Note : Les descriptions sont présentées dans la langue officielle dans laquelle elles ont été soumises.
CA 02329509 2000-11-21
WO 99/61597 1'CT/US99/11250
DESCRIPTION
IMPROVED METHODS AND MATERIALS FOR TRANSFORMATION
This invention was made with United States government support awarded by the
following agency:
NIH Grant No: GM35072
The United States has certain rights in this invention.
Background of the Invention
RNA viruses liave been found to be valuable tools in the phenotypic atid
genotypic
transfonnation of targeted cells and tissues. See, e.g., U.S. Patetit No.
5,500,360, which teaches
novel viral RNA expression vectors. It has been shown that the RNA of the
genome of an RNA
virus can be modified to include an exogenous RNA segtnerit and that the
rnodified RNA can
be introduced into a host cell, replicated therein, and thereby express the
exogenous RNA
segment.
Current methods of inoculating a host cell with modified RNA viruses involve
the in
vitro transcription of a particular strand followed by the introduction of the
resulting RNA
transcripts into the host cell. One problern with the current inoculation
method is that the RNA
rapidly degrades which causes a low eflficiency of infection. In addition, the
preparation of the
in vitro RNA transcripts is expensive and time consuming.
Further, with the advent of transformation and the genetic engineering of
platits, much
concern has arisen concerning the potential hazard of the dispersal of
dangerous traits into the
environment. For example, genes increasing the stress tolerance atid/or
herbicide resistance of
an agriculturally important crop could theoretically "leak" to surrounding
less desirable and
damaging plants, e.g., through pollen, mechanica) or insect dispersal. This
phenornenon could
create a novel species of "super-weed" which could wreak havoc on the
agricultural industry.
Existing RNA virus-based vectors can spread to non-target plants by mechanical
means and/or
by insects. Such spread can be prevetited by using vectors that can replicate
and/or move only
in target plants expressing the appropriate trans-acting factors. Accordingly,
there remains a
need for less expensive and more efficient methods of transformation of target
cells and tissues.
Moreover, there is a need for a novel method of transformation which
alleviates the potential
dangers associated with the unwanted spread of engineered traits into the
environment.
CA 02329509 2000-11-21
WO 99/61597 PC'r/US99/11250
2
Brief Surnmary of the Invention
The subject invention pertains to improved materials and methods for
transforming host
cells which involve transfecting said cells with a DNA-launching platform. One
aspect of the
subject invention pertains to a DNA-launciiing platform which encodes a
modified viral RNA
molecule downstream of DNA-dependent RNA polynierase (pol) promoter, whereby
the DNA-
launching platform is capable of being introduced into a host cell and
effectively "launching"
said modified viral RNA inolecule into the host cell such that it is
replicated and expressed
therein. The term "inodified viral RNA molecule" as used herein refers to a
viral RNA which
has been changed froni its natural state. Examples of changes of viral RNA
include, but are not
limited to, removal of a part of viral RNA genoine, insertion or substitution
of an exogenous
RNA, etc. The exogenous RNA seginent can be located in a region of the viral
RNA molecule
sucli that it does not disrupt the RNA replicatioii. Techniques for such
manipulations have been
well known to those of ordinary skill in the art for many years. Preferably,
the modified viral
RNA~molecule further comprises a ribozyme wliicli is located in the proximity
of the 3' end of
the modified viral RNA molecule. T'he viral segment may have the ability to be
replicated with
or, alternatively, without the presence of trans-acting viral replicating
elements.
Another aspect of the subject invention pertains to a method of genotypically
or
phenotypically rnodifying a host cell, comprising introducing a DNA-launching
platform which
encodes a viral RNA molecule and an exogenous RNA segnient in a location
wliich does not
disrupt the replication of said viral RNA segment or said exogenous RNA
segment, whereby the
exogenous RNA segrnent confers a detectable trait in the liost cell. The
subject'inveiition applies
to a wide array of plant cells.
Still a further aspect of the subject invention pertains to cells in which the
DNA-
launching platform of ttie subject invention has been introduced.
Yet another aspect of the subject invention pertains to a plant comprising
cells
transfected with ttie DNA-launcliing platform.
The nove) metliods and materials of the subject invention provide a greater
inoculation
efficiency of RNA viruses because use of DNA-launching platforms of the
subject invention are
niore resistant to degradation than RNA inocula, and because eacli DNA
platform produces
multiple RNA transcripts over an extended period of time. As the DNA-launching
platform
provides a genetically stable in planta archive copy of a desired vector
construct, the continuing
transcription of said DNA platfonn will repeatedly reinoculate the host cell
with the desired
construct. This serves to counteract genetic instability probleins that liave
inhibited the
expression of some genes froni vectors based on plant and animal RNA viruses.
Further, the
CA 02329509 2000-11-21
WO 99/61597 I'CT/US99/11250
3
inoculation methods of the subject invention provide a nitich simpler i,neans
of producing inocula
in bulk for large scale use, which is cheaper and more efficietit than
inoculating with in vitro
RNA transcripts.
Brief Description of the Drawing,-q
Figure 1 represetits the scheinatic for producing the I a and 2a proteins in
the host cell.
Figure 2 illustrates an exaniple of an Agrobacteritint transfonnation vector
containing
an expression cassette capable of expressing la and/or 2a BMV proteins.
Figure 3 illustrates several Agrobacterium vectors that were produced to
transfonn host
plant cells (black rectangles indicate T-DNA borders).
Figure 4 represents the general ineclianism of BMV RNA3 launching, and
replication.
Figure 5 depicts DNA-launching platforms whicii can be used in accord with the
teachings contained herein. The BMV and CCMV designations denote cis-acting
elements.
Figure 6 depicts DNA-launching platfornis which can be used in accord with the
teachings contained herein.
Figure 7 depicts DNA-launching platforms which can be used in accord with the
teachings contained herein.
Figure 8 depicts DNA-launching platforms which can be used in accord with the
teachings contained herein.
Figure 9 depicts Agrobacteriunr vector for delivery of DNA-launciting
platforms to
plant cells (open triangles represent T-DNA borders).
Figure 10 depicts DNA-launching platforins which can be used in accord with
the
teachings contained herein.
Legend For Figures 5-10:
35S = CaMV35S prornoter
t = tennitiation/polyA + sequences
Rz = ribozyme
NOS = NOS proinoter
OOA = origin of assembly
FG = foreign gene
Figure 11 shows that BMV replication factors support efficient RNA3
replication in
protoplasts.
CA 02329509 2000-11-21
WO 99/61597 1'CT/US99/11250
4
Figure 12 shows the efficient replication of launclied BMV RNA3 in
protoplasts.
Figure 13 shows transgenic expression of BMV la and 2a mRNAs in N. tabacum and
N. benthaniiana.
Figure 14 shows (he efficient replication of launched BMV RNA3 in (la +
2a)-transgenic plants.
Figure 15 shows the successful GUS expression from the launched BMV RNA3 in (1
a
+ 2a)- transgenic plants.
Figure 16 shows the successful GUS expression from the launched BMV RNA3 in
protoplasts.
Figure 17 shows the successfiil GFP expression froni the launched BMV RNA3 in
(la
+ 2a) - transgenic platits.
Figure 18 shows the successful GFP expression from tiie launched BMV RNA3 in
protoplasts.
Figure 19 shows the efficient replication of the launclied BMV RNA3 in (la +
2a)-
transgenic N. benthanriana using Agrobacteriunr inoculation.
Figure 20 shows the successful GUS expression from the launclied BMV RNA3
having
the SNMV coat protein in (I a + 2a)-transgenic plants.
Figure 21 sliows that launched BMV replicates, moves cell-to-cell, and spreads
long
distances in (la+2a)-transgenic plants.
Figure 22 sliows transfection of progeny from (1 a+2a)-transgenic N.
benthanriana with
BMV RNA3 DNA-launching platfotrn and localization of the launched RNA3 to the
roots.
Brief Description of the Sequences
SEQ ID NO. 1: pB I LR2 - partial riucleotide sequence includes BMV I a
expression
cassette.
SEQ 11) NO. 2: pB 1 LR3 - partial nucleotide sequence includes BMV 1 a
expression
cassette.
SEQ II) NO. 3: pB2LR4 - partial nucleotide sequence includes BMV 2a expressio
cassette.
SEQ ID NO. 4: pB2LR5 - partial nucleotide sequence includes BMV 2a expression
cassette.
SEQ ID NO. 5: pB12L,R6 - partial nucleotide sequence includes BMV la and 2a
expression cassettes.
CA 02329509 2000-11-21
WO 99/61597 PCT/US99/11250
SEQ ID NO. 6: pf312LR7 - partial nucleotide seqttence includes BMV la and 2a
expression cassettes.
SEQ ID NO. 7: pQ 12LR8 - partial nucleotide sequence includes E3MV 1 a and 2a
expression cassettes.
5 SEQ ID NO. 8: p13I 2LR9 - partial nucleotide sequence ittcludes BMV 1 a and
2a
expression cassettes.
Detailed Disclosure of the Itivetition
To facilitate understanding of the invention, certain terms used throughottt
are herein
defined. The tenn "RNA virus" as used herein means a virtts whose genotne is
RNA in a
double-stranded or single-stratided fonn, the single strand being a (+) strand
or (-) strand.
The terms "tratisfection" or "transfected" as used herein nieans an
introduction of a
foreign DNA or RNA into a cell by mechanical inoculation, electroporation,
agroinfection,
particle bonibardtnent, microinjection, or by other known methods.
The terms "transfonnation" or "transformed" as ttsed herein means a stable
incorporation of a foreign DNA or RNA into the cell which results in a
permanent, lteritable
alteratioti in tiie cell. Accordingly, the skilled artisan would understand
that tratisfection of a cell
may result in the transformation of that cell.
The term "launched" as used herein refers to a polynucleotide that has been
tratiscribed
from a DNA-launching platform, as described lierein and, preferably,
replicated.
The term "cis-acting element" as used herein denotes that portion of the RNA
genonie
of an RNA virus which must be present in cis, tltat is, present as a part of
each viral strand as a
necessary condition for replication of that strand. Virus replication may
depend upon the
existence of one or more trans (diffusible) elements which interact with the
cis-acting element
to carry out RNA replication. If trans-acting elements are necessary for
replication, they need
not be present or coded for on the tnodified viral RNA provided, but rnay be
made available
within the infected cell by sotne other means. For exaniple, tiie trans-acting
replication functions
may be provided by other, unniodifted or tnodified, componetits of the viral
genonie transfected
into the cells simultaneously witlt the tnodified RNA. The same approach can
be used for other
trans-acting functions includitig tnovement proteiti, coat protein, and other
functiotis. The target
cell may also be premodified, for example, cells may have been previously
transformed to
provide constitutive expression of the trans-acting functions froni a
chromosome. The cis-acting
element is composed of one or more segments of viral RNA which must be present
on any RNA
molecule that is to be replicated within a host cell by RNA replication. The
segnient will most
CA 02329509 2000-11-21
WO 99/61597 PCT/US99/11250
6
likely be the 5' and 3' terniinal portions of the viral RNA niolecule, and may
include other
portions atid/or virus open reading frames as well. The cis-actitig elenient
is accordingly defined
in functional terms: any modification which destroys the ability of tlie RNA
to replicate in a cell
known to contain the requisite trans-acting elements, is deenied to be a
tnodification in the cis-
acting element. Conversely, any niodification, sucli as deletion or insertion
in a sequence region
which is able to tolerate such deletion or insertion without disrupting
replication, is a
niodification outside the cis-acting element. As is demonstrated lierein,
using the example of
BMV which is known and accepted by those skilled in the art to be a functional
example from
which substantial portions of an RNA virus niolecule may be modified, by
deletion, itisertion,
or by a combination of deletion and insertion, witliout disrupting
replication.
"Exogenous RNA" is a term used to describe a segnient or coniponent of RNA to
be
inserted into the virus RNA to be modified, the source of the exogenous RNA
segment being
different from the RNA virus itself. The source may be another virus, an
organism such as a
plani, aninial, bacteria, virus, or fungus. The exogenous RNA niay be a
chetnically synthesized
RNA, derived from a native RNA, or it may be a combination of the foregoing.
The exogenous
RNA may provide any function which is appropriate and known to be provided by
an RNA
segment. Sucli functions include, but are not limited to, a coding function in
which the RNA
acts as a niessenger RNA encoditig a sequence wliich, wlien translated by the
host cell, results
in synthesis of a peptide or protein having useful or desired properties; the
RNA segment may
also be structural, as for example in ribosotnal RNA; it may be regulatory, as
for example with
small nuclear RNAs or anti-sense RNA; or it may be catalytic. One skilled in
the art will
understand that the exogenous RNA may encode, for example, a protein which is
a key enzytiie
in a bioclternical pathway, which upon expression effects a desirable
plienotypic characteristic,
such as altering cell nietabolisni. Further, the exogenous RNA may encode a
protein involved
in transcriptiotial regulation, such as zi c finger, winged-helix, and leucine-
zipper proteins. A
particularly interesting fitnction is provided by anti-sense RNA, sonietimes
termed (-) strand
RNA, which is in fact a sequence complementary to another RNA sequence present
in the target
cell which can, through complementary base pairing, bind to and inhibit the
function of the RNA
in the target cell.
The terni "non-viral" is used herein in a special sense to include any RNA
segment
which is not nonnally contained within the virus wliose niodification is
exploited for replication
and expression, and is tlierefore used synonymously witli "exogenous".
Accordingly, a gene
derived from a different virus species than that which is niodified is
included within the meaning
of the terms "non-viral" and "exogenous" for the purposes of describing the
invention. For
CA 02329509 2000-11-21
WO 99/61597 PCT/US99/11250
7
example, a non-viral gene as the term is used herein could include a gene
derived from a
bacterial virus, an aninial virus, or a plant virus of a type distinguishable
from the virus modified
to effect transfonnatioti. In addition, a non-viral gene may be a structural
gene derived from any
prokaryotic or eukaryotic organisin.
In one ernbodiment, the subject invention coticerns a novel method of
transfecting a host
cell which uses a DNA-launching platfonn to introduce viral RNA into the cell.
The subject
invention is directed towards a method of transfection ernploying a DNA-
launching platform
which encodes a modified viral RNA molecule coinprising an RNA viral
coinponent attached
to an exogenous RNA component and a DNA-dependent RNA pol promoter. The DNA-
dependent RNA pol promoter is preferably but not necessarily fiised within up
to 10 nucleotides
of the 5' transcriptional start site of the modified viral RNA molectile, and
more preferably
within up to 5 nucleotides of the 5' tratiscriptional start site. Expression
of the DNA-launching
platfonn produces transcripts of the niodified viral RNA niolecule that are
theti capable of RNA
replication in the presence of replication factors, wliich can be present in
the niodified viral RNA
and/or may be supplied in trans by other means including expression from
cliromosome or
supplied on different launching plasmids. When the niodified viral RNA is
replicated, the
exogenous RNA can be replicated as well. Further, the exogenous RNA can be
expressed in the
cell, thereby providing a predetennined plienotypic characteristic. In a
preferred emboditnent,
the DNA launching platfonn furtlier comprises a nucleotide seqtience encoding
a self-cleavable
ribozyme situated proximate to the 3' end of said RNA niolecule. As would be
readily apparent
to those skilled in the art, known ribozymes may be used in accordance with
the subject
invention. In a preferred embodiment, the ribozyme cleaves the modified RNA
viral molecule
at the 3' region. The 3' region can cotisist of up to 30 nucleotides upstreatn
or downstream of
the 3' end; and preferably consists of up to 10 nucleotides upstreani or
downstream of the 3' end.
In a more preferred embodiinent, the ribozyme cleaves the modified RNA viral
molecule
precisely at the 3' end. Other ktiown regulatory sequences, e.g., proinoters
and/or termination
sequences, may also be substituted for and/or included on tlte DNA-launching
platform. A
suitable restriction site can be introduced proximate to the 3' end of the
modified viral RNA
molecule sequence and the DNA molecule can be cleaved by an appropriate
restriction enzyme
prior to transfection. The term "DNA-launching platfonn" as used herein is
intended to niean
a DNA molecule, circular or litiear, which has a coding region coniprising a
segnient encoding
a modified viral RNA segrnent, and furtlier, which is capable of being
delivered into a cell and
subsequently transcribed.
CA 02329509 2000-11-21
WO 99/61597 I'C'17US99/11250
8
Possible regulatory sequences can include, but are not limited to, any
promoter already
shown to be constitutive for expression, such as those of viral origin (CaMV
19S and 35S) or
so-called "housekeeping" genes (ubiqttitin, actin, tttbulin) with their
corresponding
termination/polyA + sequences. Also, seed-and/or developnientally-specific
pronioters, such
as tltose froni plant fatty acid/lipid biosynthesis genes (ACPs,
acyltratisferases, desaturases, lipid
transfer protein genes) or froni storage protein genes (zein, napin,
cruciferin, conglycinin,
phaseolin, or lectin genes, for exainple), with their corresponding
termination/polyA + sequences
can be used for targeted expression. In addition, the gene can be placed under
the regulation of
inducible promoters and their termination sequences so that gene expression is
induced by light
(rbcS-3A. cab- I), heat (hsp gene promoters) or wounding (mannopine, I-iGPGs).
It is clear to
one skilled in the art that a protnoter may be used either in native or
truncated forin, and niay be
paired with its own or a heterologotis termination/polyA + sequence.
In a particularly preferre(i embodirnent, the stibject invention is directed
toward a
methbd of genotypically or phenotypically rnodifying a cell coniprising the
following steps: a)
forming a cDNA molectile of a virus RNA, or of at least one RNA cornponent if
the RNA virus
is multipartite, the viral RNA having been modified to contain a DNA segment
encoding a non-
viral RNA component sittiated in a region able to tolerate sucli insertioti
without disrupting
replication of the RNA product encoded thereby; b) cloning tnodified cDNA into
a DNA-
launching platfonii; and c) transfecting a suitable ltost cell witli said DNA-
launching platform.
In a most preferred embodiment, the method further comprises pretransforniing
a plant with
tratis-acting viral replication factors and/or other trans-acting factors.
Such tr5ns-acting factors
may include viral movement proteins(s), coat protein(s), viral protease(s),
and other structural
and nonstructural genes. In addition to stable expression of trans-acting
factors, trans-acting
factors may be introduced on separate expression plasmids or may be expressed
from RNA
transcripts: In a prefetred enibodiment such trans-acting factors do not
replicate. Suitable host
cells may include protoplasts, cells in suspension, or cells in tissues or
whole organisms.
In a specific einbodiniettt intended as an exaniple of the broader teachings
herein, the
RNA viral segment can be derived frorn brome tnosaic virtts (BMV), whereby the
DNA-
lautiching platform comprises DNA encoding the RNA3 segment of the virus.
Brome mosaic
virus (BMV) is a member of the a virtts-like super family of positive-strand
RNA viruses of
aninials and plants, and has a genome divided among tliree RNAs. RNA I and
RNA2 encode the
la and 2a proteins, respectively, wliich are necessary for a genomic RNA
replication and
subgenomic niRNA syritliesis (see, e.g., U.S. Patent No. 5,500,360, wliich to
the extent not
inconsistent herewith, is incorporated herein by reference). These proteins
contain three
CA 02329509 2000-11-21
WO 99/61597 PCT/US99/11250
9
dotnains cotiserved in all other menibers of the a vii-us-like super family. I
a(109kDa) contains
a c-proximal helicase-like domain and an n-proximal clomain implicated in ItNA
capping, and
2a (94kDa) contains a central polynierase-like domain. See, e.g., French and
Ahlquist, (1988).
la and 2a interact with each other and witli cell factors to fonn a membrane
bound viral RNA
replication coinplex associated with the endoplasinic reticulums of infected
cells. BMV RNA3,
a 2.1-kb RNA, encodes the 3a proteiti (32kDa) and coat protein (20kDa), whicti
are involved in
the spread of BMV itifectioti in its tiatural plant hosts but are dispensable
for RNA replication.
See U.S. Patent No. 5,500,360. 'The 3a or coat protein gene of the RNA3 viral
segment can be
replaced with exogenous RNA, whereby it does not interfere with the
replication element.
Further, the exogenous RNA segment can be inserted downstream of an additional
subgenomic
pronioter. Still further, cells or tissues can be pretransformed to express
la, 2a, 3a, and coat
protein, or any combination thereof, wherein DNA-launching platforms
containing a foreign
gene(s) with the necessary cis-acting components is transfected, such that the
foreign gene is
replicated and/or expressed.
In one embodirnent, the liost cell is pretransfornied with BMV 1 or BMV2 such
that it
is transgenically engineered to express I a and 2a proteins. Preferably, the
5' and 3' ends of
BMV 1 and BMV2 are removed such that they are incapable of replication, but
can express I a
and 2a to form a viral RNA replication cornplex associated with the
endoplasmic reticulum of
the host cell. Subsequent transfection of a DNA-launching platform comprising
the RNA3 viral
replication segment, as well as the exogenous RNA of interest, can produce the
ex,pression of
said exogenous RNA while also preventing the undesired and dangerous spread of
viral RNA
spillage into the environment. That is, because a plant rnust have all 3
segments to forni
infectious BMV particle(s), problerns associated witli the environmentally
hazardous escape of
foreign genes through mechanical or insect dispersal of RNA virus vectors are
avoided. One
skilled in the art will readily appreciate that in the example of BMV that DNA-
launching
platforms could be also derived from either RNA1 or RNA2. For example, the
sequence
encoding the la protein could be replaced with ati exogenous RNA; replication
would require
the expression of la (e.g., separate expression plasmid). In a preferred
einbodinient, the DNA-
launching platfonn also comprises a ribozytne situated proximate to the 3' end
of the niodified
RNA3, wherein said ribozynie cleaves ttie RNA3 at the 3' end. As would be
readily apparent
to the skilled artisan with the teachings contained herein, viral segments
from other known
viruses, and/or subviral agents, can be used to formulate DNA-launching
platforms of the subject
invention. One skilled in the art will appreciate that BMV is merely one
representative example
of the many viruses suitable for practicing the subject invention. It is
widely accepted that
Ch 02329509 2000-11-21
WO 99/61597 PCIYUS99/11250
principles on which tlie subject invention is based are broadly applicable to
a myriad of viruses.
Examples of other such viruses include, but are not liinited to, alfalfa
mosaic virus (AMV),
barley stripe mosaic virus, cowpea mosaic virus, cucutnber mosaic virus,
reoviruses, polio virus,
sindbis virus, vesicular stomatitis virtis, influetiza virtts, retroviruses,
and cowpea chiorotic
5 tnottle virus (CCMV) and atiy other viruses that replicate tlirough RNA
intermediates and from
which a cDNA copy can be obtained. Specificalty, as the other viruses are
furtlier characterized,
those of skill in the art will readify appreciate the applicability of the
teachings herein to other
suitable viruses as well.
The skilled artisan would easily appreciate that known methods of introducing
foreign
10 DNA into cells can be used in accordance with the teachings of the subject
disclosure. Such
metltods include, but are not limited to, niechanieal inoculation, particle
bombardment,
agroinfection, electroporation, and microinjection, as well as other known
niethods.
Various aspects of the invention can be modified as needed, depending upon
specific
characteristics of the virus selected as the transforming and transfecting
agent and of tlte RNA
segment to be itisened. For exatnple, the inserted gene need not be a
naturally occurring gene,
but may be modified, a composite of more than one codiug segment, or it may
encode more than
one protein. The RNA rnay also be inodified by combitiing insertions and
deletions in order to
control the total lengtii or other properties of the tnodified RNA tnolecule.
The inserted non-
viral gene may be either prokaryotic or eukaryotic in origin. The inserted
gene may contain its
own translation start signals, for exaniple, a ribosomal binding site and
start (AUG) codon, or
it may be inserted in a nianner whicit takes advantage of one or more of these
components
preexisting itt the viral RNA to be modified. Certain structural constraints
niust be observed to
preserve correct translation of the inserted sequence, according to principles
well undetstood in
the art. For example, if it is intended that tlte exogenous coding segtnent is
to be combined with
an endogenous coding segment, the coding sequence to be inserted niust be
inserted in reading
frame phase therewith and in the same translational direction.
It will be understood by those ordinarily, skilled in the art that there tnay
exist certain
genes whose transfer does not result in obvious phenotypic modification of the
recipient cell.
Such may occur, for example, if the translation product of the non-viral gene
is toxic to the host
cell, is degraded or processed in a manner which renders it non-functional or
possesses structural
features wltich render it impossible for the host cell to translate in
sufficient quantities to confer
a detectable plienotype on the transformed cells. However, the invention does
not depend upon
any specific property of att RNA segment or gene being transferred. Therefore,
the possible
existence of RNA segments or genes which fail to confer a readily observable
phenotypic trait
CA 02329509 2000-11-21
WO 99/61597 PCT/US99/11250
II
on recipient cells or plants is irrelevant to the invention, and in any case
will be readily
recognizable by those of ordinary skill in the art without undue
experimentation.
An exogenotis RNA segnient tnay be inserted at any convenient insertioti site
in any of
the cDNA seqtiences corresponding to a viral RNA, or componetit ItNA of a
multipartite RNA
virus, provided the insertion cloes not disrupt a sequence essential for
replication of the RNA
witliin the host cell. For example, for a virtis whose coat protein is not
essential for replication,
an exogenous RNA segment niay be inserted within or stibstituted for the
region which normally
codes for coat protein. As desired, regions which contribute to undesirable
host cell responses
may be deleted or inactivated, provided such changes do not adversely affect
the ability of the
RNA to be replicated in the host cell. For many single component and
inultipartite RNA viruses,
a reduction in the rate of normal RNA replication is tolerable and will in
some instances be
preferred, since the amount of RNA produced in a normal infection is more than
enougli to
sattirate the ribosonies of the transformed cell.
