Note : Les descriptions sont présentées dans la langue officielle dans laquelle elles ont été soumises.
CA 02327189 2002-03-19
Novel DNA-based Vaccine Against the Encephalitis Alphaviruses
Field of the Invention
This invention relates to the cloning, sequencing and expression of the
structural genes of
western equine encephalitis (WEE) virus strain 71 V-1658 and the development
and use of the
DNA-based vaccine against WEE.
Background of the Invention
List of Prior Art Literatures
Ausubel, F.M., et al, editors. (1995). C.'urrent Protocols in Molecular
Biology, New York: John
Wiley & Sons.
Bell, J. R., Bond, M.W., Nukapiller, M. B., Strauss, E.G., Strauss, J. H.,
Yamamoto, K., &
Simizu, B. (1983). Structural proteins of western equine encephalitis virus:
amino acid
compositions and N-terminal sequences. Journal of !'irology 45, 708-714.
Bird, B.R. & Forrester, F.T. (1981 ). Basic Laboratory Techniques In Cell
Culture. Atlanta:
U. S. Department of Health and Human Services, Centers for Disease Control.
Calisher, C.H. & Karabatsos, N. (1988). Arbovinus serogroups: definition and
geographic
distribution. In The Arboviruses: Epidemiologs acrd 1'cology, Vol. I,.pp. 1 '7-
57. Edited by T. P
Monath. CRC Press: Boca Raton, Fl.
Calisher, C. H., Shope, R.E, Brandt, W., Casals, J., Karabatsos, N., Murphy,
F.A., Tesh,
R.B., & Wiebe"M.E.. (1980). Proposed antigenic classification of registered
arbovirusess.
Intervirology 14, 229-232.
Calisher, C. H., Karabatsos, N., Lazuick, J. S.. Monath, T.P., & Wolff, K.L.
(1988).
CA 02327189 2002-03-19
Reevaluation of the western equine encephalitis antigenic complex of
alphaviruses (family
Togaviridae) as determined by neutralization tests. American Journal of
Tropical Medicine and
Hygiene 38, 447-452.
S Cilnis, M.J., Kang, W. & Weaver, S.C. (1996). Genetic conservation of
Highlands J viruses.
Virology 218, 343-351.
Frohman, M.A., Dush, M.K. & Martin, G.R. (1988). Rapid production of full-
length cDNAs
from rare transcripts: Amplification using a single gene-specific
oligonucleotide primer.
Proceedings of the National Academy of Science USA 85, 8998-9002.
Hahn, C. S., Lustig, S., Strauss, E.G. & Strauss, J.H. (1988). Western Equine
Encephalitis
virus is a recombinant virus. ProcE~edings of the National Academy of Science
USA 85, 5997-
6001.
Johnson, R.E. & Peters, C.J. (1996). Alphaviruses. In Fields Virology, 3rd
edn, pp. 843-898.
Edited by B. N. Fields, et al., New York: Raven Press.
Kuhn, R., Hong, Z. & Strauss, J.H. (1990). 11!Iutagenesis of the 3'
nontranslated region of
Sindbis virus RNA. Journal of Virology 64, 1465-1476.
Kuhn, R.J., Niesters, H.G.M., Hong, Z. & Strauss, J.H. (1991). Infectious RNA
transcripts
from Ross River virus cDNA clones and the construction and characterization of
defined
chimeras with Sindbis. Virology 182, 430-441.
Krieg, A.M., Yi, A.-K., Schorr, J. and Davis, H.L. (1998). The role of CpG
dinucleotides in
DNA vaccines. Trends Microbial. 6, 23-27.
MeCluskie, M.J., Davies, H.L. (1999). Novel strategies using DNA for the
induction of
mucosal immunity. Critic. Rev. in Imrnunol. 19, 303-329.
CA 02327189 2002-03-19
Ou, J.-H., Trent, D.W. & Strauss, J.H. (1982). The 3' non-coding regions of
alphavirus RNAs
contain repeating sequences. Journal of Molecular Biology 156, 719-730.
0u, J-H., Strauss, E. G. & Strauss, J.H. (1983). The 5' terminal sequences of
the genomic
RNAs of several alphaviruses. Journal of Molecular Biology 168, 1-15.
Pardon, DR, Beckering, AM. (1997). Exposing the immunology of naked DNA
vaccines.
Immunity 3;165-169.
Pfeffer, M., Proebster, B., Kinney, R.M. & Kaaden, O-R. (1997). Genus-specific
detection
of alphaviruses by a semi-nested reverse transcription reaction. American
Journal of tropical
Medicine and Hygiene 57, 709-718.
Pfeffer, M., Kinney, R.M. & Kaaden, O-R. (1998). The alphavirus 3'-
nontranslated region:
Size heterogeneity and arrangement of repeated sequence elements. Virology
240, 100-108.
Prayaga, S.K., Fuller, D.H., Haynes, J.R. & Murphey-Corb, M. (1995). Particle-
mediated
nucleic acid immunization. Vaccines' 95, 105-109.
Reisen, W.K. & Monath, T.P. (1988). Western equine encephalomyelitis, pp. 89-
137. In The
Arboviruses: Epidemiology and Ecology, Vol. v. Edited by T.P. Monath. CRC
Press: Boca
Raton, Fl.
Robinson, H.L., Feltquate, D.M., Morin, M.J., Haynes, J.R., Webster, R.G.
(1995). DNA
vaccines: A new approach to immunization. l/accine 95:69-75
Sambrook, J., Fritsch, E. F., & Maniatis, T. (1989). Molecular Cloning, a
Laboratory
Manual, ?nd edn.. Cold Spring 1-larbor: Cold Spring Harbor Laboratory.
Schlesinger, S. & Schlesinger, M.J. (1996). Togaviridae: The viruses and their
replication, In
Fields Virology, 3rd edn, pp. 825-84l . Edited by B. N. Fields, et al.. New
York: Raven Press.
_;_
CA 02327189 2002-03-19
Strauss, J. H., & Strauss, E.G. (1988). Evolution of RNA viruses. Annual
Review of
Microbiology 42, 657-683.
Strauss, J. H., & Strauss, E.G. (1994). The alphaviruses: gene expression,
replication, and
evolution. Microbiological Review 58, 491-562.
Strauss, E.G., Rice, C.M. & Strauss, J.H. (1983). Sequence coding for the
alphavirus
nonstructural proteins is interruptec:l by an opal termination codon.
Proceedings of the National
AcademyofScience USA 80, 5271-5275.
Strauss, E.G., Rice, C.M. & Strauss, J.H. (1984). Complete nucleotide sequence
of the
genomic RNA of Sindbis virus. Virology 133, 92-110.
Trent, D.W., & Grant, J.A. (1980). A comparison of new world alphaviruses in
the western
equine encephalomyelitis complex by immunochemical and oligonucleotide
fingerprint
techniques. Journal or Geraeral Virology 47:261-282.
Weaver, S. C., Hagenbaugh, A., Bellew, L.A., Netesov, S. V. , Volchokov, V. I.
, Chang, G.-J
J., Clarke, D. K., Gousset, L., Scott, T. W., 'Trent, D. W. & Holland, J. J.
(1993). A
comparison of the nucleotide seqeunces of eastern and western equine
encephalomyelitis viruses
with those of other alphaviruses and related RNA viruses. Virology 197, 375-
390.
Weaver, S. C., Kang, W, Shirako, Y., Rumenapf, T., Strauss, E.G. & Strauss,
J.H. (1997)
Recombinational history and molecular evolution ofwestern equine
encephalomyelitis complex
alphaviruses. Journal of Y~rolo~- 71, 613-623.
Wolff, J.A., Malone, R.W., Williams, P., Chong, W., Acsasi, G., Jani, A.,
Felgner, P.L.
(1990). Direct gene transfer into mouse muscle in vivo. Science 247,1465-1468.
The alphaviruses are a group of about 27 enveloped viruses with a positive
sense,
CA 02327189 2002-03-19
nonsegmented single-stranded RNA genome (Calisher et al., 1980; Strauss and
Strauss, 1988).
The alphavirus disclosed in this invention, western equine encephalitis virus
(WEE), is amember
of the WEE antigenic complex and is serologically related to the Sindbis
(SIN), Highlands J (HJ),
Fort Morgan, Buggy Creek, and Aura viruses (Calisher & Karabatsos, 1988;
Calisher et al.,
1988). WEE is endemic in western North America and strains/varieties have been
isolated from
Argentina (AG80-646), Brazil (BeAr 102091 ) and the former Soviet Union (Y62-
33) (Johnson
and Peters, 1996; Weaver et al., 1997). In nature, WEE is transmitted from its
amplifying hosts
or reservoir in wild birds, to man and horses, by mosquitoes (Culex tarsalis
being the principal
vector). While the endemic cycle has resulted in only a limited number of
human infections in
recent years, in the past, major epidemics of WEE have been recorded. The most
extensive
epidemic, including 3,336 recognized human cases and 300,000 cases of
encephalitis in horses
and mules, occurred in the western United States and Canada in 1941 (Reisen &
Monath, 1988;
Johnson and Peters, 1996).
All alphaviruses share a number of structural, sequence, and functional
similarities,
including a genome with two polyprotein gene clusters (reviewed in Strauss &
Strauss, 1994;
Schlesinger & Schlesingerl 996). The genomic organization of these viruses is
conserved (see
Figure 1 ), with the nonstructural proteins translated directly from the 5'
two-thirds of the genomic
RNA. A subgenomic positive-stranded RNA (the 26S RNA), is identical to the 3'
one-third of
the genomic RNA and serves as the translational template for the structural
proteins (capsid, E3,
E2, 6K and E 1 ).
The nonstructural proteins (nsPl, nsP2, nsP3 and nsP4) are also synthesized as
a
polyprotein and processed into the four nsPs by a nsP2 protease. Two versions
of the
nonstructural polyprotein are synthesized in alphavirus-infected cells, due to
frequent
readthrough of an opal codon between the nsP3 and nsP4 genes in several
alphaviruses (Strauss
_5_
CA 02327189 2002-03-19
et al., 1983). The nsPs function in a complex with host factors to replicate
the genome and
transcribe the subgenomic mRNA. Alphaviruses have characteristic conserved
sequences at the
extreme S' and 3' domains and the intergenic region (0u et al., 1982, 1983;
Pfeffer et al., 1998).
These conserved domains are required for viral growth and replication and are
believed to be
important in promotion of protein synthesis and the initiation of RNA-
dependent RNA
polymerise activity.
The relationship of different WEE isolates to each other has been demonstrated
using
neutralization tests (Calisher et al., 1988). Additionally, several strains of
WEE were typed by
oligonucleotide fingerprinting, and found to have greater than 90 % nt
homology (Trent & Grant,
1980). The N-terminal sequences of the nucleocapsid, and the E1 and E2
glycoproteins have
been determined by Edman degradation, and the E 1 and E2 proteins were found
to have 82
and 71 % homology, respectively, to SIN (Bell et al., 1983). Hahn et al.
(1988) sequenced the
26S region of WEE strain BFS 1703. They proposed that WEE originated as a
hybrid virus,
formed by recombination of an EEE and a Sindbis-like virus, most likely during
a co-infection
event. They suggested that two crossover events occurred, one within the E3
gene, the other
within the 3' nontranslated terminal region (NTR), resulting in a virus whose
nonstructural
domain, intragenic region, and capsid protein are similar to EEE, with
envelope proteins showing
homology to SIN.
Weaver et al. ( 1993 ) sequenced part of the nonstructural domain (nsP2 and
nsP3 genes)
of strain 5614, demonstrating this area also shows homology to EEE. Short
regions within the
nsP4 gene and the E1 protein/3' N'fR have been determined for many WEE
strains, allowing a
preliminary assessment of the nucleic acid phylogenetic relationships within
the WEE antigenic
complex (Weaver et al., 1997). Serological studies (C'alisher et al., 1988)
and preliminary
sequence determination (Cilnis et cal., 1996; Weaver et al., 1997) ofthe HJ
genome suggests this
-6-
CA 02327189 2002-03-19
is another closely related virus, and most likely a descendant of the same
recombinant viral
ancestor as modern WEE.
