Note : Les descriptions sont présentées dans la langue officielle dans laquelle elles ont été soumises.
CA 02329153 2000-11-21
WO 99/60153 PCT/US99/10808
TITLE OF TIC INVENTION
NOVEL G-PROTEIN COUPLED RECEPTOR
CROSS-REFERENCE TO RELATED APPLICATIONS
Not applicable.
STATEMENT REGARDING FEDERALLY-SPONSORED R&D
Not applicable.
REFERENCE TO MICROFICHE APPENDIX
Not applicable.
FIELD OF THE INVENTION
The present invention is directed to a novel human DNA sequence
encoding a G-protein coupled receptor having homology to the endothelin
receptor,
the protein encoded by the DNA, and uses thereof.
BACKGROUND OF THE INVENTION
G-protein coupled receptors (GPCRs) are a very large class of
membrane receptors that relay information from the exterior to the interior of
cells.
GPCRs function by interacting with a class of heterotrimeric proteins known as
G-
proteins. Most GPCRs function by a similar mechanism. Upon the binding of
agonist,
a GPCR catalyzes the dissociation of guanosine diphosphate (GDP) from the a
subunit of G proteins. This allows for the binding of guanosine triphosphate
(GTP) to
the a subunit, resulting in the disassociation of the a subunit from the (3
and y
subunits. The freed a subunit then interacts with other cellular ocmpenents,
and in the
process passes on the extracellular signal. represented by the presence of the
agonist.
Occasionally, it is the freed ~i and r subunits which transduce the agonist
signal.
GPCRs possess common structural characteristics. They have seven
hydrophobic domains, about 20-30 amino acids long, linked by sequences of
hydrophilic amino acids of varied length. These seven hydrophobic domains
intercalate into the plasma membrane, giving rise to a protein with seven
transmembrane domains, an extracellular amino terminus, and an intracellular
carboxy
-1-
CA 02329153 2000-11-21
WO 99/60153 PCT/US99/10808
terminus (Strader et al., 1994, Ann. Rev. Biochem. 63:101-132; S,chertler et
al., 1993,
Nature 362:770-7721; Dohlman et al., 1991, Ann. Rev. Biochem. 60:653-688).
GPCRs are expressed in a wide variety of tissue types and respond to a
wide range of ligands, e.g., protein hormones, biogenic amines, peptides,
lipid derived
messengers, etc. Given their wide range of expression and ligands, it is not
surprising
that GPCRs are involved in many pathological states. This has led to great
interest in
developing modulators of GPCR activity that can be used pharmacologically. For
example, Table 1 of Stadel et al., 1997, Trends Pharmacol. Sci. 18:430-437,
lists 37
different marketed drugs that act upon GPCRs. Accordingly, there is a great
need to
understand GPCR function and to develop agents that can be used to modulate
GPCR
activity.
SUMMARY OF THE INVENTION
The present invention is directed to a novel human DNA that encodes a
G-protein coupled receptor, HGO 1. The DNA encoding HGO1 is substantially free
from other nucleic acids and has the nucleotide sequence shown in
SEQ.117.N0.:1.
Also provided is an HGO1 protein encoded by the novel DNA sequence. The HG01
protein is substantially free from other proteins and has the amino acid
sequence
shown in SEQ.D~.N0.:2. Methods of expressing HGO1 in recombinant systems and
of identifying agonists and antagonists of HGO l are provided.
BRIEF DESCRIPTION OF THE DRAWINGS
Figure 1 A-B shows the complete cDNA sequence of HG01
(SEQ.117.N0.:1).
Figure 2 shows the complete amino acid sequence of HGO 1
(SEQ.ID.N0.:2). Indicated are the locations of the signal peptide, the mature
peptide,
and the seven transmembrane domains.
Figure 3 shows the results of a Northern blot of the expression of
HGO1 mRNA in various tissues.
Figure 4 shows the alignment of the HGO1 amino acid sequence with
the amino acid sequences of the Eta and Etb endothelia receptors.
-2-
CA 02329153 2000-11-21
WO 99/60153 PCTNS99/I0808
DETAILED DESCRIPTION OF THE INVENTION
For the purposes of this invention;
"Substantially free from other proteins" means at least 90%, preferably
95%, more preferably 99%, and even more preferably 99.9%, free of other
proteins.
Thus, an HGO1 protein preparation that is substantially free from other
proteins will
contain, as a percent of its total protein, no more than 10%, preferably no
more than
5%, more preferably no more than 1%, and even more preferably no more than
0.1%,
of non-HGO 1 proteins. Whether a given HGO1 protein preparation is
substantially free
from other proteins can be determined by such conventional techniques of
assessing
protein purity as, e.g., sodium dodecyl sulfate polyacrylamide gel
electrophoresis
(SDS-PAGE) combined with appropriate detection methods, e.g., silver staining
or
immunoblotting.
"Substantially free from other nucleic acids" means at least 90%,
preferably 95%, more preferably 99%, and even more preferably 99.9%, free of
other
nucleic acids. Thus, an HGO1 DNA preparation that is substantially free from
other
nucleic acids will contain, as a percent of its total nucleic acid, no more
than 10%,
preferably no more than 5%, more preferably no more than 1%, and even more
preferably no more than 0.1%, of non-HGO1 nucleic acids. Whether a given HGO1
DNA preparation is substantially free from other nucleic acids can be
determined by
such conventional techniques of assessing nucleic acid purity as, e.g.,
agarose gel
electrophoresis combined with appropriate staining methods, e.g., ethidium
bromide
staining, or by sequencing.