Plant cells which are inoculated in culture will norinally retnain transfected
as the cells
grow and divide since the RNA components expressed from the DNA-launchitig
platform are
able to replicate and thus becotne distributed to descendatit cells upon cell
division. Plants
regenerated froni plienotypically modified cells, tissues, or protoplasts
remain phenotypically
modified. Similarly, plants transfected as seedlings remain tratisfected
during growtli. Optinial
timing of application of the transfecting components will be governed by the
result which is
intetided and by variatiotis in susceptibility to the tratisfecting
cotnpotietits during variotis stages
of plant growth.
Many plant RNA viruses are seed transmitted from one generation to the next.
This
property can be exploited to effect genotypic transfortnation of a plant. That
is to say, the
modified RNA remains transmissible from one generation to the next, just as
seed-borne virus
infections are transmitted from one generation to the next.
Following are examples which illustrate procedures for practicing the
invention. These
examples sliould not be construed as liniiting. All percentages are by weight
atid all solvent
mixture proportions are by volume unless otherwise noted.
Example 1- Construction of Agz=obacleriunt Vectors
Binary vectors for expressing the BMV 1 a and 2a proteins in plants were
constructed.
Starting with the pBI 101.2 construct (Clontech, Palo Alto, CA), the GUS gene
was removed by
first cutting the construct with EcoRl and SnaBI. The overhangitig restriction
fragment ends
CA 02329509 2000-11-21
WO 99/61597 1'C7'/U599/1115u
12
were ftlled in by treatment with Kienow fragments and dNTI's. 7'he restriction
fragment ends
were religated fonning the pB101.2LR1.
The 2a expressioti cassette was inserted into pBI 101.2 LRI. First the pBI
101.2LR1 was
cut with Hind III and dephosphorylated. Next, pB2PA 17 (Dinant et al., 1993)
was cut with Hind
111 and the 2a insert was purified using a low tnelting agarose gel. The
restriction fragment ends
were ligated forming the pB2LR4 and pB2LR5 (Figures 3c and 3d).
The I a expression cassette was inserted into pBI 101.2LR I by first cutting
pBI 101.21,111
with SnaB1 and depliosphorylated. pB 1 PA 17 (Ditiant et al., 1993) was cut
with Pstl and the
extra nucleotides were removed with T4 DNA polynierase. The 1a insert was
purified using a
low nielting agarose gel. The restriction fragtnent ends were ligated fonning
the pB1LR2 and
pB I LR.3 vectors (Figures 3a and 3b).
The I a expression cassette was inserted into pB2LR4 and pB2LR5 by cutting
pB2LR4
or pB2LR5 with SnaBI and dephosphorylated. PB I PA 17 (Dinant et al., 1993)
was cut with Pstl,
and'the extra nucleotides were removed witli T4 DNA polymerase. The la insert
was purified
using low melting agarose gel and ligated with the cut pB2LR4 or pB2LR5
vectors to form
pB12LR6, pB12LR7, pB12LR8, and pBI2LR9 vectors (Figures 3e-3h).
Example 2 - Construction of DNA-launching Platfortn for wtRNA3 of BMV and for
RNA
Derivatives Containing Foreign Sequences
Vector pRT101 (Topfer et al., 1987) was cut with PpuMl and the restriction
fragment
ends were filled in with Kienow fragment and dNTPs, and cut with BamH1 and
dephosphorylated. Vector pB3RQ39 (Ishikawa et al., 1997) was cut with SnaBi
and BamHI;
the B3 fragment was isolated from a low melting agarose gel. This fragtnent
was ligated to the
cut pRT10l thereby forming pB3LR10 (Figure 4). The pB3LR 15 (Figure 4) that is
a pB3LR10
derivative has the CIaI-Kpn1 fragment replaced with the corresponding fragment
from pB3TP8
(Janda et aL, 1987).
PCR was performed on pRTl01 to amplify, an EcoRV and EcoRl fragment. To create
a Stul site instead of a PpuMI site, a one nucleotide deletion was perfonned
during the PCR
process. The resulting PCR product was cut with EcoRV and EcoR1 and inserted
into
depliosphorylated pRT101 cut with EcoRV and EcoRl to fonn pRT101LR11. The
pRT101LR11
was cut with Stul and Batnl-II and dephosphorylated. PB3RQ39 was cut with
SnaBl and BamHl
and a B3 fragment was isolated using a low melting agarose gel. The fragment
was then ligated
to pRTI01LR11 to forni pB3LRI2 (Figure 4).
CA 02329509 2000-11-21
WO 99/61597 PCT/US99/11250
13
Another DNA-launching platform was constructed with wtRNA3 of BMV having a
partially doubled CaMV35S promoter; thereby forming pB3LR14 and pB3LR16
(Figure 4).
A DNA-launching platform wlierein the BMV RNA3 coat protein was replaced with
GUS was also constructed. The pB3M122 (lshikawa el al., 1997) was cut with
Clal atid Stul and
a B3GUS insert was isolated. The pB3LRIO or pB3LR I4 DNA-launching constructs
were cut
with CIaI and Stul and dephosphorylated. The B3GUS fragment was then ligated
to the cut
pB3LR10 or pB3LRl4 thereby forining the pB3GUSLRI7 and pB3GUSLRl8 DNA-
launching
constructs (Figure 5).
A DNA-launching platform having a BMV RNA3 with a GUS gene insertion wherein
the GUS is downstream of an additional BMV subgetiomic promoter was
constructed. The
pB3LR15 construct was cut with Aval atid the restriction fragment ends were
filled in with
Klenow fragment and dNTPs. Construct was then cut witli Clal and
deptiosphorylated. The
pB3M122 was cut with Clal and Stul and a B3GUS fragnient was isolated. The
isolated B3GUS
fragment was then ligated to the cut pB3LR15 colistruct to form a new
construct of
pB3GUSCPLRl9 (Figure 5).
A BMV RNA3 based DNA-launching plati'orm with a CP gene inserted downstream of
an additional cowpea chlorotic tnottle virus (CCMV) subgenoniic proinoter was
constructed.
The pB3GUSLRI 7 construct was cut with Stul and Kpnl atid depliosphorylated.
The pBC3AJ 14
(Paclia and Ahlquist, 1991) was cut with Ndel, the ends were blunted by known
methods in the
art, and then cut witli Kpnl. A coat protein fragrnent was then isolated. The
coat protein
fragment was then ligated to the cut pB3GUSLRI 7 to form a new construct of
pB3GUSCPLR22
(Figure 5).
A DNA-launching platform was constructed having a subgenoniic RNA4. The pB4MK2
(M. Kroll, personal communications) was cut witli SnaBl and BamH1 and a RNA4
fragment was
then isolated. The pRT101LR11 construct was cut with Stul and BamHI and
dephospliorylated.
The fragment and the cut pRTIOILRI I construct were then ligated forming
pB4LR20 (Figure
5a).
A DNA-launching platform wherein the BMV coat protein was replaced with GFP
was
constructed. pEGFP (Clontech, CA) was cut with Notl, filled in with Kienow
fraginent and
dNTPs. cut with SaII, and GFP insert was isolated using low-inelting agarose
gel. The
pB3LRl5 was cut with Sall and Stul and dephospliorylated. The GFP fragment was
then ligated
to the cut pB3LRI5 thereby formitig the pB3GFPLR48 (Figure 6e).
A DNA-launching platform liaving a BMV RNA3 with a GFP gene insertion wherein
the CP is downstream of an additiotial CCMV subgenornic promoter was
constructed. The
CA 02329509 2000-11-21
WO 99/61597 PCT/US99/11250
14
pBC3AJI4 (Paclia and Ahlquist, 1991) was cut with Nde1 and EcoRl and the ends
were blunted
by known inethods in the art. The coat protein fraginent was then isolated and
ligated into
dephosphorylated and blunted pEGFP cut with Notl and Stul forming pEGFPCPLR49.
pEGFPCPLR49 was ctit with Kpnl and the EGFPCP fragment was isolated using low-
melting
agarose gel. PB3GFPLR48 was cut with Kpnl and dephospliorylated. The EGFPCP
fragrnent
was then ligated to the cut pB3GFPLR48 thereby forining the pB3GFPCPLR50
(Figure 6a).
An RNA transcription vector wherein the GFP gene is expressed as a
translational fusion
witli BMV 3a was constructed. The pB3TP 10 (Pacha and Ahlquist, 1991) was cut
with BamHl
and dephosphorylated. The GFP fragment was amplified frotn pEGFP (Clontech,
CA) using
PCR and the following primers:
5'GCAGTCGACGGTACCGCGGGCC3'
and
5'CGCGGCCGCGGATCCTGTACAGCTCG3'.
The aniplified product was cut with BamHl and purified using low-melting
agarose gel. The
GFP frag-nent was ligated to the cut pB3TP10 fonning pB3GFPLR47 (Figure 6d).
The
pB3GFPLR47 was cut witli EcoRl and transcribed using T7 RNA polymerase.
An Agrobacteriuni vector containing BMV RNA3 DNA-launching platform was
constnicted. The pBi 101.2LR 1 was cut witli Snial and dephosphorylated. The
pB3LR15 was
cut with PvuII and the B3 fragment was purified using a low-inelting agarose
gel. The B3
fragment was tlien ligated to the cut pB1101.2LR1 thereby fonning pB3LR42
(Figure 9).
A DNA-launching platform wlierein the BMV RNA3 coat protein was Teplaced with
the
SHMV (Sutui heinp mosaic virus) coat protein and the GUS gene was inserted
downstreani of
an additional BMV subgenomic promoter was constructed. The pB3RS4 (Sacher el
al., 1988)
was cut with Aval, blunted with Klenow fragment and dNTPs, and cut with Kpnl.
The SHMV
coat protein fragment was isolated using a low-melting agarose gel. The
pB3GUSLRI7 was cut
witti Stul and Kpnl and depliosphorylated. The SHMV coat protein fragnient was
ligated to the
cut pB3GUSLRI7 thereby forming pB3GUSCPLR24 (Figure 7).
Other pennutatioiis of DNA-launching platfo-ms containing one or more foreign
genes
and the necessary cis-acting replication signals will be readily appreciated
in view of the
teachings herein. For examples, see Figures 5-10.
CA 02329509 2000-11-21
WO 99/61597 PCT/US99/11250
Exaniple c-Transfection of N. tahacum Protoplasts with DNA-launchinl, Platfonn
Media:
NTI Medium ( 1 liter) was niade with Gibco-BRL (MS salt, catalog #1 1 1 1 8-03
1), 31111
of 6% KH2P04, and 0.2 E.eg/tnl 2,4D (fittal concentration). The pH was
adjusteci to 5.5-5.7 using
5 KOH, and the resulting mixture was autoclaved.
NTI Plating Medium (1 liter) was made with NTI medium and 72.86 g tnannitol,
the
pH was adjusted to 5.5-5.7, and the resulting mixture was autoclaved.
Wash Solution (I liter) was niade with 72.86 g mannitol, the p11 was adjusted
to 5.5, and
the resulting mixture was autoclaved.
10 Electroporation Buffer was niade with 0.8% NaCI, 0.02% KCI, 0.02% KI-12P04,
0.11%
Na2HPO4, and 0.4M niannitol. The pH was adjusted to 6.5, and the resulting
mixture was
autoclaved.
Enzytne Solution was inade with 0.4M mannitol, and 20mM MES. The pl 1 was
adjusted
to 5.5, and tiie resulting tnixture was autoclaved.
15 Growth conditioyrs: Cells (Nicotiana tabacunt) were grown at room
temperature in NT1
media with constant shaking (about 200 rpm).
Preparation ofcultures for digestiott: About 2-3 nil of one-week old
suspension culture
was subcultured into 50 ml of fresli N7'l media 3 days before the enzytne
digestioii. The culture
was maintained at 28 C under constant shaking.
Enzyme digestiotr: The enzytne digestion solution was prepared containing the
following: 1% cellulysin (Calbiocliem) and 0.3% tnacerase (Calbiochem) in the
enzytne
solution. The pH was adjusted to 5.5 and filter sterilized.
The cells were centrifuged at 800 rpm for 5 min. The stipeniatatit was
discarded. About
40 m1 of wash solution was added, cells were resuspended and were centrifuged
at 800 rpni for
5 min. The supernatant was discarded. The cells were then resuspended in three
volumes of
enzyme digestion solution, and incubated for 60 min. at rootn teniperature.
1'f'ashirrg: The cells were transferred into 50 ntl plastic tube and
centrifuged at 800 rptn
for 5 min. T'he supernatant was discarded. The cells were resuspended in 40 ml
of wash
solution and cetitrifuged at 800 rpm for 5 min. The supernatant was discarded.
The cells were
resuspended in 40m1 of electroporatioti buffer and centrifuged at 800 rpni for
5 min. The
supernatant was discarded. The cells were resuspended in four volumes of
electroporation
buffer.
Electroporation: One ml of cells containing the RNA or DNA inocula was
transferred
into electroporation cuvettes and placed on ice for 10 tniti. The cells were
then mixed and
CA 02329509 2000-11-21
WO 99/61597 PCT/US99/11250
16
electroporated at 500 microF, 250V. The cuvettes were placed on ice for 10
min. 7'he cells were
transferred into 10 ml ofNTl plating inedia.
Incubatial and collection ofsamples: The cells were incubated at room
teniperature in
dark. Samples were collected 24-48 hrs post inoculation.
RNA Analysis: RNA extractiwi, denaturing 1% agarose gel electrophoresis and
Northern
blot hybridization were perfomied by known methods, such as that perfonned in
Rasochova and
Miller (1996). Each lane was loaded with equal amounts (approx. 5ug) of total
RNA as
determined by spectrophotometry and cotifinned by ethidium bromide staining of
ribosomal
RNA before Northern blot hybridization. I X 106 cpin/ml of radioactive probe
in hybridization
btiffer was used per hybridization experiment. Replication of RNA3 was
confinned by detection
of sgRNA4, ttius showing that BMV RNA replication factors la and 2a expressed
from
expression plasmid(s) support efficient replication of RNA3 supplied as in
vitro transcript
(Figure 11) as well as launched froni DNA-launching platform (Figure 12).
Example 4- Production of Transgenic N tabacwn Plants
Once a desired tnolecule was constructed in E. coli, the molecule was
transferred into
Agrobacierium t:unefaciens by the freeze-thaw inethod. Vectors pB I LR2,
pB2LR4, pB 12LR6,
and p1312LR7 were all individually used. An Agrobacterium strain LBA 4404
containing an
appropriate helper Ti plasmid was grown in 5 mi of YEP medium overnight at 28
C. Two ml
of the overnight culture were added to 50 ml YEP medium in a 250-m1 flask and
shaken
vigorously (250 rpm) at 28 C until the culture grew to an ODS00 of 0.5 to 1Ø
The culture was
chilled on ice. The cell suspension was centrifuged at 3000 g for 5 niin. at 4
C. The supernatant
solution was discarded. The cells were resuspended in I ml of ice-cold 20 mM
CaCl2 solution.
0.1-m1 aliquots were dispensed into prechilled eppendorf tubes. About 1/.eg of
plasmid DNA
was added to the cells. The cells were frozen in liquid nitrogen. The cells
were thawed by
incubating the test tube in a 37 C water bath for 5 min. I ml of YEP mediutn
was added to the
tube and incubated at 28 C for 2-4 h with gentle shaking to allow the bacteria
to express the
antibiotic resistance genes. The tubes were centrifuged for 30 s and the
supernatant solution was
discarded. The cells were resuspended in 0.1 ml YEP niediurn, plated on a YEP
agar plate
containing selection antibiotic(s), and incubated at 28 C. Transfonned
colonies appeared in 2-3
days.
In vitro clonal copies of approximately three week old Nicotina tabaciim,
Wisconsin No.
38, were used as the source of explants. Leaf explants were prepared from the
second and third
ftilly expanded leaves of in vitro cultures. The leaf pieces were cut into I
cin x 1 cm squares and
CA 02329509 2000-11-21
WU 99/61597 PCT/US99/11250
17
placed upon TB1 (plus 2.0 mg/I 6-benzyl-aniinopurine, and 0.1 tng/1 -
naphthalene acetic acid)
media for 24 hours at 25 C with a 16 hour photo period.
Agrobacteriurn tunrefaciens strain LBA 4404 containing the preselected binary
vector
was used for plant transfonnation. Explants were placed in -10 nil of
overnight grown
Agrobacterium culture for 30 tnin. Leaf explants were then blotted on filter
paper and placed
on TB2 (plus 1.0 tng/I 6-benzyl-aminopurine and 0.1 rng/) -naphthalene acetic
acid) niedia for
4 days, abaxial side down. Explants are then rinsed tliree times in sterile
water, blotted on filter
paper, and placed on TB2 media for regeneration with 100 tng/1 kananiycin and
400 mg/I
carbeniciilin at 25 C, 16 hotir photo period, abaxial side down. Explants were
transferred to
fresh TB2 niedia with 100 -ng/I kanatnycin atid 400 ing/) carbeniciliin every
10 to 14 days until
plantlets developed. Plantlets typically developed at 10-14 days. Plantlets
were cut from the
callus and placed on MST media containing 100 mg/I kanamycin and 400 mg/I
carbenicillin to
induce rooting. Rooted plants were transferred to soil.
TB1 (1 liter) included 4.30 g MS salts, 100 tng niyo-inositol, 1.0 ml Nitsch
and Nitsch
vitamins, 30 g sucrose, 2 mg BAP, 0.10 mg of NAA, and 8g Noble agar. The
niedia was
adjusted to a pH 5.7 and autoclaved.
TB2 (1 liter) included 4.30 g MS salts,.100 mg niyo-inositol, 1.0 nil Nitsch
and Nitsch
vitamins. 30 g sucrose, 1.0 mg BAP, 0.10 mg NAA, and 8 g Noble agar. The
tnedia was
adjusted to pF-I 5.7 and autoclaved.
MST(l liter) included 4.30 g MS salts, 1.0 ml Nitsch and Nitsch vitamins, 30
g,sucrose,
100 mg myo-inositol, and 8.5 g Difco agar. The media was adjusted to pH 5.7
and autoclaved.
YEP (100 m1) included 1.Og Bacto-peptone, 1.0 g Bacto-yeast extract, and 0.5 g
NaCI.
The media was autoclaved.
RNA Aiialvsis: Total RNA extraction, denaturing 1% agarose gel electrophoresis
and
Northern blot hybridization was performed by known nietliods, such as that
performed in
Rasochova and Miller (1996). Each lane was loaded witli equal amounts (approx.
5 g) of total
RNA as determined by spectrophotonietry and confinned by ethidium broinide
staining of
ribosotnal RNA before Northern blot hybridization. I X 106 cpm/ml of
radioactive probe in
hybridization buffer was used per hybridization experinient. Figttre 13a
sliows the successful
expression of BMV 1 a and 2a mRNA in transgenic N. tabacuni.
Example 5- Transfection of Transgenic N. tabacum Plants witli DNA-launching
Platform
Precipitation ofDNA oyrto Microcarriers jor Particle Bombardment: (Kikkert,
1993).
CA 02329509 2000-11-21
WO 99/61597 PC'rtUa9911lLSu
18
Sterilization of Microcarriers: 80 nig of gold microcarriers were resuspended
in I inl
of 70% etlianol, soaked for 15 rnin., and centrifuged at 13,000 x g for 5 min.
The supeniatant
was carefully removed and discarded. Particles were resuspended in I ml of
sterile distilled,
deionized water and centrifuged at 13,000 x g for 5 min. Z'lie supernatant was
carefully removed
and discarded. Water wasliing of particles was repeated 2 niore times. After
final rinse,
particles were resuspended in I ml of sterile 50% glycerol.
Coating Microcarriers -vith DNA: The following was sequentially and quickly
added:
5ul DNA ( lug/pl), 50 1 of 2.5M CaCIZ, and 20 1 of 0.1 M Spennidine.
The mixture was incubated for 10 min. on a vortex shaker at room temperature.
Particles were pelleted by centrifugation at 13,000 x g for 5 sec. Supernatant
was carefully
removed and discarded. Particles were resuspended in 140 l of 70% ethanol and
centrifuged
at 13,000 x g for 5 sec. Supernatant was removed and discarded. Particles were
resuspended
in 140 pl of 100% ethanol and centrifuged at 13,000 x g for 5 sec. Supernatant
was reinoved and
discat=d. Particles were resuspended in 50 1 of 100% ethanol.
Young leaves froin tobacco plants grown in vitro on agar-solidified MS mediuni
containing 30g/liter sucrose, were bombarded with 5- l aliquots of resuspended
DNA-coated
particles using a PDS1000He biolistic gun (DuPont) and 1 100 psi rupture disks
(Bio-Rad).
RNA Analvsi.s: Total RNA extraction, denaturing 1% agarose gel electrophoresis
and
Northern blot liybridization was perfornied by known methods, sucii as that
perfonned in
Rasochova and Miller (1996). Each lane was loaded with equal aniounts (approx.
5mg) of total
RNA as determined by spectrophotometry and confirmed by ethidium bromide
staining of
ribosomal RNA before Nortliern blot hybridization. I X 106 cpm/inl of
radioactive probe in
hybridization buffer was used per liybridization experiment. Figure 14a shows
that the launched
BMV RNA3 replicates efficiently in transgenic plants expressing BMV
replication factors la
and 2a and that the launclied RNA3 is unable to replicate in the absence of
BMV 1 a and/or 2a.
Exarnple 6 - Production of Transgenic N. henthamiana Plants
Once a desired niolecule was constructed in E. coli, the molecule was
transferred into
Agrobacteriuni tunrefacieiis. Vectors pB ] LR2, pB2LR4, pB 12LR6, and pB 12LR7
were all
individually used. An Agrobacteriuni strain LBA 4404 containing an appropriate
helper Ti
plasmid was grown in 5 ml of YEP niediuin oveniight at 28 C. Two mi of the
overnight culture
were added to 50 ml YEP mediuin in a 250-mi flask and shaken vigorously (250
rpm) at 28 C
until the culture grew to an ODSõo of 0.5 to 1Ø The culture was chilled on
ice. The cell
suspension was centrifuged at 3000 g for 5 min. at 4 C. The stipernatant
solution was discarded.
CA 02329509 2005-01-06
19
The cells were resuspended in I ml of ice-cold 20 m,M CaC12 solution. 0.1-m1
aliquots were dispensed into prechilled eppendorf tubcs. About 1 g of
plasrziid
DNA was added to the cells. The cells were frozen in liquid nitrogen. The
colls
were thawed by incubating the test tube in a 370C water bath for 5 m.in. 1 rnl
of YEP medium was added to the tube and incubated at 28 C for 2-4 h with
gentle shakina to allow the bacteria to express the antibiotic resistance
genes.
The tubes were centrifuged for 30 s and the supernatant solution was
discarded.
The cells were resuspended in 0.1 ml YEP medium. The cells were plated on a
YEP agar plate containing selection antibiotic(s) and incubated at 28 C.
Transformed colonies appeared in 2-3 days.
In vitro clonal copies of approximately five-seven weeks old N.
benthumfana were used as the source of explants. Leaf explants werc prepared
from the second and third fully expanded leaves of in vitro cultures. Thc Ieaf
pieces were cut into lcan x lcro squares and placed upon MS104 media in 100
x 15 mm plates for 24 hours at 231C with a 16 hour photo period.
Agrobacterium tumefactens strain LBA 4404 containing the preselected
binary vector was used. Explants were placed 'ui --lOml of overnight grown
Agrobaterium culture for 30 min. Leaf explants were then blotted on filter
paper and placed abaxial side down on MS 104 xnedia for 4 days. Explants were
then rinsed three times in sterile water, blotted on filter paper, and placed
on
MS104 media for regeneration with 300 mg/L kanamycin and 400 rng/L
carbenicillin. Explants were transferred to fresh MS104 media with 300 mg/L
kanamycin and 400 mg/L -carbenicillin every 10-14 days until plantlets
developed. plantlcts typically developed at 31-50 days. Plantlets were cut
from the callus and placed on MST media plus 300 mg/L,' kanamycin and 400
mg/L carbenicillin to induce rooting. Rooted plants were transferred to soil.
One liter of MS104 included 4.3 g MS salt mixture, 1.0 rn1 B5 vitamin
solution, 30 g sucrose, 1.0 mg BA, 0.1 mgNAA, and 8.0 g Phytagar*. The
media was adjusted to pH 5.8 and atatoclaved.
(Trade-mark)
CA 02329509 2005-01-06
19a
100 ml) of YEP included 1.0 g Bacto-peptone. 1.0 g Bacto-yeast
extr<-ct. 0.5g NaC1. The media was autoclaved.
One liter of MST included 4.3 g MS salt mixture, 1.0 ml Nitsch &
Nitsch vitamins, 30 g sucrose, 100 mg myo-inositol , and 8.5 g Phytagar. The
media was adjusted to pE 5.7 and autoclaved.
RNA Analysis: Total RNA extraction, denaturina 1% agarose gel
electrophoresis and Northera blot hybridization was performed by Ifluown
methods, such as that performed in Rasochova and Miller (1996). Each lane
was loaded with equal amounts (approx. 5 ug) of total RNA as determined by
spec:trophotometry and confirmed by ethidium bromide stahiing of ribosomal
RNA before Northerra blot hybridization. 1 X 105 epmhnl of radioactive probe
in
CA 02329509 2000-11-21
WO 99/61597 1'C'I'/U599/112511
hybridization buffer was used per hybridization experinient. Figure 13b shows
the successful
expression of BMV la and 2a mRNA in transgenic N. benthamiana.