A highly conserved region of the alphavirus nsPl gene has been identified, and
proved
suitable for use in a polymerase chain reaction (PCR)-based genetic assay for
alphaviruses,
including WEE (Pfeffer et al., 1997). Phylogenetic analysis of this PCR
fragment yielded similar
results to those obtained by Weaver et al., (1997) for a PCR fragment in the
nsP4 gene.
In terms of therapy or prophylaxis, there are very limited possibilities. An
inactivated
vaccine to WEE is under investigational new dmg (IND) status. The vaccine uses
formalin-
inactivation of cell culture supernatants from WEE-infected tissue culture. It
requires a
minimum of 3 doses, yearly monitoring of antibody titer and possible boosters.
Its effectiveness
in the protection against an aerosol challenge of WEE has yet to be
established. A WEE live
attenuated vaccine based on an infectious clone is under development (J.
Smith, personnel
communication). The area of DNA immunization is relatively new, and has been
reviewed
in Hassett and Whitton, 1996; Donnelly et cil, 1997. Similar to live,
attenuated vaccines, DNA
vaccines are known to stimulate both humoral and cellular immune responses
(Pardon and
Backering, 1997; McCuskie and I)avies, 1999). Much of the focus has been on
methods to
deliver and efficiently express the cloned products. lntramuscular
administration of DNA has
been one of the original methods used (Wolff et al, 1990). A second method
uses ballistic
delivery of DNA coated gold panic les, using high pressure helium gas to
propel the particles into
the epidermis and dermis of animals (Prayaga et al, 1995, reviewed by Robinson
et al, 1995).
The Applicant identified a number of related areas of research, including the
development
of subunit vaccines to WEE. In the present invention, the Applicant disclosed
the cloning,
sequencing and expression of the stnrctural genes of a WEE virus (strain 71 V-
1658), as described
in Netolitzky et al., (2000) "Complete genomic RhIA sequence of western equine
encephalitis
CA 02327189 2002-03-19
virus and expression of the structural genes." ,lournc~l of Gejaeral
virolo~,ry 81, 151-159. The
DNA construct (pCXH-3), and a second construct (pVHX-6j were used in DNA
immunization
studies in a mouse model for protection against intranasal administered WEE.
Summary of the Invention
The present invention is directed to the development of a DNA-subunit vaccine
to the
WEE virus and its use against such virus. More specifically, DNA to structural
components of
the WEE virus are expressed and used as the subunit vaccine.
The present invention provides for the complete nucleotide sequence of WEE
strain 71 V-
1658. Two novel cDNA clones, pCXH-3 and pVHX-6 are also disclosed as effective
vectors for
gene expression.
The present invention also provides the complete nucleotide sequence for the
structural gene pcDWXH-7.
It further provides for a process for preparing a recombinant DNA vaccine
against
1 S WEE virus, comprising cloning and sequencing of 265 region of a WEE virus
strain 71 V-
1658 under conditions suitable to effect in vitro transcription and
translation of the functional
recombinant DNA expression vector pCXH-3 and pVHX-6.
Brief Description of the Drawings
Figure 1~ Diagram showing the WEE 71V-1658 sequencing strategy. 'The location
of PCR
probe sequences used to screen the; WEE cDNA library are also indicated, along
with the
genomic organization of the virus.
Figure 2. Multiple sequence alignment.
_g_
CA 02327189 2002-03-19
Figure 3. Stem loop structures in thc~ S' NTR.
Figure 4. Stem loop structures in the 3' NTR.
Figure 5. Phylogenetic relationship of the WEE nonstructural region compared
to other
alphaviruses.
Figure 6. Expression of WEE stmctural genes in cell culture.
Figure 7. In vitro transcription and translation of WEE expression vectors.
Figure 8. WEE mouse infectivity model.
Figure 9. Protection using ballistic delivery of pCXH-3.
Figure 10. Protection using ballistic delivery of pVl IX-6
Figure 11. Protection using ballistic delivery of pVHX-6.
Detailed Description of the Invention
The complete nucleotide sequence of tile 71 V-1658 strain of western equine
encephalitis
(WEE) virus was determined (minus vtwenty-five nucleotides from the 5' end)
and shown in SEQ
ID NO: 1. A 5' RACE reaction was used to sequence the 5' terminus from WEE
strain CBA87.
The deduced WEE genome was 11,5()8 nucleotides in length, excluding the S' cap
nucleotide and
3' poly(A) tail. The nucleotide composition was 28 ~~ A, 25 % C, 2S % G and 22
% U residues.
Comparison with partial WEE sequences of strain 5614 (nsP2-nsP3 of the
nonstructural region)
and strain BFS 1703 (26S structural region) revealed comparatively little
variation; a total of 149
nucleotide differences in 8624 bases ( 1.7 °/. divergence), of which
only 28% of these changes (42
CA 02327189 2002-03-19
nucleotides) altered the encoded anuino acids. Comparison ofdeduced nsPl and
nsP4 amino acid
sequences from WEE with the con-esponding proteins from eastern equine
encephalitis (EEE)
yielded identities of 84.9 % and 83.8 %, respectively. Previously
uncharacterized stem loop
structures were identified in the nontranslated terminal regions.
A 3100 by clone was identified (pcDNA-12) from the 3' end of the structural
genes. A
1500 by fragment was PCR amplified and cloned into t:he 5' end of pcDNA-12 to
produce a
complete clone of the structural genes (XH-7) as shown in SEQ ID NO: 2. A cDNA
clone
(pCXH-3) in which the structural genes of WEE strain 71 V-1658 were placed
under the control
of a cytomegalovirus promoter was made, and transfected into tissue culture
cells. The viral
envelope proteins were functionally expressed in tissue culture, as determined
by histochemical
staining with monoclonal antibodies which recognize WEE antigens. The
construct was used to
immunize mice ballistically and intramuscularly. Mice protected ballistically
had a significantly
reduced risk of infection, against a subsequent intranasal challenge with WEE
virus. A new
vector was constructed to determine if increased levels of expression could be
obtained. The
construct used a pVAX vector to express the WEE structural genes (pVHX-6).
Upstream portion
of the pVHX-6 vector to where it becomes the XH-7 sequence is shown as SEQ ID
NO: 3. The
remaining nucleotide sequence of pVHX-6 from the point of divergence is
identical to that of
structural gene pcDWXH-7 of SEQ 1L) NO: 2.
MATERIALS AND METHODS
Virus Culture and Purification
Tissue culture was maintained in accordance with established methods (Bird &
Forrester,
1981). Minimal essential media containing 5 °,% fetal calf serum (5%
DMEM) was used to grow
Vero (CRL 1586) and Chinese hamster ovary (CHO) Kl (CCL 61 ) cells obtained
from American
- IU-
CA 02327189 2002-03-19
Type Culture Collections. A 10 % suckling mouse brain (SMB) suspension of WEE
strain 71 V-
1658 was kindly provided by Dr. Nick Karabatsos, Centers for Disease Control,
Fort Collins,
CO. WEE Fleming and California strains were purchased from ATCC (Mannanas,
VA). WEE
B11 and CBA87 strains were kindly provided by Dr. (Jeorge Ludwig, United
States Army
Medical Research Institute of Infectious Disease (Frederick, MD). Seed stocks
of WEE strains
were made by inoculation of Vero cells with virus suspensions at a
multiplicity of infection
(MOI) of less than 0.1. For RNA isolation, virus stocks were prepared by
infecting Vero cells at
a MOI of 10. The virus was precipitated from cleared supernatant by the
addition of
polyethylene glycol MW 6000 to 7 %(w/v) and NaC',l to 2.3 %(w/v). It was
subsequently purified
on a 20-60 %(w/w) continuous sucrose gradient, followed by resuspension in
PBS.
Nucleic Acid Preparation
Viral RNA used in WEE strain 71 V-1658 library construction was prepared by
the lysis
of virus in 0.5 %(w/v) sodium dodecyl sulfate (SDS), and RNA extracted using
the cesium
chloride/guanidium isothiocyanate method previously described (Sambrook et
al., 1989). RNA
was precipitated using sodium acetate; and ethanol, then stored at -70
°C. Prior to use, RNA was
washed with 80 %(v/v) ethanol, dried and dissolved in nuclease-free water
(Promega, Madison,
WI). Integrity of the RNA was checked on formaldehyde agarose gels (Sambrook
et al., 1989).
A cDNA library of WEE strain 71V-1658 was made by Invitrogen (San Diego, CA),
by the
ligation of cDNA into the BstXI site of prepared pcDNAII vector, and
electroporation into
electrocompetent DH1 F' Escheric~hia coli cells. Manipulation of RNA and DNA
followed
established procedures (Sambrook et al., 1989; Ausubel et al., 1995). Rapid
plasmid
preparations were made using the Wizard' M plasmid purification kit (Promega,
Madison, WI).
Large-scale plasmid preparations used the alkali lysi;s protocol as modified
by Qiagen
-Il-
CA 02327189 2002-03-19
(Chatsworth, CA). For PCR, RT-PCIZ and DNA sequencing, oligonucleotide primer
design was
guided by information from WEE strain BFS1703 and other partially sequenced
WEE strains
(Hahn et al., 1988; Weaver et al., 1993), and from regions of sequence
conservation (0u et al.,
1982 &1983). Oligonucleotides were synthesized and gel purified either at the
Regional DNA
Synthesis Laboratory (Calgary, Alberta), or on a Beckman Oligo 1000 DNA
synthesizer. A
catalog with the sequences of primers used is listed in Table 1.
Construction of pCXH 3
The Invitrogen WEE library was screened by dot. blot hybridization (Sambrook
et al.,
1989) with [3zP]-labeled, random primed RT-PCR fragments as probes (Amersham,
Oakville,
ON). A 3100 by insert, pcDW-12, vvas identified, and corresponded to the 3'
end of the 26 S
RNA. The missing 5' end of the 26S region was generated by RT-PCR using the
primers
WEES'Sstl and WEEP3 (Table 1 ). The 1500 by SstIiNcoI restricted fragment was
inserted into
the plasmid, phT3T7BM+ (Boehringer Mannheim, Laval, PQ), to generate a XbaI
site on the 5'
end. The 1500 by XbaIlNcoI fragment was excised, gel purified and inserted
into the XbaI and
NcoI restriction sites ofpcDW-12. 'The resulting clone, pcDWXH-7, encoded the
complete 26S
region of WEE 71V-1658. The struictural gene insert from pcDWXH-7 was cloned
into the
mammalian expression vector, pCI (fromega, Madison, WI). The pcDWXH-7 plasmid
was first
linearized using.HindIII, followed by a Klenow fragment reaction to fill in
the 5' overhang. The
insert was then excised using XbaI, gel purified and ligated into the
XbaIlSmaI digested pCI
vector. The isolated recombinant plasmid, pCXH-3, was characterized as having
the correct
insert by restriction mapping.
Construction of pVHX 6
- 12-
CA 02327189 2002-03-19
The clone, pcDWXH-7, encoded the complete 26S region of WEE 71 V-1658 was
digested with Sac I, and relegated in the reverse orientation. The isolate,
pcDWHX-45, contained
the complete 26S of WEE, with the reverse cloning sites (HindIII on the 5' end
andXbaI on the 3'
end). The WEE 26S gene segment was excised from pcDWHX-45, and cloned into the
HincIIII
and XbaI sites of the mammalian ex~:~ression vector, pVAX (Invitrogen, La
Jolla, CA). After
transformation into E. coli DHlOa. (Life Sciences, Burlington, ON) and
screening of inserts by
restriction analysis, a resulting isolate, pVHX-6 was identified. SEQ ID NO: 3
shows the
upstream portion of the pVHX-6 vector to where it becomes the XH-7 sequence.
The remaining
nucleotide sequence of pVHX-6 from the point of divergence is identical to
that of structural
gene pcDWXH-7 of SEQ ID NO: ?.
