Note : Les descriptions sont présentées dans la langue officielle dans laquelle elles ont été soumises.
~'~TtCA99tQ08~~3= ~~ ~ ~-%~ ~ c 1SA ~ESC26,
Q i~ NGVE~B-R 199s o ~ . ~ ~ . ~ 9
SELECTIVE TREATMENT OF ENDOTHI~LIAL SOMATOSTA
RECEPTORS
FIELD OF THE INVENTION
The invention is in the field of therapeutic uses for selective peptide and
nonpeptide sornatostatin receptor agonists.
BACKGROUND OF THE INVENTION
Somatastatin {SS) is an endogenous cyclic peptide found in two major native
molecular forms of 28 and 14 amino acids {SS28 and SS 14 respectively, SS was
initially described as a somadomedin release-inhibiting factor, and is
consequently
still called SRIF in some of the literature). SS has disparate, but primarily
inhibitory,
roles in a variety of physiological systems, either acting directly on
cellular functions
or as an antagonist of stimulatory factors {Coy et al. 1993, J pediatric
Endocrinol.
6:205). The multiplicity of effects of SS on physiological processes reflects
both its
widespread distribution in vivo, ~d the existence of multiple SS receptor
subtypes.
The effects of SS are transduced by a family of SS receptors (SSTRs), of
which 5 (SSTR1 through SSTRS) have been cloned (Coy et al. 1893, supra) These
receptors may be divided into two sub-groups on the basis of their relative
sequence
similarities and affinity for SS analogues (Hoyer et al., 1'-~9~, Tre»ds
Pharmacol Sci
16:86). One sub-group consists of SSTR2, SSTR3 and SSTRS. The second sub-group
comprising SSTR1 and SSTR4. The physiology of the first sub-group of receptors
has
been more thoroughly characterized, due in part to the relative availability
of SS
analogues that are selective for these SSTRs, particularly SSTR2. It is
however
known that all 5 SSTRs share some mechanistic features, for example all 5 have
been
Shown to be coupled to G-proteins and to regulate intracellular cAMP levels,
in part,
through activation of G, (Patel et crl. I'~~4, BIOCIIE'111. Bioplys Rc~S.
Com»ru», 198:605).
s0 SS has an extremely short half life i,r i,iv.o~ rendering it unsuitable for
most
ther:~peutic uses. For therapeutic applications, a variety oi~short peptide
analogues of
SS have been identified, particularly agonists of the first sub-group of SSTRs
{see for
example U.S. Patent Nos. 4,485,I01 issued 27 Ivo~-ember 1984; 4,904,642 issued
27
_1_
CA 02340588 2001-02-23
!4 01-2001 ' , ~~ ~~.. ~ , , , _ ~ , _._ .. ~'
E ~~
PGTIGA99It1U8Q(I: . ~ lSA C)ESG2C~ ;~
v."n"h. . .~ ...._,~. ,~~ ~ , "a,~. .~.aF ... ~ ,
Q 1 NOVf~~~rR 199 ~ I . l ~
9
February 1990; 5;147,859 issued 15 September 1992; 5,409,894 issued 25 April
1995;
5,597,894 issued 28 January 1997; and, International Patient Publications: WO
97101579 of 16 January 1997 and WO 97/47317 of 18 December 1997; ail of which
are hereby incorporated by reference).
Among the most thoroughly characterized of the peptide SSTR agonists are
octreotide (Sandoz Ltd., Basel, Switzerland) and angiopc~ptin (sometimes
referred to
as BIM 23014). Octreotide is recognized as an SSTR2 sf;lective agonist (Yang
et al~~
1998, pNAS USA 95:10836). Angiopeptin is recognized as an SSTR2/SSTRS
selective agonist (Alderton et al., 1988, Br: J. Pharrnacol 124(2):323). U.S.
Patent
No. 5,750,499 (issued 12 May 1998 to Hoeger et al., incorporated herein by
reference) discloses what are claimed therein to be the first SSTR1 selective
agonists
(also described in Liapakis et al., 1996, The J. of Pharmacology and
Experimental
Therapeutics 276(3}1089, incorporated herein by referen.ce), one of which is
identified as des-AAi.z,s [DTrpB ,IAamp9]SS (Le. des-amino acid
~'z°s[DTryptophan8,
N-p-isoproply-4-aminomethyl-L-phenylalanine9~SS, abbreviated herein as the
"SSTR1 '499 agonist")
A number of nonpeptide somatostatin receptor subtype-selective agonists have
been identified using combinatorial chemistry (Rohrer et al. 1998, Science
282:737,
incorporated herein by reference). Included amongst the agonists identified by
Rhorer
et al., supra, are agonists selective for SSTRI and SSTR~4. Rhorer Qt al.,
supra, also
disclose the apparent inhibition constant (K;) for SS14 binding to the SSTR
receptors,
as shown in Table l, and disclose methods of calculating that constant for
SSTR
selective agonists. Rhorer et al., supra, indicate that the SSTRl and SSTR4
agonists
disclosed therein were not physiologically active, in that they did not
inhibit the
release of growth hormone, glucagon or insulin in a model system. In contrast,
a
SSTR2 agonist is disclosed as having potent inhibitory ei:fects on secretion
of growth
hormone, glucagon and insulin.
CA 02340588 2001-02-23 . ' 2 ' t ' i " ' ~ , . . , _ ,
i:'. ~ <,~~ . ~~' ' f.v. .Sr( 1.. L E 't1f'_ Y Lw ~I4~;~
4' C11-20t~''[v ..~ ~. : .._
-.,
~'CT/CA99/OQl~fit3 ~~ ~ !SA aESC2fi
~~ _ 9 ...~~... .n.~E e~.~ ~ NOVEL"BER 1999 I :- I ~ . 9 9
Table 1: SS14 SSTR Specificity (K; in nanomoles)*:
riviu nviuct et a1. i»°~ Jcience °"''~ w'm .
It has been suggested that particular SSTR agonists may be useful in the
treatment of a variety of diseases, particularly in light of favourable
results of
treatment in some animal models. For example, on the basis of the chicken
chorioallantoic membrane (CAM) model, it has been suggested that SSTR2
agonists
in particular may be effective inhibitors of angiogenesis (Woltering et al.
1997,
Investigational New Drugs 15:77, in which SSTR2 binding activity of a number
of
agonists is correlated with the compounds anti-angiogenic activity). With
respect to
angiogenesis, SS itself has recently been shown to control growth of a
xenografted
Kaposi's sarcoma tumor in a nude mouse model, through inhibition of murine
angiogenesis (Albini et al. 1999, The FASEB .~ 13(6):647, wherein results are
presented indicating that human endothelial cells express SSTR3). There is
also
abundant evidence that SSTR2 agonists, particularly angiopeptin, are effective
in
inhibiting intimal hyperplasia after arterial injury in animal models
(Lundergan et al.
1989, ~qtherosclerosis 80:49; Foegh et al., 1989, ~qtlaerosclerosis 78:229;
Conte et al.
