The extent of base-pairing is affected by parameters such as the degree of
complementarity between the probe and target molecules and the degree of
stringency of the hybridization conditions. The degree of hybridization
I O stringency is affected by parameters such as temperature, salt
concentration,
and the concentration of organic molecules such as formamide, and is
determined by methods known to one skilled in the art. Probes or primers
specific for nucleic acid encoding a sad gene preferably have at least 40%
sequence identity, more preferably at least 45-SS°,~o sequence
identity, even
more preferably at least 60-75% sequence identity, still more preferably at
least
80-90% sequence identity, and most preferably 100% sequence identity.
Probes may be detestably-labelled, either radioactively, or non-radioactively,
by methods well-known to those skilled in the art. Probes are used for methods
involving nucleic acid hybridization, such as: nucleic acid sequencing,
nucleic
acid amplification by the polymerase chain reaction, single stranded
conformational polymorphism (SSCP) analysis, restriction fragment
polymorphism (RFLP) analysis, Southern hybridization, Northern
hybridization, in situ hybridization, and electrophoretic mobility shift assay
(EMSA).
By "identity" is meant that a polypeptide or nucleic acid sequence
possesses the same amino acid or nucleotide residue at a given position,
compared to a reference poiypeptide or nucleic acid sequence to which the
first
CA 02326757 2000-10-25
WO 99155368 PCT/US99/09034
-15-
sequence is aligned. Sequence identity is typically measured using sequence
analysis software with the default parameters specified therein, such as the
introduction of gaps to achieve an optimal alignment (e.g., Sequence Analysis
Software Package of the Genetics Computer Group, University of Wisconsin
Biotechnology Center, 1710 University Avenue, Madison, WI 53705).
By "substantially identical" is meant a polypeptide or nucleic acid
exhibiting, over its entire length, at least 40%, preferably at least 50- 85%,
more preferably at least 90%, and most preferably at least 95% identity to a
reference amino acid or nucleic acid sequence. For polypeptides, the length of
comparison sequences is at least 16 amino acids, preferably at least 20 amino
acids, more preferably at least 25 amino acids, and most preferably at least
35 amino acids. For nucleic acids, the length of comparison sequences is at
least 50 nucleotides, preferably at least 60 nucleotides, more preferably at
least
75 nucleotides, and most preferably at least 110 nucleotides.
By "substantially pure polypeptide" is meant a polypeptide (or a
fragment thereof) that has been separated from the components that naturally
accompany it. Typically, the polypeptide is substantially pure when it is at
least 60%, by weight, free from the proteins and naturally-occurring organic
molecules with which it is naturally associated. Preferably, the polypeptide
is a
sad polypeptide that is at least 75%, more preferably at least 90%, and most
preferably at least 99%, by weight, pure. A substantially pure sad polypeptide
may be obtained, for example, by extraction from a natural source (e.g., a
bacterium), by expression of a recombinant nucleic acid encoding a sad
polypeptide, or by chemically synthesizing the polypeptide. Purity can be
measured by any appropriate method, e.g., by column chromatography,
polyacrylamide gel electrophoresis, or HPLC analysis.
CA 02326757 2000-10-25
WO 99/55368 PCTNS99109034
-16-
A protein is substantially free of naturally associated components
when it is separated from those contaminants that accompany it in its natural
state. Thus, a protein that is chemically synthesized or produced in a
cellular
system different from the cell from which it naturally originates will be
substantially free from its naturally associated components. Accordingly,
substantially pure polypeptides are not only those derived from the organisms
in which they naturally occur, but also those synthesized in organisms
genetically engineered to express a given polypeptide.
By "substantially pure DNA" is meant DNA that is free of the genes
which, in the naturally-occurring genome of the organism from which the DNA
of the invention is derived, flank the gene. The term therefore includes, for
example, a recombinant DNA which is incorporated into a vector; into an
autonomously replicating plasmid or virus; or into the genomic DNA of a
prokaryote or eukaryote; or which exists as a separate molecule (e.g., a cDNA
or a genomic or cDNA fragment produced by PCR or restriction endonuclease
digestion) independent of other sequences. It also includes a recombinant DNA
that is part of a hybrid gene encoding additional polypeptide sequence.
By "transformation" is meant any method for introducing foreign
molecules into a cell (e.g., a bacterial, yeast, fungal, algal, plant, or
animal
cell). Lipofection, DEAE-dextran-mediated transfection, microinjection,
protoplast fusion, calcium phosphate precipitation, transduction (e.g.,
bacteriophage, adenoviral or retroviral delivery), electroporation, and
biolistic
transformation are just a few of the methods known to those skilled in the art
which may be used.
By "transformed cell" is meant a cell (or a descendent of a cell) into
which a DNA molecule encoding a polypeptide of the invention has been
introduced, by means of recombinant DNA techniques.
CA 02326757 2000-10-25
WO 99155368 PGTNS99/09034
-17-
By "promoter" is meant a minimal sequence sufficient to direct
transcription. Also included in the invention are those promoter elements
which are sufficient to render promoter-dependent gene expression controllable
for cell type, developmental status, and nutrient status, or inducible by
external
S signals or agents; such elements may be located in the S' or 3' or internal
regions of the native gene.
By "operably linked" is meant that a gene and one or more regulatory
sequences are connected in such a way as to permit gene expression when the
appropriate molecules (e.g., transcriptional activator proteins) are bound to
the
regulatory sequences.
By "detestably-labeled" is meant any means for marking and
identifying the presence of a molecule, e.g., an oligonucleotide probe or
primer,
a gene or fragment thereof, a cDNA molecule, or an antibody. Methods for
delectably-labeling a molecule are well known in the art and include, without
1 S limitation, radioactive labeling (e.g., with an isotope such as 3zP or
35S) and
nonradioactive labeling (e.g., chemiluminescent labeling, or fluorescent
labeling, e.g., with fluorescein).
By "sample" is meant a specimen containing bacterial cells, cell
lysates, cell extracts, or mixtures of partially- or fully purified molecules,
such
as polypeptides or nucleic acids. Samples may be purified or fractionated by
methods known in the art, including, but not limited to, differential
precipitation or centrifugation, column chromatography, and gel
electrophoresis.
By "specifically binds" is meant that an antibody recognizes and
binds a given sad polypeptide but that does not substantially recognize and
bind
other molecules in a sample, e.g., a biological sample, that naturally
includes
CA 02326757 2000-10-25
WO 99/55368 PCTIUS99109034
-18-
protein. Preferred samples include bacterial cells and cell lysates or cell
extracts, including partially purified cell extracts.
By "expose" is meant to allow contact between an animal, cell
(prokaryotic or eukaryotic), lysate or extract derived from a cell, or
molecule
derived from a cell, and a test compound, nutrient (such as citrate), or ion
(such
as Fe2+ or Fe3+).
By "test compound" is meant a chemical, be it naturally-occurring or
artificially-derived, that is surveyed for its ability to modulate biof lm
formation, by employing one of the assay methods described herein. Test
compounds may include, for example, peptides, polypeptides, synthesized
organic molecules, naturally occurnng organic molecules, nucleic acid
molecules, and components thereof.
By "assaying" is meant analyzing the effect of a treatment or
exposure, be it chemical or physical, administered to cells (e.g., bacterial
cells)
1 S that are capable of forming biofilms. The material being analyzed may be a
cell, a lysate or extract derived from a cell, or a molecule derived from a
cell.
The analysis may be, for example, for the purpose of detecting altered gene
expression, altered nucleic acid stability (e.g. mRNA stability), altered
protein
stability, altered protein levels, or altered protein biological activity. The
means for analyzing may include, for example, nucleic acid amplification
techniques, reporter gene assays, antibody labeling, immunoprecipitation,
enzymatic assays, measurement of the presence and/or function of physical
structures such as flagella or pill (e.g., by motility assays such as swaiming
or
twitching motility assays), measurement of biofilm formation, such as
measurement of crystal violet (CV) staining or cell attachment, as described
herein, and by other techniques known in the art for conducting the analysis
of
the invention.
CA 02326757 2000-10-25
WO 99155368 PCT/US99109034
-19-
By "modulating" is meant changing, either by decrease or increase.
By "a decrease" is meant a lowering in the level of a) protein, e.g.,
measured by ELISA; b) reporter gene activity, e.g., measured by reporter gene
assay, for example, lacZ/~3-galactosidase, green fluorescent protein,
luciferase,
etc.; c) mRNA levels, e.g., measured by PCR relative to an internal control,
for
example, a "housekeeping" gene product such as ribosonal RNA; d) biofilm
formation, e.g., as measured by crystal violet staining or counting attached
cells; e) enzymatic activity of a polypeptide involved in biofilm formation,
e.g.,
enzymatic activity of CIpP; or f) measurement of flagella or pilus function,
e.g.,
by motility assays. In all cases, the lowering is preferably by at least 30%,
more preferably by at least 40%, and even more preferably by at least 100%.
By "an increase" is meant a rise in the level of a) protein, e.g.,
measured by ELISA; b) reporter gene activity, e.g., measured by reporter gene
assay, for example, IacZ/~3-galactosidase, green fluorescent protein,
luciferase,
etc.; c) mRNA levels, e.g., measured by PCR relative to an internal control,
for
example, a "housekeeping" gene product such as ribosonal RNA; d) biofilm
formation, e.g., as measured by crystal violet staining or counting attached
cells; e) enzymatic activity of a polypeptide involved in biofilm formation,
e.g.,
enzymatic activity of CIpP; or fJ measurement of flagella or pilus function,
e.g.,
by motility assays. In all cases, the rise is preferably by at least 50%, more
preferably by at least 80%, and even more preferably by at least 95%.
By "protein" or "polypeptide" or "polypeptide fragment" is meant
any chain of more than two amino acids, regardless of post-translational
modification (e.g., glycosylation or phosphorylation), constituting all or
part of
a naturally-occurring polypeptide or peptide, or constituting a non-naturally
occurring polypeptide or peptide.
CA 02326757 2000-10-25
WO 99/55368 PCT/US99/09034
-20-
By "consecutive" is meant that a series of nucleotides exists as an
unbroken sequence, i.e., uninterrupted by other nucleotides.
Brief Description of the Drawings
Fig. 1 is a representation of a photograph showing a biofilm formed
by wild-type P. fluorescens and a graph showing quantitation of biofilm
formation over time.
Fig. 2 is a graph demonstrating that protein synthesis is required for
biofilm formation by P. fluorescens.
Fig. 3 is a representation of a photograph showing that biofilms are
not formed by P. fluorescens sad mutants.
Fig. 4 (A-D) is a series of graphs showing biofilm formation on
various surfaces by wild-type P. fluorescens and sad mutants.
Fig. 5 is a graph showing restoration of biofilm formation in a clpP
mutant complemented with clpP+ (wild-type clpP).
1 S Fig. 6 is a representation of two phase-contrast photomicrographs
showing restoration of biofilm formation in a clpP mutant complemented with
clpP~" (wild-type clpP).
Fig. 7 is a graph showing nutrient-mediated rescue of the biofilm
formation defect in P. fluorescens sad mutants.
Fig. 8 is a diagram depicting a genetic model for biofilm formation
in P. fluorescens.
Fig. 9 is a series of sad gene identifier sequences.
Fig. 10 is a representation of a photograph showing that nutrients
affect biofilm formation in E. coli.
Fig. I 1 is a representation of a photograph showing biofilm
formation by wild-type and mutant E. coli strains.
CA 02326757 2000-10-25
WO 99!55368 PCT/US99I09034
-21-
Fig. 12 is a graph that shows quantification of biofilm formation in
various E. coli strains.
Figs. 13A-13D are representation of photomicrographs showing
biofilm formation by wild-type and mutant E. coli strains.
Fig. 14 is a graph showing inhibition of biofilm formation by a-
methyl-D-mannoside.
Fig. 1 S is a diagram showing a model for initiation of E. coli biofilm
formation.
Fig. 16 is a representation of a photograph showing biofilm
formation phenotypes in wild-type and mutant P. aeruginosa strains.
Fig. 17 is a representation of a photograph of a motility assay of
wild-type and mutant P. aeruginosa strains.
Fig. 18 is a representation of a photograph of a twitching motility
assay of wild-type and mutant P. aeruginosa strains.
Fig. 19 is a representation of a photomicrograph showing the edge
morphology of wild-type and mutant P. aeruginosa colonies.
Fig. 20 is a representation of a series of phase-contrast
photomicrographs showing a timecourse of biofilm formation by wild-type P.
aeruginosa.
Fig. 21 is a representation of a series of phase-contrast
photomicrographs showing biofilms formed by wild-type and mutant P.
aeruginosa at 3 hours and 8 hours after biofilm initiation.
Figs. 22A-22I are representations of phase-contrast
photomicrographs that show the role of twitching motility in biofilm formation
by wild-type P. aeruginosa.
Fig. 23 is a schematic diagram of a model for the role of flagella and
type IV pili in biofilm formation by P. aeruginosa.
CA 02326757 2000-10-25
WO 99155368 PCT/US99/09034
-22-
Description of the Preferred Embodiments
To dissect the complex phenomenon oi~biofilm formation, we
employed a genetic approach to identify genes required for the early stages of
biofilm formation. We found that pili are essential for initial attachment to
abiotic surfaces, and that flagella are necessary for biofilm spreading upon
such
surfaces. In addition, motility, but not chemotaxis, is crucial during the
early
biofilm formation. We observed that protein synthesis is necessary for
initiation of biofilm formation; in contrast, we noted that high osmolarity
inhibits biofilm formation.
Our genetic screen in P. fluorescens identified sad genes whose
products are involved in flagellar synthesis and function, and a sad gene
whose
product displays sequence homology to the E. coli ClpP protein, a component
ofthe Clp protease.
Our findings indicate the existence of at least two genetic pathways
involved in biofilm formation, and suggest that cells, in response to
environmental signals, can adopt multiple strategies for initiating cell-to-
surface interactions.
Biofilm formation in P.,dfluorescens
The experiments described herein show that: (a) P. , fluorescens can
form biofilms on an abiotic surface under a range of growth conditions; {b}
protein synthesis is required for the earliest events of biofilm formation,
suggesting that biofilm formation is a regulated process in this organism; (c)
one (or more) extra-cytoplasmic proteins plays a role in interactions with an
abiotic surface, and that the surface-exposed proteins) may constitute the
adhesion that mediates direct cell-to-surface contact; and (d) the osmolarity
of
the medium can impact the ability of P. fluorescens to form biofilms.
CA 02326757 2000-10-25
WO 99/55368 PCT/US99/09034
-23-
Mutants of P. fluorescens defective for the initiation of biofilm
formation on an abiotic surface (PVC) were isolated and designated surface
attachment defective (sad). In addition to defects in forming biofilms on PVC,
the sad mutants were also unable to initiate biofilm formation on other
hydrophobic and hydrophilic surfaces. These data suggest that mutants
identified on a single surface (i.e., PVC) may have defects in attachment on a
wide range of abiotic (and potentially biotic) surfaces.
The initial search for mutants defective in biofilm formation was
performed on minimal medium supplemented with glucose and CAA.
However, approximately half of the sad mutants could be rescued for their
biofilm formation defects (including the non-motile strains and the clpP
mutant; see below) by supplementing the minimal glucose/CAA medium with
iron, or by growing the strains with minimal medium supplemented with citrate
or glutamate as the sole source of carbon and energy.
Not all nutrients that promote biofilm formation in the wild-type
strain restore the ability of sad mutants to form a biofilm. For example,
malate
and mannitol allow growth and formation of bioflms in the wild type strain to
levels comparable to glutamate- or citrate- grown cells, but do not rescue the
biofilm formation defect of any of the sad mutants.
At this point it is not clear why glutamate and citrate, but not malate
and mannitol, have the ability to rescue the biofilrn formation defect of a
subset
of the sad mutants. P. fluorescens is a plant root colonizer, and it is
possible
that glutamate and/or citrate released by the plants may promote the formation
of biofilms on the plant root. Consistent with this idea, recent studies have
shown that citrate is the major organic acid found in exudates of roots and
seedlings of tomato plants.
CA 02326757 2000-10-25
WO 99/55368 PCT/US99/09034
-24-
Iron was also found to rescue a subset of the biofilm formation
mutants. In these experiments, iron was provided at 3 ~.M, a concentration of
iron not normally seen in natural settings. Providing even 10-fold less iron
in
the medium (0.3 ~M) results in loss of the rescue of the biofilm formation
phenotype.
Rescue of some sad mutants by growth on citrate, glutamate, or in
the presence of exogenous iron indicates that cells can form biofiims on an
abiotic surface in the absence of flagella-mediated motility. As described
below, flagella appear to play an important role in the ability of cells to
form
biofilms. However, in our system, under certain environmental conditions
(i.e.,
cells grown on citrate, glutamate, or in the presence of excess exogenous
iron)
the flagellum appears dispensable for formation of P. fluorescens biofilms on
PVC. It is possible that the cells use an alternative form of locomotion in
the
absence of a flagellum, such as twitching motility, but only do so in response
to
the appropriate environmental signals.
Our biofilm mutants strains contain disruptions in novel genes, genes
involved in flagellar synthesis, and in a gene that shows sequence homology to
the E. coli ClpP protein. This protein is a subunit of the E. coli cytoplasmic
Clp protease (Gottesman, S. arid Maurizi, M.R., 1992, Microbiol. Rev. 56: 592-
621 ). Clp protease is involved in the degradation of misfolded proteins,
RpoS,
10 protein, and Mu vir repressor (Chung, C. H., et al., 1996, Biol. Chem. 377:
549-554; Damerau, K. and St. John, A.C., 1993, J. Bacteriol. 175: 53-63;
Pratt,
L. and Silhavy, T. J., 1996, Proc. Natl. Acad. Sci . USA 93: 2488-2492;
Schweder, T., et al., 1996, J. Bacteriol. 178: 470-476).
Based on its known activities and on our results, it appears that CIpP
is involved in the regulation of biofilm formation. The target proteins) of
CIpP
required for the regulation of biofilm formation (as well as the signaling
CA 02326757 2000-10-25
WO 99!55368 PCT/US99/09034
-25-
pathway regulating Clp protease function) remain to be elucidated.
Interestingly, CIpP does not appear to be required for biofilm formation under
all growth conditions. The clpP mutant was first isolated in a screen for
strains
defective in biofilm formation in minimal glucose/CAA medium. However,
CIpP function can be bypassed by growth on citrate, glutamate, or in the
presence of exogenous iron.
We have found at least three overlapping pathways leading to the
initiation of biofilm formation on an abiotic surface. One pathway
(represented
by 15 mutants) is functional on glucose/CAA medium independent of growth
with citrate, glutamate, or exogenous iron. A second pathway, represented by
sad-19, appears to be utilized by cells grown on minimal glucose/CAA,
minimal glucose/CAA plus iron, and minimal glutamate, however, the defect in
the strain carrying sad-19 can be bypassed by growth on citrate. Twelve
mutants, represented by the strain carrying allele sad 18, are not rescued for
biofilm formation under any condition tested. These mutants may be defective
for functions common to all of the biofilm formation pathways. The extent of
the overlap among these pathways is unclear and will require further analyses.
It is also possible that there are additional, as yet unidentified signals,
which
regulate biofilm formation.
Fig. 8 shows our current genetic model for the initiation of biofilm
formation in P. fluorescens. We propose that multiple pathways can be utilized
to initiate interactions with a surface, and that these pathways can be
regulated
by varying environmental parameters. Environmental signals may include
carbon/energy sources and iron availability. Our genetic analyses indicate
that
there may be functions, such as those disrupted in the strain carrying allele
sad-
18, which are common to all known biofilm formation pathways. All of the
mutants shown here, except for flip, JIaE, sad-16, sad-20, and sad-22 are
CA 02326757 2000-10-25
WO 99/55368 PCTIUS99/09034
-26-
motile. Our genetic analysis has begun to decipher the signaling pathways and
structural genes which play a role in forming biofilms on an abiotic surface.
It
is still unclear which loci are required for sensing and responding to the
signals
required for biofilm formation (CIpP may play a role in this process) and
which
loci participate directly in the cell-to-surface interactions.
Of the 24 P. fluorescens mutants analyzed in this study and shown in
Fig. 8, only 3 of the mutants had defects in genes of known function. These
data suggest that we have isolated a number of new genes. Based on our
molecular analyses of the DNA sequence flanking the transposon insertions, we
know that the mutants are not siblings. However, it is possible that we have
identified multiple mutations within a single gene or operon, a question that
is
currently under investigation.
Biofilm formation i~ E. coli
In addition to using P. , fluorescens as an experimental model, we
have used the well-studied and genetically tractable organism, E. coli, to
rapidly identify genes required for the initial stages of biofilm formation.
As a result of our studies, we have made the surprising discovery
that, under the conditions used in our experiments, chemotaxis is not required
for the initiation of E. coli biofilm formation. In contrast, we conclude that
motility is critical for normal biofilm formation; cells defective in
flagellar
biosynthesis or motility attach poorly to PVC, and the few cells that do
attach
are often located in small, dense clusters. The observation of small cell
clusters
in paralyzed or non-flagellated cell strains suggests that, in addition to
enhancing initial surface contact, motility contributes to the initial spread
of a
biofilm by facilitating movement of cells along an abiotic surface.
CA 02326757 2000-10-25
WO 99/55368 PCTIUS99109034
-27-
Although it is possible that flagella also play a role in mediating
actual adherence to abiotic surfaces, the fact that there is no phenotypic
difference observed in the attachment (at the microscopic level) of paralyzed
cells and non-flagellated cells to surfaces, compared to flagellated cells,
does
not support this hypothesis. Although flagella, motility, and/or chemota.xis
have previously been implicated in biofilm formation in other organisms
(DeFIaun, et al., Appl. Environ. Microbiol. 60:2637-2642, 1994; Graf, et al.,
J.
Bacteriol., 176:6986-6991, 1994; Korber, et al., Appl. Environ, Microbiol.,
60:1421-1429, 1994; Korber et al., Pseudonaonas.fluorescens Microb. Ecol.,
18:1-19. 1989; Lawrence, et al., Microb. Ecol., 14:1-14, 1987; Mills and
Powelson, Bacterial Adhesion:Molecular and Ecological Diversity, John Wiley
& Sons, Inc., New York, Vol. pp. 25-57, 1996), these studies did not provide
molecular characterization of the strains; therefore, the possibility that
these
strains contained pleiotropic defects could not be ruled out.
Moreover, prior to our molecular descriptions of the lesions
conferring biofilm defects, it has been difficult to clearly define potential
roles
(adherence, motility, and/or chemotaxis) for flagella in biofilm development.
For example, one could envision flagella functioning in three non-mutually
exclusive roles: (1) flagellar-mediated chemotaxis might enable planktonic
cells to swim towards nutrients associated with a surface or towards signals
generated by cells attached to an abiotic surface, (2) flagellar-mediated
motility
might be required to overcome repulsive forces at: a surface, enabling
bacteria
to initially reach a surface, and/or (3) flagella might function in a direct
fashion
by physically adhering to an abiotic surface.
Our studies show that, in contrast to flagella, type I pili are essential
for initial attachment of E. coli prior to biofilm formation: cells harboring
lesions in genes encoding proteins involved in the regulation or biogenesis of
CA 02326757 2000-10-25
WO 99/55368 PCT/US99I09034
-28-
type I pili do not efficiently attach to the abiotic surfaces tested. Indeed,
only
rarely do cells lacking type I pili attach. Moreover, cells lacking pili never
form clusters of adhered cells, as do paralyzed and non-flagellated cells that
possess pili. In addition, we discovered that attachment is inhibited by the
presence of mannose or a-methyl-D-mannose. Type I pili contain the
mannose-specific adhesin, FimH, which plays a role in facilitating
pathogenesis
through specific interactions between FimH and mannose oligosaccharides
present on eukaryotic cell surfaces. The observation that FimH is also
critical
for attachment to abiotic surfaces was surprising and leads us to assign a
novel
role to type I pili.
There are two simple models to explain how FimH functions to
attach to abiotic surfaces. First, FimH may play an indirect role, binding to
sugars and/or proteins associated with the abiotic surface. Although this is a
formal possibility, this model would predict that small amounts of mannose
might interact with the surface and function to stimulate attachment. However,
the observation that even the smallest amount of mannose added inhibited
attachment argues against this hypothesis. Alternatively, it is possible that
the
interaction is direct and involves a region of FimH involved in non-specific
binding to abiotic surfaces. If this is the case, then the binding of mannose
to
FimH may somehow alter its conformation, masking the FimH region that
interacts with abiotic surfaces.