Expression of the Structural Genes o f WEE
The pCXH-3 expression vector was transfected into Vero or CHO K1 cells using
the
cationic lipid, LipofectamineTM (Gibco/BRL, Burlington, ON). Briefly, Vero or
CHO K1 cells
were grown to 30-50 % confluency in Costar 6-well plates. The monolayers were
transfected
with pCXH-3 in accordance with the vmanufacturer's directions, for a period of
5 hrs, followed by
a further 29 hr incubation after the addition of 5% DMEM. The monolayers were
fixed in
methanol:acetone (1:1 ) for 5 min and washed with PBS containing 0.1 %(v/v)
Tween 20 and 3
BSA (PBS-TB). The cells were incubated 45 min at 37 °C'. with a 1/100
dilution (in PBS-TB) of
concentrated cell supernatant from hybridoma cell lines expressing monoclonal
antibodies to the
WEE El (clone IlD2) or E2 (clone 3f3) proteins, followed by washing with PBS-
TB.
Monolayers were incubated with a 114000 dilution of goat anti-mouse IgG/IgM (H
& L) horse
radish peroxidase conjugate (Caltag, .So. San Francisco, C:A) for 45 min at 37
°C. After washing
with PBS-T, 2 mL of TruBlue ~'~1 HRP substrate (Kirkegaard & Peny
Laboratories, Gaitherburg,
CA 02327189 2002-03-19
MD) was added, and plates were incubated a further 30 min at room temperature,
followed by
microscopic examination.
In a second method, one-step in vitro transcription and translation reactions
using the
TNT coupled system (Promega Corporation, Madison, WI) was used to express the
gene
S products from both pCXH-3 and pVHX-6, as both have an upstream T7 promoter
which can be
used for in vitro expression of inserts. The RNA was translated in the
presence of
[3sS]methionine to produce radiolabeled WEE proteins, which were further
processed with
canine pancreatic microsomal membranes. All connponents of the in vitro
transcription and
translation reactions were incubated together for 90 min at 30 °C.
Results were analyzed by SDS-
PAGE or radioimmunoprecipitation.
Radioimmunoprecipitation
The TNT reactions were dilutf;d to a volume of 500 ml with RIP buffer
consisting of 0.1 S
M sodium chloride, 0.1 % SDS, 50 mlvl Tris-HC1 pH 7.4, and 1 % Triton X-100.
They were then
preabsorbed by incubating with 75 J L of protein Ci-agarose (Gibco BRL) for 30
min at room
temperature. The samples were centrifuged at 13,000 rpm for 1 min, and the
supernatants were
then immunoprecipitated with either ll 00 ~L of supernatants from anti-WEE
hybridoma cells or
pg of purified anti-WEE antibodies. The reactions were incubated for 1.5 hr at
room
temperature, after which 75 pL of protein G-agarose was added. The reactions
were incubated
20 for an additional 30 min at room temperature. Immunoprecipitated proteins
were collected by
centrifuging at 13,000 rpm for 1 min. The pellets were washed with S00 pL of
RIP buffer and
centrifuged at 13,000 rpm for 1 miry; 'this step was repeated three additional
times. The pellets
were resuspended in 2x Laemmli sample buffer (Bio-Rad Laboratories) containing
fresh 2% b-
mercaptoethanol and heated at 100 ''C" for 10 min. The samples were
centrifuged at 13,000 rpm
-14-
CA 02327189 2002-03-19
for 1 min, and the supernatants were collected. The immunoprecipitated
[35S]labeled WEE
proteins were further analyzed by SDS-PAGE and autoradiography. Radiolabelled
[~'~C]molecular weight markers from Amersham Pharrriacia Biotech were also run
on the
polyacrylamide gels.
DNA Sequencing
Automated sequencing of the 26S region was performed using the ABI Prism Dye
Terminator Cycle Sequencing or :Big-DyeTM Terminator Cycle Sequencing kits of
plasmid
templates according to the manufacturer's instructions (PE-Applied Biosystems,
Foster City,
CA). Sequencing reactions were purified on Centri-Sep ~ M columns (Princeton
Separations,
Adelphia, NJ), dried and analyzed on an ABI 373 or 310 automated sequencer.
For the
nonstructural region, template cDN,As were generated in a single-step
integrated RT-PCR
procedure using the TitanTM RT-PCR kit (Boehringer l~iannheim, Laval, PQ),
following the
manufacturer's suggested protocols. IRr-PCR products were purified using the
QIAquick~~M PCR
Purification kit (Qiagen, Chatsworth, CA) and sequenced (50-100 ng DNA per
reaction). The
extreme 5' end of the genome was not sequenced in WEE 71 V-1658. However, a 5'
RACE
reaction (Frohman et al., 1988) was used to obtain a cDNA fragment from the 5'
terminus of
WEE strain CBA87. Briefly, primer WEESS9 (GGTAGATTGATGTCGGTGCATGG) was used
to prime reverse transcription of the :>' terminus of the viral RNA. After
poly(A) tailing of the
cDNA with terminal transferase, a plus sense primer
(GTACTTGACTGACTGTTTTTTTTTTTTTTT) was used in conjunction with WEE559 for
amplification of the 5' terminus.
Nucleotide Sequence Analysis and Assembly
-IS-
CA 02327189 2002-03-19
Sequence traces were edited manually and assembled using the Seqman component
of the
Lasergene DNA analysis software (DhtASTAR, Madison, WI). Codon preferences and
patterns
were assessed using the CodonUse and CodonFrequency programs, while the
overall frequency
of mononucleotide and dinucleotides was calculated using the Composition
program (Wisconsin
S Package, Version 9.0, Genetics Computer Group, Madison, WI). Quantitative
assessments of
sequence similarities (nucleotide and amino acid), were calculated by
preliminary alignment
using the Pileup program, followed by manual alignment adjustment, and
analysis with the
Distances program (GCG). Amino acid sequences aligned as described, were used
as the basis
for generating phylogenetic trees (GCG). The GeneQuest module of the Lasergene
program
(DNASTAR, Madison, WI) was used to predict and calculate RNA secondary
structures at the
ends of the genomic RNA using minimal energy calculations. Multiple sequence
alignments
were accomplished using the Clustal component of MegAlign (DNASTAR). The
complete WEE
genomic nucleotide sequence has been submitted to GenI3ank (Accession Number
AF 143811 ).
Administration of DNA or Inactivated Virus
DNA solutions or an inactivated WEE virus vaccine in PBS, were administered to
the
mice by ballistic or intramuscular (IM) routes. For IM route of
administration, a 27 g needle was
used to deliver 50 ~g of DNA (pCx.H-3 or pCl - negative control) or 50 pL of
inactivated WEE
vaccine (SALK WEE inactivated vaccine). 'The volume of inoculum used was 100
pL, diluted in
PBS. Fifty pL was administered IM to each of the hind leg muscles of a mouse.
When boosters
were given, they were administered 14-28 days apart. Fc~r ballistic
administration, mice were
shaved in the abdominal area with elc;ctric hair clippers. 'The mouse was
subjected to ballistic
delivery of DNA coated onto gold pat7:icles following the manufacturer's
standard specifications.
The Helios Gene Gun (Biorad, Mississauga, ON) was used as directed, at a
pressure setting of
- 16-
CA 02327189 2002-03-19
400 psi. Mice were given 1.25 ~g DNA and 0.5 mg gold, 1 ~m diameter, per shot,
and up to
three shots for one dose time. Boostenrs were given 14-28 days apart. The mice
were challenged
14-28 days after the final booster.
S Mouse Infectivity with WEE
Female BALB/c mice, 17~-2'_i g, were obtained from the mouse breeding colony
at
Defence Research Establishment Sul'field (DRES), with 'the original breeding
pairs purchased
from Charles River Canada (St. Constant, Quebec, Canada). The use of these
animals was
reviewed and approved by Animal C'.are Committee at DRES. Care and handling of
the mice
followed guidelines set out by the C.'anadian Council on Animal Care. Virus
was administered to
the mice by intranasal (IN) or intraperitoneal (IP) routes. The volumes of
inoculum used were 50
pL for IN and 100 p.L for IP. For IN administration, mice were anaesthetized
with sodium
pentobarbital (50 mg/kg body weight, intraperitoneal). When the animals were
unconscious, they
were carefully supported by hands with their nose up, and the virus suspension
in PBS was gently
applied with a micropipette into the nostrils. The applied volume was
naturally inhaled into the
lungs. For IP infection, the mouse was manually restrained, and a 1 ml
tuberculin syringe fitted
with a 27 g needle was used to administer approximately 100 L~L of the virus
suspension in PBS.
Infected animals were observed daily, for up to 14 days post infection.
RESULTS
Complete Nucleotide Sequence of WEE Genome and Deduced Amino Acids
The nucleotide sequence of WEE strain 71 V-1658 (SEQ ID NO: 1) was determined
via
several distinct sequencing strategies, as summarized in Figure I . The 5'
terminus of 25 nt was
not determined for this strain. However, it was determined by sequencing a 5'
RACE product
-t~-
CA 02327189 2002-03-19
from strain CBA87. Excluding the terminal 5' cap structure and the 3' poly(A)
tail, the genomic
sequence of WEE was found to be 11,508 bases long. The base composition was 28
% A, 25
C, 25 % G, and 22 % U. The dinucleotide usage of the WEE genome was compared
with those
values anticipated from the base composition. Several dinucleotides were found
in lower
S proportions than anticipated, notably UpA (81 %), CpG (8:3%) and CpC (85%)
(data not shown).
Codons containing the CpG dinucleot ide were present at 82% of the anticipated
value, including
codons for serine (78%), proline (80~~°) and arginine (78°,%).
The WEE 71 V-1658 sequence was used to conduct a variety of phylogenetic
analyses
with previously determined alphavirus sequences. The alphaviruses used in the
analyses
included EEE strain North American variant (Genbank Acc. No. X67111), O'Nyong
Nyong
(ONN) strain Gulu (Genbank Acc. No. M33999), Ross River (RR) strain NB5092
(Genbank
Acc. No. M20162), Semliki Forest (SFV) (Genbank Acc. No. J02361 ), SIN strain
HR (Genbank
Acc. No. J02363) and VEE ID (Genbank Acc. No. 1.,04653). The degree of
conservation among
the various sequences (nucleotide acid amino acid) through the stereotypical
alphavirus genome is
shown in Table 2. The carboxy-terminal domain ofd nsP3, which consistently
fails to exhibit
homology among sequenced alphaviruses, was excluded from this comparison as it
has been
adjusted for in previous analysis (Weaver et al., 1993). The deduced amino
acid sequences for
nsPl-4 of WEE 71 V-1658 demonstrated closest identity to the corresponding
proteins from EEE
(Table 1 ), reflecting similar observations made for nsP2 and nsP3 of WEE 5614
and EEE
(Weaver et al., 1993).
Nontranslated Terminal Regions
Alignment of the 5' terminal nucleotide sequences of WEE CBA87 and WEE 71 V-
1658
is shown in Figure 2a, along with a comparison of the 5' termini from EEE and
VEE. 'the close
_ ~g _
CA 02327189 2002-03-19
similarity between WEE and EEE, has been verified expE;rimentally, in that a
EEE/Highlands J
degenerate primer, EHJS', was able to P(:R amplify the 5' end of the WEE
genome, while an
analogous SIN primer could not (data not shown).
Potential stem loop structures were found in WEE 71 V-1658, including a stem
loop at the
extreme 5' terminus (2-30) and a pair of stem loops (13'7-189) (Figure 3a).
The homologous
structures for EEE are also shown (Figure 3b) (0u et al., 1983). Minimal
energy values
calculated for the stem loops were similar between WEE and EEE. Further
analysis ofthe region
between the structures described above, indicated a large, highly base-paired
stem loop structure
(39-131 ), that had not been previously described, and was observed in SIN and
EEE in a similar
location (data not shown).
The sequence of WEE 71 V-1658 3' NTR, overall, shared little homology with any
of the
alphaviruses examined, but included the highly conserved 19 nt region at the
3' end ( 11490-
11508), which was identical to that determined for WEE BFS 1703 by Hahn et
al., 1988. Two
copies of the characteristic 40 base Sindbis-like terniinal repeats as
previously reported (0u et al.,
1 S 1982) were found in WEE 71 V-1658 ( 11234-11273 and I 1292-11331 ).
However, the 3' NTR of
WEE showed some surprising results that had not been previously described. The
first 40 nt
terminal repeat formed the backbone for the formation of a 57 nt double stem
loop structure
(11228-11284) (Figure 4b), consisting of an a and (3 loop. The second 40 nt
repeat of WEE
formed a nearly identical 59 nt double stem loop structure ( 11285-11343),
directly adjacent to the
first structure. SIN with three 40 nt repeats, forms three double stem loops
(Figure 4a) while
EEE, which does not contain a SIN-like 40 nt repeat, contains the a and ~i
loops (Figure 4c).