1989, Transpl Proc 21:3686; Vargas et al. ~ 1989, ~ransp~lant Proc 21:3702;
Hong et
al., 1993, Circulation 88:229; Leszczynski et al.~ 1993, ~Zegulatory peptides
43:131;
Mooradian et al. ~ 1995, J. Cardiovasc PJiarm 25:611; Light et al. ~ 1993;
,q,li J Physiol
265:H1265}. It has been suggested that this therapeutic activity in animal
models
reflects the ability of angiopeptin to inhibit the release of growth factors
from injured
endothelial cells (Hayry et al., 1996, Metabolism 45(8 Suppl 1):101). In
clinical
studies, however, the use of angiopeptin to inhibit intima,l hyperplasia
causing
restenosis in human patients has been inconclusive (Eriksen et ill., 1995,
,,q»7 Hearu J.
130:1; Emanuelsson et al. ~ 1995 Circulation 91:1689; Kent ct al. ~ 1993,
Circulation
88:I506). The poor clinical efficacy of angiopeptin in clinical trials for the
prophylaxis of restenosis follomng coronary angioplasty, in contrast to
encouraging
data from animal studies, has been attributed to a low intrinsic activity of
angiopeptin
at the SSTR2 receptor, combined with lack of agonist activity at the SSTRS
receptor
(Alderton ~t crl. 1998, Br. J. Pharnracol 124(2):323). SS~'~R2 agonists have
also been
-3-
CA 02340588 2001-02-23
Endothelial cells form a single cell layer lining all blood vessels in the
human
body, surrounded by other cell types such fibroblasts and smooth muscle cells.
Endothelial cells are restricted to blood vessels. Endothelial-cell-mediated
proliferative diseases such as angiogenic diseases and intimai hyperplasia
continue to
pose a significant health problem, caused by imbalances in the physiological
system
I O that regulates vascular remodelling. For example, ocular
neovascularization in
diseases such as age-related macular degeneration and diiabetic
retinopathy.constitute
one of the most common causes of blindness. Intimal hyperplasia causing
restenosis
or narrowing of the artery has been found to occur in 30-50% of coronary
angiopiasties and following approximately 20% of bypass procedures (McBride et
al.~
1988, N. Engl. .l. Med. 318:1734; Clowes, 1986, f vasc. Surg. 3:381).
Angiogenesis
induced by solid tumor growth may lead not only to enlargement of the primary
tumor, but also to metastasis via the new vessels.
SUMMARY OF THE INVENTION
The inventors have made the surprising discovery that SSTR1 and SSTR4 are
expressed on human endothlial cells, Ijl vitro and in vivo~ which contrasts
with the
presence of other SSTRs, particularly SSTR2, on endothelial cells in other
animals.
Accordingly, SSTR1 and SSTR4 selective agonists may be used to treat human
endothelial-cell-mediated proliferative diseases. In some aspects of the
invention, the
use of selective agonists targeted to endothelial cells may have the important
advantage of minimizing the side effects that would otherwise be associated
with
stimulating the SSTRs that are present on other cells, particularly SSTR2 on
endocrine cells. The invention therefore provides for the use of a SSTRI or
SSTR4
selective agonist to formulate a medicament for human use, where the
medicament
~0 ~z~ay be for use to treat an endothelial-cell-mediated proliferative
disease. The use of
SSTRI or SSTR4 selective agonists for treating endothelial-cell-mediated
proliferative diseases may include, for example, treatment of intimal
hyperplasia or
an angiogenic disease. In various embodiments. the aneiogenic disease may for
-4-
CA 02340588 2001-02-23
F'rmtea 24=01 2001: ~~.-'.~ ~ r~-,~ ~ r ~ j P ~~ ~ ~ t~ r~ . -
... F.:..s.~r,."~
~r l ~~~ ~ !
~~~'~~~~og~oo~o~z ~ ~, N o v E t;~.. ~~Lt~R i~9~ Isa or"~~2st~ ,
I .~,;~ 9 9
example be age-related macular degeneration, or a solid tumour. The SSTR1 sele
ive
agonists may be the SSTRl '499 agonist (des-AAI~l~ [D'TrpB ,iAamp9]SS). In
methods
of treatment, therapeutically effective amounts of the SSTRI or SSTR4
selective
agonists may be administered to a patient.
BRIEF DESCRIPTION OF THE DRAWINGS
Figure 1 is a graph showing the anti-angiogenic effects of SS14 in the
ECV304IMatrigel model (Hughes, 1996, gxperimental Cell Research 225:171-185),
as disclosed in Example 1 herein.
DETAILED DESCRIPTION OF THE INVENTION _
In one aspect, the invention provides therapeutic uses of SSTRI and SSTR4
selective agonists. In some embodiments, the invention involves the use of
SSTR1
and SSTR4 selective agonists for the treatment of endothelial-cell-mediated
1 S proliferative diseases. Examples of endothelial-cell-mediated
proliferative diseases
include intimal hyperplasia and angiogenic diseases (ang;iogenic diseases are
characterised by pathological neovascularization as a result of inappropriate
or
unregulated angiogenesis). Proliferative diseases may be mediated by
endothelial
cells, for example, where endothelial cells are involved in up-regulating a
pathological cellular proliferation, as is thought to occur in intimal
hyperplasia {where
the proliferating cells may be either endothelial or other cell types), or, as
in the case
of solid tumour vascularization, where the endothelial cells facilitate
pathological
cellular proliferation. The categories of endothelial-cell-mediated
proliferative
diseases will be recognisable by medical practitioners and those skilled in
this art, and
will change from time-to-time in accordance with progress in medical research.
In various aspects of the invention, angiogenic diseases may include
proliferative retinopathies, such as diabetic retinopathy, retinopathy of
prematurity,
corneal graft rejection, retrolentaI fibroplasia, neovascular glaucoma,
rubeosis, retinal
s0 neovaseularization due to macular degeneration (including anti-angio;,~enic
treatment
following photodynamic therapy), hypoxia, angiogenesis in the eye associated
v~ith
infection or surgical intervention, and other abnormal neovascularization
conditions
of the eye; angiogenic aspects of skin diseases such as psoriasis; blood
vessel diseases
-5-
CA 02340588 2001-02-23 t''~°' '' k= ~=~ ' .-c, a
~~ ~ Cw,.~ r.' 1 r' ~ , ~ kd ~~ I ~ V ~ ~ w i f ~ t ~ t i sL
1 P
w i. ,
~' r1 / !1 n ,.. I1 n
~9~' '1'~~"~1~~9~~f?Q$OQ~ ~ NOY~h~~ 1~9 0 LISA DESC26 ,
,Fd.. !,f",.". ,~'~.,'ast,t,2re~...ex,..~,3ak."q~r.u<,c"< s.."~, ..
such as hemagiomas, and capillary proliferation within atherosclerotic
plaques; Osler-
Webber Syndrome; myocardial angiogenesis; plaque neovascularization;
telangiectasia; hemophiliac joints'; angiofibroma; and wound granulation.
Other uses
include the treatment of diseases characterized by excessive or abnormal
stimulation
of endothelial cells, including but not limited to intestinal adhesions,
Crohn's disease,
atherosclerosis, scleroderma, and hypertrophic scars, i.e. keloids. SSTRI and
SSTR4
selective agonists may also be useful in the treatment of diseases that have
angiogenesis as a pathologic consequence such as cat scratch disease (Rochele
ninalia
quintosa) and ulcers (Helicobacter pylori).