Exarnple 7- Transfectioii of Transgenic N. benlhamiana Plants
5 Precipitation oJDNA onto Microcarriers jor Particle 13oinbardment: (From
Kikkert
(1993) "The biolistic PDS 1000/He device", Plant Cell Tiss. And Org. Cult.
33:221-226)
Sterilizaliotr of Microcarriers: 80 mg of gold microcarriers were resuspended
in I mI
of 70% ethanol, soaked for 15 min., and centrifuged at 13,000 x g for 5 inin.
The supernatant
was carefully removed and discarded. Particles were resuspended in I ml of
sterile distilled,
10 deionized water and centrifuged at 13,000 x g for 5 min. 7'lie supernatant
was caretiilly removed
and discarded. Water washing of particles was repeated 2 more tiines. Afler
final rinse,
particles were resuspended in I nil of sterile 50% glycerol.
Coating Microcarriers with DNA: To the 50 ul of particles the following was
sequentially and quickly added: 5 l DNA (lug/ l), 50ul of 2.5M CaC12, and 20 1
of O.IM
15 Spennidine.
The mixture was incubated for 10 min. on a vortex shaker at room temperature.
Particles were pelleted by centrifugation at 13,000 x g for 5 sec. Supernatant
was carefully
removed and discarded. Particles were resuspended in 140 pI of 70% ethanol and
centrifuged
at 13,000 x g for 5 sec. Supernatant was renioved and discarded. Particles
were resuspended
20 in 140 l of 100% ethanol and centrifuged at 13,000 x g for 5 sec.
Supernatant was removed and
discarded. Particles were resuspended in 50 1 of 100% ethanol.
Young leaves from N. bentharniana plants grown in vitro on agar-solidified MS
medium
containing 30g/liter sucrose, were bombarded with 5- l aliquots of resuspended
DNA-coated
particles using a PDS 1000He biolistic gun (DuPont) and 1 100 psi rupture
disks (Bio-Rad).
RNA Analvsis: Total RNA extraction, denaturing 1% agarose gel electrophoresis
and
Northern blot hybridization was performed by known rnethods, such as that
performed in
Rasochova and Miller (1996). Each lane was loaded,with equal amounts (approx.
5,pg) of total
RNA as determined by spectrophotometry and confirmed by ethidium bromide
staining of
ribosomal RNA before Nortlieni blot hybridization. I X 106 cpni/ml of
radioactive probe in
hybridization buffer was used per liybridization experinient. The launched BMV
and RNA 3
showed efficient replication (Figure 14b) in transgenic N. bentharniana plants
expressing BMV
replication factors I a and 2a and was unable to replicate in the absence of
BMV I a and/or 2a.
CA 02329509 2000-11-21
WO 99/61597 11C1'/US99/11250
21
Example 8-Transfection of Transgenic Plattts with GUS Containing DNA-
launchingI'latform
Transgenic N. tabacuni and N. bentha iaria plattts were produced according to
the
procedures discussed above. The plants were transfected with a DNA-launching
platform
containing a GUS gene (Figure 5a) by particle botnbardtnent as described in
Exatnples 5 and 7.
The plants were incubated for 3-5 days and then assayed for 0-glucuronidase
(GUS) activity
using I tng/mI X-Gluc (5-bromo-4-chloro-3-indolyl glucucuroni(le) as substrate
in 0.1 M
potassium phosphate buffer, pl-I 7.0, 50 uM potassium ferrocyanide, atid 2%
Triton X-100.
Following an overnight incubation at 37 C, cells replicating launched RNA3
derivatives and
expressing the GUS reporter gene frotn a subgenomic RNA4 gave rise to blue
spots (Figure 15).
The launclied RNA3 derivative did not replicate and express GUS reporter gene
in the absence
of BMV RNA replication factors la and 2a (e.g., in wt N. beitlhamiana and in
wt N. tabacum).
Examnle 9 - Transfection of Transgenic Platits Expressing BMV Ia. 2a. 3a. and
CI'
A plant is transfonned witlt BMV Ia, 2a, 3a, and CP genes wliereby those genes
are
stably expressed in said plant. 'This can be done with the procedures outlined
above. Any
modifications that would be needed would be readily apparent to those skilled
in the art in light
of the teachings contained herein. A DNA-launching platfonn encoding an RNA
replicon which
contains a foreign gene and necessary BMV or CCMV cis-acting replication
signals to replicate
said replicon is constructed (Figure lOb). Foreign genes to be included in
said replicon could
include, for example, a 13acillus thuringiensis polynucleotide that codes for
a B.I. protein. Other
sequences would include, e.g., sequetices that ettcode herbicide resistance,
or any otlter knowti
sequence that encodes peptides or proteins having desired qualities in plants.
Alternatively, plants can be transformed to express BMV Ia, 2a, 3a, and a TMV
coat
protein in place of the BMV coat protein. A DNA-launching platfomi is then
made containing
one or more foreign genes and the necessary cis-acting replication signals,
either BMV or
CCMV, and a TMV origin of assenibly (Figures 8a, 8b, and l0a). This launching
platfomi
provides a distinct advantage as TMV is a rod-shaped virus which has no strict
limit on the size
of RNA that can be encapsidated. Alternatively, TMV movement protein can be
used in place
of BMV3a (Figure 7c). Hybrids between tobamo and bromoviruses were sliown to
be viable
(Sacher et al., 1988; De Jong and Ahlquist, 1992).
Other permutations and combinations of genes pretransfonned and those included
in the
DNA-launching platform will readily be appreciated by the skilled artisan in
light of the
teachings herein. (See, e.g., Figures 8c, I Ob, and IOc).
CA 02329509 2000-11-21
WO 99/61597 I'CT/US99/11250
22
As indicated above, CCMV subgenomic promoter can be substituted for BMV
sequences in a desired DNA-launching platforni. Because the sequence of CCMV
subgenomic
promoter differs froni the sequence of BMV subgenomic proinoter, the
probability of
recombination tiiat would result in loss of a foreign getie is inuch lower in
a coiistruct having a
combination of tiiese two different promoters.
In the above exaniples, trans-acting components niay include, but are not
limited to,
replication factors, components responsible for cell to cell movement, or
coinponents suclt as
the coat protein which may be required for long distance spread, viral
proteases responsible for
post translational processing, or other known trans-acting functions.
Example 10 - Transfection of N. tahactmi Protoplasts with GUS Containing DNA-
Launching
latform
N. tabacuni protoplasts isolated using the above described inetliods were
inoculated by
electroporation with DNA-launching platforms for BMV RNA3 derivatives in the
presence or
absence of la and 2a expression plasmids. BMV RNA3 derivatives contained the
GUS gene in
place of the coat protein ORF (Figure 5a) (these were inoculated with or
without coat protein
expression plasmid, Figure 5b), or had the BMVCP gene translated froni an
additional
subgenomic RNA driven from BMV or CCMV subgenomic promoter (Figures 5c and
5d), or
had the SI-IMV coat protein translated from an additional BMV subgenomic RNA
(Figure 7b).
Protoplasts were collected by centrifugation (800 rpcn, 5 min.) 24 hours post
inoculation. The
chemiluminescent GUS assay was performed using GUS-LightTM (Tropix, MA)
according to
manufacturer's instructions. Protein concentrations were determined using the
Bio-Rad protein
kit (Bio-Rad Laboratories, Hercules, CA). The GUS values, determined by
luminometer, were
adjusted to the same total protein concentration. Figures l6a and 16b show
successful GUS
expression in protoplasts in the presence of trans-acting BMV replication
factors I a and 2a.
Example II - Transfection of N. tabacuni ProtoRlasts with GFP Containin,g DNA-
Launchine
Pao
N. tabacum protoplasts isolated by using the above described metliods were
transfected
by electroporation witli expression plasinids for trans-acting BMV replication
factors la and 2a
and with DNA-launching platforms for RNA3 derivatives having the GFP gene in
place of BMV
coat protein ORF (Figure 6e), the CP gene translated frotn an additional
subgenomic RNA
(Figure 6a) or with an RNA transcript having the GFP expressed as a fusion
protein with BMV
3a ORF (Figure 6d). Protoplasts were incubated for 24 hrs and exatnined for
GFP expression
CA 02329509 2000-11-21
WO 99/61597 PC'r/US99/11250
23
using a fluorescent niicroscope. Figure 18 shows the sticcessiiil expression
of GFP in
protoplasts.
Example 12 - Transfection of (la + 2a1-Transgenic Plants with BMV RNA3-Based
DNA-
Launching Platform Containing GFP
N. benthan-iana plants were transfected using a particle bombardment as
described
above with a DNA-launching platfonn for BMV RNA3 having the GFI' gene in place
of BMV
coat protein (Figure 6e). Tlie GFP expression was determined 24 hrs post
inoculation using a
fluorescent microscope. Figure 17 shows the successful expression of GFP in
(la + 2a)-
transgenic N. benthamiana.
Example 13 - Transfection of (1 a + 2a)-Transgenic N. henthanJiana with I3M V
RNA3 DNA-
Launching Platfonn Usittg Al;robacteriunr
N. benthamiana plants were inoculated with BMV RNA3 DNA-launching platfonn
using Agrobacteriurn tunrefaciens. Once the desired construct (pB3LR42) was
obtained in E.
coll it was transferred to A. tunrefaciens strain LBA4404 using a thaw-freeze
method as
described above. TheAgrobacteritmt was grown oveniight in 28 C under constant
shaking. A
single lower leaf of N. benthainiana were punctured with a needle multiple
times and submergecl
in Agrobacteriunr culture. The plants were grown at 23 C with a 16 hr
photoperiod. The
inoculated leaves were harvested 14 days post-inocti latioti. The total RNA
extraction and
northern blot hybridization were perfonned as described above. Figure 19 shows
replication of
launched BMV RNA3 in inoculated (I a + 2a)-transgenic N. benthainiana.
Example 14 - Transfection of (1 a+ 2a)-Transgenic Platits with BMV RNA3-Based
DNA-
Launching Platform Containirsg, GUS and SHMV Coat Protein
N. bentlrantiana plants were transfected using a particle bombardment as
described
above with a DNA-launching platform for BMV RNA3 wherein the BMV coat protein
was
replaced with the SHMV coat protein (Sunii-hemp mosaic virus) and tlre GUS
gene was inserted
downstream of an additional BMV subgenoniic promoter (Figure 7b). The GUS
expression was
determined by Iiistochemical GUS assay described above. Figure 20 shows the
successful
expression of GUS in (1 a + 2a)-transgenic plants.
CA 02329509 2000-11-21
WO 99/61597 1'CT/US99/112511
24
Example 15 - Movernent of Launched BMV RNA 3
FI progeny plants from self-fertilized (la+2a)-transgenic N. bentiranniana
BP14 were
inocttlated with BMV RNA3 DNA launching platform using Agrobacterium
tumefaciens.
Seedlings were germinated on Sinurf inedia containing Kananiycin. Plants were
grown at 23 C
with a 16 hr photoperiod. Once the desired construct (pB3LR42) was obtained in
E. coli it was
transferred to A. t:unefaciens strain LBA4404 using a thaw-freeze niethod as
described above.
TheAt;robacteriiun was grown oveniight at 28 C under constant shaking. A
single lower leaf
of N. benthamiana was punctured with a needle multiple times and submerged in
Agrobacteriirm
culture. The inoculated, niiddle, and upper leaves were harvested 14 days post-
inoculation.
Total Rls'A extraction and northern blot liybridization were perfonned as
described above.
RNA3 replication was detected in all leaves tested (Fig. 21). It shows that
BMV RNA3 is able
to replicate, niove cell-to-cell and spread long distance in (1 a+2a)-
transgenic plants.
Example 16 - Transfection of Progeny Frotn (la+2a)-Transgenic N. benthatnianu
With BMV
RNA3 DNA-Launciiing Platform
Progeny plants frorn self-fertilized (la+2a)-tratisgenic N. benthamiana
(designated
BP I4) were inoculated with BMV RNA3 DNA-launchitig platforni using
Agrobacteriuni as
described in Example 13, Control plants (non-transgenic N. benthamiana) were
inoculated with
the sap from BMV infected barley using inoculation buffer composed of 50tnM
NaPO4, pH7.0,
and 1% celite. Root samples were liarvested 6 weeks post inoculatioti. RNA
extraction and
northern blot hybridization were perfornied as described above. Figure 22
shows that BMV
RNA3 replicated to very high levels in roots. In some (la+2a)-transgenic
plants (Figure 22,
lanes 2, 5, 6, 7, 8, 10) replication of launclied RNA3 dratnatically exceeded
replication of wild-
type BMV in non-transgenic N. benthaniiana plants (Figure 22, lane 1). This
shows that this
system can be used for delivery of RNA, proteins, peptides or other cotnpounds
to roots and
enables testing of such compounds for various activities, for example,
activities directed against
root parasites. For example, proteins with atiti-nematode activities can be
inserted into RNA3
DNA-launching platfortn using the above described strategies and expressed in
roots upon
RNA3 replication. Sttch proteins can be engineered to be expressed in the
cytoplasm or
alternatively secreted into the sttrrounding soil.
CA 02329509 2000-11-21
WO 99/61597 PCTIUS99/11250
Example 17 - Barley Stripe Mosaic Virus
Barley stripe mosaic virus (BSMV) has a tripartite genome (RNA alpha, bcta,
and
gamma). These genomic RNAs have an m7Gppp cap at the 5' end and a t-RNA like
structure
at the 3' end (Jackson and Hunter, 1989).
5 A DNA-launchitig plasmid for BSMV RNA alpha, RNA beta, and RNA gatnma
containing BSMV RNA cDNA is constructed by precisely fusing at its 5' end to a
DNA-
dependent RNA polymerase promoter and to a self-cleaving ribozyme at its 3'
end. A
polyadenylatioti signal tnay be also included. Alternatively, a convenient
restriction site may
be engineered at the 3' end of viral cDNAs. Foreign genes or sequences may be
expressed in
10 several ways. For exaniple, DNA-lautichitig plasniids based on BSMV RNA
beta may contain
a foreign gene or sequence expressed in place of ORF beta a.
Transgenic plants having one or inore trans-acting factors fttsed to the DNA-
dependent
RNA polymerase promoter and tenninator are obtained. Such trans-acting factors
may include
parts of the viral RNA replicase (ORFs alpha a and/or gamma a) or other trans-
acting factors.
15 The trans-acting factors are stably expressed in the plant cell or their
expressioti may be induced
if an inducible pronioter is used. Cis-acting sequences necessary for BSMV RNA
replication
are removed from transgenes. Alternatively, the full-length RNA alplia is
expressed from the
chromosome. Alternatively, ORF gamnia a including the 5' untranslated region
and ORF
gamtna b frotn a seed tratisni itted strain, such as ND18, are also expressed
(Edwards, 1995).
20 A DNA-launching plastnid is constructed containing tiie DNA-dependent RNA
polymerase promoter precisely fused to the 5' end of the BSMV RNA beta, cis-
acting elements
important for BSMV RNA beta life cycle, such as the 5' and 3' etids, the
intercistronic region
between the beta a and beta b ORFs (Zliou and Jackson, 1996) and a foreign
gene or sequence
in place of ORF beta a (coat protein) which is dispensable for BSMV
replication and nioveinent
25 (Petty and Jackson, 1990). Such DNA-launching plasmids tnay lack the
ititernal poly(A) region
as this region is dispensable for replication and contain a ribozynie or a
convenient restriction
site at the 3' end of the modified viral RNA. Alternatively, a DNA-launciting
plasinid is
constructed from RNA gamnta in which ORFs gamma a and/or ganitna b are
replaced with
foreign genes or sequences which may also include the triple getie block genes
(ORFs beta b,
beta c, and beta d) or a heterologous tnovement protein (TMV 30K, RCNMV 35K).
Example 18 - Tobacco Mosaic Virus
Tobacco mosaic virus (TMV) has a single-stranded positive sense RNA getiome.
The
5' end has an m7Gppp cap and the 3' end contains a t-RNA like structure.
CA 02329509 2000-11-21
WO 99/61597 I'CT/US99/11250
26
A DNA-launching plasmid is constructed based on TMV RNA containing TMV cDNA
precisely fused at its 5' end to a DNA-dependent RNA polyinerase promoter and
at its 3' end
to a self-cleaving ribozyme. A polyadenylation signal niay be also included.
Alternatively, a
convenient restriction site may be engineered at the 3' end. Foreign gene may
be expressed frotn
an additional subgenoniic RNA by including an additional subgenomic RNA
promoter on the
(-) strand.
Transgenic plants are obtained having one or more trans-acting factors fused
to the
DNA-dependent RNA polytnerase promoter and terminator. Such factors may
include the viral
replicase (126K/183K), moveinent protein (30K), or coat protein (17.6K). At
least one cis-
acting sequence necessary for TMV RNA replication is renioved froni
transgenes. The trans-
acting factors are stably expressed in the plant cell or their expression may
be induced if an
inducible proinoter is used.
A DNA-launching plasmid is constructed containing the DNA-dependent RNA
polymerase proinoter precisely fiised to the 5' end of the TMV cDNA, cis-
acting elenients
important for the TMV life cycle, such as the 5' and 3' ends, origin of
assenibly, etc., at least one
foreign gene or sequence in place of the trans-acting factor that is expressed
from the
chromosoine, and a ribozyme or a convenient restriction site at the 3' end.
Alternatively, the
foreign gene sequence can be expressed from an additional subgenomic RNA
promoter and the
sequence coding for the trans-acting factor that is expressed froni the
transgene can be deleted
from the DNA-launching plasmid. Preferably, if the viral replicase proteins
are expressed in
transgenic plants, the DNA-launching plasmid will have a deletion of
nucleotides 3420-4902,
which appears to be a region that inhibits replication in trans. (Lewandowski
et al., 1998).
6xaniple 19 - Potato Virus X
Potato virus X (PVX) has a single-stranded positive sense RNA genome. The 5'
end has
an m7Gppp cap and the 3' end is polyadenylated. A ftill-length cDNA clone of
PVX has been
constructed and infectious RNA transcripts obtained (1-lemenway el al., 1990).
A DNA-launching plasinid is constructed based on PVX RNA containing PVX cDNA
precisely fused at its 5' end to a DNA-dependent RNA polymerase promoter and
having a
polyadeiiylation site at its 3' end. A convenient restriction site may also be
included at the 3'
end. A foreign gene niay be expressed from an additional subgenomic RNA.
Transgenic plants are obtained having one or niore trans-acting factors fused
to the
DNA-dependent RNA polyrnerase pronioter and terminator. Sucti factors may
include the viral
RNA polymerase gene (ORFI-147K), coat protein (ORP5-21 K), or triple gene
block (ORF2-
CA 02329509 2000-11-21
WO 99/61597 1'C'T/US99/11250
27
25K, ORF3-12K, ORF4-8K). 7'Ite triple gene block genes can be expressed
ittdividually.
Alternatively, they can be expressed as negative sense transcripts front which
plus sense
subgenomic RNA for ORFs 2, 3, and 4 can be transcribed by the viral replicase.
Such transgene
will have a DNA-dependent RNA polytnerase pronioter fused to sequence of ORFs
2, 3, and 4
in the minus sense orientation and the transcribed sequence will include a
subgeno-nic RNA
promoter. At least one cis-actitig sequettce ttecessary for PVX RNA
replication is retnoved from
transgenes. The trans-acting factors are stably expressed in the plant cell or
their expression may
be induced if an inducible promoter is ttsed.
A DNA-launching plasmid is constructed containing the DNA-dependent RNA
polymerase promoter precisely fttsed to the 5' end of the PVX genotne, cis-
acting elenients
important for PVX life cycle, such as the 5' and 3' ends, origin of assembly,
etc., at least one
foreign gene or sequence in place of the trans-acting factor that is expressed
from the
chroniosome and a polyadenylation signal. Alternatively, the foreign gene
sequence can be
expressed from an additional sttbgenomic RNA promoter and the sequence coding
for the trans-
acting factor that is expressed trattsgenically can be deleted frotn the
DNA=launching plasmid.
Alternatively, a DNA-launching plasmid is constructed having a DNA-dependent
ItNA
polymerase promoter, polyadenylation site, and the PVX cDNA seqtience in which
the ORF2
(25K) is replaced witlt a foreign gene or sequence. Altematively, the ORF2 is
deleted and the
foreign gene is expressed froni an additional subgenotnic RNA promoter. Such a
DNA-
launching plasntid is inoculated to transgenic plants expressing niovenient
protein from
heterologous virus, such as tobacco mosaic virus (TMV 30K), totnato mosaic
virus (ToMV
30K), or red clover necrotic niosaic virus (RCNMV 35K).
Example 20 - Flock House Virus
Flock house virus (FHV) has a genome consisting of tNvo single stranded RNAs.
RNA I
encodes protein A, involved in RNA replication, atid protein B that is
trattslated front sg RNA3
and is dispensable for RNA replication. RNA2 encodes virion capsid precursor
protein alpha.
FI-1V is infectious to insect, plant, mammalian, and yeast cells (Selling el
al., 1990; Price el al.,
1996).
A DNA-launching plasmid is constructed for FHV RNA 1 and RNA2 containing FHV
RNA cDNA precisely fused at its 5' end to a DNA-dependent RNA polymerase
promoter and
at its 3' end to a self-cleaving ribozyme. A polyadettylation signal may be
also included.
Altematively, a convenient restriction site may be engineered at the 3' end.
Foreign genes or
sequences may be expressed in several ways. For example, DNA-launclting
plasmids based on
CA 02329509 2000-11-21
WO 99/61597 PC'1'/US99/11250
28
FHV RNA I tnay contain a foreign gene or sequence expressed from subgenotnic
RNA3 as ORF
B replacetnent or as a translational fusion witli ORF B. Alternatively, a
foreign gene may be
expressecl froni an additional sg RNA. DNA-launching plasinids based on FHV
RNA2 may
contain a foreign gene(s) or sequence(s) expressed as a part of polyprotein
alpha. Foreign
gene(s) in sucli construct may include sequences necessary for polyprotein
clevage. DNA-
launching plasmids will preferably also express a movetnent protein of a
lieterologous plant
virus, sucli as 30K of TMV or 35K of ItCNMV. Alternatively, DNA-lautiching
plasinids will
be inoculated onto transgenic plants expressing such tnovement protein.
Transgenic plants are obtained having one or more trans-acting factors fused
to the
DNA-dependent RNA polynierase proinoter and terminator. Such factors may
include protein
A or capsid protein precursor alptta, and preferably will also include a
niovement protein from
a plant virus, such as 30K of TMV or 35K of RCNMV. Trans-acting factors are
stably
expressed in the plant cell or their expression tnay be induced if an
inducible promoter is used.
Transgenicaliy expressed trans-acting factors preferably lack at least one cis-
acting factor wliich
is necessary for their replica-ion, such as the 5' and/or 3' end.
A DNA-launclting plastnid is constructed based on FHV RNAI or FHV RNA2
containing a DNA-dependent RNA polynierase promoter precisely fused to the 5'
end of RNA 1
(or RNA2), cis-acting eleinents iniportant for FHV RNA 1(or RNA2) replication,
such as the 5'
and 3' ends, at least one foreign gene or sequence and a self-cleaving
ribozyme at ttte 3' end.
Polyadenvlation signal niay also be included. Alternatively, a convenient
restriction site tnay
be engineered at the 3' end of the modified viral RNA sequence of the DNA-
launclting plasmid.
DNA-launching plasniids based on FFIV RNA I tnay contain a foreign gene or
sequence in place
of ORF A. Alternatively, the ORF A inay be deleted and the foreign gene tnay
be expressed
from subgenomic RNA3, for exatnple as an ORF B replacement or as a
translational fusion with
ORF B. Alternatively, DNA-launching plasmid may contain two exogenous RNA
sequences,
one in the place of ORF A and the other expressed froin the subgenoniic RNA3.
DNA-
launclting plasinids based on FI IV RNA2 may contain a foreign gette(s) or
sequence(s) in place
of ORF alplta or expressed as a part of polyprotein alplia. Foreign gene(s) in
sttch a construct
tnay include sequences necessary for polyprotein clevage.
Example 21 - Tomato Spotted Wild Virus
Toniato spotted wild virtts (TSWV) is a tripartite (RNA L, M, S), negative
sense and
atnbisense, single stranded RNA virtis.
CA 02329509 2000-11-21
WO 99/61597 I'CT/US99/11250
29
Transgenic platits are obtaineci having one or more trans-acting factors fused
to the
DNA-dependent RNA polymerase protnoter and terminator. Such factors include
the putative
TSWV polynierase gene (ORF L), ORF N, and possibly other trans-acting factors
(NStn or NSs).
At least one cis-acting sequence, such as 5' and/or 3' ends, which are
necessary for T'SWV RNA
replicatioti are retnoved frorn the transgene. Trans-acting factors are stably
expressed in the
plant cell or their expression may be induced if an inducible promoter is
used.
A DNA-launcliing plasinid is constnicted based on TSWV RNA M in which the G1
and
G2 coding sequettces are replaced with at Icast one foreign gene or sequence.
Sttch DNA-
launching piastnid contains a DNA-dependent RNA polytnerase promoter and TSWV
RNA M
cDNA fused to the self-cleaving ribozymes at the 5' and 3' ends.
Alternatively, a DNA-
launching plasmid is cotistructed based on TSWV RNA S in whicii tiie N coding
region is
replaced with a foreign gene or sequence.