A polypeptide has "substantially the same biological activity" as HGO1
if that polypeptide has a Kd for a ligand that is no more than 5-fold greater
than the
Kd of HGO 1 for the same ligand.
A "conservative amino acid substitution" refers to the replacement of
one amino acid residue by another, chemically similar, amino acid residue.
Examples
of such conservative substitutions are: substitution of one hydrophobic
residue
(isoleucine, leucine, vaiine, or methionine) for another; substitution of one
polar
residue for another polar residue of the same charge (e.g., arginine for
lysine; glutamic
acid for aspartic acid).
The present invention relates to the identification and cloning ofHG0l,
a novel G-protein coupled receptor. The present invention provides DNA
encoding
-3-
CA 02329153 2000-11-21
WO 99/60153 PCT/US99/10808
HGO1 that is substantially free from other nucleic acids. The present
invention also
provides recombinant DNA molecules encoding HGO1.
The present invention provides a DNA molecule substantially free from
other nucleic acids having the nucleotide sequence shown in Figure 1 as
SEQ.ID.NO.:1. Analysis of SEQ.ID.NO.:1 revealed that it contains an open
reading
frame at positions 84-1,526. Thus, the present invention also provides a DNA
molecule substantially free from other nucleic acids comprising the nucleotide
sequence of positions 84-1,526 of SEQ.117.N0.:1. The present invention also
provides recombinant DNA molecules comprising the nucleotide sequence of
positions
84-1,526 of SEQ.m.N0.:1.
Sequence analysis of the open reading frame of the HGO1 DNA
revealed that it encodes a protein of 481 amino acids with a predicted signal
peptide.
Based on its predicted amino acid sequence, HGO1 most likely represents a
novel
GPCR. Northern blot analysis showed that HGO1 RNA is highly expressed in the
brain and not in the pancreas, kidney, skeletal muscle, liver, lung, placenta,
or heart.
Based upon amino acid sequence alignments, HGO1 appears to be related to the
endothelin receptors (Figure 4).
The novel DNA sequences of the present invention encoding HGO l, in
whole or in part, can be linked with other DNA sequences, i. e., DNA sequences
to
which HGO1 is not naturally linked, to form "recombinant DNA molecules"
containing
HGO1. Such other sequences can include DNA sequences that control
transcription or
translation such as, e.g., translation initiation sequences, promoters for RNA
polymerase II, transcription or translation termination sequences, enhancer
sequences,
sequences that control replication in microorganisms, or that confer
antibiotic
resistance. The novel DNA sequences of the present invention can be inserted
into
vectors such as plasmids, cosmids, viral vectors, or yeast artificial
chromosomes.
Included in the present invention are DNA sequences that hybridize to
SEQ.ll~.NO.:1 under stringent conditions. By way of example, and not
limitation, a
procedure using conditions of high stringency is as follows: Prehybridization
of filters
containing DNA. is carried out for 2 hr. to overnight at 65°C in buffer
composed of 6X
SSC, 5X Denhardt's solution, and 100 pg/ml denatured salmon sperm DNA. Filters
are hybridized far 12 to 48 hrs at 65°C in prehybridization mixture
containing 100
pg/ml denatured salmon sperm DNA and 5-20 X 106 cpm of 32P-labeled probe.
Washing of filters is done at 37°C for 1 hr in a solution containing 2X
SSC, 0.1%
-4-
CA 02329153 2000-11-21
WO 99/60153 PCT/US99/10808
SDS. This is followed by a wash in O.1X SSC, 0.1% SDS at 50°C for 45
min. before
autoradiography.
Other procedures using conditions of high stringency would include
either a hybridization step carned out in SXSSC, SX Denhardt's solution, 50%
formamide at 42°C for 12 to 48 hours or a washing step carried out in
0.2X SSPE,
0.2% SDS at 65°C for 30 to 60 minutes.
Reagents mentioned in the foregoing procedures for carrying out high
stringency hybridization are well known in the art. Details of the composition
of these
reagents can be found in, e.g., Sambrook, Fritsch, and Maniatis, 1989,
Molecular
Cloning: A Laborator~r Manual, second edition, Cold Spring Harbor Laboratory
Press.
In addition to the foregoing, other conditions of high stringency which may be
used
are well known in the art.
Another aspect of the present invention includes host cells that have
been engineered to contain and/or express DNA sequences encoding HGO1. Such
recombinant host cells can be cultured under suitable conditions to produce
HGO1.
An expression vector containing DNA encoding HGO 1 can be used for expression
of
HGO1 in a recombinant host cell. Recombinant host cells may be prokaryotic or
eukaryotic, including but not limited to, bacteria such as E. coli, fungal
cells such as
yeast, mammalian cells including, but not limited to, cell lines of human,
bovine,
porcine, monkey and rodent origin, and insect cells including but not limited
to
Drosophila and silkworm derived cell lines. Cell lines derived from mammalian
species which are suitable for recombinant expression of HG01 and which are
commercially available, include but are not limited to, L cells L-M(TK-) (ATCC
CCL
1.3), L cells L-M (ATCC CCL 1.2), 293 (ATCC CRL 1573), Raji (ATCC CCL 86),
CV-1 (ATCC CCL 70), COS-1 (ATCC CRL 1650), COS-7 (ATCC CRL 1651),
CHO-K1 (ATCC CCL 61), 3T3 (ATCC CCL 92), NIH/3T3 (ATCC CRL 1658),
HeLa (ATCC CCL 2), C127I {ATCC CRL 1616), BS-C-1 (ATCC CCL 26) and
MRC-5 (ATCC CCL 171 ).