Nonstructural Region
-19-
CA 02327189 2002-03-19
Comparisons within the nonstructural regions (4475 nt) of WEE strains 71 V-
1658 and
5614 (Weaver et al., 1993), yielded 9~4 nt changes resulting in 26 amino acid
substitutions (1.8%
difference) as summarized in Table 2. The most notable variation, a three-base
deletion (4530)
within the nsP3 gene of WEE ? 1 V-1 ti58 constitutes the only
insertion/deletion observed within
the polypeptide encoding regions. A short hypervariable region was observed
(1421-1449),
where 11 of 28 nt were different between the two WEE strains (Figure 2b). The
presence of an
opal termination codon and partial read-through site at the junction of nsP3
and nsP4 is
consistent with WEE 5614. Extending previous phylogenetic analyses of WEE
(Weaver et al.,
1993, 1997), phylogenetic trees depicting viral relatedness were constructed
with the Distances
program (GCG), for the unexamined genes (nsP 1, nsP4) and the entire
nonstructural polypeptide
encoding region (Figure 5). The data reveals the close relationship of WEE to
EEE, relative to
the other alphaviruses analyzed.
Structural Genes
The largest WEE cDNA clone; isolated, pcDW-12, was 3100 by in size, but
missing 5 nt
and the poly(A) tract from the 3' end as determined by restriction mapping and
DNS sequence
analysis. The missing 5' 1500 by fragment was synthesized using PCR (primers
WEES'Sstl and
WEEP3) and subsequently cloned into pcDW-12 to yield a full-length clone of
the structural
genes (pcDWXH-7) (SEQ ID NO: 2;). Comparison of the: structural region of WEE
71 V-1658
with WEE BFS 1703 (Hahn et al., I 988), indicated 53 nt changes, resulting in
only 11 amino acid
differences, of which two were nonconserved. One difference in residue was
observed from the
amino acid sequence of the N-terminus of the E2 protein of the WEE MacMillan
strain (Bell et
al., 1983), when this was compared to the deduced protein sequence of 71 V-
1658. A short
fragment (802 nucleotides) of the WEE 71 V-1658 E 1 protein gene, and the 3'
NTR had been
_?p_
CA 02327189 2002-03-19
published previously (Weaver et al., 1997); comparison with the sequence
reported herein
indicated no differences.
Expression of Structural Gene
Expression of the insert from the cytomegalovirus (CMV) promoter was
accomplished by
transfection of the pCXH-3 plasmid into either Vero or CHO K1 cells. Cells
expressing the E1
or E2 proteins were detected through the use of specific E1 or E2 monoclonal
antibodies to
WEE, followed by histochemical staining with the HRP substrate, Tru-Blue as
demonstrated in
Figure 6a. The control cells transfected with pCI alone showed no staining
(Figure 6b), thus,
demonstrating the fidelity of the proteins translated from the cloned 26S
region. In vitro
translation of the insert using TNT T7 rabbit reticulysate and canine
microsome system
demonstrated synthesis of 'SS-metluonine-labelled proteins of the correct size
as indicated by
immunoprecipitation with monoclonal antibodies to the NC, E1 and E2 proteins
(data not
shown). Similarly, the construct pVHX-6 was along demonstrated to produce the
correct MW
proteins as determined by in vitro transcription/translation. The level of
expression for pVHX-6
was significantly higher then for pC:XH-3 (Figure 7).
Protection Against WEE Infection using DNA Immunization
Different strains of WEE were shown vary in their virulence in BALB/c mice.
When
similar amounts of WEE were given intranasally to BALB!c mice, time to death
varied from 4 to
8 days. The California and Fleming strains were the most virulent (:Figure 8),
and the Fleming
strain was chosen as the challenge strain in protection studies. IP
administration of the virus did
not kill adult mice (data not shown). Intramuscular administration of pCXH-3
did not show any
protection, using one or two doses of 50 pg, followed by challenge 30 to 90
days after the final
-21 -
CA 02327189 2002-03-19
dose (data not shown). Intramuscular administration did result in an increase
in antibody titre to
WEE as determined by ELISA using a monoclonal antibody to the E 1 protein of
WEE (data not
shown). Expression and protection o f pCXH-3 DNA when delivered ballistically.
pCI was used
as a control DNA. When two doses of pCXH-3 was given, protection of 50% was
demonstrated
as compared to no protection for pC;I (Figure 9) or PBS controls (data not
shown). IM injection
showed marginal protection (one group 25% survival - data not shown). The dose
of WEE
Fleming strain (challenge strain) was 1.25 x 10'~ PFU for 100% killing via an
intranasal route of
infection. Preliminary studies examining protection using the pVHX-6 vector,
indicated promise
with this construct using the Gene Ciun, and ballistic delivery. With the pVHX-
6 vector, one
mouse succumbed immediately to tl~e effects of the sodium pentabarbital
(anaesthetic). The
remaining three mice showed no signs of coming down with a WEE infection, and
remained
completely heathy (Figure 10). Of the four pVAX control mice, all showed signs
on WEE
infection, and two of the four mice died, while two did recover. A repeat of
this experiment
using 3 or 4 doses of pVHX-6, given 2 weeks apart, showed complete protection
of the mice,
similar to 3 doses of WEE inactivated vaccine (Figure 11 ). Three or 4 doses
of pVAX showed
results similar to the saline control, with only about 60% of the mice
surviving Figure 11.
DISCUSSION
The WEE 71V-1658 genonnic: sequence of 11,508 bases was determined directly
from
cDNA clones of WEE or via sequencing RT-PCR products. fhe first 25 bases of
the WEE
genome was determined indirectly, tlorough the use of a 5' RACE reaction in
WEE CBA87.
Noting the relatively high conservation in the WEE sequences overall (1.7%
divergence) and in
the overlap region between the two W EE sequences (see Figure 2a), it appears
that the 5' ends of
71 V-1658 and CBA87 are of similar size and sequence.
_~»_
CA 02327189 2002-03-19
Comparison of WEE 71 V- l 658 to other partial sequences of WEE (Hahn et al.,
1988;
Weaver et al., 1993) suggests little variation at the nucleotide level among
these viruses (Table
2), showing an overall nt sequence difference of 1.7 '% over 8624 nt. Given a
calculated rate of
divergence of 0.028 % per year for the WEE E1 protein (Weaver et al., 1997),
the expected nt
S divergence for a difference in isolation of 18 years between the strains,
should be O.S % (71 V-
1658 isolated in 1971 and BFS 170~i in 195 3). The E 1 protein itself showed a
rate of divergence
of 1.S% in nt sequence between 71 V-1658 and BFS 1703. The lower rate observed
by Weaver et
al., (1997) could be due to greater conservation of structure at the C
terminus of E1, from where
the rates of divergence were calculated. Areas with high rates of divergence
were observed
between WEE strains 71 V-16S 8 and :1614 at the 3' end of nsP 1 and the Send
of nsP4 (Table 2).
The relatively high interstrain value for nsPl (4.S% difference) may be due to
the presence of a
small hypervariable region, with 11 of 28 nt changed in strain 5614 (Figure
2b). Variation in
nsP4 occurred in a stretch of 21 nt at the 3' end of the Sfil4 sequence, and
were left out of
subsequent homology comparisons (similarity with the EEE sequence was
maintained in this
region). Discounting the carboxy-terminal region of nsP3 also gives a more
accurate picture of
the homology of the nsPl-4 nonstructural region (Weaver et al., 1993). The
results for
comparison of nt and protein sequences of WEE to other alphaviruses is shown
in Table 2, and
are similar to those obtained with nsP2 and nsP3 of 5614, when compared to
other alphavirus
sequences. Phylogenetic analysis (>f the WEE 71V-1658 deduced protein
sequences of nsPl,
nsP4 and the nsPl-4 region, as related to other alphaviruses (Figure S),
illustrates the close
relationship to EEE (HJ sequences were very limited for comparative purposes
and were not
included).
Assessments of codon usage frequencies and the frequency at which certain
dinucleotides
are found throughout the genome identified a number of statistical anomalies.
The slight CpG
-23-
CA 02327189 2002-03-19
dinucleotide deficiency previously described within other alphaviruses, and
WEE itself, was
confirmed in this study, at levels comparable to those reported (Weaver et
al., 1993). The CpG
under representation is a typical feature of vertebrate genomes, and is not
seen in invertebrates.
Viruses which infect dual hosts, such as the arboviruses, might be expected to
utilize an
intermediate nucleotide bias, as indicated by the slight CpG under-utilization
observed in
alphaviruses (Weaver et al., 1993). A pronounced under-representation of two
other
dinucleotides was also observed within the WEE genome, UpA, and CpC, a
phenomenon noted
throughout the genome, though thf; role of these codon preferences is unclear.
The 5' NTR sequence of WE:I? shows a close phylogenetic affiliation to EEE,
and to HJ,
although the HJ sequence information is more limited. 0u et al., {1983) had
previouslypredicted
(based on minimal free energy calculations) two hairpin structures at the 5'
NTR of several
alphaviruses including SIN and EEE. Both structures are present in WEE, the
first ofwhich is a
5' terminal hairpin structure (2-30), similar to that calculated for EEE
(Figures 3a and b). The
second is a dual hairpin structure (13 i-162, 16S-189) which is almost
identical to that identified
1 S for EEE. The region between the tf;rminal and dual hairpins can itself
form a long hairpin
structure, and includes highly conserved stretches of 92 nt (data not shown).
The significance of
these structures is currently unknown.
Previous reports (Hahn et al., 1988; Pfeffer et al., 1998) suggested WEE virus
arose as a
result of two recombination events between alphavirus-like ancestral viruses.
The first
recombination occurred near the junction of the E3 and capsid genes. The
second recombination
occurred 80 nucleotides from the a' end of the genome. Evidence for the
occurrence of the
second recombination event is infewed from sequence similarities of the 3' NTR
between WEE,
EEE and SIN, in which WEE shows greater similarity to F:EE (65 %) than to SIN
(50 ~%) in the
last 100 nt of the 3' end. However, the apparent plasticity of the 3' NTR may
only be reflecting
_p4_
CA 02327189 2002-03-19
the selective pressures under which the nascent WEE virus evolved, resulting
in rapid selection
of 3' sequences which are more similar to EEE, and may not represent an actual
recombination
event as previously postulated.
The 3' NTRs of alphaviruses are characterized by widespread sequence
divergence and
yet contain small, strongly conserved motifs (reviewed in Strauss & Strauss,
1994; Pfeffer et al.,
1998). Analysis of the 3' NTR indicated the presence of double stem loop
structures among SIN
and WEE (Figures 4a and b). Interestingly, the 40 by repeat found in SIN and
WEE is contained
within the double stem loop structure,. SIN was found to contain 3 double stem
loop structures
and WEE was found to contain two. In SIN, the spacing between the three double
stem loop
structures was around 30 nucleotides, while in WE.E the distance was zero nt
separating the
structures. Additional alphaviruses were assessed and it is interesting to
note that double stem
loop structures were found in many of the WEE- and SIN-related viruses (SIN,
Aura, Babanki,
Ockelbo, Kyzylagach, Whataroa, WEE and HJ). The double stem loop structures
found in SIN
and WEE viruses consisted of the a loop (ALJGUA[U/C]UU ) and the [3 loop
(GCAUAAU)
(Figure 4b). Surprisingly, while EEE does not have the 40 by repeat element
found in SIN and
WEE, it contains the a and [3 loop structures (Figure 4c). The significance of
these conserved
loop structures between SIN, WEE and EEI? viruses has yet to be elucidated,
although previous
studies suggest a role in viral replication and/or host specificity (Kuhn et
al., 1990; Kuhn et al.,
1991 ). For example a deletion of' 2.6-318 nt from 3' end of SIN, resulted in
reduced viral
replication in mosquito cells but not in chicken cells (Kuhn et al., 1990). In
contrast, substitution
of the SIN 3' NTR with the substantially different RR 3' NTR (which lacks the
40 by repeat and
double stem loop structures), had nc:~ effect on the growth of the chimeric
virus in mosquito cells,
suggesting that host proteins interact with the 3' NTRs to cause differential
host effects (Kuhn et
al., I 991 ).