Exatnple 12 - Barley Mild Mosaic Virus
Genotne of barley tnild mosaic virus (BaMMV) consists of hvo positive sense,
single-
stranded, 3'-polyadenylated RNAs. The RNA 1 encodes proteitis related to the
potyviral P3,
6KI, CI, 6K2, NIa-VPg, NIa-Pro, Nlb and capsid protein (Kashiwazaki et al.,
1990). The RNA2
encodes P1 and P2 protein (Kashiwazaki el al., 1991). The Pl proteiti is
related to the potyviral
HC-Pro and the P2 protein is important for fungal transmission. An isolate was
obtained
containing a deletion in the P2 protein (Titnpe and Kuhne, 1995) thus
indicatitig that P2 is
dispensable for viral RNA replication.
A DNA-launching plasmid is constructed for BaMMV RNA 1 and RNA2 containing
BaMMV RNA cDNA precisely fused at its 5' end to a DNA-dependent RNA polymerase
promoter and a polyadenylatioti site at its 3' end. Foreign genes or sequences
may be expressed
in several ways. For example, DNA-launching plasniids based on BaMMV RNA2 may
contain
a foreign gene or sequence expressed as a part of polyprotein which can be
cleaved and a foreign
protein can be released.
Transgenic plants are obtaitied Itaving the BaMMV RNA I cDNA lacking the 5'
and 3'
ends fused to the DNA-dependent RNA polymerase promoter and tenninator.
A DNA-launching plasmid is constructed based on BaMMV (isolate M) RNA2. Such
plasmid contains a DNA-dependent RNA polymerase promoter precisely fused to
the 5' end of
RNA2, RNA2 cis-acting replication signals located in the 5' and 3' ends, Pl
ORF and a foreign
gene in place of P2 ORF or expressed as a part of Pl/P2 polyprotein which can
be cleaved and
a foreign protein can be released.
CA 02329509 2005-01-06
It should be understood that the exaxnples and embodiments described
herein are for illustrative purposes only and that various modifications or
changes in light thereof vai11 be suggested to persons slcilled in the art and
are to
be included within tlxe spirit and purview of this application.
CA 02329509 2000-11-21
WO 99/61597 PCT/US99/11250
31
References
De Jong and Ahlquist (1992) "A hybrid plant RNA virus tnade by transferritig
the noncapsid
movenient protein froni a rod-shaped to an icosahedral virus is competent for
systeniic
infection," PNAS 89:6808-6812.
Dinant, S., Janda, M., Kroner, P.A., Ahlquist, P. (1993) "I3romovirus RNA
replication and
transcription requires compatibility between the polytnerase- and helicase-
like viral
RNA synthesis proteitts,"J. Virol. 67:7181-7189.
Edwards, M.C. (1995) "Mapping of the seed transmission deterntinants of barley
stripe mosaic
v i rv s," MPN118:906-915 .
French, R. and Alilquist, P. (1988) "Characterization and engineering of
sequences controlling
in vivo synthesis of broine rnosaic virus RNA3," J. Vir=ol. 62(7):241 1-2421.
Hernenway, C., Weiss, J., O'Connell, K., and Tumer, N.E. (1990)
"Characterization of
infectious transcripts from a potato virus X cDNA clone," t"irolog), 175:365-
371.
Ishikawa, M., Diez, J., Restrepo-l-lartwig, M., Ahlquist, P. (1997) "Yeast
mutations in tnultiple
complementation groups inhibit bronie niosaic virus itNA replication and
transcription
and perturb regulated expression of viral polytnerase-like gene," PNAS94:13810-
13815.
Jackson, A.O. and Hunter, B.G. (1989) "Hordeivirus relationships and genome
organization,"
Artnu. Rev. Plrytopathol. 27:95-121.
Janda, M., French. R., Ahlquist, P. (1987) "High efficiency T7 polyrnerase
synthesis of
infectious RNA from cloned brome niosaic virus cDNA and effect of 5'
extensions on
transcript infectivity," Vir-olol,ry 158:259-262.
Kashiwazaki, S. Minobe, Y., Oniura, T., Hibino, H. (1990) "Nucleotide sequence
of barley
yellow mosaic virus RNA 1: a close evolutionary relatiotiship with
potyviruses," Jounial
oJGeneral Virology 71:2781-2790.
Kashiwazaki, S., Minobe, Y., I-iibirto, H. (1991) "Nucleotide sequetice of
barley yellow niosaic
virus RNA2." Journal of General Virology 72:995-999.
Kikkert (1993) "The biolistic PDS 1000/He device," Plant Cell Tiss. and Org.
Cul/. 33:221-226.
Lewandowski, Dennis J., Dawson, Williatn O. (1998) "Deletion of internal
sequences results in
tobacco mosaic virus defective RNAs that accumulate to high levels without
interfering
with replication of the lielper virus," Virologv 251(2):427-437.
Paclia, R.F. and Ahlquist, P. (1991) "Use of Bromovirus RNA3 hybrids to study
tetnplate
specificity in viral RNA arnplification,"Jouriral oJVirology 65:3693-3703.
Petty, I.T.D. and Jackson, A.O. (1990) "Mutational analysis of barley stripe
mosaic virus RNA
beta," Virologv 179:712-718.
CA 02329509 2000-11-21
WO 99/61597 PCT/U599/11250
32
Price, B.D., Rueckert, R.R., Ahlquist, P. (1996) "Complete replication of an
animal virus and
maintenance of expression vectors derived from it in Saccliaroinyces
cerevisiae" PNAS
93:9465-9470.
Rasochova, L. and Miller, W.A. (1996) "Satellite RNA of barley yellow dwarf-
RPV virus
reduces accuniulation of RPV helper virus RNA and attenuates RPV symptoms on
oats," Molecalar Plant-Alicrobe Interact 9:646-650.
Saclier, R., French. R., Ahlquist, P. (1988) "Hybrid brorne mosaic virus RNAs
express and are
packaged in tobacco mosaic virus coat protein in vivo," Virologv 167:15-24.
Selling, B.H., Allison, R.F., Kaesberg, P. (1990) "Genomic RNA of an insect
virus directs
svnthesis of infectious virions in plants," PNAS 87:434-438.
Timpe, U. and Kuhne, T. (1995) "Itl vitro transcript of a full-length cDNA of
a naturally deleted
RNA2 of barley niild niosaic virus (BaMMV) replicate in BaMMV-infected
plants,"
Journal qjGeneral Virology 76:2619-2623.
Topfer, R., Matzeit, V., Gronenborn, B., Schell, J., Steinbiss, H.1-l. (1987)
"A set of plant
expression vectors for transcriptional and translational fusions," Nucleic
Acids Res.
15:5890.
U.S. Patent No. 5.500,360.
Zhou, 11. and Jackson, A.O. (1996) "Analysis.of cis-acting elements for
replication of barley
stripe inosaic virus RNA," Virology 219:150-160.
CA 02329509 2000-11-21
SEQUENCE LISTING
<110> WISCONSIN ALUMNI RESEARCH FOUNDATION
<120> IMPROVED METHODS AND MATERIALS FOR TRANSFORMATION
<130> 7369-57 MIS
<140>
<141>
<150> 60/086,526
<151> 1998-05-22
<150> PCT/US99/11250
<151> 1999-05-21
<160> 8
<170> Patentln Ver. 2.1
<210> 1
<211> 7074
<212> DNA
<213> Brome mosaic virus
<400> 1
aaacactgat agtttaaact gaaggcggga 4acgacaatc tgatcatgag cggagaatta 60
agggagtcac gttatgaccc ccgccgatga cgcgggacaa gccgttttac gtttggaact 120
gacagaaccg caacgattga aggagccact cagccgcggg tttctggagt ttaatgagct 180
aagcacatac gtcagaaacc attattgcgc gttcaaaagt cgcctaaggt cactatcagc 240
tagcaaatat ttcttgt'caa aaatgctcca ctgacgttcc ataaattccc ctcggtatcc 300
aattagnnnn nnnnnnnnnn nnnnnnnnnn gatcgtttcg catgattgaa caagatggat 360
tgcacgcagg ttctccggcc gcttgggtgg agaggctatt cggctatgac tgggcacaac 420
agacaatcgg ctgctctgat gccgccgtgt tccggctgtc agcgcagggg cgcccggttc 480
tttttgtcaa gaccgacctg tccggtgccc tgaatgaact gcaggacgag gcagcgcggc 540
tatcgtggct ggccacgacg ggcgttcctt gcgcagctgt gctcgacgtt gtcactgaag 600
cgggaaggga ctggctgcta ttgggcgaag tgccggggca ggatctcctg tcatctcacc 660
ttgctcctgc cgagaaagta tccatcatgg ctgatgcaat gcggcggctg catacgcttg 720
atccggctac ctgcccattc gaccaccaag cgaaacatcg catcgagcga gcacgtactc 780
ggatggaagc cggtcttgtc gatcaggatg atctggacga agagcatcag gggctcgcgc 840
cagccgaact gttcgccagg ctcaaggcgc gcatgcccga cggcgatgat ctcgtcgtga 900
cccatggcga tgcctgcttg ccgaatatca tggtggaaaa tggccgcttt tctggattca 960
tcgactgtgg ccggctgggt gtggcggacc gctatcagga catagcgttg gctacccgtg 1020
atattgctga agagcttggc ggcgaatggg ctgaccgctt cctcgtgctt tacggtatcg 1080
ccgctcccga ttcgcagcgc atcgccttct atcgccttct tgacgagttc ttctgannnn 1140
nnnnnnnnnn nnnnnnnnnn gatcgttcaa acatttggca ataaagtttc ttaagattga 1200
atcctgttgc cggtcttgcg atgattatca tataatttct gttgaattac gttaagcatg 1260
taataattaa catgtaatgc atgacgttat ttatgagatg ggtttttatg attagagtcc 1320
cgcaattata catttaatac gcgatagaaa acaaaatata gcgcgcaaac taggataaat 1380
tatcgcgcgc ggtgtcatct atgttactag atcgggcctc ctgtcaatgc tggcggcggc 1440
tctggtggtg gttctggtgg cggctctgag ggtggtggct ctgagggtgg cggttctgag 1500
ggtggcggct ctgagggagg cggttccggt ggtggctctg gttccggtga ttttgattat 1560
gaaaagatgg caaacgctaa taagggggct atgaccgaaa atgccgatga aaacgcgcta 1620
cagtctgacg ctaaaggcaa acttgattct gtcgctactg attacggtgc tgctatcgat 1680
ggtttcattg gtgacgtttc cggccttgct aatggtaatg gtgctactgg tgattttgct 1740
ggctctaatt cccaaatggc tcaagtcggt gacggtgata attcaccttt aatgaataat 1800
ttccgtcaat atttaccttc cctccctcaa tcggttgaat gtcgcccttt tgtctttggc 1860
ccaatacgca aaccgcctct ccccgcgcgt tggccgattc attaatgcag ctggcacgac 1920
CA 02329509 2000-11-21
2
aggtttcccg actggaaagc gggcagtgag cgcaacgcaa ttaatgtgag ttagctcact 1980
cattaggcac cccaggcttt acactttatg cttccggctc gtatgttgtg tggaattgtg 2040
agcggataac aatttcacac aggaaacagc tatgaccatg attacgccaa gcttgcatgc 2100
ctgcaggtcg actctagagg atccccggtc actggatttt ggttttagga attagaaatt 2160
ttattgatag aagtatttta caaatacaaa tacatactaa gggtttctta tatgctcaac 2220
acatgagcga aaccctataa gaaccctaat tcccttatct gggaactact cacacattat 2280
tctggagaaa atagagagag atagatttgt agagagagac tggtgatttg cggactctag 2340
aggatccccg ggtaccgagc tcgaattctc gagcagaggt ctcacacaga gacaagcgca 2400
tcacttaaca caattaaaga tcaaatcacc agcgagctcg ccgttaaagc aatactcaaa 2460
ggacttcttg tqtcgtgtta aggcaaccaa acagtactcc tcatgtttaa acaaatcaca 2520
tttggtcgac tt:aagccgaa ccaaagtgac gttgtcaaca gagatccctt gcgcttcgtg 2580
tactgttttt atgtgtccat caatccagtc cttgctcacg ggaaaatcct tagccctcgt 2640
ttgaagggcc gctttatcag cttgagtcat cgtaagatac gttctgttcg gatcaatagt 2700
gacctgcaaa cc:agaagtaa tacgacgctt cgtgagactt ctagaaactt tggactcaga 2760
tgtccaggat tgatacttcg tgtccctatt accgcattta cgcttcagca gattaacagc 2820
agcgataaca tcttgcggac accggtaagt cttgtgaaca acgtcacggc gatcatattg 2880
cagattaccg tggagcaatt taaaacccgc gtcacgagac ttgaacgaaa tctgctctgt 2940
gtccccaaag gcaagaactt gtgaacattt agacagagca gccaccacca ggagttgacc 3000
ataatgtagt aaaccagcct catcaacaag cagcctatga caggacggta caccgtgcat 3060
gatcgcagaa tccgcggtgc gcacaacgtc caaagctacc ttggaattat aagtgtcagg 3120
gaataaagcc atcctgacgt cctcggccga tttacgattc gccgtcacaa ttaggtcctc 3180
tcccatacgg aatgcatctt ttatggcagt ggttttaccg catcccgcaa ctccatcaac 3240
catggaaata tcgcatgtag ggacagaaac tttggcgcta gcttctgcaa tgtccctcaa 3300
gttagagcat gcacatgttt tatcaacaat gtacgtttca tctgcgtgct tcggacctaa 3360
accatgctca ttatatccaa cagtgtaatc gtatttttta ggatacaacc agttaccgtt 3420
ggccaaatgg acattcacca tatcgtctat gcgatggtag gtctcaaaga tgctcttatt 3480
tgcgatctca cttccgcgac cgccggaaat gtcccatagg tgacgaagat tagactcgga 3540
gttgttatgt aatctcttac aataacgcac aaattccttc atggctccgt gtctagatat 3600
gccacgaggg tccgttggta cctcaacaga cacctcggca tccgggacca catcagtcac 3660
cggtttaacg tcatcactga cggactcagg gctcgaactc tcaggggcat catgaaactc 3720
ctcctgaggt atctcagcag ctggcgggac tttcgccttc ttcttcgagc gcttggtctt 3780
ggctgtctgc acttcatgct ccagccggtc gaataagtcc tcttcagtcc aaaacgttct 3840
caaacgtgat atcggtacag aatcttgctc aaattcttca acgtttgaga gacgagtcag 3900
aaacttaaaa ctgtccgcat aagaatccag acgtagtagg ggaaatctgc tagccaatgt 3960
tctcagccat cctactttcg ccctggatga atctccaccc caccaaaacc tagttttgaa 4020
gtgatggcac caacctttcc attccatccc atcgcggagg gccgtaagct tttcgtactt 4080
ttgatacaga ttcaaagtca aagcaaaggc cactagatga taatcttcaa tgtctaagcg 4140
ctcaccagcc atgatagcct gaccgttaat aataacagtc gacgacttgg cggataagat 4200
agatgcgaca gctttcatgt tctcagtcca ttctttactt tccttgaaac atctgaaagc 4260
tatctcctct ac:ctctctca ctgtggtttt ggcgacgcgc acacatttcc agcgattgag 4320
actccagtct tc;aggtattg agacccctac gtacttagat atgtcttcaa accatacaca 4380
gtgacgtagt gt:ctcccggg ggcagcgtaa atttgtagcg atgatcttat aggtcatgat 4440
gttacatttc agcatttcgc gctccaacag ataggtggtt ccatcgatgc aatgcaccga 4500
ctcggtgaaa aatgagccca aatcttgcca tccgtggatg taagataatg tgctttcatt 4560
ttcaaaatcg aatttgatca cctcatccgc gcctgacccg tcacgttgcc agtgacattt 4620
aagcaaggga agaaaaccct cgcggtcaaa caacatggcg ccgtcgaaca taacggtacc 4680
acgtagtacg cgtactccat gcgaatgcat ggcgtcacac agaccttgga agcccatatc 4740
ataaccgccg tggatacaga tagcccaatc agcttggaca tcacaatctt gagctcggtt 4800
aagacaaaag ttcgggactt catcgaaatc atcgctttct tgcaaaattt ttcgcatgcg 4860
gcacatcctc tcctcatgtc gggcagcgtc tctaacaccc aacacaggac aacaactgtg 4920
caccctttta tcccttcttg aaaagtgatg ccaccaagac cctccgaaat ctataacggg 4980
gtcttcaggg ggaaaactgt cgagacagtc ataatgctcc gctacacgca gagcaccagc 5040
caggctatgg ggcgcatgat actgctgagt caaatttaag tcaaaggcac caccataacg 5100
gtcacggaag gcgtcagcct cctcaataga gagcttattg cgaacgttga ttttcttaga 5160
ccttttcgcg tattcaatct gcgcagataa ctgttgcgca acctgattgt ctacgatgtc 5220
ttgggcactc tggctgtcag cacccttctc agcaatcaac ttcagcaaat cgatagaact 5280
tgacattttg ttggtgaaaa acaaagaaca agtagcagaa ccgtggtcga ggtcctctcc 5340
aaatgaaatg aacttcctta tatagaggaa gggtcttgcg aaggatagtg ggattgtgcg 5400
tcatccctta cgtcagtgga gatatcacat caatccactt gctttgaaga cgtggttgga 5460
CA 02329509 2000-11-21
3
acgtcttctt tttccacgat gttcctcgtg ggtgggggtc catctttggg accactgtcg 5520
gtagaggcat tcttgaacga tagcctttcc tttatcgcaa tgatggcatt tgtagaagcc 5580
atcttccttt tctactgtcc tttcgatgaa gtgacagata gctgggcaat ggaatccgag 5640
gaggtttccc gatattaccc tttgttgaaa agtctcaata gccctctggt cttctgagac 5700
tgtatctttg atattcttgg agtagacgag agtgtcgtgc tccaccatgt tgaccgggtg 5760
gtcagtccct tatgttacgt cctgtagaaa ccccaacccg tgaaatcaaa aaactcgacg 5820
gcctgtgggc attcagtctg gatcgcgaaa actgtggaat tgatcagcgt tggtgggaaa 5880
gcgcgttaca agaaagccgg gcaattgctg tgccaggcag ttttaacgat cagttcgccg 5940
atgcagatat tcgtaattat gcgggcaacg tctggtatca gcgcgaagtc tttataccga 6000
aaggttgggc aggccagcgt atcgtgctgc gtttcgatgc ggtcactcat tacggcaaag 6060
tgtgggtcaa taatcaggaa gtgatggagc atcagggcgg ctatacgcca tttgaagccg 6120
atgtcacgcc gtatgttatt gccgggaaaa gtgtacaatt cactggccgt cgttttacaa 6180
cgtcgtgact gggaaaaccc tggcgttacc caacttaatc gccttgcagc acatccccct 6240
ttcgccagct ggcgtaatag cgaagaggcc cgcaccgatc gcccttccca acagttgcgc 6300
agcctgaatg gcgaatgnnn nnnnaattca gtacattaaa aacgtccgca atgtgttatt 6360
aagttgtcta agcgtcaatt tgtttacacc acaatatatc ctgccaccag ccagccaaca 6420
gctccccgac cggcagctcg gcacaaaatc accactcgat acaggcagcc catcagnnnn 6480
nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn 6540
nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn 6600
nnnnnnnnnn nilnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn 6660
nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn 6720
nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn 6780
nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn 6840
nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn 6900
nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn 6960
nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nrmnnnnnnn nnnnnnnnnn nnnnnnnnnn 7020
nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnn 7074
<210> 2
<211> 6750
<212> DNA
<213> Brome cnosaic virus
<400> 2
aaacactgat agtttaaact gaaggcggga aacgacaatc tgatcatgag cggagaatta 60
agggagtcac gttatgaccc ccgccgatga cgcgggacaa gccgttttac gtttggaact 120
gacagaaccg caacgattga aggagccact cagccgcggg tttctggagt ttaatgagct 180
aagcacatac gtcagaaacc attattgcgc gttcaaaagt cgcctaaggt cactatcagc 240
tagcaaatat ttcttgtcaa aaatgctcca ctgacgttcc ataaattccc ctcggtatcc 300
aattagnnnn nnnnnnnnnn nnnnnnnnnn gatcgtttcg catgattgaa caagatggat 360
tgcacgcagg ttctccggcc gcttgggtgg agaggctatt cggctatgac tgggcacaac 420
agacaatcgg ctgctctgat gccgccgtgt tccggctgtc agcgcagggg cgcccggttc 480
tttttgtcaa gaccgacctg tccggtgccc tgaatgaact gcaggacgag gcagcgcggc 540
tatcgtggct ggccacgacg ggcgttcctt gcgcagctgt gctcgacgtt gtcactgaag 600
cgggaaggga ctggctgcta ttgggcgaag tgccggggca ggatctcctg tcatctcacc 660
ttgctcctgc cgagaaagta tccatcatgg ctgatgcaat gcggcggctg catacgcttg 720
atccggctac ctgcccattc gaccaccaag cgaaacatcg catcgagcga gcacgtactc 780
ggatggaagc cggtcttgtc gatcaggatg atctggacga agagcatcag gggctcgcgc 840
cagccgaact gttcgccagg ctcaaggcgc gcatgcccga cggcgatgat ctcgtcgtga 900
cccatggcga tgcctgcttg ccgaatatca tggtggaaaa tggccgcttt tctggattca 960
tcgactgtgg ccggctgggt gtggcggacc gctatcagga catagcgttg gctacccgtg 1020
atattgctga agagcttggc ggcgaatggg ctgaccgctt cctcgtgctt tacggtatcg 1080
ccgctcccga ttcgcagcgc atcgccttct atcgccttct tgacgagttc ttctgannnn 1140
nnnnnnnnnn niinnnnnnnn gatcgttcaa acatttggca ataaagtttc ttaagattga 1200
atcctgttgc cggtcttgcg atgattatca tataatttct gttgaattac gttaagcatg 1260
taataattaa catgtaatgc atgacgttat ttatgagatg ggtttttatg attagagtcc 1320
cgcaattata catttaatac gcgatagaaa acaaaatata gcgcgcaaac taggataaat 1380
tatcgcgcgc ggtgtcatct atgttactag atcgggcctc ctgtcaatgc tggcggcggc 1440
tctggtggtg gttctggtgg cggctctgag ggtggtggct ctgagggtgg cggttctgag 1500
CA 02329509 2000-11-21
4
ggtggcggct ctgagggagg cggttccggt ggtggctctg gttccggtga ttttgattat 1560
gaaaagatgg caaacgctaa taagggggct atgaccgaaa atgccgatga aaacgcgcta 1620
cagtctgacg ctaaaggcaa acttgattct gtcgctactg attacggtgc tgctatcgat 1680
ggtttcattg gtgacgtttc cggccttgct aatggtaatg gtgctactgg tgattttgct 1740
ggctctaatt cccaaatggc tcaagtcggt gacggtgata attcaccttt aatgaataat 1800
ttccgtcaat atttacc.ttc cctccctcaa tcggttgaat gtcgcccttt tgtctttggc 1860
ccaatacgca aaccgcctct ccccgcgcgt tggccgattc attaatgcag ctggcacgac 1920
aggtttcccg actggaaagc gggcagtgag cgcaacgcaa ttaatgtgag ttagctcact 1980
cattaggcac cccaggcttt acactttatg cttccggctc gtatgttgtg tggaattgtg 2040
agcggataac aatttcacac aggaaacagc tatgaccatg attacgccaa gcttgcatgc 2100
ctgcaggtcg actctagagg atccccggtc aacatggtgg agcacgacac tctcgtctac 2160
tccaagaata tcaaagatac agtctcagaa gaccagaggg ctattgagac ttttcaacaa 2220
agggtaatat cgggaaacct cctcggattc cattgcccag ctatctgtca cttcatcgaa 2280