Human embryonic kidney (ILK 293) cells and Chinese hamster ovary
(CHO) cells are particularly suitable for expression of the HGO1 protein
because these
cells express a large number of G-proteins. Thus, it is likely that at least
one of these
G-proteins will be able to functionally couple the signal generated by
interaction of
HGO1 and its ligands, thus transmitting this signal to downstream effectors,
eventually
-5-
CA 02329153 2000-11-21
WO 99/60153 PCT/US99/10808
resulting in a measurable change in some assayable component, e.g., cAMP
level,
expression of a reporter gene, hydrolysis of inositol lipids, or intracellular
Ca2+ levels.
A variety of mammalian expression vectors can be used to express
recombinant HGO1 in mammalian cells. Commercially available mammalian
expression vectors which are suitable include, but are not limited to, pMClneo
(Stratagene), pSGS (Stratagene), pcDNAI and pcDNAIamp, pcDNA3, pcDNA3.1,
pCR3.1 (Invitrogen), EBO-pSV2-neo (ATCC 37593), pBPV-1(8-2) (ATCC 37110),
pdBPV-MMTneo(342-12) (ATCC 37224), pRSVgpt (ATCC 37199), pRSVneo
(ATCC 37198), and pSV2-dhfr (ATCC 37146). Following expression in recombinant
cells, HGO1 can be purified by conventional techniques to a level that is
substantially
free from other proteins.
The present invention includes HGO1 protein substantially free from
other proteins. The amino acid sequence of the full-length HGO1 protein is
shown in
Figure 2 as SEQ.1D.N0.:2. Thus, the present invention includes HGO1 protein
substantially free from other proteins having the amino acid sequence
SEQ.ID.N0.:2.
The present invention also includes HGO1 proteins lacking a signal sequence.
An
example of such an HGO1 protein lacking a signal sequence is positions 26-481
of
SEQ.ID.N0.:2.
The present invention also includes recombinant DNA encoding an
HGO1 protein lacking a signal sequence. Thus, the present invention includes a
recombinant DNA molecule encoding an HG01 protein having the amino acid
sequence of positions 26-481 of SEQ.ID.N0.:2. The present invention also
includes a
recombinant DNA molecule comprising the nucleotide sequence of positions 159-
1,526 of SEQ.ID.NO.:1.
As with many receptor proteins, it is possible to modify many of the
amino acids of HG01, particularly those which are not found in the ligand
binding
domain, and still retain substantially the same biological activity as the
original
receptor. Thus this invention includes modified HGO1 polypeptides which have
amino
acid deletions, additions, or substitutions but that still retain
substantially the same
biological activity as HGO1. It is generally accepted that single amino acid
substitutions do not usually alter the biological activity of a protein (see,
e.g.,
Molecular Biology of the Gene, Watson et al., 1987, Fourth Ed., The
Benjamin/Cummings Publishing Co., Inc., page 226; and Cunningham & Wells,
1989,
Science 244:1081-1085). Accordingly, the present invention includes
polypeptides
-6-
CA 02329153 2000-11-21
WO 99/60153 PCTNS99/10808
where one amino acid substitution has been made in SEQ.117.N0.:2 or in one of
the
HGO1 polypeptides lacking a signal sequence listed above, wherein the
polypeptides
still retain substantially the same biological activity as HGO1. The present
invention
also includes polypeptides where two amino acid substitutions have been made
in
SEQ.ID.N0.:2 or in one of the HGO1 polypeptides lacking a signal sequence
listed
above, wherein the polypeptides still retain substantially the same biological
activity as
HGO1. In particular, the present invention includes embodiments where the
above-
described substitutions are conservative substitutions. In particular, the
present
invention includes embodiments where the above-described substitutions do not
occur
in the ligand-binding domain of HGO 1.
The present invention also includes C-terminal truncated forms of
HG01, particularly those which encompass the extracellular portion of the
receptor,
but lack the intracellular signaling portion of the receptor. Such truncated
receptors
are useful in various binding assays described herein, for crystallization
studies, and for
structure-activity-relationship studies.
Romano et al., 1996, J. Biol. Chem. 271:28612-28616 demonstrated
that some GPCRs are often found as homodimers formed by an intermolecular
disulfide bond. The location of the cysteines responsible for the disulfide
bond was
found to be in the amino terminal 17kD of the receptors. Accordingly, the
present
invention includes dimers of HGO 1 proteins.
It has been found that, in some case, membrane spanning regions of
receptor proteins can be used to inhibit receptor function (Ng et al., 1996,
Biochem.
Biophys. Res. Comm. 227:200-204; Hebert et al., 1996, J. Biol. Chem. 271,
16384-
16392; Lofts et al., Oncogene 8:2813-2820). Accordingly, the present invention
provides peptides derived from the seven membrane spanning regions of HGO1 and
their use to inhibit HGO1 function. Such peptides can include the whole or
parts of the
receptor membrane spanning domains.
The present invention also includes chimeric HGO1 proteins. Chimeric
HGO1 proteins consist of a contiguous polypeptide sequence of HGO 1 fused in
frame
to a polypeptide sequence of a non-HGO1 protein. For example, the N-terminal
domain and seven transmembrane spanning domains of HGO 1 fused at the C-
terminus
in frame to a G pratein would be a chimeric HGO1 protein.
The present invention also includes HGO1 proteins that are in the form
of multimeric structures, e.g., dimers. Such multimers of other G-protein
coupled
7_
CA 02329153 2000-11-21
WO 99/60153 PCT/US99/10808
receptors are known (Hebert et al., 1996, J. Biol. Chem. 271, 16384-16392; Ng
et al.,
1996, Biochem. Biophys. Res. Comm. 227, 200-204; Romano et al., 1996, J. Biol.