An alternative aspect of the invention comprises SSTRl and SSTR4 selective
agonist treatments for cancers susceptible to anti-angiogenic treatment,
including both
primary and metastatic solid tumors, including carcinomas of breast, colon,
rectum,
lung, oropharynx, hypopharynx, esophagus, stomach, pancreas, liver,
gallbladder and
bile ducts, small intestine, urinary tract {including kidney, bladder and
urothelium),
female genital tract, (including cervix, uterus, and ovariea as well as
choriocarcinoma
and gestational trophoblastic disease), male genital tract (including
prostate, seminal
vesicles, testes and germ cell tumors); endocrine glands {including the
thyroid,
adrenal, and pituitary glands), and skin, as well as hemangiomas, melanomas,
sarcomas {including those arising from bone and soft tissues as well as
Kaposi's
sarcoma) and tumors of the brain, nerves, eyes, and meninges (including
astrocytomas, gliomas, glioblastomas, retinoblastomas, neuromas,
neuroblastomas,
Schwannomas, and meningiomas). In some aspects of the invention, SSTR1 and
SSTR4 selective agonists may also be useful in treating solid tumors arising
from
hematopoietic malignancies such as leukemias (i.e. chloromas, plasmacytomas
and
the plaques and tumors of mycosis fungoides and cutaneous T-cell
lymphoma/leukemia) as well as in the treatment of lymphomas (both Hodgkin's
and
non-Hodgkin's lymphomas). In addition, SSTRI and SS'TR4 selective monists may
be useful in the prevention of metastases from the tumors described above
either
when used alone or in combination with radiotherapy and/or other
chemotherapeutic
agents.
-G-
CA 02340588 2001-02-23 ~-p. ~ r v. ,z c., .,~
[ i ; ~ p e.; . ts. i ~. E ; ~ ~:-~ ic'-" ~ v
22 ;11 199, F''T~C;~99/t~0$00, ~ ~~c 9 tSA ~ESC26.':,-
a.~ ~ ~. ~ R
01. NOVEMBER 1999 0 1 . I I =.9 9 .
In several aspects, the present invention relates to somatostatin receptor
agonists that are selective for one or more of the somatostatin receptor
subtypes. In
this context, receptor-ligand binding assays may be carriied out to determine
the
relative affinity of a compound for one or more of the somatostatin receptors,
as for
example is described by Rhorer et al. ~ I998, Science 282:737. In some
embodiments,
a compound will be 'selective' for a receptor if the apparent inhibition
constant of the
compound with respect to that receptor (K;, calculated as described by Rhorer
et al.~
supra) is less than the K; of the compound with respect to another SS
receptor, and in
some embodiments at least ten fold less. In some embodiments, the selectivity
of the
14 agonists used in the invention may be greater than ten fold, such as 100
fold or 1000
fold. In some embodiments, the present invention encompasses compounds that
are
selective for more than one SSTR.
In one aspect, the present invention utilises an established model system for
studying human angiogenesis. The model system comprises the spontaneously
transformed human umbilical vein endothelial cell line, :ECV304, grown on a
Matrigel substrate (Hughes, 1996, experimental Cell Research 225:171-I85}.
Matrigel is a solubilized basement membrane extract that promotes the
differentiation
of endothelial cells into capillary tube-like structures in vitro. It has been
shown that
cytoskeletal reorganization occurs when human umbilic<ii vein endothelial
cells
undergo the morphological changes associated with neovascular tube formation
on a
Matrigel substrate (Grant et al.~ 1991, Ijt Vitro Cell Dev. Biol. 27A(4):327-
36.). As
disclosed in Example 1 herein, using the i~ vitro ~giogE,nesis model
comprising
ECV304 cells on a Matrigei substrate, it has been shown. in the context of the
present
2~ invention that SS14 inhibits angiogenesis. At sub-micromolar and higher -
concentrations, SSI4 was found to significantly inhibit neovascular growth in
this
model system. These results indicate that SS 14, which is. an agonist of all
somatostatin receptor subtypes (see Table 1 ), acts on human endothelial cells
as an
angiogenesis inhibitor.
The present inventors have further demonstrated that the ECV304 cells onlv
express the SSTRI and SSTR4 receptor subtypes, and do not express SSTR2, SSTR3
or SSTRS mRNA in quantities detectable by RT-PCR (see Example 2}. Accordingly,
7-
CA 02340588 2001-02-23
,~ ~ ~. ~~t! ~~ .' rt s E ~ ., ~ ~ ytm fit.. ''.y ~ f r - w. ~ r~.r .'-'
Prmted:24~a1 :20(~~ v ~ . .. ' .. ~ .,' ~ .. ~, ~~. i:. ~;. ~,: ~ t~E i.~ ~ .:
~ , 7
~ .,
X95 PGT~GA~9.(~0~0~~ ~ ~ ~ ,ISA ,DESG2C
' Q~ l NOVEMBER 1999 ~~ I I ~ , 9 9.
the demonstrated anti-angiogenic effects of SS 14 on ECV304 cells must be
mediated
by SSTRl and/or SSTR4. The present inventors have also demonstrated that an
SSTRl selective agonist has similar physiological effects on ECV304 cells as
does
SS I4, particularly disassembly of actin stress fibres and formation of
lameliipodia
(see Example 3). This indicates that in alternative embodiments of the
invention,
SSTR1 and SSTR4 selective agonists will have anti-angi:ogenic effects on human
endothelial cells, just as SSI4 has an anti-angiogenic effect in the
ECV304/Matrigel
model system.
IO Somatostatin analogues have been shown to have: therapeutic effects in a
variety of animal models of proliferative disease, including angiogenesis and
intimal
hyperplasia. SSTR2 agonists in particular have been shown to be successful in
ameliorating the pathologies of endothelial-cell-mediated proliferative
disease
models, such as CAM, arterial balloon injury in several animal species, and
murine
I S angiogenesis in a cancer model. The present inventors have determined that
in
contrast to animal models in which endothelial cells express SSTR2 (see
Example 4
and Chen e~ al.~ 1997, J of~fivestigative Surgery 10:I7), human endothelial
cells and
tissues express SSTRI and SSTR4. This indicates that, vrhereas SSTR2 agonists
are
effective in treating animal models of human endothelial-cell-mediated
proliferative
20 pathologies or disease, SSTRl and SSTR4 selective agonists may be used to
treat
human patients.
Although various embodiments of the invention are disclosed herein, many
adaptations and modifications may be made within the scope of the invention in
25 accordance with the common general knowledge of those skilled in this art.
Such
modifications include the substitution of known equivalents for any aspect of
the
invention in order to achieve the same result in substantially the same way.
Numeric
ranges are inclusive of the numbers defining the range. In the claims, the
word
"comprising" is used as an open-ended term, substantially equivalent to the
phrase
3U "including, but not limited to'". The following examples are illustrative
of various
aspects of the invention, and are not limiting of the broad aspects of the
invention as
disclosed herein.
-g_
CA 02340588 2001-02-23
°~ f,'.' ~''.. c:.e. ~' ;':v~ ~ ~ .~. ~ y ~r' ' r~._ ,",~~ r : r' - > a
y n c°'
x4-t3'1 200';1 ~ ~ - f ' ~ ; n~ :. . ,: . ~ _.