The mannose-dependent inhibition of E. coli biofilm formation on
abiotic surfaces may have general applications to other biofilm-forming
bacteria. Bacteria that form biofilms on surfaces in medically and/or
industrially relevant environments may also require the integrity of adhesions
analogous to the requirement of E. coli for FimH. Thus, it is possible that
the
CA 02326757 2000-10-25
WO 99/55368 PCTIUS99/09034
-29-
formation of problematic biofilms could be blocked through treatment with
innocuous materials such as mannose.
The observations described here lead to the following model to
describe the initiation of E. coli biofilm formation. Motility, but not
chemotaxis, enhances cells' initial contact with an abiotic surface. This
requirement may reflect a necessity to overcome repulsive forces present at an
abiotic surface to be colonized. Once a surface is reached, type I pili are
required to achieve stable cell-to-surface attachment. The presence of the
FimH adhesion, when it is not bound to mannose, promotes such stable
adherence to abiotic surfaces. Finally, we hypothesize that motility
facilitates
the development of a mature biofilm by allowing movement along a surface,
thereby promoting spread of the biofilm.
In the work described herein, the alleles isolated affect factors
required for flagellar biogenesis, motility, and the regulation and biogenesis
of
type I pili. It is well established that flagellar-mediated motility and the
ability
to produce a number of pili contribute to the virulence of pathogenic
bacteria.
This leaves us with the suggestive overlap of functions essential for both
biofilm formation and functions needed for pathogenicity. In this regard,
screens such as the one described here may prove useful in the identification
of
gene products important for the pathogenicity of a variety of bacteria. In
addition, the work with E. coli may serve as a paradigm for the study of
bacteria less amenable to genetic and molecular approaches. Although we
predict extensive similarities in the molecular mechanisms utilized by other
biofilm-forming bacteria, distinguishing details will no doubt arise. Such
distinctions should be especially informative as to the particular mechanisms
utilized by bacteria that live in various environmental niches.
CA 02326757 2000-10-25
WO 99/55368 PCTIUS99/09034
-30-
Biof lm formation in P. aeru,~i~a
We have isolated a non-motile strain of P. aeruginosa (containing an
insertion mutation in a flgK homology that is unable to form a biofilm. This
finding shows that flagella, motility, and/or chemotaxis are required for P.
aeruginosa biofilm development. It is noteworthy that the flgK mutant of P.
aeruginosa displays a phenotype that differs from the E. coli flagellar
mutants.
Specifically, the flgK P. aeruginosa strain has only a few cells that attach
to
PVC and no micro-colonies are~formed. This highlights the point that despite a
clear conservation (between E. coli and P. aeruginosa ) in the use of flagella
during biofilm development, the aspects) of flagellar structure and function
utilized appear to be different.
In addition, we have found insertion mutations in genes required for
functional type IV pili, which interfere with normal P. aeruginosa biofilm
formation. P. aeruginosa strains lacking type IV pili form monolayers of cells
attached to PVC, but do not proceed past this stage, i.e., do not form micro-
colonies or multi-layered biofilms.
The above findings suggest that similar surface structures, such as
pili and flagella, are important in both E. coli and P. aeruginosa for normal
biofilm development. However, the precise functions of these structures,
although perhaps overlapping, are not completely conserved between these
species.
screens for compounds that affect biofilm formation
Compounds that modulate biofilm formation have various medical,
industrial, agricultural, and public works uses. For example, compounds that
stimulate biofilm formation could be used to improve colonization of plant
roots by beneficial bacteria. Conversely, compounds that inhibit biofilm
CA 02326757 2000-10-25
WO 99155368 PCT/US99/09034
-31-
formation could be employed to restrict growth of bacteria on contact lenses,
medical implants (e.g., artificial hips), walls of catheters, water and
sewerage
pipes, and within the lungs of infected patients.
The invention provides screens for the isolation of such useful
biofilm-modulating compounds. For instance, the biofilm formation assays
described in Examples I-IV below may be used to measure the effect of test
compounds on biofilm formation, relative to biofilm formation in untreated
control samples. High-throughput screens may also be readily performed.
Furthermore, the effect of test compounds on biofilm formation may
be indirectly assessed by measuring their effect on sad biological activity
(e.g.,
transcription of a sad gene or sad/reporter gene; post-transcriptional
degradation or translation of a sad mRNA or sad/reporter mRNA; or post-.
translational degradation, enzymatic function, or structural function of a sad
polypeptide or sad/reporter polypeptide) in treated vs. untreated samples,
using
enzymatic, ELISA, PCR, and reporter gene assays described herein and/or
known in the art.
The effect of test compounds on biofilm formation may also be
assessed by measuring their influence on pilus or flagellum synthesis,
structure,
or function, e.g., using ELISA, PCR, and reporter gene assays, or the various
motility assays described below, all of which are well known to skilled
artisans.
a) ELISA for the detection of compounds that modulate biofilm formation
Enzyme-linked immunosorbant assays (ELISAs) are easily
incorporated into high-throughput screens designed to test large numbers of
compounds for their ability to modulate levels of a given protein. When used
in
the methods of the invention, changes in the level of a sad protein in a
sample,
CA 02326757 2000-10-25
WO 99/55368 PCTNS99109034
-32-
relative to a control, reflect changes in the biofilm formation status of the
cells
within the sample. Protocols for ELISA may be found, for example, in
Ausubel et al.,Current Protocols in Molecular Biology, John Wiley & Sons,
New York, NY, 1997. Samples, such as lysates from bacterial cells treated
with potential biofilm formation modulators, are prepared (see, for example,
Ausubel et al., supra), and are loaded onto the wells of microtiter plates
coated
with "capture" antibodies against one of the sad proteins. Unbound antigen is
washed out, and a sad protein-specific antibody, coupled to an agent to allow
for detection, is added. Agents allowing detection include alkaline
phosphatase
(which can be detected following addition of colorimetric substrates such as p-
nitrophenolphosphate), horseradish peroxidase (which can be detected by
chemiluminescent substrates such as ECL, commercially available from
Amersham, Malvern, PA) or fluorescent compounds, such as FITC (which can
be detected by fluorescence polarization or time-resolved fluorescence). The
amount of antibody binding, and hence the level of a sad protein within a
lysate
sample, is easily quantitated on a microtiter plate reader.
As a baseline control for sad protein levels in untreated cells, a
sample from untreated cells is included. Ribosonal proteins may be used as
internal standards for absolute protein levels, since their levels do not
change
over the preferred timecourse (e.g., 0 to 10 hours for a standard biofilm
assay,
or 0 to 30 minutes for a rapid biofilm assay, as described in the examples
below). Alternatively, bacteria or bacterial cell lysate may be directly
exposed
to a compound in the absence of biofilm assay canditions. A positive assay
result, for example, identification of a compound that decreases biofilm
formation, is indicated by a decrease in sad protein levels, relative to sad
protein levels observed in untreated cells that are allowed to form a biofilm.
CA 02326757 2000-10-25
WO 99/55368 PC"T/US99/09034
-33-
Conversely, an increase in sad protein levels, relative to sad protein levels
in
untreated cells, indicates a compound that increases biofilm formation.
b) Reporter gene assays for compounds that modulate biofilm formation
Assays employing the detection of reporter gene products are
extremely sensitive and readily amenable to automation, hence making them
ideal for the design of high-throughput screens. Assays for reporter genes may
employ, for example, colorimetric, chemiluminescent, or fluorometric detection
of reporter gene products. Many varieties of plasmid and viral vectors
containing reporter gene cassettes are easily obtained. Such vectors contain
cassettes encoding reporter genes such as lacZ/~i-galactosidase, green
fluorescent protein, and luciferase, among others,. We have constructed
strains
containing sad mutations described herein with lacZ fusions that may be used
in such screens. Cloned DNA fragments encoding transcriptional control
regions of interest are easily inserted, by DNA subcloning, into such reporter
vectors, thereby placing a vector-encoded reporter gene under the
transcriptional control of any gene promoter of interest. The transcriptional
activity of a sad gene promoter operably linked to a reporter gene can then be
directly observed and quantitated as a function of reporter gene activity in a
reporter gene assay.
Bacteria containing one or more sad/reporter gene constructs are
cultured under the appropriate conditions, e.g., under conditions that promote
biofilm formation in a screen for a compound that inhibits biofilm formation.
Alternatively, bacteria or bacterial cell lysates may be directly exposed to a
compound in the absence of biofilm assay conditions. Compounds to be tested
for their effect on biofilm formation are added to the bacteria. At
appropriate
timepoints, bacteria are lysed and subjected to the appropriate reporter
assays,
CA 02326757 2000-10-25
WO 99/55368 PCTIUS99109034
-34-
for example, a coiorimetric or chemiluminescent enzymatic assay for lacZ/~i-
galactosidase activity, or fluorescent detection of GFP. Changes in reporter
gene activity of samples treated with test compounds, relative to reporter
gene
activity of appropriate untreated control samples indicate the presence of a
compound that modulates biofilm formation.
In one embodiment, one construct could comprise a reporter gene
such as lacZ or chloramphenicol acetyltransferase (CAT), operatively linked to
a promoter from a sad gene. Sad/reporter gene constructs may be present
within the genomic DNA of a bacterial cell to be tested, or may be present as
an episomal DNA molecule, such as a plasmid. A second reporter gene
operably linked to a second promoter is included as an internal control. This
could be an episomal reporter gene operatively linked, for example, to a
glucose phosphotransferase or phosphofructokinase gene. The glucose
phosphotransferase or phosphofructokinase gene is expressed in bacteria
growing on glucose. The amount of activity resulting from an internal control
reporter gene that is operably linked to a glucose kinase (or analogous)
promoter will indicate the proportion of live growing cells within a treated
sample, relative to an untreated sample. The sad reporter gene activity is
normalized to the internal control reporter gene activity. As a result of the
normalization, a relative decrease in sad promoter activity indicates a
compound that modulates biofilm formation by down-regulating sad gene
transcription (rather than, e.g., a compound that inhibits cell growth or
kills
cells, thus giving the ~pnearance of decreased sad gene transcription).
CA 02326757 2000-10-25
WO 99/55368 PCT/US99/09034
-35-
c) Quantitative PCR of sad mRNA as an assay for compounds that modulate
biofilm formation
The polymerise chain reaction (PCR), when coupled to a preceding
reverse transcription step (rtPCR), is a commonly used method for detecting
vanishingly small quantities of a target mRNA. When performed within the
linear range, with an appropriate internal control target (employing, for
example, a housekeeping gene such as the glucose phosphotransferase or
phosphofructokinase), such quantitative PCR provides an extremely precise
and sensitive means for detecting slight modulations in mRNA levels.
Moreover, this assay is easily performed in a 96-well format, and hence is
easily incorporated into a high-throughput screening assay. Bacterial cells
are
cultured under the appropriate biofilm-inducing or -inhibiting conditions, in
the
presence or absence of test compounds. The cells are then lysed, the mRNA is
reverse-transcribed, and the PCR is performed according to commonly used
methods (such as those described in Ausubel et al., Current Protocols in
Molecular Biology, John Wiley & Sons, New York, NY, 1997), using
oligonucleotide primers that specifically hybridize with the nucleic acid of
interest. In one embodiment, the target mRNA could be that of one or more of
the sad genes. Analogously to the sad protein result described above, changes
in product levels of samples exposed to test compounds, relative to control
samples, indicate test compounds with biofilm formation-modulating activity.
d) Test Compounds
In general, novel compounds for modulating biofilm formation are
identified from large libraries of both natural product or synthetic (or semi-
synthetic) extracts or chemical libraries according to methods known in the
art.
Those skilled in the field of chemical discovery and development will
CA 02326757 2000-10-25
WO 99/55368 PCT/US99/09034
-36-
understand that the precise source of test extracts or compounds is not
critical
to the screening procedures) of the invention. Accordingly, virtually any
number of chemical extracts or compounds can be screened using the
exemplary methods described herein. Examples of such extracts or compounds
include, but are not limited to, plant-, fungal-, prokaryotic- or animal-based
extracts, fermentation broths, and synthetic compounds, as well as
modification
of existing compounds. Numerous methods are also available for generating
random or directed synthesis (e.g., semi-synthesis or total synthesis) of any
number of chemical compounds, including, but not limited to, saccharide-,
lipid-, peptide-, and nucleic acid-based compounds. Synthetic compound
libraries are commercially available from Brandon Associates (Merrimack,
NH) and Aldrich Chemical (Milwaukee, WI). Alternatively, libraries of natural
compounds in the form of bacterial, fungal, plant, and animal extracts are
commercially available from a number of sources, including Biotics (Sussex,
UK), Xenova (Slough, UK), Harbor Branch Oceangraphics Institute (Ft. Pierce,
FL), and PharmaMar, U.S.A. (Cambridge, MA). In addition, natural and
synthetically produced libraries are produced, if <iesired, according to
methods
known in the art, e.g., by standard extraction and fractionation methods.
Furthermore, if desired, any library or compound is readily modified using
standard chemical, physical, or biochemical methods.
In addition, those skilled in the art of chemical discovery and
development readily understand that methods for dereplication (e.g., taxonomic
dereplication, biological dereplication, and chemical dereplication, or any
combination thereof) or the elimination of replicates or repeats of materials
already known for their effects on biofilm formation should be employed
whenever possible.
CA 02326757 2000-10-25
WO 99/55368 PCT/US99/09034
-37-
When a crude extract is found to modulate biofilm formation, further
fractionation of the positive lead extract is necessary to isolate chemical
constituents responsible for the observed effect. Thus, the goal of the
extraction, fractionation, and purification process is the careful
characterization
and identification of a chemical entity within the crude extract having an
effect
on biofilm formation. The same assays described herein for the detection of
activities in mixtures of compounds can be used to purify the active component
and to test derivatives thereof. Methods of fractionation and purification of
such heterogenous extracts are known in the art. If desired, compounds shown
to be useful agents for treatment are chemically modified according to methods
known in the art. Compounds identified as being of medical or industrial value
may be subsequently analyzed using the appropriate biofilm formation model.
Below are examples of high-throughput systems useful for
evaluating the efficacy of a molecule or compound in stimulating or inhibiting
I S biofilm formation.
e) Uses
Compounds identified using any of the methods disclosed herein
may be administered to patients or experimental animals, applied to the fluid-
contacting surfaces of medical devices, such as catheter lines, contact
lenses,
and surgical implants, applied to the fluid-contacting surfaces of industrial
devices, such as pipes, or applied to soil, seeds, or plant roots by methods
known in the various medical, manufacturing, and agricultural arts. Moreover,
fluid-contacting surfaces may be impregnated with the compounds of the
invention.
CA 02326757 2000-10-25
WO 99/55358 PCT/US99/09034
-38-
The following examples are meant to illustrate, not limit, the
invention.
Example I: General Methods
Bacterial strains, media, and chemicals.
All P. fluorescens strains and plasmids used in the experiments
described in Example II below are shown in Table 1. P. fluorescens strain
WCS365 and P. aeruginosa strain PA14 were grown at 30°C and
37°C,
respectively, on rich medium (Luria Bertani; LB) or minimal medium, unless
otherwise noted. The minimal medium used was M63 (Pardee, A.B., et al.,
1959, J. Mol. Biol. 1: 165-178) supplemented with glucose (0.2%), MgS04 (1
mM) and, where indicated, casamino acids (CAA, 0.5%), citric acid (0.4%),
glutamic acid (monosodium salt, 0.4%) or FeSo4~7Hz0 (3 ~,M). Unless
otherwise indicated, all carbon sources were provided at 0.4%.
For the experiments described in Example III, W3110 (E. coli K12
F-1- IN(rrnD-rrnE) 1 rph-1 ) was used as the parental strain; all strains
described
in Example III are either W3110 or derivatives of this strain. The media and
growth conditions used have been previously described (Pardee, A.B. et al.,
supra; Silhavy, T. et al., Experiments with gene f csions, Cold Spring Harbor
Laboratory, Cold Spring Harbor, NY, 1984), and casamino acids were added at
a concentration of 0.5%.
Whenever antibiotics were used, they were added at the following
concentrations: E. coli : ampicillin (Ap), 1 SO n.g/ml; naladixic acid (Nal),
20
~g/ml; tetracycline (Tc), 15 ~Cg/ml; kanamycin (Kn), 50 ~g/ml; P. fluorescens:
Tc, 150 p,g/ml; gentamycin (Gm), 100 n.g/ml; Kn, 500 ~g/ml; P. aeruginosa:
Tc, 150 ~g/ml. Pronase E was obtained from Sigma Chemical Co. (St. Louis,
MO).
CA 02326757 2000-10-25
WO 99155368 PCT/US99/09034
-3 9-
Tabte 1. Strains and Plasmids
Strain (Relevant genotype) Reference
Pseudornonas fluorescens strain (Geels and Schippers, Phytopathol.
WCS365 Z.,
108:207-214, 1983); Simons,
et al., Mol.
Plant Microbe Inter., 9:600-607,
1996)
P. fluorescens clpP::TnS-B30(Tcr)This study
P. fluorescens fliP::TnS-B30(Tcr)This shzdy
P. Jluorescens JIaE::TnS-B30(Tcr)This study
P. fluorescens sad-lO::TnS-B30(Tcr)This study
1~ P. fluorescens sad-l6::Tn5-B30(Tcr)This study
P. fluorescens sad-lB::TnS-B30(Tc~This study
P. fluorescens sad-19::Tn5-B30(Tcr)'This study
P. fluorescens sad-20::Tn5-B30(Tcr)This study
P..Jluorescens sad-2l::TnS-B30(Tcr)This study
1$ P. fluorescens sad-22::Tn5-B30(Tc~This study
ZK126 (clpP+, E. coli W3110) (Connell, et al., Mol. Microbiol.,
1:195-204,
1987)
Pla i s
pTnS-B22 (Gmr, 'lac2) (Simon, et al., Gene, 80:160-169, 1989)
pTnS-B30 (Tcr) (Simon, et ai., Gene, 80:160-169, 1989)
pUC181.8 (Apr) (Frank., et al., J. Bacteriol., 1781:5304-5313,
1989)
pSU39 (Knr) (Martinez, et al., Gene, 68:159-162, 1988)
pSMC26 (clpP+, Knr, derivative of pSMC28) This study
ZS pSMC28 (derivative of pSU39, Knr,
stably maintained in Pseudomonas spp.) . This study
CA 02326757 2000-10-25
WO 99/55368 PCT/US99/09034
-40-
Molecular and genetic techniques.
All plasmids were constructed in E. coli JM109 using standard
protocols (Ausubel, F.A. et al., 1990; Current Protocols in Molecular Biology,
Wiley Interscience, NY) then transferred to the appropriate strains by
electroporation (Bloemberg, G.V. et al., 1997, Appl. Environ. Microbiol., 63,
4543-4551)).
al Transduction and transposon mutagenesis
Generalized transduction in E. coli using Plvir was performed as
previously described (Silhavy, et al., supra). Genetic linkage analysis in E.
coli
was performed by using a P 1 vir lysate that had been grown on a pool of cells
containing transposons randomly inserted throughout the chromosome
(Kleckner, N., et a1.,1991, Methods in Enzymology, 204, 139-180).
Transductions into P. aeruginosa were performed as reported (Jensen, E.C. et
al., 1998, Appl. Environ. Microbiol., 64, 575-580}.
Transposon mutants in P. fluorescens were generated using a
modification of published protocols (Simons, M., et al., 1996, Mol. Plant
Microbe Inter. 9: 600-607). Recipient (P. fluorescens) and donor (E. coli S 17-
l/pTnS::B30(Tc) or E. coli S17-1/pTn5::B322(Gm)) were grown in LB to late
log phase (A600 = 0.6-0.8). After incubating P. fluorescens at 42oC for 15
min, 1 mL of the recipient was added to 0.25 mL of the donor in a I .5 mL
Eppendorf tube. The cells were pelleted in a microfuge, the medium decanted,
and the cells resuspended in 50 ~,L of LB, and the entire 50 pL was spotted on
an LB plate and incubated at 30oC for 24-48 hrs. After incubation, the cells
were scraped from the LB plate and resuspended in 1 mL LB and 250 ~,L was
subsequently plated on LB plates supplemented with Tc or Gm (to select for
the Tn5 mutants) and Nal (to select against growth of the E. coli donor). The
CA 02326757 2000-10-25
WO 99155368 PCTNS99/09034
-41-
resulting transposon mutants were screened for biofilm formation as described
below.
Transposon mutants in P. aeruginosa were generated with
Tn5-B30(Tcr) using a modification of published protocols (Simon, 8.,1989,
Gene, 80, 160-169) The resulting transposon mutants were screened for
biofilm formation as described below.
b) PCR
The DNA sequence flanking transposon mutants was determined
using arbitrary PCR (Caetano-Annoles, G., 1993, PCR Methods Appl. 3: 85-
92). In this technique, the DNA flanking insertion sites is enriched in two
rounds of amplification using primers specific to the ends of the Tn5 element
and primers to random sequence that anneal to chromosomal sequences
flanking the transposon.
PCR of P. fluorescens and P. aeruginosa transposon mutant DNA
In the first round, a primer unique to the right end of Tn5 elements
(TnSExt, 5'-GAACGTTACCATGTTAGGAGGTC-3'; SEQ ID NO: 25) and
arbitrary primer # 1 (ARB 1, 5'-
GGCCACGCGTCGACTAGTAC GATAT-3'; SEQ ID NO:
26) were used in 100 uL PCR reactions (1X Vent Polymerase buffer, MgS04
(1mM), dNTPs (0.25 mM), and Vent, exo-DNA polymerase (2 U) with 5 mL
of an overnight LB-grown culture as the source of DNA. The first round
reaction conditions were: i), 5 min. at 95oC ii) 6X {30 sec at 95~C, 30 sec at
30oC, 1 min 30 sec at 72oC), iii) 30X (30 sec at 95~C, 30 sec at 45oC, 2 min
at
72~C).
CA 02326757 2000-10-25
WO 99/55368 PCT/US99/09034
-42-
Reactions for the second round of PCR were performed as described
for the first round, except S ~,L of the first round PCR product was used as
the
source of DNA and the primers were ARB2 (S'-
GGCCACGCGTCGACTAGTAC-3'; SEQ ID NO: 27) and TnSInt (5'-
S CGGGAAAGGTTCCGTTCAGGACGC-3'; SEQ ID NO: 28). The ARB2
sequence is identical to the 5'-end of the ARB 1 primer and the sequence of
TnSInt is identical to the right-most end of TnS, near the junction between
the
transposon and the chromosome. The reaction conditions for the second round
were 30X (30 sec at 95oC, 30 sec at 45oC, 2 min at 72oC).
PCR products were purified either from an agarose gel using (3-
agarase (NEB, Beverly, MA) or with the QIAquick Spin PCR Purification Kit
(Qiagen Inc, Chatsworth, CA) as described by the manufacturer without
modification. PCR products were sequenced using the TnSInt primer at the
Micro Core Facility, Department of Microbiology and Molecular Genetics,
1 S Harvard Medical School and compared to the Genbank DNA sequence
database using the BLASTX program (Altschul, S.F., et al., 1990. J. Mol. Biol.
215: 403-410).
~'CR of E. toll transposon mutant DNA
The first round of PCR reactions used the following primers: ARB 1
(GGCCACGCGTCGACTAGTAC GATAT; SEQ ID NO: 2G)
or ARBG (GGCCACGCGTCGACTAGTAC ACGCC; SEQ
ID NO: 29) and OUT1-L (CAGGCTCTCCCGTGGAG; SEQ ID NO: 30). The
second round of PCR reactions used the following primers: ARB2
(GGCCACGCGTCGACTAGTAC; SEQ ID NO: 27) and PRIMER1L
(CTGCCTCCCAGAGCCTG; SEQ ID NO: 31 ).
CA 02326757 2000-10-25
WO 99/55368 PCT/US99109034
-43-
Following the second round of PCR amplification, PCR products were
separated a 1.0% low melt agarose gels, and bands were excised from the gel.
The agarose was digested with ~i-agarase, and the DNA was subjected to DNA
sequence analysis utilizing PRIMER1L. Sequence analysis was carried out at
S the Biopolymers Laboratory of the Department of Biological Chemistry and
Molecular Pharmacology of Harvard Medical School.
cl Southern blots
Southern blots were performed as follows: chromosomal DNA of the
sad mutants was prepared (Pitcher, D.G., 1989, Lett. Appl. Microbiol., 8,
1S1-1SG.), digested with EcoRI (TnS-B30 does not have a EcoRI site), and
transferred to GeneScreen Plus (NEN Research Products, Boston, MA) as
reported (Ausubel, F.A. et al., 1990, Current Protocols in Molecular Biology.