Chem. 271, 28612-28616).
The present invention also includes isolated forms of HG01 proteins.
By "isolated HGO1 protein" is meant HGO1 protein that has been isolated from a
natural source. Use of the term "isolated" indicates that HGO1 protein has
been
removed from its normal cellular environment. Thus, an isolated HGO1 protein
may
be in a cell-free solution or placed in a different cellular environment from
that in
which it occurs naturally. The term isolated does not imply that an isolated
HGO1
protein is the only protein present. but instead means that an isolated HGO1
protein is
at least 95% free of non-amino acid material (e.g., nucleic acids, lipids,
carbohydrates)
naturally associated with the HGO1 protein. Thus, an HGO 1 protein that is
expressed
in bacteria or even in eukaryotic cells which do not naturally (i.e., without
human
intervention) express it through recombinant means is an "isolated HG01
protein."
The specificity of binding of compounds showing affinity for HGO1 is
shown by measuring the affinity of the compounds for recombinant cells
expressing the
cloned receptor or for membranes from these cells. Expression of the cloned
receptor
and screening for compounds that bind to HGO1 or that inhibit the binding of a
known,
radiolabeled ligand of HGO 1 to these cells, or membranes prepared from these
cells,
provides an effective method for the rapid selection of compounds with high
affinity
for HGO1. Such ligands need not necessarily be radiolabeled but can also be
norusotopic compounds that can be used to displace bound radiolabeled
compounds or
that can be used as activators in functional assays. Compounds identified by
the above
method are likely to be agonists or antagonists of HGOI and may be peptides,
proteins, or non-proteinaceous organic molecules.
Therefore, the present invention includes assays by which HGO1
agonists and antagonists may be identified. Analogous methods for identifying
agonists and antagonists of other receptors are well known in the art and can
be
adapted to identify agonists and antagonists of HGO 1. For example, Cascieri
et al.,
1992, Molec. Pharmacol. 41:1096-1099 describe a method for identifying
substances
that inhibit agonist binding to rat neurokinin receptors and thus are
potential agonists
or antagonists of neurokinin receptors. The method involves transfecting COS
cells
with expression vectors containing rat neurokinin receptors, allowing the
transfected
cells to grow for a time sufficient to allow the neurokinin receptors to be
expressed,
_g-
CA 02329153 2000-11-21
WO 99/60153 PCT/US99/10808
harvesting the transfected cells and resuspending the cells in assay buffer
containing a
known radioactively labeled agonist of the neurokinin receptors either in the
presence
or the absence of the substance, and then measuring the binding of the
radioactively
labeled known agonist of the neurokinin receptor to the neurokinin receptor.
If the
amount of binding of the known agonist is less in the presence of the
substance than in
the absence of the substance, then the substance is a potential agonist or
antagonist of
the neurokinin receptor.
Accordingly, the present invention includes a method for determining
whether a substance is a potential agonist or antagonist of HGO1 that
comprises:
(a) transfecting cells with an expression vector encoding HGO1;
(b) allowing the transfected cells to grow for a time sufficient to
allow HGO 1 to be expressed;
(c) harvesting the transfected cells and resuspending the cells in the
presence of a known labeled agonist of HGO 1 in the presence and in the
absence of the
1S substance;
(d) measuring the binding of the labeled agonist to HGO 1; where if
the amount of binding of the known agonist is less in the presence of the
substance
than in the absence of the substance, then the substance is a potential
agonist or
antagonist of HGO1.
In a modification of the above-described method, step (b) is modified in
that the cells are stably transfected with the expression vector containing
HG01. In
another modification of the above-described method, step (c) is modified in
that the
cells are not harvested and resuspended but rather the radioactively labeled
known
agonist and the substance are contacted with the cells while the cells are
attached to a
substratum, e.g., tissue culture plates.
The conditions under which step (c) of the method is practiced are
conditions that are typically used in the art for the study of protein-ligand
interactions:
e.g., physiological pH; salt conditions such as those represented by such
commonly
used buffers as PBS or in tissue culture media; a temperature of about
4°C to about
55°C.
In a particular embodiment of the above-described method, the cells are
eukaryotic cells. In another embodiment, the cells are mammalian cells. In
other
embodiments, the cells are L cells L-M(TK-) (ATCC CCL 1.3), L cells L-M (ATCC
CCL 1.2), 293 (ATCC CRL 1573), Raji (ATCC CCL 86), CV-1 (ATCC CCL 70),
-9-
CA 02329153 2000-11-21
WO 99160153 PCT/US99/10808
COS-1 (ATCC CRL 1650), COS-7 (ATCC CRL 1651), CHO-K1 (ATCC CCL 61),
3T3 (ATCC CCL 92), NH3T3 (ATCC CRL 1658), HeLa (ATCC CCL 2), C127I
(ATCC CRL 1616), BS-C-1 (ATCC CCL 26) or MRC-5 (ATCC CCL 171).
The present invention also includes a method for determining whether a
substance is capable of binding to HGO1, i.e., whether the substance is a
potential
agonist or an antagonist of HG01, where the method comprises:
(a) providing test cells by transfecting cells with an expression
vector that directs the expression of HGO1 in the cells;
(b) exposing the test cells to the substance;
{c) measuring the amount of binding of the substance to HGO 1;
(d) comparing the amount of binding of the substance to HGO 1 in
the test cells with the amount of binding of the substance to control cells
that have not
been transfected with HGO1;
wherein if the amount of binding of the substance is greater in the test
cells as compared to the control cells, the substance is capable of binding to
HGO1.