. . ~ _ . i ~ ~, ~. . k. .,.k.~ ,. ; ~ t .. . , ~:. -,.,
4 '"~ ' n n n ~
~2 'f i ':1999 P~aGT~~A99It1~8~~ ~~v -, r ~ 1SA DESC2fi' :.
r .. .,_ ..: :._~a.c#~",._;~_..' ,
~.. x. s. , ._ Q 1. NOV~~'B~.R 1999 0 I . ~ l w 9 9-...:
Example 1: Anti-Angiogenic Effect of SS14
This example shows the anti-angiogenic effect o;f SS 14 on endothelial cell
capillary-like tube formation in vitro using an established model of
angiogenesis.
The model is based on the propensity of human endothelial cells, particularly
S ECV304 cells, to form capillary-like tubes on Matrigel, ;~ basement membrane
extract
(Hughes, 1996, Experimental Cell Research 225:171 ).
Five mg vials of SS 14 (Biomeasure Incorporated) were reconstituted using 1.0
mL 0.01% BSA/O.O1N acetic acidlPBS to achieve a woiking stock of 3mM. The
human endothelial cell line ECV304 (ATCC) was cultured in Medium 199 (M199,
Sigma) supplemented with 2 mM L-glutamine (Gibco B:EtL), 1 mM sodiurr~
pyruvate
(Gibco BRL), 5 x 10'5 M 2-mercaptoethanol (Sigma), 100 UImL penicillin (Gibco
BRL), 100 ug/mL streptomycin (Gibco BRL). 20 mM HEPES (Sigma). and
optionally 10% heat-inactivated fetal calf serum (Gibco :BRL) or i % BSA.
Cells
1 S were passed at a rate of 1:5 using 0.05% trypsin/0.005% EDTA (Gibco BRL)
upon
reaching confluence.
ECV304 cells (3.5 x 104 in 0.5 mL complete M199 medium) were placed onto
24-well plates that were pre-coated with 0.125 mL of Matrigel (Becton-
Dickinson).
SS 14 was immediately added to the ECV304 cells and the cells were incubated
at
3~°C in a COa humidified chamber. After 24 hours, images of tube-
formation were
recorded on f lm. Images were converted into a digital format using a Hewlett-
Packard ScanJet 4C/T scanner, the summed length of capillary-like tubes was
quantified using Optimas 6.1 image analysis software (Optimas Coip.).
Figure 2 illustrates in graphic form the finding that SS14 inhibits
neovascular
tube formation in a dose-dependent manner. The graph in Figure 2 shows that
the
inhibition of angiogenesis by SS14 was greater than SO°/<. at all SS14
concentrations
ranging from 0.1 pM to 100 pM, as measured by neovasc:ular tube length
relative to
control samples that were not treated with SS i 4.
Example 2: Characterization of Human Endothelial Cells
-9-
CA 02340588 2001-02-23
.. ~w_
F?nntecl24.01 2x011 ~ ~'~~~~ ;'~ ' ' 'x ~~~°=~, ~~ c~~'..-
... . ..
~~.1~ ~ ! l.~''3 z"~ ' ~ l ~~ l5 n ll p
99~= PCT~~A9,91608Q ~ 1 N 0 V E h~ ~3 F R 1999 0 LISA D ESC26
' Il.gg)
The endothelial characterization of the ECV304 cells used in the present
invention was confirmed by the detection of von Willebrand Factor (vWF) mRNA
by
RT-PCR and the detection of vWF by immunocytochemistry (vVhF is a well known
functional marker of endothelial cells that is involved In~ vivo in the blood
clotting
cascade). The ECV304 cells used herein also expressed the endothelial marker
endothelial nitric oxide synthase (eNOS).
RT-PCR provided evidence for the presence of ~>STRl and SSTR4 mRNA in
ECV304 cells and in a primary endothelial HUVEC cell Line from umbilical
veins.
Neither cell lines expressed SSTR2, SSTR3 or SSTRS rnRNA, with the exception
that
later passages of some HUVEC cultures showed low levels of SSTR2. _
The ECV304 and HUVEC endothelial cell lines v~ere immunostained for SSTRI
and vWF, identifying the location of the SS receptors. Tlue EC304 and HUVEC
cell
lines showed SSTRl immunostaining in both the cytopla;~m and on the plasma
membrane. Localization of vWF in ECV304 cells and eaniy passages of HUVEC
cells
showed that 95-100% of the cells were immunoreactive, however fewer cells were
immunostained in the later passage of HUVECs (<60%).
Fn the present Example, ECV304 cells (American Type Culture Collection,
Mantissas, VA) were cultured in Medium I99 (Sigma Chemical Co., St. Louis, MO)
supplemented with 2mM Glutamine, 24 mM sodium bicarbonate, 10 mM Hepes,
penicillin (100 U/ml), streptomycin (0.lmglml), and heat inactivated fetal
calf serum
(10%). HUVEC and AoSMC cells were obtained from Clonetics Corporation
(Walkersville, MD) with the required culture medium. 'The cell lines were
grown in
75 cm2 Falcon flasks (Becton Dickinson Labware, Franklin Lakes, NJ.) for
collection
of RNA or seeded onto APES (Sigma) coated 20mm coverslips in 24 well Costar
plates (Corning Inc., Coming, NY) for histological studies. The i'ollowing
EC'\'304
cell Line information is provided by the ATCC:
ATCC Number: CRL-1998, originally deposited in May 199?
Organism: Homo sapiens (human)
Designations: ECV304
Tissue: normal; umbilical vein; endothelium; endoibclial
_ 1 ~~ -
CA 02340588 2001-02-23 ~..%.. ~~ ~, ,
' . 1. ~ r r ~.. t,r: p "4 ~ ~ ~,~'~
'P~mteci 24 ~f31' 200.x:'' 'lit
~~,~,~:,,
P~~-~c~~~~oaas~= P~ I lsa ~ESC2s:.
j-2~, '~'1 1999 ~~,.. M. ,.,.. ..~.~.~ "..
~~._., f _ ..: ,~... w y ~~ NOVEMBER 1989
Morphology: cobblestone
Depositors: K. Takahashi
VirusSuscept: Semliki Forest virus {SFV)
Tumorigenic: yes, in BALB/c nulnu mice
Karyotype: modal number = 80
Products: angiotensin converting enzyme (ACE;)
FluidRenewal: 2 to 3 times weekly
SubCulturing: Remove medium, add fresh 0.25°,~o trypsin, 0.03% EDTA
solution, rinse and remove trypsin. Allow the flask to sit at room temperature
(or
incubate at 37C) until the cells detach (usually 5 to 10 minutes). Add fresh
medium,
aspirate and dispense into new flasks. -
SplitRatio: A ratio of 1:6 to 1:10 is recommended
Growth Properties: monolayer
Comments: ECV304 is a spontaneously transformed immortal endothelial cell
line established from the vein of an apparently normal human umbilical cord
{donor
number 304). The cells are characterized by a cobblestone monolayer growth
pattern,
high proliferation potential without any specific growth :factor requirement,
and
anchorage dependency with contact inhibition. Endothelium specific Weibel -
Palade
bodies were identified in electron microscopic studies. Immunocytochemical
staining
for Iectin Ulex europaeus I (UEA-I) and PHMS (anti-human endothelium as well
as
glomerular epithelium monoclonal antibody) was positive. The cells are
negative for
Factor VIII related antigen, for alkaline and acid phosphatases and for
epithelial
keratins. The cells will form tumors in BALB/c nulnu mice, and will cause
neovascularization on rabbit corneas. They are reported to produce pro-
urokinase type
PA (pro-u-PA) and express small amounts of intercellular adhesion molecule
(ICAM-
1), lymphocyte function associated antigen-3 (LFA-3). Vascular cell adhesion
molecule (VCAM-1) and granular membrane protein-140 (GMP-i40). Interleukin-1
(IL-1 ) and interferon exert suppressive effects on ECV304 cells. These cells
also
produce IL-6 after stimulation with IL-1. The line was cured of mycoplasma
contamination by a 21 day treatment with BM Cycline. Further information may
be
included in the following references, which are hereby incorporated by
reference:
Takahashi et al.~ Ig'~0. In Vitro Cell. Dev. Biol- 26:265; Takahashi and
Sawasaki,
1991, In hitro Cell. Dev. Biol- 27A:7G6; Takahasi and Sawasaki, 1992, I» 1-
'irro C~II.