Wiley Interscience, NY). The hybridization was performed with the ECL
direct nucleic acid labeling and detection system (Amersham Life Science,
Buckinghamshire, England) following the manufacturer's instructions without
modification. The DNA probe used was derived from the insertion sequence
element (ISSO) of TnS and generated using PCR with the Tn5 element as a
template. The PCR primers used to generate the probe were ISSOR.1
(S'-GCTTCCTTTAGCAGCCCTTGCGC-3'; SEQ ID NO: 32) and ISSOR.2
(S'-CTTCCATGTGACCTCCTAACATGG-3'; SF;Q ID NO: 33).
d} Cloning of integrated trans op sons
Selected transposons were cloned to determine additional DNA
sequence flanking the transposon. Chromosomal DNA was prepared (Pitcher,
D.G., et a1.,1989. Lett. Appl. Microbiol, 8: 1 S 1-1 S6), digested with EcoRI
2S {there are no EcoRI sites in these TnS derivatives), and ligated with
CA 02326757 2000-10-25
WO 99/55368 PCT/US99/09034
-44-
pBluescript, KS+, Apr (Stratagene, La Jolla, CA) previously digested with
EcoRI. Ligation mixes were electroporated into E. toll JM109, plated on LB
supplemented with Ap, then printed onto LB supplemented with Ap { 150
~,g/ml) and Tc ( 10 ~.g/ml). The Api'Tcr colonies were purified, plasmid DNA
prepared, and the plasmids were sequenced with the TnSExt primer.
el~ Construction of the clpP-carr~i_ng lap smid
A derivative of pSU39 (Martinez, E., et al., 1988, Gene 68: 159-
162) was constructed that is stably maintained in Pseudomonas spp. The 1.8
kb PstI "stabilizing fragment" of pUC 181.8 (Frank, D.W., 1989, J. Bacteriol.
171: 5304-5313) was cloned into the PstI site of pSU39, generating the plasmid
pSMC28. The stabilizing fragment allows the stable replication of plasmids in
Pseudomonas spp. To generate the plasmid required for complementation
analysis, the clpP gene of E. toll (ZK126 W3110) was amplified with primers
flanking clpP and also including the predicted promoter region of this gene.
1 S The PCR product was cloned into pSMC28, previously digested with HincII,
generating plasmid pSMC26 (clpP+).
Motility Assays.
Following strain construction involving alleles that affect flagella,
motility, and/or chemotaxis, the presence (or absence) of flagella was
confirmed using a simple staining procedure that has been previously described
{Heimbrook, et a1.,1989, J. Clin. Microbiol., 27, 2612-2615). Motility and
chemotaxis were analyzed using both swarm assays (Adler, J.,1966, Science,
153, 708-716.; Wolfe, A.J. and Berg, H.C.,1989, Proc. Natl. Acad. Sci. USA,
86, 6973-6977) and phase contrast microscopy of living cells. 1NK1324 was
used for insertion mutagenesis of W3110 as previously described (Kleckner, et
CA 02326757 2000-10-25
WO 99/55368 PCT/US99/09034
-45-
al., supra). Motility assays were performed on minimal agar plates (0.3%)
supplemented with glucose and CAA and the distance that the cells migrated
through the agar was determined after 16-24 hrs. Twitching motility was
assessed as described (Whitchurch, C.B. et al., 1990, Gene, 101, 33-44).
Biofilm formation assay.
Our standard biofilm formation assay involves starting with
relatively low number of cells 0106 CFU/ml) in minimal M63 medium
supplemented with glucose and casamino acids (C',AA) at 25°C to
37°C for $ to
48 hours. Biofilm development can be monitored indirectly by following the
increase in crystal violet (CV) staining over time; this purple dye stains the
bacterial cells, but does not stain plastics such as polyvinylchloride (PVC).
Alternatively, biofilm formation can be monitored with a rapid assay by
starting with ~10g CFU/ml. In this way, biofilm formation can be detected
after just 30 min. Using these assays, we tested the impact of various growth
conditions and environmental signals on biofilm formation and searched for
mutants defective in this process.
al Screen for mutants defective in biofilm formation
This assay is based on the ability of bacteria to form biofilms on
polyvinylchloride plastic (PVC), a material which is used to make catheter
lines
(Lopez-Lopez, G., et al., 1991, J. Med. Microbiol. 34: 349-353). Biofilm
formation was assayed by the ability of cells to adhere to the wells of 96-
well
microtiter dishes made of PVC (Falcon 3911 Microtest III Flexible Assay Plate,
Becton Dickinson Labware, Oxnard, CA) using a modification of a reported
protocol (Fletcher, M., 1977, Can. J. Microbiol. 23: 1-6). The indicated
medium ( 100 ~.L/well) was inoculated either from cells patched on LB agar
CA 02326757 2000-10-25
WO 99155368 PCTIUS99/09034
-46-
plates using a multi-prong device or a 1:100 dilution from an overnight LB
culture. After inoculation, plates were incubated at 25 °C to
37°C for 8-48
hours for P. fluorescens and P. aerugitiosa or 10-24 hours for E. coli, then
25
~.L of a 1 % solution of CV was added to each well (this dye stains the cells,
but
not the PVC), the plates were incubated at room temperature for ~15 min,
rinsed thoroughly and repeatedly with water, and scored for the formation of a
biofilm. Fig. 1 shows the formation of the biofilm at the air-medium
interface,
monitored over a 10 hr period. Because of the growth conditions used in this
assay (oxygen is the primary electron acceptor) P. fluorescerzs grows
predominantly near the surface of medium in the microtiter wells. Crystal-
violet-stained, surface-attached cells were quantified try solubilizing the
dye in
ethanol and determining the absorbance at 600 nm. The A(00 values increased
with time up to about 8-10 hours of incubation. Wells developed at 0 and 10
hours are shown above the graph in Fig. 1.
b,~_R.anid biofilm formation assay
To assess the formation of biofilms after 30 min instead of 10 hrs, P.
fluorescens was grown overnight under conditions that only weakly stimulate
biofilm formation (minimal glucose medium) resulting in a viable count of
108 colony forming units (CFU)/ml. The planktonic cells were centrifuged,
and resuspended in an equal volume of fresh minimal medium supplemented
with glucose and CAA (conditions that stimulate biofilm formation) and
assessed for biofilm formation using the CV-based assay described above. This
method was used to assess the effects of the protein synthesis inhibitor Tc
and
protease treatment on biofilm formation.
CA 02326757 2000-10-25
WO 99/55368 PCT/US99/09034
-47-
c~0uantitation of biofilm formation
Biofilm formation was quantified by the addition of 2 X 200 ~uL of
95% ethanol to each CV-stained microtiter dish well, the ethanol was
transferred to a 1.5 ml Eppendorf tube, the volume brought to 1 mL with dH20,
and the absorbance determined at 540 nm in a spectrophotometer (DU-640
Spectrophotometer, Beckman Instruments Inc., Fullerton, CA). Alternatively,
CV-stained biofilms were solubiiized in 200 ~,L of 95% ethanol, of which 125
~L was transferred to a new polystyrene microtiter dish (Costar Corporation,
Cambridge, MA), and the absorbance determined with a plate reader at 600 nm
(Series 700, Microplate Reader, Cambridge Technology, Inc., Cambridge,
MA). We also used these methods to quantify biofilm formation on
polystyrene (Pro-bind Assay Plate, non-tissue culture treated, Becton Dickson
& Co., Lincoln Park, NJ), polypropylene ( 1.5 mL microcentrifuge tube, Marsh
Biomedical Products, Inc., Rochester, NY), and borosilicate glass (Kimax 51
culture tubes, VWR, S. Plainfield, NJ).
dO Microsco~v
The visualization of P. fluorescens cells attached to PVC was
performed as reported (Blaemberg, G.V., et al., 1997, Microbiol. 63: 4543-
4551). Visualization of P. aeruginosa cells attached to PVC was performed by
phase contrast microscopy (400X magnification) using a Nikon Diaphot 200
inverted microscope (Nikon Corp., Tokyo, Japan). The images were captured
with a black and white CCD72 camera integrated with a Power Macintosh
8600/300 computer with video capability (Macintosh, Cupertino, CA). The
images were processed with Scion Image software, a modification of NIH
Image (NIH, Washington, DC) by the Scion Corporation (Frederick, MD).
CA 02326757 2000-10-25
WO 99/55368 PCT/US99/09034
-48-
e~Quantification of CV-stained attached P. aeruginosa cells and growth curves
Attached cells were quantified as described previously, with a few
modifications (Genevaux, et al., 1996, FEMS Microbiol. Lett., 142, 27-30;
O'Toole, G.A. and Kolter, R., 1998, Mol. Microbiol., 28:449-461 ). After wells
S had been stained with 125 ml of 1.0% CV, rinsed, and thoroughly dried, the
CV
was solubilized by the addition of 200 ,uL ethanol:acetone (80:20); or 95%
ethanol (with no acetone). 80 ,uL of the solubilized CV was removed and
added to a fresh polystyrene, 96-well dish, and ODGOO or ODs,o was determined
using either a Series 700, Microplate Reader from Cambridge Technology, Inc.
or an MR 700 Microplate Reader from Dynatech Laboratories, Inc.
Growth curves were determined by subculturing ( 1:100) the relevant
strain into the appropriate medium and growing the culture at room temperature
without shaking. OD~oo readings were taken over time with a spectronic 20D+
from Spectronic Instruments, Inc.
Example II: Identification of muttations that affect biofilm formation in
Pseudomonas~luorescens
Protein synthesis is required for biafilm formation.
There are marked differences in the profile of proteins synthesized
by biofilm-grown cells versus planktonic cells. We hypothesized that P.
fluorescens synthesizes proteins required to form biofilms in response to
appropriate signals. One of the predictions of such a model is that protein
synthesis inhibitors should block biofilm formation in an environment that
would otherwise promote this process. To test this prediction, cells were
incubated in the presence or absence of the protein synthesis inhibitor
tetracycline (Tc, 150 ~.g/ml) in microtiter wells for 30 minutes, after which
the
CA 02326757 2000-10-25
WO 99/553b8 PC"fIUS99/09034
-49-
wells were developed with CV to assess biofilm formation using the rapid
biofilm formation assay described above. As shown in Fig. 2, after 30 min,
biofilm formation is strongly inhibited in the presence of 150 ~g/ml Tc,
compared to the untreated control (the extent of biofilm formation is
expressed
as the absorbance at 540 nm). This concentration of Tc does not reduce the
numbers of viable planktonic cells (Tc-treated cultures, 1.0 x 108 CFU/ml;
untreated control, 1.2 x 108 CFUImI). This result indicates that new protein
synthesis is required for P. fluorescens to form biofilms on an abiotic
surface.
In contrast to the observation described above, continued protein
synthesis is not required after the initial events of biofilm formation. Cells
were first allowed to incubate in the microtiter wells for 30 minutes to form
biofilms and then treated with Tc. After incubation for an additional 30
minutes in the presence of Tc, the microtiter dish wells were developed with
CV to assess the extent of biofilm formation. There was no difference in
biofilms (Fig. 2} or viable cell counts (not shown) between Tc-treated cells
and
untreated control cells.
These data suggest that the earliest events of biofilm development
can be divided into two stages. The first stage, initial interaction with the
abiotic surface, requires new protein synthesis. I-lowever, the subsequent
stage
(short-term maintenance of the attached cells) does not require synthesis of
new
proteins.
Extra-cytoplasmic proteins participate in biofilm formation.
Extra-cytoplasmic proteins, specifically those proteins on the surface
of the bacterial cell, are thought to be important fbr bacterial attachment to
abiotic substrates. To address the importance of such proteins in our biofilm
system, we determined the effect of treatment with a protease, Pronase E
CA 02326757 2000-10-25
WO 99155368 PCT/US99109034
-50-
(added upon inoculation of the cells into microtiter wells) on the formation
of
biofilms, using the rapid attachment assay. The number of attached cells was
markedly decreased in the wells treated with Pronase E (~S-10-fold) compared
to untreated control wells. In contrast, the counts of viable planktonic cells
were similar under both conditions (average viable counts for untreated
samples, 1.5 x 10g CFU/ml and Pronase E treated samples, 2.4 x 10g CFU/ml),
indicating that treatment with protease did not decrease the number of viable
cells. This result indicates that at least one extra-cytoplasmic protein is
necessary for adherence to PVC.
Environmental factors affect biofilm formation.
Because the nutritional content of the medium can regulate biofilm
development, we tested various nutrients for their effects on the ability of
P.
fluorescens to form biofilms on PVC. The following additions to minimal
M63-based media promoted the formation of biofilms: 0.2% glucose, 0.2%
glucose + 0.5% CAA, 0.2% glucose + 3 pM FeS04, 0.5 % CAA, 0.4%
glutamate, 0.4% citrate, 0.4% malate, 0.4% mannitol, 0.4% xylose, and 0.4%
glycerol. Although glucose alone does promote biofilm formation, the addition
of iron or CAA stimulates biofilm formation by ~2- to 3-fold over glucose
alone.
We assessed the effect of changes in osmolarity on the ability of P.
fluorescens to form biofilms on PVC, using two osmolytes, NaCI and sucrose.
The NaCl concentration was varied from 0 to 0.4 M in minimal medium
supplemented with glucose and CAA. The growth of this strain was unaffected
across this range of NaCI concentrations. However, at concentrations of NaCI
at or above 0.2 M, biofilm formation was decreased by up to 4-fold, as assayed
by CV staining. Cells grown in minimal medium as above, but supplemented
CA 02326757 2000-10-25
WO 99/55368 PCTIUS99109034
-51-
with 0 to 20% sucrose, also grew to equal final optical densities. At sucrose
concentrations of 15% or 20%, however, biofilm formation decreased by
greater than 4-fold when compared to control cultures lacking sucrose. It is
important to note that the osmolarity of the medium used in these experiments
S with 0.2 M NaCI is approximately equal to medium supplemented with 15%
00.44 M) sucrose. Taken together, these data strongly suggest that growth in
high osmolarity (and not simply ionic strength) inhibits biofilm formation by
P.
fluorescens on PVC. Variations in the starting pH (from 5.0 to 8.5) of the
growth medium had no effect on biofilm formation after incubation for 10 hrs
under standard assay conditions.
The results presented above show that environmental conditions and
the nutritional status of the medium can influence biofilm formation.
Furthermore, as demonstrated by the experiments in which osmolarity was
varied, there are environmental conditions that promote cell growth, but do
not
promote significant biofilm formation.
Isolation of mutants defective in 6iofilm formation.
To isolate strains defective in biofilm formation on an abiotic
surface, Tn5-based transposons that confer Tcr or Gmr (Simon, R., et al.,
1989,
Gene 80: 160-169) were used to mutagenize P. fluorescens. Of the 14,000
transposon mutants screened, 37 mutants (0.3%) were unable to form a biofilm
(Fig. 3; assay was developed after a 10 hour incubation) and had a growth rate
indistinguishable from the wild-type strain in liquid medium. These mutants
were designated surface attachment defective (sad). Twenty-eight of these
mutants (23 motile and 5 non-motile) were analyzed further. Fig. 4A shows the
quantitation of the biofilm formed by representative sad mutants on PVC. As
described below, various growth conditions rescue the biofilm formation defect
CA 02326757 2000-10-25
WO 99/55368 PCT/US99109034
-52-
of some of the sad mutants. The subset of mutants presented in Fig. 4A-4D
and in Table 2 was chosen to represent each of the phenotypic classes defined
by the nutritional rescue experiments described below.
The biofilm formation screen described above was performed using
microtiter dishes composed of PVC. However, it is clear that bacteria form
biofilms on a wide range of abiotic surfaces. We tested the ability of wild
type
bacteria and selected mutants to form biofilms on relatively hydrophobic
surfaces (PVC, polycarbonate, and polypropylene) and on a relatively
hydrophilic surface (borosilicate glass). Wild type: and mutant strains were
allowed to form biofilms on these surfaces over a ten hour incubation period,
then stained with CV and quantitated (Fig. 4A-4D). In general, mutants that
were unable to form biofilms on PVC also were unable to form biofilms on the
other surfaces tested, suggesting that a common genetic pathway is used to
form biofilms on a range of abiotic surfaces. However, the strain carrying the
1 S sad-10 allele is notable in that it has a biofilm formation defect on
hydrophobic
surfaces (PVC, polycarbonate, and polypropylene), but its biofilm formation
phenotype on a hydrophilic surface (borosilicate glass) is indistinguishable
from that of the wild type. In addition, the sad-13 (flip) mutant displayed a
defect in biofilm formation on PVC, although this defect was less apparent on
the other surfaces, especially polystyrene. In addition,
the colony morphology of wild type bacteria vs. sad mutants was
indistinguishable on LB medium.
Phenotypes of surface attachment defective mutants.
In order to further classify the sad mutants, they were assessed for
the following phenotypes: growth in liquid medium, colony morphology,
motility, fluorescent pigment production, biofilm formation under various
CA 02326757 2000-10-25
WO 99/55368 PCTIUS99/09034
-53-
environmental conditions, and determination of their molecular defects. The
results of the phenotypic (and molecular) analyses of a representative subset
of
the sad mutants is summarized in Table 2.
The growth rate of all of the sad mutants in minimal medium
supplemented with glucose and CAA (standard assay conditions) was identical
to the wild type. None of the mutants were auxotrophs as judged by growth on
minimal medium supplemented only with glucose. All mutants were also
tested for their growth rate on minimal glucose/CA.A + 3 ~.M FeS04, minimal
medium + citrate (0.4%), and minimal medium + glutamate (0.4%). Only
those mutants whose growth rates were indistinguishable from the wild type
growth rate under all growth conditions were analyzed further.
Motility is required for biofilm formatian on biotic and abiotic
surfaces. As expected, some of the mutants isolated were non-motile (Table 2,
column 2). However, most of the strains were as motile as the wild type, yet
had severe defects in the initiation of biofilm formation.
Many bacteria, including P. fluorescens, synthesize siderophores,
phenazines, and other pigments. One of the sad mutants (sad-21) did not
produce this strain's characteristic yellow-green pil,~nent.
CA 02326757 2000-10-25
WO 99/55368 PCTIUS99/09034
-54-
Table 2. Phenotypes and molecular analysis of selected sad mutants.
Biofilm Biofilm
Allele FormationMotilityPigment Formation: RescueLocusc
on PVCa Production by Fe, Citrate
&
Glutamateb
sad+ (wild + + + + na
type)
sad-10 - + + + no match
sad-11 - + + + clpP
sad-13 - - + + flip
sad-14 - - + + flaE
sad-16 - - + + nd
sad-18 - + + - no match
sad-19 - + + -d no match
sad-20 - - + + nd
sad-21 - + - + nd
sad-22 - - + + nd
1$ a'I'he medium used was M63 minimal medium supplemented with glucose and
CAA.
bRescue of the biofihn formation defect was assessed by growing the mutants on
M63 minimal medium
supplemented with citrate or glutamate at 0.4 %, or M63 minimal medium
supplemented with glucose,
CAA and 3 mM FeS04.
cThe locus was determined by sequencing the DNA flanking the insertion element
as described in the
Experimental Procedures. If the flanking sequence was homologous to a known
locus it is listed. "No
match" indicates no significant similarity to any sequence on the database
using the BLASTX program
(Altschul, S.F., et al., 1990. J. Mol. Biol. 215: 403-410). Abbreviations: na,
not applicable; nd, not
determined.
dThe biofilm formation defect of sad-l9 is rescued by the addition of citrate,
but not by iron or
glutamate.
CA 02326757 2000-10-25
WO 99155368 PCTIUS99/09034
-5 5-
Molecular characterization of sad mutants.
The DNA sequence flanking the insertion elements was determined for
24 of the 37 mutants (22 motile and 2 non-motile) in order to identify the
genes)
disrupted in each of the mutants. Typically, 200-400 by of DNA sequence
flanking the transposon insertions were obtained using the arbitrary PCR
method.
DNA flanking sequences were compared to sequences in Genbank using the
BLASTX program (Altschul, S.F. et al., 1990, J. Mol. Biol. 215: 403-410).
BLASTX translates the DNA sequence in all six reading frames and compares
the translated sequences to sequences in Genbank. The results from analyses of
selected mutants are presented in Table 2, column G. Gene identifier sequences
of selected sad mutants are shown in Fig. 9.
The mutants fall into three broad groups. The first group is comprised
of motile strains having their mutation in a locus of known or proposed
function.
The strain carrying allele sad-ll (clpP) comprises this class. The second
group
is comprised of non-motile strains, two of which were shown to have mutations
in genes required for flagellar synthesis. The third group is comprised of
motile
strains, but unlike the first group, the DNA sequence flanking the transposon
has
no obvious similarity to any genes of known function in Genbank, as judged by
the BLASTX program. This group of mutants included those having sequences
that matched nothing in Genbank and those having sequences that matched genes
of unknown function. Transposon insertions from two representative strains of
this third group (sad-18 and sad-19) were cloned and over 500 by of DNA
sequence flanking the transposon were determined. Again, no significant
matches to genes of known function were found. In fact, only 3 of the 24
mutants analyzed had mutations in genes of known function. Two of these were
non-motile mutants (sad-13 and sad-14), in which matches to genes known to be
required for synthesis of functional flagella were identified. Taken together,
CA 02326757 2000-10-25
WO 99/SS368 PCT/US99109034
-56-
these results suggest that this genetic screen has allowed us to identify
heretofore
unknown genes.
Motility is conditionally required for biofilm formation.
Strains carrying alleles sad-13 and sad-14 (mutants originally isolated
on minimal glucose/CAA medium) have transposon insertions in structural genes
required for flagellar synthesis. It appears that we have identified the P.
fluorescens homolog offliP. The identification was made based on the degree of
similarity of the predicted polypeptide encoded by the DNA sequence flanking
the insertion in the strain carrying allele sad-13 to the P. aeruginosa PAK
flip
gene (56% identity and 66% similarity over 77 aa). FIiP is thought to
participate
in flagellar synthesis (Malakooti, 3., et al., 1994, JBacteriol. 176: 189-197)
and
is within an operon containing other flagellar biosynthetic genes, including
fli0,
which is required for non-pili mediated attachment to eukaryotic cells.
Because
flip is probably part of a gene cluster required for flagellar synthesis, it
is not
1 S presently possible to conclude whether flip andlor a downstream gene is
responsible for the biofilm formation defect. The strain carrying allele sad-
14
contains a insertion in what appears to be the P. fluorescens homolog of the
flaE
gene of Vibrio paramaemolyticus (McCarter, L.L.,1995, J. Bacteriol. 177: 1595-
1609) and the flgK gene of Salmonella typhimurium (Homma, M. et a1.,1990, J.
Mol. Biol. 213: 819-832). The predicted polypeptide (~70 aa) encoded by the
sequence flanking the insertion in sad-14 is ~40% identical and ~60% similar
to
the flaE and flgK genes. These genes are thought to encode a structural
component of the flagellum. The isolation of multiple non-motile mutants that
are also defective for biofilm formation on an abiotic surface shows that
there is
an overlap between factors required for biofilm formation on biotic and
abiotic
surfaces, and further validates our approach for isolating mutants defective
in this
CA 02326757 2000-10-25
WO 99/55368 PCT/US99/09034
-57-
process. As shown below, however, flagella-mediated motility only appears to
be required under certain growth conditions.
The Clp protease participates in biofilm formation.
The DNA sequence flanking the insertion in the strain carrying sad-ll,
which is motile and is defective in forming biofilms on both hydrophilic and
hydrophobic surfaces, encodes a polypeptide with high similarity (~80%
identity
and ~95% similarity over a 54 as stretch) to the CIpP protein of E. coli,
which is
a subunit of the cytoplasmic Clp protease (Gottesman, S. and Maurizi, M.R.,
1992, Microbiol. Rev. 56: 592-621 ). Based on this level of similarity, we
propose that we have identified the CIpP protein homolog of P. fluorescens.
The
location of the transposon insertion in clpP is just downstream of the
putative
start of translation.
We performed complementation analysis to confirm that the mutation
in clpP was causing the biofilm formation defect. The clpP gene of E. coli was
amplified from chromosomal DNA of ZK126 (W3110 clpP+) by PCR and
cloned into a vector (pSMC28) that is stably maintained in Pseudomonas spp.
