Note : Les descriptions sont présentées dans la langue officielle dans laquelle elles ont été soumises.
CA 02331853 2000-11-07
WO 99/58705 PCT/US99/09914
1
Recombinant Baculovirus-Based l:nsecticides
Cross-Reference to Related Applications
This application claims priority pursuant to 35 U.S.C. 119 based upon
Provisional Application Serial No. 60/084,705 filed May 8, 1998, the entire
disclosure of
which is hereby incorporated by reference.
Field of the Invention
The present invention relates to improved Plutella xylostella baculoviruses
for use as biological insecticides. The invention provide s recombinant
baculoviruses that
have been genetically engineered to incorporate genes encoding insecticidal
toxins.
Background of the Invention
Baculoviruses are insect viruses which are useful as biological insecticides.
Over 400 baculovirus isolates have been described. The Autographa californica
nuclear
polyhedrosis virus {AcMNPV), the prototype virus of the family Baculoviridae,
was
2 5 originally isolated from Autographa californica, a lepidopteran noctuid
commonly known
as the alfalfa looper. This virus infects 12 families and more than 30 species
within the
order of Lepidopteran insects (Granados et al. , The Biology ofBaculoviruses,
I, 99 (1986)).
AcMNPV is not known to infect productively any species outside this order.
The life cycle of baculoviruses, as exemplified by AcMNPV, includes two
3 0 stages. Each stage of the life cycle is represented by a spc~if'ic form of
the virus: budded
virions (BV) which are nonoccluded, and occlusion bodies (OB).
CA 02331853 2000-11-07
WO 99/58705 PCT/US99/09914
2
In the naturally occurring insect-infectious. form, multiple virions are found
embedded in a paxacrystalline protein matrix known as am occlusion body {OB),
which is
also referred to as apolyhedral inclusion body (P1B). The proteinaceous viral
occlusions
are referred to as polyhedra. A polyhedrin protein having; molecular weight of
29 kD is the
major viral-encoded structural protein of the viral occlusions (U.S. Patent
Number
4,745,051).
The viral occlusions are an important part of the natural baculovirus Life
cycle, providing the means for horizontal (insect-to-insect) transmission
among susceptible
insect species. In the environment, a susceptible insect (usually in the
larval stage) ingests
the viral occlusions from a contaminated food source, such as a plant. The
crystalline
occlusions dissociate in the gut of susceptible insects to release the
infectious viral particles.
These occlusion-derived viruses (ODV) replicate in the cells of the midgut
tissue.
It is believed that virus particles enter the <;ell by endocytosis or fusion,
and
the viral DNA is uncoated at the nuclear pore or in the nucleus. Viral DNA
replication is
detected within six hours. By 10-12 hours post-infection (~p.i.), secondary
infection spreads
to other insect tissues by the budding of the extracellular virus (BV) from
the surface of the
cell. The BV form of the virus is responsible for cell-to-cell spread of the
virus within an
individual infected insect, as well as for transmitting infection in cell
culture.
Late in the infection cycle (12 hours p. i. ), poiyhedrin protein can be
detected
2 0 in infected cells. It is not until 18-24 hours p. i. that the polyhedrin
protein assembles in
the nucleus of the infected cell and virus particles become embedded in the
proteinaceous
occlusions. Viral occlusions accumulate to large numbers over 4-5 days as
cells Iyse.
These polyhedra have no active role in the spread of infection in the Larva.
BVs in the
haemolymph multiply and spread, leading to the death of the larva.
2 5 When infected larvae die, millions of polyliedra remain in the decomposing
tissue, while the BVs are degraded. When other larvae are exposed to the
polyhedra by
ingestion of, e.g., contaminated plants or other food material, the cycle is
repeated.
In summary, the occluded form of the virus is responsible for the initial
infection of the insect through the gut, as well as for the environmental
stability of the
3 0 virus. ODVs are essentially non-infectious when administered by injection,
but are highly
infectious when ingested orally. The non-occluded form of the virus (i.e., BV)
is
CA 02331853 2000-11-07
WO 99158705 3 PCT/US99/09914
responsible for secondary and cell-to-cell infection. BV's are highly
infectious for cells in
culture or internal insect tissues by injection, but are not infectious when
ingested.
A major impediment to the widespread u.se of insecticidal baculaviruses in
agriculture is the time lag between initial infection of the insect and its
death. This time lag
can range from days to weeks. During this period, the; insect continues to
feed, causing
further damage to the plant. To shorten this lag time, recombinant
bacuioviruses have been
constructed that express an insect-controlling or modifying substance, such as
a toxin,
neuropeptide, hormone, or enzyme (Tomalski, M. D. et al. , Nature, 352:82-85
(1991);
Federici, In Vitro, 28:50A (1992}; Martens et al., App. & Envir. Microbiology,
56:2764-
2770 (1990); Menn et al. , Agric. Food Chem. , 37:271-278 {1989); Eldridge et
al. , Insect
Biochem., 21:341-351 (1992); Hammock et al., Nature, 344:458-461 (1990)).
A second major impediment to the use oaf insecticidal baculoviruses is the
limited host range of the viruses. While the liiriited host iange of
baculoviruses makes them
safe to non-target organisms, it has also meant that they are unable to
control the variety
of lepidopteran pests present in the field. This is particularly true when the
complex of
lepidopteran insects that needs to be controlled comprises insects that are
either non-
permissive or semi permissive for infection by the particular insecticidal
baculovirus being
used. An insect that is non permissive for infection is one that cannot be
productively
infected at any dose; an insect that is semi-permissive fc>r infection is one
that can onty be
2 0 productively infected when exposed to an amount of the virus that is at
least one, but more
generally two or more, orders of magnitude greater than that required for
productive
infection in susceptible insects, i.e., permissive hosts. Prior to the present
invention, no
baculovirus of the genus Nucleopolyhedrovinis had. been identified far which
the
diamondback moth, Plutella xylostella, is a permissive host. This insect is an
important
2 5 pest in many vegetable crops and has developed resistance to both chemical
and biological
insecticides.
Thus, there is a need in the art for biological insecticides that exhibit (i)
improved efficacy and shorter lag times between infecltion and mortality arid
{ii) exhibit
improved host range, allowing them to control a broad complement of
lepidopteran insect
30 pests, including, e.g., Plutellaxylostella.
CA 02331853 2000-11-07
WO 99/58705 _ PCT/US99/09914
4
Summary of the Invention
The present invention provides recombinant Plutella xylostella baculoviruses
(PxNPVs), which exhibit superior insecticidal activity against Plutella
xylostella insects
relative to other wild-type and recombinant baculoviruses.
Recombinant PxNPVs according to the invention are PxNPVs containing one
or more genetic alterations relative to wild-type PxIVIPV. Genetic alterations
include
without limitation introduction or deletion of one or more restriction sites;
modification,
deletion, or duplication of one or more viral-encoded genes; and introduction
of one or
more genes encoding heterologous proteins, i.e., proteins that are non-virally
encoded or
1.0 are encoded by a different virus.
Preferably, recombinant PxNPVs have uicorporated within their genomes
a nucleic acid sequence encoding an insect-modifying substance, such as, e.g.,
an
insecticidal toxin, peptide hormone, enzyme, or receptor, which is operably
linked to a
promoter capable of activating transcription in the target insect. Most
preferably, the
insect-modifying substance is an insecticidal toxin. I1: is believed that a
recombinant
baculovirus encoding an insecticidal toxin in the context of the PxNPV genomic
background
provides significantly improved insecticidal benefits.
Non-limiting examples of insecticidal toxiuns include AaIT, AaHITI,
AaHIT2, LqhIT2, IrqqITl, LqqIT2, BjITI, BjIT2, Lqhf35, l-qhaIT, SmpIT2,
SmpC1'2,
2 0 SmpCT3, SmpMT, DK9.2, DKI l, DKl2, ~-agatoxin, ;King Kong toxin, Pt6, NPS-
326,
NPS-33I, NPS-373, Tx4(6-1), TxP-1, c~-atracotoxins, a-conotoxins, tc-
conotoxins,
chlorotoxin and c.~-conotoxins. In some embodiments, th,e native secretion
signal peptide,
i. e. , the signal peptide associated with the toxin, is employed; in other
embodiments, a
heterologous signal peptide is employed to promote secretion of the toxin from
infected
2 5 insect cells. Non-limiting examples of useful heterologous signal peptides
include those
derived from the pBMHPC-12 signal sequence from Bombyx mori; the adipokinetic
hormone signal sequence from Manduca sexta; the apolipophorin signal sequence
from
Manduca sexta; the chorion signal sequence from Bombyx mori; the cuticle
signal sequence
from Drosophila melanogasier; the esterase-6 signal sequence from Drosophila
3 0 melareogaster; and the sex-specific signal sequence from Bombyx mori.
The invention also encompasses direct ligation vectors, which are designed
to facilitate the construction of recombinant PxNPV genomes by DNA fragment
ligation
CA 02331853 2000-11-07
WO 99/58705 PCTIUS99109914
in vitro. Introduction of the DNA resulting from such a iigation into an
appropriate host
cell results in the production of recombinant PxNPVs.
In another aspect, the invention provides expression cassettes encoding
insecticidal toxins. The expression cassettes comprise a promoter sequence,
preferably
5 derived from a Drosophila melanogaster hsp70 promoter, which is operably
linked to a
nucleic acid sequence encoding a toxin. The expression cassettes of the
invention may also
be incorporated into plasmid vectors, which are designated modular expression
vectors.