-ps-
CA 02327189 2002-03-19
The 26S region of 71 V-1658 was placed under the control of the CMV promoter
of pCI.
To test for functional expression of the pCXH-3 vector and for a functional
product in cell
culture, the pCXH-3 vector was transiently transfected into Vero cells. WEE
proteins were
detected on the cell using specific monoclonal antibodies to both the E 1
(Figure 6a) and E2
proteins (data not shown). The binding specificity of these monoclonals has
been previously
determined by western blot analysis and immunoprecipitation analysis (data not
shown). The use
of pCXH-3 in DNA immunization experiments indicated that the construct could
partially protect
against WEE intranasal challenge using ballistic delivery. Preliminary results
do indicate that
WEE reactive antibodies can be detected by ELISA when the pCXH-3 plasmid is
given
intramuscularly (unpublished results). However, this afforded no protection to
the mice, as there
were no survivors. Intranasal (data not shown) delivery of the pCXH-3, with
and without
liposome encapsulation did not demonstrate any protection under the conditions
used. Mice
immunized with the pCI control plasmid did not show any signs of protection in
these studies.
Expression of the WEE structural proteins in the pCI-based vector (pCHX-3)
gave
moderate to poor levels of expression in vitro, using the TNT' expression kit.
A new vector,
pVAX (Invitrogen) was designed for L~NA immunization and was basically the
same as pCI, but
lacked the intron found in the pCI ve~~tor. Initial restriction mapping of
pCXH-3 indicated the
plasmid was the expected size, but later analysis indicated a extra 4 kb
fragment was present
(data not shown). The WEE structural proteins were cloned and expressed in
pVHX-6,
indicating the correct sized proteins by SDS-PAGE, and producing higher levels
of WEE product
in vitro (Figure 7). Preliminary results with pVHX-6 indicated it could
completely protect mice
against an intranasal challenge of WEE. While 50% of the pVAX mice did
survive, they all
demonstrated at least moderate to se;vf;re infection with WEE. It is possible
that pVAX contains
CpG motifs that show some protective; effect, through a nonspecific adjuvant
like effect (Kreig et
_-y_
CA 02327189 2002-03-19
al, 1998). However, there was a dramatic difference between the pVAX and the
pVHX-6 group,
in the protection afforded the two groups of mice.
The plasmids, pCXH-3 and pVHX-6 show promise as vaccine candidates for WEE.
This
is especially important for protectic:>n against an aerosol challenge of WEE,
and event that would
be envisioned in a potential biological warfare attack using WEE as a
biological warfare agent.
This agent is difficult to protect against if delivered aerosolly, as the
agent is purported to travel
up the nerves directly into the brain. The research is applicable to VEE and
EEE, as these viruses
can also cause encephalitis following a similar route of infection (equines
and potentially
human).
It is to be understood that the embodiments and variations shown and described
herein are
merely illustrative of the principles of this invention and that various
modifications may be
implemented by those skilled in the art without departing from the scope and
spirit of the
W vention.
CA 02327189 2002-03-19
Table 1. WEE 26S Region Primers
Name Length Sequence
WEEPRO 30 AATCACCCTCTACGGCTGACCTAAATAGGT
WEEPR-SST 24 GGCTG AGCTCA ATAGGTGACGTAG
WEE3' 30 GTAGTGTATATTAGAGACCCATAGTGAGTC
WEES'SST 20 'rCCAGATACGAGCTC.'ATACT
WEEN 1 20 GG'I'GC',CG(~T'GG,AGGCCGTTT
WEEN1A 20 GA'I'CTTAGGAGGTC'GATAGC
WEEN2 20 GGC',TGATC~AAACCACTCCAC
WEEN3 20 (. CACC'C GTGTGC'I'ATTCACT
WEEN3A 20 CGC".CG'CGTTTC.~rGCCCAATA
WEEN4 20 TCACGAGCGGAGCATCTGAG
WEENS 20 GGC~:ATCAC:CCTCCACCTGAC
WEENG 20 TTGTTATTCTGTTCCGCTGC
WEEN7 20 CTA'CTGATCATGCAG TCGCA
WEEN8 20 a~GTGGAG(:C.'TC'CGC'C_~AGCGT
WEEN9 20 GAGGAGTGCiGCGGGAAAGGC
WEENIO 20 CTAAAACTCGATGTATTTCC
WEEN I 1 20 ACGCGAACGAAGATGAACGG
WEEN12 20 ACTGTCATTC1T(~C'.TGTGTGG
WEENI3 20 CACAGTCATTCCTTCACCAC
WEEN14 20 CG'hCATCAGAAAGGGGCTTG
WEEN15 20 CAAAGCTGACAGCJGAGGGAC
WEEN I6 20 GGAAAGCTC~GT'AAACiTGCCA
WEENO 20 GGAGAAC(~ACATAAAGTCGA
WNSP 1 25 (iGC."rAACGTGGACAGGGACGTGATG
WEEPO 20 GGC','rA'rCGACC'l'CCTAACrAT
WEEPOA 20 CTGTCGGTTC.'CCTGGTTTAG
WEEPI 20 CTGGGGAACGTCGCCATACT
WEEP2 20 CGTTCTCCAC iCACiCGTGTCG
WEEP2A 20 1'ATTGGGCTGAAACACGGCG
WEEP3 20 C'TTCAAGT G AT( "C~TAAACGT
WEEP4 20 rICTCCAGCCCT'~'C'.TCGCCCC
WEEPS 20 C~TTC".GACCAACC1CCTTATAC
WEEP6 20 AAGGGTGAAAAAGCGGCTGA
WEEP7 20 C~G'rGA~I'T(~TGA'I~'CrA'1'CTCAC
WEEP8 20 TGGAAACTGCCCJCCTGGAAT
WEEP10 20 (.'CT'I'GAT(:~T(~'ATGG'TCGTGG
WEEPI 1 20 TG<:'ACTGAGTGCrTCTCiTGTG
WEEP12 20 ATCiTTrC'CAGC'G7'TGGTTGGC
WEEPl 3 20 C;TGTTCTCAC'. TCTTCACAGAA
WEEP14 20 ATG'T'G'I'GC~TCGC'TTCCTTCA
_pg_
CA 02327189 2002-03-19
Table 2. Percentage Variation in Nucleotide and Encoded Amino Acid Sequences
Between WEE 71V-1658 and Other Alphaviruses
WEE WEE EEE VEE SIN RR ONN SF
(BFS1703) (5614)
5' NTR - -
nsPl (nt) - (4.5) 25.1 34.8 40.9 37.8 39.7 39.1
nsPl (aa) - (6.3) 15.1 32.1 40.3 35.5 37.2 33.3
nsP2 (nt) - 1.8 28.2 34.6 43.9 42.1 42.9 42.8
nsP2 (aa) - 0.(i 16.2 2(i.5 44.9 43.2 44.9 44.4
nsP3 (nt)* - 1.8 30.2 36.7 45.8 39.3 42.6 42.2
nsP3 (aa)* - 2.1 18.8 32.4 46.3 38.7 40.9 43.5
nsP4 (nt) (1.8) (2.4) 25.6 31.4 34.7 35.3 36.0 37.0
nsP4 (aa) (2.6) (4.3) 11.7 21.4 26.8 27.3 25.8 27.4
Intervening 4.3 - 56.6 ~ 1.5 47.6 44.7 60.0 47.7
(nt)
Capsid (nt) 2.1 - 26.3 40.8 47.7 46.3 47.5 48.2
Capsid (aa) 1.5 - 16.8 43.5 52.8 53.3 54.6 54.3
E3 (nt) 1.1 - 45.6 40.7 38.3 51.7 47.5 46.7
E3 (aa) 1.7 - 38.0 39.6 39.4 46.0 45.8 43.9
E2 (nt) 1.2 ~- 51.2 52.3 36.2 51.7 55.3 52.8
E2 (aa) 1.0 -- 59.0 60.0 31.7 63.5 65.7 64.7
6K (nt) 0.6 ~- 53.3 46.3 26.1 51.9 50.3 54.3
6K (aa) 1.8 -- 65.6 59.3 32.7 72.2 69.1 75.9
E1 (nt) 1.5 ~- 43.8 45.8 29.6 47.2 48.5 44.4
E1 (aa) O.S -- 49.0 51.0 23.4 51.5 54.8 50.3
3' NTR (nt) 0.7 -- 57.8 55.0 53.2 69.1 65.8 60.3
* based on rminal
N te domain,
C terrrunal
domain
dis<;arded
due
to lack
of homology
between
alphaviruses
( ) based mplete (289 207 BFS1703,
on inco sequence nt) nt 113
data: and for nt
nsPl nsP4 for
( 5614)
- no data
_09_
CA 02327189 2002-04-16
Canadian Seq-1416-l5ver2 rev apr 15 2002
SEQUENCE LISTING
(1) GENERAL INFORMATION:
(i) APPLICANT: The Minister of National Defence, Government of Canada
(ii) TITLE OF INVENTION: Novel DNA-Based Vaccine Against the Encephalitis
Alphaviruses
(iii) NUMBER OF SEQUENCES: 3
(iv) CORRESPONDENCE ADDRESS:
1900 - 66 slater street, Ottawa, ON K1P 5H1
(v) COMPUTER READABLE FORM:
(A) MEDIUM TYPE: Floppy disk
(B) COMPUTER: IBM PC Compatible
(C) OPERATING SYSTEM: PC-DOS/MS-DOS
(D) SOFTWARE: PC-DOS/MS-DOS
(vi) CURRENT APPLICATION DATA:
(A) APPLICATION NUMBER: CA 2,327,189
(B) FILING DATE: 2000/12/Z1
(C) CLASSIFICATION:
(viii) ATTORNEY/AGENT INFORMATION:
(A) NAME: Nelligan 0'Brien Payne LLP
(C) REFERENCE/DOCKET NUMBER: 14792-4
(2) INFORMATION FOR SEQ ID NO: 1:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 11484
(B) TYPE: nucleic acid
(C) STRANDEDNE55: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: DNA
(vi) ORIGINAL SOURCE:
(A) ORGANISM: western equine encephalomyelitis virus -
strain 71v-1658
(vii) IMMEDIATE SOURCE: Western equine encephalomyelitis virus Viruses;
ssRNA positive-strand viruses, no DNA stage;
Togaviridae; Alphavirus
(ix) FEATURE:
(A) NAME/KEY: CDS
(B) LOCATION: 25 .. 7428
(D) OTHER INFORMATION: 5' UTR <1 .. 24
(x) PUBLICATION INFORMATION:
(A) AUTHORS: Netolitzky,D.J., Schmaltz,F.L., Parker,M.D., Rayner,G.A.,
Fisher,G.R., Trent,D.W., Bader,D.E. and Na~ata,L.P.
(B) TITLE: Complete genomic RNA sequence of western equine
encephalitis virus and expression of the structural genes
(C) JOURNAL: J. Gen. virol.