The resulting plasmid pSMC26 (clpP+), and the vector control (pSMC28), were
introduced into wild-type P. fluorescens and the sad-ll (clpP) mutant. These
plasmid-carrying strains were then tested for biofilm formation. These data
are
summarized in Fig. 5. The first two columns of Fig. 5 show the biofilm
formation phenotype of the wild-type and clpP strains (not carrying any
plasmids). Complementation analysis (columns 3-6) revealed that the biofilm
formation of the clpP mutant is completely rescued by providing a plasmid-
borne
copy of clpP+ derived from E. coli (column 5). The vector control has no
effect
on biofilm formation of the wild-type or clpP strain (columns 3 and 4).
CA 02326757 2000-10-25
WO 99155368 PCTNS99/09034
-58-
Providing clpP in multiple copies appears to have no adverse effects on
biofilm
formation by the wild-type strain.
We also directly assessed the ability of the clpP mutant carrying
pSMC26 (clpP+) or the vector control (pSMC28) to attach to PVC, using phase
contrast microscopy (Fig. 6; 600X magnification; assays performed in minimal
glucose/CAA medium). The left panel of Fig. 6 shows multiple cells adhered to
the PVC plastic when the clpP mutant is carrying pSMC26 (clpP+). This
phenotype is similar to what is seen with the wild-type strain. When the clpP
mutant carries just the vector control (Fig. 6, right panel) very few cells
are found
attached to the PVC plastic. These data are consistent with the indirect
assessment of biofilm formation by CV-staining that are shown in Fig. 5, and
demonstrate that the CIpP protein participates in biofilm formation.
Multiple signaling pathways participate in biofilm formation.
As discussed above, various nutritional conditions impact biofilm
formation by P. fluorescens. Based on these observations, biofilm formation by
the sad mutants (originally isolated on minimal medium supplemented with
glucose and CAA) was assessed in a variety of media. The biofilm formation
defect of approximately half of the sad mutants was rescued by growth on
minimal medium supplemented with citrate or glutamate as the sole source of
carbon and energy, or minimal glucose/CAA medium supplemented with 3 p,M
FeSOq..
Fig. 7 shows rescue of the biofilm formation defect of sad mutants.
The extent of biofilm formation after 10 hrs of growth is expressed as the
absorbance at 600 nm. Shown are the values for the wild type and selected sad
mutants. The biofilm formation phenotype of the sad mutants was assessed with
CA 02326757 2000-10-25
WO 99/55368 PCTIUS99/09034
-5 9-
cells grown on minimal medium supplemented with: (i) glucose/CAA,
glucose/CAA plus iron (3 mM), (ii) citrate (0.4%), or (iii) glutamate (0.4%).
The sad mutants could be divided into three classes based on their
ability to be rescued by citrate, glutamate or iron-supplemented glucose/CAA
medium (Fig. 7 and Table 2). One class (containing 12 mutants) represented by
the strain carrying allele sad-18, showed a strong biofilm formation defect
under
all nutritional conditions tested. The second class, represented by the single
strain carrying the sad-19 allele, was rescued by growth on citrate, but not
on
glutamate or glucose/CAA + iron. The remainder of the sad mutants ( 10
mutants) were rescued for their biofilm formation defect when grown on minimal
medium supplemented with citrate, glutamate, or glucose/CAA + iron.
Among the sad mutants rescued by growth on citrate, glutamate, or
glucose/CAA + iron medium were the non-motile strains shown to carry
mutations in the genes required for flagellar synthesis (see Table 2). It is
important to note that growth on citrate, glutamate or iron-supplemented
glucose
medium, while restoring the cells' ability to form biofilms, does not restore
motility as assayed on 0.3% motility agar plates. Furthermore, although 0.29%
malate, mannitol, xylose, and glycerol promote biofilm formation 0.2%, these
carbon sources did not rescue the biofilm formation defect of any of the sad
mutants. Therefore, rescue of the biofilm formation defect was specific for
particular growth conditions.
The growth of mutants in minimal glucose/CAA medium
supplemented with CaCl2, MgS04, and MnS04 (all provided at 3 ~,M) did not
restore their ability to form biofilms, indicating that the ability to rescue
the
biofilm formation defect of the sad mutants is specific to iron. Taken
together,
these data show that multiple, convergent genetic pathways are involved in the
CA 02326757 2000-10-25
WO 99/55368 PCT/US99/09034
-60-
early events of biofilm formation and these pathways can be induced by
various,
specific environmental signals.
Example III: Identification of mutations that affect bioflm formation in
Escherichia coli
E. coli Forms Biofilms in a Nutrient-dependent Fashion.
We tested the ability of the well characterized, gram-negative
bacterium, E. coli, to initiate biofilm formation on abiotic surfaces. To
assay for
such attachment, we used a modified version of a previously described protocol
(Fletcher, M.,1977, Can. J. Microbiol., 23, 1-6). Cells were first grown for
either
24 or 48 hours at room temperature without shaking in microtiter dishes or
glass
tubes. In order to remove any unattached cells, the microtiter dishes (or
glass
tubes) were rinsed thoroughly with water and subsequently stained with 1.0%
crystal violet (CV) for approximately 20 minutes. This staining procedure
allowed us to visualize cells that had attached to an abiotic surface because
attached.cells stain purple with CV whereas abiotic surfaces are not stained
by
CV. We found that a number of motile laboratory strains of E. coli were able
to
attach to multiple abiotic surfaces when grown in Luria Bertani broth (LB).
Specifically, E. coli W3110 formed biofilms on all surfaces tested, including
polyvinyl chloride (PVC), polypropylene, polycarbonate, polystyrene, and
borosilicate glass.
Importantly, the ability to form such biofilms was strongly influenced
by the nutritional environment. Figure 10 shows the nutritional effects on
biofilm formation. Wild-type cells were grown in PVC microtiter dishes in LB
at room temperature without shaking for 24 hours, then subcultured ( 1:100)
into
PVC microtiter dishes containing the indicated media. These cultures were
CA 02326757 2000-10-25
WO 99155368 PCTNS99/09034
-61-
grown for 48 hours at room temperature without shaking, then rinsed and
stained
with crystal violet. Biofilm formation could be visualized with CV after as
little
as two hours of growth in LB. Similarly, biofilm formation was supported by
various minimal media containing casamino acids (CAA) (Fig.lO). In contrast,
minimal media without CAA (with either glucose or glycerol as a carbon and
energy source) did not support biofilm formation that was visible after
staining
with CV (Fig.lO).
Screen for E. coli Mutants Defective in Biofilm Formation.
To identify genes required for biofilm formation, we screened for
mutants defective in forming biofilms in LB on PVC plastic. Strain W3110 was
subjected to insertion mutagenesis (Kleckner, et al., supra) with a mini
TnlOcam,
and insertion mutants were selected on LB agar containing 30 ~g/mL
chloramphenicol.
Chloramphenicol resistant colonies were picked and grown at room
temperature in 96-well PVC microtiter~ dishes containing glucose minimal
medium with 30 ~,glml chloramphenicol. After 48 hours, the cells were
subcultured into corresponding wells in a 96-well PVC microtiter dish
containing
LB with 30 ~.g/mL chloramphenicol. The cultures were grown at room
temperature for another 48 hours and then rinsed thoroughly with water to
remove any planktonic cells. The wells were stained with CV, rinsed, and
potential biofilm-defective mutants were identified based on decreased
staining
compared to a wild-type control. Each potential biofilm-defective mutant was
isolated from its original microtiter well, streaked f:or single colonies on
LB agar,
and re-tested for its ability to form a biofilm. Each of the insertion
mutations that
appeared to confer a defect in biofilm formation was transferred into a fresh
W312 0 background via P 1 vir-transduction and re-tested. Of 10,000 such
CA 02326757 2000-10-25
WO 99/55368 PCTIUS99/09034
-G2-
insertion mutations analyzed, 177 were found to confer a decrease in biofilm
formation.
Initial Classification and Mutant Identification.
It is possible that a mutant strain isolated in the above screen could
exhibit decreased biofilm formation because it harbors a mutation that either:
( 1 )
confers a non-specific growth defect that indirectly affects biofilm
development,
or (2) interferes in the formation of biofilms without interfering with the
growth
rate. To distinguish between these possibilities, mutant strains were grown in
LB
and their growth rates were compared to the wild type. Only strains exhibiting
growth rates indistinguishable from the wild type are discussed below.
The mutant strains displayed a wide array of phenotypes with respect
to the severity in their decreased ability to form biofilms. The macroscopic
phenotypes ranged from wells that displayed subtle decreases in CV staining to
wells that appeared completely clear after CV treatment. As an early step in
1 S characterization of the mutants, each was analyzed fox its ability to
swarm on LB
motility agar (0.3% agar). Approximately one-half of the mutants (87/177)
displayed a decreased ability to swarm, whereas the remaining mutants formed
swarms that were indistinguishable from the wild type. The majority of the
Swarm' mutants were severely defective in their ability to form biofilms (i.e.
clear wells after staining with CV). Such swarm assays do not always allow one
to distinguish between defects in flagellar biosynthesis, motility, and/or
chemotaxis. Thus, the following central question arose: Which of these three
aspects of bacterial flagellalmovement is critical to biofilm formation?
Among the remaining Swarm+ mutants, 23 displayed macroscopic
phenotypes comparable to those observed with Swarm' mutants (i.e. clear wells
after staining with CV; see examples of mutants that display the clear well
CA 02326757 2000-10-25
WO 99155368 PCT/US99109034
-63-
phenotype in Fig. 11), whereas the others displayed less severe phenotypes. In
this initial study, we focused on the 23 Swarm+ mutants with the strongest
phenotypes. The 23 mutants referred to above were found to be tightly linked
to
each other, as indicated by Plvir-transduction using a nearby TnlO. The
precise
locations of nine of the 23 insertion mutations within this linkage group were
identified utilizing arbitrarily primed PCR followed by DNA sequence analysis.
All nine insertions were located in genes encoding for the regulation or
synthesis
of type I pili. Specifically, independently isolated insertions were found in
fimB
(two alleles), fimA,~mC, fimD (three alleles), and fimH. Thus, a second
question
arose: What is the role of type I pili in E. coli biofilm formation?
Motility, not Chemotaxis, is Critical for Biofilm Formation.
We reasoned that there are three mechanisms through which flagella
might be required for biofilm formation. First, it is possible that flagella
could be
directly required for attachment to abiotic surfaces, thus facilitating the
initiation
of biofilm formation (e.g. as with tethered cells). Alternatively, motility
could be
necessary to enable a bacterium to reach the surface (e.g. to move through
surface repulsion present at the medium-surface interface). Also, motility
might
be required for the bacteria within a developing biafilm to move along the
surface, thereby facilitating growth and spread of the biofilm. Finally, it is
possible that chemotaxis is required for the bacteria to swim towards
nutrients
associated with a surface.
Since flagellar synthesis, motility, and chemotaxis have been
extensively studied in E. coli (Macnab, R.M.,1996, In Neidhardt, F.C., et al.
(ed.), Escherichia coli and Salmonella typhimurium: Cellular and molecular
biology ASM Press, Washington, DC, Vol. 2, pp. 123-145; Stock, J.B. and
Surette, M.G., 1996, In Neidhardt, F.C., et al. (ed.), Escherichia coli and
CA 02326757 2000-10-25
WO 99/55368 PCT/US99/09034
-64-
Salmonella typhimurium: Cellular and molecular biology ASM Press,
Washington, DC, Vol. 2, pp. 1103-1129), well defined mutations that inhibit
each of these three aspects of flagellar function are available. Accordingly,
we
obtained the following mutations: l..fliG:kan (strains harboring this allele
are
unable to synthesize flagellin) and flhD: : kan (a master regulator of
flagellar
synthesis whose absence confers an inability to synthesize flagella), 2.
DmotA,
DmotB and DmotAB (lesions that do not inhibit flagellar biosynthesis, but
render
cells non-motile or paralyzed), 3. DcheA-Z: : kan (strains harboring this
lesion
are motile, but non-chemotactic).
Each of these alleles was moved into W3110 via P 1 vir-transduction,
and the resulting strains were analyzed for their ability to form biofilms.
Construction of these strains provided us with the tools required to
distinguish
between the possible roles of flagella/motility/chemotaxis that were detailed
above. Fig. I 1 shows biofilm formation of wild-type and mutant strains. Cells
with the indicated genotypes were grown in PVC rnicrotiter dishes in LB at
room
temperature without shaking for 24 hours, then subculture (1:50) into LB.
These
cultures were grown for 24 hours at room temperature without shaking, then
rinsed and stained with crystal violet. This assay revealed that motile cells
that
are non-chemotactic (DcheA-Z: : kan) appear to form biofilms indistinguishable
from their wild-type counterpart. In contrast, cells either lacking flagella
(fliC::kan ,.flhD::kan) or possessing paralyzed flagella (DmotA, DmotB, or D
motAB) were severely defective in biofilm formation (Fig. 11 ).
Fig. 12 shows quantification of biofilm formation. Cells with the
indicated genotypes were grown for 24 hours in PVC microtiter dishes
containing LB, then subcultured ( 1:50) into PVC microtiter dishes with LB. At
the times indicated, the microtiter dishes were rinsed, stained with CV, and
the
amount of CV staining was quantified. When biotilm formation was quantified
CA 02326757 2000-10-25
WO 99/55368 PCT/US99/09034
-65-
over time, it became very clear that, under these conditions, chemotaxis is
completely dispensable for normal biofilm formation (Fig. 12). In contrast,
cells
either lacking complete flagella (fliC: : kan) or possessing paralyzed
flagella
(DmotA, DmotB, or DmotAB) are severely hindered in the initial stages of
biofilm formation (Fig.l2).
More detailed analysis of the defects conferred by these alleles was
obtained through microscopic analysis of cells attached (or the absence of
such
attached cells) to PVC following growth in LB Fig 13 (A-D). Cells with the
indicated genotypes were grown in PVC microtiter dishes in LB at room
temperature without shaking for 24 hours, then subculture ( 1:50) into
microtiter
dishes containing LB and a tab of PVC plastic. These cultures were grown for
24 hours at room temperature without shaking. The PVC tabs were then
removed, rinsed, and the remaining cells were visualized via phase contrast
microscopy (400X magnification). Panel A shows the wild-type strain W3110;
Panel B shows the mutant strain W3110 DcheA-Z::kan (which is non-
chemotactic); Panel C shows the mutant strain W3110 FimH l ::cam (which lacks
pili); and Panel D shows the mutant strain W3110 flhD::kan (which lacks
flagella). As illustrated in Fig. 13B, motile cells that are non-chemotactic
are
able to form biofilms that are indistinguishable at the cellular level from
the
biofilms formed by wild-type cells. In contrast, non-flagellated or paralyzed
cells attach poorly to PVC. Moreover, the few cells that do attach are often
located in small, dense clusters of cells (Fig. 13D).
Type I Pili are Critical for Initial Attachment to Abiotic Surfaces.
As discussed above, the macroscopic analysis of biofilm formation of
fim mutants was analogous to that observed with the motility defective mutants
(i.e. clear wells after staining with CV) (Fig. 11 }. However, microscopic
analysis
CA 02326757 2000-10-25
WO 99/55368 PCTIUS99/09034
-66-
of these mutants revealed distinct phenotypes. Specifically, fim mutants are
even
more dramatically defective in initial attachment than are the paralyzed and
non-flagellated cells. As illustrated in Figure 13C, in most microscopic
fields no
attached cells were observed, and only infrequently were a few attached cells
observed. This result indicates that type I pili are critical for initial
interaction
with abiotic surfaces such as PVC.
a-Methyl-D-Mannoside Inhibits Attachment to Abiotic Surfaces.
One of the insertions in the fim gene cluster is located in the final gene
if the operon, fimH. Lesions in fimH have been reported to affect the length
of
the tip (fibrilla) of type I pili (Ottemann, K.M. and Miller, 3.F., 1997, Mol.
Microbiol., 24, 1109-1117). In addition, FiricH functions as a mannose-
specific
adhesion, allowing E. coli to interact specifically with mannose residues on
eukaryotic cells, thus facilitating infections such as cystitis (Hanson, M.S.
and
Brinton, C.C.,1988, Nature, 332, 265-268.; Low, D et al, 1996, In Neidhardt,
F.C., et al. (ed.), Escherichia Coli and Salmonella Typhimurium: Cellular and
Molecular Biology ASM Press, Washington, D.C., Vol. l, pp. 146-157.; Maurer,
L. and Orndorff, P.,1987, J. Bacteriol, 169, 640-645; Old, D.C., 1972. J. of
Gen.
Microbiol., 71, 149-157). Consequently, it is possible that the altered
structure of
the fibrilla of type I pili in fimH mutants could interfere with normal
attachment
to abiotic surfaces. Alternatively, the mannose-specific adhesin may play a
more
direct role in attachment.
To further address the role of FimH in biofilm formation, we tested
whether the presence of a non-metabolizable mannose analog,
a-methyl-D-mannoside, affected the ability of the wild-type strain, W3110, to
form biofiims on PVC. Fig. 14 shows the effects of a-methyl-D-mannoside on
biofilm formation. Cells were grown for 24 hours without shaking at room
CA 02326757 2000-10-25
WO 99155368 PCT/US99/09034
-67-
temperature, and then subcultured ( 1:50) into PVC microtiter dishes with LB
plus 0, 5, 1 S, 25, 50, or 100 mM a-methyl-D-mannoside. After nine hours at
room temperature without shaking, the microtiter dishes were rinsed, stained
with CV, and the amount of CV staining was quantified. As illustrated in
Fig.l4,
S a-methyl-D-mannoside inhibits biofilm formation in a concentration-dependent
fashion. Importantly, a-methyl-D-mannoside does not inhibit growth rates. As a
specificity control, we have shown that although mannose also has a similar
effect as a-methyl-D-mannoside, glucose does not inhibit biofilm formation,
and
neither mannose nor glucose inhibits growth. It is also important to note that
a-methyl-D-mannose inhibits biofilm development on all other abiotic surfaces
tested, including polycarbonate, polystyrene, and borosilicate glass. It is
reasonable to assume that these various surfaces do not resemble mannose.
Fig. 15 shows a model for initiation of E. coli biofilm formation.
Motility may be required to overcome surface repulsion, thereby allowing
initial
surface contact. Type I pili are needed to establish stable attachment,
perhaps
through interactions between the type I adhesion, FzmH, and the abiotic
surface.
Finally, motility may also enable attached, growing cells to migrate along the
abiotic surface, thereby facilitating biofilm expansion.
Example IV: Identification of mutation that affect biofilm formatig~~n_
Pseudom,~, are s aeru~i~nosa
Isolation of mutants defective in biofilm formation.
We generated a collection of 2400 random transposon mutants of P.
aeruginosa PA14 using the transposon Tn5-B30(Tcr) (Simon, R. et al., 1989,
Gene, 80, 160-169). This collection of P. aeruginosa mutants was screened in
microtiter dishes made of polyvinylchloride (PVC) to test for their ability to
form
CA 02326757 2000-10-25
WO 99/553b8 PCT/US99109034
-68-
a biofilm on an abiotic surface. The cells were allowed to grow in the wells
of
the microtiter dishes in a minimal M63 medium supplemented with glucose and
casamino acids (CAA) to assess their ability to form a biofilm, as described
above in the previous Examples. The biofilrn was detected by staining with
crystal violet (CV), a purple dye which stains the bacterial cells, but does
not
stain the PVC plastic. After addition of CV and incubation at room temperature
for ~10 min, excess CV and unattached cells were removed by vigorous and
repeated washing of the microtiter plates with water. An example of the
phenotype of the wild-type strain is shown in Fig. 16. The biofilm is observed
as
a ring of CV-stained cells which forms at the interface between air and
medium.
Under the growth conditions used in this experiment, the only electron
acceptor
available is oxygen. Therefore, the biofilm forms only where oxygen levels are
highest, that is, at the interface between air and medium. Of the 2400 mutants
screened, 15 mutants (0.5%) unable to form such a biofilm were isolated. These
mutants were designated surface attachment defective or sad. The biofilm
formation phenotypes of representative sad mutants pilYl (genbank (gb)
accession no. L76605), pilB (gb-M32066), and flgK (gb-X51738) are also shown
in Fig. 16.
Any strains exhibiting poor growth under these screening conditions
might give the same phenotype as mutants unable to initiate formation of a
biofilm. Therefore, all of the putative sad mutants were grown in liquid
minimal
M63 medium supplemented with glucose and CAA (the same medium used to
screen for mutants). Of the 15 putative sad mutants tested, 13 grew as well as
the wild-type strain, but were unable to form a biofilm. The other two
putative
sad mutants had severe growth defects relative to the wild type and were not
analyzed further.
CA 02326757 2000-10-25
WO 99155368 PCT/US99/09034
-69-
We performed Southern blot analysis of the 13 sad mutants that did
not form a biofilm to determine the number of transposon insertions in each
strain. A PCR-generated DNA fragment from the IS50 of Tn5 was used to probe
EcoRI-digested chromosomal DNA (there are no EcoRI sites in Tn5-B30). This
analysis revealed a single hybridizing band for each strain, consistent with
each
sad mutant having only a single transposon insertion. The further analyses of
two classes of mutants (totaling 8 of 13) isolated in this screen is presented
below.
We tested the P. aeruginosa sad mutants for their ability to form a
biofilm on abiotic surfaces other than PVC, including polystyrene,
polycarbonate
and polypropylene. The wild-type strain can form a biofilm on all of these
surfaces. In contrast, all of the sad mutants originally isolated on PVC were
also
defective for biofilm formation on these other surfaces.
Non-motile mutants are defective in biofilm formation.
In addition to the phenotypic analyses described above, all sad mutants
were assessed for their motility phenotype on 0.3% agar (minimal M63 medium
supplemented with glucose and CAA). Fig. 17 shows an example of a motility
assay. The flagella-mediated motility of the wild-type strain, representative
pill-defective mutants (pilB and pilC~, and non-motile mutants (flgK, sad-39,
and
sad-42) was assessed on minimal M63 glucose/CAA medium with 0.3% agar
after ~24 hrs of growth at 25°C. Migration of the cells from the point
of
inoculation (observed as a turbid zone) indicates that the strain is
proficient for
flagellar-mediated motility.
Of the 13 mutants tested, three strains (sad-36, sad-39, and sad-42)
were found to be non-motile (Fig. 17). In a typical experiment after 24 hrs of
growth at room temperature, the wild type and two representative mutants
CA 02326757 2000-10-25
WO 99/55368 PCT/US99/09034
-70-
defective in pili biogenesis (pilB and pilC~ clearly migrated from the point
of
inoculation while the sad-36, sad-39, and sad-42 strains did not.
One of these mutants, sad-36, was chosen for further analysis. The
sad-36: : Tn5(Tcr) insertion was mobilized into a wild-type genetic background
by phage SN-T-mediated transduction as reported (Jensen, E.C., et al., 1998,
Appl. Environ. Microbiol., 64, 575-580). 18 of 18 Tcr transductants
(indicating
inheritance of the Tn5 element) were non-motile and unable to make a biofilm,
demonstrating that the single insertion in this strain was responsible for the
observed phenotypes. The DNA sequence flanking the Tn5 insertion in sad-36
was determined using arbitrary PCR and compared to the Genbank database
using BLASTX (Altschul, S.F., et al., 1990, J. Mol. Biol. 215: 403-410).
BLASTX translates DNA sequence in all six reading frames and compares these
predicted protein sequences to Genbank. The determined DNA sequence
flanking the Tn5 element 0375 nt), when translated, revealed a partial ORF
with
~40% identity and ~b5% similarity to HAP1 (flgK), the flagellar-associated
hook
protein 1 of Salmonella typhimurium and Escherichia coli. Mutations in the
flgK
locus in these organisms results in the synthesis of an incomplete flagellum,
which renders the strains non-motile (Homma, M., et al., 1990, J. Mol. Biol.,
213, 819-832). The localization of the Tn5 insert of the strain carrying the
sad-36 allele to a gene required for flagellar function is consistent with the
non-motile phenotype of this strain.
Type IV pili are required for biofilm formation.
We analyzed the DNA sequence flanking the transposon inserts of the
other sad mutants. Comparison of the translated DNA sequences flanking the
Tn5 insertions in sad mutants to the Genbank database revealed that five
strains
carried mutations in genes required for the synthesis of type IV pili.