In yet another aspect, the invention provides colon-optimised genes encoding
insecticidal toxins, such as, e.g., those shown in Figures 10 and I1 below.
Codon-
optimised genes are those in which particular colons present in the native
toxin-encoding
sequence have been substituted with alternative colons that are more
efficiently utilized by
the insect cell protein-synthesizing machinery.
In yet another aspect, the invention provides insecticidal compositions and
formulations comprising at least one recombinant Pxt~TPV as described . above
and an
agriculturally acceptable carrier.
In yet another aspect, the invention provides methods for killing insect pests
and for reducing insect infestation, which comprise administering to a desired
locus an
insecticidal-effective amount of PxNF'V-containing insecticidal compositions
or
formulations.
Brief Description of the Drawings
Figure 1 is a schematic illustration of the procedures used to construct the
prod 205 .1, prod 216.1, and prod 220.2 vectors for the production of
recombinant 1?xNPV s
deleted for the viral ecdysteroid glucosyl transferase (egt) gene.
2 5 Figure 2 is a schematic illustration of the procedures used to construct
the
LAB 50.2 vector.
Figure 3 is a schematic illustration of the structure of pMEV modular
expression vectors.
Figure 4 is a schematic illustration of pl~ZEV vectors containing different
3 0 promoters.
Figure 5 is a schematic illustration of the cloning of sequences into the
modular expression vectors.
CA 02331853 2000-11-07
WO 99/58705 PCTNS99/0991a
6
Figure 6 is an illustration of the D. melancrgaster hsp70 promoter module in
pMEVS and the amplification primers used to isolate thE; sequence.
Figure 7 is an illustration of the D. melarcogaster hsp70 promoter module in
pMEVd and the amplification primers used to isolate the sequence.
Figure 8 is an illustration of a codon-optimized DNA sequence encoding
AaIT and the oligonucleotides and amplification primers that were used to
synthesize the
sequence.
Figure 9 is a schematic illustration of the structure of the pMEV/ADK
modular expression vectors.
Figure 10 is an illustration of a codon-optimized DNA sequence encoding
the LqhIT2 toxin and the oligonucleotides and amplification primers that were
used to
synthesize the sequence.
Figure 11 is an illustration of a codon-optimized DNA sequence encoding
c~-ACTX-I3V1 toxin and the oligonucleotides and amplification primers that
were used to
~ 5 synthesize the sequence.
Detailed Description of the Invention
In practicing the present invention, many techniques in molecular biology,
microbiology, recombinant DNA, protein biochemistry, and insect virology known
to those
2 o skilled in the art may be used, such as those explained filly in, for
example, Sambrook et
al., 1989, Molecular Cloning: ALaboratory Manual, Second Edition, Cold Spring
Harbor
Laboratory Press, Cold Spring Harbor, New York; ~~ligonucleotide Synthesis,
1984,
(M. L. Gait ed.); Ausubel et al. , Current Protocols in Moi!ecular Biology,
1997 (John Wiley
& Sons); the series, Methods in Enzymology (Aca.demic :Press,. Inc.); Protein
Purification:
25 Principles and Practice, Second Edition (Springer-Verlag, N.Y.); Summers et
al., A
Manual of Methods for Baculovirus vectors and insect Cell Culture Procedures,
Texas
Agricultural Experiment Station Bulletin No. 1555, 1987; and O'Reilly et al.,
Baculovirus
Expression Vectors: A Laboratory Manual, 1994 (Oxford Univ. Press, N:Y.)
The present invention provides isolated, purified recombinant Plutella
3 o xylostella baculoviruses (PxNPVs) which are useful as biological
insecticides. PxNPV as
iced herein refers to an isolate of baculovirus of the genus
Nucleopolyhedrovirus (NPV),
the wild-type version of which was isolated from infected Plutella xylostella
larvae and
CA 02331853 2000-11-07
WO 99158705 PCTIUS99109914
7
which is genetically distinct from other known baculoviruses and exhibits
higher infectivity
for Plutella xylostella larvae relative to other baculovvuses. The genomic
sequences of
recombinant PxNPVs according to thepresent invention, excluding heterologous
sequences,
exhibit at least about 90 % sequence identity, and preferably at least about
95 ~ sequence
identity, with the genomic sequence of PxNPV deposited as ATCC VR-2607. PxNPVs
encompassed by the present invention may also be identified by:
(i) Measurement of infectivity for Plutella xylostella larvae.
PxNPVs of the invention typically exhibit infectivity for Plutella xylostella
larvae that is
at least about two orders of magnitude greater than That exhibited by the V8
strain of
AcMNPV deposted as ATCG VR-2465.
(ii) Digestion of viral genomic; DNA with HindaI, XhoI, and/or
Psti and comparison of the resulting restriction fragment: pattern with
patterns produced by
digestion of genomic DNA derived from PxNPV and those derived from non-PxNPV
baculoviruses. PxNPVs of the invention, excluding fragments resulting from
genetic
alterations, exhibit restriction fragments characteristic of PxNPV, i.e., that
are present in
PxNPV digests and absent from the digests produced b;y other baculaviral DNAs.
The present inventors have discovered that the recombinant PxNPVs of the
present invention exhibit superior insecticidal activity on Plutella
xylostella larvae relative
to wild-type PxNPVs and/or recombinant NPVs derived from other species of
bacuioviruses. Recombinant PxNPVs according to the present invention are
PxNPVs in
which one or more genetic alterations have been introduced relative to wild-
type PxNPV.
"Genetic alteration" refers to any change in the sequena~ of the PxNPV genome
including,
without limitation, introduction of one or more restriction sites; deletion of
one or more
restriction sites; modification, deletion, or duplication of one or more viral-
encoded genes;
and introduction of one or more genes encoding heterologous proteins, i.e.,
non-virally
encoded proteins orproteins encoded by a different virus. For example,
modified PxNPVs
whose genomes contain restriction sites not present in wild-type PxNPV or,
conversely, are
lacking one or more restriction sites present in wild-type PxNPV are
encompassed by the
present invention. The term "restriction site" refers to a nucleic acid
sequence that is a
3 0 recognition site for a restriction endonuclease. Typically, addition
and/or deletion of one
or more restriction sites is performed to create a cloning site not present in
wild-type
PxNPV, i. e. , a sequence comprising at least one unique restriction site for
incorporation
CA 02331853 2000-11-07
WO 99158'705 PCT/US99/09914
g
of a heterologous gene into the PxNPV genome. Preferably, recombinant PxNPVs
have
incorporated within their genome at least one heterblogous gene, including
without
limitation genes encoding an insect-modifying substance such as, e. g. , an
insecticidal toxin,
a hormone, an enzyme, or a receptor.
Most preferably, recombinant PxNPV s contain a heterologous gene encoding
an insecticidal toxin. Suitable insecticidal toxins include without limitation
those listed in
the Table below:
Toxin Reference
AaIT, AaIi ITl, AafI IT2 Dai:bon et al., Int. J. Peptide Protein
Res. 20: 320-330, 1982; Loret et al. ,
Biochem. 29: 1492-1501, 1990
Lq~~~ Zlotkin et al., Biochem. 30: 4814-
4821, 1991; Zlothin et al., European
Patent Application EP 0374753 A2,
1950
IrqqITl, LqqIT2 Zla~tkin et al., Arch. of Biochem &
Bia~phys. 240: 877-887, 1985; Zlotkin
et ;al. , European Patent Application
EP 0374753 A2, 1990
BjITl, BjIT2 Le;>ter et al., Biochem. Biophys. Acta
701: 370-387, 1982; Zlotkin et aL,
European Patent Application EP
03'4753 A2, 1990
LqhP35 Zlotlcin et al, European Patent
Application EP 0374753 A2, 1990
LqhaIT Eitan et al., Biochem. 29: 5941-5947,
1990
SmpI1'2 Zlotkin et al. , European Patent
Application EP 0374753 A2, 1990
SmpCT2 Zlotlzin et al. , European Patent
Application EP 0374753 A2, 1990
i ~'
CA 02331853 2000-11-07
WO 99158705 PCTNS99/09914
9
SmpCT3 Zlotkin et al., European Patent
Application EP 0374753 A2, 1990
SmpMT Zlotkin et al. , European Patent
Application EP 0374753 A2, 1990
DK9.2 Kra~pcho et al. , International Patent
Application WO 0374753 A2, 1990
DKll Krapcho et al., International Patent
Application WO 92/15195, 1992
DK12 Kra~pcho et al: , Internatianat Patent
Application WO 92115195, 1992
~c-agatoxin Skizmer et al., J. Biol. Chem. 264:
2150-2155, 1989; Adams et al., J.
Biol'. Chem. 265: 861-867, 1990
King Kong toxin Hillyard et al., Biochem. 28: 358-
361, 1989
Pt6 Leisy et al. ; European Patent
Application EP 0556160 A2, 1993
NPS-326 Krapcho et al., International Patent
Application WO 93/15192, 1993
1 o NPS-331 Kra~phco et al. , International Patent
Application WO 93/15192; 1993
NPS-373 Krapcho et al., International Patent
Application WO 93/15192, 1993
Tx4(6-1) Figi~eriredo et al., Toxicon 33: 83-93,
1995
TxP-1 Tomalski et al., Taxicon 27: 1151-
116'7, 1989
w-atracotoxins Atkinson et al., International Patent
Application WO 93/15108, 1993
a-conotoxins Gray et al. , J. Biol. Chem. 256:
4734-4740, 1981; Gray et al. ,
Bio~;hem. 23: 2796-2802, 1984
CA 02331853 2000-11-07
WO 99/58705 PCT/US99/09914
w-conotoxins Cru:a et al., J. Biol. Chem. 260:
9281-9288, 1989; Cruz et al.,
Biocvhem. 28: 3437-3442, 1989
chlorotoxin Debin et al., Am. T Physiol. 264:
361 ~-369, 1993
c,~-conotoxins Olivera et al., Biochem. 23: 5087-
5090, 1984; Rivier et al., J. Biol.