Determining whether the substance is actually an agonist or antagonist can
then be
accomplished by the use of functional assays such as, e.g., the assay
involving the use
of promiscuous G-proteins described below.
The conditions under which step (b) of the method is practiced are
conditions that are typically used in the art for the study of protein-ligand
interactions:
e.g., physiological pH; salt conditions such as those represented by such
commonly
used buffers as PBS or in tissue culture media; a temperature of about
4°C to about
55°C.
The assays described above can be carried out with cells that have been
transiently or stably transfected with HGO1. Transfection is meant to include
any
method known in the art for introducing HGO1 into the test cells. For example,
transfection includes calcium phosphate or calcium chloride mediated
transfection,
lipofection, infection with a retroviral construct containing HGO 1, and
electroporation.
Where binding of the substance or agonist to HGO1 is measured, such
binding can be measured by employing a labeled substance or agonist. The
substance
or agonist can be labeled in any convenient manner known to the art, e.g.,
radioactively, fluorescently, enzymatically.
-10-
CA 02329153 2000-11-21
WO 99/60153 PCTNS99/10808
In particular embodiments of the above-described methods, HG01 has
an amino acid sequence selected from the group consisting of SEQ.1D.N0.:2 and
positions 26-481 of SEQ.ID.N0.:2;
The above-described methods can be modified in that, rather than
exposing the test cells to the substance, membranes can be prepared from the
test cells
and those membranes can be exposed to the substance. Such a modif cation
utilizing
membranes rather than cells is well known in the art and is described in,
e.g., Hess et
al., 1992, Biochem. Biophys. Res. Comm. 184:260-268.
Accordingly, the present invention provides a method for determining
whether a substance is capable of binding to HGO1 comprising:
(a) providing test cells by transfecting cells with an expression
vector that directs the expression of HGO 1 in the cells;
(b) preparing membranes containing HGO1 from the test cells and
exposing the membranes from the test cells to the substance;
(c) measuring the amount of binding of the substance to the HGO 1
in the membranes from the test cells;
(d) comparing the amount of binding of the substance to HG01 in
the membranes from the test cells with the amount of binding of the substance
to
membranes from control cells that have not been transfected with HGO1;
where HG01 has an amino acid sequence selected from the group
consisting of SEQ.ID.NO.:2 and positions 26-481 of SEQ.ID.N0.:2;
where if the amount of binding of the substance to HGO1 in the
membranes from the test cells is greater than the amount of binding of the
substance to
the membrances from the control cells, then the substance is capable of
binding to
HGO1.
The present invention provides a method for determining whether a
substance is capable of binding to HGO1 comprising:
(a) providing test cells by transfecting cells with an expression
vector that directs the expression of HG01 in the cells;
(b) exposing the test cells to a Ggand of HGO1 under conditions
such that the ligand binds to the HGO1 in the test cells;
(c) subsequently or concurrently to step (b), exposing the cells to a
substance that is suspected of being capable of binding to HGOl;
-11-
CA 02329153 2000-11-21
WO 99/60153 PCTNS99/10808
(d) measuring the amount of binding of the ligand to HGO1 in the
presence and the absence of the substance;
(e) comparing the amount of binding of the ligand to HGO1 in the
presence and the absence of the substance where a decrease in the amount of
binding
of the ligand to HGO1 in the presence of the substance indicates that the
substance is
capable of binding to HGO1;
where HGO 1 has an amino acid sequence selected from the group
consisting of SEQ.ID.N0.:2 and positions 26-481 of SEQ.m.N0.:2.
The present invention provides a method for determining whether a
substance is capable of binding to HGO1 comprising:
(a) providing test cells by transfecting cells with an expression
vector that directs the expression of HGOl in the cells;
(b) preparing membranes containing HGO l from the test cells and
exposing the membranes to a ligand of HG01 under conditions such that the
ligand
binds to the HG01 in the membranes;
(c) subsequently or concurrently to step (b), exposing the
membranes from the test cells to a substance;
(d) measuring the amount of binding of the ligand to the HGO1 in
the membranes in the presence and the absence of the substance;
(e) comparing the amount of binding of the ligand to HGO 1 in the
membranes in the presence and the absence of the substance where a decrease in
the
amount of binding of the ligand to HGO 1 in the membranes in the presence of
the
substance indicates that the substance is capable of binding to HGO1;
where HGO1 has an amino acid sequence selected from the group
consisting of SEQ.m.N0.:2 and positions 26-481 of SEQ.ID.N0.:2.
As a further modification of the above-described methods, RNA
encoding HGO1 can be prepared as, e.g., by in vitro transcription using a
plasmid
containing HGO 1 under the control of a bacteriophage T7 promoter, and the RNA
can
be microinjected into Xenopus oocytes in order to cause the expression of HGO1
in the
oocytes. Substances are then tested for binding to the HGO1 expressed in the
oocytes.
Alternatively, rather than detecting binding, the effect of the substances on
the
electrophysiological properties of the oocytes can be determined.
The present invention includes assays by which HGO 1 agonists and
antagonists may be identified by their ability to stimulate or antagonize a
functional
-12-
CA 02329153 2000-11-21
WO 99/60153 PCT/US99/10808
response mediated by HGO1. HGO1 belongs to the class of proteins known as G-
protein coupled receptors (GPCRs). GPCRs transmit signals across cell
membranes
upon the binding of ligand. The ligand-bound GPCR interacts with a
heterotrimeric
G-protein, causing the Ga subunit of the G-protein to disassociate from the
G(3 and
Gy subunits. The Ga subunit can then go on to activate a variety of second
messenger
systems.