CA 02340588 2001-02-23 - ' " ' '- ~ - r ~ - , .
<",;. r a .-n S. A ~ ~ L. ~ y ~ 3
~4 ~ ~ , . a_ .,ywn L <-: i..:~ _. _ "~';~~;~
~i it ~ f5 /~ n n ~c
F~~'flCA99/0a800 ' SSA DESC2fi
~.. ~~,.n,~~.8.~." .~ I NOVEMBER I~g ~ ~ ::..~ I.._ y g
Dev. Bioh 28A:380). Propagation of the cell line may bE~ carried out in~ATCC
Medium 199, 90%; heat-inactivated fetal bovine serum, 10%.
In the present Example, total RNA was isolated according to manufacturer's
directions from tissue samples and cell lines lysed in Trizol solution (Gibco
Life
Technologies, Grand Island, N.Y.). Any DNA present w~~s removed by incubation
in the
first strand buffer (25 mM Tris-HCI pH 8.3, 37.5 mM KCL, 1.5 mM MgCL2 and 10
mM
DTT) containing 1mM dNTPs (Pharmacia), 10 U Rnasin (Pharmacia), and 2U of
Dnase
(Promega Corporation, Madison, WI) and heated to 37°C for 30 min. The
DNase was
inactivated by heating to 75°C for 5 min. A sample was removed and used
as a PCR
template to verify the absence of genomic DNA. The cDNA was synthesized from
purified RNA using Superscript II reverse transcriptase (100 U MMLV; Gibco
Life
Technologies, Grand Island, N.Y.) according to the manu:facturer's directions
with oiigo-
dT primer ((Gibco), 10 U Rnasin {Pharmacia), and 1 mM dNTPs (Pharmacia)).
Samples
were incubated at 42°C for 1 hour. The enzyme was inactivated by
heating the samples
to 75°C for 15 min. The cDNA samples were stored at -20°C prior
to PCR.
For detection of SSTR subtypes in endothelial cell lines (and human blood
vessels), oligonucleotide primers were synthesized on an Applied Biosystems
Model
391 DNA synthesizer, as follows:
_ t? _
CA 02340588 2001-02-23 b~ r~ g~ ~"t f ~ ~~+. hr, ~ r n... S.~ ~ . E._~a~;~u
. . i . ~ ~ ~ r i~.. , ; ~ 1;
. - " . r ~'k, r . pr. o",eY x ~ L a ' ~
Printed.24=tl1-2.OOt. - . 12'
2~ 11 'I'999yv ~?~~'~GA9'~faQ80a~, ~~ ~ ~tSA ~ESC2fi''
~f. _ _, ~ ~~_.:,.~.~,,.. ,.t~A,:.~«.-.
p 1l NOVEMBER 1999 0 Z . 1 1. . g g1
TABLE 2: HUMAN SSTR PRIMERS
rimer primer sequence {5'-3') Position PCR Annealing
in
specificity gene product temperature
size
SSTR1 GGAGGAGCCGGTTGACTATT 1140-1159375 58~C
AAGGTAGCCTGAAAGCCTTCC 1494-1514
SSTR2 AGAGCCGTACTATGACCTGA 184-203 627 59~C
AGCCCACTCGGATTCCAGAG 793-812
SSTR3 GAGCACCTGCCACATGCAGT 661-681 316 62~C
CCCAAAGAAGGCAGGCTCCT 938-957 -
SSTR4 TCCCTTATCCTCAGCTATGC 948-968 283 60aC
CTCAGAAGGTGGTGGTCCTG 1211-1251
SSTRS TCTTCTCTTGCAGAGCCTGA 11-.30 437 63oC
TGACTGTCAGGCAGAAGACA 428-447
SSTR-1, -2, -3, -4, and -5 primer pairs were desi~led to hybridize to unique
regions of the receptors. The PCR reactions for SSTRs 1-5 were carried out
using 2{I of
cDNA in 25 (1 total volume of PCT buffer (67 mM Tris pEi 9.01, 1.5 mM MgS04,
166
mM AmS04, and 10 mM (mercaptoethanol) containing I mM MgCl2 (5 rnM MgCl2 for
SSTRS), 0.2 mM dNTPs (Pharmacia), 5% DSMO (SSTRS only) and 100 ng of 5' and 3'
primer. Taq polymerase (1.25 U, Gibco BRL). The amplification reaction was
earned
out in a RoboCycIer Gradient 96 (Stratagene, La Jolla, CA) for 35 cycles. Each
cycle
consisted of denaturation for 45 sec at 94°C, pealing for 45 sec at the
relevant
temperature (see Table 2), and an extension for 45 sec at '~2°C. A
final extension step at
72°C for ~ min terminated the amplification. The PCR products were
separated by
electrophoresis through a 1% agarose gel. The DNA was visualized and
photographed
using the Eagle Eye II Video System (Stratagene). The DANA fra~~cnents
obtained using
I 5 primers for SSTR 1, 2 and ~ were isolated from the gels and ligated Ento
pGEM-T
(Stratagene, La Jolla, CA). DNA sequencing of the sub-clone was perfonmed
using the -
dideoxynucloetide chain-termination procedure with T7 sequenase (Phannacia
Biotech
-l3-
CA 02340588 2001-02-23
PCIII~f..C~.j'~4-~ ss ..~"~ 3 ~ . S. ~~, w':sF. ~~-, t''. .~ s ~e
T
Pc~r~c~~~~ooaoo ~~ i NovEM~B ' f9 .,Iso ~ESC2s ~.
x.. . ~o. ~ , ~ .~.~ r v.~ . ~ R 999 ~ ~.T.~_ ~ _ ~ ' 9
Inc.). The DNA fragments obtained using primers for SS'TR3, and 4 were eluted
from
the agarose gel and diagnostic restriction digest analysis performed to
confirm that the
PCR products were SSTR-3 and -4.