aggacagtag aaaaggaaga tggcttctac aaatgccatc attgcgataa aggaaaggct 2340
atcgttcaag aatgcctcta ccgacagtgg tcccaaagat ggacccccac ccacgaggaa 2400
catcgtggaa aaagaagacg ttccaaccac gtcttcaaag caagtggatt gatgtgatat 2460
ctccactgac gtaagggatg acgcacaatc ccactatcct tcgcaagacc cttcctctat 2520
ataaggaagt tcatttcatt tggagaggac ctcgaccacg gttctgctac ttgttctttg 2580
tttttcacca acaaaatgtc aagttctatc gatttgctga agttgattgc tgagaagggt 2640
gctgacagcc agagtgccca agacatcgta gacaatcagg ttgcgcaaca gttatctgcg 2700
cagattgaat acgcgaaaag gtctaagaaa atcaacgttc gcaataagct ctctattgag 2760
gaggctgacg ccttccgtga ccgttatggt ggtgcctttg acttaaattt gactcagcag 2820
tatcatgcgc cccatagcct ggctggtgct ctgcgtgtag cggagcatta tgactgtctc 2880
gacagttttc cccctgaaga ccccgttata gatttcggag ggtcttggtg gcatcacttt 2940
tcaagaaggg ataaaagggt gcacagttgt tgtcctgtgt tgggtgttag agacgctgcc 3000
cgacatgagg agaggatgtg ccgcatgcga aaaattttgc aagaaagcga tgatttcgat 3060
gaagtcccga acttttgtct taaccgagct caagattgtg atgtccaagc tgattgggct 3120
atctgtatcc acggcggtta tgatatgggc ttccaaggtc tgtgtgacgc catgcattcg 3180
catggagtac gcgtactacg tggtaccgtt atgttcgacg gcgccatgtt gtttgaccgc 3240
gagggttttc ttcccttgct taaatgtcac tggcaacgtg acgggtcagg cgcggatgag 3300
gtgatcaaat tcgattttga aaatgaaagc acattatctt acatccacgg atggcaagat 3360
ttgggctcat ttttcaccga gtcggtgcat tgcatcgatg gaaccaccta tctgttggag 3420
cgcgaaatgc tgaaatgtaa catcatgacc tataagatca tcgctacaaa tttacgctgc 3480
ccccgggaga cactacgtca ctgtgtatgg tttgaagaca tatctaagta cgtaggggtc 3540
tcaatacctg aagactggag tctcaatcgc tggaaatgtg tgcgcgtcgc caaaaccaca 3600
gtgagagagg tagaggagat agctttcaga tgtttcaagg aaagtaaaga atggactgag 3660
aacatgaaag ctgtcgcatc tatcttatcc gccaagtcgt cgactgttat tattaacggt 3720
caggctatca tggctggtga gcgcttagac attgaagatt atcatctagt ggcctttgct 3780
ttgactttga atctgtatca aaagtacgaa aagcttacgg ccctccgcga tgggatggaa 3840
tggaaaggtt ggtgccatca cttcaaaact aggttttggt ggggtggaga ttcatccagg 3900
gcgaaagtag gatggctgag aacattggct agcagatttc ccctactacg tctggattct 3960
tatgcggaca gttttaagtt tctgactcgt ctctcaaacg ttgaagaatt tgagcaagat 4020
tctgtaccga tatcacgttt gagaacgttt tggactgaag aggacttatt cgaccggctg 4080
gagcatgaag tgcagacagc caagaccaag cgctcgaaga agaaggcgaa agtcccgcca 4140
gctgctgaga tacctcagga ggagtttcat gatgcccctg agagttcgag ccctgagtcc 4200
gtcagtgatg acgttaaacc ggtgactgat gtggtcccgg atgccgaggt gtctgttgag 4260
gtaccaacgg accctcgtgg catatctaga cacggagcca tgaaggaatt tgtgcgttat 4320
tgtaagagat tacataacaa ctccgagtct aatcttcgtc acctatggga catttccggc 4380
ggtcgcggaa gt:gagatcgc aaataagagc atctttgaga cctaccatcg catagacgat 4440
atggtgaatg tccatttggc caacggtaac tggttgtatc ctaaaaaata cgattacact 4500
gttggatata atgagcatgg tttaggtccg aagcacgcag atgaaacgta cattgttgat 4560
aaaacatgtg catgctctaa cttgagggac attgcagaag ctagcgccaa agtttctgtc 4620
cctacatgcg atatttccat ggttgatgga gttgcgggat gcggtaaaac cactgccata 4680
aaagatgcat tccgtatggg agaggaccta attgtgacgg cgaatcgtaa atcggccgag 4740
gacgtcagga tggctttatt ccctgacact tataattcca aggtagcttt ggacgttgtg 4800
cgcaccgcgg attctgcgat catgcacggt gtaccgtcct gtcataggct gcttgttgat 4860
gaggctggtt tactacatta tggtcaactc ctggtggtgg ctgctctgtc taaatgttca 4920
caagttcttg cc!tttgggga cacagagcag atttcgttca agtctcgtga cgcgggtttt 4980
aaattgctcc acggtaatct gcaatatgat cgccgtgacg ttgttcacaa gacttaccgg 5040
CA 02329509 2000-11-21
tgtccgcaag atgttatcgc tgctgttaat ctgctgaagc gtaaatgcgg taatagggac 5100
acgaagtatc aatcctggac atctgagtcc aaagtttcta gaagtctcac gaagcgtcgt 5160
attacttctg gtttgcaggt cactattgat ccgaacagaa cgtatcttac gatgactcaa 5220
gctgataaag cggcccttca aacgagggct aaggattttc ccgtgagcaa ggactggatt 5280
gatggacaca taaaaacagt acacgaagcg caagggatct ctgttgacaa cgtcactttg 5340
gttcggctta agtcgaccaa atgtgatttg tttaaacatg aggagtactg tttggttgcc 5400
ttaacacgac acaagaagtc ctttgagtat tgctttaacg gcgagctcgc tggtgatttg 5460
atctttaatt gtgttaagtg atgcgcttgt ctctgtgtga gacctctgct cgagaattcg 5520
agctcggtac ccggggatcc tctagagtcc gcaaatcacc agtctctctc tacaaatcta 5580
tctctctcta ttttctccag aataatgtgt gagtagttcc cagataaggg aattagggtt 5640
cttatagggt ttcgctcatg tgttgagcat ataagaaacc cttagtatgt atttgtattt 5700
gtaaaatact tctatcaata aaatttctaa ttcctaaaac caaaatccag tgaccgggtg 5760
gtcagtccct tatgttacgt cctgtagaaa ccccaacccg tgaaatcaaa aaactcgacg 5820
gcctgtgggc attcagtctg gatcgcgaaa actgtggaat tgatcagcgt tggtgggaaa 5880
gcgcgttaca agaaagccgg gcaattgctg tgccaggcag ttttaacgat cagttcgccg 5940
atgcagatat tcgtaattat gcgggcaacg tctggtatca gcgcgaagtc tttataccga 6000
aaggttgggc aggccagcgt atcgtgctgc gtttcgatgc ggtcactcat tacggcaaag 6060
tgtgggtcaa taatcaggaa gtgatggagc atcagggcgg ctatacgcca tttgaagccg 6120
atgtcacgcc gtatgttatt gccgggaaaa gtgtacaatt cactggccgt cgttttacaa 6180
cgtcgtgact gggaaaaccc tggcgttacc caacttaatc gccttgcagc acatccccct 6240
ttcgccagct ggcgtaatag cgaagaggcc cgcaccgatc gcccttccca acagttgcgc 6300
agcctgaatg gc:gaatgnnn nnnnaattca gtacattaaa aacgtccgca atgtgttatt 6360
aagttgtcta agcgtcaatt tgtttacacc acaatatatc ctgccaccag ccagccaaca 6420
gctccccgac cggcagctcg gcacaaaatc accactcgat acaggcagcc catcagnnnn 6480
nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn 6540
nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn 6600
nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn 6660
nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn 6720
nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn 6750
<210> 3
<211> 6426
<212> DNA
<213> Brome mosaic virus
<400> 3
aaacactgat agtttaaact gaaggcggga aacgacaatc tgatcatgag cggagaatta 60
agggagtcac gttatgaccc ccgccgatga cgcgggacaa gccgttttac gtttggaact 120
gacagaaccg ca.acgattga aggagccact cagccgcggg tttctggagt ttaatgagct 180
aagcacatac gtcagaaacc attattgcgc gttcaaaagt cgcctaaggt cactatcagc 240
tagcaaatat ttcttgtcaa aaatgctcca ctgacgttcc ataaattccc ctcggtatcc 300
aattagnnnn nn.nnnnnnnn nnnnnnnnnn gatcgtttcg catgattgaa caagatggat 360
tgcacgcagg ttctccggcc gcttgggtgg agaggctatt cggctatgac tgggcacaac 420
agacaatcgg ctgctctgat gccgccgtgt tccggctgtc agcgcagggg cgcccggttc 480
tttttgtcaa gaccgacctg tccggtgccc tgaatgaact gcaggacgag gcagcgcggc 540
tatcgtggct ggccacgacg ggcgttcctt gcgcagctgt gctcgacgtt gtcactgaag 600
cgggaaggga ctggctgcta ttgggcgaag tgccggggca ggatctcctg tcatctcacc 660
ttgctcctgc cgagaaagta tccatcatgg ctgatgcaat gcggcggctg catacgcttg 720
atccggctac ctgcccattc gaccaccaag cgaaacatcg catcgagcga gcacgtactc 780
ggatggaagc cggtcttgtc gatcaggatg atctggacga agagcatcag gggctcgcgc 840
cagccgaact gttcgccagg ctcaaggcgc gcatgcccga cggcgatgat ctcgtcgtga 900
cccatggcga tgcctgcttg ccgaatatca tggtggaaaa tggccgcttt tctggattca 960
tcgactgtgg ccggctgggt gtggcggacc gctatcagga catagcgttg gctacccgtg 1020
atattgctga agagcttggc ggcgaatggg ctgaccgctt cctcgtgctt tacggtatcg 1080
ccgctcccga ttcgcagcgc atcgccttct atcgccttct tgacgagttc ttctgannnn 1140
nnnnnnnnnn nnnnnnnnnn gatcgttcaa acatttggca ataaagtttc ttaagattga 1200
atcctgttgc cggtcttgcg atgattatca tataatttct gttgaattac gttaagcatg 1260
taataattaa catgtaatgc atgacgttat ttatgagatg ggtttttatg attagagtcc 1320
cgcaattata catttaatac gcgatagaaa acaaaatata gcgcgcaaac taggataaat 1380
...........~....~.. .... . __ _ _ _. . __
CA 02329509 2000-11-21
6
tatcgcgcgc ggtgtcatct atgttactag atcgggcctc ctgtcaatgc tggcggcggc 1440
tctggtggtg gttctggtgg cggctctgag ggtggtggct ctgagggtgg cggttctgag 1500
ggtggcggct ctgagggagg cggttccggt ggtggctctg gttccggtga ttttgattat 1560
gaaaagatgg caaacgctaa taagggggct atgaccgaaa atgccgatga aaacgcgcta 1620
cagtctgacg ctaaaggcaa acttgattct gtcgctactg attacggtgc tgctatcgat 1680
ggtttcattg gtgacgtttc cggccttgct aatggtaatg gtgctactgg tgattttgct 1740
ggctctaatt cccaaatggc tcaagtcggt gacggtgata attcaccttt aatgaataat 1800
ttccgtcaat atttaccttc cctccctcaa tcggttgaat gtcgcccttt tgtctttggc 1860
ccaatacgca aaccgcctct ccccgcgcgt tggccgattc attaatgcag ctggcacgac 1920
aggtttcccg actggaaagc gggcagtgag cgcaacgcaa ttaatgtgag ttagctcact 1980
cattaggcac cccaggcttt acactttatg cttccggctc gtatgttgtg tggaattgtg 2040
agcggataac aatttcacac aggaaacagc tatgaccatg attacgccaa gcttgcatgc 2100
ctgcaggtca ctggattttg gttttaggaa ttagaaattt tattgataga agtattttac 2160
aaatacaaat acatactaag ggtttcttat atgctcaaca catgagcgaa accctataag 2220
aaccctaatt cccttatctg ggaactactc acacattatt ctggagaaaa tagagagaga 2280
tagatttgta gagagagact ggtgatttgc ggactctaga ggatccccag cttttaaact 2340
tagccaaagt ggtctgcctg accaggagtt tttaacctta accaaagggc tgttcacagc 2400
ttaggttcat atatcataga accgatcatc tcagatcaga gggcttaaaa gtctcacaat 2460
gggacttcac gagcaaagca tcaactgacg ttaggcctcc tctaccggta gcgtaatcgt 2520
cgaccttctt tttcaagcgt tgtgtggtcc tacgatcatt agctaatttg agtgactcac 2580
gctcaagggc ctcatgtaaa cgtccgatcc gtttgacagg gagctcctta gtactacagt 2640
ccgaggaata aattccaatg gttctgtaga ctttgtctaa cacaccagga aactttggat 2700
tcttccagtt gtgaaaccag tcaccatcag ttttacgctc ttccgtggtg cgtttgaact 2760
tacatacagg atcgctcatc tgataaactc tgatgccttc ggtacagtag caatcagaga 2820
acctcaggaa attctcggag tataaagaaa aagccgcaag agcagctcta acctcctcga 2880
aaatccaagg tttttctttc ccatatttca gataaacaaa atgacagagc gtcgtaatca 2940
tcttctcatc aagttgatta ataaacttca ttcgatcaca gaaggaaacg aaatgtgctc 3000
tgagcatctg ttcatcacgc agaatctttc gcttagctaa gcgctggatc tctctcagag 3060
gatctggtac agacaccaaa ttgcccattt cagtttcgac gagaaactta ctacaaacgt 3120
agggcacact agggtccatg acttttatct ccatattgaa gagagacgta aacatatcgg 3180
tatccaggac tqgcttaact ttagagatga ttaaagaatc atctcctgaa aatattgcac 3240
agtcacagtc acttagatca gaggcatatg caatcatagc catagtgaca agagtattac 3300
cgaaatatgt aaacgcgtca ccagttctgc gttggaagga aacggacatt cccaccttgg 3360
catgagggtc tgataaataa gaatcgcgat gaaaatcaga ccaccaattc gtcagcggcg 3420
ctggaaagcc cagcgcaagg agtatctctc tctgaaactc taggtgcagc tcaccctgag 3480
atttatcaaa tttgcttagg tccgcttcaa gaaagtatct gttattcaag cggacattct 3540
taagctccag agaggatatc tttccgatag gcacaatgaa cctggatttc agggccagtg 3600
ataacttctc gaaacaagca gtgaaaaagg gtgaaaaatt actagtcaca cctttactat 3660
gaaatgttat agtagctgct actgctcgtt ccaagtgaag ggtgtcagtt acaacaggtt 3720
ttacgtcaga ct:tcagcata tgctggtacc gacataaatc agtctctgct gccacattca 3780
caccttgcaa gtccatgtgc ttaccccact tcttatggta ctcaagacat ttagtcatga 3840
catccataga agctctcaga cagtcttcac cgtcaacatt aaggaatgtg ctacgaaagc 3900
gctttgctat agctttcgca gtgtccttca tgttaatcgc gtctcccatt tctggaacgt 3960
ccgcgtttcg ctttttgagt gcggttaaga cttctttctg agtaccaact cttcgctgag 4020
cactcccgat attcatt.ttt ggttgaaaat atttatcggg gtccctatac cagtctacat 4080
cactttgctt aagtctgatc ctatcaaagt ccatggaata atcaccattt tcaacaaggg 4140
cttgatggta cgaatcatcg aaataagcat gggttggcag tatggaatga ctggtcgctt 4200
ctgttctagc aaggctgact ctctccatat aaattggccc agtagagatg tcagggttat 4260
ctggatggca gtgtgtatca ataacacgcg aaaccctatg ttcaataggg ttcatgattt 4320
gaagagtgat gtcgtaatca gtattagtag tctgaaactc ttcatcaatg cccatgtacc 4380
tatctccaag ggtcagctcc ttgggggtat ctccagtaac acgaacttcc tcaatttcac 4440
agttcgagga atcactggcg agttttagat cgctcgcatg atcttcatcg gcggcaaacg 4500
atacaccgta accatcacta gtatcctcgg gataccagtc atcaatttca tcttcgagca 4560
cgaaagagcc cggaatgtca agatataaca tccgtgccat ttcagcttga ggaatcagcg 4620
gtctatcggt gaactgttga accatttgtt ggacggtgtc gcaaatagag ccccagcgca 4680
ctcggtcaaa agggggatcg aatacccctc ctatctccaa gggcgctata gctaatttaa 4740
aactcgcgag agatccgtca atggcaactc cgtctgccgg ctcctgcacc tgaaggctag 4800
cagcctccac ctcgtcttct aaggattgat ctatgatcca ttggaaagac gggacctggc 4860
gaacgaaatc atcatcccag gttttcgaag acatcttggt gatagtagaa agaacaagca 4920
CA 02329509 2000-11-21
7
cacaacaaca acaaggtcag atgtgtgttg cgggtaccga gctcgaattc tcgaggtcct 4980
ctccaaatga aatgaacttc cttatataga ggaagggtct tgcgaaggat agtgggattg 5040
tgcgtcatcc cttacgtcag tggagatatc acatcaatcc acttgctttg aagacgtggt 5100
tggaacgtct tctttttcca cgatgttcct cgtgggtggg ggtccatctt tgggaccact 5160
gtcggtagag gcattcttga acgatagcct ttcctttatc gcaatgatgg catttgtaga 5220
agccatcttc cttttctact gtcctttcga tgaagtgaca gatagctggg caatggaatc 5280
cgaggaggtt tcccgatatt accctttgtt gaaaagtctc aatagccctc tggtcttctg 5340
agactgtatc tttgatattc ttggagtaga cgagagtgtc gtgctccacc atgttgacct 5400
gcaggcagca agcttgcatg cctgcaggtc gactctagag gatccccggg tggtcagtcc 5460
cttatgttac gtcctgtaga aaccccaacc cgtgaaatca aaaaactcga cggcctgtgg 5520
gcattcagtc tggatcgcga aaactgtgga attgatcagc gttggtggga aagcgcgtta 5580
caagaaagcc gggcaattgc tgtgccaggc agttttaacg atcagttcgc cgatgcagat 5640
attcgtaatt atgcgggcaa cgtctggtat cagcgcgaag tctttatacc gaaaggttgg 5700
gcaggccagc gtatcgtgct gcgtttcgat gcggtcactc attacggcaa agtgtgggtc 5760
aataatcagg aagtgatgga gcatcagggc ggctatacgc catttgaagc cgatgtcacg 5820
ccgtatgtta ttgccgggaa aagtgtacaa ttcactggcc gtcgttttac aacgtcgtga 5880
ctgggaaaac cctggcgtta cccaacttaa tcgccttgca gcacatcccc ctttcgccag 5940
ctggcgtaat agcgaagagg cccgcaccga tcgcccttcc caacagttgc gcagcctgaa 6000
tggcgaatgn n:nnnnnaatt cagtacatta aaaacgtccg caatgtgtta ttaagttgtc 6060
taagcgtcaa tttgtttaca ccacaatata tcctgccacc agccagccaa cagctccccg 6120
accggcagct cggcacaaaa tcaccactcg atacaggcag cccatcagnn nnnnnnnnnn 6180
nnnnnnnnnn n:nnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn 6240
nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn 6300
nnnnnnnnnn n:nnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn 6360
nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn 6420
nnnnnn 6426
<210> 4
<211> 6500
<212> DNA
<213> Brome mosaic virus
<400> 4
aaacactgat agtttaaact gaaggcggga aacgacaatc tgatcatgag cggagaatta 60
agggagtcac gttatgaccc ccgccgatga cgcgggacaa gccgttttac gtttggaact 120
gacagaaccg caacgattga aggagccact cagccgcggg tttctggagt ttaatgagct 180
aagcacatac gtcagaaacc attattgcgc gttcaaaagt cgcctaaggt cactatcagc 240
tagcaaatat ttcttgtcaa aaatgctcca ctgacgttcc ataaattccc ctcggtatcc 300
aattagnnnn nnnnnnnnnn nnnnnnnnnn gatcgtttcg catgattgaa caagatggat 360
tgcacgcagg ttctccggcc gcttgggtgg agaggctatt cggctatgac tgggcacaac 420
agacaatcgg ctgctctgat gccgccgtgt tccggctgtc agcgcagggg cgcccggttc 480
tttttgtcaa gaccgacctg tccggtgccc tgaatgaact gcaggacgag gcagcgcggc 540
tatcgtggct ggccacgacg ggcgttcctt gcgcagctgt gctcgacgtt gtcactgaag 600
cgggaaggga ctggctgcta ttgggcgaag tgccggggca ggatctcctg tcatctcacc 660
ttgctcctgc cgagaaagta tccatcatgg ctgatgcaat gcggcggctg catacgcttg 720
atccggctac ctgcccattc gaccaccaag cgaaacatcg catcgagcga gcacgtactc 780
ggatggaagc cggtcttgtc gatcaggatg atctggacga agagcatcag gggctcgcgc 840
cagccgaact gttcgccagg ctcaaggcgc gcatgcccga cggcgatgat ctcgtcgtga 900
cccatggcga tgcctgcttg ccgaatatca tggtggaaaa tggccgcttt tctggattca 960
tcgactgtgg ccggctgggt gtggcggacc gctatcagga catagcgttg gctacccgtg 1020
atattgctga agagcttggc ggcgaatggg ctgaccgctt cctcgtgctt tacggtatcg 1080
ccgctcccga ttcgcagcgc atcgccttct atcgccttct tgacgagttc ttctgannnn 1140
nnnnnnnnnn nnnnnnnnnn gatcgttcaa acatttggca ataaagtttc ttaagattga 1200
atcctgttgc cggtcttgcg atgattatca tataatttct gttgaattac gttaagcatg 1260
taataattaa catgtaatgc atgacgttat ttatgagatg ggtttttatg attagagtcc 1320
cgcaattata catttaatac gcgatagaaa acaaaatata gcgcgcaaac taggataaat 1380
tatcgcgcgc ggtgtcatct atgttactag atcgggcctc ctgtcaatgc tggcggcggc 1440
tctggtggtg gttctggtgg cggctctgag ggtggtggct ctgagggtgg cggttctgag 1500
ggtggcggct ctgagggagg cggttccggt ggtggctctg gttccggtga ttttgattat 1560
CA 02329509 2000-11-21
8
gaaaagatgg caaacgctaa taagggggct atgaccgaaa atgccgatga aaacgcgcta 1620
cagtctgacg ctaaaggcaa acttgattct gtcgctactg attacggtgc tgctatcgat 1680
ggtttcattg gtgacgtttc cggccttgct aatggtaatg gtgctactgg tgattttgct 1740
ggctctaatt cccaaatggc tcaagtcggt gacggtgata attcaccttt aatgaataat 1800
ttccgtcaat atttaccttc cctccctcaa tcggttgaat gtcgcccttt tgtctttggc 1860
ccaatacgca aaccgcctct ccccgcgcgt tggccgattc attaatgcag ctggcacgac 1920
aggtttcccg actggaaagc gggcagtgag cgcaacgcaa ttaatgtgag ttagctcact 1980
cattaggcac cccaggcttt acactttatg cttccggctc gtatgttgtg tggaattgtg 2040
agcggataac aatttcacac aggaaacagc tatgaccatg attacgccaa gcttgctgcc 2100
tgcaggtcaa catggtggag cacgacactc tcgtctactc caagaatatc aaagatacag 2160
tctcagaaga ccagagggct attgagactt ttcaacaaag ggtaatatcg ggaaacctcc 2220
tcggattcca ttgcccagct atctgtcact tcatcgaaag gacagtagaa aaggaagatg 2280
gcttctacaa atgccatcat tgcgataaag gaaaggctat cgttcaagaa tgcctctacc 2340
gacagtggtc ccaaagatgg acccccaccc acgaggaaca tcgtggaaaa agaagacgtt 2400
ccaaccacgt cttcaaagca agtggattga tgtgatatct ccactgacgt aagggatgac 2460
gcacaatccc actatccttc gcaagaccct tcctctatat aaggaagttc atttcatttg 2520
gagaggacct cgagaattcg agctcggtac ccgcaacaca catctgacct tgttgttgtt 2580
gtgtgcttgt tctttctact atcaccaaga tgtcttcgaa aacctgggat gatgatttcg 2640
ttcgccaggt cccgtctttc caatggatca tagatcaatc cttagaagac gaggtggagg 2700
ctgctagcct tcaggtgcag gagccggcag acggagttgc cattgacgga tctctcgcga 2760
gttttaaatt agctatagcg cccttggaga taggaggggt attcgatccc ccttttgacc 2820
gagtgcgctg gggctctatt tgcgacaccg tccaacaaat ggttcaacag ttcaccgata 2880
gaccgctgat tcctcaagct gaaatggcac ggatgttata tcttgacatt ccgggctctt 2940
tcgtgctcga agatgaaatt gatgactggt atcccgagga tactagtgat ggttacggtg 3000
tatcgtttgc cgccgatgaa gatcatgcga gcgatctaaa actcgccagt gattcctcga 3060
actgtgaaat tgaggaagtt cgtgttactg gagatacccc caaggagctg acccttggag 3120
ataggtacat gggcattgat gaagagtttc agactactaa tactgattac gacatcactc 3180
ttcaaatcat giaccctatt gaacataggg tttcgcgtgt tattgataca cactgccatc 3240
cagataaccc tgacatctct actgggccaa tttatatgga gagagtcagc cttgctagaa 3300
cagaagcgac cagtcattcc atactgccaa cccatgctta tttcgatgat tcgtaccatc 3360
aagcccttgt tgaaaatggt gattattcca tggactttga taggatcaga cttaagcaaa 3420
gtgatgtaga ctggtatagg gaccccgata aatattttca accaaaaatg aatatcggga 3480
gtgctcagcg aagagttggt actcagaaag aagtcttaac cgcactcaaa aagcgaaacg 3540
cggacgttcc agaaatggga gacgcgatta acatgaagga cactgcgaaa gctatagcaa 3600
agcgctttcg tagcacattc cttaatgttg acggtgaaga ctgtctgaga gcttctatgg 3660