Generally, a particular GPCR is only coupled to a particular type of G-
protein. Thus, to observe a functional response from the GPCR, it is necessary
to
ensure that the proper G-protein is present in the system containing the GPCR.
It has
been found, however, that there are certain G-proteins that are "promiscuous."
These
promiscuous G-proteins will couple to, and thus transduce a functional signal
from,
virtually any GPCR. See Offermanns & Simon, 1995, J. Biol. Chem. 270:15175,
15180 (Offermanns). Offermanns described a system in which cells are
transfected
with expression vectors that result in the expression of one of a large number
of
GPCRs as well as the expression of one of the promiscuous G-proteins GoclS or
Gocl6. Upon the addition of an agonist of the GPCR to the transfected cells,
the
GPCR was activated and was able, via Ga l s or Ga 16, to activate the (3
isoform of
phospholipase C, leading to an increase in inositol phosphate levels in the
cells.
Therefore, by making use of these promiscuous G-proteins as in
Offermanns, it is possible to set up functional assays for HGO1, even in the
absence of
knowledge of the G-protein with which HGO1 is coupled in vivo. One possibility
is to
create a fusion or chimeric protein composed of the extracellular and membrane
spanning portion of HGO1 fused to a promiscuous G-protein. Such a fusion
protein
would be expected to transduce a signal following binding of ligand to the
HGO1
portion of the fusion protein. Accordingly, the present invention provides a
method of
identifying antagonists of HGO 1 comprising:
(a) providing cells that expresses a chimeric HGO1 protein fused at
its C-terminus to a promiscuous G-protein;
(b) exposing the cells to an agonist of HGO1;
(c) subsequently or concurrently to step (b), exposing the cells to a
substance that is a suspected antagonist of HGO1;
(d) measuring the level of inositol phosphates in the cells;
-13-
CA 02329153 2000-11-21
WO 99/60153 PCT/US99/10808
where a decrease in the level of inositol phosphates in the cells in the
presence of the substance as compared to the level of inositol phosphates in
the cells in
the absence of the substance indicates that the substance is an antagonist of
HGO 1.
Another possibility for utilizing promiscuous G-proteins in connection
with HGO 1 includes a method of identifying agonists of HGO l comprising:
(a) providing cells that expresses both HGO1 and a promiscuous G-
protein;
(b) exposing the cells to a substance that is a suspected agonist of
HGO l;
(c) measuring the level of inositol phosphates in the cells;
where an increase in the level of inositol phosphates in the cells as
compared to the level of inositol phosphates in the cells in the absence of
the suspected
agorust indicates that the substance is an agonist of HGOI.
Levels of inositol phosphates can be measured by monitoring calcium
mobilization. Intracellular calcium mobilization is typically assayed in whole
cells
under a microscope using fluorescent dyes or in cell suspensions via
luminescence
using the aequorin assay.
In a particular embodiment of the above-described method, the cells are
eukaryotic cells. In another embodiment, the cells are mammalian cells. In
other
embodiments, the cells are L cells L-M(TK-) (ATCC CCL 1.3), L cells L-M (ATCC
CCL 1.2), 293 (ATCC CRL 1573), Raji (ATCC CCL 86), CV-1 (ATCC CCL 70),
COS-1 (ATCC CRL 1650), COS-7 (ATCC CRL 1651), CHO-Kl (ATCC CCL 61),
3T3 (ATCC CCL 92), NIH/3T3 (ATCC CRL 1658), HeLa (ATCC CCL 2), C127I
(ATCC CRL 1616), BS-C-1 (ATCC CCL 26) or MRC-5 (ATCC CCL 171).
In a particular embodiment of the above-described method, the cells are
transfected with expression vectors that direct the expression of HGO 1 and
the
promiscuous G protein in the cells.
The conditions under which step (b) of the method is practiced are
conditions that are typically used in the art for the study of protein-ligand
interactions:
e.g., physiological pH; salt conditions such as those represented by such
commonly
used buffers as PBS or in tissue culture media; a temperature of about
4°C to about
SS°C.
In a particular embodiment of the above-described method, the
promiscuous G-protein is selected from the group consisting of Gals or Gocl6.
- 14-
CA 02329153 2000-11-21
WO 99/60153 PCT/US99/10808
Expression vectors containing Gals or Gal6 are known in the art. See, e.g.,
Offermanns; Buhl et al., 1993, FEBS Lett. 323:132-134; Amatruda et ad., 1993,
J.
Biol. Chem. 268:10139-10144.
The above-described assay can be easily modified to form a method to
5 identify antagonists of HGO 1. Such a method is also part of the present
invention and
comprises:
(a) providing cells that expresses both HGO1 and a promiscuous G-
protein;
(b) exposing the cells to a substance that is an agonist of HGO1;
10 (c) subsequently or concurrently to step (b), exposing the cells to a
substance that is a suspected antagonist of HGO1;
(d) measuring the level of inositol phosphates in the cells;
where a decrease in the level of inositol phosphates in the cells in the
presence of the suspected antagonist as compared to the level of inositol
phosphates in
15 the cells in the absence of the suspected antagonist indicates that the
substance is an
antagonist of HGOI .