For detection of vWF in endothelial cells, oligonu~;,leotide primers with the
sequence: 5'CCCACCCTTTGATGAACACA3' for the forward primer and
5'CCTCACTTGCTGCACTTCCT3' for the reverse primer were used in PCR reactions
to detect von Willebrand's factor (vWF) cDNA. The PCR. reaction was performed
in
PCR buffer (20 mM Tris-HCI (pH8.4), SO mM KCI) cont;~ining 2.0 mM MgCl2, 0.2
mM dNTPs, (Pharmacia), 5% DSMO, and I00 ng of 5' and 3' primer with the
addition
of Taq polymerise (1.25 U, Gibco BRL). The 35 PCR cycles were performed as
described above with an annealing temperature of 60°C. The PCR products
were
separated and visualized as above. The DNA fragment w;~s isolated from the gel
and
diagnostic restriction digest analysis was performed to confirm the PCR
product was
VWF.
Example 3: Effect of an SSTRl Selective Agonist on lKuman Endothelial Cells
It has been demonstrated that SS acting through S;iTRI regulates intracellular
pH (Barber et al. ~ I989, J Biol. Chem. 264:21038) and that intracellular pH
in turn
regulates actin stress fiber production (Tominaga et al. ~ I998, Mol. Biol.
Cell. 9:2287).
The present Example illustrates the common effects ofSSl4 and an SSTRI
selective
agonist on actin bundling in endothelial cells, using fluorescently labelled
phalloidin to
Iocaiise actin.
To assay the effect of SS 14 on endothelial cells, ECV304 cells were washed to
remove growth medium and fresh medium (lacking serum) added (Imllwell). The
cells
were cooled to 4°C for I 5 minutes to concentrate SSTRs at the plasma
membraye prior
to the addition of SS14 (IOnM, Peninsula Laboratories; Be:l~llollt, CA) to
test wells while
control melts received a similar volume of medium only. 'the cells were
subsequently
incubated at 37°C for 30 min, fixed in 4% PFA for S Illlll and washed
in fl3S. The actin
cyosl:eleton was visualized by incubating the cells with A.LE~A-4SS conjugated
phalloidin ( 1:50, Molecular Probes Inc., Eugene, OR) for :L 5 min at room
temperature.
Cells were screened using a Zeiss Axiophot microscope as, previously
described. Similar
- I4-
CA 02340588 2001-02-23
~ a ~
F?rntect 24 ~t3~1 20.01 ° '~:'. ~ ~ "'~ ~.". i ~.. ~ ~ 'ø f~~. ~ ,~.-
,~ 'h
'~ . ' r~ ~ 1 1 s < l n 1. . .. ", ~;~3
a ~ ~ ~~ '~ ~ ~ ~ ~ V
2~ ~'11 '199 ' "P~T'~~I193~(?Qg04 ~ ~! ~ V E M B F I SA DESC2fi '~'
H E... ~~~~...... R 1999 ~1 =ii.~y~
protocols were used to evaluate the effects SSTRI selective agonists on
endothelial cells.
In control ECV304 cells abundant stress fibres strE;tching the entire length
of the
cell and few lamellipodia were observed. The SS14-treatc;d ECV304 cells showed
a loss
of long stress fibers and the remaining fibers were short and lacked
directional
organization. In addition, there was an increase in the number and size of
lamellipodia at
the plasma membrane. In addition to these morphological changes, SS 14 was
shown to
inhibit the Na/H exchanger on ECV304 cells, as determin~°d by
intracellular pH imaging
This indicates that monitoring changes to the actin cytoskeleton or
intracellular pH are
I O rapid and simple methods to follow activation of SS receptors on
endothelial cells. In
some embodiments, this assay may be used to screen for SSTR1 or SSTR4
selective
agonists.
Treatment of ECV304 or HLJVEC cells with the SSTR1 '499 agonist produced
results similar to treatment of the cells with SS I4. The insult of SSTR1 '499
treatment
was a decrease in stress fibres and an increase in lamelli;podia formation.
Treatment of
ECV304 or HUVEC cells with a SSTR2 selective agonist, DC32-87 (Raynor et al.~
1993, Col. Pharmacol 43(G):838) had no effect on the endothelial cells.
Example 4: SSTIts in Human Endothelial Tissues v. .Animal Tissues
In humans, the presence of mRNA for SSTRl, SSTR2 and SSTR4 (but not
SSTR3 or SSTRS) was detected by RT-PCR in normal aorta, normal internal
mammary artery, normal saphenous vein, and athlerosclerotic popliteal
arteries. In all
normal endothelial tissues, SSTRl was expressed and was the most abundant of
the
receptor sub-types. The expression of SSTR2 and SSTF:3 was more variable, with
some individuals lacking expression of one of the two sub-types. In normal
tissues,
the abundance of the mRNA was lower for SSTR2 and SSTR3 compared to SSTRI .
- 35 -
CA 02340588 2001-02-23 . , ~ ' " ' ; '~~ ~~~ ~ s' -
. ,
.-
Pririted.~4='0't 2~a'1::
~'~~ ~ ,,gca annann
lSi4 DE~C2fi
P~~tc~9~~oosoo ~ I NOVEMBER r999 ~ l . I I
99
Human artery samples (100-400 mg) were collectE;d from bypass procedures,
amputations or from human donors for organ transplantation in association with
Pacific
Organ Retrieval and Transplant Society with ethical permission from the
Ethical
Committee on Human Experimentation at the University of British Columbia.
Normal
veins N=6 (greater saphenous and arm), arteries N=S (aorl:a and internal
mammary) and
diseased atherosclerotic or aneurysmal arteries N=3 were collected. The normal
tissues
used to obtain these results were as follows: 2 normal aortic samples, one
from a 42-
year-old woman and the second from a 19-year-old male; 3 internal mammary
arteries
and 3 saphenous veins from male patients ranging from 69-74 years of age. In
athlerosclerotic popliteal arteries, SSTRl was also the predominant receptor
with
variable levels of SSTR2 and SSTR4, again there was no cwidence for the
pre~,sence of
SSTR3 or SSTRS. The 3 popliteal arteries were collected from male patients of
68, 72
and 73 years of age.
The vascular tissues analyzed herein include both endothelial and non-
endothelial cells. In particular, non-endothelial smooth muscle cells form a
substantial
component of the vasculature. In a primary cell preparatiion of aortic smooth
muscle
cells, mRNAs for SSTR1, SSTR2 and SSTR4 were detected. In these aortic cell
cultures, vWF mRNA was also detected, and vWF immunostaining (<10% of cells)
was detected, indicating that the cultures included some endothelial cells.
Taken together with the results of the analysis of mRNA expression in human
endothelial cells (Example 2), the results reported in this Example suggest
that the
SSTR2 mRNA detected in human vascular tissues originates with the non-
endothelial
2~ cells in the tissues, while the SSTR1 and SSTR4 mRNA originates with the
endothelial cells.
-lb-
CA 02340588 2001-02-23 .~c ;, ~. p"_ " ,
,.~t~~~~~ G4-~~ ~~~~r ' ~. -.- ..r v..; '~L" ~ r ~ le,.t~ r ~ i'' ,~ S ~ i''
.. : f .,~
~.. y ~ ~ r. : ~, ,1.
PGT'lGR~91008a0 ~ ISA DESG2G
~ ~ 'f 99~' ... . ...
. s:3,.~. . s~.. . 1 NOVEMBER 1999 0 ~ . I I . 9 9
~,=t . a..