Chern. 262: 1194-1198, 1987
The toxin-encoding sequence is operably linked to a promoter, i. e. , a
5 promoter sequence is placed upstream of the toxin-encoding sequence so that
expression of
the toxin is under the control of the promoter. The promoter may be a
baculovirus-derived
promoter, such as, e.g., DA26, 35K, 6.9K, and polyhe~3rin {polh) promoters
(O'Reilly et
al., J. Gen. carol. 71:1029 (1990); Friesen et al., J. W ol. 61:2264, 1987;
Wilson etal.,
J. ~rol. 61:661-666, 1987; Hooft van Iddekinger et al., ~rol. 131:561, 1983;
and see,
10 generally, Miller, ed., TheBaculoviruses, Plenum Press, New York, 1997):
Alternatively,
a host cell promoter may be used, such as, e.g., an insect-derived hsp70
promoter or actin
promoter. Any native or synthetic promoter active in promoting transcription
in target
insect cells may be used.
Furthermore, the DNA sequence encoding; the toxin may comprise the native
upstream sequence encoding the signal peptide which, in its cell of origin,
directs secretion
of the toxin. Alternatively, the toxin-encoding sequence may be fused in-frame
with an
upstream DNA sequence encoding a heterologous signal sequence, i.e., a
sequence derived
from another source, including without limitation sequences derived from the
pBMHPC-12
signal sequence fmm Bombyx mori, the adipokinetic. hormone signal sequence
from
2 0 Manduca sexta, the apolipophorin signal sequence from .Martduca sexta, the
chorion signal
sequence from Bombyx rnori, the cuticle signal sequence from Drosophila
melanogaster,
the esterase-6 signal sequence from Drosophila melano~aster, and the sex-
specific signal
sequence from Bombyx mori, all of which are disclosed in U.S. Patent No.
5,547,871.
In some embodiments, the recombinant PxNPVs of the invention have
2 5 incorporated within their genome a gene encoding wild-type or mutant
juvenile hormone
esterase (JHE), expression of which can cause irreversible termination of the
feeding stage
and pupation and thus result in death of the target insect. See, e.g., WO
94!03588.
CA 02331853 2000-11-07
WO 99/58705 PCTIUS99109914
11
Recombinant PxNPVs may also be produced by genetically altering a wild-
type or pre-existing recombinant PxNPV strain in a manner that results in the
modification
of one or more viral-encoded functions. For example, one or more viral genes,
such as,
e.g., those encoding the viral polyhedrin protein, ecdysteroid glucosyl
tra.nsferase (EGT),
or p10 protein may be modified, deleted, or duplicated. Furthermore, viral-
encoded
sequences derived from other baculaviruses may also be introduced, such as,
e.g., the
region from the V8 strain of AcMNPV which carries a determinant that results
in a faster
killing phenotype, as disclosed in U.S. Patent No. 5,662,897.
Non-limiting examples of recombinant PxNPVs according to the invention
s 0 include those having ATCC deposit numbers VR 2607,'VR 2608, and VR-2609.
The present invention provides methods and compositions for the
construction of recombinant PxNPVs. Any method known in the art may be used to
construct recombinant PxNPVs. For example, co-infection of an appropriate host
cell with
two strains of PxNPV may result in homologous recombination in viyo between
related
sequences, resulting in the formation of a recombinant PxNPV. Similarly;
homologous
recombination can occur in vivo in cells co-transfected with purified PxNPV
viral genomic
DNA and a second nucleic acid containing PxNPV sequences. Alternatively,
recombinant
PxNPV s may be pr~luced by introducing into a cell isolated viral genomic DNA
which had
been previously modifed in vitro.
2 0 In one series of embodiments, recombinant PxNPVs are formed by the use
of direct ligation vectors and modular expression vectors. These components,
and methods
for using them to form recombinant PxNPVs, are descr7ibed below.
PxNPV-Derived Direct LlQatiOn Vectors
2 5 Direct ligation virus vectors comprise purified PxNPV viral genomic DNAs
which can be used to construct recombinant PxNPV genomes by DNA ligation in
vitro.
Direct ligation vectors direct the production of recombinant PxNPV virions
when
introduced into an appropriate host cell. In some embodiments, PxNPV direct
ligation
vectors comprise PxNPV genomic DNA that has been modified to incorporate at
least one
3 0 cloning site not present in wild-type PxNPV. A cloning site comprises one
or more
restriction sites which are either absent from wild-type :PxNPV genome or are
not found
within the nucleic acid encoding or regulating an essential PxNPV viral
function. In the
CA 02331853 2000-11-07
WO 99/58705 PCT/US99/09914
12
latter case, the direct ligation vectors of the invention .are engineered to
delete any such
restriction sites which lie outside the cloning site, so that the cloning site
comprises at least
one unique restriction site. Digestion of a direct li~;ation vector using one
or more
restriction enzymes specified by the cloning site thus produces a DNA
preparation into
which a heterologous nucleic acid segment can be introduced, usually in a
single ligation
step, without disrupting an essential viral function. Following Iigation of a
heterologous
nucleic acid into a direct ligation vector, the resulting DrdA preparation may
be introduced
into an appropriate host cell for propagation of recombinant P~TPV. Direct
ligation
vectors simplify the production of recombinant PxNPVs by obviating the
dependence on
in vivo recombination events to form recombinant viruses. See, e.g.,
International Patent
Application WO 94/28114.
Cloning sites for use in PxNPV direct ligation vectors are designed by first
selecting one or more restriction enzymes that either (i) ~do not digest PxNPV
DNA at all
or (ii) recognize a small number of sites that do not lie within the nucleic
acid encoding or
regulating an essential PxNPV viral function. The selection is performed by
(i) searching
the PxNPV DNA sequence computationally or (ii) subjE~ting PxNPV DNA to
digestion
with the enzymes) and detecting the presence or absence of digestion products.
If the
enzyme recognizes a small number of sites, these sites may be disrupted, using
conventional
techniques (such as, e.g., restriction enzyme digestion followed by blunt-
ending and re-
2 0 ligation) to produce PxNPV DNA that lacks the sites but supports viral
replication and
infectivity.
After selection of one or more restriction siites, the cloning site is
introduced
into PxNPV DNA (whether wild-type or modified as described above to inactivate
one or
more restriction sites} by any appropriate means, includirng homologous
recombination in
vivo or ligation in vitro. Preferably, the cloning site vncludes at least non-
overlapping
restriction sites to allow (i) directional cloning of an insert nucleic acid
and/or (ii)
independent insertion of multiple insert nucleic acids.
To form direct ligation vectors from PxN~PV, other mod~cations may be
introduced, including without limitation those that result in inactivation of
a viral gene, such
3 0 as, e.g., that encoding polyhedrin, ecdysteroid glucosyl transferase (EGT)
or p10 protein.
In some embodiments, the cloning site is introduced u~ a location that results
in such
inactivation.
CA 02331853 2000-11-07
WO 99/58705 PCT/US99/09914
13
Modular Expression Vectors and Expression Cassettes:
Modular expression vectors for use in the present invention are plasmid
vectors containing an expression cassette which can be excised from the
modular expression
vector and ligated into the PxNPV direct ligation vectors described above.
Typically, the
expression cassette comprises, in a 5' = to - 3' directian: a promoter
sequence operably
linked to a S' untranslated region {IJllt) which includes the transcription
start site; a
sequence containing one ar more restriction sites to facilitate insertion of a
heterologous
gene (this sequence is designated an "insertion site"); and a 3' UTR sequence
containing
at least a site for 3' terminal mRNA processing and polyadenylation. The
expression
cassette is flanked on either end by appropriate restriction sites compatible
with a PxNPV
direct ligation vector.
Suitable promoters for use in modular expression vectors include baculovirus
promoters and host cell promoters. Suitable baculovirus promoters include,
without
limitation, DA26, 35K, 6.9K, and polyhedrin {polh) promoters. Suitable host
cell
promoters include without limitation hsp70 and actin promoters, preferably
derived from
an insect species. Sequences "derived from" a promoter sequence encompass
modifications, including deletions, insertions, substitutions and
duplications, of native
promoter sequences. The only requirement is that the final promoter function
effectively
in a target insect cell to direct the expression of the lheterologous gene to
which it is
2 0 operably linked.
Expression cassettes may also include sequences encoding signal sequences,
which direct the secretion of the heterologous protein. T'he signal sequences
may be those
associated with the heterologous protein or may be derived from a different
protein.
Suitable signal sequences include, without limitation, those derived from the
pBMHPC-12
2 5 signal sequence from Bombyx mori; the adipokinetic hormone signal sequence
from
Manduca sexta; the apolipophorin signal sequence from Manduca sexta; the
chorion signal
sequence from Bombyx mori; the cuticle signal sequence; from Drosophila
melanogaster;
the esterase-6 signal sequence from Drosophila melanagaster; and the sex-
specific signal
sequence from Bombyx mori. A nucleic acid sequence encoding the signal peptide
is
3 0 inserted between the 5-UTR and the start of the mature heterologous
protein. The junction
between the 3' terminus of the signal peptide-encoding se~~uence and the start
of the mature
heteralogous protein is designed so that insertion of the heterologous
sequence results in an
CA 02331853 2000-11-07
WO 99/58705 PCT/US99/099I4
I
in-frame fusion protein between the signal peptide and the heterologous
sequence.