CA 02326757 2000-10-25
WO 99/55368 PCTIUS99109034
Type IV pili are important for the adherence to and colonization of
eukaryotic cell surfaces and are thought to play a role in pathogenesis. Four
of
the five mutants defective in type IV pili biogenesis identified in the screen
had
mutations in the piIBCD operon, which is thought to code for accessory factors
S required for pili assembly and function. The strains carrying alleles sad-
31,
sad-33, and sad-34 have mutations in the pilB gene. The DNA sequence
flanking the transposon insertions in sad-33 and sad-34 was identical,
indicating
that these two strains were probably siblings. The mutations carried in sad-31
and sad-33/sad-34 map to two different locations within pilB.
The strain carrying allele sad-29 has a mutation in the pilC gene.
Because the piIBCD locus may form an operon, it is possible that polarity onto
pilD is actually causing the phenotype. However, it has been shown in P.
aeruginosa PAO 1 that mutations in any of these loci result in the loss of the
synthesis of pili as indicated by resistance to the pilus-specific
bacteriophage
P04 and visual inspection by electron microscopy. (Nunn, D., et al., 1990, J.
Bacteriol., 172, 2911-2919).
The fifth mutant, sad-25, maps to yet a third locus, a homolog of the
pilYl gene of P. aeruginosa PAO1. In P. aeruginosa, the pilYl gene is in a
cluster of genes (including pilV, pilW, pilX, pilY2, and pilE~ that are
required for
type IV pili biogenesis. Consistent with the mapping of these mutations to
genes
required for type IV pill biogenesis was their resistance to lysis by phage
F116
(Pemberton, J.M., 1973, Virology, 55, 558-560), which utilizes type IV pili as
its
receptor.
It has been shown that type IV pili are required for a form of
surface-associated movement known as twitching motility. Twitching motility is
thought to be a consequence of the extension and retraction of type IV pili,
which
CA 02326757 2000-10-25
WO 99/55368 PCT/US99/09034
-72-
propels the bacteria across a surface by an undescribed mechanism (Bradley,
D.E., 1980,
Can. J. Microbiol., 26, 146-154; Darzins, A., 1994, Mol. Microbiol., 11,
137-153.; Whitchurch, C.B., 1990. Gene, 101, 33-44). We assessed the
twitching motility phenotype of the mutants carrying alleles sad-25 (pilYl ),
sad-29 (pilC), sad-31 (pilB), and sad-33 (pilB). The wild-type, a
representative
flagellar mutant (flgl~, and four type IV pill mutants are shown in Fig. 18.
To assess twitching motility, cells were stabbed into an LB agar plate
(1.5% agar) with a toothpick, incubated overnight at 37°C, then for 1-2
days at
room temperature (~25°C). Twitch+ strains form a colony on the agar
surface
and form a hazy zone of cell growth within the agar substrate. Twitch- strains
still form a colony on the agar, but lack the zone of growth within the agar.
Also,
the colonies of Twitch+ strains are flat, spreading, and irregularly shaped,
while
the colonies formed by strains defective in the synthesis of type IV pill are
rounded and somewhat dome-shaped.
In addition to forming a colony on the surface of the agar plate ( 1.5%
agar), Twitch+ strains of P. aeruginosa PA14 form a haze of growth that
surrounds the point of inoculation. This assay differs from the test for
flagella-mediated motility, which is performed by inoculating cells onto 0.3%
agar plates (see Fig. 17). Furthermore, strains capable of twitching motility
have
a spreading colony morphology while strains defective in twitching motility
produce rounded colonies. This difference in colony shape can also be observed
in Fig. 18.
Twitching motility can also be assessed by phase-contrast microscopy.
At the microscopic level, the edge of the colonies of strains proficient in
twitching motility are highly irregular. This is thought to be a consequence
of
the surface movement associated with type IV pill. Mutants lacking functional
CA 02326757 2000-10-25
WO 99/553b8 PCTIUS99/09034
-73-
type IV pili have smooth-edged colonies. To further confirm that our strains
did
not have functional type IV pili, we observed the edges of wild-type and
pili-deficient mutants by phase contrast microscopy. As shown in Fig. 19
(micrographs are at 400X magnification), the wild-type strain has the expected
S irregular colony edge and the representative pili-deficient strain (sad-
3llpilB) has
the expected smooth colony edge phenotype. All the pili-defective mutants
behaved in a fashion identical to sad-31. Transmission electron microscopic
analysis of the pill mutants confirmed the lack of these structures on the
surface
of the mutant cells.
Mutants defective in flagellar-mediated motility and type IV pili
biogenesis define two steps in a developmental pathway. We utilized the sad
mutants isolated in this study as tools to initiate the dissection of the
early steps
in biofilm formation. In order to follow the initiation of biofilm formation
by the
wild-type and sad mutants, we directly visualized the formation of the biofilm
on
PVC using phase contrast microscopy. A small tab of PVC plastic (~3mm x
~6mm) was incubated in the well of a microtiter dish that had been inoculated
with 10G CFU/mL of the appropriate strain in minimal M63 medium
supplemented with glucose and CAA. After incubation far various times at
37°C, the plastic tab was removed from the microtiter dish with ethanol-
sterilized
forceps, rinsed with 1 mL of sterile minimal M63 medium, placed on a slide,
and
examined by phase-contrast microscopy (400X magnification).
Fig. 20 shows a time course of the development of a biofilm on PVC
by the wild-type strain over 7.S hrs at 37°C as observed by phase-
contrast
microscopy. As early as 30 minutes after inoculation, the wild type formed a
dispersed monolayer of bacterial cells attached to the surface of the PVC
plastic.
A progressively more dense monolayer of cells formed on the surface over the
next 3-4 hours. By S hours, and continuing until at least 7.S hours, this
CA 02326757 2000-10-25
WO 99/55368 PCTIUS99109034
-74-
monolayer almost completely covered the PVC surface and became punctuated
by micro-colonies {indicated by arrows) which were distributed across the
surface of the PVC plastic and were comprised of multiple layers of cells.
Typically, the wild-type micro-colonies were ~3-5 layers of cells thick.
We directly visualized the ability of the type IV piii-deficient and
non-motile strains to form a biofilm on PVC using phase-contrast microscopy
and compared their phenotypes to the wild-type strain. Fig. 21 shows phase-
contrast photomicrographs of the wild-type strain, a representative pili-
defective
mutant {flgK), and a representative non-motile mutant (pilB) after incubation
for
3 hours at 37°C in the presence of PVC plastic. Micrographs were taken
at 400X
magnification; approximately 50 fields were searched for each strain tested,
and
representative fields are shown. For the representative non-motile strain
(carrying a mutation in flgK), few to no cells were observed attached the PVC
plastic even after 8 hrs of incubation in the presence of the PVC surface
(Fig.
21). All other non-motile strains analyzed had a phenotype identical to the
flgK
mutant.
We also directly visualized the biofilm formation phenotype of a
representative mutant defective in pili biogenesis (pilB). At the early time
points
(< 3 hrs), there was little difference in the biofilm formation phenotype of
the
wild type and the type I V pili mutants; both the wild-type and the pili-
defective
strain form a dispersed monolayer of cells on the surface of the PVC plastic.
By
8 hours, in contrast to the aggregates of cells formed by the wild-type
strain, the
pili-defective mutants did not develop these characteristic micro-colonies
(Fig.
21 ). Furthermore, the wild-type strain almost completely covered the PVC
surface with a dense, tightly-packed layer of cells (Fig. 21 ). The phenotype
of
the type IV pili mutants at this 8 hour time point was unchanged from that
CA 02326757 2000-10-25
WO 99155368 PCT/US99/09034
-75-
observed at 3 hrs, that is, a dispersed monolayer of cells. The other mutants
defective in pill biogenesis (pilC and pilYl ) had similar phenotypes.
A role for twitching motility in biofilm formation.
To better define the events that lead to micro-colony formation by the
wild type and to determine if surface-based twitching motility plays a role in
biofilm formation, we employed phase-contrast time-lapse microscopy to follow
a developing biofiim. Utilizing time-lapse microscopy, we watched individual
micro-colonies formed by the wild-type strain over a period of 56 minutes
(with
images acquired at 15 second intervals). Shown in Figs. 22A-22I is a montage
of
9 phase-contrast micrographs taken during biofilm formation by the wild-type
strain every 7 minutes between 360 and 416 minutes post-inoculation. Arrows
indicate micro-colonies that form and/or disperse over the course of the
experiment. The black circles indicate the identical spot on the field in
panels H
and I. Several micro-colonies were followed through the course of this
experiment to illustrate the movement of cells across the PVC plastic surface.
In Figs. 22A-22I, the white arrow indicates the position of a
micro-colony which is first clearly visible in Fig. 22B, becomes larger (Fig.
22C), but has dispersed by Fig. 22D. This micro-colony does not reform during
the course of this experiment (Figs. 22D through 22I). A series of time-lapse
micrographs taken at 15 second intervals between 374 minutes (Fig. 22C) and
381 minutes {Fig. 22D) show that this micro-colony disperses because the cells
comprising the colony move apart, while still remaining associated with the
plastic surface.
The black arrow points to a large micro-colony evident in Fig. 22A.
This large micro-colony becomes progressively smaller (Figs. 22B through 22F)
and eventually splits into two small, adjacent micro-colonies (Fig. 22G). In
Fig.
CA 02326757 2000-10-25
WO 99/55368 PCTIUS99/09034
-76-
22H, these two adjacent micro-colonies form a larger single colony which has
grown slightly in size when visualized 7 minutes later (Fig. 22I).
The formation of micro-colonies in this system is due in large part to
the aggregation of cells found dispersed in the monolayer of cells on the
surface
and not solely to the growth of the bacterial cells. This point is further
illustrated
by data presented in Figs. 22H and 22I. The dark circle in Fig. 22I indicates
a
dense, well-formed micro-colony. However, this colony is not evident 7 minutes
previously in Fig. 22H. The elapsed 7 minutes between the micrograph shown in
Fig. 22H and the micrograph shown in Fig. 22I represents less than the time
needed for a single population doubling under these growth conditions.
Furthermore, analysis of the time-lapse film shows that this micro-colony
forms
by recruiting adjacent cells from the monolayer. The data described above and
shown in Figs. 22A-22I demonstrate the dynamic nature of micro-colony
formation and dispersal during the course of biofilm development.
As discussed above, type IV pili are required for surface based
twitching motility and mutants defective in type IV pili biogenesis do not
make
the micro-colonies characteristic of the wild-type strain. It is important to
note
that none of the behaviors described above for the wild-type were observed in
the
representative type IV pili mutant, pilB. As shown above in Fig. 21, this
strain
does not form micro-colonies when observed either after 8 hrs of growth or
when
monitored by time-lapse microscopy.
Fig. 23 shows a model for the role of flagella and type IV pili in P.
aeruginosa biofilm formation. Flagella or flagella-mediated motility appear to
be important for the formation of a bacterial monolayer of the abiotic
surface.
Type IV pili appear to play a role in downstream events such as micro-colony
formation.
CA 02326757 2000-10-25
WO 99/55368 PCT/US99I09034
_77_
Other Embodiments
All publications and patent applications mentioned in this specification
are herein incorporated by reference to the same extent as if each independent
publication or patent application was specifically and individually indicated
to be
S incorporated by reference.
While the invention has been described in connection with specific
embodiments thereof, it will be understood that it is capable of further
modifications and this application is intended to cover any variations, uses,
or
adaptations of the invention following, in general, the principles of the
invention
and including such departures from the present disclosure come within known or
customary practice within the art to which the invention pertains and may be
applied to the essential features hereinbefore set forth, and follows in the
scope
of the appended claims.
What is claimed is:
CA 02326757 2000-10-25
WO 99155368 PCT/US99/09034
SEQUENCE LISTING
<110> The President and Fellows of Harvard College
<120> REGULATION OF BIOFILM FORMATION
<130> 00246/505W03
<150> 60/102,870
<151> 1998-10-02
<150> 60/083,259
<I51> 1998-04-27
<160> 49
<170> FastSEQ for Windows Version 3.0
<210> 1
<211> 1090
<212> DNA
<213> Psuedomonas fluorescens
<220>
<221> variation
<222> (1)...(1090)
<223> n is a, t, c, or g.
<400> I
gagcgcagnagaggaagngngggaggangaggaaggaggagagnggaagaaggggggaag60
gggaggggggaagggagagnggggagnngggggnatnngggannngggnggggngnggnn120
ntgnttatnatnangctccggccggacgaagaaattcccgatgcattgctcgagcgcgta180
ggcctgtctcgggacaaggtcaaccacgtattcagcaaagtgctcnaggcggaantgctg240
ctgcgcgaactggcctcgcanttcagccacggctgaataggctcgcccggtcatttgatc300
tttcccacgctctgcgtgggaatgcatcccgtgacgctctgcgtcacatctcagaagcgg360
aacgcggagcgtccctggcgacnttcccncncagggagcgtggggaaccnancaaacntg420
gtcccctcgattntaaagttcttccttaaaancttcttncgggcttccagggtattttgg480
tccancccccttgggaacccanatcccccaggcggcccggggttgccccntttgatcctg540
gggattccgactttgttccttgnaaatccccccttccattgaaaccncccangtttngcc600
ttttgtttccctttgggcccntnccaatccgntgnggcaaaaacgcccattanggggcng660
gggcggtccccccccccncgnntgttactnaantncanaacgccnnttgggccanaaann720
tcgnctngngnnnnnncnncgncntctttnctncccntccnnnctntnntcctcngtgta780
tntccaantcntnccnncgcccntccngcctccccactncctnngccctccnnnccnncg840
cgttncattnctccnccntnntccgcttntccccntttancgtngccgttncccgcccgn900
nncnnngtcatcnntgncgctcttccncccnccctgtccncccantgccnngnnnctccg960
aggtcgcnggtctcnccnccnccngnttcgtgcncnggcncnngatcccgttcncnccng1020
nccntnatgctgaccagtnngngngngtngnnncctcccgtcngnacntgtntngngggg1080
gggcccnccc 1090
<210> 2
<211> 277
<212> DNA
<213> Psuedomonas fluorescens
1
CA 02326757 2000-10-25
WO 99/55368 PCT/US99/09034
<220>
<221> variation
<222> (1)...(277)
<223> n is a, t, c, or g.
<400>
2
ggnggg'gnngggncttgtgtataaatntcaggctctgacatccaggccgcaggcggcctg 60
gtcccnatggttatcgaccantccgcccgcggcnaangtgcctatnanatctactcncgt 120
ctgctcaangaacgcgtcatctttctggtgggcccggtaaaagactacatggccnacctg 180
atctgtgcgcaactnttgttccttgaanccnaaaacccgnacnaggatatccatctctat 240
atcaacnccccnggtactagttcaacccgtgaaaaaa 277
<210> 3
<211> 819
<212> DNA
<213> Psuedomonas fluorescens
<220>
<221> variation
<222> (1)...(819)
<223> n is a, t, c, or g.
<400>
3
gctngtgtctacgcntcagcaanaatgccgcccgcgacnacaacncttaatcngctgaaa 60
ntccattggatgatgctccacccgtccatccnancctggaagccaggattnctgcccgac 120
atnanggtncgggtggcaacaatctcaccgnaacctgnncctgtggtcacaancgaggtt 180
caggtcaccacggncgtcccggcaccggttgccccnctggtcaggccgggccagggnncg 240
gtngccccagangtcnatcctccctttgaccctnaancngacccgcncnatgcntggcna 300
ccnttgcntttggcaatggaccngggnggacatnttnccgcccgctatccagggcncnac 360
ccaanantacngccccggcgtccctctannntntactattcnacgcgtgggcananntgc 420
ccctngtnggcttncctttctcttccccgncncctntttttccccnnntttttttgncgc 480
gncccnctctcnntccctnccttccncnnnccntcgtctnnnnccctngtgggcctcncc 540
cctttntccttccttccncntttncttccgtggccctnctctctgnttccncncngtngc 600
gtccggttancccagcctcgctctccnccgctgnngcnctctcntttcttgcttcntctt 660
ccctgtggccctntgcgatcncncnancttctcctcgctnnggtcncanccttcngtntc 720
cgcnngngncgncnncctnctctngcnccnnnntcgtcttcgtnnncnngtnctnnnncn 780
ncagtcnngtgtngnnagnttnncgnagtntgnnatccc 819
<210> 4
<211> 832
<212> DNA
<213> Psuedomonas fluorescens
<220>
<221> variation
<222> (1)...(832)
<223> n is a, t, c, or g.
<400> 4
gatggtatcg gtnactcggt caccgctggg gtggtgctcg gaacaggttc tcgaagttcc 60
cgccagtggc cttatcgatg ctgacttcaa ctttgcccgc gtctttgtag acgtcgtctt 120
ttggtgcgtc gacagtcacg gtgccggtcg tggcgcccgc agcgatgttg atcaccgcgc 180
cgttgctcag ggtcacagtg acaggcgagc ccgcggcgtt ggtcaaggtt gcggtgtaaa 240
cgatcgaacc gccttccgca acgctatcgg ttgcactcaa agtcaggccg gtagtgtcct- 300
gaatgtctgt nanngtggtg tcngccgggg tggcgtccan gtccaatatt tcataattnc 360
2
CA 02326757 2000-10-25
WO 99155368 PCT/US99/09034
naccntggggtcctccannttnannctcaagttatcgcccccccccaaaggctcctttng420
cgtnacnaaattcaccgannccganctggcnccnaaccggaanggtganggtctgggccg480
ttcnaacanggttnnataaccaaacggaacntcgggtcaccggtttcntttaacngaagg540
nggtgttnnaaccncggncccnncttccggccaangngngaaattnncnggtgggnggaa600
aanaggtcnangttttnaangggtttccngtnancntcntnnnccccnanggntttnttn660
ntnanaaaccaaanntcnccngaatttnccnccnggtnggnttttnncngnannnnggaa720
nttnnngggtgggnnnnccnntcctttgtttnnaaaatnanncnttttngggnccnnnnc780
naaaagggncannngnggnccnnntgggnnggnnnccnnngggnccnaagnt 832
<210> 5
<211> 1054
<212> DNA
<213> Psuedomonas fluorescens
<220>
<221> variation
<222> (1)...(1054)
<223> n is a, t, c, or g.
<400> 5
cncaanggcncagagcacaggatatgcngcaatctcatggacaaacggcgccagcccnat 60
ggaggccaccgacnccacatccgtcgcgccggtcgcttgcaggcncgccaacgcancctc 120
aaggttctgcgccanttgcancnctncctcgcncaccanccnnagttgccagcnccncaa 180
actccccaccncnaanncncntnacnaaatnntgggtttccgnataccgcccncactcac 240
gcaccaattgctcacccncggcctgaacnaactggtcggtncnctncccgccccatccnc 300
tggttnaaacnggccnattccttnacccccagcaacancnaataacccggacctggccan 360
cnccgggtngctcacccgggcattaaactgcattttcaaaatatnnccggttggccacgc 420
ccgtnaggttgtcctgntaggatccnacccccantttcnctntgcccctnggnctgntcn 480
nggaanngnnccntgagctttctcgaccatctgggtttcttnctcntgcncccactcncg 540
nnncaagttttaaggtnttnnctccgggnaatcctctnnggcnannncttnaactgnaaa 600
cttccnccgaacngggncctaanantagncctatnnggggnnacnngcgttgnccaaccn 660
aactntttttttttcccagccgcggggctnttcaagtcnttgaacgnaactcctcnngtc 720
nttccacanggnctcccccctantntntaaccgcgtntcntctatnttgggngtccccgn 780
ntncatacatgncngagtanaagaagctcnancctcccnannnggntctccgccccccaa 840
tttntcccctctctccctttnancntctaaatatattctttnntgggnntnaanaagggg 900
ggcgcanaaanacctntctccggggggggttgtgggncctnnanaaacccccctttctnt 960
tntnnncccccctccgngggggctccnccctccctntttgttttccccncctannaatcc 1020
ctactcncnggnctagttgaaaaaacannaacgc 1054
<210> 6
<211> 880
<212> DNA
<213> Psuedomonas fluorescens
<220>
<221> variation
<222> (1)...(880}
<223> n is a, t, c, or g.
<400> 6
ncnnacgnntngnaagtgatcaggccnattaaacnnntgacnaaannagaacangnnggt 60
ctgttactactcttcaagaccaacccaagncgaccgtgnatagcgngncctntacgcagc 120
atcngttccncatttagattnntatccatccntaagtttcnccgggtcagaacgntnctt 180
gacgtacaacccatanngcggggtanngggnnattttnngctacctcncatgttttggaa-240
gnccnantncccnttaatnggnagcnncanncangcncnnggggattattacnactcnac 300
3
CA 02326757 2000-10-25
WO 99155368 PCTIUS99/09034
ccntgganaacnttgccactacngcnggncccccgcngngtccnggnctcccctgcccac 360
ttcccttgtctcccgncctctntncccccttttcncgtcnncttctggtgtncgnttccc 420
ctccccccngtcctcnttcancnnctngcgtctngggcacctngncgnnctcttccctnc 480
tggcccctctnncccccnttcgttntancccctctctcnacntncttcatcccgtccctn 540
ttcttnctctccnctcnccnccctntcctantcctntcgtcccnctncgntcntcgtctn 600
cctncnccncttntcgacttcnncntgttgncccncccgcngngncttctctngtcttct 660
cccgtcngcngctcagnncccntccttccnttnctnctnnctgtccgncngcgnncctgt 720
ncctncgncccctagnnnggncgcgcctcngcnncctcgtcccnngntntnntctttctg 780
cnccgtgctcnntnttcntntntcnnctcgcccatccnctncctctntnnnncgtngntt 840
ccncttctaggnccnnattccnannncnggccnttncccc 880
<210> 7
<211> 779
<212> DNA
<213> Psuedomonas fluorescens
<220>
<221> variation
<222> (1)...(779)
<223> n is a, t, c, or g.
<400> 7
ncaanncagatcctgnaaaacgggaaaggttccnttcaggtacgctacttgtgtataaaa 60
gtcagggcccaaacgccccaggtgcaacaactggtcnaaggctacntggcgggttacaac 120
cgtgcgctggtcnaacgcaaggccaaaggcctgcccnaacaatgtgccagcnaatgggta 180
cggccgatcacggcgctggacctggtcaagttgacccgccggctgttggtggaagggggc 240
gtcggccagttcgccnangcc:ctggccggcgcgcaaccgccccaggcnaccgcactcgcg 300
ggcaccccggtcaccggtttcgcggccgccgcaacccggcagcagcnttttgccctgaaa 360
cgcggcaacaatgcnttgggccatcggcancnaacgctcgttcaatgggccgttnggaat 420
ntttgcttggcaaaccccccatttttcccgttgggttaggcggcattccttttctnacca 480
naaagcacctgaaccattccc:cggcaancttggaaattcttgggccccngngcctgccaa 540
ttttgccnaaaaatcaanatcggtttcaaccanccnccttgcctggaaccaaaccgtcaa 600
aaactccaaaaaaattcccccttnccncttgcaatcnntcnaagaaccaacccttttttn 660
ccaaggnattttttttccnanaaacnncaaangtntttntnaattttacnacttaaggcc 720
anttnnaaagtncccaattttttanngtccaatttgncccnattttaaaggctccggtt 779
<210> 8
<211> 848
<212> DNA
<213> Psuedomonas fluorescens
<220>
<221> variation
<222> (1)...(848)
<223> n is a, t, c, or g.
<400> 8
gccnnnncncnattatncaagntctaagtgttnnaccanatnccaaggacataatgactt 60
ncctttattaantgtccggaccatnccatatncaaccgtgcanaccgtnaacttnaccca 120
ncatgnctccgcntgtcgtatttatannccccataagcttcncccgtcagaacgttncaa 180
taggtacantnatactgcncggcncatggcattttggctttctttatgttnggnagttcn 240
aacagcctttttatggagcgtccacagctatagggggaaantnctattcaacnctggcna 300
aantttgaaaaactnagancttcnnnggtntataggggtatcccntgaccaaannccnct 360
aattccnacnctttgntcccacttcctccctngcgcgnctttaccnngngccccgtccct-420
tccccncngnncntnggncacngggggaaangnnntcnccccgtggttttctcccngtcn 480
4
CA 02326757 2000-10-25
WO 99155368 PC"T/US99/09034
tngnnnnncctcgtgnntcccggnnccttnccccccngttcggaactnttctcccctncn 540
cccncgcgngtgcgtctnnntnncccnngntncncnggnttncncngccnccntttcctc 600
ccccccccccttanccngganccctctccctncgcntggccngccccccnggnccctccc 660
ctntnccctcggngncncncgncgcnctccttnncnttcgcctcctccnnccntcnnctc 720
cnctcntnccnntcccnnccctcntnnntcccccntgcccnnnncnccggccnttcgntc 780
ctcnnnnnnntncctgngcccgcgtgcncngtngcgncccgctntcctgcctgtcncccc 840
ccctnccc 848
<210> 9
<211> 533
<212> DNA
<213> Psuedomonas fluorescens
<220>
<221> variation
<222> (1) . .. (533)
<223> n is a, t, c, or g.