(D) VOLUME: 81
(E) ISSUE: Pt 1
(F) PAGES: 151 - 159
(G) DATE: 2000
(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 1:
accctacaaa ctaatcgatc caatatggaa agaattcacg ttgacttaga tgctgacagc 60
ccgtatgtca agtcgttaca gcggacgttt ccacaatttg agatcgaagc aaggcaggtc 120
Page 1
CA 02327189 2002-04-16
Canadian -1416-l5ver2
5eq rev apr
15 2002
actgacaatgaccatgccaatgccagagcgttttcgcatgtggcaacaaagctcattgag 180
agcgaagtcgaccgggaccaagttatcttggacattggaagtgcgcccgtcagacatgca 240
cattccaatcaccgctatcattgtatctgccctatgataagcgctgaagacccggacaga 300
ctacaacggtatgcagaaagacttaagaaaagtgacattaccgacaagaacatagcctct 360
aaggcggcagacctgctggaagtcatgtcaacaccagacgcagagactccatctctgtgt 420
atgcacacagacgccacgtgtaggtactttggaagtgtagcagtataccaagatgtgtac 480
gcagtccatgcaccgacatcaatctaccaccaggcgcttaaaggagttaggacaatttac 540
tggataggctttgacacgaccccttttatgtacaaaaacatggcaggttcctaccctact 600
tacaacacgaactgggctgacgagagagtattggaagcacgtaacattggcctcggtaac 660
tcagatcttcaggagagcaggcttggaaaactctcaatccttaggaagaagaggctccaa 720
cctactaataagatcatattctcggttggttcaacaatctacacagaagatagatcactg 780
ttacgtagctggcatcttccaaacgtgttccacttgaaaggaaagtctaacttcacaggt 840
agatgtgggaccattgtcagctgtgaagggtacgtcatcaaaaagataacgatcagccca 900
ggactatacggtaaagttgagaacttggcgtccacaatgcatcgcgagggtttcttgagt 960
tgcaaagtcacagatacgctgcgcggcgagagggtttcttttgctgtgtgtacgtatgta 1020
ccagccacactttgcgatcagatgacagggattctggcaactgacgttagtgtggatgac 1080
gcacaaaaactattggttgggctcaaccaaaggattgtcgtcaatggtaggacgcaaaga 1140
aatactaacacaatgcagaactatctattaccagtggtcgcccaggcgttttccaggtgg 1200
gcgcgtgaacatcgtgccgacttggacgacgagaaagaactaggggtgcgggagcgcact 1260
cttactatgggctgctgctgggctttcaagacccagaaaatcacatccatctacaagaag 1320
cctggtacgcaaacaattaagaaagtacctgccgtctttgactcatttgtgattccacgc 1380
cttaccagccacgggctcgatatgggcttccgccgtaggctcaagctgctgcttgaacca 1440
actgtcaaacccgcaccggctattacaatggccgatgtggagcatctgcgtggcttacag 1500
caagaagctgaagaagtggctgcagcggaagagatcagagaagccctgccacccttgctc 1560
cctgaaatagaaaaagagaccgtagaggcagaagtagacctcattatgcaagaggcagga 1620
gcaggtagcgtggagacaccacgaggacacatcagggtgacaagttacccaggcgaagag 1680
aagattgggtcttacgctatactttcaccccaggcggtattgaatagtgaaaaactggcg 1740
tgtatccacccattggcggaacaagtactggtaatgactcacaaaggtagggcagggaga 1800
tacaaagtcgagccataccacggtaaggtcattgtaccagaagggacggcggtccctgtt 1860
caagacttccaggcattgagtgagagcgctacgatcgttttcaacgagagggagttcgta 1920
aacagatacctgcaccacatcgcaatcaacggaggagcgctaaacactgacgaagagtac 1980
tataagactgtaaagactcaggacacagactcagaatacgtcttcgatattgacgcacga 2040
aagtgtgttaagcgagaagacgcaggtcccttgtgcctaaccggtgatctggtagatcca 2100
ccatttcacgagtttgcgtacgagagtctcaagacacgaccagcagcacctcacaaagtc 2160
ccaaccatcggagtctatggagtgccaggttcaggtaaatctggaatcatcaaaagcgct 2220
gtgactaagaaagatctggttgtgagtgcgaagaaggaaaactgcgcagaaatcatcagg 2280
gatgtaaggaggatgagacgtatggatgttgctgctaggactgtcgattcagtgcttcta 2340
aatggggttaagcaccccgttaacactctgtacattgatgaggcatttgcctgccatgca 2400
gggacgctgctggcactgattgccatcgtcaaacctaagaaagtggtattgtgcggggac 2460
ccaaaacaatgcggcttctttaacatgatgtgcctgaaagtacattttaaccatgacata 2520
tgcactgaagtgtaccataaaagcatctctaggaggtgcacacagactgtaaccgccatc 2580
gtctccacgctcttctacgacaagcgaatgaagacggttaacccatgtgctgataaaatc 2640
atcatagataccacagggaccacaaagccgcacaaagatgatctgattctaacctgtttc 2700
agaggatgggtgaaacagctacagattgactacaaaaatcacgaaatcatgactgcggct 2760
gcatcgcaaggacttacgcggaaaggcgtttatgctgtcaggtacaaagtcaacgagaat 2820
ccactctactcgcagacttctgagcacgtgaacgtgttacttacacgcacagaaaaacgc 2880
attgtctggaagacgctagctggtgatccctggataaagacacttacagctaaatatccc 2940
ggggatttcacggcttcattggacgactggcagcgcgaacacgacgccattatggcacgc 3000
gttcttgataagccgcagacagctgatgtgttccagaataaggtgaacgtctgctgggcg 3060
aaggctttagagccagtcttggccacggccaacattgtgctgacgagacagcagtgggag 3120
acgttgcacccattcaagcatgacagagcgtactcacctgaaatggcactgaacttcttt 3180
tgcaccaggttctttggagtagacctggacagtgggttattttccgctcctaccgtcgca 3240
cttacttacagggatcagcactgggataactcgccagggaagaacatgtatgggcttaat 3300
agagaggtagcaaaggagttgtcacggcgatatccgtgcatcacaaaagcggttgacaca 3360
ggcagggtagctgatataaggaataataccatcaaggactactctccaacaattaatgtg 3420
gttccattaaatcgccggttgccccactcgttgatcgttgaccacaaaggacagggtaca 3480
actgatcacagcggattcctatctaagatgaagggcaaatctgtgttggtgatcggcgat 3540
cctatcagcattccagggaagaaagtagagtccatgggtccattgcccactaataccatc 3600
aggtgtgatctcgatttgggaatacctagccatgtcggtaaatatgacattatctttgtc 3660
aatgttaggaccccgtacaggaaccatcactaccaacagtgcgaggatcacgctatccac 3720
cacagcatgctaacgtgtaaggctgtccaccacctgaacactggcggaacatgtgtggct 3780
atagggtatgggcttgctgatcgcgcaaccgagaatatcatcactgcggtggcacgctca 3840
tttaggtttacccgtgtctgtcagcctaagaacactgccgaaaatactgaggttctcttc 3900
gtgttcttcggcaaggacaacggcaaccacacacatgaccaggacagactcggtgtagtg 3960
cttgacaacatctatcaagggtcaaccaggtacgaggcagggagagctccagcgtacaga 4020
gtgatcagaggtgacattagcaagagcgctgaccaagctatcgttaatgctgctaatagc 4080
aaaggtcaaccaggttccggagtgtgcggtgcactgtaccgaaaatggccggctgctttt 4140
gatagacagccaatagctgtcgggacggctagacttgtgaagcacgaaccgctcatcata 4200
Page 2
CA 02327189 2002-04-16
Canadian -1416-l5ver2
5eq rev apr
15 2002
catgctgtaggacccaatttttctaagatgccggaaccggagggcgaccttaagctcgca 4260
gctgcctacatgagcatagcgtccatcgtcaacgctgagcggattacaaaaatatcagta 4320
ccgctactgtcaaccggcatctattctggtggcaaagatcgagtgatgcaatcattgcat 4380
cacctgttcactgctttcgacactacggatgccgatgtcaccatatattgcttggataaa 4440
caatgggagaccaggataatcgaggccattcaccgcaaagaaagcgtcgaaattctggat 4500
gatgacaagccagtagacattgacttggtcagggtccacccaaacagctctttggcaggc 4560
agaccaggttactccgtcaatgagggcaagttgtattcatacctggaaggtacacgattc 4620
catcagaccgccaaggacattgccgaaatccatgcaatgtggcccaacaaatctgaggct 4680
aatgagcagatttgcttgtacatcctgggggagagtatgtccagcatccgctccaaatgc 4740
ccagtagaggagtcagaggcgtctgctccacctcacacacttccatgcctgtgtaattac 4800
gctatgacggctgagcgcgtatacaggttgcgctctgcgaagaaagaacagttcgccgta 4860
tgctcatcattcctgttgccgaagtacaggatcacaggcgtgcagaagctacagtgcagc 4920
aaaccagtcctgttttcaggcgtcgtaccaccggctgtacaccccaggaagtacgcggaa 4980
ataattctagaaacgccaccaccgccagcaacgacaaccgtaatatgtgaaccaactgtg 5040
ccagaacgtatacccagtccggtgatttctagagcaccaagtgcggaatcactgctatcg 5100
cttggcggcgtctcgttctctagctctgccacacgctcgtcaaccgcctggagcgactat 5160
gacaggcggtttgtggttacagctgatgtgcatcaagcgaacacgtctacgtggagcatc 5220
cctagtgctcctggcttggacgtccagctgccttctgacgtcactgattcccactggagt 5280
attccaagtgcatcaggctttgaagtgagaacaccatctgtacaggacctaactgcggag 5340
tgtgcgaagcctcgtggactggccgaaataatgcaagacttcaatactgctcctttccag 5400
tttctttcggactacagaccagtaccggcaccacggagacgccccatcccatcacctaga 5460
tcgacggcttccgcacctccagttccaaagccacgcaggactaagtaccaacaaccacca 5520
ggagtcgctagagcgatctcagaagcggagttggacgagtacatccgtcaacactccaac 5580
tgacggtatgaagcgggagcgtatattttctcatcggaaacaggccaaggtcaccttcaa 5640
cagaaatcagtacgtcaatgtaaactacaagaacctatattggatcgggccgtccatgag 5700
aagtattacgccccgcgcctcgatctcgaaagagagaaaatgttacagaagaaactgcaa 5760
ttatgcgcctctgaaggaaatagaagcaggtatcaatcacgaaaagtagaaaatatgaaa 5820
gcaattacagcggagcgactcatttctggattgggcacatatctatcatcagaagtgaat 5880
cctgtcgagtgttacagagtcaattatcctgtaccaatctactcgtcaacggtaattaac 5940
aggtttacatctgcagaggtcgcggttaaaacgtgcaacttagttatccaagagaattac 6000
cctacagtagccagttattgtataacagatgaatacgatgcgtatcttgacatggtggac 6060
ggcgcatcgtgctgtctagatacagccactttttgtccggctaaactgagaagctaccca 6120
aagaagcatagctatttgcagccagagataagatcagccgtcccatcgcctatacagaat 6180
acattacaaaatgtattggctgcagctactaaaaggaattgcaacgttacccaaatgcga 6240
gaattacctgtcttagattcggcggcatttaatgttgattgtttcaagaaatacgcatgc 6300
aatgatgagtactgggatacctttcgcgataaccctattcggctaactacagagaacgtt 6360
acgcaatatgtgacaaagctgaaagggccgaaagcagcagcattgtttgcgaatactcat 6420
aatctaaaaccgttgcaggagataccaatggatcaattcgtcatggatctaaagagagat 6480
gtcaaagttactcccggcacgaaacatacagaggagcggcctaaggtgcaggttattcag 6540
gctgcagatccccttgctaccgcttacctttgcgggatccatcgggaattagtccgtaga 6600
ctgaatgcggtgcttctgccaaatatccatactctcttcgacatgtcagcggaagatttt 6660
gatgcgattattgctgaacatttccaccacggcgacccagtattggaaacggacatcgcg 6720
tcgtttgataaaagcgaagacgacgctatcgccatttcggcgttgatgatccttgaggac 6780
ttaggtgtcgaccaaccgctcttagatttgatagaggcggcgttcggcaatatcacatct 6840
gtgcacctacctacaggaacgaggtttaaatttggtgccatgatgaaatccggtatgttc 6900
ttaacgctgtttgtcaacacactagtcaatatcatgattgctagcagagtactacgtgaa 6960
cggttaaccacgtcagcgtgcgcggcctctatcggcgacgataacatagtgcatggtgtc 7020