atgtcatgac taaatgtctt gagtaccata agaagtgggg taagcacatg gacttgcaag 3720
gtgtgaatgt ggcagcagag actgatttat gtcggtacca gcatatgctg aagtctgacg 3780
taaaacctgt tgtaactgac acccttcact tggaacgagc agtagcagct actataacat 3840
ttcatagtaa aggtgtgact agtaattttt cacccttttt cactgcttgt ttcgagaagt 3900
tatcactggc cctgaaatcc aggttcattg tgcctatcgg aaagatatcc tctctggagc 3960
ttaagaatgt ccgcttgaat aacagatact ttcttgaagc ggacctaagc aaatttgata 4020
aatctcaggg tgagctgcac ctagagtttc agagagagat actccttgcg ctgggctttc 4080
cagcgccgct gacgaattgg tggtctgatt ttcatcgcga ttcttattta tcagaccctc 4140
atgccaaggt gggaatgtcc gtttccttcc aacgcagaac tggtgacgcg tttacatatt 4200
tcggtaatac tcttgtcact atggctatga ttgcatatgc ctctgatcta agtgactgtg 4260
actgtgcaat attttcagga gatgattctt taatcatctc taaagttaag ccagtcctgg 4320
ataccgatat gtttacgtct ctcttcaata tggagataaa agtcatggac cctagtgtgc 4380
cctacgtttg tagtaagttt ctcgtcgaaa ctgaaatggg caatttggtg tctgtaccag 4440
atcctctgag agagatccag cgcttagcta agcgaaagat tctgcgtgat gaacagatgc 4500
tcagagcaca tttcgtttcc ttctgtgatc gaatgaagtt tattaatcaa cttgatgaga 4560
agatgattac gacgctctgt cattttgttt atctgaaata tgggaaagaa aaaccttgga 4620
ttttcgagga ggttagagct gctcttgcgg ctttttcttt atactccgag aatttcctga 4680
ggttctctga ttgctactgt accgaaggca tcagagttta tcagatgagc gatcctgtat 4740
gtaagttcaa acgcaccacg gaagagcgta aaactgatgg tgactggttt cacaactgga 4800
agaatccaaa gtttcctggt gtgttagaca aagtctacag aaccattgga atttattcct 4860
cggactgtag tactaaggag ctccctgtca aacggatcgg acgtttacat gaggcccttg 4920
agcgtgagtc actcaaatta gctaatgatc gtaggaccac acaacgcttg aaaaagaagg 4980
tcgacgatta cgctaccggt agaggaggcc taacgtcagt tgatgctttg ctcgtgaagt 5040
cccattgtga gacttttaag ccctctgatc tgagatgatc ggttctatga tatatgaacc 5100
CA 02329509 2000-11-21
9
taagctgtga acagcccttt ggttaaggtt aaaaactcct ggtcaggcag accactttgg 5160
ctaagtttaa aagctgggga tcctctagag tccgcaaatc accagtctct ctctacaaat 5220
ctatctctct ctattttctc cagaataatg tgtgagtagt tcccagataa gggaattagg 5280
gttcttatag ggtttcgctc atgtgttgag catataagaa acccttagta tgtatttgta 5340
tttgtaaaat acttctatca ataaaatttc taattcctaa aaccaaaatc cagtgacctg 5400
caggcatgca agcttgcatg cctgcaggtc gactctagag gatccccggg tggtcagtcc 5460
cttatgttac gtcctgtaga aaccccaacc cgtgaaatca aaaaactcga cggcctgtgg 5520
gcattcagtc tggatcgcga aaactgtgga attgatcagc gttggtggga aagcgcgtta 5580
caagaaagcc gggcaattgc tgtgccaggc agttttaacg atcagttcgc cgatgcagat 5640
attcgtaatt atgcgggcaa cgtctggtat cagcgcgaag tctttatacc gaaaggttgg 5700
gcaggccagc gt:atcgtgct gcgtttcgat gcggtcactc attacggcaa agtgtgggtc 5760
aataatcagg aagtgatgga gcatcagggc ggctatacgc catttgaagc cgatgtcacg 5820
ccgtatgtta ttgccgggaa aagtgtacaa ttcactggcc gtcgttttac aacgtcgtga 5880
ctgggaaaac cctggcgtta cccaacttaa tcgccttgca gcacatcccc ctttcgccag 5940
ctggcgtaat agcgaagagg cccgcaccga tcgcccttcc caacagttgc gcagcctgaa 6000
tggcgaatgn nnnnnnaatt cagtacatta aaaacgtccg caatgtgtta ttaagttgtc 6060
taagcgtcaa tttgtttaca ccacaatata tcctgccacc agccagccaa cagctccccg 6120
accggcagct cggcacaaaa tcaccactcg atacaggcag cccatcagnn nnnnnnnnnn 6180
nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn 6240
nnnnnnnnnn nrinnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn 6300
nnnnnnnnnn nrinnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn 6360
nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn 6420
nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn 6480
nnnnnnnnnn nnnnnnnnnn 6500
<210> 5
<211> 10100
<212> DNA
<213> Brome mosaic virus
<400> 5
aaacactgat agtttaaact gaaggcggga aacgacaatc tgatcatgag cggagaatta 60
agggagtcac gttatgaccc ccgccgatga cgcgggacaa gccgttttac gtttggaact 120
gacagaaccg caacgattga aggagccact cagccgcggg tttctggagt ttaatgagct 180
aagcacatac gtcagaaacc attattgcgc gttcaaaagt cgcctaaggt cactatcagc 240
tagcaaatat ttcttgtcaa aaatgctcca ctgacgttcc ataaattccc ctcggtatcc 300
aattagnnnn nnnnnnnnnn nnnnnnnnnn gatcgtttcg catgattgaa caagatggat 360
tgcacgcagg ttctccggcc gcttgggtgg agaggctatt cggctatgac tgggcacaac 420
agacaatcgg ctgctctgat gccgccgtgt tccggctgtc agcgcagggg cgcccggttc 480
tttttgtcaa gaccgacctg tccggtgccc tgaatgaact gcaggacgag gcagcgcggc 540
tatcgtggct ggccacgacg ggcgttcctt gcgcagctgt gctcgacgtt gtcactgaag 600
cgggaaggga ctggctgcta ttgggcgaag tgccggggca ggatctcctg tcatctcacc 660
ttgctcctgc cgagaaagta tccatcatgg ctgatgcaat gcggcggctg catacgcttg 720
atccggctac ctgcccattc gaccaccaag cgaaacatcg catcgagcga gcacgtactc 780
ggatggaagc cggtcttgtc gatcaggatg atctggacga agagcatcag gggctcgcgc 840
cagccgaact gttcgccagg ctcaaggcgc gcatgcccga cggcgatgat ctcgtcgtga 900
cccatggcga tgcctgcttg ccgaatatca tggtggaaaa tggccgcttt tctggattca 960
tcgactgtgg ccggctgggt gtggcggacc gctatcagga catagcgttg gctacccgtg 1020
atattgctga agagcttggc ggcgaatggg ctgaccgctt cctcgtgctt tacggtatcg 1080
ccgctcccga ttcgcagcgc atcgccttct atcgccttct tgacgagttc ttctgannnn 1140
nnnnnnnnnn nn:nnnnnnnn gatcgttcaa acatttggca ataaagtttc ttaagattga 1200
atcctgttgc cggtcttgcg atgattatca tataatttct gttgaattac gttaagcatg 1260
taataattaa catgtaatgc atgacgttat ttatgagatg ggtttttatg attagagtcc 1320
cgcaattata catttaatac gcgatagaaa acaaaatata gcgcgcaaac taggataaat 1380
tatcgcgcgc ggtgtcatct atgttactag atcgggcctc ctgtcaatgc tggcggcggc 1440
tctggtggtg gttctggtgg cggctctgag ggtggtggct ctgagggtgg cggttctgag 1500
ggtggcggct ctgagggagg cggttccggt ggtggctctg gttccggtga ttttgattat 1560
gaaaagatgg caaacgctaa taagggggct atgaccgaaa atgccgatga aaacgcgcta 1620
cagtctgacg ctaaaggcaa acttgattct gtcgctactg attacggtgc tgctatcgat 1680
CA 02329509 2000-11-21
ggtttcattg gtgacgtttc cggccttgct aatggtaatg gtgctactgg tgattttgct 1740
ggctctaatt cccaaatggc tcaagtcggt gacggtgata attcaccttt aatgaataat 1800
ttccgtcaat atttaccttc cctccctcaa tcggttgaat gtcgcccttt tgtctttggc 1860
ccaatacgca aaccgcctct ccccgcgcgt tggccgattc attaatgcag ctggcacgac 1920
aggtttcccg actggaaagc gggcagtgag cgcaacgcaa ttaatgtgag ttagctcact 1980
cattaggcac cccaggcttt acactttatg cttccggctc gtatgttgtg tggaattgtg 2040
agcggataac aatttcacac aggaaacagc tatgaccatg attacgccaa gcttgcatgc 2100
ctgcaggtca ctggattttg gttttaggaa ttagaaattt tattgAtaga agtattttac 2160
aaatacaaat acatactaag ggtttcttat atgctcaaca catgagcgaa accctataag 2220
aaccctaatt cccttatctg ggaactactc acacattatt ctggagaaaa tagagagaga 2280
tagatttgta gagagagact ggtgatttgc ggactctaga ggatccccag cttttaaact 2340
tagccaaagt ggtctgcctg accaggagtt tttaacctta accaaagggc tgttcacagc 2400
ttaggttcat atatcataga accgatcatc tcagatcaga gggcttaaaa gtctcacaat 2460
gggacttcac gagcaaagca tcaactgacg ttaggcctcc tctaccggta gcgtaatcgt 2520
cgaccttctt tttcaagcgt tgtgtggtcc tacgatcatt agctaatttg agtgactcac 2580
gctcaagggc ctcatgtaaa cgtccgatcc gtttgacagg gagctcctta gtactacagt 2640
ccgaggaata aattccaatg gttctgtaga ctttgtctaa cacaccagga aactttggat 2700
tcttccagtt gtgaaaccag tcaccatcag ttttacgctc ttccgtggtg cgtttgaact 2760
tacatacagg atcgctcatc tgataaactc tgatgccttc ggtacagtag caatcagaga 2820
acctcaggaa attctcggag tataaagaaa aagccgcaag agcagctcta acctcctcga 2880
aaatccaagg tttttctttc ccatatttca gataaacaaa atgacagagc gtcgtaatca 2940
tcttctcatc aagttgatta ataaacttca ttcgatcaca gaaggaaacg aaatgtgctc 3000
tgagcatctg ttcatcacgc agaatctttc gcttagctaa gcgctggatc tctctcagag 3060
gatctggtac agacaccaaa ttgcccattt cagtttcgac gagaaactta ctacaaacgt 3120
agggcacact agggtccatg acttttatct ccatattgaa gagagacgta aacatatcgg 3180
tatccaggac tggcttaact ttagagatga ttaaagaatc atctcctgaa aatattgcac 3240
agtcacagtc acttagatca gaggcatatg caatcatagc catagtgaca agagtattac 3300
cgaaatatgt aaacgcgtca ccagttctgc gttggaagga aacggacatt cccaccttgg 3360
catgagggtc tgataaataa gaatcgcgat gaaaatcaga ccaccaattc gtcagcggcg 3420
ctggaaagcc cagcgcaagg agtatctctc tctgaaactc taggtgcagc tcaccctgag 3480
atttatcaaa tttgcttagg tccgcttcaa gaaagtatct gttattcaag cggacattct 3540
taagctccag agaggatatc tttccgatag gcacaatgaa cctggatttc agggccagtg 3600
ataacttctc gaaacaagca gtgaaaaagg gtgaaaaatt actagtcaca cctttactat 3660
gaaatgttat agtagctgct actgctcgtt ccaagtgaag ggtgtcagtt acaacaggtt 3720
ttacgtcaga cttcagcata tgctggtacc gacataaatc agtctctgct gccacattca 3780
caccttgcaa gt:ccatgtgc ttaccccact tcttatggta ctcaagacat ttagtcatga 3840
catccataga agctctcaga cagtcttcac cgtcaacatt aaggaatgtg ctacgaaagc 3900
gctttgctat agctttcgca gtgtccttca tgttaatcgc gtctcccatt tctggaacgt 3960
ccgcgtttcg ct:ttttgagt gcggttaaga cttctttctg agtaccaact cttcgctgag 4020
cactcccgat attcattttt ggttgaaaat atttatcggg gtccctatac cagtctacat 4080
cactttgctt aagtctgatc ctatcaaagt ccatggaata atcaccattt tcaacaaggg 4140
cttgatggta cgaatcatcg aaataagcat gggttggcag tatggaatga ctggtcgctt 4200
ctgttctagc aaggctgact ctctccatat aaattggccc agtagagatg tcagggttat 4260
ctggatggca gt.gtgtatca ataacacgcg aaaccctatg ttcaataggg ttcatgattt 4320
gaagagtgat gtcgtaatca gtattagtag tctgaaactc ttcatcaatg cccatgtacc 4380
tatctccaag ggtcagctcc ttgggggtat ctccagtaac acgaacttcc tcaatttcac 4440
agttcgagga atcactggcg agttttagat cgctcgcatg atcttcatcg gcggcaaacg 4500
atacaccgta accatcacta gtatcctcgg gataccagtc atcaatttca tcttcgagca 4560
cgaaagagcc cggaatgtca agatataaca tccgtgccat ttcagcttga ggaatcagcg 4620
gtctatcggt ga.actgttga accatttgtt ggacggtgtc gcaaatagag ccccagcgca 4680
ctcggtcaaa agggggatcg aatacccctc ctatctccaa gggcgctata gctaatttaa 4740
aactcgcgag agatccgtca atggcaactc cgtctgccgg ctcctgcacc tgaaggctag 4800
cagcctccac ctcgtcttct aaggattgat ctatgatcca ttggaaagac gggacctggc 4860
gaacgaaatc atcatcc.cag gttttcgaag acatcttggt gatagtagaa agaacaagca 4920
cacaacaaca acaaggtcag atgtgtgttg cgggtaccga gctcgaattc tcgaggtcct 4980
ctccaaatga aatgaacttc cttatataga ggaagggtct tgcgaaggat agtgggattg 5040
tgcgtcatcc cttacgtcag tggagatatc acatcaatcc acttgctttg aagacgtggt 5100
tggaacgtct tctttttcca cgatgttcct cgtgggtggg ggtccatctt tgggaccact 5160
gtcggtagag gcattcttga acgatagcct ttcctttatc gcaatgatgg catttgtaga 5220
CA 02329509 2000-11-21
11
agccatcttc cttttctact gtcctttcga tgaagtgaca gatagctggg caatggaatc 5280
cgaggaggtt tcccgatatt accctttgtt gaaaagtctc aatagccctc tggtcttctg 5340
agactgtatc tttgatattc ttggagtaga cgagagtgtc gtgctccacc atgttgacct 5400
gcaggcagca agcttgcatg cctgcaggtc gactctagag gatccccggt caacatggtg 5460
gagcacgaca ctctcgtcta ctccaagaat atcaaagata cagtctcaga agaccagagg 5520
gctattgaga cttttcaaca aagggtaata tcgggaaacc tcctcggatt ccattgccca 5580
gctatctgtc acttcatcga aaggacagta gaaaaggaag atggcttcta caaatgccat 5640
cattgcgata aaggaaaggc tatcgttcaa gaatgcctct accgacagtg gtcccaaaga 5700
tggaccccca cccacgagga acatcgtgga aaaagaagac gttccaacca cgtcttcaaa 5760
gcaagtggat tgatgtgata tctccactga cgtaagggat gacgcacaat cccactatcc 5820
ttcgcaagac ccttcctcta tataaggaag ttcatttcat ttggagagga cctcgaccac 5880
ggttctgcta cttgttcttt gtttttcacc aacaaaatgt caagttctat cgatttgctg 5940
aagttgattg ctgagaaggg tgctgacagc cagagtgccc aagacatcgt agacaatcag 6000
gttgcgcaac agttatctgc gcagattgaa tacgcgaaaa ggtctaagaa aatcaacgtt 6060
cgcaataagc tctctat=tga ggaggctgac gccttccgtg accgttatgg tggtgccttt 6120
gacttaaatt tgactcagca gtatcatgcg ccccatagcc tggctggtgc tctgcgtgta 6180
gcggagcatt atgactgtct cgacagtttt ccccctgaag accccgttat agatttcgga 6240
gggtcttggt ggcatcactt ttcaagaagg gataaaaggg tgcacagttg ttgtcctgtg 6300
ttgggtgtta gagacgctgc ccgacatgag gagaggatgt gccgcatgcg aaaaattttg 6360
caagaaagcg atgatttcga tgaagtcccg aacttttgtc ttaaccgagc tcaagattgt 6420
gatgtccaag ctgattgggc tatctgtatc cacggcggtt atgatatggg cttccaaggt 6480
ctgtgtgacg ccatgcattc gcatggagta cgcgtactac gtggtaccgt tatgttcgac 6540
ggcgccatgt tgtttgaccg cgagggtttt cttcccttgc ttaaatgtca ctggcaacgt 6600
gacgggtcag gcgcggatga ggtgatcaaa ttcgattttg aaaatgaaag cacattatct 6660
tacatccacg gatggcaaga tttgggctca tttttcaccg agtcggtgca ttgcatcgat 6720
ggaaccacct atctgttgga gcgcgaaatg ctgaaatgta acatcatgac ctataagatc 6780
atcgctacaa atttacgctg cccccgggag acactacgtc actgtgtatg gtttgaagac 6840
atatctaagt acgtaggggt ctcaatacct gaagactgga gtctcaatcg ctggaaatgt 6900
gtgcgcgtcg ccaaaaccac agtgagagag gtagaggaga tagctttcag atgtttcaag 6960
gaaagtaaag aatggactga gaacatgaaa gctgtcgcat ctatcttatc cgccaagtcg 7020
tcgactgtta ttattaacgg tcaggctatc atggctggtg agcgcttaga cattgaagat 7080
tatcatctag tggcctttgc tttgactttg aatctgtatc aaaagtacga aaagcttacg 7140
gccctccgcg atgggatgga atggaaaggt tggtgccatc acttcaaaac taggttttgg 7200
tggggtggag attcatccag ggcgaaagta ggatggctga gaacattggc tagcagattt 7260
cccctactac gtctggattc ttatgcggac agttttaagt ttctgactcg tctctcaaac 7320
gttgaagaat ttgagcaaga ttctgtaccg atatcacgtt tgagaacgtt ttggactgaa 7380
gaggacttat tcgaccggct ggagcatgaa gtgcagacag ccaagaccaa gcgctcgaag 7440
aagaaggcga aagtcccgcc agctgctgag atacctcagg aggagtttca tgatgcccct 7500
gagagttcga gccctgagtc cgtcagtgat gacgttaaac cggtgactga tgtggtcccg 7560
gatgccgagg tgtctgttga ggtaccaacg gaccctcgtg gcatatctag acacggagcc 7620
atgaaggaat ttgtgcgtta ttgtaagaga ttacataaca actccgagtc taatcttcgt 7680
cacctatggg acatttccgg cggtcgcgga agtgagatcg caaataagag catctttgag 7740
acctaccatc gc;atagacga tatggtgaat gtccatttgg ccaacggtaa ctggttgtat 7800
cctaaaaaat acgattacac tgttggatat aatgagcatg gtttaggtcc gaagcacgca 7860
gatgaaacgt acattgttga taaaacatgt gcatgctcta acttgaggga cattgcagaa 7920
gctagcgcca aagtttctgt ccctacatgc gatatttcca tggttgatgg agttgcggga 7980
tgcggtaaaa ccactgccat aaaagatgca ttccgtatgg gagaggacct aattgtgacg 8040
gcgaatcgta aatcggccga ggacgtcagg atggctttat tccctgacac ttataattcc 8100
aaggtagctt tggacgttgt gcgcaccgcg gattctgcga tcatgcacgg tgtaccgtcc 8160
tgtcataggc tgcttgttga tgaggctggt ttactacatt atggtcaact cctggtggtg 8220
gctgctctgt ct:aaatgttc acaagttctt gcctttgggg acacagagca gatttcgttc 8280
aagtctcgtg acgcgggttt taaattgctc cacggtaatc tgcaatatga tcgccgtgac 8340
gttgttcaca agacttaccg gtgtccgcaa gatgttatcg ctgctgttaa tctgctgaag 8400
cgtaaatgcg gtaataggga cacgaagtat caatcctgga catctgagtc caaagtttct 8460
agaagtctca cgaagcgtcg tattacttct ggtttgcagg tcactattga tccgaacaga 8520
acgtatctta cgatgactca agctgataaa gcggcccttc aaacgagggc taaggatttt 8580
cccgtgagca aggactggat tgatggacac ataaaaacag tacacgaagc gcaagggatc 8640
tctgttgaca acgtcacttt ggttcggctt aagtcgacca aatgtgattt gtttaaacat 8700
gaggagtact gtttggttgc cttaacacga cacaagaagt cctttgagta ttgctttaac 8760
CA 02329509 2000-11-21
12
ggcgagctcg ctggtgattt gatctttaat tgtgttaagt gatgcgcttg tctctgtgtg 8820
agacctctgc tcgagaattc gagctcggta cccggggatc ctctagagtc cgcaaatcac 8880
cagtctctct ctacaaatct atctctctct attttctcca gaataatgtg tgagtagttc 8940
ccagataagg gaattagggt tcttataggg tttcgctcat gtgttgagca tataagaaac 9000
ccttagtatg tatttgtatt tgtaaaatac ttctatcaat aaaatttcta attcctaaaa 9060
ccaaaatcca gtgaccgggt ggtcagtccc ttatgttacg tcctgtagaa accccaaccc 9120
gtgaaatcaa aaaactcgac ggcctgtggg cattcagtct ggatcgcgaa aactgtggaa 9180
ttgatcagcg ttggtgggaa agcgcgttac aagaaagccg ggcaattgct gtgccaggca 9240
gttttaacga tcagttcgcc gatgcagata ttcgtaatta tgcgggcaac gtctggtatc 9300
agcgcgaagt ctttataccg aaaggttggg caggccagcg tatcgtgctg cgtttcgatg 9360
cggtcactca ttacggcaaa gtgtgggtca ataatcagga agtgatggag catcagggcg 9420
gctatacgcc atttgaagcc gatgtcacgc cgtatgttat tgccgggaaa agtgtacaat 9480
tcactggccg tcgttttaca acgtcgtgac tgggaaaacc ctggcgttac ccaacttaat 9540
cgccttgcag cacatccccc tttcgccagc tggcgtaata gcgaagaggc ccgcaccgat 9600
cgcccttccc aacagttgcg cagcctgaat ggcgaatgnn nnnnnaattc agtacattaa 9660
aaacgtccgc aatgtgttat taagttgtct aagcgtcaat ttgtttacac cacaatatat 9720
cctgccacca gccagccaac agctccccga ccggcagctc ggcacaaaat caccactcga 9780
tacaggcagc ccatcagnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn 9840
nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn 9900
nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn 9960
nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn 10020
nnnnnnnnnn nnnnrmnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn 10080
nnnnnnnnnn nnnnnnnnnn 10100
<210> 6
<211> 10240
<212> DNA
<213> Brome mosaic virus
<400> 6
aaacactgat agtttaaact gaaggcggga aacgacaatc tgatcatgag cggagaatta 60
agggagtcac gttatgaccc ccgccgatga cgcgggacaa gccgttttac gtttggaact 120
gacagaaccg caacgattga aggagccact cagccgcggg tttctggagt ttaatgagct 180
aagcacatac gtcagaaacc attattgcgc gttcaaaagt cgcctaaggt cactatcagc 240
tagcaaatat ttcttgtcaa aaatgctcca ctgacgttcc ataaattccc ctcggtatcc 300
aattagnnnn nnnnnnnnnn nnnnnnnnnn gatcgtttcg catgattgaa caagatggat 360
tgcacgcagg ttctccggcc gcttgggtgg agaggctatt cggctatgac tgggcacaac 420
agacaatcgg ctgctctgat gccgccgtgt tccggctgtc agcgcagggg cgcccggttc 480
tttttgtcaa gaccgacctg tccggtgccc tgaatgaact gcaggacgag gcagcgcggc 540
tatcgtggct ggccacgacg ggcgttcctt gcgcagctgt gctcgacgtt gtcactgaag 600
cgggaaggga ctggctgcta tt.gggcgaag tgccggggca ggatctcctg tcatctcacc 660
ttgctcctgc cgagaaagta tccatcatgg ctgatgcaat gcggcggctg catacgcttg 720
atccggctac ct:gcccattc gaccaccaag cgaaacatcg catcgagcga gcacgtactc 780
ggatggaagc cggtcttgtc gatcaggatg atctggacga agagcatcag gggctcgcgc 840
cagccgaact gt:tcgccagg ctcaaggcgc gcatgcccga cggcgatgat ctcgtcgtga 900
cccatggcga tgcctgcttg ccgaatatca tggtggaaaa tggccgcttt tctggattca 960
tcgactgtgg ccggctgggt gtggcggacc gctatcagga catagcgttg gctacccgtg 1020
atattgctga agagcttggc ggcgaatggg ctgaccgctt cctcgtgctt tacggtatcg 1080
ccgctcccga ttcgcagcgc atcgccttct atcgccttct tgacgagttc ttctgannnn 1140
nnnnnnnnnn nrinnnnnnnn gatcgttcaa acatttggca ataaagtttc ttaagattga 1200
atcctgttgc cggtcttgcg atgattatca tataatttct gttgaattac gttaagcatg 1260
taataattaa catgtaatgc atgacgttat ttatgagatg ggtttttatg attagagtcc 1320
cgcaattata catttaatac gcgatagaaa acaaaatata gcgcgcaaac taggataaat 1380
tatcgcgcgc ggtgtcatct atgttactag atcgggcctc ctgtcaatgc tggcggcggc 1440
tctggtggtg gttctggtgg cggctctgag ggtggtggct ctgagggtgg cggttctgag 1500
ggtggcggct ctgagggagg cggttccggt ggtggctctg gttccggtga ttttgattat 1560