<400> 9
tatttgtgtataagntcagcgccagcagtgaccgatgtcaccgataccatcgacaccagc 60
accgtttcgctcacagcgacttcgacggtggccgaaggtgggactgtcgtttacaccgcc 120
tcggttaacgcacccgtgaccgacgctccgttggttatcaccctgttccaaacggccana 180
ccatcnccattccggttggngccagcancngcaccgtgaacttcgtgacaccaaacgacg 240
ccctcgcgggcggcgataacctgagcgtgaagattgatgacgccaagggtggcaattacn 300
aaaaactggacatcgacgccaccccggcggacaccaccgttaccgatntgcaggacacta 360
ccggcctgaccttgantgcaaccgatagcgttgctgaangcggntcgatcgtttacaccg 420
caacattgaccaacgccnccggntcgcctgtcnctgtnaccctgaacaacngngcggtga 480
tcaacatccctgcgggngtttccccccccgtnctantctacacgngngaaaaa 533
<210> 10
<211> 591
<212> DNA
<213> Psuedomonas fluorescens
<220>
<221> variation
<222> (1)...(591)
<223> n is a, t, c, or g.
<400>
tgattgtgtataagatcagccagcaaggcgccgtcgtcgggttggtaaagccccaccagc 60
aacttggccagggaactcttgcccgagccgctgcggccaatgatgccnattttctcgccc 120
ggcttgancaccaggttnatattctacacctngggnttctgctggttcgganaaatnaaa 180
nttcaactnanngnattccaacggccccttccagaactttcnggtcanggggngctcntc 240
caaattgcgctcttggggcagctccntcatctggtcganaganatcttggtcaccccccc 300
ctgttggtatcgggtcntcangcccnacaacnaaaccaacnggctgagggcgcgaccgct 360
gaacatntntcangcgaccancccacccntgctcangcnaccggcgatnatcaagtntac 420
nccnaaaanaanatgaccaccccngccagttnctggatcaacaaagtgatgttctttgcc 480
nggccgganaacatcttcacccccanttctaagcggctgaaggtgccgatagtctgttcc 540
cnctggtattggcgtnccnccccccntactantcaacncntggnaaaaaaa 591
<210> Z1
<211> 1249
<212> DNA
<213> Psuedomonas fluorescens
5
CA 02326757 2000-10-25
WO 99155368 PCT/US99/09034
<220>
<221> variation
<222> (1) . . . (1249)
<223> n is a, t, c, or g.
<400>
11
ctgggtgtataagatcagggccantngtgtcctggagtgtctgtnacagtggtttcggca60
ngcttgccctcnanatncantttttcgtaattgccaccctatggcctnctccnaatttga120
ancacnagnnacctncccantgncaagggcttcttcngcntcnngaaattcanccnacnn180
naaatngggccaaccctgantggttaccgtcntgccgcncccnctcnggncatttctctg240
ccnaagcntcccggtncctngnttgccttctaacccaagcgncngntntnnancnncctt300
gtttcncccctncngnccnacgggtggaanggttttncccccntaggggcctcnnttntt360
tctaaancgcttttccagaaaaaggcctgcccggtntacnccttcttanntntcgtcgcg420
tccnagngcttatcnctctctnnccccttcggatactnctctgtaagtttccctaaaatc480
nnctggntnggnttctnncnanaaagaanatctntgggggctttntntnttatatcctct540
cntattgtnctttncnntancntctntccnngannctcattcccganaccctctnnnnnc600
cgccttncnctctcntatantttctnagttgaaccgctcntcccnctncactnttattnn660
ntnngcgggncgcncnctttgtccctcnttaaccctggggntngcgagcntacnggctcn720
ctccctaatnctctgggcggtnnnggggcgnacgtcctcgccttcgttcnnaaatnnttc780
ntaanttccaacntcgngcngccccgctccggnnnnnncaatnttntctcccccctattc840
tngctacncagcgngtgatnatcccnttctcannagcctnttcngggtataacngngnag900
ngannctctctctttagtnccnnaanccnatctctnctcctcttcttcnggtcgcgctnc960
tanancnctggtcagttnnntcctcnatgnnncnnaggntcccnnttnctcnctcncttc1020
ttgnnnactcccngtntgtccnggantggntcttccgcctcggnancnntgctcctntnt1080
tcncnanncgaanantctccttnctaacacnccttcgccnaanacnttttnactctnccc1140
tcntccttcnctnnctcgtctnattntnanttncntncctanncngtgactcgttagcnc1200
tccgntctttccnantcttcgcccccntctccncnctcnannctatccc 1249
<210> 12
<211> 373
<212> DNA
<213> Psuedomonas fluorescens
<220>
<221> variation
<222> (1)...(373)
<223> n is a, t, c, or g.
<400> 12
tnattgtgtataagntcaggactagagntcctctcttagtnacggttcgcagcgttttgc60
accgcatcgtccantgcgtnccccaccccgtactagtcgacacgtgganaaactcgcccg120
gagtcgacncgtgggtantagtcgaagcgtggnganggntcncgntatnaggcntaanan180
ctgcatcacgaaagcngggggaaggttctcnaaaanttcnccnatgagggagaacacgga240
aanccctttaccncaggggcggcccngaaatctggcaacngancggnnggagaatcnncc300
atttcgtcagctccatgggcaccaccgggaacatcatgggcgtcnnntnccngtactant360
cgaccgtggccaa 373
<210> 13
<211> 683
<212> DNA
<213> Psuedomonas fluorescens
<220>
<221> variation
<222> (1)...(683)
6
CA 02326757 2000-10-25
WO 99/55368 PCTIUS99/09034
<223> n is a, t, c, or g.
<400>
13
tgactgtgtgttataagntcagncgcacntggnagtccncntntggttggtangatccgc 60
ancnattaagctggccnngggaaantcnggttcaacccgntgcngncaatganncnntat 120
ttcactcncccggcgtncac.ncctnngtantantcgacccntggncantantantctaca 180
nntggtcaaaacntttcgannnngtaggngncgccctntntanangtnancttcgtnacg 240
ggggaggaaaangctccccggnggccannngccgagcctaaaaaangaggcangtanggg 300
tgngaaaaaanaatanctngatangacnccacccnntttgacgccaattaaccgangtac 360
angacccngncnaactcattttnagtgtncgcgacagaaattttnanggncgcnccangn 420
gaanggntctcnanggtttngnaaannnaaacnaggccctccnntaaatggtggacccgc 480
ggnnaannttnnccncgantggggttttgaaattacttttcaacaatcttcaaaacntcc 540
gggtcnanccaggaggggncaaaaaaaaaatnttttccgngtngccnnaaaaatatccna 600
aattttntcnccccccccccnccnnaaaagaagggngggggggaaggggaaaaagggggg 660
aangaggg99999aa99999999 683
<210> 14
<211> 672
<212> DNA
<213> Psuedomonas fluorescens
<220>
<221> variation
<222> (1)...(672)
<223> n is a, t, c, or g.
<400>
14
gtgcttgtgtataagntcagnccctggcctgngcgncnacaactccggtnnccgtctaca 60
ntttagcnaaggatcggtcattgcctngtctnctggntanactnccgggacnatccacct 120
caatactccnnccattnacgtctatggtaaccnggaggtcggtcancagnncnattaccg 180
gtnctaccngtggaaacttcgaaaatctngtggcnaacacgggacctgcggtccccncca 240
nttccgattcnggnganacnncatggntgtcncnnacnggnngcnacnccattcctgnan 300
gggngccaanttcctttcncntcaanccgtnggnaacgggcccnaatnccgtnaacgtta 360
ccnnnganaaatggtcngttttccattcccccgggggnanaaaccgggacngaagatttc 420
aanacccgcgcntntnattntaccnnggggnnngcgggtcgncccccncnnnacnngtga 480
naanggggggctnttcaaanttcntngtgttnancacnaccctggggtttnatantantt 540
ncanaattncgggnggaanaccaccggggcttnannncttnnaacnggncnnncnaccnn 600
ctttccnnnnngggggggngttccnncnnccccccnttnnnttnntttnnaaannttttt 660
gggggaaaaaas
672
<210> I5
<211> 1676
<212> DNA
<213> Psuedomonas fluorescens
<220>
<221> variation
<222> (1)...(1676)
<223> n is a, t, c, or g.
<400> 15
tgcttgtgta taagatcagg gcccgncgcc nccnnantta ngtctgggtc aacgacacnn 60
catnggtgcn gtggnanctc antttacnag gcncttaaaa ngcatnattg ttatncagtn 120
ngncgaggtn gntcctcccn tanccgaagn natntgnnna cttggaanga tttnancntt. 180
ttccantcgg tngntaccag nngtgantcn tcantttctg acacccnctg gtnncnntcc 240
7
CA 02326757 2000-10-25
WO 99/55368 PCT/US99109034
tgttcacncctanannngaccnctctctccgntgngggcctggngcntaatatnntaccg 300
gctttnnantgctgtcagtatnantctcgnnagcngnaaantcnctctncanncggtgtn 360
tntngtctcncncttctcctnctcntacactcactnactntntnctgnnaatcnntctnn 420
ctgtantatcacggncancncgttctntgtggggctcncttganaggctccccctnacct 480
ctctannnacngtgtcgggtatnncnctataanagtcttgtgcatgtntcacagtnacat 540
cgtcgccnnncncgngtagctctgcatcntcgcccttttntttctnttctctcngcaaan 600
atcttnntntctctcnntcnatcattattcncangcgnnggggtctccntccccctcnnn 660
ncntcngttcnanacangtcntntttagctatgtcttatgtncncctntcanttttnctn 720
cncttcncacncttcagannggctnngnctgacctctatagtcgntcntctcctccctct 780
nctnntctctcngcnataacgcncntncncttctggnetctcnngctctctnntnntata 840
tccnncgccnnttctctctatctctccgntntgtgctcntcaattgtncnctctctcgtn 900
cnnctgtcnnntctancgtnttcttgacttnannaatacntacctctcttngcctctctn 960
cntntnctctcnccgcatctctnngaccgctncctctgcncngcgcnatctcttctttnc 1020
gttctccnnttctcgcgnctctctnngtactngcttttcccnctacctntctcttgctcc 1080
ttcctcgcntcntctncctctctcttctctntctangtcnncncgnccatnggctttctc 1140
tcgctncntntcnctcttctntctntnccgtctcgtctngatcnntctctcatcatntnc 1200
tntnttntcatcangctntntgncactctccnatctgtntctctntcttantnntccntc 1260
cttcctnttctcttanctcncgtnnatnncnttctctgatntcctcnagtatntctatgt 1320
acgctnncnttnatcgngnncctntctctatcancatcatnctagctnncttcctatngt 1380
cctgctctcactntttctgccnanatatnnatcnctnctctntatcttcntanattnntn 1440
cctntnaatgtttnanaatgctctactcnanctctctntntcttnnnctccagntcactc 1500
tctananntgcctnncgttatacgntcttntncgctttantgcgtntnctatcantnncg 1560
ctcttttnttctcntctcnccntgtncttnncacactntcttcatctcttctcnnatatn 1620
natgtcnntctatnnccncttctatgctntcncctntcnanccacantntnntctc 1676
<210> 16
<211> 721
<212> DNA
<213> Psuedomonas fluorescens
<220>
<221> variation
<222> (1) ... (721)
<223> n is a, t, c, or g.
<400>
16
tncttgtgtataagatcaggcctatngccgnctgnggnttntctgggtgcncgacgcgcc 60
attcgaaaaaancagctccgnnaccngttccaantacacnnngttgtncnnccgnagttc 120
cagcttcngcctcgccnacgt.nnacaattcctncnaaaccctgggtgtgntnttccnnna 180
gctnatgtanganngtcnatnggnctgnnngnactgtcntaccnagncncangtnggcac 240
caaccngagcntcattcncgcnnacnncgaaccccgngngnatcgcttctntccnaacnc 300
cnncaantccaacnccatnggttgtgttgncnacgacnngngcgaaaacnncgcncacnn 360
ngnccnagtcaagttcccgcatacccacagcnggtcngggggtntcnccccctntcntgt 420
tccaaacatnnccatanaannnnnggtntgctgggggaatccaanccntcnnctgnggtt 480
cgatcnaaacaanatangggtcaanggncngccacttgcntnatnaatttcnncagtgcc 540
cntnnctnnctgatnngcnaagccnncnnngggttggngggggnnnttncccnnntatna 600
antanaaacggcngntccnttnncnnccangggtgnttgnngntttnnaaaacnnctttt 660
nnnnaaananccccccncctntttnccnnggannannatccnnaaannnngttccnnccc 720
c 721
<210> 17
<211> 452
<212> DNA
<213> Psuedomonas fluorescens
8
CA 02326757 2000-10-25
WO 99155368 PGT/US99109034
<220>
<221> variation
<222> (1)...(452)
<223> n is a, t, c, or g.
<400> 17
atnnngnnnntncttgtgtataagntcagggcnccncctntcnnaacttngtctgggtcg 60
ngctacacnncannggnnactggcagctcggtnaccgctacctnanaacgcttcantgtt 120
cctcagcnggtccacgtccagccttgagccacatgtnaaaanncngccnacaanccnngg 180
ngtnaanntccacgnnntgcncgacgantgccaatnnaannttctcnacngtttcacctg 240
gaangaccttgccganaccnanacnntcaccaanggtgaanncaactcccggnagatncg 300
ctncacnccngaccccaacgaatcctncgccgnnggttttnttagcancatcgncgncan 360
caaccangnccanttcncccr_gntntcattccnnccnancgacggnnnntctgggcgtcn 420
ccccccccgtactantctacncntnncaaaas 452
<210> 18
<211> 442
<212> DNA
<213> Psuedomonas fluorescens
<220>
<221> variation
<222> (1)...(422)
<223> n is a, t, c, or g.
<400> 18
tncttgtgtataagntcaggntctnagatgagctcggtagttcangagnttttctgcgac 60
cgcgnnnccgacgnctgnaatcgntggcnaggtnngcntanacannnnaaagtanncccc 120
tcgaancgntcnntgacctcctgntccaaatngtcacgngcattggncgacgcnngcnca 180
cccnncacttcgctcgacntcccaaaancngcctgggccnngcncgncnggattnngccc 240
gacatcnnctnancaaantnccccnccgcntactngnccanccttgaccannttttgcnc 300
tcctntccttactgggtcngcttcgntcccggnttgctnaccannatggtccnaancctg 360
ctgtcctncactctcaaatncgcccccggccaaccntgctgatcgncttcnncncccnag 420
tnctattcaacccctgcccaas 442
<210> 19
<211> 538
<212> DNA
<213> Psuedomonas fluorescens
<220>
<221> variation
<222> (1)...(538)
<223> n is a, t, c, or g.
<400>
19
ctttgttgtataagnatcagacactagagcttgccccttctncancncttcnatggacag 60
cggctttcgggccgtcgagcaacgatctgtccacagtnnancaccannaggcgntccacc 120
atcaanagaaagganncncggtncntnaccacnnacacangtcttgttatcnaccacggc 180
agccaagcgntgtttcaaacgttcttcagcngtgttgtccatggatctggttggttcgtc 240
caanaacaagataggcgtgttnancnccntncnactngacacgtggaaattntngctcta 300
accncccgacangttctgtcnncnctcnccnaatnnnaattcataaccttncngatgccn 360
gcgggcaaattcatncncncccgccanttcacggnctggaacacanttcaactncnacgt 420
ttcnggcgccnaaaantcttgttgtcncccaggntttnnnnancancnngatnttnttgg.480
ggnnccttnccnaanttnttnnncnnctcccntnannttgaanntngnnggatgttna 538
9
CA 02326757 2000-10-25
WO 99155368 PCT/US99/09034
<210> 2a
<211> 218
<212> DNA
<213> Psuedomonas fluorescens
<220>
<221> variation
<222> (1}...(218)
<223> n is a, t, c, or g.
<400> 20
tnatttgtgt ataagttcag gttgctngnt gnacgccatc ccggccaagg gttgccggcg 60
tcacccacat ngtactagtc nncgcgtggc cnaaacggtg angtctncta attgatgctt 120
gccaacgntt naaaaaaaag tatngacagg gtnttaacca tcagnttntn ccnaaangta 180
ctagtctacc cgtggccana naantnnann nntggnca 218
<210> 21
<211> 642
<212> DNA
<213> Psuedomonas fluorescens
<220>
<221> variation
<222> (1}...(642}
<223> n is a, t, c, or g.
<400> 21
tnctttgtgtataagntcaggccccggggtancgncagtangtntgncgancggctcctg 60
caagctgncggcgrianatccngcgctncctcttnntgcntctgaaatgcattncccctcn 120
atgagtcggctgtcttcanggttnggntggttncaacatccatcancttgntctccnctg 180
ttaccccngcngtnncctgccgccctctcagaccnggatncccgtncancaccccctagt 240
tctaanaacgtaccangaanaangaacacccgctcgcgggtgggcctacttcacctatcc 300
tgcccggctgacgccgttggatacaccaaggaaagtctacacnaaccctttggcaaaatc 360
ctgtntatcgtgcgaaaaangatggatataccgaaaaaatcgctatantgaccccnantc 420
anggttnttgcaacggaaaancnctncttccctgctgttttgtggaatatctaccgactg 480
ganacaggccaatgcatgaaattactgaactgaagggacaagcaaaaaaccatccaanna 540
actncaccaacnanctggccgagtnggtttnaatccccgcgccggccaaaaaacgccngc 600
attaannaangcnggttgtttctnttnctcgnnnaaanaaas 642
<210> 22
<211> 583
<212> DNA
<213> Psuedomonas fluorescens
<220>
<221> variation
<222> (I)...(583)
<223> n is a, t, c, or g.
<400>
22
tattgtgtataagatcagnccagcngtggtcntacagntgggacaggcggcgtcgcaagc 60
ttcccctcgagtgntgntccagnnatancgagncntgngtgttataaacaaancacggnn 120
atcgtataacnccgttcgtgacgncgtatcgccanatctnnaatnccgnaaacgggtnga 180
aatccgtaatccaagtgttatcntgcncgggatgttctagagcaactccatcatctntac 240
aancttgttcgancttgtcatggcacctccactgagacaacggtgtnctcaatagtcanc 300
CA 02326757 2000-10-25
WO 99/55368 PCT/US99109034
acncccctnncccccngggagganatntntcnctggnnccacncnancancatctttaac 360
gnatatttcttntttatcagcccnnttggttacccnntgcgtcattgggtggntgcagcg 420
acaacncccggagaaancnatttncttggnnggctcntcnatcatcngcaccncccccca 480
aattganaaggtcgccccncnccnngaganacnntancccangtcggccntcnncangtg 540
cgtggcgtcccccncccgtnctantcnacccttnccagnccaa 583
<210> 23
<211> 360
<212> DNA
<213> Psuedomonas fluorescens
<220>
<221> variation
<222> (1}...(360}
<223> n is a, t, c, or g.
<400>
23
tctttaantagnaccgacgantcctcctancacccctaaccagtcnacggctngtggcga 60
ctggatatngacactngaccaggtcggggcntcnccccacnnntnctattcaacgcttgg 120
ccaaacacgtggtcanatctctcnccagtgcccctcntancnttctccgatacacttntc 180
ttcttccaatatcccccgctaatcccctctcatcngtgaannggccccgctccattaaaa 240
agcatngngcnnacaaacaaccngagatcnttcnnnttnncanncctcccgntccctcaa 300
atttcgnnaggggnccggttgcgacccnaaaccgcntccnngnggnaaatttcttncntt 360
<210> 24
<211> 494
<212> DNA
<213> Psuedomonas fluorescens
<220>
<221> variation
<222> (1) .. . (494)
<223> n is a, t, c, or g.
<400> 24
tncttgtgtataagntcaggcgcaggcgngaccgcactanctatgtgangngctctcngt 60
cggngnnncaggcnatgcccgtcattgtccatntgcngacnaccctactactcttntgcn 120
tgancatgactgccgggccganaagttgcgcattgtcacctaaccctgggcgcctgtatg 180
tctncnaaaanaactgcaagatgctgggcctggactacnaaaccacggccatcgtgttca 240
agcncctgggtntcgacgtggaatggcagttcctgccgtggaancgctgcctggtgatgc 300
tggancaggggttggcgtaccgnncccngtacnnttnnacccntgnnnaaancnatnccn 360
tgcngctttaccccnncnaancnctntcngacntggaatttgtgatnttctacnccnatg 420
cccngccccatccntttcgcncncncnataanctgggngnccccncccccgtnntantcn 480
accntggnnaanaa 494
<210> 25
<211> 23
<212> DNA
<213> Escherichia coli
<400> 25
gaacgttacc atgttaggag gtc 23
<210> 26
<211> 35
11
CA 02326757 2000-10-25
WO 99/55368 PCT/US99/09034
<212> DNA
<213> Artificial Sequence
<220>
<221> variation
<222> (1)...(35)
<223> n is a, t, c, or g.
<223> Random sequence
<400> 26
ggccacgcgt cgactagtac nnnnnnnnnn gatat 35
<210> 27
<211> 20
<212> DNA
<213> Artificial Sequence
<220>
<223> Random sequence
<400> 27
ggccacgcgt cgactagtac 20
<210> 28
<211> 24
<212> DNA
<213> Escherichia coli
<400> 28
cgggaaaggt tccgttcagg acgc 24
<210> 29
<211> 35
<212> DNA
<213> Escherichia coli
<220>
<221> variation
<222> (1)...(35)
<223> n is a, t, c, or g.