gtctccgacaccttgatggcggagagatgcgccacttggctgaacatggaagtaaaaatt 7080
attgatgcagttattggtatcaaagcaccctacttctgtgggggatttatcctggtggac 7140
cagataacaggcacagcctgcagagtcgcagaccctctaaaaaggctttttaagcttgga 7200
aaaccattgccagtcgatgatacccaagactgcgaccgccgccgggcactgcatgatgaa 7260
gcaatgcgatggaacagaattggaattacggacgagttagtgaaggccgtagaatccaga 7320
tacgagatcatactggcaggcctgatcatcacgtctctgtccacgttagccgaaagcgtt 7380
aagaacttcaagagcataagagggagcccaatcaccctctacggctgacctaaataggtg 7440
acgtagtagacacgcacctacccaccggcagaatgtttccataccctcagctgaactttc 7500
caccagtttaccctacaaatccgatggcttaccgagatccaaaccctcctaggcgccgct 7560
ggaggccgtttcggcccccgctggctgctcaaatcgaagatcttaggaggtcgatagtca 7620
acttgactttcaaacaacgatcacctaatccgccgccaggtccaccgccaaagaagaaga 7680
agagtgctcctaagccaaaacctactcagcctaaaaagaagaagcagcaagccaagagga 7740
cgaaacgcaagcctaaaccagggaaacgacaacgtatgtgtatgaagttggagtcggaca 7800
agacatttccgatcatgctgaacggccaagtgaatggatatgcctgcgttgtcggaggaa 7860
ggctgatgaaaccactccacgttgaaggaaaaattgataatgagcaattagcggccgtga 7920
aattgaagaaggctagcatgtacgacttggagtacggcgacgttccccagaacatgaaat 7980
cagacacgctgcagtacaccagcgacaaaccaccgggcttctacaactggcaccacggcg 8040
cagtccagtatgagaatgggagatttaccgtaccgagaggagtgggcgggaaaggcgaca 8100
gcggaagaccgatcctggacaacagaggcagagttgtggctattgttctaggaggtgcaa 8160
atgagggcacgcgtacggcgctttcagtggtcacttggaaccagaaaggggtgaccatta 8220
gggatacccccgaaggttctgaaccgtggtcactagttacagcgctatgcgtgctttcga 8280
Page 3
CA 02327189 2002-04-16
Canadian -1416-l5ver2
seq rev apr
15 2002
atgtcacgttcccatgcgacaaaccacccgtgtgctattcactgacgccagaacgaacac 8340
tcgacgtgctcgaagagaacgtcgacaatccaaattacgacacgctgctggagaacgtct 8400
tgaaatgtccatcacgccggcccaaacgaagcattaccgatgacttcacactgaccagtc 8460
cctacctggggttctgcccgtattgcagacactcaacgccgtgtttcagcccaataaaaa 8520
ttgagaacgtgtgggacgaatctgatgatggatcgattagaatccaggtctcggcacaat 8580
tcggctacaatcaggcaggcactgcggatgtcaccaaattccgttacatgtctttcgacc 8640
acgaccatgacatcaaggaagacagtatggagaaaatagctatcagcacatctggaccct 8700
gccgtcgtcttggccacaaagggtacttcctgttagctcaatgtcctccaggtgacagtg 8760
taaccgtcagtatcacgagcggagcatctgagaattcatgcaccgtggagaaaaagatca 8820
ggaggaagtttgtcggtagagaggagtacttgttcccacccgtccatggaaagctggtaa 8880
agtgccacgtttacgatcacttgaaggagacgtctgccgggtacataaccatgcacaggc 8940
caggcccacacgcgtataagtcctatctggaggaagcgtcaggcgaagtgtacattaaac 9000
caccttctggcaagaacgtcacctacgaatgtaagtgtggcgactacagcacaggtatcg 9060
tgagcacgcgaacgaagatgaacggctgcactaaagcaaaacagtgcattgcctacaaga 9120
gcgaccaaacgaaatgggtcttcaactcgccggatcttattaggcacacagaccactcag 9180
tgcaaggtaaattgcacattccattccgcttgacaccgacagtctgcccggttccgttag 9240
ctcacacgcctacagtcacgaagtggttcaaaggcatcaccctccacctgactgcaatgc 9300
gaccaacattgctgacaacgagaaaattggggctgcgagcagacgcaacagcagaatgga 9360
ttacagggtctacatccaggaatttttctgtggggcgagaagggctggagtacgtatggg 9420
gtaaccatgaaccagtcagagtctgggcccaggagtcggcaccaggcgacccacatggat 9480
ggccgcatgagatcatcatccactattatcatcggcatccagtctacactgtcattgtgc 9540
tgtgtggtgtcgctcttgctatcctggtaggcactgcatcatcagcagcttgcatcgcca 9600
aagcaagaagagactgcctgacgccatacgcgcttgcaccgaacgcaacggtacccacag 9660
cattagcggttttgtgctgcattcggccaaccaacgctgaaacatttggagaaactttga 9720
accatctgtggtttaacaaccaaccgtttctctgggcacagttgtgcattcctctggcag 9780
cgcttgttattctgttccgctgcttttcatgctgcatgccttttttattggttgcaggcg 9840
tctgcctggggaaggtagacgccttcgaacatgcgaccactgtgccaaatgttccgggga 9900
tcccgtataaggcgttggtcgaacgcgcaggttacgcgccacttaacctggagatcacgg 9960
tcgtctcatcggaattaacaccttcaactaacaaggagtacgtgacctgcaaattccaca 10020
cagtcattccttcaccacaagttaaatgctgcgggtccctcgagtgcaaggcatcctcaa 10080
aggcggattacacatgccgcgtttttggcggtgtgtaccctttcatgtggggaggcgcac 10140
aatgcttctgtgacagtgagaacacacaactgagtgaggcgtacgtcgagttcgctccag 10200
actgcactatagatcacgcagtcgcactaaaagttcacacagctgctctgaaagtcggcc 10260
tgcgtatagtatacggcaacaccaccgcgcacctggatacgtttgtcaatggcgtcacgc 10320
caggttcctcacgggacctgaaggtcatagcagggccgatatcagccgctttttcaccct 10380
ttgaccataaggtcgtcatcagaaaggggcttgtttacaactacgacttccctgagtatg 10440
gagctatgaaaccaggagcgttcggcgatattcaagcatcctcgcttgatgctacagaca 10500
tagtagcccgcactgacatacggctgctgaagccttctgtcaagaacatccacgtcccct 10560
acacccaagcagtatcagggtatgaaatgtggaagaacaactcaggacgacccctgcaag 10620
aaacagcaccatttggatgtaaaattgaagtggagcctctgcgagcgtctaactgtgctt 10680
acgggcacatccctatctcgattgacatccctgatgcagcttttgtgagatcatcagaat 10740
caccaacaattttagaagttagctgcacagtagcagactgcatttattctgcagactttg 10800
gtggttctctaacattacagtacaaagctgacagggagggacattgtccagttcactccc 10860
actccacgacagctgttttgaaggaagcgaccacacatgtgactgccgtaggcagcataa 10920
cactacattttagcacatcgagcccacaagcaaattttatagtttcgctatgcggcaaga 10980
agtccacctgcaatgctgaatgtaaaccaccggccgaccacataattggagaaccacata 11040
aagtcgaccaagaattccaggcggcagtttccaaaacatcttggaactggctgcttgcac 11100
tgtttgggggagcatcatccctcattgttgtaggacttatagtgttggtctgcagctcta 11160
tgcttataaacacacgtagatgactgagcgcggacactgacatagcggtaaaactcgatg 11220
tacttccgaggaagcgtggtgcataatgccacgcgccgcttgacactaaaactcgatgta 11280
tttccgaggaagcacagtgcataatgctgtgcagtgtcacattaatcgtatatcacacta 11340
catattaacaacactatatcacttttatgagactcactatgggtctctaatatacactac 11400
acatattttacttaaaaacactatacacactttataaattcttttataatttttcttttg 11460
tttttattttgtttttaaaatttc 11484
(2) INFORMATION FOR SEQ ID NO: 2:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 4150
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: DNA
(vi) ORIGINAL SOURCE:
Page 4
CA 02327189 2002-04-16
Canadian Seq-1416-l5ver2 rev apr 15 2002
(A) ORGANISM: western equine encephalomyelitis virus -
strain 71v-1658
(ix) FEATURE:
(A) NAME/KEY: CDS
(B) LOCATION: 160-3869
(D) OTHER INFORMATION: vector sequence 1 - 9
5' Sacl primer 9 - 20
3' end of NS4 gene 16 - 114
intragenic region 115 - 158
polyprotein (C-E3-E2-6K-E1) 159 - 3856
pcDw-xH7 nontranslated region 3857 - 4150
(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 2:
ggccctctagagctcatactggcaggcctgatcatcacgtctctgtccacgttagccgaa 60
agcgttaagaacttcaagagcataagagggagcccaatcaccctctacggctgacctaaa 120
taggtgacgtagtagacacgcacctacccaccggcagaatgtttccataccctcagctga 180
actttccaccagtttaccctacaaatccgatggcttaccgagatccaaaccctcctaggc 240
gccgctggaggccgtttcggcccccgctggctgctcaaatcgaagatcttaggaggtcga 300
tagtcaacttgactttcaaacaacgatcacctaatccgccgccaggtccaccgccaaaga 360
agaagaagagtgctcctaagccaaaacctactcagcctaaaaagaagaagcagcaagcca 420
agaggacgaaacgcaagcctaaaccagggaaacgacaacgtatgtgtatgaagttggagt 480
cggacaagacatttccgatcatgctgaacggccaagtgaatggatatgcctgcgttgtcg 540
gaggaaggctgatgaaaccactccacgttgaaggaaaaattgataatgagcaattagcgg 600
ccgtgaaattgaagaaggctagcatgtacgacttggagtacggcgacgttccccagaaca 660
tgaaatcagacacgctgcagtacaccagcgacaaaccaccgggcttctacaactggcacc 720
acggcgcagtccagtatgagaatgggagatttaccgtaccgagaggagtgggcgggaaag 780
gcgacagcggaagaccgatcctggacaacagaggcagagttgtggctattgttctaggag 840
gtgcaaatgagggcacgcgtacggcgctttcagtggtcacttggaaccagaaaggggtga 900
ccattagggatacccccgaaggttctgaaccgtggtcactagttacagcgctatgcgtgc 960
tttcgaatgtcacgttcccatgcgacaaaccacccgtgtgctattcactgacgccagaac 1020
gaacactcgacgtgctcgaagagaacgtcgacaatccaaattacgacacgctgctggaga 1080
acgtcttgaaatgtccatcacgccggcccaaacgaagcattaccgatgacttcacactga 1140
ccagtccctacctggggttctgcccgtattgcagacactcaacgccgtgtttcagcccaa 1200
taaaaattgagaacgtgtgggacgaatctgatgatggatcgattagaatccaggtctcgg 1260
cacaattcggctacaatcaggcaggcactgcggatgtcaccaaattccgttacatgtctt 1320
tcgaccacgaccatgacatcaaggaagacagtatggagaaaatagctatcagcacatctg 1380
gaccctgccgtcgtcttggccacaaagggtacttcctgttagctcaatgtcctccaggtg 1440
acagtgtaaccgtcagtatcacgagcggagcatctgagaattcatgcaccgtggagaaaa 1500
agatcaggaggaagtttgtcggtagagaggagtacttgttcccacccgtccatggaaagc 1560
tggtaaagtgccacgtttacgatcacttgaaggagacgtctgccgggtacataaccatgc 1620
acaggccaggcccacacgcgtataagtcctatctggaggaagcgtcaggcgaagtgtaca 1680
ttaaaccaccttctggcaagaacgtcacctacgaatgtaagtgtggcgactacagcacag 1740
gtatcgtgagcacgcgaacgaagatgaacggctgcactaaagcaaaacagtgcattgcct 1800
acaagagcgaccaaacgaaatgggtcttcaactcgccggatcttattaggcacacagacc 1860
actcagtgcaaggtaaattgcacattccattccgcttgacaccgacagtctgcccggttc 1920
cgttagctcacacgcctacagtcacgaagtggttcaaaggcatcaccctccacctgactg 1980
caatgcgaccaacattgctgacaacgagaaaattggggctgcgagcagacgcaacagcag 2040
aatggattacagggtctacatccaggaatttttctgtggggcgagaagggctggagtacg 2100