Sequences "derived from" a known signal sequence encompass modifications,
including
deletions, insertions, and substitutions, of amino acid residues within the
signal sequence.
The only requirement is that the resulting sequence function effectively in a
target insect
cell to direct the secretion from the insect cell of the heterologous sequence
to which it is
linked.
Iieterologous sequences for use in the present invention include, without
limitation, those encoding insect-modifying substances, such as, e.g.,
insecticidal toxins,
hormones, enzymes, and receptors. Suitable insecticidal toxins include without
limitation
AaIT, AaHITl, AaHIT2, LqhiT2,. LqqITI, LqqIT2; IBjITl, BjIT2, LqhP35, LqhaIT,
SmpIT2, SmpCT2, SmpCT3; SmpMT, DK9.2, DKll, DKl2, ~c-agatoxin, King Kong
toxin, Pt6, NPS-326, NPS-331, NPS-373, Tx4(6-1), TxF~-1, c,~-atracotoxins, a-
conotoxins,
~u-conotoxins, chlorotoxin and c~-conotoxins.
The nucleic acid sequences encoding the insect-modifying substances and/or
the signal peptides may correspond to the native nucleic acid sequences
encoding these
peptides. Alternatively, the sequences may be altered to take into account the
optimal
codon usage for known genes in either the virus vector (or closely related
strains) andlor
in the insects that are the targets of the insecticidal viruses of the
invention. Codon
optimized sequences, i.e., sequences in which the nucleic acid sequence
encoding a
2 0 particular amino acid has been modified without changing the amino acid
encoded at that
position, may be designed using methods well-known in the art, such as, for
example, by
comparing colon usage in known gene sequences in the virus andJor in the
target insect and
in the nucleic acid sequences encoding the signal peptides and insect-
modifying substances
of the invention. Preferably, colon usage in the sequences encoding the signal
peptides and
2 5 insect-modifying substances reflects the colon usage of the virus vector
or the target insect.
Examples of colon-optimized toxin sequences are shown in Figures 10 and I I.
Production of Recombinant PxNPVs
Recombinant PxNPVs may be produced by either (i) co-transfecting PxNPV
3 0 DNA and a heterologous sequence into an appropriate host cell, to allow
for homologous
recombination in vivo or (ii) ligation in vitro of a heterologous sequence
into a direct
ligation vector, followed by introduction of the construct into an appropriate
host cell to
CA 02331853 2000-11-07
WO 99/58705 PCT/US99/09914
allow for viral propagation. Appropriate host cells are any cells that support
baculovirus
replication, including without limitation Sf9 cells, S.~P11 cells, and High
Fiver"" cells
(Invitrogen, Carlsbad CA). An isolated virus according to the invention is one
which has
been cloned through plaque purification in tissue culture, for example, or
otherwise
5 prepared from a single viral genotype.
Typically, a modular expression vect~ar is constricted to contain an
expression cassette in which a suitable promoter sequencx is operably linked
to a sequence
encoding a heterologous protein, i. e. , expression of the heterologous
protein is placed under
the control of the promoter. The expression cassette is excised from the
modular expression
10 vector and inserted into a PxNPV direct ligation vector by DNA ligation in
vitro. The
ligation mixture is then transfected into an appropriate host cell.
Recombinant PxNPVs are
recovered from the growth medium and characterized for LCsa and LTso using any
conventional method, including without limitation diet ovezlay assays, diet
incorporation
assays, and leaf dip assays.
15 LCso is the concentration of virus at which 50 % of infected larvae are
dead
within the duration of the test period. LTso is the time after infection when
50 % of the
infected larvae are dead when exposed to a specified dose of virus.
Preferably, PxNPVs according to the invention exhibit an LCso of about 1
x 105 OBs/ 16cm2 or less on Plutella xylostella larvae when measured using the
standard
2 o diet overlay assay as described in Example 6 below. Other baculovirus
isolates typically
exhibit higher LCsos on Plutella xylostella larvae, i.e., they are less
efficacious, relative to
their infectivity for other insect species.
Insecticidal Compositions and Formulations
2 5 The present invention provides insecticidal compositions and formulations
that include one or more recombinant PxNPVs. Preferably, the recombinant
PxNPVs of
the invention kill Plutella xylostella larvae more effectively than wild-type
PxNliV or
recombinant versions of other baculoviruses (see, e.g., lExample l I below).
An insecticidal composition according to the invention includes at least one
3 0 recombinant PxNPV. An insecticidal formulation connprises at least one
recombinant
PxNPV in an insecticidally effective amount and an agriculturally suitable
carrier. An
insecticidally effective amount is an amount that causes a detectable
reduction in the
CA 02331853 2000-11-07
WO 99/58705 PCT/US99/09914
1~
infestation, as manifested in the number or amount of the insect pests in a
given area or
amount of a crop; the damage caused by the insect pests; or any other
appropriate parameter
of infestation. The formulations may be in the form of wettable powders,
dispersible
granular formulations, granules, suspensions, emulsions, solutions for
aerosols, baits, and
otherconventional insecticidepreparations. Suitable carriers are, without
limitation, water,
alcohol, hydrocarbons or other organic solvents, or a mineral, animal, or
vegetable oil, or
a powder such as talc, clay, silicate, or kieselguhr. Wetting agents, coating
agents, UV
protectants, dispersants, and sticking agents may also be included. A nutrient
such as a
sugar may be added to increase feeding behavior and/or attract insects. Flow
agents such
as, for example, clay-based flow agents, may be added to minimize caking of
wettable
powders or other dry preparations. The compositions ma;y be formulated as
coated particles
or as microencapsulated material. The formulations must be non phytotoxic and
not
detrimental to the integrity of the recombinant PxNPV contained therein, nor
should any
components significantly deter insect feeding or any viral functions.
Exemplary
formulations are disclosed in EP published application Ofi97 i70 Al; PCT
application WA
92/19102; and U.S. Patent No. 4,948,586.
The insecticidal formulations of the invention may also include one or more
chemical insecticides andlor one or more non-PxNPV biological control agents.
Chemical
insecticides include without limitation pyrethroids, pyrazolines,
organophosphates,
2 o carbamates, formadines, and pyrroles, all of which are arell-known in the
art. Exemplary
compounds are disclosed in PCT applications 96/03048, 96/01055, and 95/95741.
Biological control agents include, e.g., non-PxNPV bacu:loviruses (native or
recombinant);
Bacillus thutzngiensis; Nosema polyvora; M. grandis; Bracon mellitor;
entomopathogenic
fungi; and nematodes.
2 5 The present invention also provides methods for killing insect pests. The
methods comprise contacting the insects with an insecticide-effective amount
of the
compositions or formulations of the invention. The invention also provides
methods for
reducing insect infestation of, e.g., a crop, which comprise administering to
a desired locus
an insecticidally effective amount of the compositions or formulations of the
invention. The
3 0 insecticidal formulations are administered using conventional techniques,
such as, e. g. ,
spraying or dusting crops. Typically, the formulations are administered at
dosages of
between about 2.4 X 10$ and about 2.4 X 10'Z OBslhectare (OBs are occlusion
bodies).
CA 02331853 2000-11-07
WO 99158705 PCT/US99109914
17
Effective dosages depend on, for example, the insect tar,~;et, the recombinant
PxNPV used,
and the plant crop being treated. The dosages comprising an insecticidally
effective amount
can be determined by those of ordinary skill in the art easing conventional
methods.
Description of the Preferred Embodiments
The following examples illustrate the invention without limitation.
Example 1: Construction of Egt-Deleted~3-Galactosidasa~Containing Recombinant
PxNPV
The following experiments were performed to produce a recombinant
PxNPV in which the viral ecdysteroid glucosyl transferase (egt) gene had been
deleted and
replaced with an E. coli ~i-galactosidase (~i-gal) marker gene.
A stock of wild-type PxNPV that had been passaged through insects was
plaque purified using conventional procedures as described in O' Reilly et al.
(Baculovirus
Expression Vectors: ALaboratoryManual, Oxford University Press, New York, NY,
1994)
to produce a clonal stock of virus for genetic engineering. The integrity of
this stock,
designated PxNPV-3, was confirmed by comparison of restriction enzyme patterns
to the
parental stock of PxNPV. Bioassays against a panel of iinsect species also
confirmed that
its vin~lence matched the uncloned stock.
2 0 Figure 1 illustrates the procedure used to construct a transfer vector for
use
in disrupting the egt gene in PxNPV by insertion of a ~~i-galactosidase gene.
The close
similarity of the restriction enzyme patterns of AcNPV aJnd PxNPV indicated
homology at
the DNA level which enabled the use of transfer vectors teased on the V8
strain of AcNPV,
which is disclosed in U.S. Patent No. 5,662,897. A vector comprising the (3-
gal cassette,
designated pmd 216.1, was constructed as follows. A Bam HI-to-Xba I fragment
containing the ~i-gal gene under control of the Drosophila melanogaster hsp 70
promoter
was isolated from pAcDzl (Zuidema et al., J. Gen. Virol. 71:2201 (1990)). This
fragment
was then subcloned into pBluescriptT~" SK+ (Stratagene, La Jolla, CA) between
the Bam HI
and Xba I sites of the polylinker. The Pst "G" fragment of AcNPV strain
VBvEGTDEL,
3 0 which contains the egt gene and surrounding region (see, 'U. S. Patent No.