<400> 29
ggccacgcgt cgactagtac nnnnnnnnnn acgcc 35
<210> 30
<211> 17
<212> DNA
<213> Escherichia coli
<400> 30
caggctctcc cgtggag 17
<210> 31
<211> 17
12
CA 02326757 2000-10-25
WO 99/553b8 PG"T/US99/09034
<212> DNA
<213> Escherichia coli
<400> 31
ctgcctccca gagcctg 17
<210> 32
<211> 23
<212> DNA
<213> Escherichia coli
<400> 32
gcttccttta gcagcccttg cgc 23
<210> 33
<211> 24
<212> DNA
<213> Escherichia coli
<400> 33
cttccatgtg acctcctaac atgg 24
<210> 34
<211> 595
<212> PRT
<213> Escherichia coli
<400> 34
Met Ala Gln Val Ile Asn Thr~Asn Ser Leu Ser Leu Ile Thr Gln Asn
1 5 10 15
Asn Ile Asn Lys Asn Gln Ser Ala Leu Ser Ser Ser Ile Glu Arg Leu
20 25 30
Ser Ser Gly Leu Arg Ile Asn Ser Ala Lys Asp Asp Ala Ala Gly Gln
35 40 45
Ala Ile Ala Asn Arg Phe Thr Ser Asn Ile Lys Gly Leu Thr Gln Ala
50 55 60
Ala Arg Asn Ala Asn Asp Gly Ile Ser Val Ala Gln Thr Thr Glu Gly
65 70 75 80
Ala Leu Ser Glu Ile Asn Asn Asn Leu Gln Arg Ile Arg Glu Leu Thr
85 90 95
Val Gln Ala Ser Thr Gly Thr Asn Ser Asp Ser Asp Leu Asp Ser Ile
100 105 110
Gln Asp Glu Ile Lys Ser Arg Leu Asp Glu Ile Asp Arg Val Ser Gly
115 120 125
Gln Thr G1n Phe Asn Gly Val Asn Val Leu Ala Lys Asp Gly Ser Met
130 135 140
Lys Ile Gln Val Gly Ala Asn Asp Gly Gln Thr Ile Thr Ile Asp Leu
145 150 155 160
Lys Lys Ile Asp Ser Asp Thr Leu Gly Leu Asn Gly Phe Asn Val Asn
165 170 175
Gly Ser Gly Thr Ile Ala Asn Lys Ala Ala Thr Ile Ser Asp Leu Thr
180 185 190
Ala Ala Lys Met Asp Ala Ala Thr Asn Thr Ile Thr Thr Thr Asn Asn
195 200 205
Ala Leu Thr Ala Ser Lys Ala Leu Asp Gln Leu Lys Asp Gly Asp Thr
13
CA 02326757 2000-10-25
WO 99155368 PCT/US99109034
210 215 220
Val Thr Ile Lys Ala Asp Ala Ala Gln Thr Ala Thr Val Tyr Thr Tyr
225 230 235 240
Asn Ala Ser Ala Gly Asn Phe Ser Phe Ser Asn Val Ser Asn Asn Thr
245 250 255
Ser Ala Lys Ala Gly Asp Val Ala Ala Ser Leu Leu Pro Pro Ala Gly
260 265 270
Gln Thr Ala Ser Gly Val Tyr Lys Ala Ala Ser Gly Glu Val Asn Phe
275 280 285
Asp Val Asp Ala Asn Gly Lys Ile Thr Ile Gly Gly Gln Glu Ala Tyr
290 295 300
Leu Thr Ser Asp Gly Asn Leu Thr Thr Asn Asp Ala Gly Gly Ala Thr
305 31U 315 320
Ala Ala Thr Leu Asp Gly Leu Phe Lys Lys Ala Gly Asp Gly Gln Ser
325 330 335
Ile Gly Phe Asn Lys Thr Ala Ser Val Thr Met Gly Gly Thr Thr Tyr
340 345 350
Asn Phe Lys Thr Gly Ala Asp Ala Gly Ala Ala Thr Ala Asn Ala Gly
355 360 365
Val Ser Phe Thr Asp Thr Ala Ser Lys Glu Thr Val Leu Asn Lys Val
370 375 3B0
Ala Thr Ala Lys Gln Gly Thr Ala Val Ala Ala Asn Gly Asp Thr Ser
385 390 395 400
Ala Thr Ile Thr Tyr Lys Ser Gly Val Gln Thr Tyr Gln Ala Val Phe
405 410 415
Ala Ala Gly Asp Gly Thr Ala Ser Ala Lys Tyr Ala Asp Asn Thr Asp
420 425 430
Val Ser Asn Ala Thr Ala Thr Tyr Thr Asp Ala Asp Gly Glu Met Thr
435 440 445
Thr Ile Gly Ser Tyr Thr Thr Lys Tyr Ser Ile Asp Ala Asn Asn Gly
450 455 460
Lys Val Thr Val Asp Ser Gly Thr Gly Ser Gly Lys Tyr Ala Pro Lys
465 470 4?5 480
Val Gly Ala Glu Val Tyr Val Ser Ala Asn Gly Thr Leu Thr Thr Asp
485 490 495
Ala Thr Ser Glu Gly Thr Val Thr Lys Asp Pro Leu Lys Ala Leu Asp
500 505 510
Glu Ala Ile Ser Ser Ile Asp Lys Phe Arg Ser Ser Leu Gly Ala Ile
515 520 525
Gln Asn Arg Leu Asp Ser Ala Val Thr Asn Leu Asn Asn Thr Thr Thr
530 535 540
Asn Leu Ser Glu Ala Gln Ser Arg Ile Gln Asp Ala Asp Tyr Ala Thr
545 550 555 560
Glu Val Ser Asn Met Ser Lys Ala Gln Ile Ile Gln Gln Ala Gly Asn
565 570 575
Ser Val Leu Ala Lys Ala Asn Gln Val Pro Gln Gln Val Leu Ser Leu
580 585 590
Leu Gln Gly
595
<210> 35
<211> 119
<212> PRT
<213> Escherichia coli
14
CA 02326757 2000-10-25
WO 99/55368 PCT/US99/09034
<400> 35
Met Gly Ile Met His Thr Ser Glu Leu Leu Lys His Ile Tyr Asp Ile
1 5 10 15
Asn Leu Ser Tyr Leu Leu Leu Ala Gln Arg Leu Ile Val Gln Asp Lys
20 25 30
Ala Ser Ala Met Phe Arg Leu Gly Ile Asn Glu Glu Met Ala Thr Thr
35 40 45
Leu Ala Ala Leu Thr Leu Pro Gln Met Val Lys Leu Ala Glu Thr Asn
50 55 60
Gln Leu Val Cys His Phe Arg Phe Asp Ser His Gln Thr Ile Thr Gln
65 70 75 80
Leu Thr Gln Asp Ser Arg Val Asp Asp Leu Gln G1n Ile His Thr Gly
85 90 95
Ile Met Leu Ser Thr Arg Leu Leu Asn Asp Val Asn Gln Pro Glu Glu
100 105 110
Ala Leu Arg Lys Lys Arg Ala
115
<210> 36
<211> 295
<212> PRT
<213> Escherichia coli
<400> 36
Met Leu Ile Leu Leu Gly Tyr Leu Val Val Leu Gly Thr Val Phe Gly
1 5 10 15
Gly Tyr Leu Met Thr Gly Gly Ser Leu Gly Ala Leu Tyr Gln Pro Ala
20 25 30
Glu Leu Val Ile Ile Ala Gly Ala Gly Ile Gly Ser Phe Ile Val Gly
35 40 45
Asn Asn Gly Lys Ala Ile Lys Gly Thr Leu Lys Ala Leu Pro Leu Leu
50 55 60
Phe Arg Arg Ser Lys Tyr Thr Lys Ala Met Tyr Met Asp Leu Leu Ala
65 70 75 80
Leu Leu Tyr Arg Leu Met Ala Lys Ser Arg Gln Met Gly Met Phe Ser
85 90 95
Leu Glu Arg Asp Ile Glu Asn Pro Arg Glu Ser Glu Ile Phe Ala Ser
100 105 110
Tyr Pro Arg Ile Leu Ala Asp Ser Val Met Leu Asp Phe Ile Val Asp
115 120 125
Tyr Leu Arg Leu Ile Ile Ser Gly His Met Asn Thr Phe Glu Ile Glu
130 135 140
Ala Leu Met Asp Glu Glu Ile Glu Thr His Glu Ser Glu Ala Glu Val
145 150 155 160
Pro Ala Asn Ser Leu Ala Leu Val Gly Asp Ser Leu Pro Ala Phe Gly
165 170 175
Ile Val Ala Ala Val Met Gly Val Val His Ala Leu Gly Ser Ala Asp
180 185 190
Arg Pro Ala Ala Glu Leu Gly Ala Leu Ile Ala His Ala Met Val Gly
195 200 205
Thr Phe Leu Gly Ile Leu Leu Ala Tyr Gly Phe Ile Ser Pro Leu Ala
210 215 220
Thr Val Leu Arg Gln Lys Ser Ala Glu Thr Ser Lys Met Met Gln Cys
225 230 235 240
Val Lys Val Thr Leu Leu Ser Asn Leu Asn Gly Tyr Ala Pro Pro Ile
CA 02326757 2000-10-25
WO 99155368 PCT/US99/09034
245 250 255
Ala Val Glu Phe Gly Arg Lys Thr Leu Tyr Ser Ser Glu Arg Pro Ser
260 265 270
Phe Ile Glu Leu Glu Glu His Val Arg Ala Val Lys Asn Pro Gln Gln
275 280 285
Gln Thr Thr Thr Glu Glu Ala
290 295
<210> 37
<211> 308
<212> PRT
<213> Escherichia coli
<400> 37
Met Lys Asn Gln Ala His Pro Ile Ile Val Val Lys Arg Arg Lys Ala
1 5 10 15
Lys Ser His Gly Ala Ala His Gly Ser Trp Lys Ile Ala Tyr Ala Asp
20 25 30
Phe Met Thr Ala Met Met Ala Phe Phe Leu Val Met Trp Leu Ile Ser
35 40 45
Ile Ser Ser Pro Lys Glu Leu Ile Gln Ile Ala Glu Tyr Phe Arg Thr
50 55 60
Pro Leu Ala Thr Ala Val Thr Gly Gly Asp Arg Ile Ser Asn Ser Glu
65 70 75 80
Ser Pro Ile Pro Gly Gly Gly Asp Asp Tyr Thr Gln Ser Gln Gly Glu
85 90 95
Val Asn Lys Gln Pro Asn Ile Glu Glu Leu Lys Lys Arg Met Glu Gln
100 105 110
Ser Arg Leu Arg Lys Leu Arg Gly Asp Leu Asp Gln Leu Ile Glu Ser
115 120 125
Asp Pro Lys Leu Arg Ala Leu Arg Pro His Leu Lys Ile Asp Leu Val
130 135 140
Gln Glu Gly Leu Arg Ile Gln Ile Ile Asp Ser Gln Asn Arg Pro Met
145 150 I55 160
Phe Arg Thr Gly Ser Ala Asp Val Glu Pro Tyr Met Arg Asp Ile Leu
165 170 175
Arg Ala Ile Ala Pro Val Leu Asn Gly Ile Pro Asn Arg Ile Ser Leu
180 185 190
Ser Gly His Thr Asp Asp Phe Pro Tyr Ala Ser Gly Glu Lys Gly Tyr
195 200 205
Ser Asn Trp Glu Leu Ser Ala Asp Arg Ala Asn Ala Ser Arg Arg Glu
210 215 220
Leu Met Val Gly Gly Leu Asp Ser Gly Lys Val Leu Arg Val Val Gly
225 230 235 240
Met Ala Ala Thr Met Arg Leu Ser Asp Arg Gly Pro Asp Asp Ala Val
245 250 255
Asn Arg Arg Ile Ser Leu Leu Val Leu Asn Lys Gln Ala Glu Gln Ala
260 265 270
Ile Leu His Glu Asn Ala Glu Ser G1n Asn Glu Pro Val Ser Ala Leu
275 280 285
Glu Lys Pro Glu Val Ala Pro Gln Val Ser Val Pro Thr Met Pro Ser
290 295 300
Ala Glu Pro Arg
305
16
CA 02326757 2000-10-25
WO 99/55368 PCT/US99/09034
<210> 38
<211> 245
<212> PRT
<213> Escherichia coli
<400> 38
Met Arg Arg Leu Leu Ser Val Ala Pro Val Leu Leu Trp Leu Ile Thr
1 5 10 15
Pro Leu Ala Phe Ala Gln Leu Pro Gly Ile Thr Ser Gln Pro Leu Pro
20 25 30
Gly Gly Gly Gln Ser Trp Ser Leu Pro Val Gln Thr Leu Val Phe Ile
35 40 45
Thr Ser Leu Thr Phe Ile Pro Ala Ile Leu Leu Met Met Thr Ser Phe
50 55 60
Thr Arg Ile Ile Ile Val. Phe Gly Leu Leu Arg Asn Ala Leu Gly Thr
65 70 75 80
Pro Ser Ala Pro Pro Asn Gln Val Leu Leu Gly Leu Ala Leu Phe Leu
85 90 95
Thr Phe Phe Ile Met Ser Pro Val Ile Asp Lys Ile Tyr Val Asp Ala
100 105 110
Tyr Gln Pro Phe Ser Glu Glu Lys Ile Ser Met Gln Glu Ala Leu Glu
115 120 125
Lys Gly Ala Gln Pro Leu Arg Glu Phe Met Leu Arg Gln Thr Arg Glu
130 135 140
Ala Asp Leu Gly Leu Phe Ala Arg Leu Ala Asn Thr Gly Pro Leu Gln
145 150 155 160
Gly Pro Glu Ala Val Pro Met Arg IIe Leu Leu Pro Ala Tyr Val Thr
165 170 175
Ser Glu Leu Lys Thr Ala Phe Gln Ile Gly Phe Thr Ile Phe Ile Pro
180 185 190
Phe Leu Ile Ile Asp Leu Val Ile Ala Ser Val Leu Met Ala Leu Gly
195 200 205
Met Met Met Val Pro Pro Ala Thr Ile Ala Leu Pro Phe Lys Leu Met
210 215 220
Leu Phe Val Leu Val Asp Gly Trp Gln Leu Leu Val Gly Ser Leu Ala
225 230 235 240
Gln Ser Phe Tyr Ser
245
<210> 39
<211> 375
<212> PRT
<213> Escherichia coli
<400> 39
Met Ile Arg Leu Ala Pro Leu Ile Thr Ala Asp Val Asp Thr Thr Thr
1 5 10 15
Leu Pro Gly Gly Lys Ala Ser Asp Ala Ala Gln Asp Phe Leu Ala Leu
20 25 30
Leu Ser GIu Ala Leu Ala Gly Glu Thr Thr Thr Asp Lys Ala Ala Pro
35 40 45
Gln Leu Leu Val Ala Thr Asp Lys Pro Thr Thr Lys Gly Glu Pro Leu
50 55 60
Ile Ser Asp IIe Val Ser Asp Ala Gln Gln Ala Asn Leu Leu Ile Pro
65 70 75 80
17
CA 02326757 2000-10-25
WO 99/55368 PGTNS99/09034
Val Asp Glu Thr Pro Pro Val Ile Asn Asp Glu Gln Ser Thr Ser Thr
85 90 95
Pro Leu Thr Thr Ala Gln Thr Met Ala Leu Ala Ala Val Ala Asp Lys
100 105 110
Asn Thr Thr Lys Asp Glu Lys Ala Asp Asp Leu Asn Glu Asp Val Thr
115 120 125
Ala Ser Leu Ser Ala Leu Phe Ala Met Leu Pro Gly Phe Asp Asn Thr
130 135 140
Pro Lys Val Thr Asp Ala Pro Ser Thr Val Leu Pro Thr Glu Lys Pro
145 150 155 160
Thr Leu Phe Thr Lys Leu Thr Ser Glu Gln Leu Thr Thr Ala Gln Pro
165 170 175
Asp Asp Ala Pro Gly Thr Pro Ala Gln Pro Leu Thr Pro Leu Val Ala
180 185 190
Glu Ala Gln Ser Lys Ala Glu Val Ile Ser Thr Pro Ser Pro Val Thr
195 200 205
Ala Ala Ala Ser Pro Leu Ile Thr Pro His Gln Thr Gln Pro Leu Pro
210 215 220
Thr Val Ala Ala Pro Val Leu Ser Ala Pro Leu Gly Ser His Glu Trp
225 230 235 240
Gln G1n Ser Leu Ser Gln His Ile Ser Leu Phe Thr Arg Gln Gly Gln
245 250 255
Gln Ser Ala Glu Leu Arg Leu His Pro Gln Asp Leu Gly Glu Val Gln
260 265 270
Ile Ser Leu Lys Val Asp Asp Asn Gln Ala Gln Ile Gln Met Val Ser
275 280 285
Pro His Gln His Val Arg Ala Ala Leu Glu Ala Ala Leu Pro Val Leu
290 295 300
Arg Thr Gln Leu Ala Glu Ser Gly Ile Gln Leu Gly Gln Ser Asn Ile
305 310 315 320
Ser Gly Glu Ser Phe Ser Gly Gln Gln Gln Ala Ala Ser Gln Gln Gln
325 330 335
Gln Ser Gln Arg Thr Ala Asn His Glu Pro Leu Ala Gly Glu Asp Asp
340 345 350
Asp Thr Leu Pro Val Pro Val Ser Leu Gln Gly Arg Val Thr Gly Asn
355 360 365
Ser Gly Val Asp Ile Phe Ala
370 375
<210> 40
<211> 547
<212> PRT
<213> Escherichia coli
<400> 40
Met Ser Ser Leu Ile Asn Asn Ala Met Ser Gly Leu Asn Ala Ala Gln
1 5 10 15
Ala Ala Leu Asn Thr Ala Ser Asn Asn Ile Ser Ser Tyr Asn Val Ala
20 25 30
Gly Tyr Thr Arg Gln Thr Thr Ile Met Ala Gln Ala Asn Ser Thr Leu
35 40 45
Gly Ala Gly Gly Trp Val Gly Asn Gly Val Tyr Val Ser Gly Val Gln
50 55 60
Arg Glu Tyr Asp Ala Phe Ile Thr Asn Gln Leu Arg Ala Ala Gln Thr
65 70 75 80
18
CA 02326757 2000-10-25
WO 99/55368 PCT/US99/09034
Gln Ser Ser Gly Leu Thr Ala Arg Tyr Glu Gln Met Ser Lys Ile Asp
85 90 95
Asn Met Leu Ser Thr Ser Thr Ser Ser Leu Ala Thr Gln Met Gln Asp
100 105 110
Phe Phe Thr Ser Leu Gln Thr Leu Val Ser Asn Ala Glu Asp Pro Ala
115 120 125
Ala Arg Gln Ala Leu Ile Gly Lys Ser Glu Gly Leu Val Asn Gln Phe
130 135 140
Lys Thr Thr Asp Gln Tyr Leu Arg Asp Gln Asp Lys Gln Val Asn Ile
145 150 155 160
A1a Ile Gly Ala Ser Val Asp Gln Ile Asn Asn Tyr Ala Lys Gln Ile
165 170 175
Ala Ser Leu Asn Asp Gln Ile Ser Arg Leu Thr Gly Val Gly Ala Gly
180 185 190
Ala Ser Pro Asn Asn Leu Leu Asp Gln Arg Asp Gln Leu Val Ser Glu
195 200 205
Leu Asn Gln Ile Val Gly Val G1u Val Ser Val Gln Asp Gly Gly Thr
210 215 220
Tyr Asn Ile Thr Met Ala Asn Gly Tyr Ser Leu Val Gln Gly Ser Thr
225 230 235 240
Ala Arg Gln Leu Ala Ala Val Pro Ser Ser Ala Asp Pro Ser Arg Thr
245 250 255
Thr Val Ala Tyr Val Asp Gly Thr Ala Gly Asn Ile Glu Ile Pro Glu
260 265 270
Lys Leu Leu Asn Thr Gly Ser Leu Gly Gly Ile Leu Thr Phe Arg Ser
275 280 285
Gln Asp Leu Asp Gln Thr Arg Asn Thr Leu Gly Gln Leu Ala Leu Ala
290 295 300
Phe Ala Glu Ala Phe Asn Thr Gln His Lys Ala Gly Phe Asp Ala Asn
305 310 315 320
Gly Asp Ala Gly Glu Asp Phe Phe Ala Ile Gly Lys Pro Ala Val Leu
325 330 335
Gln Asn Thr Lys Asn Lys Gly Asp Val Ala Ile Gly Ala Thr Val Thr
340 345 350
Asp Ala Ser Ala Val Leu Ala Thr Asp Tyr Lys Ile Ser Phe Asp Asn
355 360 365
Asn Gln Trp Gln Val Thr Arg Leu Ala Ser Asn Thr Thr Phe Thr Val
370 375 380
Thr Pro Asp Ala Asn Gly Lys Val Ala Phe Asp Gly Leu Glu Leu Thr
385 390 395 400
Phe Thr Gly Thr Pro Ala Val Asn Asp Ser Phe Thr Leu Lys Pro Val
405 410 415
Ser Asp Ala Ile Val Asn Met Asp Val Leu Ile Thr Asp Glu Ala Lys
420 425 430
Ile Ala Met Ala Ser Glu Glu Asp Ala Gly Asp Ser Asp Asn Arg Asn
435 440 445
Gly Gln Ala Leu Leu Asp Leu Gln Ser Asn Ser Lys Thr Val Gly Gly
450 455 460
Ala Lys Ser Phe Asn Asp Ala Tyr Ala Ser Leu Val Ser Asp Ile Gly
465 470 475 480
Asn Lys Thr Ala Thr Leu Lys Thr Ser Ser Ala Thr Gln Gly Asn Val
485 490 495
Val Thr Gln Leu Ser Asn Gln Gln Gln Ser Ile Ser Gly Val Asn Leu
500 505 510
Asp Glu Glu Tyr Gly Asn Leu Gln Arg Phe Gln Gln Tyr Tyr Leu Ala
19
CA 02326757 2000-10-25
WO 99/55368 PCTIUS99/09034
515 520 525
Asn Ala Gln Val Leu Gln Thr Ala Asn Ala Ile Phe Asp Ala Leu Ile
530 535 540
Asn Ile Arg
545
<210> 41
<211> 566
<212> PRT
<213> Psuedomonas aeruginosa
<400> 41
Met Asn Asp Ser Ile Gln Leu Ser Gly Leu Ser Arg Gln Leu Val Gln
1 5 10 15
Ala Asn Leu Leu Asp Glu Lys Thr Ala Leu Gln Ala Gln Thr Gln Ala
20 25 30
Gln Arg Asn Lys Leu Ser Leu Val Thr His Leu Val Gln Asn Lys Leu
35 40 45
Val Ser Gly Leu Ala Leu Ala Glu Leu Ser Ala Glu Gln Phe Gly Ile
50 55 60
Ala Tyr Cys Asp Leu Asn Ser Leu Asp Arg Glu Ser Phe Pro Arg Asp
65 70 75 80
Ala Ile Ser Glu Lys Leu Val Arg Gln His Arg Val Ile Pro Leu Trp
85 90 95
Arg Arg Gly Asn Lys Leu Phe Val Gly Ile Ser Asp Ala Ala Asn His
100 105 110
Gln Ala Ile Asn Asp Val Gln Phe Ser Thr Gly Leu Thr Thr Glu Ala
115 120 125
Ile Leu Val Glu Asp Asp Lys Leu Gly Leu Ala Ile Asp Lys Leu Phe
130 135 140
Glu Asn Ala Thr Asp Gly Leu Ala Gly Leu Asp Asp Val Asp Leu Glu
145 150 155 160
Gly Leu Asp Val Gly Val Lys Glu Thr Ser Gly Gln Glu Asp Thr Gly
165 170 175
Ala Glu Ala Asp Asp Ala Pro Val Val Arg Phe Val Asn Lys Met Leu
180 185 190
Leu Asp Ala Ile Lys Gly Gly Ser Ser Asp Leu His Phe Glu Pro Tyr
195 200 205
Glu Lys Ile Tyr Arg Val Arg Phe Arg Thr Asp Gly Met Leu His Glu
210 215 220
Val Ala Lys Pro Pro Ile Gln Leu Ala Ser Arg Ile Ser Ala Arg Leu
225 230 235 240
Lys Val Met Ala Gly Leu Asp Ile Ser Glu Arg Arg Lys Pro Gln Asp
245 250 255
Gly Arg Ile Lys Met Arg Val Ser Lys Thr Lys Ser Ile Asp Phe Arg
260 265 270
Val Asn Thr Leu Pro Thr Leu Trp Gly Glu Lys Ile Val Met Arg Ile
275 280 285
Leu Asp Ser Ser Ser Ala Gln Met Gly Ile Asp Ala Leu Gly Tyr Glu
290 295 300
Glu Asp Gln Lys Glu Leu Tyr Leu Ala Ala Leu Lys Gln Pro Gln Gly
305 310 315 320
Met Ile Leu Val Thr Gly Pro Thr Gly Ser Gly Lys Thr Val Ser Leu
325 330 335
Tyr Thr Gly Leu Asn Ile Leu Asn Thr Thr Asp Ile Asn Ile Ser Thr
CA 02326757 2000-10-25
WO 99/55368 PCT/US99/09034
340 345 350
Ala Glu Asp Pro Val Glu Ile Asn Leu Glu Gly Ile Asn Gln Val Asn
355 360 365