tatggggtaaccatgaaccagtcagagtctgggcccaggagtcggcaccaggcgacccac 2160
atggatggccgcatgagatcatcatccactattatcatcggcatccagtctacactgtca 2220
ttgtgctgtgtggtgtcgctcttgctatcctggtaggcactgcatcatcagcagcttgca 2280
tcgccaaagcaagaagagactgcctgacgccatacgcgcttgcaccgaacgcaacggtac 2340
ccacagcattagcggttttgtgctgcattcggccaaccaacgctgaaacatttggagaaa 2400
ctttgaaccatctgtggtttaacaaccaaccgtttctctgggcacagttgtgcattcctc 2460
tggcagcgcttgttattctgttccgctgcttttcatgctgcatgccttttttattggttg 2520
caggcgtctgcctggggaaggtagacgccttcgaacatgcgaccactgtgccaaatgttc 2580
cggggatcccgtataaggcgttggtcgaacgcgcaggttacgcgccacttaacctggaga 2640
tcacggtcgtctcatcggaattaacaccttcaactaacaaggagtacgtgacctgcaaat 2700
tccacacagtcattccttcaccacaagttaaatgctgcgggtccctcgagtgcaaggcat 2760
cctcaaaggcggattacacatgccgcgtttttggcggtgtgtaccctttcatgtggggag 2820
gcgcacaatgcttctgtgacagtgagaacacacaactgagtgaggcgtacgtcgagttcg 2880
ctccagactgcactatagatcacgcagtcgcactaaaagttcacacagctgctctgaaag 2940
tcggcctgcgtatagtatacggcaacaccaccgcgcacctggatacgtttgtcaatggcg 3000
tcacgccaggttcctcacgggacctgaaggtcatagcagggccgatatcagccgcttttt 3060
caccctttgaccataaggtcgtcatcagaaaggggcttgtttacaactacgacttccctg 3120
agtatggagctatgaaaccaggagcgttcggcgatattcaagcatcctcgcttgatgcta 3180
Page 5
CA 02327189 2002-04-16
Canadian -1416-l5ver2
Seq rev apr
15 2002
cagacatagtagcccgcactgacatacggctgctgaagccttctgtcaagaacatccacg 3240
tcccctacacccaagcagtatcagggtatgaaatgtggaagaacaactcaggacgacccc 3300
tgcaagaaacagcaccatttggatgtaaaattgaagtggagcctctgcgagcgtctaact 3360
gtgcttacgggcacatccctatctcgattgacatccctgatgcagcttttgtgagatcat 3420
cagaatcaccaacaattttagaagttagctgcacagtagcagactgcatttattctgcag 3480
actttggtggttctctaacattacagtacaaagctgacagggagggacattgtccagttc 3540
actcccactccacgacagctgttttgaaggaagcgaccacacatgtgactgccgtaggca 3600
gcataacactacattttagcacatcgagcccacaagcaaattttatagtttcgctatgcg 3660
gcaagaagtccacctgcaatgctgaatgtaaaccaccggccgaccacataattggagaac 3720
cacataaagtcgaccaagaattccaggcggcagtttccaaaacatcttggaactggctgc 3780
ttgcactgtttgggggagcatcatccctcattgttgtaggacttatagtgttggtctgca 3840
gctctatgcttataaacacacgtagatgactgagcgcggacactgacatagcggtaaaac 3900
tcgatgtacttccgaggaagcgtggtgcataatgccacgcgccgcttgacactaaaactc 3960
gatgtatttccgaggaagcacagtgcataatgctgtgcagtgtcacattaatcgtatatc 4020
acactacatattaacaacactatatcacttttatgagactcactatgggtctctaatata 4080
cactacacatattttacttaaaaacactatacacactttataaattctctcataatttca 4140
ctttaggttt 4150
(2) INFORMATION FOR SEQ ID NO: 3:
(i)SEQUENCE CHARACTERISTICS:
(A) LENGTH: 4395
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii)MOLECULE TYPE: DNA
(vi)ORIGINAL SOURCE:
(A) ORGANISM: western equine encephalomyelitis virus
-
strain 71V-1658
(vii) IMMEDIATE SOURCE: Example of a CMV coupled the
promoter to
pcdw-xh7 sequence
(ix)FEATURE:
(A) NAME/KEY: CMV promoter
(B) LOCATION: 1 .. 1260
(D) OTHER INFORMATION: pvAX vector 1 - 196
sequence
CMV promoter 1 - 11 5
CMV putative transcriptional start site 125
T7 promoter 148 - 167
PvAx mulitcloning region 168 - 196
polyprotein (C-E3-E2-6K-E1) 214 - 4065
pcDw-Hx45 nontranslated region 4066 - 4348
pcDw-Hx45 vector sequence 4349 - 4385
pvAx vector sequence 4386
(xi) SEQUENCE DESCRIPTION: SEQ ID N0: 3:
accaaaatcaacgggactttccaaaatgtcgtaacaactccgccccattgacgcaaatgg 60
gcggtaggcgtgtacggtgggaggtcatatataagcagagtctctctggctaactagaga 120
acccactgcttactggcttatcgaaattaatacgactcactatagggagacccaagctgg 180
ctagcgtttaaacttaagcttggtaccgagctcatactggcaggcctgatcatcacgtct 240
ctgtccacgttagccgaaagcgttaagaacttcaagagcataagagggagcccaatcacc 300
ctctacggctgacctaaataggtgacgtagtagacacgcacctacccaccgccagaatgt 360
ttccataccctcagctgaactttccaccagtttaccctacaaatccgatggcttaccgag 420
atccaaaccctcctaggcgccgctggaggccgtttcggcccccgctggctgctcaaatcg 480
aagatcttaggaggtcgatagtcaacttgactttcaaacaacgatcacctaatccgccgc 540
caggtccaccgccaaagaagaagaagagtgctcctaagccaaaacctactcagcctaaaa 600
agaagaagcagcaagccaagaggacgaaacgcaagcctaaaccagggaaacgacaacgta 660
tgtgtatgaagttggagtcggacaagacatttccgatcatgctgaacggccaagtgaatg 720
gatatgcctgcgttgtcggaggaaggctgatgaaaccactccacgttgaaggaaaaattg 780
ataatgagcaattagcggccgtgaaattgaagaaggctagcatgtacgacttggagtacg 840
gcgacgttccccagaacatgaaatcagacacgctgcagtacaccagcgacaaaccaccgg 900
gcttctacaactggcaccacggcgcagtccagtatgagaatgggagatttaccgtaccga 960
Page 6
CA 02327189 2002-04-16
Canadian -1416-l5ver2
Seq rev apr
15 2002
gaggagtgggcgggaaaggcgacagcggaagaccgatcctggacaacagaggcagagttg 1020
tggctattgttctaggaggtgcaaatgagggcacgcgtacggcgctttcagtggtcactt 1080
ggaaccagaaaggggtgaccattagggatacccccgaaggttctgaaccgtggtcactag 1140
ttacagcgctatgcgtgctttcgaatgtcacgttcccatgcgacaaaccacccgtgtgct 1200
attcactgacgccagaacgaacactcgacgtgctcgaagagaacgtcgacaatccaaatt 1260
acgacacgctgctggagaacgtcttgaaatgtccatcacgccggcccaaacgaagcatta 1320
ccgatgacttcacactgaccagtccctacctggggttctgcccgtattgcagacactcaa 1380
cgccgtgtttcagcccaataaaaattgagaacgtgtgggacgaatctgatgatggatcga 1440
ttagaatccaggtctcggcacaattcggctacaatcaggcaggcactgcggatgtcacca 1500
aattccgttacatgtctttcgaccacgaccatgacatcaaggaagacagtatggagaaaa 1560
tagctatcagcacatctggaccctgccgtcgtcttggccacaaagggtacttcctgttag 1620
ctcaatgtcctccaggtgacagtgtaaccgtcagtatcacgagcggagcatctgagaatt 1680
catgcaccgtggagaaaaagatcaggaggaagtttgtcggtagagaggagtacttgttcc 1740
cacccgtccatggaaagctggtaaagtgccacgtttacgatcacttgaaggagacgtctg 1800
ccgggtacataaccatgcacaggccaggcccacacgcgtataagtcctatctggaggaag 1860
cgtcaggcgaagtgtacattaaaccaccttctggcaagaacgtcacctacgaatgtaagt 1920
gtggcgactacagcacaggtatcgtgagcacgcgaacgaagatgaacggctgcactaaag 1980
caaaacagtgcattgcctacaagagcgaccaaacgaaatgggtcttcaactcgccggatc 2040
ttattaggcacacagaccactcagtgcaaggtaaattgcacattccattccgcttgacac 2100
cgacagtctgcccggttccgttagctcacacgcctacagtcacgaagtggttcaaaggca 2160
tcaccctccacctgactgcaatgcgaccaacattgctgacaacgagaaaattggggctgc 2220
gagcagacgcaacagcagaatggattacagggtctacatccaggaatttttctgtggggc 2280
gagaagggctggagtacgtatggggtaaccatgaaccagtcagagtctgggcccaggagt 2340
cggcaccaggcgacccacatggatggccgcatgagatcatcatccactattatcatcggc 2400
atccagtctacactgtcattgtgctgtgtggtgtcgctcttgctatcctggtaggcactg 2460
catcatcagcagcttgcatcgccaaagcaagaagagactgcctgacgccatacgcgcttg 2520
caccgaacgcaacggtacccacagcattagcggttttgtgctgcattcggccaaccaacg 2580
ctgaaacatttggagaaactttgaaccatctgtggtttaacaaccaaccgtttctctggg 2640
cacagttgtgcattcctctggcagcgcttgttattctgttccgctgcttttcatgctgca 2700
tgccttttttattggttgcaggcgtctgcctggggaaggtagacgccttcgaacatgcga 2760
ccactgtgccaaatgttccggggatcccgtataaggcgttggtcgaacgcgcaggttacg 2820
cgccacttaacctggagatcacggtcgtctcatcggaattaacaccttcaactaacaagg 2880
agtacgtgacctgcaaattccacacagtcattccttcaccacaagttaaatgctgcgggt 2940
ccctcgagtgcaaggcatcctcaaaggcggattacacatgccgcgtttttggcggtgtgt 3000
accctttcatgtggggaggcgcacaatgcttctgtgacagtgagaacacacaactgagtg 3060
aggcgtacgtcgagttcgctccagactgcactatagatcacgcagtcgcactaaaagttc 3120
acacagctgctctgaaagtcggcctgcgtatagtatacggcaacaccaccgcgcacctgg 3180
atacgtttgtcaatggcgtcacgccaggttcctcacgggacctgaaggtcatagcagggc 3240
cgatatcagccgctttttcaccctttgaccataaggtcgtcatcagaaaggggcttgttt 3300
acaactacgacttccctgagtatggagctatgaaaccaggagcgttcggcgatattcaag 3360
catcctcgcttgatgctacagacatagtagcccgcactgacatacggctgctgaagcctt 3420
ctgtcaagaacatccacgtcccctacacccaagcagtatcagggtatgaaatgtggaaga 3480
acaactcaggacgacccctgcaagaaacagcaccatttggatgtaaaattgaagtggagc 3540
ctctgcgagcgtctaactgtgcttacgggcacatccctatctcgattgacatccctgatg 3600
cagcttttgtgagatcatcagaatcaccaacaattttagaagttagctgcacagtagcag 3660
actgcatttattctgcagactttggtggttctctaacattacagtacaaagctgacaggg 3720
agggacattgtccagttcactcccactccacgacagctgttttgaaggaagcgaccacac 3780
atgtgactgccgtaggcagcataacactacattttagcacatcgagcccacaagcaaatt 3840
ttatagtttcgctatgcggcaagaagtccacctgcaatgctgaatgtaaaccaccggccg 3900
accacataattggagaaccacataaagtcgaccaagaattccaggcggcagtttccaaaa 3960
catcttggaactggctgcttgcactgtttgggggagcatcatccctcattgttgtaggac 4020
ttatagtgttggtctgcagctctatgcttataaacacacgtagatgactgagcgcggaca 4080
ctgacatagcggtaaaactcgatgtacttccgaggaagcgtggtgcataatgccacgcgc 4140
cgcttgacactaaaactcgatgtatttccgaggaagcacagtgcataatgctgtgcagtg 4200
tcacattaatcgtatatcacactacatattaacaacactatatcacttttatgagactca 4260
ctatgggtctctaatatacactacacatattttacttaaaaacactatacacactttata 4320
aattcttttataatttttcttttgctttagagcacactggcggccgttactagtggatcc 4380
gagctctagagggcc 4395
Page 7