In a particular embodiment of the above-described method, the cells are
eukaryotic cells. In another embodiment, the cells are mammalian cells. In
other
embodiments, the cells are L cells L-M(TK-) (ATCC CCL 1.3), L cells L-M (ATCC
20 CCL 1.2), 293 (ATCC CRL 1573), Raji {ATCC CCL 86), CV-1 (ATCC CCL 70),
COS-1 (ATCC CRL 1650), COS-7 {ATCC CRL 1651), CHO-K1 (ATCC CCL 61),
3T3 (ATCC CCL 92), NIII/3T3 (ATCC CRL 1658), HeLa (ATCC CCL 2), C127I
(ATCC CRL 1616), B S-C-1 (ATCC CCL 26) and MRC-5 (ATCC CCL 171 ).
The conditions under which steps (b) and (c) of the method are
25 practiced are conditions that are typically used in the art for the study
of protein-ligand
interactions: e.g., physiological pH; salt conditions such as those
represented by such
commonly used buffers as PBS or in tissue culture media; a temperature of
about 4°C
to about 55°C.
In a particular embodiment of the above-described method, the cells are
30 transfected with expression vectors that direct the expression of HGO1 and
the
promiscuous G-protein in the cells.
In a particular embodiment of the above-described method, the
promiscuous G-protein is selected from the group consisting of Gals or Gal6.
- 15-
CA 02329153 2000-11-21
WO 99/60153 PC'f/US99/10808
In particular embodiments of the above-described methods, HGO 1 has
an amino acid sequence selected from the group consisting of SEQ.ID.N0.:2 and
positions 26-481 of SEQ.117.N0.:2.
When screening compounds in order to identify potential
pharmaceuticals that specifically interact with a target receptor, it is
necessary to
ensure that the compounds identified are as specific as possible for the
target receptor.
To do this, it is necessary to screen the compounds against as wide an array
as
possible of receptors that are similar to the target receptor. Thus, in order
to find
compounds that are potential pharmaceuticals that interact with receptor A, it
is
necessary not only to ensure that the compounds interact with receptor A (the
"plus
target") and produce the desired pharmacological effect through receptor A, it
is also
necessary to determine that the compounds do not interact with receptors B, C,
D, etc.
(the "minus targets"). In general, as part of a screening program, it is
important to
have as many minus targets as possible (see Hodgson, 1992, Bio/Technology
10:973-
980, at 980). HGO 1 proteins and DNA encoding HG01 proteins have utility in
that
they can be used as "minus targets" in screens design to identify compounds
that
specifically interact with other G-protein coupled receptors.
The present invention also includes antibodies to the HGO1 protein.
Such antibodies may be polyclonal antibodies or monoclonal antibodies. The
antibodies of the present invention are raised against the entire HGOl protein
or
against suitable antigenic fragments of the protein that are coupled to
suitable carriers,
e.g., serum albumin or keyhole limpet hemocyanin, by methods well known in the
art.
Methods of identifying suitable antigenic fragments of a protein are known in
the art.
See, e.g., Hopp & Woods, 1981, Proc. Natl. Acad. Sci. USA 78:3824-3828; and
Jameson & Wolf, 1988, CABIOS (Computer Applications in the Biosciences) 4:181-
186.
For the production of polyclonal antibodies, HGO1 protein or an
antigenic fragment, coupled to a suitable carrier, is injected on a periodic
basis into an
appropriate non-human host animal such as, e.g., rabbits, sheep, goats, rats,
mice. The
animals are bled periodically and sera obtained are tested for the presence of
antibodies
to the injected antigen. The injections can be intramuscular, intraperitoneal,
subcutaneous, and the like, and can be accompanied with adjuvant.
For the production of monoclonal antibodies, HGO1 protein or an
antigenic fragment, coupled to a suitable carrier, is injected into an
appropriate non-
-16-
CA 02329153 2000-11-21
WO 99/60153 PCT/US99/10808
human host animal as above for the production of polyclonal antibodies. In the
case of
monoclonal antibodies, the animal is generally a mouse. The animal's spleen
cells are
then immortalized, often by fusion with a myeloma cell, as described in Kohler
&
Milstein, 1975, Nature 256:495-497. For a fuller description of the production
of
monoclonal antibodies, see Antibodies: A Laboratory Manual, Harlow & Lane,
eds.,
Cold Spring Harbor Laboratory Press, 1988.
Gene therapy may be used to introduce HGO1 polypeptides into the
cells of target organs. Nucleotides encoding HGO 1 polypeptides can be ligated
into
viral vectors which mediate transfer of the nucleotides by infection of
recipient cells.
Suitable viral vectors include retrovirus, adenovirus, adeno-associated virus,
herpes
virus, vaccinia virus, and polio virus based vectors. Alternatively,
nucleotides
encoding HGO1 polypeptides can be transferred into cells for gene therapy by
non-
viral techniques including receptor-mediated targeted transfer using ligand-
nucleotide
conjugates, lipofection, membrane fusion, or direct microinjection. These
procedures
and variations thereof are suitable for ex vivo as well as in vivo gene
therapy. Gene
therapy with HGO1 polypeptides will be particularly useful for the treatment
of
diseases where it is beneficial to elevate HGO1 activity.
The following non-limiting examples are presented to better illustrate
the invention.
EXAMPLE 1
Cloning and sequencing of HG01
A cDNA fragment encoding full-length HGO 1 can be isolated from a
human fetal brain cDNA library by using the polymerise chain reaction (PCR)
employing the following primer pair:
HGO1 FL1528R TGGGGAAAGAACAGCACACACC (SEQ. B7. NO.:11)
HGO1 FL31F CTGGGCTGGCTGTCTCCTGCTC (SEQ.117. N0.:12)
PCR reactions can be carried out with a variety of thermostable
enzymes including but not limited to AmpliTaq, AmpliTaq Gold, Vent polymerise.