Val Asn Pro Arg Gln Gly Met Asp Phe Ser Gln Ala Leu Arg Ala Phe
370 375 380
Leu Arg Gln Asp Pro Asp Val Ile Met Val Gly Glu Ile Arg Asp Leu
385 390 395 400
Glu Thr Ala Glu Ile Ala Ile Lys Ala Ala Gln Thr Gly His Met Val
405 410 415
Met Ser Thr Leu His Thr Asn Ser Ala Ala Glu Thr Leu Thr Arg Leu
420 425 430
Leu Asn Met Gly Val Pro Ala Phe Asn Leu Ala Thr Ser Val Asn Leu
435 440 445
Ile Ile Ala Gln Arg Leu Ala Arg Lys Leu Cys Ser His Cys Lys Lys
450 455 460
Glu His Asp Val Pro Lys Glu Thr Leu Leu His Glu Gly Phe Pro Glu
465 470 475 480
Glu Leu Ile Gly Thr Phe Lys Leu Tyr Ser Pro Val Gly Cys Asp His
485 490 495
Cys Lys Asn Gly Tyr Lys Gly Arg Val Gly Ile Tyr Glu Val Val Lys
500 505 510
Asn Thr Pro Ala Leu Gln Arg Ile Ile Met Glu Glu Gly Asn Ser Ile
515 520 525
Glu Ile Ala Glu Gln Ala Arg Lys Glu Gly Phe Asn Asp Leu Arg Thr
530 535 540
Ser Gly Leu Leu Lys Ala Met Gln Gly Ile Thr Ser Leu Glu Glu Val
545 550 555 560
Asn Arg Val Thr Lys Asp
565
<210> 42
<211> 406
<212> PRT
<213> Psuedomonas aeruginosa
<400> 42
Met Ala Asp Lys Ala Leu Lys Thr 5er Val Phe Ile Trp Glu Gly Thr
1 5 10 15
Asp Lys Lys Gly Ala Lys Val Lys Gly Glu Leu Thr Gly G1n Asn Pro
20 25 3a
Met Leu Val Lys Ala His Leu Arg Lys Gln Gly Ile Asn Pro Leu Lys
35 40 45
Val Arg Lys Lys Gly Ile Ser Leu Leu Gly Ala Gly Lys Lys Val Lys
50 55 60
Pro Met Asp Ile Ala Leu Phe Thr Arg Gln Met Ala Thr Met Met Gly
65 70 75 BO
Ala Gly Val Pro Leu Leu Gln Ser Phe Asp Ile Ile Gly Glu Gly Phe
85 90 95
Asp Asn Pro Asn Met Arg Lys Leu Val Asp Glu Ile Lys Gln Glu Val
100 105 110
Ser Ser GIy Asn Ser Leu Ala Asn Ser Leu Arg Lys Lys Pro Gln Tyr
115 120 125
Phe Asp Glu Leu Tyr Cys Asn Leu Val Asp Ala Gly Glu Gln Ser Gly
130 135 140
Ala Leu Glu Asn Leu Leu Asp Arg Val Ala Thr Tyr Lys Glu Lys Thr
21
CA 02326757 2000-10-25
WO 99155368 PCT/US99109034
145 150 155 160
Glu Ser Leu Lys Ala Lys Ile Lys Lys Ala Met Thr Tyr Pro Ile Ala
165 170 175
Val Ile Ile Val Ala Leu Ile Val Ser Ala Ile Leu Leu Ile Lys Val
180 185 190
Val Pro Gln Phe Gln Ser Val Phe Glu Gly Phe Gly Ala Glu Leu Pro
195 200 205
Ala Phe Thr Gln Met Ile Val Asn Leu Ser Glu Phe Met Gln Glu Trp
210 215 220
Trp Phe Phe Ile Ile Leu Ala Ile Ala Ile Phe Gly Phe Ala Phe Lys
225 230 235 240
Glu Leu His Lys Arg Ser Gln Lys Phe Arg Asp Thr Leu Asp Arg Thr
245 250 255
Ile Leu Lys Leu Pro Ile Phe Gly Gly Ile Val Tyr Lys Ser Ala Val
260 265 270
Ala Arg Tyr Ala Arg Thr Leu Ser Thr Thr Phe Ala Ala Gly Val Pro
275 280 285
Leu Val Asp Ala Leu Asp Ser Val Ser Gly Ala Thr Gly Asn Ile Val
290 295 300
Phe Lys Asn Ala Val Ser Lys Ile Lys Gln Asp Val Ser Thr Gly Met
305 310 315 320
Gln Leu Asn Phe Ser Met. Arg Thr Thr Ser Val Phe Pro Asn Met Ala
325 330 335
Ile Gln Met Thr Ala Ile Gly Glu Glu Ser Gly Ser Leu Asp Glu Met
340 345 350
Leu Ser Lys Val Ala Ser Tyr Tyr Glu Glu Glu Val Asp Asn Ala Val
355 360 365
Asp Asn Leu Thr Thr Leu Met Glu Pro Met Ile Met Ala Val Leu Gly
370 375 380
Val Leu Val Gly Gly Leu Ile Val Ala Met Tyr Leu Pro Ile Phe Gln
385 390 395 400
Leu Gly Asn Val Val Gly
405
<210> 43
<211> 290
<212> PRT
<213> Psuedomonas aeruginosa
<400> 43
Met Pro Leu Leu Asp Tyr Leu Ala Ser His Pro Leu Ala Phe Val Leu
1 5 10 15
Cys Ala Ile Leu Leu Gly Leu Leu Val Gly Ser Phe Leu Asn Val Val
20 25 30
Val His Arg Leu Pro Lys Met Met Glu Arg Asn Trp Lys Ala Glu Ala
35 40 45
Arg Glu Ala Leu Gly Leu Glu Pro Glu Pro Lys Gln Ala Thr Tyr Asn
50 55 60
Leu Val Leu Pro Asn Ser Ala Cys Pro Arg Cys Gly His Glu Ile Arg
65 70 75 80
Pro Trp Glu Asn Ile Pro Leu Val Ser Tyr Leu Ala Leu Gly Gly Lys
85 90 95
Cys Ser Ser Cys Lys Ala Ala Ile Gly Lys Arg Tyr Pro Leu Val Glu
100 105 110
Leu Ala Thr Ala Leu Leu Ser Gly Tyr Val Ala Trp His Phe Gly Phe
22
CA 02326757 2000-10-25
WO 99/55368 PCTIUS99109034
115 120 125
Thr Trp Gln Ala Gly Ala Met Leu Leu Leu Thr Trp Gly Leu Leu Ala
130 135 140
Met Ser Leu Ile Asp Ala Asp His Gln Leu Leu Pro Asp Val Leu Val
145 150 155 160
Leu Pro Leu Leu Trp Leu Gly Leu Ile Ala Asn His Phe Gly Leu Phe
165 170 175
Ala Ser Leu Asp Asp Ala Leu Phe Gly Ala Val Phe Gly Tyr Leu Ser
180 185 190
Leu Trp Ser Val Phe Trp Leu Phe Lys Leu Val Thr Gly Lys Glu Gly
195 200 205
Met Gly Tyr Gly Asp Phe Lys Leu Leu Ala Met Leu Gly Ala Trp Gly
210 215 220
Gly Trp Gln Ile Leu Pro Leu Thr Ile Leu Leu Ser Ser Leu Val Gly
225 230 235 240
Ala Ile Leu Gly Val Ile Met Leu Arg Leu Arg Asn Ala Glu Ser Gly
245 250 255
Thr Pro Ile Pro Phe Gl.y Pro Tyr Leu Ala Ile Ala Gly Trp Ile Ala
260 265 270
Leu Leu Trp Gly Asp Gln Ile Thr Arg Thr Tyr Leu Gln Phe Ala Gly
275 280 285
Phe Lys
290
<210> 44
<211> 185
<212> PRT
<213> Psuedomonas aeruginosa
<400> 44
Met Leu Leu Lys Ser Arg His Arg Ser Leu His Gln Ser Gly Phe Ser
1 5 10 15
Met Ile Glu Val Leu Val Ala Leu Leu Leu Ile Ser Ile Gly Val Leu
20 25 30
Gly Met Ile Ala Met Gln Gly Lys Thr Ile Gln Tyr Thr Ala Asp Ser
35 40 45
Val Glu Arg Asn Lys Ala Ala Met Leu Gly Ser Asn Leu Leu Glu Ser
50 55 60
Met Arg Ala Ser Pro Lys Ala Leu Tyr Asp Val Lys Asp Gln Met Ala
65 70 75 80
Thr Gln Ser Asp Phe Phe Lys Ala Lys Gly Ser Ala Phe Pro Thr Ala
85 90 95
Pro Ser Ser Cys Thr Pro Leu Pro Asp Ala Ile Lys Asp Arg Leu Gly
100 105 110
Cys Trp Ala Glu Gln Val Lys Asn Glu Leu Pro Gly Ala Gly Asp Leu
115 120 125
Leu Lys Ser Asp Tyr Tyr Ile Cys Arg 5er Ser Lys Pro Gly Asp Cys
130 135 140
Asp Gly Lys Gly Ser Met Leu Glu Ile Arg Leu Ala Trp Arg Gly Lys
145 150 155 160
Gln Gly Ala Cys Val Asn Ala Ala Asp Ser Ser Ala Asp Thr Ser Leu
165 170 175
Cys Tyr Tyr Thr Leu Arg Val Glu Pro
180 185
23
CA 02326757 2000-10-25
WO 99/55368 PCT/US99/09034
<210> 45
<211> 274
<212> PRT
<213> Psuedomonas aeruginosa
<400> 45
Met Ser Met Asn Asn Arg Ser Arg Arg Gln Ser Gly Leu Ser Met Ile
1 5 10 15
Glu Leu Leu Val Ala Le.u Ala Ile Ser Ser Phe Leu Ile Leu Gly Ile
20 25 30
Thr Gln Ile Tyr Leu Asp Asn Lys Arg Asn Tyr Leu Phe Gln Gln Gly
35 40 45
Gln Ala Gly Asn Gln Glu Asn Gly Arg Phe Ala Met Met Phe Leu Asp
50 55 60
Gln Gln Leu Ala Lys Val Gly Phe Arg Arg Arg Ala Asp Asp Pro Asn
65 70 75 80
Glu Phe Ala Phe Pro Ala Gln Gln Lys Thr Ala Tyr Cys Glu Ala Phe
85 90 95
Lys Ala Gly Ser Thr Leu Val Pro Ala Val Val Lys Ala Gly Gln Ser
100 105 110
Gly Phe Cys Tyr Arg Tyr Gln Pro Ala Pro Gly Glu Ala Tyr Asp Cys
115 I20 125
Glu Gly Asn Ser Ile Thr Thr Pro Ser Asp Pro Phe Ala Thr Ala Gln
130 135 140
Ala Ile Thr Ala Arg Val Leu Phe Val Pro Ala Thr Ala Asp Val Pro
145 150 155 160
Gly Ser Leu Ala Cys Ser Ala Gln Thr Ile Lys Glu Lys Gly Gln Glu
165 170 175
Ile Val Ser Gly Leu Val Asp Phe Lys Leu Glu Tyr Gly Val Gly Pro
180 185 190
Thr Met Ala Gly Lys Arg Glu Val Glu Ser Phe Val Glu Gln Ala Asn
195 200 205
Ile Ala Asp Arg Pro Val Arg Ala Leu Arg Tyr Ser Ala Leu Met Ala
210 215 220
Ser Asp Lys Asn Leu Arg Gln Gly Asp Ser Lys Thr Leu Asp Asp Trp
225 230 235 240
Ile Thr Leu Tyr Pro Se:r Ser Lys Thr Ser Leu Gln Gly Asn Asp Lys
245 250 255
Asp Arg Leu Tyr Gln Ile Ala Lys Gly Ser Gln Thr Leu Arg Asn Leu
260 265 270
Val Pro
<210> 46
<211> 172
<212> PRT
<213> Psuedomonas aeruginosa
<400> 46
Met Asn Asn Phe Pro Ala Gln Gln Arg Gly Ala Thr Leu Val Ile Ala
1 5 10 15
Leu Ala Ile Leu Val Ile Val Thr Leu Leu Ala Val Ser Ser Met Arg
20 25 30
Glu Val Val Leu Glu Ser Arg Ile Thr Gly Asn Val Ile Glu Gln Thr
35 40 45
24
CA 02326757 2000-10-25
WO 99/55368 PC1'/US99I09034
Arg Leu Gln Asn Ala Ala Glu Ser Gly Leu Arg Glu Gly Glu Arg Arg
SO 55 60
Phe Val Asn Thr Leu Arg Pro Pro Glu Pro Gly Thr Gly Cys Thr Ala
65 70 75 80
Asp Asn Val Ala Arg Pro Cys Leu Leu Asp Leu Ala Ala Leu Asn Leu
85 90 95
Lys Leu Ala Asp Thr His Gln Asn Pro Val Gly Val Leu Lys Gly Ile
100 105 110
Ala Asn Thr Trp Met Ser Tyr Arg Gly Ser Asp Ile Ser Ser Ala Thr
115 120 125
Thr Ala Gly Asn Ala Leu Gln Arg Ala Val Glu Gln Pro Ala His Ser
130 135 140
Leu Gly Arg Pro Gly Gln Arg Ser Gly Lys Pro Arg Ile Arg Gln Pro
145 150 155 160
Asp Ala Arg His Arg His Leu Leu Leu Arg Asp Gln
165 170
<210> 47
<211> 1161
<212> PRT
<213> Psuedomonas aeruginosa
<400> 47
Met Arg Gly Ile Gly Thr Phe Tyr Tyr Glu Thr Asn Ser Val Ala Arg
1 5 10 15
Asn Gln Thr Asn Ser Glu Thr Val Leu Gln Thr Val Ala Arg Pro Ser
20 25 30
Leu Tyr Gln Leu Ile Glu Pro Arg Met Lys Ser Val Leu His Gln Ile
35 40 45
Gly Lys Thr Ser Leu Ala Ala Ala Leu Ser Gly Ala Val Leu Leu Ser
50 55 60
Ala Gln Thr Thr His Ala Ala Ala Leu Ser Val Ser Gln Gln Pro Leu
65 70 75 80
Met Leu Ile Gln Gly Val Ala Pro Asn Met Leu Val Thr Leu Asp Asp
85 90 95
Ser Gly Ser Met Ala Phe Ala Tyr Ala Pro Asp Ser Ile Ser Gly Tyr
100 105 110
Gly Asn Tyr Thr Phe Phe Ala Ser Asn Ser Phe Asn Pro Met Tyr Phe
115 120 125
Asp Pro Asn Thr Gln Tyr Lys Leu Pro Lys Lys Leu Thr Leu Val Asn
130 135 140
Gly Gln Val Gln Ile Gln Asp Tyr Pro Ala Pro Asn Phe Ser Ser Ala
145 150 155 160
Trp Arg Asn Gly Phe Thr Arg Arg Gly Ser Ile Asn Leu Ser Asn Ser
165 170 175
Tyr Lys Val Thr Ile Glu Tyr Gly Arg Gly Tyr Asp Lys Glu Ser Thr
180 185 190
Ile Lys Ala Asp Ala Ala Tyr Tyr Tyr Asp Phe Thr Gly Ser Ser Ser
195 200 205
Trp Asn Arg Thr Asn Gln Ala Cys Tyr Thr Arg Arg Tyr Val Ser Thr
210 215 220
Glu Gln Arg Gln Asn Phe Ala Asn Trp Tyr Ser Phe Tyr Arg Thr Arg
225 230 235 240
Ala Leu Arg Thr Gln Thr Ala Ala Asn Leu Ala Phe Phe Arg Leu Pro
245 250 255
CA 02326757 2000-10-25
WO 99/55368 PCTIUS99/09034
Glu Asn Ala Arg Val Ser Trp Gln Leu Leu Asn Asp Ser Asn Cys Asn
260 265 270
Gln Met Gly Ser Gly Ser Arg Leu Arg Gln Leu Phe Gln Gln Leu Ser
275 280 285
Thr Gly Leu His Arg Ser Thr Ala Gly Glu Leu Leu Gln Leu Ala Gly
290 295 300
Lys Thr Phe Gly Gln Trp Trp Tyr Ala Leu Arg Gln Ala Met Thr Arg
305 310 315 320
Glu Ala Ser Phe Ser Arg Arg Pro Ala Ser Asn Gly Pro Tyr Ala Tyr
325 330 335
Arg Pro Gly Thr Gln Thr Ala Pro Glu Tyr Ser Cys Arg Gly Ser Tyr
340 345 350
His Ile Leu Met Thr Asp Gly Leu Trp Asn Asn Asp Ser Ala Asn Val
355 360 365
Gly Asn Ala Asp Ser Thr Ala Arg Asn Leu Pro Asp Gly Lys Ser Tyr
370 375 380
Ser Ser Gln Thr Pro Tyr Arg Asp Gly Thr Phe Asp Thr Leu Ala Asp
385 390 395 400
Gln Ala Phe His Tyr Trp Ala Thr Asp Ala Arg Pro Asp Ile Asp Asp
405 410 415
Asn Ile Lys Pro Tyr Ile Pro Tyr Pro Asp Gln Asp Asn Pro Ser Gly
420 425 430
Glu Tyr Trp Asn Pro Arg Asn Asp Pro Ala Ile Trp Gln His Met Val
435 440 445
Thr Tyr Thr Leu Gly Leu Gly Leu Asn Thr Ser Leu Thr Ser Pro Arg
450 455 460
Trp Glu Gly Ser Thr Phe Ser Gly Gly Tyr Asn Asp Ile Val Ala Gly
465 47U 475 480
Asn Leu Ser Trp Pro Arg Ala Ser Asn Asn Asp Ser Asn Asn Val Tyr
485 490 495
Asp Leu Trp His Ala Ala Val Asn Ser Arg Gly Glu Phe Phe Ser Ala
500 505 510
Asp Ser Pro Asp Gln Leu Val Ala Ala Phe Gln Asp Ile Leu Asn Arg
515 520 525
Ile Ser Gly Lys Asp Leu Pro Ala Ser Arg Pro Ala Ile Ser Ser Ser
530 535 540
Leu Gln Glu Asp Asp Thr Gly Asp Lys Leu Thr Arg Phe Ala Tyr Gln
545 550 555 560
Thr Ser Phe Ala Ser Asp Lys Asn Trp Ala Gly Asp Leu Thr Arg Tyr
565 570 575
Ser Leu Thr Thr Gln Asp Lys Ala Thr Val Gln Thr Asn Leu Trp Ser
580 585 590
Ala Gln Ser Ile Leu Asp Ala Met Pro Asn Gly Gly Ala Gly Arg Lys
595 600 605
Ile Met Met Ala Gly Ser Gly Thr Ser Gly Leu Lys Glu Phe Thr Trp
610 615 620
Gly Ser Leu Ser Ala Asp Gln Gln Arg Lys Leu Asn Arg Asp Pro Asp
625 630 635 640
Arg Asn Asp Val Ala Asp Thr Lys Gly Gln Asp Arg Val Ala Phe Leu
645 650 655
Arg Gly Asp Arg Arg Lys Glu Asn Ser Asp Asn Phe Arg Thr Arg Asn
660 665 670
Ser Ile Leu Gly Asp Ile Ile Asn Ser Ser Pro Ala Thr Val Gly Lys
675 680 685
Ala Gln Tyr Leu Thr Tyr Leu Ala Gln Pro Ile Glu Pro 5er Gly Asn
26
CA 02326757 2000-10-25
WO 99/55368 PCT/US99/09034
690 695 700
Tyr Ser Thr Phe Ala Glu Ala Gln Lys Thr Arg Ala Pro Arg Val Tyr
705 710 715 720
Val Gly Ala Asn Asp Gly Met Leu His Gly Phe Asp Thr Asp Gly Asn
725 730 735
Glu Thr Phe Ala Phe Ile Pro Ser Ala Val Phe Glu Lys Leu His Lys
740 745 750
Leu Thr Ala Arg Gly Tyr Gln Gly Gly Ala His Gln Phe Tyr Val Asp
755 760 765
Gly Ser Pro Val Val Ala Asp Ala Phe Phe Gly Gly Ala Trp His Thr
770 775 780
Val Leu Ile Gly Ser Leu Arg Ala Gly Gly Lys Gly Leu Phe Ala Leu
785 790 795 800
Asp Val Thr Asp Pro Ala Asn Ile Lys Leu Leu Trp Glu Ile Gly Val
805 810 815
Asp Gln Glu Pro Asp Leu Gly Tyr Ser Phe Pro Lye Pro Thr Val Ala
820 825 B30
Arg Leu His Asn Gly Lys Trp Ala Val Val Thr Gly Asn Gly Tyr Ser
835 840 845
Ser Leu Asn Asp Lys Ala Ala Leu Leu Ile Ile Asp Leu Glu Thr Gly
850 855 860
Ala Ile Thr Arg Lys Leu Glu Val Thr Gly Arg Thr Gly Val Pro Asn
865 870 875 880
Gly Leu Ser Ser Leu Arg Leu Ala Asp Asn Asn Ser Asp Gly Val Ala
885 890 895
Asp Tyr Ala Tyr Ala Gly Asp Leu Gln G1y Asn Leu Trp Arg Phe Asp
900 905 910
Leu Ile Ala Gly Lys Val Asn Gln Asp Asp Pro Phe Ser Arg Ala Asn
915 920 925
Asp Gly Pro Thr Val Ala Ser Ser Phe Arg Val Ser Phe Gly Gly Gln
930 935 940
Pro Leu Tyr Ser Ala Val Asp Ser Ala Gly Ala Ala Gln Ala Ile Thr
945 950 955 960
Ala Ala Pro Ser Leu Val Arg His Pro Thr Arg Lys Gly Tyr Ile Val
965 970 975
Ile Phe Gly Thr Gly Lys Tyr Phe Glu Asn Ala Asp Ala Arg Ala Asp
980 985 990
Thr Ser Arg Ala Gln Thr Leu Tyr Gly Ile Trp Asp Gln Gln Thr Lys
995 1000 1005
Gly Glu Ala Ala Gly Sex Thr Pro Arg Leu Thr Arg Gly Asn Leu Gln
1010 1015 1020
Gln Gln Thr Leu Asp Leu Gln Ala Asp Ser Thr Phe Ala Ser Thr Ala
1025 1030 1035 104
Arg Thr Ile Arg Ile Gly Ser Gln Asn Pro Val Asn Trp Leu Asn Asn
1045 1050 1055
Asp Gly Ser Thr Lys Gln Ser Gly Trp Tyr Leu Asp Phe Met Val Asn
1060 1065 1070
Gly Thr Leu Lys Gly Glu Met Leu Ile Glu Asp Met Ile Ala Ile Gly
1075 1080 1085
Gln Val Val Leu Leu Gln Thr Ile Thr Pro Asn Asp Asp Pro Cys Ala
1090 1095 1100
Asp Gly Ala Ser Asn Trp Thr Tyr Gly Leu Asp Pro Tyr Thr Gly Gly
1105 1110 1115 112
Arg Thr Arg Phe Thr Val Phe Asp Leu Gly Arg Gln Gly Val Val Gly
1125 1130 1135
27
CA 02326757 2000-10-25
WO 99/55368 PCTIUS99I09034
Leu Glu Ile Arg Leu Thr Gly Thr Thr Arg Arg Asn Val Gly Asn Pro
1140 1145 1150
Val Pro Ser Arg Lys Ala Trp Glu Ala
1155 1160
<210> 48
<211> 115
<212> PRT
<213> Psuedomonas aeruginosa
<400> 4B
Met Lys Val Leu Pro Met Leu Leu Ala Leu Ala Val Pro Gly Leu Cys
1 5 10 15
Trp Ala Glu Asp Pro Gln Thr Phe Glu Gly Ala Gly Val Val Phe Glu
20 25 30
Val Gln Val Glu Lys Asn Leu Val Asp Ile Asp His Arg Leu Tyr Arg
35 40 45
Leu Pro Asn Ser Thr Val Arg Asn Gly Met Pro Ser Leu Phe Gln Val
50 55 60
Lys Pro Gly Ser Val Val Ser Tyr Ser Gly Thr Val Ser Gln Pro Trp
65 70 75 80
Ser Thr Ile Thr Asp Ile Tyr Ile His Lys Gln Met Ser Glu Gln Glu
85 90 95
Leu Ala Glu Met Ile Glu Lys Glu Gln Pro Arg Gln Asp Gly Glu Glu
100 105 110
Gln Pro Arg
115
<210> 49
<211> 141
<212> PRT
<213> Psuedomonas aeruginosa
<400> 49
Met Arg Thr Arg Gln Lys Giy Phe Thr Leu Leu Glu Met Val Val Val
1 5 10 15
Val Ala Val Ile Gly Ile Leu Leu Gly Ile Ala Ile Pro Ser Tyr Gln
20 25 30
Asn Tyr Val Ile Arg Ser Asn Arg Thr Glu Gly Gln Ala Leu Leu Ser
35 40 45
Asp Ala Ala Ala Arg Gln Glu Arg Tyr Tyr Ser Gln Asn Pro Gly Val
50 55 60
Gly Tyr Thr Lys Asp Val Ala Lys Leu Gly Met Ser Ser Ala Asn Ser
65 70 75 80
Pro Asn Asn Leu Tyr Asn Leu Thr Ile Ala Thr Pro Thr Ser Thr Thr
85 90 95
Tyr Thr Leu Thr Ala Thr Pro Ile Asn Ser Gln Thr Arg Asp Lys Thr
100 105 110
Cys Gly Lys Leu Thr Leu Asn Gln Leu Gly Glu Arg Gly Ala Ala Gly
115 120 125
Lys Thr Gly Asn Asn Ser Thr Val Asn Asp Cys Trp Arg
130 135 140
28