5, 662, 897), was
then subcloned into the polylinker of pUC 9 at the Pst I site. The resulting
plasmid was
designated pmd 205.1.
CA 02331853 2000-11-07
WO 99/58705 PCT/US99/09914
18
The final transfer vector was constructed by performing a four-fragment
ligation between (i) pBluescriptT"" SK+ digested with Bam HI and Pst I which
had been
dephosphoryiated with calf intestinal phosphatase; (ii) the 0.975 kb Bgl II-to-
Pw B
fragment of pmd 205.1; (iii) the 3.86 kb Sma I-to-Xba I ~i-gal fragment of pmd
216.1; and
(iv) the 1.6 kb Xba I-to-Pst I fragment of pmd 205.1.. The resulting transfer
vector,
designated pmd 220.2, contains an hsp 70-driven (3-gal marker gene cloned into
the site of
the egt deletion.
An egt-deleted ~i-gal marked PxNPV was constructed by homologous
recombination between pmd 220.2 and PxNPV-3 DNA cotransfected into cultured Sf
9
l0 cells. I ~cg of pmd 220.2 DNA and 250 ng of PxNPV-3 DNA were mixed with 25
~,g of
Lipofectin (Gibco BRL, Gaithersburg MD) in a final volLume of 200 ul of TNM-FH
(JRIi
Biosciences, Lenexa KS). After incubation at room temperature for 15 minutes,
the
mixture was brought to a final volume of 2.0 ml with TNM-FH complete media
(TNM-FH
plus IO % fetal bovine serum and 1 % pluronic F68 (Gibco BRL, Gaithersburg,
MD)). The
mixture was overlaid on 2.75 x I05 Sf 9 cells which had been plated in a well
of a standard
6-well tissue culture plate. Cells were refed with fresh media at 24 hours and
budded virus
was harvested after an additional 96 hours. Recombinant viruses were occlusion
body
positive (occ+) and expressed the (3-gal gene. Recombinants (occ-+-/blue
plaques) were
identified by three rounds of plaque purif cation in the presence of 100
~cg/ml 5 bromo-4-
2 0 chloro-3-indolyi-~3-D-galactopyranoside (X-gal). The resulting virus was
designated T96-
19.1.1.1.
Example 2: Construction of an EEt-Deleted Direct l~igation PxNPV Viral Vector
The following experiments were performied to construct a direct ligation
2 5 vector derived from PxNPV (see, e. g. , International Patent Application
US 94!06079).
This vector contains a polylinker (designated "Bsu-Sse linker", see below)
inserted into the
PxNPV genome at the egt site.
Two oligonucleotides were synthesized to form the Bsu-Sse linker, having
the sequences:
3 0 5'- CCTCAGGGCAGCTTAAGGCAGCGGACCGGCA(iCCTGCAGG -3' (Oligo 32) and
5'- CCTGCAGGCTGCCGGTCCGCTGCCTTAAGCTGCCCTGAGG -3' (Oligo 33)
CA 02331853 2000-11-07
WO 99/58705 PCT/US99/09914
19
Once annealed, these two oligomers encode several restriction endonuclease
sites, including Bsu 36I and Sse 83871 sites, useful in the construction of
recombinant
viruses. Each was diluted to a concentration of 30 lpmol/~cl into an annealing
buffer
containing 10 mM Tris-HCl (pH 7.5), 100 mM NaCI and 1 mM EDTA. The mixture was
heated to 95°C for 10 minutes and then slowly cooled ~to room
temperature over several
hours.
The annealed oligonucleotides were inserted into the pmd 205.1 transfer
vector as follows. The pmd 205.1 vector was digested with Spe I, which cuts at
a single
site located just upstream of the egt deletion (Figure 2). The ends of the
digested pla.smid
were filled in using the Klenow fragment of DNA polyrrierase I in the presence
of all four
nucleotides. 100 ng of the linearized plasmid were then ligated to 15 pmol of
the double
stranded linker with T4 DNA ligase in a total volume of 10 ~d. After the
ligation reaction
was complete, the T4 ligase was heat inactivated and the rriixture was treated
with
polynucleotide kinase. The 8. 8 kb DNA band was purified by electrophoresis in
a 1 % low
s5 melt preparative grade agarose gel (BioRad, Richmond VA). The gel slice
containing the
8. 8 kb linear DNA was melted at 65°C and an in-gel ligation using
approximately 1 / 10 of
the gel slice was used to recircularize the DNA, which was then used to
transform E. coli
DH5 a cells.
The resulting plasmids were screened using polymerise chain reaction (PCR)
2 0 to determine the orientation of the Bsu-Sse linker relative to the egt
gene. Oligos 32 and
33 were separately paired with oligomer EGT 1 {5'-
GCGGCCAATATATTGGCCGTGTTT -3'), which is sprxific for the region of the egt
gene
5' to the deletion. The orientation of the Bsu-Sse linker vn LAB 50.2 is
indicated in Figure
2.
2 5 An egt-deleted direct ligation PxNPV vector was constructed by homologous
recombination between LAB 50.2 and T96-19.1.1.1 PxNPV viral DNA that had been
co-
transfected into cultured Sf9 cells as described in Example l, using 1 ~.g of
LAB 50.2 and
250 ng of T96-19.1. I .1 viral DNA. In this case, recombinant viruses were
occlusion body
positive and did not express the ~3-gal gene. Recombinant (occ+/white) viruses
were
3 0 identified by three rounds of plaque purification in the presence of 100
~cg/ml X-gal. The
resulting virus was named T97-8.1.1.1 (ATCC deposit no: VR-2608).
CA 02331853 2000-11-07
WO 99/58705 PCTIUS99109914
Example 3: Construction of Modular Ex,~ression Vectors Useful for Production
of
Recombinant PxIVPVs
A. .pMEV 1-4
The design, construction and usage of vectors pMEV l, pMEV2, pMEV3 and
5 pMEV4 for the expression of foreign genes under the control of baculoviral
promoters are
disclosed in International Patent Application US 94/060 79. These vectors have
the general
structure shown in Figure 3. Each vector was derived from the pBluescript SK+
plasmid
(Stratagene, La.~Jolla CA) by substituting the region between the Sst I and
Xho I sites in the
pBluescript polylinker with an expression cassette composed of the following
elements: (i)
a short synthetic linker DNA with recognition sites for restriction enzymes
Sst I, Sse 8387
I and Stu I; (ii) a promoter module, which consists of the promoter and
complete 5'
untranslated region (UTR} of a selected AcMNPV viral gene; (iii) a polylinker
module, to
facilitate insertion of a protein coding region of interest; (iv} a 3' UTR
module, which
consists of the complete 3'-untranslated region of the AcIVINPV 6.9K (basic
protein) gene;
15 and (v) a short synthetic linker DNA with recognition sates for restriction
enzymes Stu I,
Bsu 36 I and Xho I.
As shown in Figure 4, the promoter modules in vectors pMEVl through
pMEV4 are derived from genes that are expressed at diffi~rent stages in the
virus life cycle.
The DA26 gene promoter module in pMEV 1 and the 35K gene promoter module in
pMEV4
2 0 are derived from genes that are expressed early in the virus life cycle;
that is, before the
onset of DNA synthesis. The 6.9K gene promoter module in pMEV2 is derived from
a
"late" structural gene, which is expressed after the onset of DNA synthesis,
and the
polyhedrin (polh) gene promoter module in pMEV3 is from a "very late" gene
that encodes
the major structural component of viral occlusion bodies.
The polylinker module,is designed to alla~w placement of a protein coding
region immediately adjacent to the 5' UTR of the promoter module without the
introduction
of extraneous linker sequences. As shown in Figure 5, the polylinker contains
an Esp3 I
site which is positioned so that digestion of the vector with Esp3 I cuts
between positions
-4 and -5 in the top strand of the promoter module ,and at the junction
between the
3 o promoter and polylinker modules in the bottom strand. Treatment of Esp3 I-
digested DNA
with DNA polymerase in the presence of the four standard :Z' -deoxynucleoside
triphosphates
(dNTPs) creates a linearized vector that is blunted at the exact 3' terminus
of the promoter
CA 02331853 2000-11-07
WO 99!58705 PCT/US99/09914
21
module. This segment can be joined to a 5' blunt-ended fragment whose sequence
begins
with the ATG initiation codon of the desired protein codvng region. To
facilitate directional
cloning of the protein coding fragment, the 3' terminus of the fragment is
constructed so
that it contains a recognition site for one of the enzymes that cleave within
the polylinker
module (illustrated with BamH I in Figure 5) and both the protein coding
fragment and
vector are digested with this enzyme prior to ligation.
A key feature of these vectors is the presence of recognition sites for
restricrion enzymes Sse8387 I and Bsu36 I at either end of the expression
cassette. This
allows for the excision of inserted sequences from the modular expression
vector and their
to ligation into the direct ligation PxNPV vectors of thepresent invention
(see, e.g., Example
2 above).