gaaaagatgg caaacgctaa taagggggct atgaccgaaa atgccgatga aaacgcgcta 1620
cagtctgacg ctaaaggcaa acttgattct gtcgctactg attacggtgc tgctatcgat 1680
ggtttcattg gtgacgtttc cggccttgct aatggtaatg gtgctactgg tgattttgct 1740
CA 02329509 2000-11-21
13
ggctctaatt cccaaatggc tcaagtcggt gacggtgata attcaccttt aatgaataat 1800
ttccgtcaat atttaccttc cctccctcaa tcggttgaat gtcgcccttt tgtctttggc 1860
ccaatacgca aaccgcctct ccccgcgcgt tggccgattc attaatgcag ctggcacgac 1920
aggtttcccg actggaaagc gggcagtgag cgcaacgcaa ttaatgtgag ttagctcact 1980
cattaggcac cccaggcttt acactttatg cttccggctc gtatgttgtg tggaattgtg 2040
agcggataac aatttcacac aggaaacagc tatgaccatg attacgccaa gcttgcatgc 2100
ctgcaggtca ctggattttg gttttaggaa ttagaaattt tattgataga agtattttac 2160
aaatacaaat acatactaag ggtttcttat atgctcaaca catgagcgaa accctataag 2220
aaccctaatt cccttatctg ggaactactc acacattatt ctggagaaaa tagagagaga 2280
tagatttgta gagagagact ggtgatttgc ggactctaga ggatccccag cttttaaact 2340
tagccaaagt ggtctgcctg accaggagtt tttaacctta accaaagggc tgttcacagc 2400
ttaggttcat atatcataga accgatcatc tcagatcaga gggcttaaaa gtctcacaat 2460
gggacttcac gagcaaagca tcaactgacg ttaggcctcc tctaccggta gcgtaatcgt 2520
cgaccttctt tttcaagcgt tgtgtggtcc tacgatcatt agctaatttg agtgactcac 2580
gctcaagggc ctcatgtaaa cgtccgatcc gtttgacagg gagctcctta gtactacagt 2640
ccgaggaata aattccaatg gttctgtaga ctttgtctaa cacaccagga aactttggat 2700
tcttccagtt gtgaaaccag tcaccatcag ttttacgctc ttccgtggtg cgtttgaact 2760
tacatacagg atcgctcatc tgataaactc tgatgccttc ggtacagtag caatcagaga 2820
acctcaggaa attctcggag tataaagaaa aagccgcaag agcagctcta acctcctcga 2880
aaatccaagg tttttctttc ccatatttca gataaacaaa atgacagagc gtcgtaatca 2940
tcttctcatc aagttgatta ataaacttca ttcgatcaca gaaggaaacg aaatgtgctc 3000
tgagcatctg ttcatcacgc agaatctttc gcttagctaa gcgctggatc tctctcagag 3060
gatctggtac agacaccaaa ttgcccattt cagtttcgac gagaaactta ctacaaacgt 3120
agggcacact agggtccatg acttttatct ccatattgaa gagagacgta aacatatcgg 3180
tatccaggac tggcttaact ttagagatga ttaaagaatc atctcctgaa aatattgcac 3240
agtcacagtc acttagatca gaggcatatg caatcatagc catagtgaca agagtattac 3300
cgaaatatgt aaacgcgtca ccagttctgc gttggaagga aacggacatt cccaccttgg 3360
catgagggtc tgataaataa gaatcgcgat gaaaatcaga ccaccaattc gtcagcggcg 3420
ctggaaagcc cagcgcaagg agtatctctc tctgaaactc taggtgcagc tcaccctgag 3480
atttatcaaa tttgcttagg tccgcttcaa gaaagtatct gttattcaag cggacattct 3540
taagctccag agaggatatc tttccgatag gcacaatgaa cctggatttc agggccagtg 3600
ataacttctc gaaacaagca gtgaaaaagg gtgaaaaatt actagtcaca cctttactat 3660
gaaatgttat agtagctgct actgctcgtt ccaagtgaag ggtgtcagtt acaacaggtt 3720
ttacgtcaga cttcagcata tgctggtacc gacataaatc agtctctgct gccacattca 3780
caccttgcaa gtccatgtgc ttaccccact tcttatggta ctcaagacat ttagtcatga 3840
catccataga agctctcaga cagtcttcac cgtcaacatt aaggaatgtg ctacgaaagc 3900
gctttgctat agctttcgca gtgtccttca tgttaatcgc gtctcccatt tctggaacgt 3960
ccgcgtttcg ct.ttttgagt gcggttaaga cttctttctg agtaccaact cttcgctgag 4020
cactcccgat attcattttt ggttgaaaat atttatcggg gtccctatac cagtctacat 4080
cactttgctt aagtctgatc ctatcaaagt ccatggaata atcaccattt tcaacaaggg 4140
cttgatggta cgaatcatcg aaataagcat gggttggcag tatggaatga ctggtcgctt 4200
ctgttctagc aaggctgact ctctccatat aaattggccc agtagagatg tcagggttat 4260
ctggatggca gtgtgtatca ataacacgcg aaaccctatg ttcaataggg ttcatgattt 4320
gaagagtgat gtcgtaatca gtattagtag tctgaaactc ttcatcaatg cccatgtacc 4380
tatctccaag ggtcagctcc ttgggggtat ctccagtaac acgaacttcc tcaatttcac 4440
agttcgagga atcactggcg agttttagat cgctcgcatg atcttcatcg gcggcaaacg 4500
atacaccgta accatcacta gtatcctcgg gataccagtc atcaatttca tcttcgagca 4560
cgaaagagcc cggaatgtca agatataaca tccgtgccat ttcagcttga ggaatcagcg 4620
gtctatcggt gaactgttga accatttgtt ggacggtgtc gcaaatagag ccccagcgca 4680
ctcggtcaaa agggggatcg aatacccctc ctatctccaa gggcgctata gctaatttaa 4740
aactcgcgag agatccgtca atggcaactc cgtctgccgg ctcctgcacc tgaaggctag 4800
cagcctccac ctcgtcttct aaggattgat ctatgatcca ttggaaagac gggacctggc 4860
gaacgaaatc atcatcccag gttttcgaag acatcttggt gatagtagaa agaacaagca 4920
cacaacaaca acaaggtcag atgtgtgttg cgggtaccga gctcgaattc tcgaggtcct 4980
ctccaaatga aatgaac.ttc cttatataga ggaagggtct tgcgaaggat agtgggattg 5040
tgcgtcatcc cttacgtcag tggagatatc acatcaatcc acttgctttg aagacgtggt 5100
tggaacgtct tctttttcca cgatgttcct cgtgggtggg ggtccatctt tgggaccact 5160
gtcggtagag gcattcttga acgatagcct ttcctttatc gcaatgatgg catttgtaga 5220
agccatcttc cttttctact gtcctttcga tgaagtgaca gatagctggg caatggaatc 5280
CA 02329509 2000-11-21
14
cgaggaggtt tcccgatatt accctttgtt gaaaagtctc aatagccctc tggtcttctg 5340
agactgtatc tttgatattc ttggagtaga cgagagtgtc gtgctccacc atgttgacct 5400
gcaggcagca agcttgcatg cctgcaggtc gactctagag gatccccggt cactggattt 5460
tggttttagg aattagaaat tttattgata gaagtatttt acaaatacaa atacatacta 5520
agggtttctt atatgctcaa cacatgagcg aaaccctata agaaccctaa ttcccttatc 5580
tgggaactac t:cacacatta ttctggagaa aatagagaga gatagatttg tagagagaga 5640
ctggtgattt gcggactcta gaggatcccc gggtaccgag ctcgaattct cgagcagagg 5700
tctcacacag agacaagcgc atcacttaac acaattaaag atcaaatcac cagcgagctc 5760
gccgttaaag caatactcaa aggacttctt gtgtcgtgtt aaggcaacca aacagtactc 5820
ctcatgttta aacaaatcac atttggtcga cttaagccga accaaagtga cgttgtcaac 5880
agagatccct tgcgcttcgt gtactgtttt tatgtgtcca tcaatccagt ccttgctcac 5940
gggaaaatcc t.tagccctcg tttgaagggc cgctttatca gcttgagtca tcgtaagata 6000
cgttctgttc ggatcaatag tgacctgcaa accagaagta atacgacgct tcgtgagact 6060
tctagaaact ttggactcag atgtccagga ttgatacttc gtgtccctat taccgcattt 6120
acgcttcagc agattaacag cagcgataac atcttgcgga caccggtaag tcttgtgaac 6180
aacgtcacgg cgatcatatt gcagattacc gtggagcaat ttaaaacccg cgtcacgaga 6240
cttgaacgaa atctgctctg tgtccccaaa ggcaagaact tgtgaacatt tagacagagc 6300
agccaccacc aggagttgac cataatgtag taaaccagcc tcatcaacaa gcagcctatg 6360
acaggacggt acaccgtgca tgatcgcaga atccgcggtg cgcacaacgt ccaaagctac 6420
cttggaatta taagtgtcag ggaataaagc catcctgacg tcctcggccg atttacgatt 6480
cgccgtcaca attaggtcct ctcccatacg gaatgcatct tttatggcag tggttttacc 6540
gcatcccgca actccatcaa ccatggaaat atcgcatgta gggacagaaa ctttggcgct 6600
agcttctgca atgtccctca agttagagca tgcacatgtt ttatcaacaa tgtacgtttc 6660
atctgcgtgc ttcggaccta aaccatgctc attatatcca acagtgtaat cgtatttttt 6720
aggatacaac cagttaccgt tggccaaatg gacattcacc atatcgtcta tgcgatggta 6780
ggtctcaaag atgctcttat ttgcgatctc acttccgcga ccgccggaaa tgtcccatag 6840
gtgacgaaga ttagactcgg agttgttatg taatctctta caataacgca caaattcctt 6900
catggctccg tgtctagata tgccacgagg gtccgttggt acctcaacag acacctcggc 6960
atccgggacc acatcagtca ccggtttaac gtcatcactg acggactcag ggctcgaact 7020
ctcaggggca tcatgaaact cctcctgagg tatctcagca gctggcggga ctttcgcctt 7080
cttcttcgag cgcttggtct tggctgtctg cacttcatgc tccagccggt cgaataagtc 7140
ctcttcagtc caaaacgttc tcaaacgtga tatcggtaca gaatcttgct caaattcttc 7200
aacgtttgag agacgagtca gaaacttaaa actgtccgca taagaatcca gacgtagtag 7260
gggaaatctg ctagccaatg ttctcagcca tcctactttc gccctggatg aatctccacc 7320
ccaccaaaac ctagttttga agtgatggca ccaacctttc cattccatcc catcgcggag 7380
ggccgtaagc ttttcgtact tttgatacag attcaaagtc aaagcaaagg ccactagatg 7440
ataatcttca atgtctaagc gctcaccagc catgatagcc tgaccgttaa taataacagt 7500
cgacgacttg gcggataaga tagatgcgac agctttcatg ttctcagtcc attctttact 7560
ttccttgaaa catctgaaag ctatctcctc tacctctctc actgtggttt tggcgacgcg 7620
cacacatttc cagcgattga gactccagtc ttcaggtatt gagaccccta cgtacttaga 7680
tatgtcttca aaccatacac agtgacgtag tgtctcccgg gggcagcgta aatttgtagc 7740
gatgatctta taggtcatga tgttacattt cagcatttcg cgctccaaca gataggtggt 7800
tccatcgatg caatgcaccg actcggtgaa aaatgagccc aaatcttgcc atccgtggat 7860
gtaagataat gtgctttcat tttcaaaatc gaatttgatc acctcatccg cgcctgaccc 7920
gtcacgttgc cagtgacatt taagcaaggg aagaaaaccc tcgcggtcaa acaacatggc 7980
gccgtcgaac ataacggtac cacgtagtac gcgtactcca tgcgaatgca tggcgtcaca 8040
cagaccttgg aagcccatat cataaccgcc gtggatacag atagcccaat cagcttggac 8100
atcacaatct tgagctcggt taagacaaaa gttcgggact tcatcgaaat catcgctttc 8160
ttgcaaaatt tttcgcatgc ggcacatcct ctcctcatgt cgggcagcgt ctctaacacc 8220
caacacagga caacaactgt gcaccctttt atcccttctt gaaaagtgat gccaccaaga 8280
ccctccgaaa tctataacgg ggtcttcagg gggaaaactg tcgagacagt cataatgctc 8340
cgctacacgc agagcaccag ccaggctatg gggcgcatga tactgctgag tcaaatttaa 8400
gtcaaaggca ccaccataac ggtcacggaa ggcgtcagcc tcctcaatag agagcttatt 8460
gcgaacgttg attttcttag accttttcgc gtattcaatc tgcgcagata actgttgcgc 8520
aacctgattg tctacgatgt cttgggcact ctggctgtca gcacccttct cagcaatcaa 8580
cttcagcaaa tcgatagaac ttgacatttt gttggtgaaa aacaaagaac aagtagcaga 8640
accgtggtcg aggtcctctc caaatgaaat gaacttcctt atatagagga agggtcttgc 8700
gaaggatagt gggattgtgc gtcatccctt acgtcagtgg agatatcaca tcaatccact 8760
tgctttgaag acgtggttgg aacgtcttct ttttccacga tgttcctcgt ggg=tgggggt 8820
CA 02329509 2000-11-21
ccatctttgg gaccactgtc ggtagaggca ttcttgaacg atagcctttc ctttatcgca 8880
atgatggcat ttgtagaagc catcttcctt ttctactgtc ctttcgatga agtgacagat 8940
agctgggcaa tggaatccga ggaggtttcc cgatattacc ctttgttgaa aagtctcaat 9000
agccctctgg tcttctgaga ctgtatcttt gatattcttg gagtagacga gagtgtcgtg 9060
ctccaccatg ttgaccgggt ggtcagtccc ttatgttacg tcctgtagaa accccaaccc 9120
gtgaaatcaa aaaactcgac ggcctgtggg cattcagtct ggatcgcgaa aactgtggaa 9180
ttgatcagcg ttggtgggaa agcgcgttac aagaaagccg ggcaattgct gtgccaggca 9240
gttttaacga tcagttcgcc gatgcagata ttcgtaatta tgcgggcaac gtctggtatc 9300
agcgcgaagt ctttataccg aaaggttggg caggccagcg tatcgtgctg cgtttcgatg 9360
cggtcactca ttacggcaaa gtgtgggtca ataatcagga agtgatggag catcagggcg 9420
gctatacgcc atttgaagcc gatgtcacgc cgtatgttat tgccgggaaa agtgtacaat 9480
tcactggccg tcgttttaca acgtcgtgac tgggaaaacc ctggcgttac ccaacttaat 9540
cgccttgcag cacatccccc tttcgccagc tggcgtaata gcgaagaggc ccgcaccgat 9600
cgcccttccc aacagttgcg cagcctgaat ggcgaatgnn nnnnnaattc agtacattaa 9660
aaacgtccgc aatgtgttat taagttgtct aagcgtcaat ttgtttacac cacaatatat 9720
cctgccacca gccagccaac agctccccga ccggcagctc ggcacaaaat caccactcga 9780
tacaggcagc ccatcagnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn 9840
nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn 9900
nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn 9960
nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn 10020
nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn 10080
nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn 10140
nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn 10200
nnnnnnnnnn nnnnnnn,nnn nnnnnnnnnn nnnnnnnnnn 10240
<210> 7
<211> 10272
<212> DNA
<213> Brome mosaic virus
<400> 7
aaacactgat agtttaaact gaaggcggga aacgacaatc tgatcatgag cggagaatta 60
agggagtcac gttatgaccc ccgccgatga cgcgggacaa gccgttttac gtttggaact 120
gacagaaccg caacgattga aggagccact cagccgcggg tttctggagt ttaatgagct 180
aagcacatac gtcagaaacc attattgcgc gttcaaaagt cgcctaaggt cactatcagc 240
tagcaaatat ttcttgtcaa aaatgctcca ctgacgttcc ataaattccc ctcggtatcc 300
aattagnnnn nnnnnnnnnn nnnnnnnnnn gatcgtttcg catgattgaa caagatggat 360
tgcacgcagg ttctccggcc gcttgggtgg agaggctatt cggctatgac tgggcacaac 420
agacaatcgg ctgctctgat gccgccgtgt tccggctgtc agcgcagggg cgcccggttc 480
tttttgtcaa gaccgacctg tccggtgccc tgaatgaact gcaggacgag gcagcgcggc 540
tatcgtggct ggccacgacg ggcgttcctt gcgcagctgt gctcgacgtt gtcactgaag 600
cgggaaggga ctggctgcta ttgggcgaag tgccggggca ggatctcctg tcatctcacc 660
ttgctcctgc cgagaaagta tccatcatgg ctgatgcaat gcggcggctg catacgcttg 720
atccggctac ctgcccattc gaccaccaag cgaaacatcg catcgagcga gcacgtactc 780
ggatggaagc cggtcttgtc gatcaggatg atctggacga agagcatcag gggctcgcgc 840
cagccgaact gttcgccagg ctcaaggcgc gcatgcccga cggcgatgat ctcgtcgtga 900
cccatggcga tgcctgcttg ccgaatatca tggtggaaaa tggccgcttt tctggattca 960
tcgactgtgg ccggctgggt gtggcggacc gctatcagga catagcgttg gctacccgtg 1020
atattgctga agagcttggc ggcgaatggg ctgaccgctt cctcgtgctt tacggtatcg 1080
ccgctcccga ttcgcagcgc atcgccttct atcgccttct tgacgagttc ttctgannnn 1140
nnnnnnnnnn nnnnnnnnnn gatcgttcaa acatttggca ataaagtttc ttaagattga 1200
atcctgttgc cggtcttgcg atgattatca tataatttct gttgaattac gttaagcatg 1260
taataattaa catgtaatgc atgacgttat ttatgagatg ggtttttatg attagagtcc 1320
cgcaattata catttaatac gcgatagaaa acaaaatata gcgcgcaaac taggataaat 1380
tatcgcgcgc ggtgtcatct atgttactag atcgggcctc ctgtcaatgc tggcggcggc 1440
tctggtggtg gttctggtgg cggctctgag ggtggtggct ctgagggtgg cggttctgag 1500
ggtggcggct ctgagggagg cggttccggt ggtggctctg gttccggtga ttttgattat 1560
gaaaagatgg caaacgctaa taagggggct atgaccgaaa atgccgatga aaacgcgcta 1620
cagtctgacg ctaaaggcaa acttgattct gtcgctactg attacggtgc tgctatcgat 1680
CA 02329509 2000-11-21
16
ggtttcattg gtgacgtttc cggccttgct aatggtaatg gtgctactgg tgattttgct 1740
ggctctaatt cccaaatggc tcaagtcggt gacggtgata attcaccttt aatgaataat 1800
ttccgtcaat atttaccttc cctccctcaa tcggttgaat gtcgcccttt tgtctttggc 1860
ccaatacgca aaccgcctct ccccgcgcgt tggccgattc attaatgcag ctggcacgac 1920
aggtttcccg actggaaagc gggcagtgag cgcaacgcaa ttaatgtgag ttagctcact 1980
cattaggcac cccaggcttt acactttatg cttccggctc gtatgttgtg tggaattgtg 2040
agcggataac aatttcacac aggaaacagc tatgaccatg attacgccaa gcttgctgcc 2100
tgcaggtcaa catggtggag cacgacactc tcgtctactc caagaatatc aaagatacag 2160
tctcagaaga ccagagggct attgagactt ttcaacaaag ggtaatatcg ggaaacctcc 2220
tcggattcca ttgcccagct atctgtcact tcatcgaaag gacagtagaa aaggaagatg 2280
gcttctacaa atgccatcat tgcgataaag gaaaggctat cgttcaagaa tgcctctacc 2340
gacagtggtc ccaaagatgg acccccaccc acgaggaaca tcgtggaaaa agaagacgtt 2400
ccaaccacgt cttcaaagca agtggattga tgtgatatct ccactgacgt aagggatgac 2460
gcacaatccc actatccttc gcaagaccct tcctctatat aaggaagttc atttcatttg 2520
gagaggacct cgagaattcg agctcggtac ccgcaacaca catctgacct tgttgttgtt 2580
gtgtgcttgt tctttctact atcaccaaga tgtcttcgaa aacctgggat gatgatttcg 2640
ttcgccaggt cccgtctttc caatggatca tagatcaatc cttagaagac gaggtggagg 2700
ctgctagcct tc;aggtgcag gagccggcag acggagttgc cattgacgga tctctcgcga 2760
gttttaaatt agctatagcg cccttggaga taggaggggt attcgatccc ccttttgacc 2820
gagtgcgctg gggctctatt tgcgacaccg tccaacaaat ggttcaacag ttcaccgata 2880
gaccgctgat tcctcaagct gaaatggcac ggatgttata tcttgacatt ccgggctctt 2940
tcgtgctcga agatgaaatt gatgactggt atcccgagga tactagtgat ggttacggtg 3000
tatcgtttgc cgccgatgaa gatcatgcga gcgatctaaa actcgccagt gattcctcga 3060
actgtgaaat tgaggaagtt cgtgttactg gagatacccc caaggagctg acccttggag 3120
ataggtacat gggcattgat gaagagtttc agactactaa tactgattac gacatcactc 3180
ttcaaatcat gaaccctatt gaacataggg tttcgcgtgt tattgataca cactgccatc 3240
cagataaccc tgacatctct actgggccaa tttatatgga gagagtcagc cttgctagaa 3300
cagaagcgac cagtcattcc atactgccaa cccatgctta tttcgatgat tcgtaccatc 3360
aagcccttgt tgaaaatggt gattattcca tggactttga taggatcaga cttaagcaaa 3420
gtgatgtaga ct.ggtatagg gaccccgata aatattttca accaaaaatg aatatcggga 3480
gtgctcagcg aagagttggt actcagaaag aagtcttaac cgcactcaaa aagcgaaacg 3540
cggacgttcc agaaatggga gacgcgatta acatgaagga cactgcgaaa gctatagcaa 3600
agcgctttcg tagcacattc cttaatgttg acggtgaaga ctgtctgaga gcttctatgg 3660
atgtcatgac taaatgtctt gagtaccata agaagtgggg taagcacatg gacttgcaag 3720
gtgtgaatgt ggcagcagag actgatttat gtcggtacca gcatatgctg aagtctgacg 3780
taaaacctgt tgtaactgac acccttcact tggaacgagc agtagcagct actataacat 3840
ttcatagtaa aggtgtgact agtaattttt cacccttttt cactgcttgt ttcgagaagt 3900
tatcactggc cctgaaatcc aggttcattg tgcctatcgg aaagatatcc tctctggagc 3960
ttaagaatgt ccgcttgaat aacagatact ttcttgaagc ggacctaagc aaatttgata 4020
aatctcaggg tgagctgcac ctagagtttc agagagagat actccttgcg ctgggctttc 4080
cagcgccgct gacgaattgg tggtctgatt ttcatcgcga ttcttattta tcagaccctc 4140
atgccaaggt gggaatgtcc gtttccttcc aacgcagaac tggtgacgcg tttacatatt 4200
tcggtaatac tcttgtcact atggctatga ttgcatatgc ctctgatcta agtgactgtg 4260
actgtgcaat attttcagga gatgattctt taatcatctc taaagttaag ccagtcctgg 4320
ataccgatat gtttacgtct ctcttcaata tggagataaa agtcatggac cctagtgtgc 4380
cctacgtttg tagtaagttt ctcgtcgaaa ctgaaatggg caatttggtg tctgtaccag 4440
atcctctgag agagatccag cgcttagcta agcgaaagat tctgcgtgat gaacagatgc 4500
tcagagcaca tttcgtttcc ttctgtgatc gaatgaagtt tattaatcaa cttgatgaga 4560
agatgattac gacgctctgt cattttgttt atctgaaata tgggaaagaa aaaccttgga 4620
ttttcgagga ggttagagct gctcttgcgg ctttttcttt atactccgag aatttcctga 4680
ggttctctga ttgctactgt accgaaggca tcagagttta tcagatgagc gatcctgtat 4740
gtaagttcaa acgcaccacg gaagagcgta aaactgatgg tgactggttt cacaactgga 4800
agaatccaaa gtttcctggt gtgttagaca aagtctacag aaccattgga atttattcct 4860
cggactgtag tactaaggag ctccctgtca aacggatcgg acgtttacat gaggcccttg 4920
agcgtgagtc actcaaatta gctaatgatc gtaggaccac acaacgcttg aaaaagaagg 4980
tcgacgatta cgctaccggt agaggaggcc taacgtcagt tgatgctttg ctcgtgaagt 5040
cccattgtga gacttttaag ccctctgatc tgagatgatc ggttctatga tatatgaacc 5100
taagctgtga acagcccttt ggttaaggtt aaaaactcct ggtcaggcag accactttgg 5160
ctaagtttaa aagctgggga tcctctagag tccgcaaatc accagtctct ctctacaaat 5220
CA 02329509 2000-11-21
17
ctatctctct ctattttctc cagaataatg tgtgagtagt tcccagataa gggaattagg 5280
gttcttatag ggtttcgctc atgtgttgag catataagaa acccttagta tgtatttgta 5340
tttgtaaaat acttctatca ataaaatttc taattcctaa aaccaaaatc cagtgacctg 5400
caggcatgca agcttgcatg cctgcaggtc gactctagag gatccccggt caacatggtg 5460
gagcacgaca ctctcgtcta ctccaagaat atcaaagata cagtctcaga agaccagagg 5520
gctattgaga cttttcaaca aagggtaata tcgggaaacc tcctcggatt ccattgccca 5580
gctatctgtc acttcatcga aaggacagta gaaaaggaag atggcttcta caaatgccat 5640
cattgcgata aaggaaaggc tatcgttcaa gaatgcctct accgacagtg gtcccaaaga 5700
tggaccccca cccacgagga acatcgtgga aaaagaagac gttccaacca cgtcttcaaa 5760
gcaagtggat tgatgtgata tctccactga cgtaagggat gacgcacaat cccactatcc 5820
ttcgcaagac ccttcctcta tataaggaag ttcatttcat ttggagagga cctcgaccac 5880