' Immunocytochemistry was used to confirm that endothelial cells in situ
expressed SSTRl. In normal and diseased blood vessels endothelial cells were
immunostained by SSTRl but not SSTR2 antibodies. Von Willebrand's Factor-
immunoreactivity {IR) was limited to endothelial cells in normal and diseased
vessels.
S For immunocytochemistry, a small portion from each vess~;,l sample was fixed
in 4%
paraformaldehyde ((PFA) for lh and i0(m cryostat sections mounted on glass
slides and
cultured cells fixed for 10 min in PFA were used for immunocytochemistry.
Rabbit
antisera to human SSTR-1 (1:100) and SSTR-2 (1:100) (C~URE/Gastroenteric
Biology
Center Antibody/RIA Core, NIH ,grant DK 41301) and VfTF (Sigma; 1:1000) were
incubated on sections or whole cells at 4°C overnight. After washing in
PBS to remove
excess antibodies the bound antibodies were localized using Cy3 conjugated
donkey
anti-rabbit IgG (Jackson ImmunoResearch Laboratories Inc., West Grove, PA.) at
1:1000 for lh at room temperature. Slides were screened using a Zeiss Axiophot
microscope equipped with epifluorescence. Representative sections were
digitized using
a Biorad MRC b00 confocal laser scanning microscope equipped with a krypton
argon
laser. The resultant image stacks were converted to maximum intensity
projections
using NIH image (share ware) and the final images produced using Adobe
Photoshop.
The results of assays of SSTRs in tissue from animal models may be
contrasted with the foregoing results from human tissues {see for a background
example: Chen et al. ~ 1997, ,~ Invest. Surg. 10:17). In control samples of
rodent iliac
arteries no detectable immunoreactivity was observed to antisera specific for
SSTR-1,
2 and 3. However, after injury, SSTR-2 immunoreactivity was observed on the
surface of the endothelial cells re-populating the injured site. The identity
of the
SSTR-2 immunoreactive cells and endothelial cells was conf rmed by double
staining
with a monoclonal antibody to vWF. This immunocytochemical result indicates
that
SSTR-2 is the active SS receptor in the rat model of arterial injury. This was
confirmed with RT-PCR using primers specific for tile 5 known SSTRs. The
results
demonstrated that normal rat arteries expressed low levels of SSTR2 and SSTR3,
but
,U IlOt SSTR1, SSTR4 or SSTRS. A competitive PCR protocol wras used to compare
the
levels of SSTR2 mRNA in control and injured vessels. The results using this
protocol
demonstrated a clear increase in expression levels of the SSTR2 receptor 7
days after
balloon injury of the rat iliac arteries. Subsequent experiments demonstrated
that this
- 17-
CA 02340588 2001-02-23 r'x , t ~ ~'~ ~ '. ,~ ; ~' t ~ ~ ' ~ ' .,
.. . ~ . ~x::,~ . ~..... <..~.i n ' :,r i. ~ a ., a a S~ t i
~~t'lCt'~f.'G~ ~~-=4'~,-~0~~ >~E'
hence the ability of SSTRl and SSTR4 selective agonists to inhibit intimal
hyperplasia in humans.
Exampie 5: Therapeutic Formulatious
In one aspect, the invention provides a variety of therapeutic uses for SS
agonists. In various embodiments, SSTR1 and SSTR4 selective agonists may be
used
therapeutically in formulations or medicaments for the treatment of human
I O endothelial-cell-mediated proliferative diseases, such as pathological
angiogenesis
and intimal hyperplasia, including cancers susceptible to SSTRI and SSTR4
selective
agonists {such as susceptible solid tumors). The invention provides
corresponding
methods of medical treatment, in which a therapeutic do;>e of a SS agonist is
administered in a pharmacologically acceptable formulation. Accordingly, the
15 invention also provides therapeutic compositions comprising a SS agonist
and a
pharmacologically acceptable excipient or carrier. The therapeutic composition
may
be soluble in an aqueous solution at a physiologically acceptable pH. In one
aspect of
the invention, SSTRl and/or SSTR4 selective agonists may be administered using
a
perforated balloon catheter, as disclosed in International Patent Publication
VVO
20 93/088f 6 of i 3 May 1993, which is hereby incorporated by reference.
The invention provides pharmaceutical compositiions (medicaments}
containing (comprising) SS agonists. In one embodiment, such compositions
include a
SS agonist compound in a therapeutically or prophylactically effective amount
25 sufficient to alter, and preferably inhibit, production of gamma
interferon, and a
pharmaceutically acceptable carrier. In another embodirrient, the composition
includes
a SS agonist compound in a therapeutically or prophylactically effective
amount
sufficient to inhibit angiogenesis, and a phannaceuticaliy acceptable cawier.
30 The SSTRl and SSTR4 selective agonists may b~~ used in combioaUon with
other compositions and procedures for the treatment of diseases. For example,
a tumor
may be treated conventionally with photodynamic therapy, surgery, radiation or
chemotherapy combined with a SSTRl or SSTR4 selective agonist, and then a
SSTRI
- is -
CA 02340588 2001-02-23
t~
f'riritecl 24 'Q1 2.01 ' a°~ g ~ ~ ~°~~~~ ~'~' F'.'~ Ea ~ ~~
~y:~ '~~'
. ; , ;e:.a
!~~ .,~ ? 1 / f! ~1,. n w
~ ~ ~ gg~ P~~'IC~199100800~1SA DESC2fi '
~~. _ ._=.,.e. . ~ . _ . .
~t _.. :, , ~ p I NOVEMBE R 1999 ~ I . 1 I . 9 Q
or SSTR4 selective agonist may be subsequently administered to the patient to
extend
the dormancy of micrometastases and to stabilize and inhibit the growth of any
residual primary tumor.
A "therapeutically effective amount" refers to an amount effective, at dosages
and for periods of time necessary, to achieve the desired therapeutic result,
such as
reduction or reversal of angiogenesis in the case of cancers, or reduction or
inhibition
intimal hyperplasia. A therapeutically effective amount of SS agonist may vary
according to factors such as the disease state, age, sex, and weight of the
individual,
and the ability of the SS agonist to elicit a desired response in the
individual. Dosage
regimens may be adjusted to provide the optimum therapeutic response. A_
therapeutically effective amount is also one in which an.y toxic or
detrimental effects
of the SS agonist are outweighed by the therapeutically lbeneficial effects.
A "prophylactically effective amount" refers to an amount effective, at
dosages and for periods of time necessary, to achieve the desired prophylactic
result,
such as preventing or inhibiting the rate of metastasis of a tumour or the
onset of
intimal hyperplasia. A prophylactically effective amount can be determined as
described above for the therapeutically effective amount. Typically, since a
prophylactic dose is used in subjects prior to or at an earlier stage of
disease, the
prophylactically effective amount will be less than the therapeutically
effective
amount.
In particular embodiments, a preferred range for therapeutically or
prophylactically effective amounts of a SSTRI or SSTR:4 selective agonist may
be 0.1
nM-O.1M, 0.1 nM-O.OSM, 0.05 nM-15~M or 0.41 nM-IOpM. Alternatively, total
daily dose may range from about 0.001 to about lmg/k~; of patients body mass.