B. pMEV~ and pMEVf~
Two vectors, pMEVS and pMEV6, were constructed to incorporate a D.
melanogaster hsp70 (major heat shock) gene promoter. pMEVS contains a 724 by
segment
of the D: melanogaster hsp70 promoterl5' UTR (de:~ignated hsp70Bam in Figure
4)
extending from position -493 to position +231- with respect to the
transcription start site of
the hsp70 gene. pMEV6 contains a 475 by segment of the same promoterl5' IJTR
(designated hsp70Xba in Figure PD2), extending from position -244 to position
+231.
2 0 The promoter modules used to construct pMEVS and pMEV6 were
synthesized by PCR amplification using plasmid phcHSP70PL (Morris et al. , J.
~rol.
6b:7397 (1992)) as the template. The oligonucleotide primers for each reaction
and the
sequence of the amplified product are shown in Figures fi and 7 (for pMEVS and
pMEV6,
respectively). Each of the primers has a bipartite structure. The 5' portion
has no sequence
homology with the phcHSP70PL template and is used to incorporate specific
restriction
sites into the termini of the final PCR product. These ini;lude the Sst I,
Sse8387 I and Stu
I sites at the 5' end of the PCR product and the Esp3 I and Xba I sites at the
3' end of the
PCR product (see Figures b and 7). The 3' portion of each primer contains
sequences
homologous to the phcHSP70PL template and defrnes one of the tmundaries of the
hps70-
3 0 specific sequences in each module.
CA 02331853 2000-11-07
WO 99/58705 PCT/IJS99109914
22
Prior to the PCR reactions, the (-) strand primer (IEiSP70Esp) was
phosphorylated at
its 5' terminus by incubating 200 pmol of primer for 30 min at 37°C in
a 10 ml reaction
containing 70 mM Tris-HCl (pH 7.5), IO mM MgCl2, 5 mM DTT, 1 mM ATP and 10
units T4 polynucleotide kinase (New England Biolabs, Beverly MA). The PCR
xeactians
were then performed in separate MicroAmp tubes (Perkin Elmer, Norwalk CT)
according
to the following procedure. 50 pmol of each primer ways combined with 0.25 -
1.0 ng of
phcHSP70PL DNA in a 50 ~cl reaction containing 2;0(? ~cM dNTPs; 1X cloned Pfu
polymerise buffer (Shatagene, La Jolla CA) and 5 units of cloned Pfu DNA
polymerise
(Stratagene, La Jolla CA). The samples were placedl in a Perkin-Elmer Model
9600
thermal cycler (Perkin Ehner, Norwalk CT) and subjected to 2 cycles of 1 min
at 94°C
(denaturation step), 1.5 min at 50°C (annealing step) and 3 min at
72°C (extension step)
followed by 28 cycles of 1 min at 94° C, 1.5 min at 55 ° C and 3
min at 72 ° C. On the last
cycle, the extension reaction was carried out for an additional 7 min and the
reactions were
brought to 4°C. The amplification products were extracted once with
phenol:chloroform:isoamyl alcohol (25:24:1), adjuste~3 to 0.3M sodium acetate,
and
precipitated with ethanol.
After dissolution in a suitable reaction buffer, the DNA was digested with
Pst I (which cleaves at the Sse8387 I site) and the fragments containing the
presumptive
hsp70 promoter modules were purified by electrophoresis on a 1.2 ~ low melt
preparative
2 0 grade agarose gel (BiaRad, Richmond, CA). The base vextor fox constructing
pMEVS and
pMEVb was prepared by cleaving pMEV l with EcoR :f and filling in the ends
with the
Klenaw fragment of DNA polymerise I in the presencE; of all four dNTPs.
Following
secondary digestion of the vector by Sse8387 I and dephosphorylation of the
termini with
calf intestine alkaline phosphatase, the large (3.1 kb) fragment containing
the pBluescript
backbone and the 3' UTR and polylinker modules was purified on a low melt
agarose gel
and ligited individually with the purified hsp70 promoter modules to form
pMEVS and
pMEV6.
C. nMEVS/ADK-AaIT and pMEV6/ADK-AaIT'
3 fl The pMEVS and pMEV6 vectors described above were further engineered
to incorporate the gene encoding AaIT, an insect-specific toxin that is
expressed in the
venom of the North African scorpion Andoctuonus australis (Hector) (Zlotkin et
al. ,
CA 02331853 2000-11-07
WO 99/58705 . PCTIUS99/09914
23
Biochimie 53:1073 (I971)). When AaIT is injected into the body cavity of an
insect larva,
it binds selectively to voltage-sensitive sodium channels and causes a
transitory contractile
paralysis. Chronic administration ofthe toxin, which can be achieved by
infecting insect
larvae with AaIT producing baculoviruses, is associated with a prolonged state
of paralysis
and eventual death {Stewart et al., Nature 352:85 (19~>1); Maeda et al.,
Virol. 184:777
(1991); McCutchen et al., Biotecycnol. Q:848 {1991)). U. S. Patent 5;547,871
discloses a
codon-optimized ADK-AaiT gene sequence in which secretion of the AaIT toxirn
is directed
by a signal peptide from the Manduca sexta adipolzinetic hormone {ADK) gene.
The
insertion of the ADK-AaIT coding region into the pIVJtEV I - pMEV4 vectors (to
yield
pla.smids pMEV lIADK-AaIT - pMEV4/ADK-AaITJ is disclosed in International
Patent
Application US 94/06079.
To construct the pMEVS and pMEV6 derivatives encoding ADK-AaIT, a
fragment containing the ADK-AaIT gene sequence was synthesized by PCR using
pMEV3/ADK-AaTT as a template. The (+) strand primer, designated PD30, begins
at the
initiator ATG codon of the ADK signal peptide. The (-) strand primer,
designated 69K3UT,
was chosen so that it primes DNA synthesis at a location downstream of the
polylinker
module; that is, within the 3'UTR of pMEV3lADK-AaIT. The sequences of the
primers
and the amplified DNA fragment are presented in Figure 8.
Prior to amplification, the 5' terminus of t:he (+) strand primer, PD30, was
2 0 phosphorylated as described above for HSP70Esp. The IPCR reaction was also
carried out
as described above, except that the amplification was performed for 25 cycles
of 1 min at
94 ° C, 1.5 min at 52 ° C, and 3 min at 72 ° C. After
synthesis, the DNA was digested with
BamH I, which cuts in the polylinker module, and the 274 by 5'-blunt/3'-BamH I
fragment
containing the ADK-AaIT coding region is inserted unto pMEVS and pMEV6. The
2 5 structures of the resulting plasmids, pMEVS/ADK-Aai'.C and pMEV6lADK-AaIT,
were
confirmed by restriction enzyme analysis and partial DNA sequence
determination.
D. MEVS vectors containing an ADK: signal"peptide module
The following experiments were performed to produce a series of modular
3 0 expression vectors that contain DNA encoding the ADK signal peptide {see
above) that can
be used to direct the secretion of any inserted sequence. A series of vectors
(designated
pMEVIIADK through pMEV6/ADK) was constructed in which the 57 by codon-
optimized
CA 02331853 2000-11-07
WO 99158705 PCTlUS99/09914
24
sequence for the ADK signal peptide (residues 1 - 57 in Figure 8} was placed
between the
promoter and polylinker modules. The expression cassettes in these vectors
have the
general structure shown in Figure 9.
To construct the pMEVx/ADK vector series, a DNA fragment containing the
promoter module and linked ADK signal peptide was recovered from the
corresponding
pMBVx/ADK-AaTT vector by PCR. The (+)-strand primer for each reaction was a
promoter specific oligonucleotide that primes DNA synthesis at the 5' end of
the promoter
module and incorporates restriction sites for Sst I, Sse8387 I and Stu I into
the 5' end of
the amplified fragment. The templates and (+) strand primers for each reaction
are listed
in the following table:
Tem late Primer S ,_ uence,
pMEVIIADK- DA26FZ 5'- AGCAGCGAGCTCCTGCAGGCCTACGCGT
AaIT AATTCGATATAGAC -3'
pMEV2lADK- 69KFZ 5'- AGCAGCGAGC'TCCTGCAGGCCTATGCCG
AaTT TGTCCAATTGCAAG -3'
pMEV3lADK- PHF 5'- AGCAGCGAGC'TCCTGCAGGCCTGACGCA
AaIT CAAACTAATATCAC -3'
pMEV4/ADK- 35KPR01 5'- AGCAGCGAGC'TCCTGCAGGCCTCTTGAT
2 AaIT GTCTCCGATTTC -3'
0
pMEVS/ADK- HSP70Bam 5'- AGCAGCGAGC'TCCTGCAGGCCTGATCCT
AaIT TAAATTGTATCCTA -3'
pMEV6/ADK- HSP70Xba 5'- AGCAGCGAGC'TCCTGCAGGCCTAGAATC
AaIT CCAAAACAAACTIJG -3'
The (-) strand primer for each reaction, designated ADKRev (5'-
CGGATCTAGACACGTCTCGGGCCTCAGCGATAATCACGAAGGC-3'), primes
synthesis from the 3' terminus of the ADK signal peptide and incorporates
sites for Esp3
I and Xba I into the 3' end of the amplified fragment. 7Che PCR reaction was
carried out
3 0 as described above for pMEVS-6, except that the amplifiication is
performed for 25 cycles
of i min at 94 ° C, 1. 5 min at 52 ° C and 3 min at 72 °
C . 'The DNA synthesized from all of
the templates except pMEVSIADK-AaIT was digested with Pst I, which cuts at the
S se8387
I site upstream of the promoter, and Xba I; which cuts. downstream of the ADK
signal
peptide, and the fragment containing the promoter module and signal peptide
was inserted
CA 02331853 2000-11-07
WO 99/58705 PCT/US99/09914
between the Pst I (Sse8387 I) and Xba I sites in one of the existing pMEVx
vectors, such
as pMEVl .