ggttctgcta cttgttcttt gtttttcacc aacaaaatgt caagttctat cgatttgctg 5940
aagttgattg ctgagaaggg tgctgacagc cagagtgccc aagacatcgt agacaatcag 6000
gttgcgcaac agttatctgc gcagattgaa tacgcgaaaa ggtctaagaa aatcaacgtt 6060
cgcaataagc tctctattga ggaggctgac gccttccgtg accgttatgg tggtgccttt 6120
gacttaaatt tgactcagca gtatcatgcg ccccatagcc tggctggtgc tctgcgtgta 6180
gcggagcatt atgactgtct cgacagtttt ccccctgaag accccgttat agatttcgga 6240
gggtcttggt ggcatcactt ttcaagaagg gataaaaggg tgcacagttg ttgtcctgtg 6300
ttgggtgtta gagacgctgc ccgacatgag gagaggatgt gccgcatgcg aaaaattttg 6360
caagaaagcg atgatttcga tgaagtcccg aacttttgtc ttaaccgagc tcaagattgt 6420
gatgtccaag ctgattgggc tatctgtatc cacggcggtt atgatatggg cttccaaggt 6480
ctgtgtgacg cc:atgcattc gcatggagta cgcgtactac gtggtaccgt tatgttcgac 6540
ggcgccatgt tgtttgaccg cgagggtttt cttcccttgc ttaaatgtca ctggcaacgt 6600
gacgggtcag gcgcggatga ggtgatcaaa ttcgattttg aaaatgaaag cacattatct 6660
tacatccacg gatggcaaga tttgggctca tttttcaccg agtcggtgca ttgcatcgat 6720
ggaaccacct atctgttgga gcgcgaaatg ctgaaatgta acatcatgac ctataagatc 6780
atcgctacaa atttacgctg cccccgggag acactacgtc actgtgtatg gtttgaagac 6840
atatctaagt acgtaggggt ctcaatacct gaagactgga gtctcaatcg ctggaaatgt 6900
gtgcgcgtcg ccaaaaccac agtgagagag gtagaggaga tagctttcag atgtttcaag 6960
gaaagtaaag aatggactga gaacatgaaa gctgtcgcat ctatcttatc cgccaagtcg 7020
tcgactgtta ttattaacgg tcaggctatc atggctggtg agcgcttaga cattgaagat 7080
tatcatctag tggcctttgc tttgactttg aatctgtatc aaaagtacga aaagcttacg 7140
gccctccgcg atgggatgga atggaaaggt tggtgccatc acttcaaaac taggttttgg 7200
tggggtggag at:tcatccag ggcgaaagta ggatggctga gaacattggc tagcagattt 7260
cccctactac gtctggattc ttatgcggac agttttaagt ttctgactcg tctctcaaac 7320
gttgaagaat ttgagcaaga ttctgtaccg atatcacgtt tgagaacgtt ttggactgaa 7380
gaggacttat tcgaccggct ggagcatgaa gtgcagacag ccaagaccaa gcgctcgaag 7440
aagaaggcga aagtcccgcc agctgctgag atacctcagg aggagtttca tgatgcccct 7500
gagagttcga gccctgagtc cgtcagtgat gacgttaaac cggtgactga tgtggtcccg 7560
gatgccgagg tgtctgttga ggtaccaacg gaccctcgtg gcatatctag acacggagcc 7620
atgaaggaat ttgtgcgtta ttgtaagaga ttacataaca actccgagtc taatcttcgt 7680
cacctatggg acatttccgg cggtcgcgga agtgagatcg caaataagag catctttgag 7740
acctaccatc gcatagacga tatggtgaat gtccatttgg ccaacggtaa ctggttgtat 7800
cctaaaaaat acgattacac tgttggatat aatgagcatg gtttaggtcc gaagcacgca 7860
gatgaaacgt acattgttga taaaacatgt gcatgctcta acttgaggga cattgcagaa 7920
gctagcgcca aagtttctgt ccctacatgc gatatttcca tggttgatgg agttgcggga 7980
tgcggtaaaa ccactgccat aaaagatgca ttccgtatgg gagaggacct aattgtgacg 8040
gcgaatcgta aatcggccga ggacgtcagg atggctttat tccctgacac ttataattcc 8100
aaggtagctt tggacgttgt gcgcaccgcg gattctgcga tcatgcacgg tgtaccgtcc 8160
tgtcataggc tgcttgttga tgaggctggt ttactacatt atggtcaact cctggtggtg 8220
gctgctctgt ctaaatgttc acaagttctt gcctttgggg acacagagca gatttcgttc 8280
aagtctcgtg acgcgggttt taaattgctc cacggtaatc tgcaatatga tcgccgtgac 8340
gttgttcaca agacttaccg gtgtccgcaa gatgttatcg ctgctgttaa tctgctgaag 8400
cgtaaatgcg gtaataggga cacgaagtat caatcctgga catctgagtc caaagtttct 8460
agaagtctca cgaagcgtcg tattacttct ggtttgcagg tcactattga tccgaacaga 8520
acgtatctta cgatgactca agctgataaa gcggcccttc aaacgagggc taaggatttt 8580
cccgtgagca aggactggat tgatggacac ataaaaacag tacacgaagc gcaagggatc 8640
tctgttgaca acgtcacttt ggttcggctt aagtcgacca aatgtgattt gtttaaacat 8700
gaggagtact gtttggttgc cttaacacga cacaagaagt cctttgagta ttgctttaac 8760
CA 02329509 2000-11-21
18
ggcgagctcg ctggtgattt gatctttaat tgtgttaagt gatgcgcttg tctctgtgtg 8820
agacctctgc tcgagaattc gagctcggta cccggggatc ctctagagtc cgcaaatcac 8880
cagtctctct ctacaaatct atctctctct attttctcca gaataatgtg tgagtagttc 8940
ccagataagg gaattagggt tcttataggg tttcgctcat gtgttgagca tataagaaac 9000
ccttagtatg tatttgtatt tgtaaaatac ttctatcaat aaaatttcta attcctaaaa 9060
ccaaaatcca gtgaccgggt ggtcagtccc ttatgttacg tcctgtagaa accccaaccc 9120
gtgaaatcaa aaaactcgac ggcctgtggg cattcagtct ggatcgcgaa aactgtggaa 9180
ttgatcagcg ttggtgggaa agcgcgttac aagaaagccg ggcaattgct gtgccaggca 9240
gttttaacga tcagttcgcc gatgcagata ttcgtaatta tgcgggcaac gtctggtatc 9300
agcgcgaagt ctttataccg aaaggttggg caggccagcg tatcgtgctg cgtttcgatg 9360
cggtcactca ttacggcaaa gtgtgggtca ataatcagga agtgatggag catcagggcg 9420
gctatacgcc atttgaagcc gatgtcacgc cgtatgttat tgccgggaaa agtgtacaat 9480
tcactggccg tcgttttaca acgtcgtgac tgggaaaacc ctggcgttac ccaacttaat 9540
cgccttgcag cacatccccc tttcgccagc tggcgtaata gcgaagaggc ccgcaccgat 9600
cgcccttccc aacagttgcg cagcctgaat ggcgaatgnn nnnnnaattc agtacattaa 9660
aaacgtccgc aatgtgttat taagttgtct aagcgtcaat ttgtttacac cacaatatat 9720
cctgccacca gccagccaac agctccccga ccggcagctc ggcacaaaat caccactcga 9780
tacaggcagc ccatcagnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn 9840
nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn 9900
nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn 9960
nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn 10020
nnnnnnnnnn nnnnnnnnnn nnrinnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn 10080
nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn 10140
nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn 10200
nnnnnnnnnn nnnnnnrinnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn 10260
nnnnnnnnnn nn 10272
<210> 8
<211> 10166
<212> DNA
<213> Brome mosaic virus
<400> 8
aaacactgat agtttaaact gaaggcggga aacgacaatc tgatcatgag cggagaatta 60
agggagtcac gttatgaccc ccgccgatga cgcgggacaa gccgttttac gtttggaact 120
gacagaaccg caacgattga aggagccact cagccgcggg tttctggagt ttaatgagct 180
aagcacatac gtcagaaacc attattgcgc gttcaaaagt cgcctaaggt cactatcagc 240
tagcaaatat ttcttgtcaa aaatgctcca ctgacgttcc ataaattccc ctcggtatcc 300
aattagnnnn nnnnnnnnnn nnnnnnnnnn gatcgtttcg catgattgaa caagatggat 360
tgcacgcagg ttctccggcc gcttgggtgg agaggctatt cggctatgac tgggcacaac 420
agacaatcgg ctgctctgat gccgccgtgt tccggctgtc agcgcagggg cgcccggttc 480
tttttgtcaa gaccgacctg tccggtgccc tgaatgaact gcaggacgag gcagcgcggc 540
tatcgtggct ggccacgacg ggcgttcctt gcgcagctgt gctcgacgtt gtcactgaag 600
cgggaaggga ct:ggctgcta ttgggcgaag tgccggggca ggatctcctg tcatctcacc 660
ttgctcctgc cgagaaagta tccatcatgg ctgatgcaat gcggcggctg catacgcttg 720
atccggctac ctgcccattc gaccaccaag cgaaacatcg catcgagcga gcacgtactc 780
ggatggaagc cggtcttgtc gatcaggatg atctggacga agagcatcag gggctcgcgc 840
cagccgaact gttcgccagg ctcaaggcgc gcatgcccga cggcgatgat ctcgtcgtga 900
cccatggcga tgcctgcttg ccgaatatca tggtggaaaa tggccgcttt tctggattca 960
tcgactgtgg ccggctgggt gtggcggacc gctatcagga catagcgttg gctacccgtg 1020
atattgctga agagcttggc ggcgaatggg ctgaccgctt cctcgtgctt tacggtatcg 1080
ccgctcccga ttcgcagcgc atcgccttct atcgccttct tgacgagttc ttctgannnn 1140
nnnnnnnnnn nrinnnnnnnn gatcgttcaa acatttggca ataaagtttc ttaagattga 1200
atcctgttgc cggtcttgcg atgattatca tataatttct gttgaattac gttaagcatg 1260
taataattaa catgtaatgc atgacgttat ttatgagatg ggtttttatg attagagtcc 1320
cgcaattata catttaatac gcgatagaaa acaaaatata gcgcgcaaac taggataaat 1380
tatcgcgcgc ggtgtcatct atgttactag atcgggcctc ctgtcaatgc tggcggcggc 1440
tctggtggtg gttctggtgg cggctctgag ggtggtggct ctgagggtgg cggttctgag 1500
ggtggcggct ctgagggagg cggttccggt ggtggctctg gttccggtga ttttgattat 1560
CA 02329509 2000-11-21
19
gaaaagatgg caaacgctaa taagggggct atgaccgaaa atgccgatga aaacgcgcta 1620
cagtctgacg ctaaaggcaa acttgattct gtcgctactg attacggtgc tgctatcgat 1680
ggtttcattg gtgacgtttc cggccttgct aatggtaatg gtgctactgg tgattttgct 1740
ggctctaatt cccaaatggc tcaagtcggt gacggtgata attcaccttt aatgaataat 1800
ttccgtcaat atttaccttc cctccctcaa tcggttgaat gtcgcccttt tgtctttggc 1860
ccaatacgca aaccgcctct ccccgcgcgt tggccgattc attaatgcag ctggcacgac 1920
aggtttcccg ac:tggaaagc gggcagtgag cgcaacgcaa ttaatgtgag ttagctcact 1980
cattaggcac cccaggcttt acactttatg cttccggctc gtatgttgtg tggaattgtg 2040
agcggataac aatttcacac aggaaacagc tatgaccatg attacgccaa gcttgctgcc 2100
tgcaggtcaa catggtggag cacgacactc tcgtctactc caagaatatc aaagatacag 2160
tctcagaaga ccagagggct attgagactt ttcaacaaag ggtaatatcg ggaaacctcc 2220
tcggattcca ttgcccagct atctgtcact tcatcgaaag gacagtagaa aaggaagatg 2280
gcttctacaa atgccatcat tgcgataaag gaaaggctat cgttcaagaa tgcctctacc 2340
gacagtggtc ccaaagatgg acccccaccc acgaggaaca tcgtggaaaa agaagacgtt 2400
ccaaccacgt cttcaaagca agtggattga tgtgatatct ccactgacgt aagggatgac 2460
gcacaatccc actatccttc gcaagaccct tcctctatat aaggaagttc atttcatttg 2520
gagaggacct cgagaattcg agctcggtac ccgcaacaca catctgacct tgttgttgtt 2580
gtgtgcttgt tctttctact atcaccaaga tgtcttcgaa aacctgggat gatgatttcg 2640
ttcgccaggt cccgtctttc caatggatca tagatcaatc cttagaagac gaggtggagg 2700
ctgctagcct tcaggtgcag gagccggcag acggagttgc cattgacgga tctctcgcga 2760
gttttaaatt agctatagcg cccttggaga taggaggggt attcgatccc ccttttgacc 2820
gagtgcgctg gggctctatt tgcgacaccg tccaacaaat ggttcaacag ttcaccgata 2880
gaccgctgat tc:ctcaagct gaaatggcac ggatgttata tcttgacatt ccgggctctt 2940
tcgtgctcga agatgaaatt gatgactggt atcccgagga tactagtgat ggttacggtg 3000
tatcgtttgc cgccgatgaa gatcatgcga gcgatctaaa actcgccagt gattcctcga 3060
actgtgaaat tgaggaagtt cgtgttactg gagatacccc caaggagctg acccttggag 3120
ataggtacat gggcattgat gaagagtttc agactactaa tactgattac gacatcactc 3180
ttcaaatcat gaaccctatt gaacataggg tttcgcgtgt tattgataca cactgccatc 3240
cagataaccc tgacatctct actgggccaa tttatatgga gagagtcagc cttgctagaa 3300
cagaagcgac cagtcattcc atactgccaa cccatgctta tttcgatgat tcgtaccatc 3360
aagcccttgt tgaaaatggt gattattcca tggactttga taggatcaga cttaagcaaa 3420
gtgatgtaga ctggtatagg gaccccgata aatattttca accaaaaatg aatatcggga 3480
gtgctcagcg aagagttggt actcagaaag aagtcttaac cgcactcaaa aagcgaaacg 3540
cggacgttcc agaaatggga gacgcgatta acatgaagga cactgcgaaa gctatagcaa 3600
agcgctttcg tagcacattc cttaatgttg acggtgaaga ctgtctgaga gcttctatgg 3660
atgtcatgac taaatgtctt gagtaccata agaagtgggg taagcacatg gacttgcaag 3720
gtgtgaatgt ggcagcagag actgatttat gtcggtacca gcatatgctg aagtctgacg 3780
taaaacctgt tgtaactgac acccttcact tggaacgagc agtagcagct actataacat 3840
ttcatagtaa aggtgtgact agtaattttt cacccttttt cactgcttgt ttcgagaagt 3900
tatcactggc cctgaaatcc aggttcattg tgcctatcgg aaagatatcc tctctggagc 3960
ttaagaatgt ccgcttgaat aacagatact ttcttgaagc ggacctaagc aaatttgata 4020
aatctcaggg tgagctgcac ctagagtttc agagagagat actccttgcg ctgggctttc 4080
cagcgccgct gacgaattgg tggtctgatt ttcatcgcga ttcttattta tcagaccctc 4140
atgccaaggt gggaatgtcc gtttccttcc aacgcagaac tggtgacgcg tttacatatt 4200
tcggtaatac tcttgtcact atggctatga ttgcatatgc ctctgatcta agtgactgtg 4260
actgtgcaat attttcagga gatgattctt taatcatctc taaagttaag ccagtcctgg 4320
ataccgatat gtttacgtct ctcttcaata tggagataaa agtcatggac cctagtgtgc 4380
cctacgtttg tagtaagttt ctcgtcgaaa ctgaaatggg caatttggtg tctgtaccag 4440
atcctctgag agagatccag cgcttagcta agcgaaagat tctgcgtgat gaacagatgc 4500
tcagagcaca tttcgtttcc ttctgtgatc gaatgaagtt tattaatcaa cttgatgaga 4560
agatgattac gacgctctgt cattttgttt atctgaaata tgggaaagaa aaaccttgga 4620
ttttcgagga ggttagagct gctcttgcgg ctttttcttt atactccgag aatttcctga 4680
ggttctctga ttgctactgt accgaaggca tcagagttta tcagatgagc gatcctgtat 4740
gtaagttcaa acgcaccacg gaagagcgta aaactgatgg tgactggttt cacaactgga 4800
agaatccaaa gtttcctggt gtgttagaca aagtctacag aaccattgga atttattcct 4860
cggactgtag tactaaggag ctccctgtca aacggatcgg acgtttacat gaggcccttg 4920
agcgtgagtc actcaaatta gctaatgatc gtaggaccac acaacgcttg aaaaagaagg 4980
tcgacgatta cgctaccggt agaggaggcc taacgtcagt tgatgctttg ctcgtgaagt 5040
cccattgtga gacttttaag ccctctgatc tgagatgatc ggttctatga tatatgaacc 5100
CA 02329509 2000-11-21
taagctgtga acagcccttt ggttaaggtt aaaaactcct ggtcaggcag accactttgg 5160
ctaagtttaa aagctgggga tcctctagag tccgcaaatc accagtctct ctctacaaat 5220
ctatctctct ctattttctc cagaataatg tgtgagtagt tcccagataa gggaattagg 5280
gttcttatag ggtttcgctc atgtgttgag catataagaa acccttagta tgtatttgta 5340
tttgtaaaat acttctatca ataaaatttc taattcctaa aaccaaaatc cagtgacctg 5400
caggcatgca agcttgcatg cctgcaggtc gactctagag gatccccggt cactggattt 5460
tggttttagg aattagaaat tttattgata gaagtatttt acaaatacaa atacatacta 5520
agggtttctt atatgctcaa cacatgagcg aaaccctata agaaccctaa ttcccttatc 5580
tgggaactac tcacacatta ttctggagaa aatagagaga gatagatttg tagagagaga 5640
ctggtgattt gcggactcta gaggatcccc gggtaccgag ctcgaattct cgagcagagg 5700
tctcacacag agacaagcgc atcacttaac acaattaaag atcaaatcac cagcgagctc 5760
gccgttaaag caatactcaa aggacttctt gtgtcgtgtt aaggcaacca aacagtactc 5820
ctcatgttta aacaaatcac atttggtcga cttaagccga accaaagtga cgttgtcaac 5880
agagatccct tgcgcttcgt gtactgtttt tatgtgtcca tcaatccagt ccttgctcac 5940
gggaaaatcc ttagccctcg tttgaagggc cgctttatca gcttgagtca tcgtaagata 6000
cgttctgttc ggatcaatag tgacctgcaa accagaagta atacgacgct tcgtgagact 6060
tctagaaact tt.ggactcag atgtccagga ttgatacttc gtgtccctat taccgcattt 6120
acgcttcagc agattaacag cagcgataac atcttgcgga caccggtaag tcttgtgaac 6180
aacgtcacgg cgatcatatt gcagattacc gtggagcaat ttaaaacccg cgtcacgaga 6240
cttgaacgaa at.ctgctctg tgtccccaaa ggcaagaact tgtgaacatt tagacagagc 6300
agccaccacc aggagttgac cataatgtag taaaccagcc tcatcaacaa gcagcctatg 6360
acaggacggt acaccgtgca tgatcgcaga atccgcggtg cgcacaacgt ccaaagctac 6420
cttggaatta taagtgtcag ggaataaagc catcctgacg tcctcggccg atttacgatt 6480
cgccgtcaca attaggtcct ctcccatacg gaatgcatct tttatggcag tggttttacc 6540
gcatcccgca actccatcaa ccatggaaat atcgcatgta gggacagaaa ctttggcgct 6600
agcttctgca atgtccctca agttagagca tgcacatgtt ttatcaacaa tgtacgtttc 6660
atctgcgtgc ttcggaccta aaccatgctc attatatcca acagtgtaat cgtatttttt 6720
aggatacaac cagttaccgt tggccaaatg gacattcacc atatcgtcta tgcgatggta 6780
ggtctcaaag atgctcttat ttgcgatctc acttccgcga ccgccggaaa tgtcccatag 6840
gtgacgaaga ttagactcgg agttgttatg taatctctta caataacgca caaattcctt 6900
catggctccg tgtctagata tgccacgagg gtccgttggt acctcaacag acacctcggc 6960
atccgggacc acatcagtca ccggtttaac gtcatcactg acggactcag ggctcgaact 7020
ctcaggggca tcatgaaact cctcctgagg tatctcagca gctggcggga ctttcgcctt 7080
cttcttcgag cgcttggtct tggctgtctg cacttcatgc tccagccggt cgaataagtc 7140
ctcttcagtc caaaacgttc tcaaacgtga tatcggtaca gaatcttgct caaattcttc 7200
aacgtttgag agacgagtca gaaacttaaa actgtccgca taagaatcca gacgtagtag 7260
gggaaatctg ctagccaatg ttctcagcca tcctactttc gccctggatg aatctccacc 7320
ccaccaaaac ctagttttga agtgatggca ccaacctttc cattccatcc catcgcggag 7380
ggccgtaagc ttttcgtact tttgatacag attcaaagtc aaagcaaagg ccactagatg 7440
ataatcttca atgtctaagc gctcaccagc catgatagcc tgaccgttaa taataacagt 7500
cgacgacttg gcggataaga tagatgcgac agctttcatg ttctcagtcc attctttact 7560
ttccttgaaa catctgaaag ctatctcctc tacctctctc actgtggttt tggcgacgcg 7620
cacacatttc cagcgattga gactccagtc ttcaggtatt gagaccccta cgtacttaga 7680
tatgtcttca aaccatacac agtgacgtag tgtctcccgg gggcagcgta aatttgtagc 7740
gatgatctta taggtcatga tgttacattt cagcatttcg cgctccaaca gataggtggt 7800
tccatcgatg caatgcaccg actcggtgaa aaatgagccc aaatcttgcc atccgtggat 7860
gtaagataat gtgctttcat tttcaaaatc gaatttgatc acctcatccg cgcctgaccc 7920
gtcacgttgc cagtgacatt taagcaaggg aagaaaaccc tcgcggtcaa acaacatggc 7980
gccgtcgaac ataacggtac cacgtagtac gcgtactcca tgcgaatgca tggcgtcaca 8040
cagaccttgg aagcccatat cataaccgcc gtggatacag atagcccaat cagcttggac 8100
atcacaatct tgagctcggt taagacaaaa gttcgggact tcatcgaaat catcgctttc 8160
ttgcaaaatt tttcgcatgc ggcacatcct ctcctcatgt cgggcagcgt ctctaacacc 8220
caacacagga caacaactgt gcaccctttt atcccttctt gaaaagtgat gccaccaaga 8280
ccctccgaaa tctataacgg ggtcttcagg gggaaaactg tcgagacagt cataatgctc 8340
cgctacacgc agagcaccag ccaggctatg gggcgcatga tactgctgag tcaaatttaa 8400
gtcaaaggca ccaccataac ggtcacggaa ggcgtcagcc tcctcaatag agagcttatt 8460
gcgaacgttg attttcttag accttttcgc gtattcaatc tgcgcagata actgttgcgc 8520
aacctgattg tctacgatgt cttgggcact ctggctgtca gcacccttct cagcaatcaa 8580
cttcagcaaa tcgatagaac ttgacatttt gttggtgaaa aacaaagaac aagtagcaga 8640
CA 02329509 2000-11-21
21
accgtggtcg aggtcctctc caaatgaaat gaacttcctt atatagagga agggtcttgc 8700
gaaggatagt gggattgtgc gtcatccctt acgtcagtgg agatatcaca tcaatccact 8760
tgctttgaag acgtggttgg aacgtcttct ttttccacga tgttcctcgt gggtgggggt 8820
ccatctttgg gaccactgtc ggtagaggca ttcttgaacg atagcctttc ctttatcgca 8880
atgatggcat ttgtagaagc catcttcctt ttctactgtc ctttcgatga agtgacagat 8940
agctgggcaa tggaatccga ggaggtttcc cgatattacc ctttgttgaa aagtctcaat 9000
agccctctgg tcttctgaga ctgtatcttt gatattcttg gagtagacga gagtgtcgtg 9060
ctccaccatg ttgaccgggt ggtcagtccc ttatgttacg tcctgtagaa accccaaccc 9120
gtgaaatcaa aaaactcgac ggcctgtggg cattcagtct ggatcgcgaa aactgtggaa 9180
ttgatcagcg ttggtgggaa agcgcgttac aagaaagccg ggcaattgct gtgccaggca 9240
gttttaacga tcagttcgcc gatgcagata ttcgtaatta tgcgggcaac gtctggtatc 9300
agcgcgaagt ctttataccg aaaggttggg caggccagcg tatcgtgctg cgtttcgatg 9360
cggtcactca ttacggcaaa gtgtgggtca ataatcagga agtgatggag catcagggcg 9420
gctatacgcc atttgaagcc gatgtcacgc cgtatgttat tgccgggaaa agtgtacaat 9480
tcactggccg tcgttttaca acgtcgtgac tgggaaaacc ctggcgttac ccaacttaat 9540
cgccttgcag cacatccccc tttcgccagc tggcgtaata gcgaagaggc ccgcaccgat 9600
cgcccttccc aacagttgcg cagcctgaat ggcgaatgnn nnnnnaattc agtacattaa 9660
aaacgtccgc aatgtgttat taagttgtct aagcgtcaat ttgtttacac cacaatatat 9720
cctgccacca gccagccaac agctccccga ccggcagctc ggcacaaaat caccactcga 9780
tacaggcagc cc:atcagnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn 9840
nnnnnnnnnn nrinnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn 9900
nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn 9960
nnnnnnnnnn nrinnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn 10020
nnnnnnnnnn nrinnnnnrinn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnrinnn 10080
nnnnnnnnnn nrinnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn 10140
nnnnnnnnnn nrinnnnnnnn nnnnnn 10166