For AmpliTaq, reactions can be carried out in 10 mM Tris-Cl, pH 8.3, 2.0 mM
-17-
CA 02329153 2000-11-21
WO 99/60153 PCT/US99/10808
MgCl2, 200 pM for each dNTP, 50 mM KCI, 0.2 wM for each primer, 10 ng of DNA
template, 0.05 units/wl of AmpliTaq. The reactions are heated at 95°C
for 3 minutes
and then cycled 35 times using the cycling parameters of 95°C, 20
seconds, 62°C, 20
seconds, 72°C, 3 minutes. In addition to these conditions, a variety of
suitable PCR
protocols can be found in PCR Primer. A Laborator~Manual, edited by C.W.
Dieffenbach and G.S.Dveksler, 1995, Cold Spring Harbor Laboratory Press.
A suitable cDNA library from which a clone encoding HGO1 can be
isolated would be a random primed fetal brain cDNA library consisting of
approximately 4.0 million primary clones constructed in the plasmid vector
pBluescript
(Stratagene, LaJolla, CA). The primary clones of such a library can be
subdivided into
pools with each pool containing approximately 20,000 clones and each pool can
be
amplified separately.
By this method, a cDNA fragment encoding an open reading frame of
481 amino acids (SEQ.ID.N0.:2) is obtained. This cDNA fragment can be cloned
into
a suitable cloning vector or expression vector. For example, the fragment can
be
cloned into the mammalian expression vector pcDNA3.1 (Invitrogen, San Diego,
Ca).
HGO1 protein can then be produced by transferring an expression vector
comprising
positions 84-1,526 of SEQ.ID.NO.:1 or portions thereof into a suitable host
cell and
growing the host cell under appropriate conditions. HGO1 protein can then be
isolated
by methods well known in the art.
As an alternative to the above-described PCR method, a cDNA clone
encoding HGO1 can be isolated from a cDNA library using as a probe
oligonucleotides
specific for HGO1 and methods well known in the art for screening cDNA
libraries
with oligonucleotide probes. Such methods are described in, e.g., Sambrook et
al.,
1989, Molecular Cloning: A Laboratory Manual; Cold Spring Harbor Laboratory,
Cold Spring Harbor, New York; Glover, D.M. (ed.), 1985, DNA Cloning: A
Practical
Approach, MRL Press, Ltd., Oxford, U.K., Vol. I, II. Oligonucleotides that are
specific for HGO1 and that can be used to screen cDNA libraries are:
HG01.F223 GCCTGCCCATCCTCTTCACA (SEQ. ID. N0.:3)
HGO1.R349 CCACGGTCAGGCCCACCA (SEQ. ID. N0.:4)
HGO1.R145 ATACAGGGACTCGGGCAGGC (SEQ. m. N0.:5)
HG01.R107 TCCTGGACTGCTGCTGCT (SEQ. B~. N0.:6)
HGO1.F715 CGTTGAAGCGGTCAATGC (SEQ. )Z7. N0.:7)
HGO1.VW56 0F TGGGGAAAGAACAGCAGACA (SEQ.117. N0.:8)
HG01.43R ATGGCTGGATGAGCAGGAGA (SEQ. ID. N0.:9)
HG01.85R CCACAGCCAAAATCACAGCA (SEQ. >D. NO.:10)
- 1$ -
CA 02329153 2000-11-21
WO 99/60153 PCT/US99/10808
HG01_FL1528R TGGGGAAA.GAACAGCACACACC (SEQ. m. NO.:11)
HGO1_FL31F CTGGGCTGGCTGTCTCCTGCTC (SEQ. m. N0.:12)
PBS.873F CCCAGGCTTTACACTTTATGCTTCC (SEQ. B7. N0.:13)
PBS.543R GGGGATGTGCTGCAAGGCGA (SEQ. DJ. N0.:14)
Membrane-spanning proteins, such as GPCRs, when first translated
generally possess an approximately 16 to 40 amino acid segment known as a
signal
sequence. Signal sequences direct the nascent protein to be transported
through the
endoplasmic reticulum membrane, following which signal sequences are cleaved
from
the protein. Signal sequences generally contain from 4 to 12 hydrophobic
residues but
otherwise possess little sequence homology. The Protein Analysis tool of the
GCG
program (Genetics Computer Group, Madison, Wisconsin), a computer program
capable of identifying likely signal sequences, was used to examine the N
terminus of
HGO 1. A likely signal sequence was found at positions 13-25 of (SEQ. m.
N0.:2).
EXAMPLE 2
Tissue distribution of HGO1 RNA transcripts
An approximately 1.5 kb fragment containing HGO1 was randomly
primed with a 32P-dCTP using the Megaprime DNA Labeling System (Amersham)
and used to probe a Human MTN Blot (Clontech Cat # 7760-1, Clontech, Palo
Alto,
CA, USA). The MTN blot was hybridized in Expresshyb (Clontech) containing
2x106
cpm/ml HGO1 probe at 65°C overnight and washed to a final stringency of
0.1 X
SSC/0.5% SDS at 65°C, and then exposed to X-ray film by
autoradiongraphy. The
results are shown in Figure 3.
The present invention is not to be limited in scope by the specific
embodiments described herein. Indeed, various modifications of the invention
in
addition to those described herein will become apparent to those skilled in
the art from
the foregoing description. Such modifications are intended to fall within the
scope of
the appended claims.
Various publications are cited herein, the disclosures of which are
incorporated by reference in their entireties.
-19-