Because the hsp70Bam promoter module in pMEV5 contains an internal Xba
I site, the hsp70BamIADK module must be inserted into pMEVx framework in two
pieces.
S Accordingly, one portion of the DNA synthesized from the pMEV5IADK-AaIT
template
was digested with Pst i and Xho Land a second portion was digested with Xho I
and Xba
I. The Pst IIXho I fragment representing the 5' segment of the hsp74BamIADK
module
was combined with the Xho I/Xba I fragment repr.~senting the 3' segment of the
hsp?OBamIADK module and ligated into a Pst IIXba I vector fragment prepared
from
10 pMEVl.
Each of the resulting pMEVxIADK vectors is identical in structure to the
corresponding pMEVx vector, except for the insertion of the 57 by ADK signal
peptide
between the promoter and polylinker modules.
15 Example 4: Construction of Modular Expression Vectors Encoding Insecticidal
Toxins
The following experiments were performed to produce modular expression
vectors encoding insecticidal toxins suitable for incorporation into
recombinant PxNPVs
according to the present invention.
2 0 A. Tx~I
The straw itch mite toxin TxP-I is a paralytic neurotoxin isolated from the
venom of the predatory straw itch mite, Pyemotes tritici (:Tomalski et al. ,
Toxicon 27:1151
(1989)). The tox34 gene encodes a precursor protein of 291 amino acids
(Tomalski et al. ,
Nature 352:82 (1.991)).
2 5 To test the efficacy of the tox34 gene wilhin the context of a recombinant
PxNPV, three different Txp-1 constructs were prepared which differed in the
amirtoterminal
signal sequence that directs secretion of the toxin from cells. One construct
retained the
native tox34 aminoterminal sequence; one contained an ADK signal peptide in
place of the
aminotenninal 40 residues of the tox34 preprotein; and ane contained the ADK
signal
3 0 peptide in place of the aminoterminal 2b residues of the tox34 preprotein.
Three different segments of the tox34 gene; corresponding to codons 1 - 291
(designated tox34), 27 - 291 (tox34L) and 40 - 291 (tox3~lS) were synthesized
by PCR and
CA 02331853 2000-11-07
WO 99/58705 PCT/US99/09914
26
adapted for cloning into one or more of the modular expression vectors
described above.
The template for the amplification reactions was plasmid pHSP70tox34 (Lu et
al.,
Biological Control 7:320 (1996)). The plus-strand primer for each
amplification is shown
in the following table:
~Ya ent Primer ~, Sequence
tox34 TOX34ATG 5' - ATGAAAATTTGTACAT'1'TT1TATTCC -3'
tox34L TOX34NT1 5' - GTTAAACCTTTTAGGTCTTTTAATAATATTTCC
-3,
tox34S TOX34NT2 5' - GATAATGGCAATGTCGAATCTGTA - 3'
The (-) strand primer, designated TOX34CT2, 5'-
GTACCCCCGGGATCCAATTTAACACAGTCTTGA,ATCACTT-3', primes synthesis
from the 3' end of the tox34 coding region and incorporates restriction sites
for BamH I and
Xma I (Sma I) into the 3' terminus of the amplified fragment. Prior to
amplification; the
5' terminus of each (+) strand primers was phosphorylated usiung the procedure
described
for primer HSP70Esp in Example 3 above. The PCR reactions were carried out as
described in Example 3, except that the cycling consisted) of 2 cycles of 1
min at 94°C, 1.5
min at 45 ° C and 3 min at 72 ° C followed by 28 cycles o:f 1
min at 94 ° C, 1. 5 min at 55 ° C
and 3 min at 72 ° C.
Following synthesis, the DNA was digested with Xma I and the 5'-blunt/3'-
2 0 Xma I tox34 coding region fragments (designated tox34, tox34L or tox34S}
were purified
and cloned into a MEVS vector prepared as describesi in Example 3, except that
the
polylinker was cleaved with Xma I {which cleaves at the Sma I site) rather
than with BamH
I.
The follawing table summarizes the components from which each TxP-I
2 5 expressing MEVS vector was constructed:
Construct Vector Tx -I encoding fra ent
MEVl/Tox34 MEVl tox34
MEVS/Tox34 MEVS tox34
MEV6/Tox34 MEV6 tox34
3 MEV 1 /ADK-Tox34L MEV 1 /ADK tox34L
0
MEV 1 /ADK-Tox34S MEV 1 /ADK tox34S
CA 02331853 2000-11-07
WO 99158705 PCT/US99/09914
27
MEV2/ADK-Tox34L MEV2/ADK tox34L
MEV2/ADK-Tox34S MEV2IADK tox34S
B.
In addition to excitatory toxins, such as AaIT, many Buthinae scorpion
venoms contain a second type of insect-specific toxin that causes a slow,
progressive flaccid
paralysis (Zlotkin et al., Biochemistry 30:4814 (1991)). The best studied
member of this
group is the toxin LqhIT2, which is isolated from the scorpion Leiurus
quinquestriatus
hebreaeus. The cloned cDNA for LqhIT2 reveals a 21 amino acid signal peptide
and three
C-terminal amino acids (Gly-Lys-Lys) that are removed from the taxin post-
translationally
(Zlotkin et al., Arch. Insect Biochem. Physiol. 22:55 (1.993)).
To investigate the ability of the LqhIT2 toxin to improve the insecticidal
activity of PxNPV, a DNA sequence encoding the mature .LqhIT2 toxin was
assembled and
cloned into four different pMEVx/ADK expression vectors: pMEV 11ADK,
pMEV2/ADK,
pMEVS/ADK and pMEV6JADK. The sequence of tlhe toxin coding region shown in
Figure 10 differs from the native cDNA sequence in 27 of 61 codons; these
changes were
introduced so that codon usage in the synthetic LghIT2 coding region reflects
overall codon
usage in the AcMNPV genome (Ayres et al (1994)).
Assembly of the DNA fragment containing the LqhIT2 coding region was
2 0 carried out in several steps. First, four oligonucleotides were
synthesized which
collectively represent both strands of the LqhIT2 coding region and a small
amount of 3'
flanking linker DNA (Figure 10). Prior to use, thE; 5 ° termini of
oligonucleotides
LqhIT2F2 (which. comprises the 3' portion of the (+) strand) and LqhIT2R3
(which
comprises the 3' portion of the (-) strand) were phosphorylated using the
procedure
2 5 described in Example 3. 40 pmol of each oligonucleotide were annealed in
10 ~l of 50 mM
NaCI by heating briefly to 95 ° C and then slowly cooling the mixture
to 60 ° C . The mixture
was adjusted to a total volume of 40 ~cl and the two halves of the LqhIT2
coding region
(LqhIT2Fl: LqhIT2R3 and LqMT2F2:LqhIT2R4) were ligated. Due to the presence of
incomplete synthesis products in each of the oligonucleotides, the initial
ligation produced
3 0 a heterogeneous mixture of fragments ranging from 200 - 1000 by in Length.
The desired
product was isolated from this mixture by PCR, using 0.5 ~cl of the ligation
reaction as a
source of template and oligonucleotides LqhIT2 PCRF {l>hosphorylated at its 5'
terminus)
CA 02331853 2000-11-07
WO 99/58785 pCTNS99/09914
2g
and LqhIT2 PCRR as primers (Figure IO). Amplificaticra was carried out for 25
cycles of
1 min at 94 ° C, 1. 5 min at 55 ° C and 3 min at 72 ° C,
as dc;scribed in Example 3 . Following
synthesis, the DNA was digested with BamH I, which cuts in the linker segment
adjacent
to the termination codon, and the desired 190 by 5'-bluntl3'-BamH I fragment
was purified
by gei electrophoresis and cloned into MEVS vectors pMEVI/ADK, pMEV2JADK,
pMEVS/ADK and pMEV6JADK as outlined in Example 3 and Figure 5. The sequence of
the LqhIT2 coding region in each vector was confirmed by DNA sequencing.
B. w-ACTX-HVl
The w-atracotoxins are a family of insecticidal peptide toxins isolated from
Australian funnel web spiders. One of the best studied members of this group
is w-
atracotoxin-HVl (w-ACTX-HVl), a 37-residue peptide toxin isolated from the
venom of
the Blue Mountains funnel web spider Hadronyche versuta (International patent
application
AU93/00039). c~-ACTX-HVl inhibits insect voltage-gated calcium channels and is
lethal
to Helicoverpa armigera larvae, but it is harmless to newborn mice.
Based on the amino acid sequence of w-A.CTX-HV 1, two oligonucleotides
were designed that represent the two strands of the w-ACTX-HV1 coding'region
and a
small amount of 3' flanking linker DNA. Codon usage within the w-ACTX-HV 1
coding
region is designed to reflect overall codon usage in the AcMNPV genome (Ayres
et al
(1994)): The sequences of these oligonucleotides are shown in Figure 11. Due
to the
length of oligonucleotides ACTXIiVIF and ACTXHV1R, there was a strong
likelihood that
each was significantly contaminated with incomplete synthesis products.