Dosage values may vary with the severity of the condition to be alleviated. It
is to be
further understood that for any particular subject, specific dosage regimens
should be
3(> adjusted over tune according to the individual need and the professional
judgement of
the person administering or supervising the administration of the
compositions, and
that dosage ranges set forth herein are exemplary only a.nd are not intended
to limit
the scope or practice of the methods of the invention.
_ lg _
CA 02340588 2001-02-23 Kv- ~. :. ~, ~ g",.". ~ - r. r ;:. ;-
~t, t
.~~ .
'prEritei~.24-01 ~. ~~ ..' ~~ ~ h ~ ~~ ~.~ ~~-..~' t'm ~~::, ~ ;
~.::
ISA DESC2fi=.::
Q l~ NOVEMBER 1999 0 i;, L 1 -. 9 9
The amount of active SSTR selective agonist in a therapeutic composition
may vary according to factors such as the disease state, a;ge, sex, and weight
of the
individual. Dosage regimens may be adjusted to provide 'the optimum
therapeutic
S response. For example, a single bolus may be administered, several divided
doses
may be administered over time or the dose may be proportionally reduced or
increased as indicated by the exigencies of the therapeutic situation. It is
especially
advantageous to formulate parenteral compositions in dosage unit form for ease
of
administration and uniformity of dosage. Dosage unit form as used herein
refers to
physically discrete units suited as unitary dosages; each unit containing a
predetermined quantity of active compound calculated to produce the desired
therapeutic effect in association with the required pharmaceutical carrier.
The
specification for the dosage unit forms of the invention are dictated by and
directly
dependent on (a) the unique characteristics of the active compound and the
particular
therapeutic effect to be achieved, and (b) the limitations inherent in the art
of
compounding such an active compound for the treatment: of sensitivity in
individuals.
As used herein "pharmaceutically acceptable carc~ier" or "excipient" includes
any and all solvents, dispersion media, coatings, antibacterial and antifungal
agents,
isotonic and absorption delaying agents, and the like that: are
physiologically
compatible. In one embodiment, the carrier is suitable for parenteral
administration.
Alternatively, the carrier can be suitable for intravenous, intraperitoneal,
intramuscular, sublingual or oral administration. Pharmaceutically acceptable
carriers
include sterile aqueous solutions or dispersions and sterile powders for the
extemporaneous preparation of sterile injectable solutions or dispersion: The
use of
such media and agents for pharmaceutically active substances is well known in
the
art. Except insofar as any conventional media or agent i:> incompatible with
the active
compound, use thereof in the pharmaceutical compositions of the invention is
contemplated. Supplementary active compounds can also be incorporated into the
compositions.
Therapeutic compositions typically must be sterile and stable under the
conditions of manufacture and storage. The composition can be formulated as a
-20-
CA 02340588 2001-02-23
,~ ~ ~ ~ ~ °~ ~ ~' ' ~~
'('rrr~t~ct 24=(?'t 2~0'! ' ~, ~ ~ n:
w.
. s v..i t l ~..~a 't
'' ' ~.Uv
~~~~~~~s~oog~o- ~ 0 V E ~ B ~ R 1999 0 I , ~s~ Q ~s~ ~s
solution, microeinulsion, iiposome, or other ordered structure suitable to
high drug
concentration. The carrier can be a solvent or dispersion medium containing,
for
example; water, ethanol, polyol (fox example, glycerol, propylene glycol, and
liquid
polyethylene glycol, and the like); and suitable mixtures l:hereof. The proper
fluidity
can be maintained, for example, by the use of a coating stach as lecithin, by
the
maintenance of the required particle size in the case of dispersion and by the
use of
surfactants. In many cases, it will be preferable to include; isotonic agents,
for
example, sugars, polyalcohols such as mannitol, sorbitol, or sodium chloride
in the
composition. Prolonged absorption of the injectable compositions can be
brought
about by including in the composition an agent which delays absorption, for
example,
monostearate salts and gelatin. Moreover, the SS agonists can be administered
in a
time release formulation, for example in a composition which includes a slow
release
polymer. The active compounds can be prepared with carriers that will protect
the
compound against rapid release, such as a controlled release formulation,
including
implants and microencapsulated delivery systems. Biodegradable, biocompatible
polymers can be used, such as ethylene vinyl acetate, polyanhydrides,
polyglycolic
acid, collagen, polyorthoesters, polylactic acid and polylactic, polyglycolic
copolymers (PLG). Many methods for the preparation of such formulations are
patented or generally known to those skilled in the art.
Sterile injectable solutions can be prepared by incorporating the active
compound (e.g.SS agonist) in the required amount in an appropriate solvent
with one
or a combination of ingredients enumerated above, as required, followed by
filtered
sterilization. Generally, dispersions are prepared by incorporating the active
compound into a sterile vehicle which contains a basic dispersion medium and
the
required other ingredients from those enumerated above. In the case of sterile
powders for the preparation of sterile injectable solutions., the preferred
methods of
preparation are vacuum drying and freeze-drying which :yields a powder of the
active
ingredient plus any additional desired ingredient from a previously sterile-
filtered
solution thereof. In accordance with an alternative aspect: Of thL
lIlvl;ntlOll, a SS
agonist may be formulated with one or more additional compounds that enhance
the
solubility of the SS agonist.
-21
CA 02340588 2001-02-23 _ _ _
~~1~Y~CItGG~~~4:~ ~G~~:"1'~; ~ ~ ~ , 5; ;~ t, t,
~~ ~ v..fi~ ~ W n ., n n
~~ ~~ ~s~s ~cTic~~stoosoo;- ~s~ ~~sc2s
~. . .z . . . . . ~.. > 3 . . ~... ... y~~ ~ ~ N p V E M B F R 199 0 I . 1 1 .
9 9
A further form of administration is to the eye. An SSTRI or SSTR4 selec ~ a
agonist may be delivered in a pharmaceutically acceptable ophthalmic vehicle,
such
that the compound is maintained in contact with the ocular surface for a
sufficient
time period to allow the compound to penetrate the corneal and internal
regions of the
eye, as for example the anterior chamber, posterior charr~ber, vitreous body,
aqueous
humor, vitreous humor, cornea, iris/ciliary, lens, choroidlretina and sclera.
The
pharmaceutically-acceptable ophthalmic vehicle may, for example, be an
ointment,
vegetable oil or an encapsulating material. Alternatively., the compounds of
the
invention may be injected directly into the vitreous and aqueous humour. In a
further
alternative, the compounds may be administered systemiically, such as by
intravenous
infusion or injection, for treatment of the eye. In some embodiments, anti-
angiogenic
treatment with SSTRl or SSTR4 agonists may be underl:aken following
photodynamic therapy (such as is described in U.S. 5,98,349 issued 25 August
1998,
incorporated herein by reference).
In accordance with another aspect of the invention, therepeutic compositions
of the present invention, comprising SSTRi or SSTR4 selective agonists, may be
provided in containers having labels that provide instructions for use of
SSTR1 or
SSTR4 selective agonists to treat endothelial-cell-mediated proliferative
diseases.
-22-
CA 02340588 2001-02-23
~PrErited.24 ~~1 2 ~ ~ ~~ ~..~., , 22°='
v . :. ~ - a-.-~ .