Accordingly, a
PCR strategy similar to that described above far LqhIT2 was used to synthesize
an w-
ACTX-HVl coding region fragment suitable for cloning :into MEVS vectors. In
this case,
2 5 0. I pmol of each oligonucleotide were combined arid used as the template
for PCR
amplification of the desired full length c~-ACTX-HVl product. The primers for
the
reaction were ACTXPCRF (phosphorylated at its 5' terminus as described above)
and
ACTXPCRR. The PCR reaction was performed as described above, except that
amplification was carried out for i5 cycles of 1 min at 94° C, I .5 min
at 55 ° C and 3 min
at 72°C. Following amplification, the DNA was cleaved with BamH I,
which cuts in the
linker segment adjacent to the termination codon, and the desired 118 by 5'-
bluntl3'-BamH
I fragment was purified by gel electrophoresis and cloned into MEVS vectors
CA 02331853 2000-11-07
WO 99/58705 PCTlU599/0991a
29
pMEVIIADK, pMEV2IADK, pMEVS/ADK and pMEV6/ADK. The sequence of the c~-
ACTX-HV1 coding region in each vector was confirmed by DNA sequencing.
Example 5: Construction of Recombinant PxNI'Vs
The following experiments were performed to construct recombinant
PxNPVs encoding insecticidal toxins.
Viral DNA was prepared from occlusion bodies {O'Reilly et al. 1994). The
purified DNA was digested with Bsu 36I and Sse 8387I using an approximately 5
units of
enzymeltcg DNA. Size exclusion chromatography or sucrose gradient purification
was used
to separate the viral genomic DNA from the excised fragment. The resulting
linearized
viral DNA was ethanol precipitated and resuspended in 10 mM Tris-HCl pH 8.0/ 1
mM
F..DTA at a concentration of 0.2 - 1 wgl~,l.
0.5 ~g of the linearized DNA was then ligated with 15 ng of a purified Bsu
36I/Sse 8387I digested fragment from an appropriate ME~,Vs vector in a
reaction volume of
5 ~1 overnight at 15 ° C. The mixture was then used to t:ransfect Sf 9
cells as described in
Example I. The culture was refed with fresh medium 24 hours after
transfection. After
an additional 72 hours, the culture supernatant was harvested, diluted, and
used to re-infect
Sf 9 cells for plaque isolation. Random plaques were pi~;,ked and used to
infect wells of a
48-well plate containing 6 x 104 Sf 9 cells/well in 0.5 mls TNM-FH complete
media.
2 0 Recombinants were identified using primers specific for the inserted gene.
Virus from
plaques giving .positive wells were purified through two additional rounds of
plaque
purification.
The following table provides information on the various recombinant
PxNPVs which have been prepared.
2 V~ _ --__!~ MEVs used
5
PxEGTDEL/35K ADK-AaIT ME~.V4/ ADK-AaIT
PxEGTDEL/hs 70Bam ADK-AaIT ME~,VS/ ADK-AaIT
PxEGTDEL/ DA26 tox34 MBVl/ tox34
PxEGTDELIh 70Bam tox34 ME;VS/ tox34
3 PxEGTDF..L/hs 70Xba tox 34 ME;V6/ tox34
0
1?xEGTDEL/DA26 ADK-tox34S 1VIBV 1/ ADK-tox34S
PxEGTDEL/DA26 ADK-tox34L 1V~,V1/ ADK-tox34L
PxEGTDEL/6.9K ADK-tox34S MEV2l ADK-tox34S
CA 02331853 2000-11-07
WO 99/58705 PCT/US99/09914
Virus M_~Vs used
PxEGTDPL/6.9K ADK-tox34L MEV2/ ADK-tox34L
Ac(V8)EGTDET./DA26 ADK-AaIT MEV41 ADK-AaIT
PxEGTDEL/DA2fi ADK- hIT2 MEV l / ADK-
PxEGTDEL/6.9K ADK- hT>~2 MlEV2/ ADK- hIT'2
5 PxEGTDEL/hs 70 Bam ADK- hIT2 ~ MlEVS/ ADK- hIT2
PxEGTDEL/hs 70 Xba ADK- hIT2 MlEV61 ADK- hIT2
PxEGTDEI,/DA26 ADK-w-ACTX-I3V1 MIEVl/ ADK-w-ACTX-I3V1
PxEGTDEL/6.9K ADK-w-ACTX-I3V1 MlEV2/ ADK-w-ACTX-HVl
PxEGTDEL/h 70 Bam ADK-ca-ACTX-IiV MlEV51 ADK-w-ACTX-HV l
I
10 PxEGTDBL/h 70 Xba ADK-w-ACTX-HV MlEV6/ ADK-w-ACTX-HV 1
1
Example 6: Efficacy of Recombinant PxNPVs F~oressin~ Insecticidal Proteins
The following experiments were performed to test the insecticidal potency
of recombinant PxNPVs according to the present invention.
15 A standard diet overlay assay was perf~armed on second instar Plutella
xyloStella larvae (2-3 days old, 0.15-0.3 mg) to determine the dosage required
to achieve
50% mortality in the test insect population (i.e., the lLCso). Viral stocks
were serially
diluted in 0.01 % sodium dodecyl sulfate and 50 ~cl aliquots of the viral
suspensions were
used to surface contaminate 15 mm round arenas containnng linseed oil-
augmented
20 Stoneville diet (Southland Products Incorporated, Lake Village, AK).
Individual larvae
were placed in each arena and allowed to feed on the contaminated diet for the
duration of
the test. Dead larvae were scored twice daily over the initial three days of
the test then at
least daily until the onset of pupation in six to seven days. Data from
replicates were
pooled and analyzed by probit analysis (Finney, 1952). The median time for
lethality to
2 5 occur {LTso) was determined by probit analysis of the tune to death at a
single dose.
The results are shown in the following tables. For purposes of comparison,
all occlusion body (OB) concentrations are expressed as OBs/lbcm2 of diet.
rPxNPV LCD (OBsI 16cm2) LTso (days) ~ 4.
S x
104
3 PxEGTDELI35K ADK-AaIT 9.34 x 10z 2.69
0
wt PxNPV 5.97 x 10 4.39
D....l.:r ....1..--..._
._~ ~_~ .c___
_ ___ ._____ ..___ b-~-.~--.~v... uu~vv avtraav.awo w~W 1 0.1J~J1VA1111WG1y
.~G aeuvuciuose uea~meEi.
CA 02331853 2000-11-07
WU 9g~58~0$ PCT/US99109914
31
LCo LTso (days)LTso (~Ys)
C~3
rPxNl'V (OBs/ 1 f~m2}Q 4.5 x 4.5 x 104
103
PxEGTDELI 35K ADK AaIT 7 x 102 3
7
. 3.0
PxEGTDEL/hsp70Bam ADK-AaIT6 x 102 3.7
2.7
Ac(V8 EGTDEL/DA26 ADK-AaIT6.3 x 105 ND* 4.0
'
T lvy nor aecermmea
Pmbit values were generated from four replicates with approximatel3r 32
larvae/dose treatment.
These results indicate that (i} the addition of a toxin gene to the PxNPV
s0 genome not only increases the speed of kill of the virus but also
dramatically lowers the
effective LCso on Plutella xylostella larvae; and (iii} recombinant PxNpVs
have a
dramatically lowered LCso with a much faster speed of kill when compared to a
closely
related recombinant AcNPV. Since Plutella xylostella is an important vegetable
pest, this
fording is of critical importance in considering the choice of a recombinant
baculovirus for
use as a biopesticide in the vegetable market.
The following tables present data from assays of recombinant PxrTPV s
expressing a second insect-selective toxin, tox34.
rPxNPV LTso (days) LTso (days)
~4.Sx7t03 ~4.Sx104
2 PxEGTDELIDA26 tox34 4.5 3.4
0
PxEGTDEL/h 70Bam tox34 2.6 1.9
PxEGTDEL/h 70Xba tox34 2.0 1.8
PxEGTDELI DA26 ADK-tox34S 3.7 2.7
PxEGTDEL/DA26 ADK-tox34L 3.1 2.4
2 PxEGTDEL/6.9K ADK-tox34S 2.9 1.6 _
5
PxEGTDEL/6.9K ADK-tox34L 3. 2 1, g
PxEGTDEL/ h 70Bam ADK-AaIT 3.0 ~ 2.2
Drnl.a ....l..e.. .., ._~ ~_~
c____ __
_ .. ___ a_~__~__ .__......_. ...j.....»..,~ ........Z.lavnauaaway .r.4
iamac~uvse LieaCmenL.
--
Mean LCso LTso (days)
G 4.5
r (OBs/16cm2 x 103
PxEGTDEL/ h 70 Xba tox34 0. 8 x 102 2.4
CA 02331853 2000-11-07
WO 99/58705 PCTIUS99/09914
32
PxEGTDEL/hs 70 Bam ADK-AaIT2.9 x 14z 3.3
wt PxNPV 165 x 10'~ 4.6 ~ 4.5 x
104
The data indicate that the increased efficacy of recombinant PxNPVs is not
limited to AaIT-expressing constructs. The tox34 expressing PxNPVs exhibit as
low an
LTso and LCso as the AaIT-expressing recombinant. In some cases (i.e.,
PxEGTDEL/hsp70Xba tox34) expression of tox34 by tlhe recombinant PxNPV results
in
an LTse significantly lower than the AaTF-expressing recombinants.
All patents, patent applications, articles, publications, and test methods
mentioned above are hereby incorporated by reference in their entirety.
Many variations of the present invention will suggest themselves to those
skilled in the art in light of the above detailed description. Such obvious
variations are
within the full intended scope of the invention.
